text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
referring now to the drawing , and more particularly to fig1 and 2 , shown therein as a receptacle 10 having a magnetic assembly 12 attached to a wall 14 of the receptacle 10 . the receptacle 10 may be any device used to manually carry objects including , but not limited to , purses , bags , hand bags , carry on bags , suitcases , cases , backpacks , shoulder bags , fanny packs , hip packs , kits , valises , carpetbags , grips , gripsacks , wallets , pocketbooks , day bags , drawstring bags , tote bags , briefcases , beach bags , diaper bags , coats , shirts , and other pieces of clothing . the wall 14 is generally constructed of a material such as leather , fabric , polymer , or any other material known in the art which may be used in the construction of a receptacle . the magnetic assembly 12 includes an internal magnet 16 ( also referred to herein as a first magnet ) and an external magnet 18 ( also referred to herein as a second magnet ), each of which is magnetically attractive to the other . the internal magnet 16 has a front side 20 and a back side 22 and the external magnet 18 has a front side 24 and a back side 26 ( fig3 ). in use the internal magnet 16 is placed inside the receptacle 10 and the back side 22 of the internal magnet 16 is placed against an inner surface 28 of the wall 14 . the external magnet 18 is then placed adjacent an outer surface 30 of the wall 14 opposite the internal magnet 16 such that the external magnet 18 magnetically engages the internal magnet 16 whereby the internal magnet 16 and external magnet 18 each engage a portion of the wall 14 therebetween and press against and secure each other to the wall 14 of the receptacle 10 , thereby forming the magnetic assembly 12 as shown in fig1 and 4 . more than one magnetic assembly 12 may be used with a single receptacle 10 , for example as shown in fig1 and 2 wherein two magnetic assemblies 12 are shown with the receptacle 10 . the magnetic assembly 12 can be moved anywhere upon the wall 14 of the receptacle 10 of any other wall of the receptacle 10 simply by separating the internal magnet 16 or the external magnet 18 from the wall 14 , repositioning the internal magnet 16 and external magnet 18 on another portion of the wall 14 or any other wall of the receptacle 10 , and magnetically reconnecting the magnets 16 and 18 as before . preferably the magnetic assembly 12 is positioned near an upper end 32 of the receptacle 10 as indicated in fig1 and 2 but it will be understood by a person of ordinary skill in the art that the magnetic assembly 12 can be positioned anywhere on or in the receptacle 10 desired by the user as long as the magnetic assembly 12 is capable of operating in the manner described herein . for example , the magnetic assembly 12 may be located upon an inner wall ( not shown ) within the receptacle 10 . as shown in fig3 and 4 , the magnetic assembly 12 is used to hold a key holder 40 at a specified position within the receptacle 10 , so that the key holder 40 can be relatively easily located and removed from the receptacle 10 by observing the location of the external magnet 18 on the wall 14 of the receptacle 10 . in fact , this is a particular advantage of the present invention since unlike prior art key attaching devices , the external magnet 18 of the present invention enables a user to quickly find the key holder 40 , even in dark conditions by feeling the location of the external magnet 18 on the outer surface 30 of the wall 14 of the receptacle 10 . in a preferred embodiment , the key holder 40 as shown in fig3 and 4 includes a key ring 42 , one or more keys 44 , and a tab 46 constructed of steel , or any material having ferrous particles or magnetic properties , such as a flexible magnetic tape with adhesive backing . the key ring 42 is preferably constructed of a metal containing iron , such as steel , or any other material used by those of ordinary skill in the art to construct key rings . the key holder 40 may optionally have a chain , fob , charm , or other decorative or functional device disposed thereon . the key ring 42 may also be a chain , wherein the key ring 42 is a key chain . as shown in fig4 , the tab 46 of the key holder 40 is magnetically attached to the internal magnet 16 of the magnetic assembly 12 when in use . preferably , the outer surface 30 of the external magnet 18 has a decorative appearance which may include , but is not limited to , a decorative color , logo , trademark , engraving , shape , form , pattern , attachment or cover . in the embodiment shown in fig5 , a key holder 48 is constructed of a key ring 50 , similar to key rings described previously herein , which is connected , such as by sodering , welding and the like , welded to a steel tab 52 . further , the key ring 50 is depicted as having at least one key 54 disposed thereon . in the embodiment shown in fig6 , a key holder 56 which includes a key ring 58 as described elsewhere herein , and preferably constructed of steel , is illustrated as having a key 60 disposed thereon . the key ring 58 is magnetically connected to the internal magnet 16 without using a tab as herein before described with reference to the key holder 40 ( fig4 ) and the key holder 48 ( fig5 ). in the embodiment of the magnetic assembly 12 shown in fig7 , the magnetic assembly 12 includes the internal magnet 16 , and the external magnet 18 magnetically adhered to the wall 14 of the receptacle 10 . a key holder 62 is attached to the internal magnet 16 . further , a decorative item 64 is attached to the external magnet 18 for providing a decorative appearance to the external magnet 18 . the decorative item 64 may be adhesively attached , clipped or snapped on , pulled over , magnetically attached to , painted on or attached to the external magnet 18 in any other manner known in the art . the decorative item 64 may be , for example , a plate or medallion made from a magnetically attractive material such as steel . the decorative item 64 may simply be a piece of fabric adhesively attached to the external magnet 18 . preferably , the decorative item 64 is removable so that the appearance of the external magnet 18 can be changed when desired , for example , to match the decorative aspect of the receptacle 10 with which the magnetic assembly 12 is used . while the invention has been described herein in connection with certain embodiments so that aspects thereof may be more fully understood and appreciated , it is not intended to limit the invention to these particular embodiments . on the contrary , it is intended to cover all alternatives , modifications and equivalents as may be included within the scope of the invention as defined by the appended claims . thus , the examples described herein , which include preferred embodiments , will serve to illustrate the practice of this invention , it being understood that the particulars shown are by way of example and for purposes of illustrative discussion of preferred embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of procedures as well as of the principles and conceptual aspects of the invention . changes may be made in the construction and the operation of the various components , elements and assemblies described herein or in the steps or the sequence of steps of the methods described herein without departing from the spirit and scope of the invention as defined in the following claims . | 8 |
the invention will now be described with respect to fig1 which illustrates in schematic form , the apparatus of the invention , generally designated by the numeral 20 . the apparatus 20 is connected to a digital device 22 to be tested . it will be appreciated by those skilled in the art that the digital device 22 includes at least one digital channel ( not illustrated ). it will further be appreciated by those skilled in the art that it is the channel ( or channels ) which is actually under test . the apparatus 20 includes a computer 24 which has a keyboard interface 25 , random access memory ( ram ) 26 , a bios prom 27 , and a bus and interrupt controller 28 . the computer 24 includes intel &# 39 ; s 80386 microprocessor as its cpu 29 . other similar microprocessor such as intel 80286 , motorola 5600x and motorola 680x0 may also be used with expected success . the computer 24 also includes a 16 bit input / output data bus line 30 and a disk drive ( not shown ) being capable of being loaded with software specifically designed to cause the hardware to operate appropriately . the apparatus 20 includes a generator board 40 which creates a controlled data stream as will be explained more fully with reference to fig2 . the data bus 30 connects the computer 24 and the generator board 40 and allows communication between them . for example , the computer 24 through operation of the keyboard 26 , instructs the generator board 40 to create the desired controlled data stream . a detector board 80 is connected to the device 22 for receiving data from the device 22 . the detector 80 receives the controlled data stream from the device 22 . the controlled data stream is in words ( or in parallel ). the words are typically 8 or 16 bits in length , although it is within the scope of invention to have words be of any length . the detector board 80 , utilizing the software in accordance with the invention , scans the data from the device 22 and determines which predetermined pattern was used to create the controlled data stream . upon detecting the appropriate pattern , the detector 80 compares data from the device 22 with the result expected from the pattern generated as local reference on detector board 80 . any unexpected results are considered error events . the errors are identified and located by address in the controlled data stream and put on the data bus 30 and stored in the computer 24 . once the detector board 80 knows the correct pattern used to create the controlled data stream , the user may select one of two modes ; an on - line mode for immediate display on a high resolution graphic display 34 or a record mode which stores the data on a hard disk 36 for later analysis . additionally , the user has a choice of different analysis that may be performed either on - line or in play mode as will be more fully appreciated hereinafter . it will be appreciated that a data stream may be received from the device which is not a controlled data stream . for example , in another embodiment of the apparatus in accordance with this invention , there is no generator . in that embodiment , the detector simply receives a raw data stream from the device based on a test pattern within the device to be tested . the detector 80 is then set to accommodate this pattern and compare it to the expected result of this pattern . typically , each device under test includes one of the standard test patterns which are well known in the field . these standard test patterns are already loaded into the detector 80 . the apparatus 20 additionally includes a video controller 32 for receiving and carrying out instructions from the computer 24 on the graphic display 34 . a disk controller 34 receives and carries out the instructions from the computer 24 on a hard disk 36 and floppy disk 37 . the floppy disk 37 is used for off line back - up . additionally , the floppy disk 37 may be used so that a sampling of the test results may be made and separately analyzed either locally or by shipping the diskette for off - site testing . the apparatus 20 also includes a serial communications port 38 which allows the apparatus 20 to be connected to the device 22 in such a way that control signals through the computer 24 over the data bus 30 may be given . for example , the device under test may have no control features and the serial port can be used to send control signals such as stop , play , rewind and the like . illustrative of this function is an ampex dcrsi which has no play , rewind or like function . the ampex dcrsi has only a serial port for control . the apparatus 20 can be connected to the ampex dcrsi through the serial port 38 and controlled thereby . this saves the user the cost of an external terminal which would typically be necessary for such a device under test . the port 38 may comprise an rs232 or an ieee488 . the serial port 38 can further be used to facilitate the sending of a data stream or a sampling thereof to an off - site location for analysis and testing through a modem or a direct link to a similar port on another computer which may be local or off - site . with respect to fig2 there is shown the schematic representation of the generator board 40 . the generator board 40 includes a pattern generator 44 which creates either a fixed or pseudo random pattern through which the controlled data stream is created . the generator board 40 includes a parallel to serial interface 42 which accepts a clock from the device 22 . it is possible for the parallel to serial interface 42 to accept either a serial or parallel clock along either line 43 or line 45 , respectively . depending upon whether the device 22 accepts serial or parallel clock , the parallel to serial interface 42 will hand off a parallel or serial clock and the controlled data stream to the device 22 over either line 47 or 49 , respectively . the generator board 40 additionally includes a generator - computer interface 48 . the generator - computer interface 48 acts as the interface between the computer 24 and an internal data bus 51 . the generator - computer interface 48 receives the instructions from the computer 24 and instructs the generator board 40 to carry out these instructions over the data bus 30 . an error injector 46 within the generator board 40 allows the user to inject errors into the controlled data stream as desired . additionally , the error injector 46 may be used for testing the apparatus 20 itself by testing a solid wire and observing the results . in operation , if data to the device 22 is to be sent in a serial fashion , a divide by 8 circuit 50 within the parallel to serial interface 42 converts the internal parallel words to serial bits . it will be appreciated that this could be a divide by n circuit where n could be any number desired within the spirit and scope of this invention . if the data stream to the device 22 is to be sent in words ( in parallel ) then it passes directly to a mux 52 over line 45 . otherwise , the serial data stream passes to mux 52 after being divided . upon activation of the apparatus 20 , the user selects the type of pattern to be transmitted by using the keyboard 25 . the computer 24 sends a control signal over line c to the pattern generator 44 . the pattern generator 44 creates the controlled data stream based on the pattern selected by the user . the pattern generator 44 includes a pseudo random generator 54 and an n - bit fixed generator shown generally by the numeral 56 . a mux 58 and a control circuit 60 within the pattern generator 44 select the appropriate source of information between the pseudo and fixed generators . the control circuit 60 is instructed by a control register 62 within the generator - computer interface 48 as to the appropriate pattern to be selected . an n - bit fixed pattern can be selected by the user , where &# 34 ; n &# 34 ; in the preferred embodiment equals 16 . however , it is possible for n to be between 1 and 32 , 000 . other variations of n are also within the spirit and scope of this invention . the fixed number generator includes a fixed high register 64 and a fixed low register 66 . the control register 62 sends a signal along the data bus 30 to alternate between the two registers 64 and 66 and a control signal is sent to the mux 52 to allow only the correct fixed register signal to pass to the parallel to serial interface 42 . there are four ( 4 ) different types of pseudo - random patterns that can be generated by the pseudo random generator 54 . these four patterns are based on 4 different polynomials and will be explained in detail with reference to fig6 - 9 . each pattern is periodic , meaning that it repeats itself . if the user has selected a pseudo random pattern , the control register 62 will contain the appropriate bits that instruct the pseudo random generator 54 to generate one of the four patterns available . the control register 62 will also instruct the control circuit 60 to signal the mux 58 that only the signals from the pseudo random generator 54 are to pass . when the signals do pass through the mux 58 , whether from the fixed generator 56 or the pseudo random generator 54 , they go to an exclusive or ( xor ) gate 68 within the parallel to serial interface 42 . if the device 22 accepts parallel data ( words ), the controlled data stream is sent directly to the parallel port of the device 22 . if the device 22 only accepts serial data , the controlled data stream is converted to serial at the parallel to serial shift register 70 and then sent to the device 22 . the pattern generator 44 includes a pair of one shots , 71 and 72 . the first one shot 71 is connected to the parallel clock and a status register 73 of the generator - computer interface 48 . the one shot 71 detects whether a clock was found and goes high to indicate that a clock signal is present . the second one shot 72 is connected to the pseudo random generator 54 and an external trigger . the external trigger tells the user the start of a new period of repeating pseudo random pattern . the external trigger can also be used as a synchronizing signal , for example with an oscilloscope . the generator board 40 includes the error injector 46 which affords the capability to test the apparatus 20 with a known error profile . thus , the performance of the user &# 39 ; s device 22 can be determined by a given error profile . the error injector 46 includes an error inject fifo 74 , an injector counter 75 having low and high registers and a control circuit 76 . the fifo 74 contains 2 , 048 8 - bit words ( or bytes ) and determines the profile of the error or errors to be injected . the injector counter 75 instructs the fifo 74 when to inject its data stream to a mux 77 within error injector 46 . the control circuit 76 instructs the mux 77 to allow the fifo &# 39 ; s data stream to pass to the xor 68 of the parallel to serial interface 42 . in this way , the injector counter 75 determines spacing of the selected error profile . the error injector 46 also includes a &# 34 ; 0 &# 34 ; circuit 78 . the &# 34 ; 0 &# 34 ; circuit continually sends a low or &# 34 ; 0 &# 34 ; signal to the mux 77 . when the error injector 46 is turned off , no errors are desired to be injected . the mux 77 is instructed to allow the low signal to pass to the xor gate 68 , thus leaving the controlled data stream uncorrupted . with respect to fig3 there is shown the schematic representation of the detector board 80 . the detector board 80 is connected to the device 22 either in a parallel word or serial bit fashion . the detector board 80 compares the controlled data stream from the device 22 to an expected result and lists the unexpected results as error events . the error events may be bit errors or burst errors . bit errors are errors which are shorter than the minimum length that the user desires to attribute to a burst . these may be set arbitrarily by the user or by default of the apparatus 20 . burst errors are the remaining errors . error lengths are determined by the spacing of the error bits . if the spacing between error bits is less than the user specified minimum error free interval ( efi ), the error length is said to span the entire interval . again the user may set the minimum efi to a desired length arbitrarily or leave it to the default of the apparatus 20 . burst errors are also counted as single error events . typically , the user will set the minimum burst length to a large number if he desires to isolate large bursts and to a small number if he desires to isolate small bursts . typically , the user will set the efi to 11 because he desires to receive information about both large and small bursts and often will set the efi to 1 to isolate single bit errors . the detector board 80 includes a serial to parallel converter 82 , a reference generator 84 , an error logging member 86 and a detector - computer interface 88 . the serial to parallel converter 82 receives the controlled data stream from the device 22 and if necessary converts the controlled data stream to parallel before passing the controlled data stream to the reference generator 84 . the reference generator 84 matches the pattern used for creating the controlled data stream in a manner which will be explained more fully hereinafter with respect to the detailed description of the reference generator 84 . once the pattern of the controlled data stream is matched by the reference generator 84 , the controlled data stream is read into the detector board 80 and compared with the pattern in the reference generator 84 at the error logging member 86 . each time an unexpected result is observed by the error logging member 86 , the location information is sent to a fifo memory 90 within the error logging member 86 . the location information is stored in the fifo memory 90 and then sent to the detector - computer interface 88 at the appropriate time . a data bus interface 92 within the detector - computer interface 88 receives the location information from the fifo memory 90 and upon an appropriate instruction from a control circuit 104 within the error logging member 86 sends the location information to the computer 24 along the data bus 30 . the serial to parallel converter 82 includes a divide by n circuit , which in the preferred embodiment is a divide by 8 circuit attached to a one shot for detecting whether or not a clock is present , a serial to parallel converter element 97 for receiving the serial clock and data of the device 22 , and parallel latching register 98 for holding the serial to parallel converted data from the device 22 . blank , marker , and resync signals are received by the serial to parallel converter 82 and entered into a second latch 99 . the reference generator 84 is virtually identical to the pattern generator 44 . and the reference generator 84 includes the same elements for generating either a fixed or pseudo - random pattern as the pattern generator 44 . the reference generator 84 accepts a sampling of data or a seed from the controlled data stream in the form of 3 8 - bit words to initialize the reference generator 84 and start its operation . the reference generator 84 then generates a first pattern . it will be appreciated that the first reference pattern generated could be any of the patterns which the apparatus is capable of generating . thus a fixed or pseudo random pattern could be generated first . each succeeding pattern is then generated until the pattern in the controlled data stream is matched . simultaneously , the controlled data stream is passed through the reference generator 84 to a comparator 100 within the error logging member 86 . the comparator 100 compares the controlled data stream to the reference generator &# 39 ; s generated pattern . the comparator 100 is a series of xor gates linked together by a nor gate ( not shown ). each time the comparator detects a difference between the pattern generated by the reference generator 84 and the controlled data stream a high signal or &# 34 ; one &# 34 ; is sent to the control circuit which in turn registers an error event in the error event fifo memory 90 . it will be appreciated that an or gate could also be used and a low signal would be generated with the same results . after a short period of time enough words will have been compared that the error event fifo memory 90 will have either overflowed or the pattern will have been matched . in the preferred embodiment , the error event fifo memory 90 comprises a 64k bit fifo ram . four bytes of data are held in the error event fifo memory 90 for each error event . thus , if the pattern does not match the memory will quickly overflow and a signal will be sent to the detector - computer interface 88 . upon receipt of the overflow signal , the computer 24 instructs the control circuit 60 to sequence to the next pattern . if the error event fifo memory 90 does not overflow , then a match has been found and the comparison of the controlled data stream to the reference pattern continues . it will be appreciated by those skilled in the art that a bit stream having a data rate considerably faster than the general purpose processing power of the cpu 29 can be analyzed by the device 20 in accordance with this invention , only because the actual number of errors is typically quite small . the error logging member 86 includes a 23 bit counter 106 which records the location of each error event as it is sent to the error event fifo memory 90 . there are three separate types of error events . the first has been described above , namely an error event in the controlled data stream . the second is when there is a transition on the marker signal . the marker is used for modulo marker analysis as will be explained more fully below . the third error event occurs when the 23 bit counter 106 rolls over . the error logging member 86 further includes a one shot 108 connected to an outside trigger which signals high each time an error event is recorded . this enables the viewer to see when his controlled data stream is having many errors . in a worst case analysis , where there are too many errors for the apparatus 20 to analyze , choking occurs as will be explained more fully with reference to fig4 . this means that there are too many errors for the apparatus to process at the given data rate . the apparatus 20 cuts off and no processing is done . however , the external trigger continues to indicate errors . should the number of errors diminish to the point where processing can be performed , the user can again begin either on - line analysis or start storing the data in the record mode . the reference generator 84 includes a sequence data member 110 which is used to read the value of the data that is being generated by the reference generator . this is used in diagnostic modes for checking reference generator operation and for reading the 16 bit fixed pattern , if the same is detected . also , if a fixed pattern is detected in the controlled data stream , the pattern value is displayed on the graphic display 34 . the error event fifo memory 90 includes a pin ( not shown ) that signals when the fifo memory 90 is half full . this pin is connected to a half full interrupt 112 within the detector - computer interface 88 . when the error event fifo memory 90 signals that it is half full , the half full interrupt 112 sends a signal to the computer which causes the error event fifo memory 90 to dump its contents on the internal bus 81 which in turn transports the data to the data bus interface 92 for storage in the computer 24 memory . the control circuit 104 receives the marker and blank signals from the second latch 99 . if there is a blank signal , the comparator 100 is instructed to ignore any differences between the controlled data stream and the reference pattern . thus , if there is a blank signal , no error event is recorded to the error event fifo memory 90 . at various times the user may know that the controlled data stream will have excessive errors during a portion of the data stream , but may still wish to have the remaining portion of the controlled data stream analyzed . the user would insert a blanking signal during that portion of the controlled data stream and continue the analysis on the remaining portion of the controlled data stream . for example , when a multiple head tape deck is to be tested , in an unformatted application a great deal of noise will be generated during the time the heads are switching due to rotation . the user inserts a blanking signal during the head changing period to eliminate meaningless errors on the controlled data stream . the resync signal is stored in the second latch 99 and then appropriately transmitted to the control circuit 60 . the resync signal is used to re - seed the pattern generators within the reference generator 84 . for example , after the head switch described above , the controlled data stream will fall out of sync with respect to the reference generated pattern . this will cause the error event fifo memory 90 to eventually overflow and cause the computer to issue an instruction for re - seeding . instead of waiting for the error event fifo memory 90 to indirectly cause an overflow and hence a resync , the resync signal can be explicitly set high to cause the process of re - seeding and synchronizing to be done much earlier allowing more user - data to be analyzed . the detector - computer interface 88 includes control and status registers 94 and 102 which are used during initialization and operation of the detector board 80 . with respect to fig4 there is shown the graphic representation of the maximum error rates that can be handled by the device 22 for a given data rate for a given mode or analysis type . the level at which the device 22 cuts off the analysis is defined as the &# 34 ; choke &# 34 ; level and fig4 represents the choke analysis . it will be appreciated that the bit error rate decreases as the further from the origin it gets and the user data rate increases as it gets further from the origin . the user can select between two modes , on - line and record as discussed above . in the on - line analysis , the graphic display 34 immediately starts to display the measurements made by the device 22 . in the record mode , the data is recorded to the hard disk 36 for later analysis and display . the user can also select between various types of analysis including modulo analysis , strip chart analysis and bit error rate analysis . in fig4 line 120 represents the on - line modulo analysis choke line . at any data rate where the number of errors is below line 120 , the device 20 in accordance with the invention will not perform on - line modulo analysis . however , if the bit error rate for a given data rate is below the line 120 but above the record mode choke line , line 122 , the analysis can be done off - line and later displayed on the graphic display 34 . line 124 represents the on line strip chart analysis choke line and line 126 represents the on line bit error rate choke line . with respect to fig5 there is shown the circuit schematic of a fixed pattern detector generally indicated by the numeral 160 . the fixed pattern detector 160 is the same as the fixed pattern generator 56 with the exception that the comparison circuitry shown in fig1 and described below is not present . the fixed pattern detector 160 includes registers 162 and register 164 . the fixed pattern detector 160 detects a 16 - bit fixed pattern of any length . two consecutive 8 - bit bytes ( a total of 16 bits ) are taken from the data stream under test through input lines 140 through 147 . alternatively , the two bytes are latched into registers 162 and 164 . by alternating the outputs of these registers , 162 and 164 , unto lines 166 through 173 , the fixed 16 bit sequence is constantly regenerated for comparison by the xor gates 133 with the data stream under test . if any output from the xor gates 133 is logic high , then an error is detected . the comparison circuitry generally indicated by the numeral 174 includes the register 138 and xor gates 133 which detects mismatches between the fixed pattern under test ( user &# 39 ; s data ) and the fixed pattern generated by the registers 162 and 164 . with respect to fig6 through 9 , there is shown the circuit schematic for each of the four pseudo - random patterns that can be generated by the device 22 . fig6 through 9 each represent schematics of linear feedback shift registers . the pseudo random generator 54 generates one of four pseudo random patterns depending upon which linear feedback shift register is chosen . fig6 represents , in circuit schematic , the 2 7 - 1 polynomial which is generally designated by the numeral 130 and defines a linear feedback shift register . the linear feedback shift register 130 comprises a series of 8 xor input gates 132 and 8 xor output gates 133 . the series of 8 xor input gates are connected to 8 registers 134 . the registers 134 are all tied to a clock line 136 which is connected to device 22 divide by 8 clock . input lines 140 , 141 , 142 , 143 , 144 , 145 , 146 and 147 are connected to the 8 input xor gates 132 as shown . the registers are seeded by explicit command from the computer upon the start of operation or by an external resync operation . after seeding the contents of the 8 registers are fed back through the appropriate xor gates to the inputs of the registers so as to create a new set of outputs when the next clock pulse occurs . this process is repeated for every rising edge of the divide by 8 user clock . fig7 represents , in circuit schematic , the 2 15 - 1 polynomial which is generally designated by the numeral 150 . as seen from the drawing , this second polynomial is of an identical construction to the first polynomial 130 and works in a substantially similar manner . however , the second polynomial includes additional registers 152 which are also used to hold information form state to state between clock edges when generating the pseudo random bit sequence . it will also be seen that the data word formed on the output xor gates 133 is taken from the last 8 registers . fig8 represents , in circuit schematic , the 2 20 - 1 polynomial ( the third polynomial ) which is generally designated by the numeral 154 . the third polynomial 154 is of the same general construction as the first and second polynomials , 130 and 150 , respectively . however , the third polynomial includes 20 registers where the first polynomial includes 8 and the second polynomial includes 15 . fig9 represents , in circuit schematic , the 2 23 - 1 polynomial ( the fourth polynomial ) which is generally designated by the numeral 156 . the fourth polynomial 156 is of the same general construction as the first , second and third polynomials , 130 , 150 and 154 , respectively . however , the fourth polynomial includes 23 registers where the first polynomial includes 8 , the second polynomial includes 15 and the third includes 20 . the different polynomials allow the user to exercise different aspects of their designs . pseudo - random sequences generated by small polynomials have little low frequency components whereas sequences generated by long polynomials has substantial low frequency components . different frequency components in the controlled data stream may be used to spot different failure modes or idiosyncracies of the device 22 . while the foregoing detailed description has described several embodiments of the apparatus for testing digital electronic circuits in accordance with this invention , it is to be understood that the above description is illustrative only and not limiting of the disclosed invention . particularly , the apparatus of the invention has been described with respect to certain patterns for creating a controlled data stream . it will be appreciated that these patterns can vary from the ones described within the scope and spirit of this invention . thus the invention is to be limited only by the claims as set forth below . | 7 |
in accordance with some embodiments , mechanisms for providing self - interference cancellation in a full duplex transceiver in accordance with some embodiments are provided . in some embodiments , digital self - interferences can be provided using a non - linear tapped delay line . turning to fig1 , an example 100 of a block diagram of a full duplex transceiver incorporating self - interference cancellation mechanisms in accordance with some embodiments is shown . as illustrated , transceiver 100 includes a digital - to - analog converter ( dac ) 104 , a mixer 106 , a local oscillator generator 108 , a power amplifier ( pa ) 110 , an antenna interface 112 , an antenna 114 , a low - noise amplifier ( lna ) 116 , a mixer 118 , an analog self - interference ( si ) canceller 120 , an analog - to - digital converter ( adc ) 122 , an adder 124 , and a digital self - interference ( si ) canceller 126 . during operation of transceiver 100 , dac 104 converts a signal to be transmitted from digital form to analog form resulting in a transmitter ( tx ) analog baseband signal 128 . the transmitter analog baseband signal is then upconverted by mixer 106 using a local oscillator from local oscillator generator 108 . the upconverted signal is then amplified by power amplifier ( pa ) 110 . the signal output by pa 110 is represented in fig1 by signal 130 , which includes a p tx component , which is an amplified form of the transmitter signal , and a self - interference ( si ) third - order inter - modulation ( im3 ) distortion component . the signal output by pa 110 is provided to antenna interface 112 , which directs the signal to antenna 114 for transmission . a signal received at antenna 114 is represented in fig1 by signal 132 , which includes a desired signal component and a noise component . the signal received at the antenna is directed by antenna interface 112 to the input of low noise amplifier 116 , which amplifies the received signal . as illustrated by signals 134 , the signals received at the antenna are combined with interference from the signal output by pa 110 that is not isolated by antenna interface 112 . mixer 118 then downconverts the amplified signal using a local oscillator from generator 108 . based on transmitter analog baseband signal 128 , analog self - interference canceller 120 provides a signal that cancels at least some of the self - interference in the output of mixer 118 . the combined output of mixer 118 and canceller 120 is represented by receiver ( rx ) analog baseband signals 136 . the rx analog baseband signal is then converted to digital form by adc 122 and provided to adder 124 . digital si canceller 126 , based on signals at the input to dac 104 , provides digital cancellation signals to adder 124 that , when added to the output of adc 122 , further cancels the self - interference from the p tx signal and the si im3 distortion . the is represented by signals 138 . dac 104 and adc 122 can be implemented in any suitable manner using any suitable digital - to - analog and analog - to - digital converters . in some embodiments , analog self - interference canceller 120 can be implemented as described below in connection with analog baseband self - interference canceller 228 of fig2 . mixers 106 and 118 can be implemented in any suitable manner using any suitable mixers in some embodiments . generator 108 can be implemented in any suitable manner using any suitable local oscillator generator in some embodiments . power amplifier 110 can be implemented in any suitable manner using any suitable power amplifier in some embodiments . lna 116 can be implemented in any suitable manner using any suitable low noise amplifier in some embodiments . adder 124 can be implemented in any suitable manner using any suitable adder in some embodiments . antenna 114 can be implemented in any suitable manner using any suitable antenna in some embodiments . antenna interface 112 can be implemented in any suitable manner using any suitable antenna interface , such as non - reciprocal circulator or an electrical balance duplexer , in some embodiments . in some embodiments , rather than using antenna interface 112 and a single antenna 114 , two antennas 114 can be used , one connected to the output of power amplifier 110 and the other connected to the input of lna 116 , and antenna interface 112 can be omitted . turning to fig2 , a more detailed example 200 of portion 140 of transceiver 100 in accordance with some embodiments is shown . box 299 represents a chip on which the encompassed components can be implemented in some embodiments . in some embodiments , such a chip can be implemented in 65 nm cmos technology . as illustrated , transceiver portion 200 is implemented using transmit baseband buffers 202 and 204 , a transmit modulator 206 , a power amplifier 208 , a non - reciprocal circulator 210 ( of which inductors 214 are a part ), an antenna 212 , a circulator local oscillator ( lo ) generator 216 , inductors 218 and 220 , a common - gate , common - source low - noise transconductance amplifier ( lnta ) 222 , a receiver ( rx ) lo generator 224 , a four - phase passive mixer 226 , an analog baseband ( bb ) self - interference canceller ( sic ) 228 , transimpedance amplifiers ( tias ) 234 , and analog baseband recombination circuitry 236 . transmit baseband buffers 202 and 204 can be implemented in any suitable manner using any suitable baseband buffers in some embodiments . transmit modulator 206 can be implemented in any suitable manner using any suitable modulator in some embodiments . for example , in some embodiments , modulator 206 can be implemented using part number trf370417 available from texas instruments ( of dallas , tex .). power amplifier 208 can be implemented in any suitable manner using any suitable power amplifier in some embodiments . non - reciprocal circulator 210 can be implemented in any suitable manner using any suitable non - reciprocal circulator in some embodiments . for example , in some embodiments , non - reciprocal circulator can be implemented using non - reciprocal circulator as described in connection with fig4 of international patent application no . pct / us2016 / 065456 , filed dec . 7 , 2016 , which is hereby incorporated by reference herein in its entirety . antenna 212 can be implemented in any suitable manner using any suitable antenna in some embodiments . inductors 218 and 220 can be implemented in any suitable manner using any suitable inductors for use with lnta 222 in some embodiments . common - gate , common - source low - noise transconductance amplifier ( lnta ) 222 can be implemented in any suitable manner using any suitable lnta in some embodiments . for example , in some embodiments , lnta 222 can be implemented as shown in the schematic of fig2 . four - phase passive mixer 226 can be any suitable four - phase passive mixer in some embodiments . for example , in some embodiments , mixer 226 can be implemented as shown in the schematic of fig2 . transimpedance amplifiers ( tias ) 234 can be implemented in any suitable manner using any suitable tias in some embodiments . for example , in some embodiments , tias 234 can be implemented as shown in the schematic of fig2 . analog baseband recombination circuitry 236 can be implemented in any suitable manner using any suitable analog baseband recombination circuitry in some embodiments . for example , recombination circuitry 236 can be implemented using voltage to current converting g m cells as shown in circuitry 734 of fig7 of international patent application no . pct / us2016 / 065456 , filed dec . 7 , 2016 , which is hereby incorporated by reference herein in its entirety . the recombination circuit may be formed from multiple pairs of g m s to form i / q outputs of the receiver . during operation , transmit signals received at baseband i and q inputs 201 are amplified by buffers 202 and 204 , modulated by modulator 206 , amplified by amplifier 208 , directed to antenna 212 by circulator 210 , and transmitted by antenna 212 . signals received at antenna 212 are directed by circulator 210 to lnta 222 , amplified by lnta 222 , down - converted by mixer 226 , amplified by tias 234 , converted to i and q baseband outputs by circuitry 236 , and output at outputs 203 . analog bb sic 228 taps from the transmit baseband signals between the baseband buffers 202 and 204 , adjusts the amplitude and the phase of the tapped signals , and injects cancellation currents at the inputs to tia 234 . amplitude and phase scaling in analog bb sic 228 is achieved through two five - bit digitally - controlled phase rotators 230 and 232 injecting into the i - paths and the q - paths of the rx analog bb , respectively . each phase rotator can include 31 ( or any other suitable number ) identical cells with independent controls 238 ( these controls can determine the contribution of each cell to the analog bb sic current ). each cell , which can be implemented in any suitable manner in some embodiments ( e . g ., such as shown in box 229 ), of the phase rotator adopts a noise - canceling common - gate ( cg ) and common - source ( cs ) topology , allowing partial cancellation of the noise from the cg devices ( dependent on the phase rotator setting at controls 238 ). circulator 210 can be implemented in any suitable manner in some embodiments , such as described in connection with fig4 and 6 of international patent application no . pct / us2016 / 065456 , filed dec . 7 , 2016 , which is hereby incorporated by reference herein in its entirety . circulator 210 receives from circulator lo generator 216 two sets of eight non - overlapping clock signals each with 12 . 5 % duty cycle . these clock signals are used to control the switches in the eight paths of the n - path filter of circulator 210 . generator 216 can be implemented in any suitable manner in some embodiments . for example , in some embodiments , to generate these clock signals , generator 216 receives two differential ( 0 degree and 180 degree ) input clocks that run at four times the desired commutation frequency . a divide - by - two frequency - divider circuit 244 generates four quadrature clocks with 0 degree , 90 degree , 180 degree , and 270 degree phase relationship . these four clock signals drive two parallel paths for the two sets of switches . in a first of the two paths , a programmable phase shifter 246 that allows for arbitrary staggering between the two commutating switch sets is provided . programmable phase shifter 246 enables switching between − 90 degree and + 90 degree staggering , which allows dynamic reconfiguration of the circulation direction . the phase shifter also allows for fine tuning of the staggered phase shift to optimize the transmission loss in the circulation direction and isolation in the reverse direction . after phase shifting , another divide - by - two circuit 248 and a non - overlapping 12 . 5 % duty - cycle clock generation circuit 250 create the clock signals that control the commutating transistor switches in the first path . in a second of the two paths , directly after first divide - by - two frequency - divider circuit 244 , another divide - by - two circuit 252 and a non - overlapping 12 . 5 % duty - cycle clock generation circuit 254 create the clock signals that control the commutating transistor switches in the second path . divide - by - two circuits 244 , 248 , and 252 , phase shifter 246 , and non - overlapping 12 . 5 % duty - cycle clock generation circuits 250 and 254 can be implemented in any suitable manner . in some embodiments , circulator lo generator 216 may use static 90 degree phase - shifts or digital phase interpolators that preserve the square - wave nature of the clock . at rx lo port 242 , rx lo generator 224 receives two differential ( 0 degree and 180 degree ) input clocks that run at two times the operating frequency of the receiver ( e . g ., 750 mhz ). a divide - by - two frequency - divider circuit ( which can be implemented in any suitable manner ) in generator 224 generates four quadrature clocks with 0 degree , 90 degree , 180 degree , and 270 degree phase relationship . in some embodiments , although not shown , an impedance tuner can be provided to counter reflections due to antenna impedance mismatch . the tuner can be used at the ant port for joint optimization of sic bandwidth ( bw ) between the circulator and the analog bb canceller . in some embodiments , transceivers take advantage of inherent down - conversion of an n - path filter to merge a circulator and a receiver . turning back to fig1 , in accordance with some embodiments , digital self - interference canceller 126 can be implemented using a non - linear tapped delay line . in some embodiments , a non - linear tapped delay line can be implemented in any suitable hardware processor ( such as a digital signal processor , microprocessor , etc .) that is programmed to perform a non - linear tapped delay line function . for example , in accordance with some embodiments , such a non - linear tapped delay line can be implemented as illustrated in fig3 , which essentially models the self - interference channel in digital as a truncated volterra series : y [ n ] = ∑ k = 0 n h 1 [ k ] x [ n - k ] + ∑ k = 0 n h 2 [ k ] x 2 [ n - k ] + ∑ k = 0 n h 3 [ k ] x 3 [ n - k ] + … + ∑ k = 0 n h p [ k ] x p [ n - k ] where y [ n ] is the digital si canceller output , x [ n ] and x [ n − k ] ( k represents the delay index ) are the current and past tx digital baseband signals , n corresponds to the maximum delay in the modeled si channel , and h i [ k ] ( i = 1 , 2 , 3 , . . . , p ) is the i - th order digital canceller coefficient for delay index of k . in some embodiments , truncating the volterra series can be used to reduce the digital si canceller complexity to a manageable level . for example , in some embodiments , non - linear terms up to 4th order ( i . e ., p = 4 ) can be considered with a delay spread length of 41 samples ( i . e ., n = 40 ), resulting in 164 total unknown canceller coefficients . in some embodiments , the digital si canceller coefficients can be determined using a two - tone pilot signal . more particularly , given an m - length pilot sequence y ( y [ 0 ], y [ 1 ], . . . , y [ m − 1 ]) and a n - length nonlinear coefficient sequence h ( h 1 [ 0 ], h 1 [ 1 ], . . . ), and taking noise into account , we have the following linear equation : where x is a m * n matrix that consists of tx digital baseband signals ( x [ 0 ], x [ 1 ], x 2 [ 0 ], x 3 [ 0 ], . . . ), and n is the noise from the si channel . the goal is to find a ĥ that minimizes | xĥ − y |. when the received data points are more than the number of unknown coefficients ( m & gt ; n ), this becomes a least - squares problem , and ĥ can be found as : although the disclosed subject matter has been described and illustrated in the foregoing illustrative implementations , it is understood that the present disclosure has been made only by way of example , and that numerous changes in the details of implementation of the disclosed subject matter can be made without departing from the spirit and scope of the disclosed subject matter , which is limited only be the claims that follow . features of the disclosed implementations can be combined and rearranged in various ways . | 7 |
as shown in fig1 and 2 , the toilet flushing device of the present invention comprises : a valve assembly 20 , connected with a water supply apparatus 11 and a toilet bowl 12 ; an automatic control device 50 ; a manual control device 60 ; a filter grid 70 ; and a scent box 80 . the water supply apparatus 11 and the toilet bowl 12 are conventional art and do not need further explanation . the automatic control device 50 , upon receiving of a signal , drives opening of the valve assembly 20 to release water and to flush the toilet bowl 12 . the manual control device 60 manually drives opening of the valve assembly 20 . thereby flushing of the toilet bowl 12 is activated in two ways , so that , if the automatic control device 50 fails , manual flushing of the toilet bowl 12 is still possible . the filter grid 70 and the scent box 80 provide desinfection , eliminating of bad odor and adding of scent . in the following , a detailed description is given . for convenient installation on the toilet bowl 12 , the valve assembly 20 , the automatic control device 50 and the manual control device 60 are housed in an outer case 15 . referring to fig3 , the valve assembly 20 comprises : an inlet pipe 22 , connected with the water supply apparatus 11 ; an outlet pipe 23 , connected with the toilet bowl 12 ; and a valve 30 . the valve 30 further comprises : a fixing tube 31 ; a first magnet 33 ; a rubber base plate 35 ; a second magnet 41 ; and a second spring 42 . upon opening of the valve 30 of the valve assembly 20 , water is allowed to flow through the outlet pipe 23 into the toilet bowl 12 . the rubber base plate 35 is placed between the inlet pipe 22 and the outlet pipe 23 , having an inlet opening 36 and an outlet opening 37 . the fixing tube 31 has an inside with a pressure chamber 38 , as shown in fig4 a . the first magnet 33 is movable in a vertical movement inside the pressure chamber 38 , with an amplitude of the vertical movement being determined by a length and a weight of the first magnet 33 . the first magnet 33 further has higher end leaning against a first spring 34 and and lower end carrying a silicon tip 39 . the first spring 34 presses the first magnet 33 downward , so that the silicon silicon tip 39 closes the outlet opening 37 of the rubber base plate 35 . the second magnet 41 is mounted on an - upper side of the fixing tube 31 . when driven by the automatic control device 50 or the manual control device 60 , the second magnet 41 pulls the first magnet 33 upward , enabling outflow of water . afterwards , the second spring 42 pulls the second magnet 42 away from the first magnet 33 , so that outflow of water is stopped . of the first and second magnets 33 , 41 , either both are made of magnetic material or one is made of magnetic material and one is made of magnetizable material . for adjusting the length and the weight of the first magnet 33 , an extension pin 331 is placed between the first magnet 33 and the silicon tip 39 . the extension pin 331 is preferably made of pvc . referring to fig4 a - 4 c , letting out of water is achieved in the following way . as shown in fig4 a , in a closed state of the valve 30 , the first magnet 33 closes the outlet opening 37 of the rubber base plate 35 . in this state , pressures on upper and lower sides of the rubber base plate 35 are equal , and the valve 30 is closed , so that no water flows out through the outlet pipe 23 . as shown in fig4 b , in an opened state of the valve 30 , the second magnet 41 pulls the first magnet 33 upward , against pressure from the first spring 34 , opening the outlet opening 37 of the rubber base plate 35 . in this state , pressure on the lower side of the rubber base plate 35 exceeds pressure on the upper side thereof , and the valve 30 is opened , so that water flows out through the outlet pipe 23 . as shown in fig4 c , when the second magnet 41 is removed from the first magnet 33 by the second spring , the first spring 34 pushes the first magnet 33 downward , closing again the outlet opening 37 of the rubber base plate 35 , so that the closed state of the valve 30 is assumed again and no water flows out through the outlet pipe 23 . referring again to fig2 and 3 , the automatic control device 50 comprises : a sensor 51 , receiving an external signal ; a coil 52 , mounted on the upper side of the fixing tube 31 and generating a magnetic field when flown through by an electric current ; a control circuit 53 , connected with the sensor 51 and the coil 52 ; and a shifting assembly 54 , having an upper plate 55 and a lower plate 57 , which is made of magnetizable material . the upper plate 55 is fastened to the coil 52 . the lower plate 57 has a lower edge fastened to the second magnet 41 . the control circuit 53 is connected with an electrical power source 58 . when the sensor 51 receives an external signal , the control circuit 53 causes electric current to flow through the coil 52 , which in turn attracts the lower plate 57 , so that the second magnet 41 is brought close to the first magnet 33 , causing water to flow out through the water outlet pipe 23 . as shown in fig4 a , for holding the second magnet 41 , a connecting assembly 43 connects the second magnet 41 with the lower plate 57 . the connecting assembly 43 has a first lobe 44 , fastened to the second magnet 41 , a second lobe 45 , fastened to the lower plate 57 , and a pin 46 , passing through the first and second lobes 44 , 45 . the control circuit 53 works as follows : a . the sensor 51 receives an external signal for about 6 seconds . b . the coil 52 , passed through by electric current , causes water to be released for 3 seconds . c . the sensor 51 having for 4 seconds received a continuous external signal , goes into a standby state . d . the sensor 51 receives no external signal . e . the coil 52 , passed through by electric current , causes water to be released for 3 - 6 seconds . as shown in fig2 , the power source 58 is a regular power source , a solar panel or an energy - storing device , providing electrical power for the automatic control device 50 . as further shown in fig4 a , the manual control device 60 comprises : a casing 61 , housing the valve assembly 20 ; a rod 62 , which passes through the casing 61 , having an inner end 63 , which is connected with the second magnet 41 , and an outer end 64 , which projects from the outer case 15 ; and a third spring 65 , connected with the casing 61 and the rod 62 at a certain location thereof . when the rod 62 , by pressure on the outer end 64 thereof , is manually pushed inward , the second magnet 41 is moved close to the first magnet 33 , causing outflow of water through the outlet pipe 23 . with no pressure on the outer end 64 of the rod 62 , the third spring 65 presses the rod 62 outward into an original position . for assessing a need to use the manual control device 60 , the automatic control device 50 has a light indicator 56 , signalling a defect thereof or a lack of electrical power , so a user knows that the manual control device 60 has to be employed for flushing . referring now to fig5 a , for ensuring a pleasant scent , a scent box 80 is mounted on the outlet pipe 23 . the scent box 80 has a container 81 , having an upper side with an inlet 82 and a lower side with an outlet 83 and containing a scenting liquid 85 , which has a desinfecting effect . the scent box 80 further has an adjusting device 91 , which further comprises : a chamber 92 , having a rectangular cross - section and being connected with the outlet 83 , further having an upper end with a central hole 93 and a lower end with a connecting channel 921 , which has a far end with a snout 922 that reaches into the outlet tube 23 ; an adjusting screw 94 , passing through the central hole 93 and having a lower end and a middle section with a thread 95 ; an upper block 96 , placed inside the chamber 92 next to the outlet 83 , silicon tip , while being not turnable against the chamber 92 , and engaging with the thread 95 of the adjusting screw 94 ; and a lower block 97 , mounted below the lower end of the adjusting screw 94 , keeping an adjustable distance 98 to the upper block 96 . turning of the adjusting screw 94 vertically shifts the upper block 96 , varying the distance 98 , thereby varying a flow rate of the scenting liquid 85 . the lower block 97 has a via hole 971 , through which an i - shaped rod 972 passes . the i - shaped rod 972 has an upper plate 973 , a lower plate 974 and a connecting rod 975 , which connectes the upper and lower plates 973 , 974 , passes through the via hole 971 and is longer than the via hole 971 . referring to fig5 a - 5 c , the scent box 80 works as follows . as shown in fig5 a , in a normal state of the scent box 80 , the upper block 96 closes the outlet 83 , so that no scenting liquid 85 enters the chamber 92 . as shown in fig6 b , when the valve assambly 20 opens to release flushing water , flushing water enters the chamber 92 through the connecting channel 921 . then the lower and upper blocks 97 , 96 float upward , and the i - shaped rod 972 moves upward , closing the via hole 971 . subsequently , scent liquid 85 enters the chamber 92 between the upper and lower blocks 96 , 97 . as shown in fig5 c , upon closing of the valve assembly 20 , no flushing water flows out . then the lower and upper blocks 97 , 96 move downward , and the i - shaped rod 972 moves downward , briefly opening the via hole 971 , so that scent liquid 85 enters the chamber 92 below the lower block 97 and flows out through the connecting channel 921 . referring again to fig2 , for monitoring how much scenting liquid 85 is left in the container 82 , the outer case 15 carries a transparent plate 16 . while preferred embodiments of the invention have been set forth for the purpose of disclosure , modifications of the disclosed embodiments of the invention as well as other embodiments thereof may occur to those skilled in the art . accordingly , the appended claims are intended to cover all embodiments which do not depart from the spirit and scope of the invention . | 4 |
with referenced to the attached illustrations , the present invention discloses an evidence enclosure for supporting a limb , typically belonging to a deceased suspect or criminal , and which can include a forearm and hand providing dna or fingerprint evidence such as may be associated with a criminal proceeding , one aspect of the enclosure being not only to protect the evidence from contamination but to also protect the same from falling off or being otherwise dislodged from the hand . as will be further described , the limb enclosure provides stand - offs for spacing above a ground surface , as well as circumferential extending and adjustable attachments at one end for securing about an end location of the decedent &# 39 ; s limb ( e . g . elbow and / or forearm ). as will also be described , the fabric covering with an open inserting and drawstring closing end is provided for sealing the limb once inserted axially within the evidence enclosure in a direction towards its closed opposite end . referring first to fig1 , a perspective view of the forensic limb enclosure is generally depicted at 10 according to one non - limiting embodiment of the present inventions . the enclosure defines a body with a first portion 12 and a second portion 14 , each being constructed of a closed tubular configuration ( defined as any circular or polygonal shaped portion not limited to a hexagonal cross sectional configuration as shown ) and having a specified axial length . the first portion 12 is open at a forward inserting end ( such as for receiving a detached hand and forearm limb associated with a crime scene ) with the second inter - engaged portion 14 exhibiting an opposite closed end 16 . in one non - limiting application , the body is constructed of a rigid paperboard , such as which can be internally lined with a kraft paper . as is further known , kraft paper or paperboard ( cardboard ) is produced from chemical pulp produced in the kraft process , which is a process for conversion of wood into wood pulp , which consists of almost pure cellulose fibers , the main component of paper . in this fashion , the bags are breathable as needed to avoid premature contamination of the organic and other dna evidence contained therein , such including protection from any of air , moisture , dust and dirt . other non - limiting variants may include constructing the expandable body from a plasticized or plastic composite material ( such including a sanitary plastic ) and which can be interiorly lined with kraft paper material . as further best shown in fig3 , the respective cross sectional profiles of the portions 12 and 14 are dimensioned with slight variances ( with the first portion 12 being slightly greater in diameter for slidably receiving a forward inserting perimeter profile of the second portion 14 ) and so that the second portion can frictionally slide in bi - directional fashion ( see arrow 18 ) both in and out of an interface boundary 20 between the overlapping telescoping portions 12 / 14 . the range of axial telescoping adjustment is limited by the amount of overlap between the inserted perimeter of the second portion 14 and the outer receiving perimeter 12 of the first portion 12 . a plurality of axial extending length fixing straps 22 , 24 , et seq . are provided which extend from the first body portion 12 in overlapping fashion across the interface line 20 and in surface contact with the exterior of the second portion 14 . the straps 22 , 24 , such as which can also include a paperboard material , also include inner surface peel away strips which reveal adhesive locations , see in underside hidden phantom representation at 26 in fig3 . in this fashion , and upon the telescoping portions 12 and 14 being inter - adjusted to a desired overall length corresponding to that necessary to receive the dna containing hand / forearm , the underside peel away strips ( not shown ) are removed and the straps secured in place to establish a desired overall length of the portions 12 / 14 and to prevent subsequent inter - displacement between the portions 12 / 14 . additional features include the provision of perimeter stand - off rims / flanges 28 and 30 associated with each of the telescoping portions 12 and 14 , the stand - off flanges spacing the main telescoping bodies 12 / 14 above a ground surface or the like upon which the enclosure can be supported , such as during the evidence gathering / storage protocol . as will be described in further detail , the stand - off rims or flanges 28 / 30 can be either permanently affixed to the telescoping portions ( such as integrated into the assembled blanks ) or can be separately attached by any of adhesives , hook and loop fasteners , tab and slot configurations or the like . an open interior and elongated fabric 32 ( e . g . such as having a sleeve shape ) is provided with a drawstring and defines an elongated shape with first and second open ends , a first of which is illustrated in supported fashion upon the first telescoping portion 12 , and against an inside surface of the associated extending standoff rim 28 . the fabric 32 with end positioned tightening drawstring ( see at 33 in fig3 ) includes an elongated body and , prior to inserting the hand and forearm ( see at 2 ) into the open end of the enclosure , is positioned upon an exterior circumferential supporting location of the elongated and length adjustable enclosure body . also shown are pluralities of circumferential integrated and extending adjustable strap attachments , see at 34 / 36 and 38 / 40 in each of fig1 - 2 , which extend from the inner opposing end of the first enclosure portion 12 ( see also base portion defined by the pair of indicated and interconnected hex panels 42 / 44 from which the pairs of strap attachments extend in opposing and circumferentially encircling fashion ). inner surfaces of a selected one of the pairs of width adjustable attachments ( see at 46 and 48 as indicated in fig1 ) can also include adhesives , such as which can be accessed through the use of additional peel - away strips , and to that , upon inserting the hand and lower forearm into the length adjusted enclosure , the pairs of circumferential straps are adjusted to securely fasten the enclosure to the location of the ( upper ) forearm projecting from its upper open end . as further depicted in the side view of fig3 , insertion of the limb 2 into the open end thereof of the enclosure is succeeded by the extension of the drawstring extended over the limb ( such as further may be removed from the body of a victim or suspect or which may remain attached to the decedent ). at this point , the encased limb is transported to a crime or dna lab or the like , prior to removal and in order to process the evidence in a secure environment . with further reference to fig4 - 7 , presented are a series of progressive installation illustrations of the limb enclosure for receiving and enclosing a ( severed ) limb in dna safeguarding fashion , such according to one non - limiting protocol for receiving , closing and tagging an evidence entrained limb in dna protecting fashion . fig8 - 10 further provide a series of schematic views of the blank constructions associated with the limb ( forearm / hand ) enclosure and pertaining to the first 12 and second 14 individual portions prior to configured assembly in the manner shown in fig1 - 3 . this includes a cutaway plan view of an assembled blank in fig8 depicting each of cut 50 and crease 52 lines associated with either of the main inter - telescoping sections and according to one non - limiting arrangement . also depicted are a pair of unfolded blank views corresponding to the unfolded first portion 12 ( fig9 ) and second portion 14 ( fig1 ), each of these depicting the multiple and inter - foldable panels which collectively define the hex polygonal or other desired cross sectional shape of each inter - fitting telescoping portion . without limitation , the stand off rims or spacers 28 and 30 can also be provided as separate slide - on or adhesively attachable portions ( see as described below with reference to fig1 - 12 ). additional features include the evidence enclosures being pre - printed with informational fields necessary for proper evidence submission to all crime laboratories , including such as a chain of custody section . other variants of the limb receiving evidence enclosure can include the body being reconfigured to provide a single elongated and tubular receiving portion as opposed to having first 12 and second 14 inter - telescoping portions . this can also include providing the enclosure as a single unitary and elongated body with such as additional breakaway portions or reducing its overall length ( such contemplating length reducing perforations in circumferentially spaced iterations at its remote end , such which can remain open until appropriately length sized and prior to receiving a separately attachable end cap . the evidence enclosure can further be reconfigured for receiving other types of limbs ( including legs , feet etc .) in additional envisioned variants . referring to fig1 , an illustration is shown of an alternate form of stand off spacer or rim attachment , see pair at 54 and 56 , each of which defining a separate assembly secured to each of the telescoping main body portions 12 and 14 , such as via hook and loop band attachments 58 and 60 . as further depicted in the fig1 , a blank illustration is provided of selected stand off attachment 54 of fig1 and which includes a plurality of inter - folding panels which assemble to create a cradling three sided cross sectional support profile . the panels further assemble to provide each attachable stand - off spacer with inner and outer linearly spaced ledges ( these shown at 58 and 60 for selected spacer attachment 54 in fig1 and further including opposite pairs of inter - folding panels 58 / 60 and 58 ′/ 60 ′ in fig1 ). as further shown in fig1 , the blank construction of the spacer attachment further includes tabs 62 / 64 and slots 66 / 68 for inter - assembling the pairs of support ledges 58 / 60 and 58 ′/ 60 ′, as well as a pair of fold - in supports 70 and 72 which interconnect to ends of a common base panel 74 also supporting the stand off ledges . without limitation , the present design includes any version of a stand - off spacer configuration ( permanent or attachable ) beyond that shown . the present invention accordingly provides an effective forensic style glove or covering which elevates the dna or evidence contaminated limb ( such as also including gunshot residue or the like ) to allow for securing key evidence up off of the ground and out of any of debris , dirt , mud , snow rain or other foreign contaminants ( the draw sting attachment extending over the forearm providing additional contamination prevention support ). an additional feature of the assembly is that it permits the removal of the stand - off attachments as shown in fig1 - 12 , such as in order to permit the assembly 10 to be placed within a body bag along with the remainder of the corpse . additional to the paperboard and kraft paper constructions previously described , it is again understood that the contamination preventative and limb support assembly can also be stored prior to use in any type of rigid or flexible sanitary container , such being enabled for rapid deployment in the field . the main body portions of the forensic enclosure can further include any type of fabric ( cotton ) or other interior lining to further assist in capturing , containing , preserving and protecting the evidence , thereby maintaining its integrity for use at trial . having described my invention , other and additional preferred embodiments will become apparent to those skilled in the art to which it pertains , and without deviating from the scope of the appended claims : | 0 |
fig1 is a prior art storz collar 1 and seal ring 2 . the storz collar 1 includes connecting lugs 3 and 4 . wrenching lugs 6 and 7 are also shown . threads 5a are also illustrated on the seal ring . referring to fig2 threads 5a of the seal ring mate with threads 5b of the storz collar 1 . fig2 illustrates the prior art storz collar 1 and seal ring 2 along line 2 -- 2 of fig1 . storz collar 1 includes a first cam surface 9 and a second cam surface 10 . a ramp 12 on the cam surface 9 is also illustrated as is a stop 11 on the cam surface 10 . the cam surfaces 9 and 10 are generally circularly shaped and include a ramp portion and a stop portion . fig2 also illustrates seal recess 8 in the seal ring 2 . fig2 a illustrates the storz collar and the seal ring 2 of the prior art interconnected together . reference numeral 45 in fig2 a indicates the location of excess portion of the seal ring which must be machined prior to having a completed coupling half . in other words seal ring 2 must be flush with the bottom of storz collar 46 as shown in fig2 b . fig2 c is a cross - sectional view of the seal ring prior to the machining of the seal recess 8 . see fig2 . fig3 is a top view of the prior art storz collar sometimes referred to herein as a locking collar . fig3 illustrates wrenching lugs 6 , 6 &# 39 ;, 7 and 7 &# 39 ;. fig4 is a top view of the prior art sealing ring 2 . fig5 is a cross - sectional view of the instant invention taken along line 5 -- 5 of fig6 . fig5 illustrates the first slot 14 and the second slot 42 . the slots are arcuate and extend through circumferential shoulder 47 . first slot 14 includes a first wall 16 , a second wall 17 , and a slot wall 30 . second slot 42 includes a first wall 18 , a second wall 19 , and a slot wall 31 . these slots are an important aspect of the present invention , as will be described further hereinbelow . fig5 illustrates the one piece storz collar - seal ring with threads 13 machined into the storz collar . reference numeral 28 indicates a flush surface which is formed into the storz collar - seal ring during the molding process . no separate machining process is necessary to trim the seal ring as was required in connection with the prior art . for example see fig2 a and 2b which illustrate that the seal ring 2 was machined to provide a flush surface such as the one represented by reference numeral 28 in fig5 . fig5 a is a cross - sectional view of the instant invention similar to that shown in fig5 with the seal recess 8 machined into the coupling half , otherwise known as the storz collar - seal ring . fig6 is a top view of the coupling half of the invention illustrating the slots 14 and 42 , ramps 12 and 25 , and stops 27 and 26 on cam surfaces 9 and 10 , respectively . the stops 27 and 26 are raised portions such that when the connecting lugs 3 and 4 of another coupling half engage the cam surfaces 9 and 10 . when the coupling halves are rotated each with respect to the other , the connecting lugs abut stops 27 and 26 preventing further rotation of the coupling halves with respect to each other . the coupling action of the halves is known in the art . referring still to fig6 wrenching lugs 23 and 24 are shown which perform the identical function of the wrenching lugs of the prior art . fig7 is a bottom view of the coupling half of the invention illustrating the slots 14 and 42 . underside 12 &# 39 ; of ramp 12 and underside 25 &# 39 ; of ramp 25 are shown . the purpose of illustrating the undersides of the ramps is just to provide a reference point for viewing fig7 . access spaces 20 , 21 provide room to interconnect connecting lugs which are sometimes referred to as connecting cam locks 3 , 4 . reference numeral 22 indicates an integral seal ring . it will be noticed when referring to fig7 that connecting lugs or cam locks 3 , 4 are also shown here . it will be understood by those skilled in the art that only one coupling half is shown in the drawing figures and that this coupling half mate with either an identical coupling half or an adapted version of this coupling half mounted to a fire truck , a fire hydrant , or another hose length or section . fig7 a is a bottom view of the coupling half of the invention illustrating a machined seal recess 8 in the integral seal ring 22 . the integral seal ring 22 is somewhat of a misnomer because this invention permits the storz collar - seal ring to be made of one part or piece as compared to two parts ( one of which is the seal ring ) which require machining as is known in the prior art . fig8 is a perspective view of the instant invention . most notably , slots 14 and 42 are illustrated . reference numeral 29 indicates that threads are to be machined on the inner surface of the storz collar . fig9 is a cross - sectional view of the invention taken along the line 9 -- 9 of fig8 . line 9 -- 9 is also set forth in fig6 . fig9 illustrates ramp 12 as part of and leading to cam surface 9 and ramp 25 as part of and leading to cam surface 10 . it will be noted that in fig9 the seal recess 8 has not yet been machined into the coupling half . reference numeral 32 indicates the portion of the storz collar - seal ring where the seal recess will be machined . fig1 is a cross - sectional view of the first mold 33 and the second mold 34 in the cavity of the instant invention . it will be noted that the first mold 33 engages the second mold 34 in three places as indicated generally by reference numerals 47 , 48 , and 49 . these places of engagement 47 , 48 , and 49 are separated by mold cavities . these mold cavities are illustrated in fig1 as having already received molten material such as aluminum . the mold cavities are defined using the same reference numerals used in fig5 . typically the storz collar - seal ring will be made from either aluminum or brass . aluminum or brass are used in the prior art storz collar and seal ring assemblies . fill ports 35 and 36 are indicated and these fill ports are used to supply molten aluminum or molten brass to the mold . fig1 is a cross - sectional view taken through the mold at a place where the slot 14 and 42 are formed . fig1 is a cross - sectional view of the first mold 33 and the second mold 34 and the cavity illustrating the portion of the cavity which forms the connecting lugs . reference numerals 3 &# 39 ; and 4 &# 39 ; illustrate the connecting lugs prior to machining . reference numerals 43 and 44 are used to denote additional fill ports which are used to fill the cavity . fig1 is a cross - sectional view of the prior art three piece locking collar mold taken along line 12 -- 12 of fig1 . fig1 illustrates a first bottom mold 37 , a first core 38 , a second core 39 , a third core 40 , and a fourth core 41 . after the molding process is completed the first core 38 and the second core 39 are pulled upwardly around the spaces in which the connecting lugs or cam locks 3 and 4 are formed . the first bottom mold 37 is pulled downwardly and the third core 40 and fourth core 41 collapse inwardly so that they may be pulled out from underneath the ramps , cam surfaces and stops . fig1 is a cross - sectional view taken along the line 13 -- 13 of fig1 . fig1 illustrates a cross - sectional view of the storz collar along the line which does not illustrate the connecting lugs or cam locks 3 and 4 . the foregoing invention has been described by way of example only . those skilled in the art will readily recognize that several changes and modifications may be made to the foregoing invention without departing from the scope and the spirit of the appended claims . for instance , a different slot configuration is contemplated . many different slot configurations which will permit the formation of ramps , cam surfaces and stops of different configurations are envisioned . | 5 |
referring to fig1 , a schematic rendition ( 10 ) showing a typical shaped charge and a preferred embodiment of the present inventive disrupter ( 5 ), with , for clarity and illustrative purposes , the disrupter ( 5 ) spaced out of the hollow open mouth of the shaped charge — in use the disrupter would be fully lodged within the hollow open mouth of the shaped charge . such that , in use , the rounded front end of the central support ( 8 ) would be adjacent to the central point ( 7 ) of the shaped charge liner ( 4 ). also shown , are the high explosive ( 3 ) and the detonator ( 1 ) of the shaped charge — the two unnumbered lines entering the detonator ( 1 ) are the triggering wires . referring to fig2 , a preferred embodiment of the inventive shaped charge jet disrupter ( 5 ), which is formed of a central support ( 12 ) which in use extends centrally into the mouth of the shaped charge , from which support a plurality of generally hemi - circular plates ( 14 ) extend generally perpendicularly therefrom , the radius of the plates increasing toward the mouth of the shaped charge to form a conical outline , and where the plates are arranged along the length of the support in a staggered fashion about the longitudinal axis of the support ( which staggering can clearly be seen by referring to section b - b of fig2 ). as shown in fig2 , there are six ( 6 ) generally hemi - circular plates , staggered along the length of the central support ( 12 )— however , for the purposes of achieving the desired mitigation of the jet from a shaped charge , four , or five , or six , or seven , or more such plates could be used . further , while a hemi - circular plate is shown attached to the base of the central support in fig2 — alternatively , a completely circular plate could be attached thereto , in order to provide an improved means of securing the subject inventive disrupter in place within the hollow open mouth of the shape charge . the central support ( 12 ) may be in the form of a relatively thin member as shown in fig2 , i . e . a generally cylindrical support with a rounded end , which end , when in use , is located adjacent to the central point of the liner , pointing toward the detonator located at the end of the shaped charge opposite the open mouth ( as shown in fig1 ). or in alternative embodiments , the central support can be a relatively flat broadened support that uniformly narrows toward a rounded top , which top points towards the detonator located at the end of the shaped charge opposite the open mouth ; such as illustrated in fig3 , showing a thin triangular in cross - section wedge that has a rounded tip ; the base of which flat broadened support may extend part or all of the way to the periphery of the open end of the mouth , such that , if a complete 360 degree , circular , plate is present at the base of the central support , the base of such a thin triangular cross - section wedge , could extend part way across the diameter thereof , or fully across the diameter thereof ( as shown in fig3 ). as illustrated in fig3 , showing an alternative embodiment of the present invention , preferably , there is a completely circular base plate at the base of the central support , the diameter of which plate is just less than that of the opening of the mouth , such that the plate will effectively cover the hollow mouth opening in such a way that it will be easy to fasten the plate , and disrupter extending therefrom , to the front edges of the mouth . in use , the disrupter may be fastened by any convenient means to the front edges of the mouth — using metal or plastic clips , tape ( such as duct or masking tape ), or the diameter of the circular base plate might be such as to provide a force fit into the shaped charge ( but , if such is the case a means of grasping the circular base plate must be provided to easily remove it from the mouth — and many such means are known in the art ). in use , the present inventive disrupter must merely be located within the hollow open mouth of the shaped charge at the time the shaped charge is detonated as detailed below — it need not be fastened therein . preferably , as shown in fig3 , the disrupter of the present invention has at least 4 generally 180 degree hemi - circular plates staggered along the length of the central support , in addition to the 360 degree , completely circular , base plate provided as a means to fasten the disrupter to the front edge of the hollow open mouth of the shaped charge ( which completely circular plate does not aid in and is not required for the desired mitigation effect ). the plates may be sections greater or less than 180 degrees in extent . in fact , the plates may be sections that are about 10 to about 20 degrees more or less than the preferred 180 degree hemi - circular sections . preferably , the disrupter of the present invention is manufactured of a single material that is not fragile and will withstand the normal forces involved in the storage and transport of the shaped charge device . potential materials of construction of the disrupter are plastic , metals , composites , or glass — preferably a low cost plastic material , most preferably a material which can be injection molded , such as abs , acetal , k resin , nylon 6 / 6 , pet , polypropylene , polyethylene , styrene , or tpe . in an alternate preferred embodiment , the disrupter of the present invention may be manufactured as part of the storage / shipping container for the shaped charge device . the shaped charge device can be positioned within the storage / shipping container such that the central support with asymmetrically arranged plates of the disrupter extends from the base or a wall of the storage / shipping container fully into the hollow open mouth of the shaped charge device and the device is firmly secured such that the disrupter will remain in such a functional position . as modern finite element simulation software is precise , it was possible to eliminate various alternative disrupter embodiments that failed to reduce the momentum , i . e . penetrating power , of the shaped charge jet significantly , without costly experimentation . particular embodiments that failed to model a significant reduction in penetrating power are shown in fig4 ( a pinwheel type shape ); fig5 , ( a cone shape with square shaped holes therethrough ); fig6 ( a cone shape with elongated slots therethrough ); fig7 ( a central support with a set of 360 degree plates , uniformly along the length thereof ); fig8 ( a truncated solid cone with a series of cylindrical holes longitudinally therethrough ). the modeling software used was a proprietary u . s . military program , 3d - ale ; however , this program and its results are very similar to and can be reproduced by using a commercially available program ls - dyna ®, available from livermore software technology , livermore , calif . the finite element modeling of the present invention has shown that the disruptive effect is completed by the at least 4 generally hemi - circular plates arranged in a staggered fashion along the length of the central support and generally perpendicular to that central support — the outline of the hemi - circular plates forming a cone , i . e . the radius of the plates increasing toward the base of the central support ( with the largest radius plate being located at or near the base of the central support ). also , as preferred , the full 360 degree circular base plate can be located at the base of the central support , to provide a means to attach to that central support a closure to the front edge of the hollow open mouth of the shaped charge . as stated above , this 360 degree circular base plate adds little to the disruptive effect and is to provide a means to more easily secure the disrupter to the front edge of the hollow open mouth . a base line and two experiments with preferred embodiments of the subject inventive disrupter were conducted to demonstrate the efficacy of the inventive disrupter , i . e . the mitigation of the shaped charge jet by the inventive disrupter . in each case a typical military shaped charge , a m2a4 , fifteen - pound shaped demolition charge was used — modified only to contain an alternate , qualified , insensitive explosive material . specifically , while the m2a4 charge usually contains a 50 gram booster of composition a3 and a 11 . 5 - pound main charge of composition b — in place of the composition b , the main charge was replaced with the insensitive explosive , imx - 104 . imx - 104 is a known and qualified , equivalent energy , replacement for composition b — imx - 104 containing 2 , 4 - dinitroanisole ( dnan ), 3 - nitro - 1 , 2 , 4 - triazol - 5 - one ( nto ) and rdx . further , as is standard with the m2a4 , a cylindrical fiber base slips onto the end of the charge to provide a 6 - inch standoff distance . the cavity liner is a cone of glass versus the typical metal . and , the charge is 14 15 / 16 inches high and 7 inches in diameter , including the standoff . in the base line case , a modified m2a4 ( as detailed above ) was placed hollow open mouth down directly on top of four ( 4 ), 3 inch thick , rha witness plates and detonated . the penetration of the shaped charge jet was measured as 16 . 5 cm . in the first test of a preferred embodiment of the disrupter of the present invention , the embodiment illustrated in fig2 was tested — using the modified m2a4 . the particular preferred disrupter embodiment was manufactured of accura 60 plastic , a clear polycarbonate like epoxy , available from 3d systems corporation , rock hill , s . c . this disrupter was placed within the mouth of the modified m2a4 shaped charge , held in place using duct tape , and the shaped charge with disrupter inside was placed , hollow open mouth down , on four witness plates — exactly as was done in the base case ( where only the presence of the disrupter was different ). the penetration was measured at 1 . 45 cm — a reduction , i . e . mitigation of the penetrative power / effect , of about 91 . 2 % from the base case . in the second test of a preferred embodiment of the disrupter of the present invention , the embodiment illustrated in fig3 was tested — using the modified m2a4 . the particular disrupter was also manufactured of accura 60 plastic . again , as in the test of the first embodiment described above , this disrupter was placed within the mouth of the modified m2a4 shaped charge and the shaped charge with disrupter inside was placed , hollow open mouth down , on four ( 4 ), 3 inch thick , rha witness plates — again , exactly as was done in the base case ( where only the presence of the disrupter was different ). the penetration was measured at 1 . 956 cm — a reduction , mitigation , of about 88 . 2 % from the base case . | 5 |
the present invention relates to a jewelry article comprising at least first and second magnetic jewelry - forming components , each configured and dimensioned in a predetermined shape and having a magnetizable portion for repulsive magnetic association with the other component , wherein the magnetizable portions repulse each other with a magnetic strength that can be overcome by a person &# 39 ; s hand strength such that the components can be placed in different positions relative to each other , and the first component further comprises a retaining structure that prevents the second component from being completely separated from the first component when the magnetized portions of the components repulse each other , such that the magnetic repulsion between the components enables them to attain a first configuration wherein the second component is positioned remotely from the first component and a second configuration wherein the person &# 39 ; s hand strength applies a force to urge the components towards each other , wherein upon release of the force the components return to the first configuration . the invention also relates to a magnetic jewelry - forming component for preparing a jewelry article comprising a body member configured and dimensioned in an ornamental shape and having a first magnetizable portion for repulsive magnetic association with at least one other magnetic jewelry - forming component and at least one further element that has a magnetized portion of the same polarity as the first magnetizable portion for magnetic association therewith , wherein the body member has a magnetic strength that can be overcome by a person &# 39 ; s hand strength such that the body member and at least one other magnetic jewelry - forming component can be placed in different positions relative to each other , and wherein the further element comprises a retaining structure that prevents complete separation of the body member from the at least one other magnetic jewelry - forming component when the first magnetized portion of the body member is magnetically repulsed from the at least one other magnetic jewelry - forming component , wherein the body member has outer and inner surfaces , the at least one other jewelry - forming component comprises at least one dimensioning member that is operatively associated with the body member with the first magnetizable portion of the body member and the dimensioning member magnetically repulsing each other with a maximum magnetic strength that can be overcome by a person &# 39 ; s hand strength , such that the magnetic repulsion between the body and dimensioning members enables the component to attain a first configuration wherein the one component can be affixed to a rod or rods , bar or other elongated object ( s ), the other component is associated with the rod in a manner that enables it to freely move along the rod and the stop can be positioned behind the other component to prevent its movement away from the body member by a desired distance . the other component is free to move between the body member and stop member , with the magnetic repulsion between the components holding the second component away from the first . preferably , the components are maintained in their magnetic repulsion configuration by guides either through the components or constraining the components . this is important due to the fact that magnetic fields are unidirectional and opposite polarities prefer and dominate to attract each other . generally , the components are designed with some control to prevent attraction . in addition to the above , the components can be keyed , cammed or otherwise arranged guided to prevent the components from moving into a position where they would attract rather than repel . for example , two magnets shaped like spoke wheels would normally rotate slightly so that the spokes do not align and then would come together because space between fields are reversed . to maintain repulsion with these forms , a keyed axle , i . e ., a square shaped axel and square hole in the wheel , is used to maintain the spoke wheels in the desired position . another preferred arrangement is to have the first and second components connected by a flexible restraining structure , such as a wire or tether , so that the components can move relative to each other but only by a predetermined distance . alternatively , the components can be placed in a chamber of a transparent material or a cage so that they can move relative to each other while still being visible . the chamber can be configured in any desired cylindrical shape , such that round , polygonal etc , where the components are configured to move only vertically in the chamber . this can be accomplished , for example , by configuring a rectangular shaped component in a rectangular chamber . any shaped component that keys or is otherwise restrained from rotation can be used . these cage or chamber structures provide the limits in furthest separation distance of the components . it is important to recognize that the polarity of the components must be such that the same polarity on each component faces the other , so that the maximum repulsive force is generated to urge the components apart . dimensioning member is positioned remotely from the body member and a second configuration wherein the person &# 39 ; s hand strength urges the dimensioning members towards the body member . in one embodiment , the body member has at least one female element associated therewith for magnetically attracting and receiving a male element of the at least one other magnetic jewelry - forming component , with the first magnetized portion providing a minimum magnetic strength that is sufficient to retain the male element within the female element and a maximum magnetic strength that can be overcome by a person &# 39 ; s hand strength to separate the male and female elements , such that a plurality of such components can be magnetically coupled to form an article of jewelry . the body member can have an arcuate shape with the female element is located at an end of the arcuate shape , and wherein the female element defines a cavity having a depth sufficient to receive a male element of the other jewelry - forming component at different positional relationships therein . alternatively , the further element can be a male element that extends away from the female element and is located on the opposite end of the arcuate shape , with the male element having a forward end that is magnetically attracted to the first magnetizable portion of the body member of the at least one other magnetic jewelry - forming component . the body member then can be at least partially tubular and with first magnetized portion of the body member being provided by a magnetized pellet or disk member . also , the further element can be female element located on an opposite end of the tubular body member . preferably , each female element defines a cavity having a depth sufficient to receive a male element at different positional relationships therein , and each female element is magnetized to attract oppositely polarized male elements . another embodiment of the invention relates to a jewelry article in the form of a ring , bracelet , anklet , chain , choker , necklace , or watchband comprising between two and two hundred jewelry - forming components defined herein . these articles are conveniently formed by a plurality of jewelry - forming components with sufficient surrounding structure or members to retain the components in magnetic association . generally , the surrounding structure or members help guide and constrain the components so that they are not repulsed out of a desired magnetic relation or out of the jewelry article . this is generally achieved by the use of one or more stop members which help define a boundary within which the components are located . for example , when one component is in the form or a body member affixed onto a rod , bar or other elongated object , then at least one other component can be associated with or placed along the rod in an arrangement such that the magnetic repulsion of the components causes the second component to be free - floating or levitating above the body member of the first component . these components are provided with essentially the same magnetic polarity so that they repulse each other and with a maximum magnetic strength that can be overcome by a person &# 39 ; s hand strength , such that the magnetic repulsion between the components can be changed by hand force . this enables the second component to be moved between a first configuration wherein it is positioned remotely from the body member and a second configuration wherein the person &# 39 ; s hand strength , gravity or other forces cause the component to move away from or even toward the body member , thus imparting motion to the jewelry article . the relative size of the components or the degree of magnetivity can be used to achieve the desired spacing between them . for example , a relatively large component can be used to force relatively smaller components to be repulsed further away . alternatively , relatively heavier components can be used so that their weight causes movement toward each other with the magnetic force then causing the components to move apart . when arranged vertically , gravitation force is a major consideration , with the components levitating due to the magnetic repulsion . when the components are arranged in a horizontal configuration , gravitational effects are reduced . the movements of the components imparted by magnetic repulsion provides unique effects in the jewelry article . the drawing figure illustrates a preferred article in the form of an earring 10 . the earring has a central rod 15 upon which three disks 20 , 25 , 30 are mounted . each disk is shown solid but may have a band of precious stones , such as diamonds , mounted around its periphery . they also may have other adornments or ornamentation , or they can be of different shapes or sizes . the lowermost disk 20 can be affixed to the rod 15 , whereas the top disks 25 , 30 can freely move vertically up and down on the rod 15 . disks 25 , 30 are configured so that they can rotate on the rod 15 as well . a stop member in the form of a peripheral rib 35 is provided to limit the upward movement of the top disk 30 . alternatively , the lowermost disk 20 can sit on a stop member 40 to prevent downward movement of that disk , and it can be configured so that it also rotates on the rod 15 . each disk is magnetized with the same polarity , so that they repulse each other to a spaced relation . for example , the bottom disk 20 repulses the middle disk 25 which in turn repulses the upper disk 30 . the middle disk 25 also repulses the lower disk 20 downwards . the resulting spacing is achieved as shown in the drawing . as the person wearing the earring walks or moves , such movement , along with the weight of the disks and gravity , causes the top two disks 25 , 30 to move downward , but the magnetic repulsion force then causes those disks to move upward . this movement makes the piece appear to be magically levitating and changing as the person moves , thus providing a unique appearance that heretofore has not been achieved . the relative size and weight of the disks can be achieved to obtain a desired spacing or other spatial arrangement . the top of the rod has a linkage to a post 50 which can be rotated to a perpendicular position to the rod and inserted into the pierced ear lobe for engaging an holding element that enables the earring to be worn . while a single rod is illustrated , one or more rods , wires or similar retaining elements can be used to maintain the disks in the desired spaced magnetic repulsive arrangement . the disks are shown in the drawing as having a circular circumference but of course any size or shape can be used . while flat surfaces in opposed magnetic repulsion are preferred these are not required as the magnetic forces can be emanate from any shape . this feature enables the invention to have parts with holes , recesses , cavities , slots or other discontinuities with other components being held in magnetic association or repulsion in the holes or slots along with , or by , the appropriate restraining member or members . the skilled artisan can contemplate a wide variety of variations of how to implement or incorporate these features in a final article of jewelry . for example , if one component is provided with a cylindrical cavity having a sufficient depth , the other component can be configured to fit within the cavity . the weight of the second component can be selected so that it cannot be repulsed out of the cavity whereas the magnetic force between the two components maintains the distance between them . the cavity can include openings or slots in its cylindrical sidewall to provide greater visibility of the second component therein . alternatively , the second component can be associated with the cavity with a mechanical connection that prevents complete separation , such as configuring the cavity with include a narrowed or partially blocked opening or with a stop member as described previously . for any of these embodiments , an adornment of a precious stone , a material having a different color from that of the body member , indicia , or a part of a character , pattern or design can be included for further visual effects in the final article . for example , the magnetic field emitted or radiated by one component can be used to configure additional components to form indicia or other ornamental patterns that are visible when the components are in their usual magnetic repulsion positions . the magnetized components can be arranged so that they are uniquely engageable to form the article . the jewelry article can also magnetically join or repulse these components and their adornments to form a bracelet , brooch , pin or earring . the jewelry article can also include components that form a clasp , with the movement of the components from one position to another position signifying the proper closing of the clasp . the term “ adornment ” is used herein to generally define any item that is added to the jewelry component or article . this would include stones , stone mountings , or inserts , overlays , or other attachments of a precious , semi - precious or non - precious metal or alloy , or of coatings of metal , plastic or elastomers that are provided upon or with the component or article . the adornment is preferably permanently attached or joined to the component or article but it can also be releasably associated with the component or article , e . g ., a charm . the jewelry article can also include a restraining component to facilitate connection or removal of the article for wearing . a preferred component is a hinge or clasp . the article can include components that form a clasp , with the movement of the components from one position to another position signifying the proper closing of the clasp . the jewelry article can also include a plurality of magnetized locations arranged to be offset for providing rotational movement to the components as they come together to automatically provide a mechanical interlock of the components . as noted , the relative size of the magnetized areas is also taken into consideration . while the same size areas can be magnetized for convenience , different size areas can be provided as well . in general , the larger the size of the magnetized area , the lesser number of such areas are needed . it is desirable to make the matching magnetized areas of each component the same size , but this is not critical . one reason for making multiple areas of magnetic field is to obtain relative small but short localized field strengths . these would provide much weaker overall magnetic strength than if the entire ring or jewelry object is to be magnetized . also , the smaller magnetized areas are more superficial in nature , and the field lines do not radiate far beyond the object if at all . thus , the jewelry has no deleterious affect on watches , credit cards , computer disks or related items , while still providing magnetic force sufficient to impart the desired features to the jewelry . it should be noted that the magnetic strength of the joined components can be overcome much more easily by applying a shearing force rather than by trying to pull apart the components in directly opposite directions . for this reason , it is sometimes useful to design a flange or other retention member that prevents sliding motion for shearing the parts . in a useful arrangement , between 6 and 24 equally spaced magnetic poles are provided around each component . preferably , 8 to 20 poles are used , with particularly advantageous effects being obtained with 12 to 16 poles . in general , between 4 and 40 poles can be used . in yet another embodiment , the multiple poles can be configured in the component as an indicia or other ornamental pattern that would be invisible during wearing of the component until and unless particles or films of magnetizable indicators , e . g ., iron filings or films that are responsive to magnetic fields , come into proximity with the component . these embodiments indicate the wide range of utility of the present invention . the invention is not limited to earrings but can be applied to many different types of jewelry components using the principles disclosed herein . for example , the magnetic portions can be used to form chain links , clasps or stone mountings . one portion can be used to magnetically mount an adornment onto any other portion that forms part of a larger jewelry article . for example , a bracelet or necklace can be provided with magnetized portions that can receive other magnetized portions that carry stones , crystal or contrasting color components or the like . in this way , the owner of the piece can custom design it for the occasion by attaching the desired color coordinated stones or colored portions for example to complement an outfit or signify the occasion . another advantageous utility of the tactile sensation of the portions clicking or locking into position is when the portions are utilized as part of a clasp having no visible means of connection . the clicking provides an indication of a positive locking of the parts together so that the user knows that the article has been properly joined for wearing . in addition , the multiple poles can be offset so that upon contact of the components , the poles impart a rotational movement to one component relative to the other , and this movement can be used to create an automatic mechanical interlock as the component moves from one position to another . this provides an even more secure connection and closing of the clasp . there are numerous ways to provide the plural magnetic locations on the article . conventional magnetic materials can be buried or hidden in gold , silver or other precious metals that are not magnetizable . in this way , the precious metal would provide the desired appearance of the piece while the hidden magnetized material would provide the desired magnetic pole . a less complex way to achieve this result is to utilize a magnetizable precious metal , such as polarium ® as described herein . this alloy , which is disclosed in u . s . pat . no . 6 , 869 , 567 , can simply be magnetized in the desired locations using the appropriate fixtures as is known to the skilled magnetist . other magnetizable precious metal alloys can also be used if desired . in all cases , the magnetic strength of the alloy must be sufficiently high to provide secure magnetic joining of the components without generating high magnetic fields that would affect magnetic sensitive components when handled by a wearer of the jewelry . for example , a person wearing earrings according to the preferred embodiment can safely handle credit cards or computer diskettes without damaging the electronic information therein . a distance of as small as 1 / 16th of an inch or less between the article and magnetic sensitive component is generally sufficient to avoid problems of this type . for costume jewelry or other less expensive pieces , conventional permanent magnets rather than precious metal magnets can instead be used . these can be visible or hidden , such as by coatings , encapsulation , or encasement , or as an inlay or by placement into a recess in a jewelry article or component . any cross sectional configuration of the components is possible . although shown as round in the preferred embodiments of these components , other configurations such as polygonal , elliptical or combinations thereof are suitable . when male and female components are used , they preferably have the same configuration , but this is not necessary and any matable configurations can be used . also , the shape of the outer surface of these components is unlimited and can be of any desired shape with or without additional ornamentation , undulations , or other surface characteristics . the preferred magnetic strength should be between 200 and 4500 gauss depending upon distances between the parts , types , shapes and sizes of magnets , etc . as the skilled artisan would know , this magnetic strength should be sufficiently low that the elements can be easily separated by hand or finger force , or even by the weight of the components . depending upon the specific designs utilized , the article can be separated into the jewelry - forming components or the components can be moved to different relative positions , thus enabling the article to temporarily assume an expanded or larger size configuration to facilitate placement on the wearer . in some designs , if desired or necessary , the components can be disassembled to allow cleaning or rearrangement . different components can reassembled in a different arrangement , if desired , or can be interchanged with other components of similar size to provide a different appearance to the piece , e . g ., by providing different colors , stones or other items to match the clothing or the wearer or to simply provide a different visual effect to the piece . typical sizes for the jewelry - forming components of the invention can vary over a wide range . generally , arcuate shaped components are used , but the designer has an unlimited selection of desirable sizes , shapes , colors , etc ., depending upon the visual effects to be achieved , of course limited only by sizes that can be worn by the wearer without discomfort or injury . the components of the invention can be used for many purposes . for example , a conventional necklace can be provided with a plurality of components that have oppositely polarized male ( or female ) elements extending away from the wearer . then a plurality of ornamentations , such as gem or stone settings or metal shapes , e . g ., cubes , polygons , figures , letters or numbers , etc ., can be provided with a female ( or male ) element of opposite magnetic polarity to that of the male elements , this allows the user to connect the ornamentations onto the necklace in a desired manner by magnetically coupling the male and female elements . this arrangement allows the user to custom design the necklace for the occasion by adding the desired stones and other ornamentations , moreover , since the couplings are not permanent , the necklace can be rearranged or redesigned as desired for future uses . by including an appropriate post or clasp arrangement on one of the jewelry - forming component of the invention , the skilled artisan is able to create a wide range of earring designs from such components . in addition , one of ordinary skill in the art would recognize that the components of the invention can be used in combination with additional functional parts such as hinges , rivets , ball and socket joints , and other engineered items that allow for motion between the components . when a ball and socket type joint is used , the ball and socket can be magnetized with different polarities so that the can be maintained together in magnetic association . the final jewelry articles that can be made vary greatly , thus demonstrating the versatility of the jewelry - forming components of the invention . these examples are not intended to be limiting for the invention , as skilled artisans can easily create additional structures or methods to accomplish the desired results . the magnetic repulsion between the body member and the dimensioning members has a maximum strength that can be overcome by a person &# 39 ; s hand strength . generally , as a skilled artisan would know , a magnetic strength of between 200 and 4500 gauss , depending upon distances between parts , types , shapes , and sizes of magnets , would be sufficiently low to be overcome by hand strength or by force applied in wearing the product . hence , the force applied by the wearer to slide on the ring easily overcomes the magnetic force between the body member and the dimensioning members , urging the dimensioning members to spread out . with the wearer &# 39 ; s hand strength urging the dimensioning members to spread out , the ring attains a different configuration in which the dimensioning members are moved towards and positioned closer to the body member . the preferred alloys for use in this invention are magnetized precious metal alloys , such as those which are platinum based and contain at least about 70 % platinum by weight . while amounts as high as 95 % by weight are suitable , the most preferred amount is between 75 and 80 % by weight as these amounts enable the strongest magnetic properties to be achieved . in order to impart magnetic properties to these alloys , cobalt is added and the alloy is heat - treated . the amount of cobalt can range from about 5 to 30 % by weight , and is complementary to the weight of the platinum . as between these two components , a weight ratio of 70 : 30 to 95 : 5 pt : co is preferable . an example of this material is known as polarium ® and is available from the inventor . this alloy , which is disclosed in u . s . pat . no . 6 , 869 , 567 , is preferred for fine jewelry because it has greater magnetic power than known magnetic gold alloys . of course , various changes and modifications of the preferred embodiments are apparent to the skilled artisan after viewing this disclosure . for example , the number of components is not critical and it should be understood that two , three , four , or more can be used and fall within the scope of the present invention . this allows the designer to create multiple portion rings , clasps , bracelets or necklaces , etc ., with the components repulsing each other when worn . also , the components can be concentric , where one fits into the other , and the outer one has windows or cut - out portions to allow viewing of the adornments on the outer surface of the inner component . any changes and modifications that fall within the true spirit and scope of the inventions disclosed herein are intended to be encompassed and covered by the appended claims . | 0 |
fig1 is a schematic view of a cargo container 1 being equipped with a refrigeration system . the refrigeration system comprises a compressor 2 , a condenser ( not shown ), an expansion device in the form of an electronic thermovalve 3 , and an evaporator 4 . the evaporator 4 is arranged inside a closed volume 5 defined by the cargo container 1 , and the refrigeration system is thereby capable of providing refrigeration for the closed volume 5 . a number of fans 6 , two of which are shown , are arranged in the closed volume 5 adjacent to the evaporator 5 . the fans 6 circulate the air inside the closed volume 5 in such a manner that air is pushed in a direction from the fans 6 towards the evaporator 4 , the air thereby passing the evaporator 4 before proceeding into the closed volume 5 and providing cooling for goods stored in the closed volume 5 . the air then returns to the region of the fans 6 , where it is once again pushed towards and across the evaporator 4 . a temperature sensor 7 is arranged adjacent to the fans 6 . accordingly , the temperature sensor 7 measures the temperature , t return , of air returning to the fans 6 and the evaporator 4 from the closed volume 5 . as described above , t return is an indication of the temperature of the goods being stored in the closed volume 5 . the measured temperature is supplied to a controller 8 which controls the refrigeration system . the controller 8 controls the refrigeration system in accordance with an embodiment of the present invention . a number of heating elements 9 are arranged on the evaporator 4 . the heating elements 9 can be used when defrosting of the evaporator 4 is required . furthermore , the heating elements 9 may be used for increasing the temperature in the closed volume 5 in the case that the goods being stored in the closed volume 5 must be stored at a temperature which is higher than the ambient temperature . fig2 is graph illustrating temperature of return air , t return , as a function of time , during operation of a refrigeration system in accordance with a method according to an embodiment of the invention . t return may advantageously be measured by means of the temperature sensor 7 shown in fig1 . it can be seen from the graph of fig2 , that t return is initially significantly higher than the set point temperature , t set , which is the desired temperature inside the closed volume 5 . however , due to the refrigeration provided by the refrigeration system , t return decreases as a function of time , and gradually approaches t set . fig3 illustrates a compressor switching pattern of a compressor forming part of a refrigeration system which is controlled in accordance with a method according to an embodiment of the invention . the refrigeration system may , e . g ., be the refrigeration system illustrated in fig1 . in fig3 the compressor is switched on at regular intervals , and the time elapsing from the compressor is switched on until the next time the compressor is switched on constitutes one compressor switching cycle . in fig3 it appears that the on - time of the compressor is fixed at substantially half the compressor switching cycle . it should , however , be noted that the on - time of the compressor could be smaller than or larger than half the compressor cycle , and / or that the compressor on - time could vary from one compressor cycle to another . in the latter case the compressor may be switched off when certain criteria are fulfilled , as described above . in fig3 it is indicated that ten compressor switching cycles constitutes one period . during this period the compressor switching pattern is monitored and determined , and subsequently the speed of the fans of the refrigeration system is controlled on the basis of the determined compressor switching pattern , as described above . this control of the speed of the fans is continued for a subsequent period , i . e . for ten compressor switching cycles . during this time period , the compressor switching pattern is also monitored and determined , and during the subsequent period , the speed of the fans is controlled on the basis of this compressor switching pattern . fig4 is a graph illustrating total ventilation percentage of evaporator fans as a function of the temperature difference , t diff , between the temperature of return air , t return , and the set point temperature , t set . as described above , the total ventilation percentage represents the fraction of the total available ventilation speed of all of the fans , which is required during a specific time period . at low temperature difference , i . e . t diff smaller than 0 . 8 k , a low total ventilation percentage is required , and a total ventilation percentage of 12 . 5 % is therefore selected . at t diff = 1 . 4 k a total ventilation percentage of 50 % is required , and at t diff = 1 . 6 k and higher temperature differences , all of the fans must be operated at maximum speed , i . e . the total ventilation percentage must be 100 %. a linear interpolation is performed between these three fix points , and the resulting curve provides a correspondence between t diff and required total ventilation percentage for all values of t diff . 1 . 6 k is in this case a threshold value in the sense that the speed of the one or more fans is controlled in accordance with a ‘ normal mode ’, i . e . at full speed , when the temperature difference is higher than 1 . 6 k , and the speed of the one or more fans is controlled in accordance with a ‘ low capacity mode ’ when the temperature difference is lower than 1 . 6 k . in the ‘ low capacity mode ’ the total ventilation percentage is lower than 100 % indicating that at least one of the one or more fans is not operated at full speed . during operation of a refrigeration system , t return is measured , and t diff is calculated as t diff = t return − t set . the graph of fig4 is then used for determining a required total ventilation percentage , based on the calculated temperature difference . once the total ventilation percentage has been determined in this manner , a switching pattern for the fans can be selected , which ensures that the determined total ventilation percentage is obtained . a given total ventilation percentage can be obtained in a number of ways . for instance , a total ventilation percentage of 50 % can be obtained by switching half of the fans off , while operating the remaining fans at full speed . alternatively , all of the fans may be operated at full speed for half of the time , while being switched off for the remaining part of an operating period . in this case the on - time of the fans may be distributed substantially evenly across the operating period . the fans may be switched on / off simultaneously , or they may be switched on / off sequentially , thereby ensuring that at least one fan is switched on at any time . as another alternative , all of the fans may be operated at half the maximum speed during the entire period . as yet another alternative , any other suitable switching pattern may be selected . in any event , the switching pattern is selected on the basis of a determined compressor switching pattern , as described above . fig5 illustrates a switching pattern for an evaporator fan according to a first embodiment of the invention . the solid line represents the compressor switching pattern , as illustrated in fig3 , and the dotted line represents the switching pattern of an evaporator fan . in the embodiment illustrated in fig5 , the speed of the fan is controlled in the following manner . during the first compressor switching cycle , the fan is switched on at low speed when the compressor is switched on , and the fan is switched off when the compressor is switched off . during the next compressor switching cycle , the fan is also switched on at low speed when the compressor is switched on . however , when the compressor is switched off , the fan remains switched on , until the compressor is switched off during the subsequent switching cycle . this switching pattern for the fan continues . the lower graph illustrates fluctuations in t return relative to the set point temperature , t set , as a function of time , when the speed of the fans is controlled in accordance with the method illustrated in fig5 . it can be seen that t return only deviates from t set by ± 0 . 8 ° c ., i . e . the temperature inside the closed volume is maintained at an almost constant level . fig6 illustrates a switching pattern for an evaporator fan according to a second embodiment of the invention . the solid line represents the compressor switching pattern , as illustrated in fig3 , and the dotted line represents the switching pattern of an evaporator fan . in the embodiment illustrated in fig6 , the speed of the fan is controlled in the following manner . each time a new compressor switching cycle is commenced , i . e . each time the compressor is switched on , the fan is also switched on at low speed . however , when the compressor is switched off , the fan remains switched on for a little while before being switched off . the lower graph illustrates fluctuations in t return relative to the set point temperature , t set , as a function of time , when the speed of the fans is controlled in accordance with the method illustrated in fig6 . it can be seen that the fluctuations of t return in this case are even smaller than in the situation illustrated in fig5 , in that t return only deviates from t set by ± 0 . 4 ° c . fig7 illustrates temperature fluctuations as a function of time in a refrigerated closed volume when the refrigeration system is operated according to an embodiment of the invention , and when the refrigeration system is operated according to a prior art method of the kind in which it has been attempted to reduce the energy consumption of the refrigeration system . it is clear from fig7 that the temperature fluctuations of the prior art method are significantly larger than the temperature fluctuations of the method according to the invention . this is an advantage , since it is thereby possible to maintain the temperature in the closed volume within a very narrow temperature range , and the goods stored in the closed volume are thereby kept at a substantially constant ideal temperature . while the present invention has been illustrated and described with respect to a particular embodiment thereof , it should be appreciated by those of ordinary skill in the art that various modifications to this invention may be made without departing from the spirit and scope of the present . | 5 |
the multi - process electronic control valve system as disclosed herein provides at least three functions relating to the control and flow of fluids . these functions are pressure , flow , and fluid depth . although the embodiments are described with particular reference to an embodiment to be utilized with water wells , it is understood that the device of the present disclosure is readily adaptable to any fluid flow control application needing the functionality disclosed herein . therefore the examples of the multi - process electronic control valve system in this specification is meant to be exemplary only , and not meant to be limiting in any way . referring now to fig1 , a schematic diagram of a control valve system installed on a well according to aspects of the present disclosure is shown . the system 100 is installed onto a water well 102 or other fluid reservoir . the system 100 selectively controls a pressure output , a flow rate , and a well depth , as will be described herein . a water level 104 of the well 102 may be monitored and reported by a depth transducer 106 . an electrical signal indicating a depth of the water 104 or other fluid may be transmitted electronically on an electronic signal line 108 . this information is monitored and utilized by the control unit 110 . in the present disclosure , all transducer signal lines may be analog or digital depending upon the transducer employed . a pump 112 may be submerged in the well 102 or may be placed remotely therefrom . the pump 112 provides fluid under pressure to a valve assembly 200 that may be connected to a well output 114 . in some embodiments , the control unit 110 may also activate and deactivate the pump 112 by pump signal line 113 . the control unit 110 may connect to the valve assembly 200 by at least two signal lines . an open signal line 116 may provide a signal from control unit 110 to valve assembly 200 indicating to open or increase the opening of the valve assembly 200 . a close signal line 118 interconnecting the control unit 110 and the valve assembly 200 may provide for a signal indicating that the valve assembly 200 should be partially or fully closed . a flow transducer 120 may be provided on or near the output 114 for providing an electric signal on signal line 121 to the control unit 110 indicating the flow rate of the output 114 . a pressure transducer 122 may provide a signal on signal line 123 to the control unit 110 indicating a pressure at the output port 114 . it will be appreciated that the control unit 110 , having the combined signals from the depth transducer 106 , the flow transducer 120 , and the pressure transducer 122 may signal the valve assembly 200 to open or close in order to selectively control the depth , flow rate , or pressure of the output 114 . in the present embodiment , the control unit 110 provides for user selection of the monitoring and control function of the system 100 . in order to facilitate interaction with the user , the control unit 110 may provide various i / o devices , including a view screen 124 and a keypad 126 . via interaction with the system 100 , using the view screen 124 and keypad 126 , a user can control various modes of operation and parameters of the system 100 . referring now to fig2 , a diagram of a valve assembly 200 according to aspects of the present disclosure is shown . the valve assembly 200 interacts with the control unit 110 to open and close in response to signals therefrom . the valve assembly 200 may be able to open or close fully , as well as having a high degree of fine tuning and adjustability between the fully closed and fully open positions . a main valve 202 is provided that interposes the pump 112 and the output port 114 . in the present embodiment , the main valve 202 is a hydraulically operated diaphragm actuated and pilot controlled globe valve , but in other embodiments the valve could be victaulic , threaded , or another type of valve . in the present embodiment , the main valve 202 will close with an elastomer on metal seal . in the configuration of the present embodiment , shown in fig2 , the main valve 202 is interconnected with a needle valve 204 that controls the closing speed of the valve 202 . in order to control the amount of overshoot or hysteresis of the system 100 , the needle valve 204 may be set to a suitable speed to allow the main valve 202 to close with sufficient speed so as to be responsive , but also prevents it from closing so fast as to cause an undesirable amount of overshoot when closing the valve . in some embodiments , the needle valve 204 may be adjustable by the end user . some embodiments will provide an isolation ball valve 206 in series with the needle valve 204 . a strainer 208 may be provided to protect the components of the fluid circuit from contamination . a check valve 210 may also operate to prevent reverse flow through the needle valve circuit as well . in the present embodiment , the actual closing of the main valve 202 is controlled by an electric solenoid 212 . in the present embodiment , the solenoid 212 is a normally open electric solenoid pilot valve . the solenoid 212 may be electrically connected to the control unit 110 to receive signals therefrom and to close the main valve 202 in response . in order to affect an opening of the main valve 202 , a separate valve circuit is provided for a second solenoid 214 . the solenoid 214 in the present embodiment is a normally open electric solenoid pilot valve . in response to a signal from the control unit 110 , the solenoid 214 will open to cause the main valve 202 to open and thereby increase flow rate and pressure on the output port 114 . an isolation ball valve 216 is provided in parallel with the solenoid 214 . additional isolation ball valves 216 , 218 are provided in series . as on the closing side , the opening side provides a needle valve 220 that may be tuned in order to control the opening speed of the valve 202 . as before , the opening speed may be set to provide a requisite degree of responsiveness from the main valve 202 while being slow enough to prevent an undesirable amount of overshoot . a check valve 222 is provided in the circuit to prevent undesirable reverse flow of fluids through the fluid circuit . a strainer 224 aids in preventing contamination of the components . the present embodiment shown in fig2 provides a position transmission assembly 228 that interconnects with the main valve 202 . this allows the relative degree of opening or closing of the valve 202 to be provided back to the control unit 110 . in some embodiments , this information may be available to the user . in the present embodiment , the information provided by the position transmission assembly 228 is not necessarily needed by the control unit 110 . referring now to fig3 , a schematic diagram 300 of a valve control unit according to aspects of the present disclosure is shown . fig3 provides one possible way in which the control unit 300 can be constructed . it will be appreciated that the control unit 300 is an expansion or elaboration on the control unit 110 shown in figure 1 . the control unit 300 may be based around a microcontroller 302 . the microcontroller 302 may be an integrated circuit or a general purpose microprocessor that has been programmed according to the functionality described herein . the microcontroller 302 is provided to a power supply 301 and a ground source 304 . these may be based upon a battery system or may be a part of the commercial electric grid . a console 306 connects to the microcontroller 302 via data bus 307 . a video display 308 and a keypad 310 are provided to allow a user to interact with the microcontroller 302 . it can be seen that the microcontroller 302 provides open signal line 116 and closed signal line 118 to the respective pilot valves 214 , 212 . this enables the microcontroller 302 to affect the opening and closing of the main valve 202 . it is understood that a relay network may actually be provided by the open and closed signal lines 116 , 118 , if such are needed to effectively power and operate the solenoids 212 , 214 . the transducers for depth 106 , flow 120 , and pressure 122 may provide their data on signal lines 108 , 121 and 123 , respectively . these may be read by the microcontroller 302 . it is understood that various signal conditioning and / or analog to digital conversion may take place between the microcontroller 302 and the various transducers . in operation , a user will interact with the microcontroller 302 using the keypad 310 and the display screen 308 . at this point , a user may indicate to the microcontroller 302 which of the selective operations is desired . operations available to the user may include , but are not limited to : operating the pump 112 and / or valve assembly 200 to maintain a desired fluid level 104 in the well 102 ; maintaining a specified pressure ; and maintaining a specified flow rate . it will be appreciated that , in some instances , more than one of these functions may be controlled at a time . however , in other cases owing to limitations of water supply and pressure , it may only be possible to control one of the desired parameters based upon a selection from the user . for example , if the well has plenty of water , the amount of pressure may be the most critical due to limitations of the downstream irrigation system . in other cases , the amount of water flow required ( e . g ., for crops ) may take precedent over the pressure being generated . referring now to fig4 , a flow diagram of one method of operation of the valve control system 100 of the present disclosure is shown . at step 402 , it may be determined whether the system has been set on rain hold . if the system has been set on rain hold , this would indicate that the user did not desire for the control unit 110 to do anything . in this case , the control program may end ( or restart ) and continue querying at step 402 until such time as the rain hold has been released . if at step 402 there is no rain hold , at step 404 the determination may be made by the control unit as to whether the pressure monitoring function has been selected by the user . if so , at step 406 a reading may be taken of the pressure transducer 122 in order to determine whether or not the desired pressure has already been achieved . if the desired pressure has not been achieved , the valve may be adjusted at step 408 and the pressure checked again at step 406 . through iterations of adjusting the valve 408 , it can be determined when the pressure is within the desired threshold at step 406 . once the desired pressure has been achieved , the control loop will end or repeat until a different parameter is selected or until the rain hold is re - engaged . it will be appreciated that the step of adjusting the valve 408 may include signaling the valve 202 to open further , or close further , depending on the reading from the appropriate transducer . it may also require several steps of adjusting in order to achieve the desired flow rate or pressure . if the pressure monitor function has not been selected at step 404 , it may be determined at step 410 whether the flow monitor function has been selected . if so , the flow transducer 120 may be checked or queried at step 412 to determine if the flow rate is within the specified range . if not , the valve may be adjusted at step 414 . the flow rate may be again checked at step 412 and the adjustment and checking process repeated until the flow rate is within the desired parameters . at this point , the controller terminates or continues monitoring or waiting for an additional command . if at step 410 the flow monitor function has not been selected , this indicates that the depth control function has been selected by the user . at step 416 , a depth reading may be taken by the depth transducer 106 . depending upon the signal return from the depth transducer 106 , the valve may be adjusted at step 418 . it will be appreciated that changes in depth may occur much more slowly than changes in flow rate or pressure . therefore , it may be desirable to limit the amount of valve adjustment that can occur at step 418 . it is also understood that the valve assembly 200 cannot be opened beyond full capacity . thus , the query at step 412 may also include an accounting of the position of the main valve 202 . if at step 416 the depth 104 has fallen below the specified parameter indicating that the valve assembly 200 should be closed off , the control loop simply waits for further additional commands , as there is no further need to adjust the valve at step 418 . thus , the present invention is well adapted to carry out the objectives and attain the ends and advantages mentioned above as well as those inherent therein . while presently preferred embodiments have been described for purposes of this disclosure , numerous changes and modifications will be apparent to those of ordinary skill in the art . such changes and modifications are encompassed within the spirit of this invention as defined by the claims . | 8 |
minick at al , 7 , 11 used a mc - 8 column , coupled with the addition of 1 - octanol to both components of the eluent , together with the addition of small amounts of n - decylamine in the aqueous phase . supelcosil columns such as supelcosil abz / abz + and discovery rp - amide 16 also known as embedded amide functional group columns do not require a modifier such as n - decylamine . octanol was useful to reproduce the intermolecular interactions experienced by a solute in a classical “ shake - vial ” octanol / buffer partition determination , while reducing the retention times . this invention “ combines ” the column used by pagliara et al ., 6 with the conditions used by minick et al , 7 with the exception of the use of n - decylamine , and extends its application to a set of diverse drug - like compounds . we also used an appropriate flow rate for each type of lipophilicity . the value generated by this method is referred to as elogpo oct . the data obtained for an initial set of 27 compounds , in the absence or presence of octanol , pointed to a clear difference in performance , as shown by fig1 and 2 , and by their respective equations . the compounds used are the first 27 compounds reported in table 1 . the data used in fig1 were generated using only methanol and morpholino propane sulfonic acid ( mops ) buffer as the mobile phase , as opposed to fig2 where octanol was added to methanol , and octanol - saturated water was used to prepare the buffer . different columns were used for these runs , but the inter - column variability was checked ( data not shown ), and an excellent correlation was obtained for the three different columns . in one case , the same column was tested initially and after 4 months of intensive use , with significant difference . this established that the difference in performance was due to the addition of octanol to both components of the mobile phase , and not by potential differences in the column packing . fig1 and 2 clearly bring out the significant difference between the addition of 1 - octanol to the mobile phase ( both components ), with respect to the data generated in its absence . in both cases the slope is close to unity , but the error is more than doubled in the absence of 1 - octanol as expressed by eq . 1 and eq . 2 . in both cases a range of 6 logp oct units is encompassed by these experiments . n = 27 , r 2 = 0 . 835 , r = 0 . 914 , s = 0 . 556 , f = 126 , q 2 = 0 . 808 ( eq . 1 ) n = 27 , r 2 = 0 . 970 , r = 0 . 985 , s = 0 . 238 , f = 803 , q 2 = 0 . 965 ( eq . 2 ) the question of the value of the slope has been stressed by minick et al . 11 pointing to the work of melander et al ., 12 these authors state that “ . . . equations correlating log k ′ w and logp oct data represent linear free energy relationships in which the slope is an estimate of how closely the free energies of the processes compare .” a slope close to unity implies that the two processes are homoenergetic , i . e . the free energy changes are the same . in the present case , a slope very close to unity was obtained with or without 1 - octanol . furthermore , a larger slope would result in the magnification of any error in the determination of log k ′ w if the estimation of logp oct was the final goal . the log k ′ w data could be used as a self - consistent scale of lipophilicity and , in this case , the second consideration would not be very important . an example might be represented by the work of valko et al ., 13 which describes a chromatographic hydrophobicity index ( chi ), obtained via a gradient run . in this case a correlation with a “ classical ” shake flask logp oct was not necessarily sought , and a self - consistent chi scale was established . however , logp oct ( or logd oct ) data are so widely used in many correlations by the medicinal chemistry community , that a “ classical ” logp oct value is likely to be desired . the correlation was expanded by adding more drug compounds , aiming at expanding the physicochemical diversity of the set . nine more compounds were added as reported in table 1 . at the same time an analysis of the data and the column performance , via the well - known salvation parameters of abraham 14 - 15 , was performed to answer the question of closeness between the classical shake flask logp oct values , and rp - hplc derived values , beyond what could be surmised by a slope close to unity . first , eq . 3 shows that the correlation is excellent , and the predictive power of the method , expressed by the q 2 value , is also very good . fig3 shows graphically the correlation between the shake - flask and the rp - hplc data . also the slope shown by eq . 3 is very similar to the slope in eq . 2 , further demonstrating the accuracy of the method , and yielding an indirect assessment of its robustness in predicting unknown compounds . the cross - validated coefficient of determination , or q 2 value , shows the excellent predictive power of this method . the correlation was obtained by averaging the values obtained , for each compound , using three different columns . n = 36 , r 2 = 0 . 977 , r = 0 . 988 , s = 0 . 251 , f = 1434 , q 2 = 0 . 974 ( eq . 3 ) furthermore it is worth noting that a plot of residuals vs . the logp oct values , as in fig4 shows that the error distribution is very consistent across the entire range , and no curvature ( larger error ) is observed at extreme values . this is important because it shows that similarly accurate determinations can be obtained across 6 logp oct units . as a further measure for a day - to - day system suitability check , we used control charts , as shown in fig5 for nifuroxime , constructed for ten compounds suitably chosen across the entire range . an unexpected variation in these plots would immediately “ flag ” questionable results . the values obtained via eqn . 3 were designated as elogp oct , and referred to them as such in this document . an analysis of the balance of forces underlying these phenomena , using a linear free energy relationship , based on salvation parameters was conducted , as described by abraham . 14 - 15 in these equations r is the excess molar refraction , π 2 h is the dipolarity / polarizability , σα 2 h and σβ 2 0 are the ( summation ) hydrogen bond acidity and basicity , respectively , and v x is the mcgowan &# 39 ; s volume . in particular the superscript “ 0 ”, used for the hydrogen - bonding basicity parameter , refers to a particular scale of values , useful for certain types of solutes , when the organic portion of the binary system is a partially miscible solvent , as in the case of water - saturated octanol . the other subscripts and superscripts have the usual meaning , i . e . they refer to hydrogen bonding scales and to the solute . 5 the calculated parameters are reported in table 2 , and the coefficients for the respective equations ( eq . 4 and 5 ), whether log k ′ w or elogp oct values are used , are close ( for log k ′ w ) or essentially identical ( for elogp oct ) to the coefficients of the equation based on shake - flask logp oct values ( eq . 6 ), as reported by abraham , for 613 solutes . 15 however , the ratios of coefficients , normalized to the v x coefficient , are essentially identical for all three equations ( data not shown ). we conclude that the elogp oct values , obtained using the method presented here , and expressed by eq . 3 , are identical to shake - flask values , but they can be generated at a much higher throughput , and combine ease of operation with a wide dynamic range . due to lack of other partition data , and perhaps to a difficulty brought about by a possible push - pull effect in the case of nifuroxime , we were not able to obtained accurate parameters for this compound and 6 - mercaptopurine , and these two solutes were excluded from the correlation . logk ′ w = 0 . 062 + 0 . 409 r 2 − 0 . 955π 2 h − 0 . 040α 2 h − 3 . 092σβ 2 0 + 3 . 485 v x n = 34 , r 2 = 0 . 980 , r = 0 . 989 , s = 0 . 225 , f = 276 , q 2 = 0 . 967 ( eq . 4 ) elogp oct = 0 . 199 + 0 . 452 r 2 − 1 . 053π 2 h − 0 . 044σα 2 h − 3 . 411σ 2 0 β + 3 . 843 v x n = 34 , r 2 = 0 . 980 , r = 0 . 989 , s = 0 . 248 , f = 276 , q 2 = 0 . 967 ( eq . 5 ) logp oct = 0 . 088 + 0 . 562 r 2 − 1 . 054π 2 h − 0 . 034σα 2 h − 3 . 460σβ 2 0 + 3 . 814 v x n = 613 , r 2 = 0 . 995 , r = 0 . 997 , s = 0 . 116 , f = 23162 ( eq . 6 ) as a further improvement , the calculation procedure was automated through in - house software to obtain the final elogp oct value , without any manual intervention from the chromatographic data file . this modification allows for an enhanced throughput , starting with an already rapid procedure . elogp oct data for any compound are obtained , on average , in 20 minutes or less , on a single instrument . the current method is , at the moment , limited to neutral or weakly acidic or basic compounds , but it covers the practical limitation involved in the determination of compounds which are devoid of any significant ionization , within a reasonable range of ph , and thus are not amenable to a logp oct determination via well - known potentiometric techniques . 16 by a judicious choice of mobile phase and rp - hplc column , a very accurate logp oct determination method has been developed , which is characterized by rapid throughput , ruggedness and minimal manual intervention set forth in the introduction , for drug - like compounds . since logp oct has been shown to be an important parameter for the adme profiling of new chemical entities , 3 such as estimation of solubility , intestinal permeability and clearance , this method is useful for applications in pharmaceutical discovery and development settings . materials and methods . all the solutes were purchased directly from commercial sources ( aldrich , sigma and fluka ) and used as received . fluconazole was obtained internally . de - ionized water , hplc grade methanol ( j . p . baker ) and 1 - octanol ( fisher scientific ) were used throughout . the mobile phase consisted , in all cases , of 20 mm mops buffer at ph 7 . 4 , and methanol in varying proportions from 70 to 15 % v / v . a 0 . 25 % ( v / v ) amount of octanol was added to methanol , and octanol - saturated water was used to prepare the buffer , with the exception of the correlation obtained without octanol in either component of the mobile phase ( vide infra ). the capacity factors data ( k ′=( t r − t 0 )/ t 0 ) obtained at various amounts of methanol were then extrapolated to 0 % methanol and reported as log k ′ w , using a linear procedure . in all cases , except for allopurinol ( r 2 = 0 . 96 ) the coefficient of squared correlation was = 0 . 99 . injections of pure methanol were used to determine t 0 , i . e . the dead time , while t r has the usual meaning of the retention time for the analyte . all the chromatographic runs were performed on a hp - 1100 hplc chemstation at the ambient temperature . the columns used were supelcosil lc - abz , 5μm , 4 . 6 × 50 mm . a diode array detector was used to monitor signals at 235 , 255 , 265 and 275 nm . columns having different silica bond lots were tested to ensure reproducibility . samples were dissolved in 1 : 1 methanol / water at a concentration of 10 - 30 μg / ml . the flow rate was 0 . 5 , 1 or 2 ml / min , depending on the lipophilicity range . three lipophilicity ranges were established using , in all cases , three points for the extrapolation to k ′ w , as described in the table below . the samples were placed in the appropriate range by estimating their lipophilicity via computed values , or by prior experience with a given class . in each case the entire group of samples was run before the column is equilibrated to the next condition , in an automated fashion , and the initial estimation need not be very accurate . the data analysis was automated via in - house software yielding the elogp oct values , directly from the chromatographic data files . the shake - flask logp oct data were taken from the literature or determined in - house , except when data were not available or could not be determined experimentally due to the high lipophilicity of the compound . in such cases a computed value was used . the shake - vial experimental measurements performed in - house were all conducted at least in duplicate , in amber glass vials and , in some cases , with varying ratios of octanol and mops buffer , mutually pre - saturated prior to the experiment . overnight shaking was used . hplc analysis at different wavelengths , after centrifugation and separation of the phases , was used for the quantitative analysis , using both phases . all regression analyses were performed via the jmp software ( v . 3 . 2 . 1 , sas institute , sas campus drive , cary , n . c . 27513 ). ten compounds were selected across the set of 36 compounds , covering the entire range of lipophilicity , to monitor the day - to - day performance of the method . statistical calculations showed that the use of the 10 compounds would assure that the estimated slope , in the final regression equation , would be within ± 0 . 09 of true one . the jmp software was also used for the quality monitoring . data accumulated for the standard set of compounds , and regularly plotted on the control charts , constitute a powerful method for the detection of trends and variations in performance . variations in log k w values , for the selected compounds , should not exceed ± 3 k s , where k s is the standard deviation estimate based on data collected under well controlled experiments . a control chart for nifuroxime is shown in fig5 . | 6 |
referring to the drawing , the inventive data selective circuit comprises an inverting section and a non - inverting section . the inverting section comprises transistors 4 , 6 , 8 , 10 , 12 , and 14 , diodes 16 , 18 , 20 , and 22 , and resistors 24 , 26 , 28 , 30 , and 32 . the non - inverting section comprises transistors 34 , 36 , 38 , 40 , 42 , 44 , and 46 , diodes 48 , 50 , 52 , and 72 , and resistors 54 , 56 , 58 , 60 , 62 , and 64 . referring first to the inverting section , an input voltage ( v in ) appearing at terminal 2 is applied to the base of an input pnp transistor whose emitter is coupled via resistor 24 to a source of supply voltage ( v cc ) appearing at terminal 66 . the emitter of transistor 4 is also coupled to the anode of schottky diode 18 and to the base schottky transistor 6 . the collector of transistor 6 is coupled via resistor 26 to the source of supply v cc , and the emitter of transistor 6 is coupled to the base of schottky transistor 8 , the anode of schottky diode 20 , and to the anode of schottky diode 16 . the cathode of schottky diode 16 is coupled to the base of transistor 4 . the collector of transistor 8 is coupled to the base of schottky transistor 10 , to the cathode of schottky diode 22 , and , via resistor 28 , to the source of supply voltage v cc . the emitter of transistor 8 is coupled to the base of schottky transistor 14 and , via resistor 30 , to ground . the emitter of transistor 10 is coupled to the base of npn transistor 12 and , via resistor 32 , to the anode of schottky diode 22 and to the junction of the emitter of transistor 12 and the collector of schottky transistor 14 which is in common with output terminal 68 at which the inverted output ( v out ) appears . the collectors of both transistors 10 and 12 are coupled to the source of supply voltage v cc while the emitter of transistor 14 is coupled to ground . transistor 4 may be referred to as an input transistor while schottky transistor 6 is a buffer transistor . transistor 8 is a phase splitter transistor and transistors 10 , 12 and 14 are included in what may be referred to as a push - pull output stage . the non - inverting portion of the circuit includes an input pnp transistor 34 , a buffer transistor 36 , an inverting transistor 38 , a phase splitter transistor 40 and an output push - pull stage including transistors 42 , 44 and 46 . the input signal v in appearing at terminal 2 is applied to the base of input transistor 34 . the emitter of transistor 34 is coupled to the base of schottky transistor 36 and , via resistor 54 , to the source of supply voltage v cc . the collector of schottky transistor 36 is coupled , via resistor 56 , to v cc , and the emitter of transistor 36 is coupled to the base of schottky transistor 38 and to the anode of schottky diode 48 . the cathode of diode 48 is coupled to the base of transistor 34 . the collector of transistor 38 is coupled to the base of schottky transistor 40 and , via resistor 58 , to v cc while the emitter of transistor 38 is coupled via diode 50 to ground . the collector of transistor 40 is coupled to the base of schottky transistor 42 , the cathode of schottky diode 52 and , via resistor 60 , to v cc . the emitter of transistor 40 is coupled to the base of schottky transistor 46 and , via resistor 62 , to ground . the emitter of transistor 42 is coupled to the base of npn transistor 44 and , via resistor 64 , to the anode of schottky diode 52 and to the junction of the emitter of transistor 44 and the collector of schottky transistor 46 which junction is in common with the non - inverting output terminal 70 ( v out ). the collector terminals of transistors 42 and 44 are coupled to v cc while the emitter terminal of transistor 46 is coupled to ground . the inventive selector circuit shown in the drawing operates as follows . with a low voltage at terminal 2 ( v in is a logical &# 34 ; zero &# 34 ;) input transistor 4 is rendered conductive which in turn renders transistor 6 nonconductive . since no base drive is being supplied to transistor 8 , transistor 8 remains off causing transistors 10 and 12 to be rendered conductive . with transistor 8 off , no base drive is supplied to transistor 14 keeping it off . thus , the voltage at terminal 68 ( v out ) will go high ; i . e . v out becomes a logical &# 34 ; one &# 34 ;. since a low voltage exists at input terminal 2 , transistor 34 will become conductive causing transistor 36 to be rendered nonconductive so as not to supply base drive to transistor 38 to turn it on . with transistor 38 off , transistor 40 is turned on causing base drive to be diverted from transistor 42 and supplied to the base of transistor 46 turning transistor 46 on . with transistor 42 turned off , transistor 44 is likewise off and thus the voltage at output terminal 70 ( v out ) will go low ; i . e . v out becomes a logical &# 34 ; zero &# 34 ;. when v in at terminal 2 switches from a low to a high ( i . e . from a logical zero to a logical one ) both input transistors 4 and 34 will begin to turn off . ignoring schottky diodes 18 and 20 for the time being , schottky transistor 6 will begin to turn on when input transistor 4 turns off . when transistor 6 is sufficiently on , there will be sufficient base drive to transistor 8 likewise turning it on . this will cause transistor 14 to become conductive and transistors 10 and 12 to become nonconductive casing output terminal 68 to go low ; i . e . v out becomes a logical zero . in response to transistor 34 turning off , transistor 36 will turn on supplying base drive to transistor 38 . when transistor 38 turns on , transistor 40 will turn off removing base drive from transistor 46 and supplying base drive to transistor 42 . thus , transistor 46 turns off and transistor 44 turns on causing the output voltage v out at terminal 70 to go high ; i . e . v out becomes a logical &# 34 ; one &# 34 ;. as can be seen , the non - inverting portion of the circuit includes one additional inverting stage when compared to the inverting portion of the circuit . thus , when the input voltage switches from a logical zero to a logical one , the inverting output terminal 68 may be driven low prior to the non - inverting output 70 being driven high . thus , for some period of time , both outputs v out and v out would be low . to avoid this , a schottky diode 18 is placed between the base of transistor 6 in the inverting portion of the circuit and the junction of the emitter of transistor 44 and the collector of transistor 46 in a noninverting portion of the circuit . thus , when the input voltage v in goes from a low to a high causing transistor 4 to turn off , schottky diode 18 diverts base drive from transistor 6 causing transistor 6 to remain off which in turn causes transistors 8 and 14 to remain off . thus , the voltage at terminal 68 remains high . when the collector of transistor 46 reaches the threshold for transistors 6 , 8 and 14 due to the input voltage switching from a low to high level , schottky diodes 18 and 20 become reverse biased . thus , base drive is supplied to transistor 6 turning it on . once transistor 6 is turned on , base drive is applied to transistor 8 turning it on which in turn causes transistor 14 to become conductive and output terminal 68 to go low . as can be seen , output terminal 68 cannot go low until output terminal 70 reaches a high enough level thus avoiding the problem of dual deselection . schottky diode 20 serves merely to divert current which may be coupled via diode 16 into the base of transistor 8 during the low - to - high transition at terminal 2 . schottky diodes 16 and 48 are placed between the base of transistors 8 and 38 respectively and transistors 4 and 34 respectively for the purpose of removing charge when the input voltage at terminal 2 goes low . resistors 30 and 62 provide base charge removal paths for transistors 14 and 46 respectively . resistor 32 in conjunction with schottky diode 22 provides a means for removing charges from the base of transistor 12 while resistor 64 in conjunction with diode 52 provides a charge removal path for transistor 44 . furthermore , since the anodes of diodes 22 and 52 are coupled to output terminals 68 and 70 respectively , diodes 22 and 52 provides means for discharging capacitive loads . finally , resistors 24 , 26 , 28 , 54 , 56 , 58 , and 60 are merely bias resistors to set appropriate current levels . diode 72 assures that the voltae v in at terminal 2 does not fall significantly below ground . the above description is given by way of example only . changes of form and details may be made by one skilled in the art without the parting from the scope of the invention . for example , reference has been made throughout the specification of schottky diodes and schottky transistors . it would be clear to one skilled in the art that such devices may be replaced by traditional diodes and transistors and still yield an operative circuit . | 7 |
embodiments of the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which certain embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided by way of example so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . furthermore , like numbers refer to like elements throughout . fig1 shows a schematic diagram of an exemplary communications system 100 in which the disclosed embodiments may be applied . the communications system 100 comprises a number of communication devices 102 , 104 , 106 , 110 , 112 , 114 which may or may not be able to communicate with each other . a method in which a first communication device 102 , hereinafter denoted as a sender device 102 , wishes to establish a connection with a second communication device 104 , hereinafter denoted as a receiver device 104 , will be described below . it should be understood that the communication device 102 , is not limited to be a sender device only , it may alternatively be a receiver device or take the role of both a sender device and a receiver device in the communications system 100 . similarly the communication device 104 , is not limited to be a receiver device only , it may alternatively be a sender device or take the role of both a receiver device and a sender device in the communications system 100 . that is , any communication device within the communication system 100 may include both sender and receiver capability . the sender or receiver devices may also act as a third party device . the functionality of the third party device will be further described below . however , it should be noted that when communications is to be established between a sender device 102 and a receiver device 104 , neither the sender device 102 nor the receiver device 104 may act as a third device in the process of establishing communications between the devices 102 and 104 . in the following it will be assumed that at least part of the system 100 is in a state of operation . when the communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 are connected to the system 100 each communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 may create a unique identification , or identity , to be used in future communications in order to identify said communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 , it should be noted that the unique identity defined by the identification may not be validated by any other communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 in the system 100 . the unique identity is accepted by other devices in the system 100 when a relation , that is , communication , is established . the unique identity is thus used for matching purposes and may not have controlling authority . moreover , as will be explained below , even if a unique identity of a first device in the system 100 is copied by a second device in the system 100 , or alternatively that the identity of the first device is identical to the identity of the second device by chance , this will not affect the process of establishing a digital relation between two devices in the system 100 . typically such a unique identity may take the form of a sequence of random binary or integer numbers . the longer the sequence the higher the probability of generating a sequence that is unique for each communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 . the unique identity may alternatively , or additionally , be associated with a serial number of the communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 . a communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 which is able to communicate with other communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 is thus associated with a digital identity . the digital identity may also be associated with a number of references . a reference of a digital identity may pertain to the collated information provided by other communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 regarding the communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 associated with said digital identity . references will be further discussed below . in an initial step the sender device 102 creates an identification of the sender device 102 and the receiver device 104 creates an identification of the receiver device 104 . typically , the communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 may need to create an identification only once . each communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 may keep track of each established communication e . g . by means of associating each established communication with a sequence number . the sequence number is associated with the communication device to which a communication was established . in fig1 solid lines 116 , 118 , 120 , 122 , 124 , 126 , 130 between two communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 represents that communication has previously been established between the two communication devices at each end of the solid line 116 , 118 , 120 , 122 , 124 , 126 , 128 , 130 . for example , assume that the receiver device 104 has previously established communication with the communication devices 106 , 110 , 112 as indicated by the solid lines 130 , 122 , 124 in fig1 . as indicated by the dashed line 132 communications is to be established between the sender device 102 and the receiver device 104 . assume further that the relative order in which communication was established from the receiver device 104 to the communication devices 106 , 110 , 112 was established in the order 106 , 112 , 110 . that is , communication was established from the receiver device 104 to the communication device 112 before communication was established from the receiver device 104 to the communication device 110 and after communication was established from the receiver device 104 to the communication device 106 . all sequence numbers of a communication device may be associated with a list of sequence numbers . this list is preferably stored in the communication device . denote by l 104 the list of sequence numbers for receiver device 104 . denote further identification information of communication device 108 as interpreted by the sender device 104 as id ( 104 , 106 ) and similarly id ( 104 , 110 ) and id ( 104 , 112 ) for communication devices 110 and 112 , respectively . the sequence number for an established communications from a first communication device to a second communication device may further comprise a number representing the relative order in which the communication was established from the second device to the first device . assume that communication device 110 established communications with the devices 104 , 112 , 114 in the order 112 , 104 , 114 . that is , in this exemplary scenario communication from the communication device 110 to the sender device 104 was the second ( 2nd ) established communication from the communication device 110 . similarly , assume that for in this example communications from the third device 106 to the receiver device 104 was the third ( 3rd ) communication established from the third device 106 ; assume that for in this example communications from the communication device 112 to the receiver device 104 was the fifth ( 5th ) communications established from the third device 112 . in this exemplary scenario the list l ( 104 ) of sequence numbers of the receiver device 104 may thus have the form : thus , utilizing such lists of sequence numbers comprised in the communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 allows for two or more communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 to be associated with the same unique identity without producing conflicting statements in the communications system 100 . assuming that the sender device 102 wishes to establish a communication with the receiver device 104 , as indicated by the dashed line 132 in fig1 , the sender device 102 sends a request pertaining to establishing a relation between the sender device 102 and the receiver device 104 to said receiver device 104 . the receiver device 104 then sends at least an identification of a second master device 154 to the sender device 102 . when receiving the identification of the second master device 154 the sender device 102 forwards the identification of the second master 154 device to a first master device 152 . the first master device 152 and the second master device 154 may be viewed as digital notaries . a digital notary may be a company , agency or authority , or the like which may act as notary in digital communications systems and networks . as such the digital notary may provide certified digital witnesses . digital witnesses will be further disclosed below . the digital notary may also provide archive and / or functionalities and / or means . it may be required that the master devices 152 and 154 are certified by an organization , see below . the first master device 152 then sends a request pertaining to communication conditions to the second master device 154 , which conditions according to the second master device 154 need to be fulfilled in order for the sender device 102 to establish communication with the receiver device 104 . the communication conditions may be associated with a set of values which may pertain to security issues and identification issues . for example the identification issues may relate to communication policies , such as communication protocols , utilized between the sender device 102 and the receiver device 104 . it should be noted that the first master device 152 does not need to communicate an identity of the sender device 102 to the second master device 154 . the second master device 154 then sends the communication conditions to the first master device 152 . in case the sender device 102 fulfills the communication conditions , the first master device 152 may acknowledge to the second master device 154 that the communication conditions are fulfilled . similarly the first master device may communicate communication conditions to the second master device 154 , which need to be fulfilled by the receiver device 104 , to establish communication with the sender device 102 . a first access key may then be provided by the sender device 102 to the first master device 152 , and a second access key may be provided by the receiver device 104 to the second master device 154 . thus by utilizing such access keys access rights may be enabled . communication pertaining to the sender device 102 and the receiver device 104 may then be enabled between the first master device 152 and the second master device 154 . by utilizing the first master device 152 and the second master device 154 authentication of the sender device 102 and the receiver device 104 may be achieved . the request sent from the sender device 102 to the receiver device 104 pertaining to establishing a relation between the sender device 102 and the receiver device 104 may comprises at least an identification of a first group of devices 106 , 108 . the first group of devices 106 , 108 is a group of devices with which the sender device 102 has previously established a communication . in this case the disclosed method may continue as follows . the request is received by the receiver device 104 . in response to the request the receiver device 104 analyses the identities of the devices comprised in the first group of devices 106 , 108 and compares the identities to an intermediate group of devices 106 , 110 , 112 to which the receiver device has previously established a communication with . the receiver device 104 then sends at least an identification of a second group of devices to the sender device 102 . the second group of devices comprises the device ( s ) 106 which are comprised in both the first group of devices and the intermediate group of devices . that is , the second group comprises devices ( s ) 106 which are common and known by both the sender device and the receiver device , or in other words , devices with which both the sender device 102 and the receiver device 104 have previously established a connection . that is , the second group may be represented by an empty set if the sender device 102 and the receiver device 104 have no common communication devices to which they both have previously established a communication . the identification of the second group is then received by the sender device 102 . in a case there exists at least one common device , hereinafter denoted as a third device 106 , in the first group and said second group of devices , the establishment of a communication between the sender device and the receiver continues as follows . the sender device 102 requests a reference from at least one of the common third device ( s ) 106 regarding the receiver device 104 . references have briefly been discussed above . a reference may be based on a hash value . hash values per se are known in the art and will thus not be further described in this disclosure . the reference may also be based on a set of statements , wherein the statements may inter alia pertain to contact information , such as a name and / or an address , of a user of the device of which the reference is associated with . for example , if the reference is associated with the receiver device 104 the reference may comprise a name and / or an address of the receiver device 104 and / or a user of the receiver device 104 . the reference may be comprised in an xml document . further , a reference may be associated with a sender and a recipient . thus , in other words a reference may be said to be signed ( by a sender ) towards a recipient , wherein the signature which is used to sign the reference then advantageously comprise identification of the recipient device . optionally , when the reference is transmitted from a first device to a second device , for example from the receiver device 104 to the sender device 102 , the reference may be encrypted , which may have the general effect of increasing confidentiality and security of the transmission , and in particular increasing confidentiality and security of the transmission of the reference . the sender device 102 requests a reference of the receiver device 104 from the third device 106 , wherein the reference sent from the third device 106 is addressed to and associated with the sender device 102 , and wherein the sent message comprising the reference may be encrypted by the third device 106 such that only the sender device 102 may decrypt the message part comprising the reference . the sender device 102 may for example request information pertaining to identification of the receiver device 104 as performed by the third device 106 . that is , the third device 106 may perform identification of the receiver device 104 by comparing references or reference values . the reference values may be hash values . the reference values may alternative be sequence numbers . the reference may alternative be identity information received from the sender device . the references or reference values may be a combination of hash values , sequence numbers and identity information . the third device 106 may thus be viewed as a trusted third part . the information pertaining to identification of the receiver device 104 may be associated with a previously established communication between the receiver device 104 and the third device 106 . when the sender device 102 receives the reference from the third device 106 , which reference has been sent from the third device 106 to the sender device 102 via the receiver device 104 , the sender device 102 may verify the reference by comparing information comprised in the reference with previously stored information associated with the third device 106 , such as a sequence number associated with previous communication between the sender device 102 and the third device 106 . if the message part comprising the reference has been encrypted by the third device 106 the sender device 102 may first need to decrypt the message . the reference may also be associated with the sender device 102 by incorporating an address field in the reference and to add the identity of the sender device 102 in the address field . this adds security to the process since the sender device 102 may ensure that the information delivered to the third device 102 is associated with the sender device 102 although the request is sent from the sender device 102 to the receiver device 104 and not from the sender device 102 directly to the third device 106 . that is , the reference request is received by the receiver device 104 , which receiver device 104 then forwards the reference request to the third device 106 . the third device 106 thus receives the reference request regarding the receiver device 104 from the receiver device 104 . the third device 106 then sends the reference to the receiver device 104 . the receiver device 106 thus receives the reference and sends the reference to the sender device 102 , which receives and verifies the reference . the sender device 102 may then create a first public encryption key for establishing communication from the sender device 102 to the receiver device 104 . the sender device 102 then encrypts the received reference with the created first public encryption key . further , the sender device 102 encrypts the created first public encryption key using an additional public encryption key , wherein the additional public encryption key is associated with the previously established communication between the sender device 102 and the third device 106 . the encrypted first public encryption key and the encrypted received reference are then sent from the sender device 102 to the receiver device 104 . the receiver device 104 thus has no knowledge of the first public encryption key as created by the sender device 102 . in addition the receiver device 104 has no knowledge of the additional public encryption key associated with the previously established communication between the sender device 102 and the third device 106 . hence the receiver device 104 is neither able to decrypt the encrypted first public encryption key nor the encrypted received reference . in order for the receiver device 104 to validate the information pertaining to the previously established communication between the receiver device 104 and the third device 106 comprised in the encrypted reference the receiver device 104 forwards the encrypted first public encryption key to the third device 106 . this message sent from the receiver device 104 to the third device 106 further comprises a request pertaining to decryption of the encrypted first public encryption key . since the first public encryption key has been encrypted with the additional public encryption key which , as stated above , is associated with the previously established communication between the sender device 102 and the third device 106 , the third device 106 is able to decrypt the encrypted first public encryption key . the decrypted first public encryption key can then be sent back from the third device 106 to the receiver device 104 . for added security the third device 106 may encrypt the decrypted first public encryption key using a further public encryption key using an additional public encryption key , wherein the additional public encryption key is associated with the previously established communication between the third device 106 and the receiver device 104 . since the receiver device 104 knows the further public encryption key which has been used to encrypt the first public encryption key the receiver device 104 may thus decrypt the , received encrypted first public encryption key after reception . using the decrypted first public encryption key the receiver device 104 may thus decrypt the previously received encrypted reference pertaining to the previously established communication between the receiver device 104 and the third device 106 . the receiver device 104 may then validate the contents of the reference . that is , by comparing information comprised in the reference to information , such as sequence numbers , comprised in the receiver device 104 , the receiver device 104 is able to verify that information comprised in reference is correct and indeed pertains to the previously established communication between the receiver device 104 and the third device 106 . if the reference comprises a hash value ( as described above ) the receiver device 104 may calculate the hash value of the first public encryption key . the receiver device 104 may then perform a comparison between this calculated hash value and the hash value comprised in the reference in order to verify that the reference has not been altered during the transmission from the third device 106 to the sender device 102 via the receiver device 104 , or from third device 106 to the receiver device 104 . an established communication between a sender device 102 and a receiver device 104 may be said to define a digital contract . a digital contract may thus pertain to a digital relationship between two or more communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 , wherein the contract may comprise information pertaining to digital signatures and / or digital witnesses ( as will be further disclosed below ). a digital contract thus created may be utilized to identify the communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 when the communication device 102 , 104 , 106 , 108 , 110 , 112 , 114 interacts , or communicates , with other communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 . digital contracts may be utilized for authentication , access rights and / or for signature purposes . digital contracts may therefore be used to retrieve references . fig2 shows a schematic diagram of a communications system 200 in which the invention may apply . as in the communications system 100 of fig1 , the communications system 200 comprises a number of communication devices 102 , 104 , 202 , 204 , 206 , 208 , 210 which may or may not be able to communicate with each other . in the following it will be assumed that the system 200 is in a state of operation and that communications is to be established between a sender device 102 and a receiver device 104 , as indicated by the dashed line 224 . as for the method disclosed above with reference to the communications system 100 of fig1 , a first device 102 , denoted a sender device , wishes to establish a communication with a second device 104 , denoted a receiver device , in the communications system 200 . in the exemplary scenario of fig2 the sender device 102 is associated with communication devices 202 and 208 . that is , the sender device 102 has previously established communication with communication devices 202 and 208 as indicated by the solid lines 212 and 218 . similarly , the receiver device has previously established communication with communication devices 204 , 206 and 210 as indicated by the solid lines 216 and 222 . it may thus be concluded that the sender device 102 and the receiver device 104 according to this scenario do not share a common communication device . in the language set forth above with reference to fig1 the second group may be represented by an empty set . however , it is assumed that the sender device 102 is associated with a fourth device 202 . further the receiver device 104 is associated with a fifth device 204 . the fourth device 202 is moreover associated with the fifth device 204 as indicated by the solid line 214 . see further the description associated with fig3 below . wherein in a case there does not exist at least one common third device in the first group and the second group of devices , the establishment of a communication between the sender device and the receiver may continue as follows . the sender device 102 sends a request comprising at least an identification of at least one sub - group associated with a fourth device 202 with which sub - group the sender device 102 is associated . this request is received by the receiver device 104 . the receiver device 104 analyses the identification of the at least one sub - group comprised in the request and compares the identification to a list comprising at least one sub - group with which the receiver device 104 is associated . in a case at least one common sub - group is found the receiver device 104 sends at least an identification of the at least one common sub - group associated with a fifth device 204 to the sender device 102 . the at least one common sub - group is thus associated with both the sender device 102 and the receiver device 104 . it may thus be said that the sender device 102 may be associated with the receiver device 104 via the fourth device 202 and the fifth device 204 . the identification of the at least one common sub - group is then received by the sender device 102 . the sender device 102 then sends a message to the receiver device 104 , wherein the sender device 102 requests a reference from the fifth device 204 regarding said receiver 104 . the message further comprises information that the reference is to be validated by the fourth device 202 . this request is forwarded to the fifth device 204 by the receiver device 104 . after reception the fifth device 204 sends the reference to the receiver device 104 and the receiver device 104 forwards the reference to the sender device . however , since it may be assumed that communication has not been established between the sender device 104 and the fifth device 204 ( otherwise the sender device 102 and the receiver device 104 should have the fifth device 204 as a common device ) the sender device 102 may not be able to validate the received reference . therefore the sender device 102 sends the received reference to the fourth device 202 for validation , wherein the message sent from the sender device 102 to the receiver device 202 may also comprise information pertaining to the origin of the reference . for the present case the origin of the reference is the fifth device 204 . after reception and validation of the reference the fourth device 202 sends the validated reference to the sender device 102 . the message from the fourth device 202 to the sender device 102 may also comprise validating information pertaining to the origin of the reference . that is , for the present case the validating information pertaining to the origin of the reference would disclose the fifth device 204 as the origin . the sender device 102 may then create a first public encryption key for ester establishing communication from the sender device 102 to the receiver device 104 . the sender device 102 then encrypts the received reference with the created first public encryption key . further , the sender device 102 encrypts the rested first public encryption key using an additional public encryption key , wherein the additional public encryption key is associated with the previously established communication between the sender device 102 and the fourth device 202 . the encrypted first public encryption key and the encrypted received reference are then sent from the sender device 102 to the receiver device 104 . the receiver device 104 thus has no knowledge of the first public encryption key as created by the sender device 102 . in addition the receiver device 104 has no knowledge of the additional public encryption key associated with the previously established communication between the sender device 102 and the fourth device 202 . hence the receiver device 104 is neither able to decrypt the encrypted first public encryption key nor the encrypted received reference . in order for the receiver device 104 to validate the information pertaining to the previously established communication between the receiver device 104 and the fifth device 204 comprised in the encrypted reference the receiver device 104 forwards the encrypted first public encryption key to the fifth device 204 . this message sent from the receiver device 104 to the fifth device 204 further comprises a request pertaining to decryption of the encrypted first public encryption key . since the first public encryption key has been encrypted with the additional public encryption key which , as stated above , is associated with the previously established communication between the sender device 102 and the fourth device 202 , the fifth device 204 is thus not able to decrypt the encrypted first public encryption key . in order for the encrypted first public encryption key to be decrypted the fifth device 204 thus forwards the request to the fourth device 202 , which thus is able to decrypt the encrypted first public encryption key . the decrypted first public encryption key can then be sent back from the fourth device 202 to the receiver device 104 via the fifth device 204 . for added security the fourth device 202 and the fifth device 204 may encrypt the decrypted first public encryption key using further public encryption keys . separate encryption keys are used during transmission from the fourth device 202 to the fifth device 204 and during transmission from the fifth device 204 to the receiver device 104 . using the decrypted first public encryption key the receiver device 104 may thus decrypt the previously received encrypted reference pertaining to the previously established communication between the receiver device 104 and the fifth device 204 . the receiver device 104 may then validate the contents of the reference . that is , by comparing information comprised in the reference to information , such as sequence numbers , comprised in the receiver device 104 , the receiver device 104 is able to verify that information comprised in reference is correct and indeed pertains to the previously established communication between the receiver device 104 and the fifth device 204 . if the reference comprises a hash value ( as described above ) the receiver device 104 may calculate the hash value of the first public encryption key . the receiver device 104 may then perform a comparison between this calculated hash value and the hash value comprised in the reference in order to verify that the reference has not been altered during transmission . in a case there are no sub - groups common to both the sender device 102 and the receiver device 104 , the receiver device 104 may send a message to the sender device 102 indicating that no common sub - groups are found . the receiver device 104 may further request that the sender device 102 sends a new request comprising at least an identification of at least one sub - group with which the sender device 102 is associated , and which identification was not previously transmitted from the sender device 102 to the receiver device 104 . the receiver device 104 then receives this new request and analyses the identification as described above . the outlined procedure may continue until a common sub - group is found . alternatively , if no common sub - group is to be found the process of establishing communications between the sender device 102 and the receiver device 104 may be terminated . alternatively , if no common sub - group is to be found the sender device 102 and the receiver device 104 may search for a common device associated with a higher hierarchical level , as will be described below . fig3 shows an example of a communications system 300 in which communication has previously been established between the fourth device 202 and devices 102 and 302 , respectively , as indicated by the solid lines 308 and 310 , and wherein communication has been established between the fifth device 204 and devices 104 , 304 and 306 , respectively , as indicated by the solid lines 318 , 314 and 316 . further , communications is to be established by a sender device 102 and a receiver device 104 as indicated by the dashed line 320 . thus , devices 102 , 202 and 302 may be said to represent a first sub - group of the communications system 300 whilst devices 104 , 204 , 304 and 306 may be said to represent a second sub - group of the communications system 300 . the sub - groups may also be said to represent different classes . the sub - groups may for example represent different geographical locations , such as different nations or countries or parts thereof . thus , in this case the fourth device 202 and the fifth device 204 may for example represent or , act on the behalf of , different government bodies in the respective countries associated with the fourth device 202 and the fifth device 204 , respectively . for example , the fourth device 202 may be geographically located in a first nation whilst the fifth device 204 may be geographically located in a second nation different from said first nation . examples of suitable government bodies may include an agency responsible of handling identification information , such as a national identity register . as such the fourth device 202 and the fifth device 204 may be said to represent so called trusted third parties . the government bodies in different countries may be associated with an organization , such as a global trust center , which organization may enforce or suggest communication conditions which should be fulfilled by communication devices for the communication devices to be able to establish communication with each other . the organization may thus communicate these communication conditions to the above disclosed master devices . moreover , it may be required that the organization certifies the master devices . in a case the communications system 300 is associated with a corporate company the different sub - groups may represent different departments or divisions within the corporate company . thus , in this case the fourth device 202 and the fifth device 204 ( which are associated as indicated by the solid line 312 ) may for example represent different data service centers associated with each department or division associated with the fourth device 202 and the fifth device 204 , respectively . other examples include , but are not limited to , different internet service providers , internet communities , bank memberships , dub memberships , and the like . it is generally a requirement and / or an agreement that the sender device 102 and the receiver device 104 trusts the authority , agency , company , or the like ( represented by the fourth device 202 and the fifth device 204 ) offering and / or being responsible of the internet service , internet community , bank membership , or club membership . again , the fourth device 202 and the fifth device 204 may be said to represent so called trusted third parties . as will be appreciated by the skilled person these are just a few examples in which the invention may apply . in general , it may thus be assumed that at least one device in each sub - group ( here exemplified by the fourth device 202 in the first sub - group and the fifth device 204 in the second sub - group , respectively ) has established communication with a device in another sub - group . further , in some case it may be assumed that one of the sub - group devices ( such as the fourth device 202 in the first sub - group and the fifth device 204 in the second sub - group , respectively ) acts as a government body which may be responsible for issuing memberships to each device in the sub - group . in addition , a communication device may be associated with a plurality of different sub - groups , wherein each associated sub - group pertains to different applications . for example , on the one hand a communication device may be associated with a bank membership , and on the other hand the communication device may simultaneously be associated with internet community . fig4 shows a schematic diagram of a communications system 400 , similar to the communications system 300 of fig3 in which the invention may be applied . as in fig3 the sender device 102 wishes to establish communications to the receiver device 104 as indicated by the dash - dotted line 422 , wherein the sender device 102 is associated with a first sub - group via the fourth device 202 and the receiver device 104 is associated with a second sub - group via the fifth device 204 as indicated by solid lines . according to the scenario as disclosed in fig4 the first sub - group comprises devices 102 , 202 and 412 , whereas the second sub - group comprises devices 104 , 204 and 420 . with reference to the above the first and second sub - groups may represent different countries . for example the first sub - group may represent devices in a first country and the second sub - group may represent devices in a second country . the fourth device 202 and the fifth device 204 may then act as government bodies . in this example the sender device 102 is further associated with a third sub - group comprising devices 102 , 406 , 408 and 410 as indicated by dashed lines and with a fourth sub - group comprising devices 102 , 414 , 416 and 418 as indicated by dotted lines . for example the third sub - group may represent devices associated with the same bank , whereas the fourth sub - group may represent devices associated with the same internet service provider . fig5 shows a schematic diagram of a communications system 500 , similar to the communications system 100 of fig1 in which the invention may apply . as in the communications system 100 of fig1 , the communications system 200 comprises a number of communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 , 502 , 504 which may or may not be able to communicate with each other . in the following it will be assumed that the system 500 is in a state of operation . as for the method disclosed above with reference to the communications system 100 of fig1 , a first device 102 , denoted a sender device , wishes to establish a communication with a second device 104 , denoted a receiver device , in the communications system 500 . as in fig1 solid lines 510 , 512 , 514 , 516 , 518 , 520 , 522 , 524 , 526 between two communication devices 102 , 104 , 106 , 108 , 110 , 112 , 114 , 502 , 504 represents that communication has previously been established between the two communication devices at each end of the solid line 510 , 512 , 514 , 516 , 518 , 520 , 522 , 524 , 526 . that is , as in the exemplary scenario of fig5 communication has previously been established e . g . between the sender device 102 and the third device 106 , between the sender device 102 and a first auxiliary device 502 , between the receiver device 104 and the third device 106 , and between the receiver device 104 and a second auxiliary device 504 . as indicated by the dashed line 528 communications is to be established between the sender device 102 and the receiver device 104 . the first and second auxiliary devices 502 , 504 , respectively , may be said to represent digital witnesses for the sender device 102 and the receiver device 104 , respectively . that is , it may be required that all relations established involving the sender device 102 are monitored by the first auxiliary device 502 . more generally , it may thus be required that all relations are monitored by auxiliary devices ; a first auxiliary device 502 monitors the operations of , and / or the messages sent and received by , the sender device 102 , whilst a second auxiliary device 504 monitors the operations of , and / or the messages sent and received by , the receiver device 102 . the monitoring process of the first and second auxiliary devices 502 , 504 may thus be said to involve capturing message transaction information , such as the sender and / or recipient of the message . the monitoring process of the first and second auxiliary devices 502 , 504 may also comprise supplying the transmitted messages with a time stamp and / or a digital signature . time stamps and digital signatures per se are known in the art and will thus not be further discussed in this disclosure . when establishing communication between a sender device 102 and a receiver device 104 the first auxiliary device 502 of the sender device 102 and the second auxiliary device 504 of the receiver device 204 may also be required to establish communication . next , with reference to the communications system 500 of fig5 the process of terminating established communication between the sender device 102 and the receiver device 104 will be disclosed . however the process applies also to the communications systems 100 , 200 , 300 and 400 of fig1 - 4 , mutatis mutandis . firstly , it is to be understood that in a case the first auxiliary device 502 monitors the operations of , and / or the messages sent and received by , the sender device 102 , the messages sent by the sender device 102 comprise two digital signatures ; one digital signature associated with the sender device 102 and one digital signature associated with the first auxiliary device 502 . thus in a case the first auxiliary device 502 monitors all communications relations established by the sender device 102 the sender device 102 may terminate the established communication between the sender device 102 and the receiver device 104 by sending a message to the first auxiliary device 502 , wherein the message comprises information stating that the first auxiliary device 502 shall not insert a digital signature into the monitored message . that is , in this case the messages sent by the sender device 102 comprise one digital signature , which digital signature is associated with the sender device 102 . if the receiver device 104 receives a message not comprising a digital signature of the first auxiliary device 502 the receiver device 502 may choose to classify the received message as incomplete and may thus further ignore its contents . since the receiver device 104 ignore the contents of the received message the established communication from the sender device 102 to the receiver device 104 , and / or the established communication between the sender device 102 and the receiver device 104 may be said to have been terminated . alternatively , the receiver device 104 may send a message to the sender device 102 stating that the received messages was interpreted as incomplete since the received message did not comprise a digital signature of the first auxiliary device 502 . a method in a communications system 100 , 200 , 300 , 400 , 500 for authentication of a sender device 102 and a receiver device 104 , wherein the method has been disclosed above with references to fig1 - 5 , can also be illustrated in a flowchart . thus such a method may be summarized as comprising creating , in a step 602 , by the sender device 102 , an identification of the sender device 102 ; creating , in a step 604 , by the receiver device 104 , an identification of the receiver device 104 ; sending , in a step 606 , by the sender device 102 , a request pertaining to establishing a relation between the sender device 102 and a receiver device to the receiver device 104 ; sending , in a step 608 , by the receiver device 104 , at least an identification of a second master device 154 to the sender device 102 ; sending , in a step 610 , by the sender device 102 , the identification of the second master device 154 to a first master device 152 ; sending , in a step 612 , from the first master device 152 , a request pertaining to communication conditions needed by the sender device 102 for the sender device 102 to establish communication with the receiver device 104 to the second master device 154 ; sending , in a step 614 , from the second master device 154 , the communication conditions to the first master device 152 ; if it is determined , in a step 616 , that the sender device 102 fulfills the communication conditions , providing , in a step 618 , by the sender device 102 , a first access key to the first master device 152 ; and providing , in a step 620 , by the receiver device 104 , a second access key to the second master device 154 . it should here be noted that a system and method for establishing communications from a sender device 102 to a receiver device 104 has been disclosed . however , as the skilled person will understand , communications from the receiver device 104 to the sender device 102 may be established in the same way since , as stated above , the sender device 102 may also comprise the functionality of the receiver device 104 and vice versa . thus the sender device 102 may interchangeably act as a receiver device 104 and vice versa . thus it may be said that the above system and method may be applied for establishing communications between the sender device 102 and the receiver device 104 . the invention has mainly been described above with reference to a few embodiments . however , as is readily appreciated by a person skilled in the art , other embodiments than the ones disclosed above are equally possible within the scope of the invention , as defined by the appended patent claims . | 7 |
the method and apparatus for pulsing , backwashing and cleaning a granular medium filter according to this invention is illustrated with reference to the figures . certain features of a typical filter adapted to practice the invention are shown in partial cross - section in fig1 . the invention is not limited to the particular configuration shown in the figures however . a bed 10 of granular medium such as sand is supported on a screen 12 within a filter tank cell 14 having tank walls 16 and a tank bottom 18 . an underdrain structure 20 supports the screen 12 while a hold down grating 22 secures the screen 12 in place from above . the grating 22 is held in place by adjustable hold down means 23 secured to tank walls 16 . the bed divides the tank cell 14 into a head space 24 above the bed and an underdrain cavity 26 below the filter bed . the underdrain cavity 26 is vented to the atmosphere by a vent conduit 28 . the underdrain structure 20 comprises an air and / or liquid distributing device made up of a plurality of generally vertically extending modular compartments or chambers 30 below the fine mesh screen 12 . the compartments or chambers 30 may be generated by intersecting a first plurality of mutually parallel , generally rectangular partitions perpendicularly with a second plurality of mutually parallel , generally rectangular partitions to produce modular compartments which , in this instance , can be described as an &# 34 ; egg crate &# 34 ; structure . chambers of other geometrical shapes would function equally well in the underdrain structure . the lower ends of the chambers are open to the underdrain cavity 26 while the upper ends of the chambers are open to the under side of the screen 12 . the upper ends of the chambers 30 may optionally be capped by a flat grating 31 designed to support the screen as well as match up with the upper hold down grating 22 to prevent air from moving between compartments during pulsing . the underdrain structure also contains a set of nozzles 32 directed upwardly toward the under side of the screen 12 . the nozzles are supplied with fluid by an array of conduit 34 which traverse the underdrain structure adding support to the &# 34 ; egg crate &# 34 ; structure . in fig1 influent liquid to be filtered enters the head space 24 above the filter bed 10 through an inlet weir 36 controlled by a valve ( not shown ). influent liquid is directed to a distribution trough 38 and then to splash plates 40 or other types of distributor and then to the upper bed surface 42 . solids suspended in the liquid are retained at the surface of the filter bed 10 as the filtered liquid passes down through the bed and through the screen 12 and the underdrain structure 20 into the underdrain cavity 26 . the filtrate is discharged from the underdrain cavity 26 through a conduit 44 controlled by a valve 46 to final disposal or further treatment . a portion of the filtrate is retained in a clearwell 48 , where it is stored for backwashing and pulsing the filter bed 10 . as solids collect on and within the filter bed medium 10 , the liquid level 50 above the bed upper surface 42 rises to a first selected level 50a , activating a first level sensor switch 52 connected to a controller 54 which activates a diffuser 56 extending over the bed surface 42 for the purpose of creating currents in the wastewater above the bed surface . the diffuser 56 , generally a conduit with a number of small holes , supplied with air by a conduit 57 , creates fine bubbles which cause the liquid above the diffuser to be less dense and thereby causes currents within the wastewater contained in the head space 24 . the currents sweep over the bed surface 42 and tend to lift and suspend the solid particles collected on the surface during filtration , as well as holding in suspension solid particles removed from the filter medium bed 10 during the pulse cleaning operation described later . this creation of currents in the liquid above the filter bed is termed the &# 34 ; air scour &# 34 ; method for lifting particulate material trapped on the filter bed surface 42 . the diffuser may be operated continuously or intermittently to conserve energy . as wastewater continues to enter the filter cell , the liquid level 50 rises to a second selected level 50b activating a second level sensor switch 58 which initiates an air pulsing cycle for the filter cell . a third level sensor switch 60 , which initiates the backwash cycle , may be deactivated during each pulsing cycle to prevent premature backwash . the air pulsing cycle for the cell occurs as follows . effluent discharge from the conduit 44 ceases by closing the valve 46 and opening a valve 62 allowing a pump 64 to transfer filtrate from the clearwell 48 into the underdrain cavity 26 . as the cavity fills , excess air in the underdrain cavity 26 is expelled through the vent conduit 28 . when the liquid level in the underdrain cavity 26 reaches the lower edges of the underdrain structure 20 , and rises in each of the underdrain support chambers 30 , this compresses the trapped air to a point just sufficient to overcome the resistance of the bed and forces the air trapped in these chambers 30 through the screen 12 and upward through that portion of the filter bed 10 above each of the chambers 30 . the passage of air up through the filter bed increases the porosity of the bed and causes some of the solids retained on the surface to be folded into the bed proper , further increasing bed porosity . the individual chambers 30 ensure that air is forced evenly through the entire filter bed 10 . the air pulsing cycle is continued until the filtrate pumped into the underdrain cavity 26 by the pump 64 approaches the screen 12 . influent liquid continues to enter the filter cell during the air pulsing cycle . following an air pulsing cycle the pump 64 shuts off , the pump valve 62 closes and the effluent valve 46 is opened , allowing the underdrain cavity 26 to drain . the air pulsing cycle restores a substantial portion of the original porosity of the cell filter bed and flow of liquid through the bed is increased . the air pulsing cycle functions to decrease the liquid level above the filter medium bed 10 . the backwash level sensor 60 is reactivated following each air pulsing cycle . after initiation of the first pulsing cycle for the filter cell , the controller 54 activates additional air pulsing cycles a predetermined intervals of time , head space liquid level permitting . the pulsing of the filter cell continues until either a predetermined number of pulsing cycles has occurred or the liquid level 50 above the filter bed surface 42 rises to a third predetermined level 50c , initiating a backwash cycle . the predetermined maximum number of air pulsing cycles performed before backwash may be fixed or vary according to influent flow . alternatively , a backwash cycle may be initiated after a predetermined filtration time . in the case where initiation of the backwash cycle is controlled by the level sensor 60 , solids accumulate on and in the filter bed to the extent that the air pulsing of the filter cell becomes less and less effective in reducing the liquid level above the filter bed . in this case the liquid level 50 rises to a third selected level 50c , activating the level switch 60 which initiates a backwash cycle for the filter cell . influent flow to the filter cell via the weir 36 ceases by closing the influent control valve ( not shown ). a valve 66 in a conduit 68 leading from the distribution trough 38 opens to remove influent liquid above the bed to the upper edge of the trough 38 , as well as backwash liquid from the filter cell . the effluent valve 46 closes , the pump valve 62 opens and the pump 64 delivers filtrate to the underdrain cavity 26 forcing excess air through the vent 28 and compressing trapped air and finally filtrate up through the filter bed medium 10 at a cleansing velocity . at the same time as the pump 64 commences the backwash liquid flow , an array of nozzles 32 below the screen 12 provides upwardly directed liquid jets which &# 34 ; auger &# 34 ; up through the filter bed to break up incrustations . this &# 34 ; augering &# 34 ; action occurs as first air and then filtrate passes upwardly through the screen and filter bed . the liquid is supplied to the nozzles by a pump 70 which delivers liquid from the clearwell 48 via a conduit 72 to a manifold 74 which feeds the array of conduit 34 supplying the nozzles 32 . the backwash flow of filtrate continues and the filtrate washes the solids stored in and on the bed from the filter medium bed , carrying the solids over the top edge of the distribution trough 38 and out from the filter cell via the conduit 68 to disposal . the open tops of the cylinders 30 produces an even flow of backwash liquid up through the entire screen and filter bed which dislodges any sheet like or deleterious material from the filter bed . the vertical augers provided by the nozzles 32 counteracts any size classification of the bed medium during the backwashing cycle . the control valve 66 in the conduit 68 , which removes backwash liquid from the trough 38 , is open only during the backwash cycle . the diffuser 56 continues to provide currents in the liquid above the filter bed during the backwash cycle which assists in carrying solids over the top edge of the distribution trough 38 and out of the filter cell . after the specified backwash cycle duration the pumps 64 and 70 cease operation and the effluent valve 46 opens allowing liquid to flow from the filter and another filtration cycle commences . referring to fig2 a cut - away view of one embodiment of the underdrain assembly , screen and hold down grating is shown . each chamber 30 contains a pair of conduits 34 each of which has two nozzles 32 directed upwardly toward screen 12 . the hold down grating 22 above the screen is sized and positioned such that a nozzle is positioned at the center of each opening in the grating 22 . the optional flat grating 31 located atop the chambers 30 but below the screen 12 exactly matching the hold down grating 22 is omitted from fig2 and 3 for clarity . fig3 is a cut - away view of another embodiment of the invention where a single conduit 34 and nozzle 32 is located in each chamber 30 . the hold down grating 22 again is positioned such that the nozzle 32 is directed at the center of each opening in the grating . matching flat grating 31 located below the screen 12 is again omitted for clarity . the entire screen area not covered by the hold down grating 22 thus is exposed to the full upward flow of backwashing liquid which flushes out any sheet - like or deleterious material which may have accumulated at the interface between the screen and the bed medium . the sequence of operational steps for the filter cell is the same for the embodiments shown in fig2 and 3 . the conduit and nozzle assembly within the underdrain structure provides a unique avenue for supplying either gas or liquid to the underside of the filter medium bed . chemical cleaner can be directed evenly throughout the underdrain structure and up through the filter bed by the nozzles . another alternative is the inclusion of a gas carrying conduit through the chambers which can provide a gas ( air ) to the underside of the bed when the filter is flooded . this is particularly useful for internally scouring the bed during cleaning with minimal dilution of the chemical cleaning solution . this can be accomplished by providing a gas supply to the conduit and nozzle system already used for liquid jet production , or by adding a dedicated gas line to the underdrain chambers with an aperture in that line within each of the chambers . | 1 |
referring to fig1 in one embodiment of the invention , a heating system 11 includes a first heating chamber 12 having walls 13 and an interior space 14 disposed in the proximity of an induction work coil 16 . the electromagnetic field from the coil 16 ( not shown ), when it is energized by an rf source 17 , interacts with and causes heating eddy currents in the wall 13 of chamber 12 , causing heat to be generated and transferred to the interior 14 of the chamber 12 . fluid , such as water 18 , contained in the chamber 12 is thereby heated . a second heating chamber 21 having walls 22 and an interior space 23 is also disposed in the proximity of the induction work coil 16 so that its electromagnetic field interacts with the chamber wall 22 inducing eddy currents therein which produce heat which is transferred to the chamber interior 23 . a conduit 24 connects the interior 14 of chamber 12 with the interior 23 of chamber 21 by which steam 25 formed in chamber 12 can migrate into chamber 21 where it can be superheated before exiting through exit channel 26 . a deflection plate 20 attached to channel 26 where it opens into chamber 21 causes the steam from chamber 12 to dwell in chamber 21 long enough to be superheated before exiting through channel 26 . the deflector plate 20 has the general shape of the chamber 21 and sized to leave an opening between its perimeter ( or at least a portion thereof ) and the chamber wall 22 through which steam can enter that portion of chamber 21 from which it can directly exit channel 26 . in this embodiment of the invention , both the conduit 24 and the channel 26 pass through the middle of induction work coil 16 , although other configurations are within the scope of the invention as illustrated in fig2 . providing water 18 to first chamber 12 and maintaining a proper water level are all well within the skills of the art , as well as fully explained in my u . s . pat . no . 5 , 773 , 797 . a primary advantage of the present invention is that the electromagnetic field ( not shown ) induced in induction work coil 16 is used to simultaneously heat the interior spaces 14 and 23 of the two heating chambers 12 and 21 , respectively . referring to fig2 in an alternative embodiment of the invention , an exit channel 27 , rather than passing through the center of the induction work coil 16 , extends out the bottom of the second chamber 21 . in all other respects , the embodiments are the same , and , in particular , the first heating chamber 12 and the second heating chamber 21 are disposed relative to the induction work coil 16 so that both interact with the electromagnetic field established in the coil 16 to produce heating within both chambers 12 and 21 . a deflection plate 30 adjacent the conduit 24 where it opens into chamber 21 causes the steam from chamber 12 to dwell in chamber 21 long enough to be superheated . referring to fig3 in this embodiment of the invention , as in the two previously described embodiments , the first chamber 12 and the second chamber 21 are both disposed relative to the induction work coil 16 so that they interact with the electromagnetic field produced by the coil 16 when energized by the rf source 17 . in this embodiment , however , the walls 13 and 22 of the chambers 12 and 21 , respectively , are not made of a material in which eddy currents or other heating activity occurs by virtue of interaction with an electromagnetic field . instead , a heating element 31 is disposed within the interior 14 of the first chamber 12 and a similar heating element 32 is disposed within the interior 23 of the second chamber 21 . heating elements 31 and 32 are made of a ferrous or other induction capable material in which heating eddy currents are induced by the electromagnetic field produced by the induction work coil 16 . material most advantageously used for the heating elements 31 and 32 are carbon and carbon plate . in this embodiment , the heating element 32 also functions as a deflector as described above in connection with deflector 20 . thus , in this embodiment , as the electromagnetic field from the induction work coil 16 induces eddy currents in heating elements 31 and 32 , the water 18 in the first chamber is heated into steam which passes through conduit 24 to the second chamber 21 where it is further heated into superheated steam which then exits through channel 27 in the bottom of the second chamber 21 . once again , the single heating coil 16 is positioned so that its electromagnetic field interacts with and causes heating in both the first chamber 12 and the second chamber 21 . referring to fig4 and 5 , a boiler 50 embodying the present invention has a first chamber 41 formed by cylindrical , spaced - apart walls 42 and 43 defining an interior space 44 . chamber 41 surrounds a second chamber 46 formed by a circular wall 47 defining an interior space 48 . in a space 52 , between chambers 41 and 46 , is an induction work coil 51 which , when powered by an rf source ( not shown ), induces eddy currents in the walls 43 and 47 thereby producing heat in the chambers 41 and 46 . a third chamber 53 formed by wall 54 , which can be an extension of wall 42 , and defining interior space 56 forms a means for connecting the interior spaces 44 and 48 of chambers 41 and 46 , respectively . once again , the coil 51 is disposed relative to the two chambers 41 and 46 so that both are heated simultaneously to heat the fluid in chambers 41 and 46 by the efficient use of induction work coil 51 . when the fluid is water or the like , steam is produced . the steam from space 56 can be used for a variety of commercial purposes , such as , for example , processing foods . the invention is useful for a water heater ( boiler ), steam generator , thermal fluid heater or fryer , to name just a few . in all cases , the present invention provides the advantage of efficiency in the use of energy . referring to fig6 and 7 , in this embodiment of the invention , a system 61 for producing superheated steam includes a cylindrical outer chamber 62 which surrounds an inner cylindrical chamber 63 . the outer chamber 62 , has a cross - section in the shape of a torus , formed by outer cylindrical wall 64 and concentrically spaced - apart inner wall which define an interior space 67 which is supplied with water 68 by a valve 76 . the level of the water 68 is maintained at a predetermined level in a manner well known in the art and which need not be described herein . disposed within the interior space 67 of chamber 62 is a cylindrical heating core 71 having a toroidal cross - section and formed of a ferrous or other induction capable material having a plurality of channels 72 formed therein which run longitudinally from the top 73 to the bottom 74 of the heating core 71 , providing pathways by which water introduced by pump 76 can flow from the bottom of outer chamber 62 to the top of that chamber . the concentric inner chamber 63 is formed by a cylindrical wall 78 that is co - axial with first chamber walls 64 and 66 and spaced apart from wall 66 . a cylindrical inner core member 81 is disposed within the inner chamber 63 and is formed from a ferrous or other induction capable material . a plurality of channels 82 extend from the top 83 to the bottom 84 of the core 81 and provide pathways for steam to pass from the upper portion 85 of inner chamber 63 to the lower portion 86 of chamber 63 from which the steam can exit through channel 87 that connects with the inner chamber 63 . disposed in the space 91 between the outer chamber wall 66 and the inner chamber wall 78 is an induction work coil 92 which , when energized by an rf source ( not shown ), produces an electromagnetic field that simultaneously causes the inner core member 81 and the outer core member 71 to generate heat . as previously explained and is well known in the art , the electromagnetic field induces eddy currents in the core members 81 and 71 producing heat . the water 68 in the outer chamber 62 is heated to produce steam which rises into a third chamber 94 which connects the outer chamber 62 to the inner chamber 63 . the steam 95 formed in the outer chamber 62 passes into the inner chamber 63 and is superheated by the core member 81 and is eventually discharged through channel 87 as superheated steam . while heating cores 71 and 81 are described in connection with this embodiment of the invention , it will occur to those skilled in the art that the invention could operate without these cores when the chamber walls are heated by an electromagnetic field , as previously described in connection with other embodiments . once again , the invention provides an efficient use of the induction work coil 92 by disposing the heating chambers relative thereto so that the electromagnetic field produced by the coil produces heat in both chambers simultaneously . it will be apparent to those skilled in the art that various changes , modifications and alterations in the teachings of the present invention may be contemplated without departing from the intended spirit and scope thereof . as such , it is intended that the present invention only be limited by the terms of the appended claims . | 7 |
the present invention will now be described in detail with reference to the embodiments shown in the drawings . the present invention provides an illuminating optical system for illuminating an eye fundus , an imaging optical system for imaging the illuminated eye fundus and other optical systems in a main unit and provides ophthalmologic examination functions or devices to a separate attachment unit . the attachment unit is mounted on the main unit via a mount in order to perform a variety of ophthalmologic examination functions . fig1 shows a first embodiment of the present invention in which the ophthalmologic examination apparatus is configured as a non - mydriatic fundus camera . in the ophthalmologic examination apparatus shown in fig1 , an illuminating optical system for illuminating an eye fundus and an imaging optical system for imaging the illuminated eye fundus are provided to a main unit 10 of the apparatus . in the illuminating optical system , light emitted from a halogen lamp or another light source 11 together with light reflected by a concave mirror 12 forms into infrared light via a visible - cutting / infrared - transmitting filter 13 , passes through a stroboscope 14 , diffuses on a diffusion plate 15 , and illuminates a ring slit 16 disposed at a position conjugate with an anterior ocular segment ( pupil ) 1 b of an eye 1 to be examined . illuminating light from the ring slit 16 passes through a lens 17 , a black spot plate 18 for eliminating the reflection of an objective lens 22 , a half mirror 19 and a relay lens 20 ; reflects from an apertured total reflection mirror 21 having a central aperture ; passes through the objective lens 22 ; impinges on the eye fundus 1 a from the anterior ocular segment 1 b of the eye 1 to be examined ; and illuminates the eye fundus 1 a with infrared light . reflected light from the eye fundus 1 a arrives via the objective lens 22 and passes through the aperture of the total reflection mirror 21 , a photography stop 31 , a focus lens 32 and an imaging lens 33 , then reflecting from a half mirror 34 and impinging on an infrared - transmitting / visible - reflecting mirror 36 via a field stop 35 disposed in a position conjugate with the eye fundus 1 a . infrared light transmitted through the infrared - transmitting / visible - reflecting mirror 36 reflects from a mirror 38 , passes through an imaging lens 37 and impinges on an imaging device 40 composed of an infrared - light - sensitive ccd or the like . a signal from the imaging device 40 is then input to a monitor 41 . visible light reflected by the mirror 36 enters an attachment unit 50 via either of at least two types of variable - power lenses 47 a and 47 b and then reaches an imaging device 53 composed of a visible - light - sensitive ccd or the like that is housed in the attachment unit 50 . the attachment unit 50 is removably mounted to a mount 51 fixed to the main unit 10 adjacent to a position conjugate with the pupil . when a shutter 46 is manipulated , a shutter - manipulation signal is fed from the shutter 46 via a connector 52 to the imaging device 53 and a memory 54 for storing an image on the imaging device 53 . power is also supplied to the imaging device 53 and memory 54 from the main unit 10 via the connector 52 . in such an imaging optical system , the position conjugate with the fundus 1 a of the eye 1 to be examined is indicated by r , and the position conjugate with the anterior ocular segment ( particularly the pupil ) is indicated by p . the field stop 35 is disposed in a position conjugate with the eye fundus with respect to the optical system ( first optical system ) composed of the objective lens 22 , imaging lens 33 , and the like . therefore , the image of the eye fundus produced by the optical system is formed adjacent to the field stop 35 . in addition , the imaging plane of the imaging device 40 is disposed in a position conjugate with the field stop 35 relative to the imaging lens 37 , and the imaging plane of the imaging device 53 is disposed in a position conjugate with the field stop 35 relative to the variable - power lenses 47 a and 47 b ( second optical system ). the eye fundus image on the field stop 35 is accordingly again created on the imaging devices 40 and 53 by the imaging lens 37 and the variable - power lenses 47 a and 47 b . in such a configuration , the visible - cutting / infrared - transmitting filter 13 is inserted into the illuminating optical path . therefore , the eye fundus is illuminated by infrared light and an image of the eye fundus is produced at the position of the field stop 35 by the objective lens 22 , focus lens 32 , and imaging lens 33 . the eye fundus image of the field stop 35 is transmitted by the infrared - transmitting / visible - reflecting mirror 36 and is again created on the imaging region of the imaging device 40 by the imaging lens 37 . therefore , the image of the eye fundus is displayed as a black - and - white image on a monitor 41 . this allows the image of the eye fundus to be observed via the monitor 41 by the examiner . a focus - dot light source 30 is provided to the illuminating optical system . the light beam from the light source 30 impinges on the eye fundus 1 a via the half mirror 19 . the position of the focus dot changes in accordance with the movement of the focus lens 32 , so that the examiner can observe the focus dot and bring the eye to be examined into focus . an anterior ocular segment lens 42 is inserted into the optical path at the initial stage of alignment . the examiner can accordingly verify the image of the anterior ocular segment 1 b of the eye 1 to be examined using the monitor 41 . during alignment or focusing , an internal fixation lamp 43 is turned on , and the examiner can reliably perform alignment or focusing by bringing the attention of the person being examined to the fixation lamp . when the apparatus has been aligned , the shutter switch 46 is operated to produce a shutter operation signal , which is input to the imaging device 53 of the attachment unit 50 and to the memory 54 via the connector 52 . this enables the imaging device 53 to be activated to prepare an operation for capturing a still image of the eye fundus . a signal for initiating the emission of light ( light regulating signal ) is transmitted from the imaging device 53 to the stroboscope 14 in synchronization with the operation signal of the shutter switch 46 , thus enabling light to be emitted therefrom . the image of the eye fundus illuminated by light emitted from the stroboscope 14 is created at the position of the field stop 35 and is then recreated on the imaging region of the imaging device 53 by the variable - power lens 47 a ( 47 b ). the imaging device 53 therefore captures the eye fundus image as a still image . the still image created by the imaging device 53 is saved in the memory 54 in the attachment unit 50 . the still image saved in the memory 54 is loaded into an external computer ( not shown ), displayed on the monitor 41 , or output to a printer ( not shown ). alternatively , the memory 54 can itself be made into a cartridge and configured to be detachable from the attachment unit 50 . when the cartridge is introduced into another device , the contents of the memory can be read by this other device . the image of the eye fundus can also be produced with a variable photographic magnification ratio with the aid of the variable - power lenses 47 a , 47 b disposed on the imaging optical system or with the aid of a zoom lens in place of the variable - power lenses . when the ratio is high , an expanded image of the eye fundus is captured without any image of the field stop 35 . when the ratio is low , an image of the eye fundus is captured together with the image of the field stop . for example , images that have been captured by setting the ratio to two values , retrieved from the memory 54 and displayed on the monitor 41 are schematically shown as symbols a and b in the upper right part of fig1 . the symbol a indicates an image of the eye fundus captured using a high magnification ratio , while the symbol b shows an image of the eye fundus captured using a low magnification ratio . it can be understood that the image of the field stop is also captured in the photography of low magnification ratio , as is shown by hatching in the periphery of the image b . the examiner can thereby determine an approximate capture ratio by viewing the appearance of the field stop in the image . on the other hand , the image received by the imaging device 40 disposed on the observation optical system receives no magnification of the variable - power lenses and the examiner can observe the black - and - white image at the same magnification ratio on the monitor 41 . to facilitate alignment , the magnification ratio of the optical system leading to the imaging device 40 may be set so that the imaging device can capture an image c having a wider region than the region captured by the imaging device 53 . alignment using the imaging device 40 can thereby always be performed at a wide angle regardless of the magnification of the variable - power lens 47 a ( 47 b ). fig2 shows another embodiment . the same numeric symbols are applied to parts having the same or similar functions , and detailed descriptions thereof have accordingly been omitted . the ophthalmologic examination apparatus of this embodiment can be used as a mydriatic / non - mydriatic fundus cameras . the attachment unit 50 is provided with a monitor 55 to which the imaging device 53 and the memory 54 are connected . a signal from the imaging device 53 or a signal from the memory 54 is sent to the monitor 55 , and an image of the eye fundus can be displayed thereon . when the ophthalmologic examination apparatus is used as a non - mydriatic fundus cameras , a visible - cutting / infrared - transmitting filter 13 is inserted into the optical path and the examiner can observe the image of the eye fundus from the imaging device 40 in the same manner as in the first embodiment . conversely , when used as a mydriatic fundus camera , the visible - cutting / infrared - transmitting filter 13 is retracted from the optical path , and the eye fundus is irradiated with visible light . the examiner therefore photographs the eye fundus using the imaging device 53 and observes the image of the eye fundus displayed on the monitor 55 . the image of the eye fundus captured as a still image by the imaging device 53 , under mydriatic or non - mydriatic mode , can be directly displayed on the monitor 55 , or can temporarily be stored in the memory 54 , retrieved from the memory and then displayed on the monitor 55 . in the second embodiment , the monitor 55 can be used in place of the monitor 41 of the main unit 10 . alternatively , a monitor can be provided to the imaging device 53 or a monitor can be provided to the exterior of the attachment unit 50 . when the monitor 41 is used , the signals from the imaging device 53 and the memory 54 are directed to the monitor 41 , as indicated by the dashed line . the visible - cutting / infrared - transmitting filter 13 is inserted into or retracted from the optical path in accordance with mydriatic and non - mydriatic modes . the display of the images from the imaging devices 40 and 53 in both the modes is therefore automatically switched in accordance with the insertion and retract of the filter 13 . in the mydriatic mode , an infrared - cutting / visible - transmitting filter may be inserted into the optical path in place of the filter 13 in order to protect the eye to be examined . fig3 shows a third embodiment in which the ophthalmologic examination apparatus is used as a mydriatic and non - mydriatic fundus cameras in the same manner as in fig2 . in fig3 , the same numeric symbols are applied to parts having functions that are the same as or similar to those of fig1 and 2 , and detailed descriptions thereof have accordingly been omitted . an appearance of this embodiment is shown in fig7 . in this embodiment , an ocular function is provided to the attachment unit 50 , and a return mirror 60 is disposed in the optical path between the mount 51 and the imaging device 53 . when the return mirror 60 is in the indicated position , the image of the eye fundus reflected by the return mirror 60 is guided to an ocular lens 63 via a prism 61 and a lens 62 , and the image of the eye fundus can be observed via the ocular lens 63 . in this instance , a cap ( light shielding means ) 67 is mounted on a viewing hole 64 of an eyepiece in order to prevent stray light from entering when the device is not in use . the ocular lens 63 is placed near the monitor 55 of the second embodiment and is preferably disposed in a position that corresponds to the optical axis of the objective lens 22 to a degree whereby the monitor 41 in the main unit and the ocular lens will not greatly interfere with one another . the examiner can thereby readily perform alignment . a separate imaging device 65 composed of a ccd can be mounted to the viewing hole 64 . an image of the eye fundus from the imaging device 65 is sent to the monitor 41 via a connecter 66 , and can be displayed on the monitor 41 . a separate monitor may be used , but a less costly configuration can be achieved if the monitor 41 within the main unit 10 is used . in such a configuration , when the device is used as a non - mydriatic fundus cameras , a visible - cutting / infrared - transmitting filter 13 is inserted into the optical path during observation in the same manner as in the first and second embodiments , the image of the eye fundus from the imaging device 40 is displayed on the monitor 41 , and the examiner performs alignment and focusing while viewing the image of the eye fundus . conversely , when the device is used as a mydriatic fundus cameras , the visible - cutting / infrared - transmitting filter 13 is withdrawn from the optical path , and the image of the eye fundus irradiated with visible light is reflected by the mirror 36 , transmitted by a variable - power lens , reflected by the return mirror 60 and observed via the ocular lens 63 . instead of being observed via the ocular lens 63 , the image of the eye fundus can also be observed by mounting a ccd or another imaging device 65 on the viewing hole 64 and displaying the image of the eye fundus from the imaging device 65 on the monitor 41 . during image capture in both the non - mydriatic and mydriatic modes , the return mirror 60 is kept out of the optical path , the image of the eye fundus captured by the imaging device 53 is stored in the memory 54 and the stored image is exported to an external computer , displayed on the monitor 41 , or output to a printer . if the memory 54 can be removed , the contents of the memory can be read by another device once the memory has been introduced into the other machine . advantages are realized with this embodiment in that direct eye observation via the ocular lens can be performed at the same magnification ratio as the image capture magnification ratio , and in that alignment by the imaging device 40 can always be performed at a wide angle regardless of the magnification used , as is the same with the first embodiment . fig4 shows a still further embodiment in which the ophthalmologic examination apparatus is used as a mydriatic and non - mydriatic fundus cameras in the same manner as in fig2 and 3 . in fig4 , the same numeric symbols are applied to parts having functions that are the same as or similar to those of fig1 , 2 and 3 , and detailed descriptions thereof have been omitted . in the embodiment of fig4 , the ophthalmologic examination apparatus has a function whereby an eye fundus can be photographed for stereographical observation . for this purpose , a plurality of apertures 31 ′ for dividing light beams is introduced into the optical path in proximity to the photography stop 31 . a dividing prism ( optical path dividing means ) 70 is additionally provided in the attachment unit 50 , and a plurality of aperture stops 71 is disposed directly before the dividing prism 70 in a position p conjugate with the pupil of the anterior ocular segment of the eye to be examined . an image of the eye fundus that has passed through the dividing prism 70 is received by an interpupillary adjustment prism 74 via a return mirror 72 , and is stereographically observed by the examiner via a binocular ocular unit composed of a right - eye ocular lens 75 a and a left - eye ocular lens 75 b . if the return mirror 72 is retracted from the optical path , the image of the eye fundus is captured by the imaging device 53 via lenses 73 a and 73 b for stereographical eye fundus observation . the imaging device 53 is mounted to the attachment unit 50 via an adapter 76 . an imaging device used exclusively for stereographical observation can also be mounted in place of this imaging device . a ring slit 16 disposed in the illuminating optical system in the main unit 10 can be exchanged with a ring slit 16 ′ for stereographical observation . the filter 13 is retracted from the optical path when the eye fundus is observed via a binocular ocular unit . in such a configuration , the eye fundus can be observed in a stereographical rather than planar fashion , and the eye fundus can therefore be scanned from multiple angles . in fig4 , the optical elements in the attachment unit 50 and the plurality of aperture 31 ′ are disposed in a direction orthogonal to the page space , but the representation in the drawing is shown from the direction orthogonal to the page space for the sake of simplicity . in the embodiment of fig4 , the plural aperture 31 ′, dividing prism 70 , plurality of aperture stops 71 , return mirror 72 , and lenses 73 a , 73 b are disposed so that they are respectively introduced into the optical path in accordance with the selection of the variable - power lenses 47 a and 47 b , e . g . when variable - power lenses having a high magnification ratio have been selected . this allows a preferable configuration to be obtained because the attachment unit 50 does not need to be switched for stereographical photography . in the first through fourth embodiments , a position p that is conjugate with the pupil exists adjacent to the mount 51 . therefore , an attachment unit having a normal photography function and an attachment unit having a stereographical photography function can readily be used . in addition , alignment by the monitor 41 during stereographical photography involves using a single screen as with normal photography ( rather than using a split screen ), and the focusing and working dots for normal photography can be used without modification for stereographical photography . therefore , the examiner can perform alignment without difficulty . fig5 shows a still further embodiment in which the ophthalmologic examination apparatus works as a perimeter . in fig5 , the same numeric symbols are applied to parts having functions that are the same as or similar to those of fig1 through 4 , and detailed descriptions thereof have accordingly been omitted . in the embodiment of fig5 , an adjustable light - emitting diode 80 that emits visible light and infrared light and that can be moved manually or automatically in a plane orthogonal to the optical path is provided to the attachment unit 50 in a position r conjugate with the eye fundus in order to allow the apparatus to function as a perimeter . the light - emitting diode 80 functions as a projection target for an erg ( electroretinogram ). when the shutter switch 46 is operated , the light - emitting diode 80 is caused by a controller 81 to light up and to emit visible light and infrared light . the visible light is transmitted by the variable - power lens 47 a ( 47 b ), is reflected by the mirror 36 and is projected as stimulation light on the eye fundus 1 a from the pupil 1 b of the examined eye via the mirror 34 , lenses 33 , 32 , the aperture of the total reflection mirror 21 and the objective lens 22 . an erg electrode 82 is attached to the eye to be examined a signal from the electrode 82 is input to a computer 84 having a monitor 85 and an external storage device 86 . the computer 84 functions as a device for filing the eye fundus image and also produces a retinal potential diagram in accordance with the signals from the electrode 82 . the diagram produced is displayed on a monitor 85 and stored in the external storage device 86 . in this embodiment , the target created by the light - emitting diode 80 is transferred to the infrared light - sensitive imaging device 40 . infrared light from the light - emitting diode 80 that has passed through the mirror 36 is reflected by the mirror 38 via a mirror 91 , prism 92 , and half mirror 93 , and is made incident on the imaging device 40 so as to be viewable on the monitor 41 . in this instance , the mirror 91 is disposed in a position conjugate with the field stop 35 , and the distance a between the field stop 35 and the mirror 36 is equal to the distance between the prism 92 and the mirror 93 . visible light from the light - emitting diode 80 is reflected by the surface of the imaging lens 33 and returned as reflected light on the imaging device 40 . to prevent this , a filter 90 for transmitting infrared light and reflecting visible light is introduced between the infrared - transmitting / visible - reflecting mirror 36 and the half mirror 93 . the filter 90 has infrared transmitting characteristics , so that observation light impinges on the imaging device 40 without being cut by the filter 90 . in this embodiment , a liquid crystal display ( lcd ) device 87 may be disposed in place of the light - emitting diode 80 at a position r of the attachment unit 50 that is conjugate with the eye fundus . the liquid crystal display 87 is connected to the computer 84 via the controller 81 . targets , letters , striped patterns and the like are displayed on the display device 87 . the targets and the like displayed are projected onto the fundus of the eye to be examined as stimulation light in the same manner as the target created by the light - emitting diode 80 . for example , the target is displayed at a variety of positions on the display device 87 by a computer each time the shutter switch 46 is operated or through a prescribed program . the target displayed is then projected onto the eye fundus and recognized by the person being examined . upon recognition , the person being examined operates a response switch 83 to transmit a signal to the computer 84 , thus enabling the visual field of the person being examined to be measured . in addition , letters can be displayed on the display device 87 , and an examination can be performed in regard to whether the person being examined correctly recognizes the letters to examine weak eyesight . in this instance , a computer keyboard , touch panel , or other input means is provided to allow recognized letters to be input . alignment must be performed in any erg examinations that utilize a liquid crystal display device or a light - emitting diode . alignment is performed by directing infrared light on the eye fundus , capturing the light reflected therefrom using the imaging device 40 and displaying the image of the eye fundus on the monitor 41 . in all instances , the shutter switch 46 that is operated after alignment is complete serves as a start switch for starting the examination . fig6 shows a still further embodiment in which the ophthalmologic examination apparatus has a function for spectroscopically analyzing and examining an eye fundus . in fig6 , the same numeric symbols are applied to parts having functions that are the same as or similar to those of fig1 through 5 , and detailed descriptions thereof have accordingly been omitted . in the embodiment of fig6 , a mirror 100 that is intermittently driven using a mirror - rotating device 101 composed of a stepping motor or the like is disposed in a position p in the attachment unit 50 conjugate with the pupil in order to spectroscopically analyze an image of the eye fundus . the image of the eye fundus reflected by the mirror 100 is transmitted by a lens 102 , reflected by a mirror 103 , passed through a slit 104 , is reflected by a mirror 105 , transmitted by a lens 106 , and made incident on a spectral element 107 . the spectral element 107 has the same configuration as the prism / grating / prism ( pgp ) described in japanese laid - open patent application no . 2002 - 224041 . this element spectroscopically divides the image of the eye fundus slit by the slit 104 over a prescribed wavelength bandwidth in the longitudinal and perpendicular directions of the slit 104 . the spectroscopically divided image of the eye fundus passes through a lens 108 and impinges on an imaging device 109 composed of a ccd or the like . a spectral image of the slit image of the eye fundus is thus created and stored in a memory 110 . in such a configuration , when alignment is completed , the shutter switch 46 is operated , the light source 11 is turned on , and the eye fundus is illuminated while the mirror 100 is rotated in prescribed steps by the stepping motor . a line position of the image of the eye fundus created by the slit 104 changes in accordance with the rotation of the mirror , and slit images at the line positions of the eye fundus are captured by the imaging device 109 in accordance with the position of the mirror 100 . spectral data of the slit images of the eye fundus at the line positions as captured by the imaging device 109 are loaded into the memory 110 in synchronization with the line positions of the eye fundus obtained from the mirror - rotating device 101 , stored for each line and spectroscopically analyzed by a spectral image analyzing device ( not shown ) accordingly , an apparatus having the eye fundus image capture functions of the first and second embodiments can be converted to an apparatus that shares a large portion of the main unit while having a function for spectroscopically analyzing an image of the eye fundus . such an apparatus can be obtained merely by installing an attachment unit that has a function for spectroscopically analyzing an image of the eye fundus . | 0 |
with regard to the present invention , it is important to note that the salts utilized for the ion exchange process are lithium salts or a proton source . although it is contemplated that such salts can include ammonium hydrogen sulfate , lithium nitrate , lithium sulfate , other lithium salts , and protonating salts , for the purpose of the experiments conducted , ammonium hydrogen sulfate and lithium nitrate were used . a schematic of the ion exchange assembly utilized in experiments is shown in fig1 and is indicated generally by the reference numeral 20 . in experiments conducted , a crucible 21 was placed on a hot plate 22 . a molten salt bath 23 was prepared in the crucible 21 . in tests that were conducted , 20 grams of either lithium nitrate or ammonium hydrogen sulfate were used to prepare the molten salt bath . after an appropriate temperature of the molten salt bath was reached , for example of from 145 - 600 ° c ., glass samples 24 were placed into the molten salt ion exchange bath . appropriate glass can be soda silicate , soda lime silicate , boro silicate , and alumino silicate glass . in the tests that were conducted , the glass samples 24 were pyrex 7740 . the glass samples 24 were soaked for a specified period of time , for example 0 . 01 to 24 hours . the samples were then taken out of the salt bath and air - cooled to room temperature . they were then thoroughly rinsed with deionized water . the glass samples 24 could also be etched for cleaning the surface thereof prior to being subjected to anodic bonding . for example , a 50 / 50 by volume solution of nitric acid and sulfuric acid , for example 20 ml of each , could be used for the etch . the following table 1 shows the ranges of temperature and time utilized for the lithium and proton exchange treatments of the glass samples 24 . fig2 shows an apparatus used for laboratory testing of the present invention . the anodic bonding apparatus of fig2 is indicated generally by the reference numeral 40 . with the anodic bonding apparatus 40 utilized in one set of experiments , to minimize temperature gradients a ceramic - topped hot plate 41 was housed in an acrylic tube and lid 42 . leads 43 and 44 of a voltage source 45 were connected to gold - plated spring - loaded contacts in such a manner that the positively biased contact 43 was pressed against a graphite block 47 , and the negatively biased contact 44 was pressed against a glass sample 48 . it should be noted that with respect to the cathode , a gold - plated contact was used because it is non - blocking . in addition , for purposes of the experiments conducted , the contact was concentrated at a point so that the formation of the anodic bond could be easily observed and recorded . the anodic bonding temperature was measured using a k - type thermocouple ( indicated by the reference numeral 49 ) and an omega hh81 thermocouple indicator . the highest temperature reading measured on the graphite block was used as the temperature at which the anodic bond took place . after the appropriate temperature , for example from 100 ° c . to 500 ° c ., was reached , a potential was applied across the materials being bonded to one another , namely the glass sample 48 and the semiconducting material 50 , which in the embodiment illustrated in fig2 is a silicon wafer . the power source utilized in the experiments was a fluke model 408b ; any appropriate power source could of course be used . in the experiments conducted , in order to protect the ceramic - topped hot plate from arcing during the application of voltage , thin alumina plates were placed between the hot plate 41 and the graphite block 47 . it should be noted that the graphite block was used because it does not inject ions into the system ; in other words , the graphite block acts as a blocking anode . the relative robustness of the anodic bond that was produced using the apparatus of fig2 was determined by the forced insertion of a razor blade into the interface between the glass sample 48 and the silicon wafer 50 . if the bond did not fail , or if the pyrex broke leaving a layer of glass attached to the silicon wafer , then the bond was rated a 100 % anodic bond . if the glass sample 48 and silicon wafer 50 separated completely , then the bond was considered electrostatic and 0 % bond was recorded . if a portion of the glass sample 48 adhered to the silicon wafer 50 , then that percentage was recorded as the percent bonded . glass that has adhered to silicon is easily observed by visual inspection . anodic bonds of pyrex to silicon at temperatures below 300 ° c . have not been documented in the current anodic bond literature . as a matter of fact , there has been some reference to anodic bonds at temperatures below 300 ° c . as being kinetically impractical for commercial applications , m . harz , and h . engelke . “ curvature changing or flattening of anodically bonded silicon and borosilicate glass ,” sensors and actuators , vol . 64a , ( 1998 ) 95 - 100 . experimental confirmation of the time dependence with respect to temperature during anodic bonding of untreated pyrex wafers has been verified according to fig3 . clearly , as the temperature is lowered to temperatures below 320 ° c ., the time to complete an anodic bond increases significantly . furthermore , attempts to bond untreated pyrex at 280 ° c . with a voltage of 500vdc have been unsuccessful . using the apparatus of fig2 samples were anodically bonded for 10 minutes with an applied voltage of 2000vdc ( table 2 ). for each temperature , two replicates were run . bond quality was tested using the razor blade technique . as shown in table 2 , lithium - exchanged pyrex exhibited superior bonding qualities overall other treatments . at both 230 and 250 ° c ., lithium - exchanged pyrex formed 100 % anodic bonds . anodic bonds did not form at 230 ° c . for untreated samples . at 250 ° c ., only 90 % of the sample bonded . proton - exchanged pyrex also exhibited better bonding qualities than untreated pyrex . at 220 ° c ., 25 % of the sample bonded , and at 240 ° c . 100 % of the sample bonded . lithium - exchanged pyrex also exhibited superior bonding characteristics over untreated pyrex when voltages lower than 500vdc were applied at temperatures ranging between 280 and 320 ° c . lithium - exchanged pyrex bonded at 280 ° c . with an applied voltage of 500vdc while a bond for untreated pyrex did not form under the same operating conditions . furthermore , lithium - exchanged pyrex formed bonds at 320 ° c . when a voltage of 200vdc was applied . a bond did not form for untreated pyrex under the same operating conditions . experiments have also been conducted to demonstrate that the ion exchange technique of the present invention also works for , for example , six inch wafers that are bonded using a commercial bonder at low voltage , namely 200vdc , and 310 ° c ., as well as at low temperature , namely 250 ° c ., and 2000vdc , in both instances in less than 10 minutes . six inch , { fraction ( 1 / 4 )} inch thick pyrex 7740 wafers were lithium treated for ion exchange for 45 minutes at 325 ° c . 250 grams of lithium nitrate were used for the ion exchange . the treated samples were then subjected to a turgitol ( union carbide of danbury , conn .) semiconductor surfactant scrub with clean room texwipe ( texwipe co . llc , upper saddle river , n . j .) for 1 minute , and were then rinsed with deionized water . to further clean the treated pyrex wafers , 2030 ml of h 2 so 4 ( 96 % sulfuric acid ) was placed in a large quartz bowl . 870 ml of h 2 o 2 ( 30 % hydrogen peroxide ) was rapidly poured in the sulfuric acid . the treated pyrex wafer samples were then etched by the aforementioned mixture for 10 minutes for cleaning . the etched pyrex wafers were then removed from the solution and again rinsed with deionized water , this time for 10 minues . anodic bonding was then effected using a wafer fusion bonder model evg - 520 under the bonding parameters provided in the following table 3 . good bonds were formed on all samples . low temperature , in other words below 280 ° c ., and low voltage , in other words below 500vdc , anodic bonds form with the use of pyrex glass that has been surface modified pursuant to the present invention . in particular , experiments were conducted with pyrex glass pretreated in either a molten lithium nitrate or ammonium hydrogen sulfate bath . for lithium - exchanged pyrex , anodic bonds were formed with silicon at temperatures as low as 230 ° c . with an applied voltage of 2000vdc within 10 minutes . similarly , proton - exchanged pyrex formed anodic bonds at temperatures as low as 240 ° c . when a potential of 2000vdc was applied for 10 minutes . furthermore , low voltage anodic bonds readily form when lithium - exchanged pyrex is used as opposed to untreated pyrex . the present invention is , of course , in no way restricted to the specific disclosure of the specification and drawing , but also encompasses any modifications within the scope of the appended claims . | 7 |
referring to fig1 a non - integrated x - ray imaging system 2 is shown having a rotatable x - ray head 4 carried by an arm 6 and a mechanically separate planar x - ray imaging device 8 , such as a film cartridge or a digital imaging array , for recording an image of a patient 10 beneath whom it is located . the imaging device 8 is shown inclined at an angle to the horizontal . the x - ray head 4 contains an x - ray source ( not shown ) with which an x - ray exposure of the patient 10 can be carried out . a computer system 12 provides a user interface via which information , such as for controlling the duration and energy of an x - ray beam produced by the x - ray source , may be entered into a power supply / control unit 13 of the system 2 , which is responsive to the input to vary the power it supplies to the x - ray head 4 . a mobile x - ray generator 14 is shown in fig2 . this type of generator 14 is usually provided to be rolled to a bed of the patient when an x - ray image is needed . an x - ray head 16 is located at one end of an arm 18 and may be effectively adjusted vertically and horizontally with respect to a control / power supply unit 20 by rotation of the arm 18 about a first pivot axle 22 and a second pivot axle 24 . importantly for the system according to the present invention the x - ray head 16 is mounted for independent rotation about each of two orthogonal axes x and y , as shown by the arrows . as is well known in the art and as is shown in fig3 the x - ray head 16 contains an x - ray source , such as an x - ray tube 26 with a collimator 28 in the form of movable diaphragm plates 30 with which a generally rectangular x - ray beam 32 can be generated . the x - ray beam 17 is oriented in centered fashion on a planar , typically rectangular , imaging surface 34 of an imaging device , such as a film cartridge 36 that is arranged on an examination table ( or patient bed ) 38 . the preferable and most common mutual orientation of the head 16 and imaging surface 34 is illustrated in fig3 . wherein the central ray 40 of the x - ray beam 32 strikes the mid - point 42 of the planar imaging surface 34 perpendicularly to that surface 34 . to aid in the mutual orientation it is known to provide the head 16 of the system of fig2 with head angle sensors , as shown in fig4 . the head 16 is mounted in a cradle 44 by means of a rotational mount 46 for rotation of the head 16 about the axis x . the cradle 44 is itself rotatable about an axle 48 connected to the arm 6 for rotation of the head 16 about the axis y which is perpendicular to the other axis x . a first known head angle sensor 50 , of the ball type as described with regard to the mobilette system above , is mounted on an external surface of the head 16 at a first viewing station 52 for providing a display of the angle of inclination of the head 16 to the horizontal dependent on rotation about the associated axis x . a second known head angle sensor 54 is mounted on an external surface of the head 16 at a second viewing station 56 to be perpendicular to the first sensor 50 and provides a display of the angle of inclination of the head 16 to the horizontal dependent on rotation about the associated axis y . as can be seen from the figure an operator cannot read both head angle sensors 50 , 54 from a single operating location . a non - integrated x - ray imaging system according to the present invention for example , as illustrated in fig2 has an x - ray head 16 substantially similar to that illustrated in that figure and fig4 except that the angle sensors 50 , 54 have been removed and replaced with known angle sensors having an electrical signal output indicative of a detected angle of inclination , such as first and second accelerometers or inclinometers 58 , 60 illustrated schematically in fig5 . these head angle sensors 58 , 60 are arranged to measure inclinations of the head 16 as occur with rotations around the x and y axes respectively , to provide functional equivalence with known angle sensors 50 , 54 . fig5 shows a portion of the x - ray head 16 showing the first and the second head angle sensors 58 , 60 located internally of the head 16 with their outputs connected to a processing unit 62 which may include the functionality of a difference forming means as described below and which drives a display 64 . the display 64 is here illustrated as a visual display unit such as an lcd unit but may be of the type described below with reference to fig6 and is driven by the processing unit 62 to display angle information dependent on the angles measured by the first and second head angle sensors 58 , 60 . the display 64 thus acts to present angle information from each of the head angle sensors 58 , 60 at a single viewing station 66 , which is here shown to be an external wall section of the head 16 . alternatively , one or both of the processing unit 62 and the display 64 can be located in or on the power / control unit 20 of the imaging system of fig2 . it will be appreciated that the display 64 may also be formed by two displays in a side - by - side arrangement ( not shown ), one associated with each angle sensor 58 , 60 , while still being at a single viewing station 66 . a further form of the display 68 is shown in fig6 which is particularly useful for displaying differences between an actual angle of inclination , as measured by a one of the head angle sensors 58 , 60 , and a corresponding desired angle of inclination , as described in more detail below , to intuitively guide an operator to vary the inclination of the x - ray head 16 to achieve the proper orientation . the display 68 has a first linear array 70 of individually actuable light emitting diodes ( leds ) intersecting with and substantially perpendicular to a second linear array 72 of leds . the led 74 common to each array 70 , 72 is here arranged to be the middle led of each of the arrays 70 , 72 . when the arrays 70 , 72 are employed to display the differences , this middle led illuminates to indicate correct alignment ( zero angular difference between the head 16 and imaging device ). the operation of this display 68 is explained in greater detail below with regard to the non - integrated x - ray imaging system shown in fig7 . considering fig7 an x - ray head 76 , such as that shown in fig2 contains first and second head angle sensors 78 , 80 for measuring respective angles of inclination of the head 76 to the horizontal for rotation of the head 76 about respective perpendicular axes x and y , as described above . the head 16 is operably connected to a power / control unit 82 which provides power to energize an x - ray source ( not shown ) within the head 16 . an imaging device 84 , such as a digital imaging array or a film cartridge , is also provided in non - mechanical connection with the imaging head 76 so as to be mutually independently orientable . a first imaging angle sensor 86 and a second imaging angle sensor 88 are located with the imaging device 84 , each providing an output signal indicative of the inclination of a planar imaging surface 90 of the imaging device 84 to the horizontal to complement those angles measured by the head angle sensors 78 , 80 . the angles measured by the imaging angle sensors 86 , 88 provide desired angles which are to be attained by the x - ray head 76 ( as measured by the complementary head angle sensors 58 , 60 ). alternatively the imaging angle sensors 86 , 88 may be mounted on a support which is removably locatable on the imaging device 84 , preferably on or proximal with the planar imaging surface 90 . such a support may have two orthogonally arranged support bars , one for each imaging sensor 86 , 88 , which may be located on the imaging device 84 so as to lie substantially parallel with adjacent sides of the planar imaging surface . a processing unit 92 , such as a programmable microprocessor , is located within the power / control unit 82 and is arranged to receive signals from all sensors 78 , 80 , 86 , 88 representative of the angles measured by each of the sensors 78 , 80 , 86 , 88 and to form a difference between the desired angles measured by the imaging angle sensors 86 , 88 and respective angles measured by the complementary head angle sensors 78 , 80 . a signal indicative of this difference for rotation of the head around each of the x and y rotational axes provides a drive signal to a display 94 which is located either on the head 76 or the power / control unit 82 at a single viewing station . the display 94 responds to the drive signal by providing a visual display related to the thus formed differences . as also shown in fig7 a user input device 84 , such as a keypad or keyboard ( with or without an associated display ) is also provided , via which an operator may provide the desired angles , measured manually in a known manner , as an alternative to having the display 94 provided with imaging angle sensors 86 , 88 . in the embodiment of fig7 the display 94 has the two linear arrays 70 , 72 of leds of the type described in connection with fig6 . the array 72 is here associated with “ y - differences ”, for rotation of the head 76 around the y axis . this is the output from the second imaging angle sensor 88 minus that from the second head angle sensor 80 . the array 70 is here associated with “ x - differences ”, for rotation of the head 76 around the x axis . this is the output from the first imaging angle sensor 86 minus that from the first head angle sensor 78 . the processing unit 92 is programmed to form an x - difference and selectively activates one led 98 in the led array 70 , the location of which one led 98 is dependent on this x - difference . in this example the processor 92 operates to cause an individual led 98 in the led array 70 to illuminate , selected according to the rules : ( a ) for absolute values of x - differences greater than 10 degrees each led of the array 70 represents a variation of 10 degrees from the desired angle ( represented by the central led 74 ). ( b ) for absolute values of x - difference less than 10 degrees each led of the array 70 represents a variation of 1 degrees from the desired angle . thus as , shown in fig6 the processor 92 has formed an x - difference with an absolute value of either 2 degrees or of between 20 to 29 degrees . the processing unit 92 also is programmed to form a y - difference and selectively illuminates one led , 100 , in the led array 72 , the location of which one led 100 is dependent on this y - difference . in this example the processor 92 operates to illuminate an individual led in the led array 72 according to the rules , suitably amended for reference to the y - difference , set out above for illuminating an individual led in the array 70 , dependent on the x - difference . thus as , shown in fig6 the processor 92 has formed a y - difference with an absolute value of either 4 degrees or of between 40 to 49 degrees . the processing unit 92 is further programmed to utilize the signs of the x - and y - differences respectively determine on which side of the central led 74 the individual led will be illuminated . it will be appreciated by those skilled in the art that the resolution of the display can be readily adjusted to suit the particular application and the resolution of the angle sensors 78 , 80 , 86 , 88 used . it will be further appreciated that the individual led arrays 70 , 72 may be readily replaced by a visual display unit driven to display individual segements each corresponding to an individual led of the arrays 70 , 72 , which segments may be higlighted in a manner corresponding to the activation of an individual led 98 , 100 in each of the respective arrays 70 , 72 . the common led 74 can be operated by the processor 92 to blink until both desired angles have been attained by the x - ray head 76 , at which time the illumination will become constant . this blinking provides a enhanced visual warning to the operator that the orientation of the head 76 is incorrect . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art . | 0 |
fig1 depicts a simplified block diagram of a conventional video receiver 100 capable of decoding and processing a compressed digital video stream . receiver 100 includes a decoder 102 and a video processor 104 . decoder 102 includes an entropy decoder or variable length decoder ( vld ) 108 , an inverse quantization block 110 , an inverse transform block 112 , a motion compensation block 114 , and a de - blocker 118 . video processor 104 includes processing sub - blocks such as a scaling unit 120 , a de - interlace block 122 , color converter 124 and a video output interface 126 . video output interface 126 is interconnected with display 106 . decoder 102 and video processor 104 are in communication with a block of memory 116 which may be used to provide a frame buffer . output interface 126 may be a random access memory digital to analog converter ( ramdac ), digital visual interface ( dvi ) interface , a high definition multimedia interface ( hdmi ) interface or the like . display 106 , can be one of a television , computer monitor , liquid crystal display ( lcd ), a projector or the like . decoder 102 receives an encoded / compressed video stream , decodes it into pixel values and outputs decoded pixel data . the received input video stream may be compliant to an mpeg - 2 format , h . 264 ( mpeg - 4 part 10 ) format , vc - 1 ( smpte 421m ) format or the like . the input video stream may be received from a digital satellite receiver , or cable television set - top box , a local video archive , a flash memory , a dvd , an optical disc such as hd - dvd or blu - ray disc , or the like . video processor 104 receives the decoded pixel data from decoder 102 , processes the received data and provides a video image to an interconnected display 106 . scaling unit 120 , de - interlace block 122 , and color converter 124 are functional blocks that may be implemented as dedicated integrated circuits , or as firmware code executing on a microcontroller or a similar combination of hardware and software . decoded video data may be transferred from decoder 102 to video processor 104 using data lines 130 or memory 116 . an internal bus is used to transfer data from one sub - block to another with in decoder 102 , and video processor 104 respectively . the received video stream is entropy decoded by vld 108 . the output of vld 108 is then inverse quantized using inverse quantization block 110 and an inverse transform ( e . g ., inverse discrete cosine transform ) is carried out using inverse transform block 112 . after appropriate motion compensation in mc block 114 and removal of blocking artifacts in de - blocker 118 , decoded pixels are then output to video processor 104 . video processor 104 may perform a variety of video post processing functions such as scaling , de - interlacing , and color - space conversion before outputting a final image to display 106 . as noted above , some data corruption may occur during transmission and these errors may sometimes result in noticeable artifacts . for example , invalid values may be output by decoder 102 as a result of corrupted input values . invalid values may include pixel color components that are outside of valid ranges . at the encoder , input pixel color values of raw video are all within a predetermined bound or range , typically 0 - 255 for red , green and blue values . these rgb values are first transformed to yuv or ycbcr color - space and encoded using standard blocks for quantizing , transforming and entropy coding ( variable length coding ) to produce a compressed bit stream . fig2 depicts a color cube 200 in the rgb color - space . the color components may be gamma corrected r ′ g ′ b ′ values . each color is represented by its red component plotted along axis 202 , its green component along axis 204 and its blue component shown along axis 206 . thus each color may be represented by a point ( r ′, g ′, b ′) in the three dimensional color cube 200 . for example the color black is located at ( 0 , 0 , 0 ); while the color white is at ( 255 , 255 , 255 ). all points along diagonal line 208 represent grey valued colors ranging from black to white . the ycbcr color - space on the other hand , is a scaled and offset version of the yuv color - space . y is defined to have a nominal 8 - bit range of 16 - 235 ; cb and cr are defined to have a nominal range of 16 - 240 . the yuv color - space is used by pal ( phase alternation line ), ntsc ( national television system committee ), and secam ( sequential color with memory ) composite color video standards . detailed discussions of the relationship between ycbcr , yuv and r ′ g ′ b ′ color - spaces can be found in jack , keith . 2005 . video demystified : a handbook for the digital engineer 4th ed . oxford : elsevier , the contents of which are hereby incorporated by reference . conversions from yuv to gamma corrected r ′ g ′ b ′ values may be carried out using the following equations . similarly , conversions from ycbcr to gamma corrected r ′ g ′ b ′ values may be carried out using the following equations ( with y , cb , cr having nominal 8 - bit ranges of 16 - 235 , 16 - 235 , 16 - 235 respectively ). equations [ 1 ]-[ 3 ] are approximations and slightly different coefficients may be used for different applications depending on the display device , gamma correction , the video source , and the like . for example , the equations below may be used for some display terminals . not all possible ycbcr input values map to valid r ′ g ′ b ′ values within the defined range ( 0 - 255 for each of r ′, g ′ and b ′). this may be easily seen when examining the rgb color cube 200 ′ within the context of the ycbcr color - space as depicted in fig3 . as shown , there are many values in the ycbcr color - space 300 that lie outside the rgb cube 200 ′. in the presence of transmission errors , or due to defects in physical media such as dvds or optical discs , or other sources of error , invalid ycbcr color values may be output by decoder 102 of conventional receiver 100 ( of fig1 ). as noted , each ycbcr value is obtained from an r ′ g ′ b ′ color value . each r ′ g ′ b ′ color includes defined ranges for r ′, g ′ and b ′— for example , 0 - 255 when using 8 bits . thus , if a ycbcr value is transformed to rgb color - space using equations [ 1 ]-[ 3 ], then the resulting r ′, g ′ and b ′ values should be with in the defined range ( e . g ., 0 - 255 ). if any of the resulting r ′, g ′ or b ′ values are invalid — that is , they fall outside the defined range — then the received ycbcr value is likely corrupted . in other words , if the received video bit stream is corrupted , then decoded ycbcr values may be outside of color cube 200 ′. in conventional receivers such as receiver 100 , color converter 124 which converts color components from a non - rgb color - space to an rgb color - space , uses a simple logic to limit or clip the r ′ g ′ b ′ output to be within the defined range . for example , in rgb displays that use 8 - bits per color component , each color component may only range from 0 to 255 . during color - space conversion , color converter 124 substitutes 0 when a negative value is calculated for a given color component , while for a computed color component that is greater than 255 is truncated to 255 by color converter 124 . unfortunately , this often leads to very noticeable bright pink or bright green artifacts . for example , when cb and cr are negative or zero , the computed r , b components are also negative ( and hence typically truncated to 0 ) while the g component is positive , which leads to a green artifact . similarly when cb and cr are above 255 , a pink artifact may be observed after color - space conversion and truncation . to prevent such artifacts , video receivers exemplary of embodiments of the present invention may include a different logic to translate non - rgb ( e . g . ycbcr ) colors that do not map to predetermined bounds or valid ranges in the rgb color - space . accordingly , fig4 depicts a schematic block diagram of a video receiver 400 exemplary of an embodiment of the present invention . video receiver 400 accepts , decodes , and processes a compressed digital video stream , and outputs decoded images to an interconnected display 106 . receiver 400 may include a decoder 402 and a video processor 404 . decoder 402 may further include a variable length decoder ( vld ) 408 , an inverse quantization ( iq ) block 410 , an inverse transform block 412 , a motion compensation ( mc ) block 414 and an in - loop processing unit 406 . a microcontroller 430 in communication with decoder 402 may form part of receiver 400 . video processor 404 may include a scaling unit 420 , a de - interlace block 422 , color converter 424 and a video output interface 426 . decoder 402 and video processor 404 may be in communication with memory 416 which may be used to provide a frame buffer . decoder 402 and video processor 404 may contain combinatorial and sequential circuitry , numerous local memory blocks , first - in - first - out ( fifo ) memory structures , registers , and the like . output interface 426 may provide output signals compliant to video graphics array ( vga ), super vga ( svga ), digital visual interface ( dvi ), high definition multimedia interface ( hdmi ) or other display interface standards . display 106 may be a cathode ray tube ( crt ) monitor , lcd , a projector , a television set , a flat panel display or the like . scaling unit 420 , de - interlace block 422 , and color converter 424 may be substantially similar to their counterparts in fig1 and may be implemented in the form of dedicated circuits , firmware code executing on a microcontroller 428 , or some other suitable combination of hardware and software . a bus 428 may interconnect the various blocks and sub - blocks within receiver 400 . decoded video data may be transferred from decoder 402 to video processor 404 using bus 428 , memory 416 , or dedicated signal lines 432 . microcontroller 430 may program registers in sub - blocks such as inverse transform block 412 , motion compensation block 414 and an in - loop processing unit 406 using bus 428 . fig5 depicts an enlarged schematic diagram of in - loop processing unit 406 illustrating additional details . in - loop processing unit 406 may include filtering block 434 , memory unit 440 , an invalid color detector 442 , and control register 448 . memory unit 440 may further include an incoming data input interface 436 , data buffer 438 and output interface 444 . memory unit 440 may also include a flag register 450 . input interface 436 and output interface 444 may each include fifo structures . flag register 450 may have 2 m status bits or flags ( e . g . 2 6 = 64 flags ) and may be in communication with a bus 456 . detector 442 may include a color - space conversion block 460 interconnected to a number of comparators 462 a , 462 b , 462 c , 462 d , 462 e , 462 f , ( individually and collectively 462 ). detector 442 may be capable of writing to at least some of the 2 m status bits in register 450 using bus 456 . to address 2 m bits ( e . g . 64 bits ) in register 450 , bus 456 may have m address line ( i . e ., 6 address lines ), at least one data line and one or more control lines . in operation , decoder 402 may also receive a compressed video stream compliant to a known standard such as mpeg - 2 , h . 264 ( mpeg - 4 part 10 ), vc - 1 ( smpte 421m ). again , the encoded input video stream may be received from a digital satellite receiver , or cable television set - top box , a local video archive , a flash memory , a dvd , an optical disc such as hd - dvd or blu - ray disc , or the like . the received video stream is entropy decoded by vld 408 . the output of vld 108 is then inverse quantized using inverse quantization block 410 and an inverse transform may be carried out in inverse transform block 412 . the inverse transform may be the inverse discrete cosine transform ( idct ). the output of inverse transform block 412 may be received by mc block 414 which may carry out required motion compensation processing . output pixels from mc block 414 may be received by in - loop processing unit 406 directly ; or alternately may be placed memory 416 from which they may be read into in - loop processing unit 406 . video processor 404 may perform substantially the same functions as its counter part in fig1 ( video processor 104 ), including scaling , de - interlacing , color - space conversion and the like . in - loop processing unit 406 contains filtering block 434 which may be used to remove blocking artifacts that are often observed when a block - oriented transform ( such as dct ) is used by the encoding scheme to produce compressed video stream . an input bus 452 may be used to transfer data from mc block 414 to in - loop processing unit 406 . detector 442 may tap input bus 452 and perform detection of pixel color values that are outside rgb cube 200 ′ in fig3 and therefore would not map to valid an r ′ g ′ b ′ value . for example , in an exemplary embodiment using 8 - bits for each color component , detector 442 may signal output interface 444 by writing an error indicator bit to flag register 450 unless the conditions : 0 ≦ y + 1 . 732 ( cb − 128 )≦ 255 are all satisfied by y , cb and cr . as may be appreciated , the inequalities are derived directly from equations [ 1 ]-[ 3 ] above . similar inequalities derived from equations [ 4 ]-[ 6 ] may also be used . the inequalities can be tested by first using color - space conversion ( csc ) block 460 within detector 442 , to produce an intermediate pixel with r ′ g ′ b ′ components , and then using comparators 462 to determine if each component of the intermediate pixel is within predetermined bounds . csc block 460 may be implemented using standard adders , multipliers and coefficient registers . comparator 462 a may be used to test that r ′≦ r max ( e . g ., r max = 255 ). comparator 462 b may be used to test that 0 ≦ r ′ ( r ′ is computed by block 460 using equation [ 1 ]). similarly , comparator 462 c may be used to test that g ′≦ g max ( e . g ., g max = 255 ). comparator 462 d may be used to test that 0 ≦ g ′ ( g ′ is computed by block 460 using equation [ 2 ]). lastly , comparator 462 f may be used to test that 0 ≦ b ′ ( g ′ is computed by block 460 using equation [ 3 ]) while comparator 462 e may be used to test that b ′≦ b max ( e . g ., b max = 255 ). detector 442 may write an error indicator to flag register 450 using bus 456 for any pixel that fails to satisfy the above inequalities . prior to outputting a pixel to video processor 404 , output interface 444 may inspect flag register 450 and if an invalid color indicator bit is set then output interface 444 may replace the invalid pixel with a valid replacement pixel and output the valid pixel . in another exemplary embodiment , the detector need not dynamically compute equations [ 1 ]-[ 3 ] for each ( y , cb , cr ) component of a received pixel . instead , predetermined ranges ( y min , y max ), ( cb min , cb max ), ( cr min , cr max ), corresponding to y , cb and cr may be programmed into control register 448 . accordingly , fig6 displays another embodiment of a detector 442 ′ for determining if pixel in a first color - space ( e . g . ycbcr ), once color converted , would contain a component in a second color - space ( e . g . rgb ) that exceeds a predetermined bound , by performing a comparison of a pixel component in the first color - space ( e . g . y in ycbcr ) to a corresponding range in the same first color - space ( e . g ., y min to y max ). in other words , detector 442 ′ may compare a component of a pixel in a first color - space to a corresponding range also in the first color - space ( e . g . check that y min ≦ y ≦ y max ) to determine if transforming the pixel to a second ( e . g . rgb ) color - space , would lead to a component ( either r , g or b ) being outside its corresponding predetermined bound ( e . g . 0 to 255 ) in the second color space . detector 442 ′ may include a number of comparators 464 a , 464 b , 464 c , 464 d , 464 e , 464 f , ( individually and collectively 464 ). detector 442 ′ has the same input and output interfaces as detector 442 , and thus may be capable of writing to at least some of the 2 m status bits in register 450 using bus 456 . detector 442 ′ signals output interface 444 to output a replacement pixel when a component is found to be outside its corresponding range in the ycbcr color - space . exemplary values that may be commonly used to define these predetermined ranges include : other values may of course be used to define the ranges . in addition , in specific embodiments , a single range may be used for both chroma values — that is , a single value cbcr min in register 448 may be used as both cb min and cr min and similarly the same value cbcr max in register 448 may be used as both cb max and cr max . an error condition to trigger a pixel component replacement may be flagged if , for example , y & lt ; y min or y & gt ; y max . similarly , an error may be flagged when one of the conditions cb & lt ; cb min ; cr & lt ; cr min ; cb & gt ; cb max or cr & gt ; cr max is satisfied . unlike detector 442 ( fig5 ), detector 442 ′ in fig6 uses fixed limit values defined in the ycbcr space — i . e ., predetermined ranges ( y min , y max ), ( cb min , cb max ), ( cr min , cr max )— which are known to generate invalid color values in the rgb color space . thus , explicit ycbcr to rgb conversion is not needed in detector 442 ′. the replacement pixel may have color components that produce a grey pixel or a pixel color close to grey , so as not to produce highly visible artifacts . in one exemplary embodiment , output interface 444 may replace an invalid pixel containing color components ( y , cb , cr ), with a grey color pixel having color components ( y , 128 , 128 ) in the ycbcr color - space , if either one of cb or cr values is invalid . this replacement leaves the luma value y unchanged while the chroma values cr and cb are set to 128 each . conveniently , the replacement output pixel contains the same luma information ( y ) as the original input pixel . equations [ 1 ]-[ 3 ] indicate that replacing any invalid color with a pixel having components ( z , 128 , 128 ) for 0 ≦ z ≦ 255 in the ycbcr color - space , produces a valid grey color of the form ( z , z , z ) in rgb space . any color of the form ( z , z , z ) lies along line 208 ( in fig2 ) which represents all points of grey in rgb color cube 200 . as noted above , grey is far less noticeable than a bright pink or bright green artifact that often results from truncating values to 0 or 255 . noting that replacing an invalid color component with ( y , 128 , 128 ) would produces a valid color only if 0 ≦ y ≦ 255 , output interface 444 may replace invalid pixel with color components ( y , cb , cr ) with ( 128 , 128 , 128 ) if the invalid components include y ( that is , if y & lt ; 0 or y & gt ; 255 ). if y is an invalid component , output interface 444 may immediately replace y by 128 or more generally by 2 n - 1 when n bits are used to represent y . advantageously , detection of invalid values received via bus 452 by detector 442 , ahead of outputting pixels to video processor 404 allows for convenient replacement of the output pixel &# 39 ; s color components by output interface 444 . in another embodiment , output interface 444 may replace an invalid pixel containing color components ( y , cb , cr ), with a fixed grey color pixel having color components ( x , 128 , 128 ) in the ycbcr color - space . for 8 - bit per color component display , by choosing x so that it is in the range 0 ≦ x ≦ 255 , a valid rgb color - space output pixel would be sent to display 106 . again using equations [ 1 ]-[ 3 ], it can be easily verified that ( x , 128 , 128 ) in the ycbcr color - space translates to ( x , x , x ) in the rgb color - space . in one specific exemplary embodiment , x may be fixed to 128 so that the replacement pixel is ( 128 , 128 , 128 ) in the ycbcr as well as rgb color - spaces . in another embodiment , control register 448 may contain programmable fields for storing replacement color values y new , cr new and cb new . microcontroller 430 may program control register 448 with replacement color values y new , cr new and cb new . when detector 442 indicates to output interface 444 that a current pixel has invalid color components ( through bus 456 and flag register 450 ), then output interface 444 may replace the invalid pixel color values ( y , cb , cr ) with ( y new , cr new , cb new ) respectively . video processor 404 thus would receive the replacement pixel with components ( y new , cr new , cb new ) as its input . y new , cr new and cb new should be chosen so that they fall within color cube 200 ′ in fig2 ( that is , they can be transformed to a valid color in the rgb color - space without further processing ). advantageously programmable replacement color values allow the replacement colors to be adapted to the input video sequence as needed . thus when out - of - range colors are detected , even less noticeable replacement colors ( than grey colors ) may be used instead of predetermined color values . for example , if a pixel is found to be corrupted , it may be replaced by a pixel derived from its neighboring pixels . in particular , the pixel to the left , above and above - left of a corrupted pixel , may be used to compute the replacement pixel . neighboring pixels may be buffered in buffer 438 and used for computing a replacement pixel . various methods for computing the replacement pixel from neighboring pixels such as averaging , substitution , filtering , interpolation and the like , are well known to those of ordinary skill in the art . the replacement strategy — that is , whether to use neighboring pixels , replace a color component , use a completely predetermined pixel , etc . may be selectable by appropriately programming the video receiver hardware ( via a control register 448 , for example ). the above embodiments are discussed for cases in which color pixels ready for display output are represented by 8 - bits per color component . however , the skilled reader would readily appreciate that for general representations with n - bits per color component , the range of valid ( r ′, g ′, b ′) values may be determined by the conditions { r min ≦ r ′≦ r max }, { g min ≦ g ′≦ g max } and { b min ≦ b ′≦ b max } in which typically r min = g min = b min = 0 and r max = g max = b max = 2 n − 1 . similarly the ranges ( y min , y max ), ( cb min , cb max ), ( cr min , cr max ) may be set to different values depending on n . thus for example , instead of using ( y , 128 , 128 ) for an invalid cr or cb component of an input pixel , for the general n - bit case , output interface 444 may use a replacement color of the form ( y , 2 n - 1 , 2 n - 1 ) for 0 ≦ y ≦ 2 n − 1 in ycbcr color - space , to produce a grey output pixel of the form ( y , y , y ) in rgb color - space . in an alternate embodiment , decoding and video processing operations may be combined in a single circuit which outputs r ′ g ′ b ′ colors . here , color replacement may take place in the rgb color - space . in this case , computed r ′, g ′ and b ′ values may be temporarily stored in a buffer . if an interconnected display device represents each color component using n - bits , then a temporary buffer may be used to store each color component using m bits ( m & gt ; n ) per color component to allow examination of r ′, g ′ and b ′ without truncating them to n - bit values due to overflow . if at least one of r ′, g ′, or b ′ does not fall with in the range 0 to 2 n − 1 , replacement color pixel of the form ( z , z , z ) in rgb color - space with z ≈ 2 n - 1 ( and 0 ≦ z ≦ 2 n − 1 ) may be used to output a grey color ( replacement pixel ) directly in rgb color - space . replacing ycbcr pixels in in - loop processing unit 406 rather than replacing the transformed rgb pixels , may be advantageous as it allows a conventional video processor to be used . a video receiver , exemplary of an embodiment of the present invention , may thus contain a conventional video processor ( such as video processor 108 ) interconnected with a video decoder such as decoder 402 . such a receiver would deliver the benefits of the present invention while still using a conventional video processor . this may be particularly advantageous in applications in which the decoder and the display processor ( video processor ) are independent from each other . thus , in typical implementations the pixel replacement may be done within in - loop processing unit 406 while decoded ycbcr pixels are still in a pipeline , rather than at the display processing stage ( e . g ., in video processor 404 ) in which an extra processing filter would likely be required . circuits exemplary of embodiments of the present invention may be used in graphics display adapters . a graphics display adapter may include an exemplary circuit such as decoder 402 , in communication with an external color - space converter unit ( such as color converter 424 ). the color - space converter accepts its input from the exemplary circuit in ycbcr space and outputs a corresponding pixel for display in r ′ g ′ b ′ space to a display output interface . since the exemplary circuit would ensure that its output ( color converter &# 39 ; s input ) pixel components would map to valid r ′ g ′ b ′ values ( i . e ., within predetermined ranges for r ′, g ′ and b ′) artifacts associated with clipping would be avoided . advantageously , the external color converter unit may be a conventional color converter . that is , the exemplary circuit would provide to a conventional color converter , an input ( in ycbcr color - space ) that is guaranteed to have its r ′ g ′ b components ( after color conversions ) falling within their corresponding predetermined ranges ( e . g ., 0 to 255 ). conveniently , this allows off the shelf color converter units ( e . g ., color converter 124 ) to be used , while delivering the benefits of the present invention . exemplary embodiments of the present invention may be used in conjunction with other error correcting methods implemented in vld 408 , iq block 410 , inverse transform block 412 and mc block 414 . as noted , some of the corrupted pixels that are received , may not be detected and corrected in these blocks , and thus it is advantageous to include embodiments of the present invention in video receivers . in addition , some video coding standards may devote a higher proportion of the transmission bandwidth to actual video data and a correspondingly lower proportion to error correcting codes . this may lead to an increased number of received bit errors , which in turn makes the use of embodiments of the present invention in video receivers adapted to receive encoded video streams so encoded , desirable . of course , the above described embodiments are intended to be illustrative only and in no way limiting . the described embodiments of carrying out the invention are susceptible to many modifications of form , arrangement of parts , details and order of operation . the invention , rather , is intended to encompass all such modification within its scope , as defined by the claims . | 6 |
fig1 illustrates the golf swing practice device according to the present invention generally designed by reference number 10 . the device 10 comprises a harness portion 12 which is coupled to preferably adjustable rod shaped elements 14 ( see fig2 ) that are coupled by swivel clamping mechanism 16 ( see also fig2 and 3 ) to handle position 18 of a golf club 20 . the harness portion 12 preferably comprises four adjustable straps 22 , 24 , 26 and 28 each of which have respective strap adjusting elements 30 , 32 , 34 and 36 . a cruciform shaped back strap attaching member 38 serves to attach each of the straps 22 , 24 , 26 and 28 thereto on the back of a golfer when the device 10 is placed on a golfer &# 39 ; s body . the harness portion 12 also comprises a front strap attaching member 40 which serves by means of four slits therein to couple the four straps 22 , 24 , 26 and 28 thereto and also functions to support ball - socket assembly 42 ( see also fig2 ). the ball - socket assembly 42 which is centrally located ( see fig4 ) comprises ball member 44 movably contained within socket member 46 ( see fig2 ). shaft 48 which is secured to the ball member 44 ( is shown in fig2 ) is connected by washer 50 and nut 52 that attaches threaded end portion 54 to end cup shaped member 56 of elements 14 . the elements 14 preferably comprise two rod shaped members 58 and 60 wherein rod shaped member 60 telescopes within rod shaped member 58 . the rod shaped member 58 can be changed in length , as desired , according to the length of the arms of the golfer and also according to the length of use of the device 10 . for example , gradual extension of a golfer &# 39 ; s swing can be established using a slightly increased length rod shaped member 58 as compared to the initially used member 58 . the use of increasingly longer tubes 58 adds more extension to a golfer &# 39 ; s swing therefore creating more distance and giving the player &# 39 ; s body more flexibility . the rod shaped member 58 is attached to the end cup shaped member 56 such as by the use of a slip fit between the inner surface portion of the end cup shaped member 56 and the outer surface portion of the outer end of the rod shaped member 58 . end portion 62 of the rod shaped member 60 is connected , as shown in fig2 to the swivel clamping mechanism 16 . bolt 64 connects end portion 62 ( by means of an aperture therein ) to element 66 that contains an internally threaded recess portion to couple to the bolt 64 . swivel clamp 68 ( see fig3 ) permits , by a simple and easy to use finger screw device 70 , attachment of clamp 68 to the handle 18 of the golf club 20 as shown in fig1 . as shown in fig2 and 3 , swiveling action of the swivel clamp 68 is achieved by means of rotation of connection member 67 about coupling member 69 which is a very important aspect or feature of this invention because a golfer can properly cock their wrists during the back swing and subsequent down swing due to the swiveling action of the swivel clamp 68 . the main purpose of the swivel clamp 16 is to achieve a proper hinge of the golfer &# 39 ; s wrists on the back swing . the swivel clamping device 16 allows proper wrist hinging because it swivels on a plane that allows for accepted hand / wrist position throughout the swing . a major fault of most golfers is casting or throwing the golf club from the top of their swing , however , in the device of this invention , the golfer keeps the rod or tube 60 from separating from rod or tube 58 at the beginning of the downswing by exerting a slight downward pressure . this feature allows the player to create a proper downswing path delaying the wrist break and allowing for longer and straighter shots . the swivel clamping device 16 is important to the invention because it allows the wrists to hinge properly on the backswing and release on the downswing . referring to fig6 and 7 , the device 10 is shown in use by a golfer for striking a golf ball off of a tee using the golf club ( which in this case is a driver ) 20 . in fig6 the golfer is shown in position ready to bring his golf club 20 back in a proper swing to strike the golf ball off of the tee . in fig7 the golfer is shown bringing his golf club 20 back for the golf shot and this view clearly depicts the significant advantages of the device 10 in enabling and , because of the arrangement of the various elements of the device 10 , forcing the golfer to create a proper golf swing by bringing back the left arm ( for a right handed golfer as shown in fig6 and 7 ) without bending the elbow ( which if significantly bent is generally considered to be bad for a proper golf swing ). fig7 discloses that when the hands are about waist high , this is considered by all teachers of the game to be a significant checkpoint in the swing . at this point the toe of the club should be pointing straight up and the leading edge of the club perpendicular to the ground . the swivel clamp 16 allows a golfer to readily achieve this desired position therefore , this device 10 requires a golfer to always practice striking a golf ball without significantly bending the front elbow thereby achieving a proper golf swing . while the invention has been described in its preferred embodiments , it is to be understood that the words which have been used are words of description rather than limitation and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the invention in its broader aspects . as shown in the drawings , the device 10 is connected to the handle 18 of the golf club 20 spaced from the end of the handle 18 thereby permitting the golfer to position their hands on the handle 18 , but yet permit the entire swing of the golf club 20 to be controlled to obtain a proper swing without undesired bending of the front elbow . | 0 |
referring to the drawings , fig1 illustrates a first form of the present invention , that is , a multi - head robot system 100 capable of delivering numerous robotic devices 130 to a task site or first workstation 150 . in the embodiment depicted in fig1 a series of robotic devices 130 are shown removably attached to a drive belt 120 . the drive belt 120 may be a chain , belt , cable or other suitable means for moving the robotic devices 130 along a track 110 . a machine vision control system 180 monitors the location and movement of the robotic devices 130 . the robotic devices rest upon the track 110 , and are propelled or carried along the track by the drive belt 120 . the track 110 is supported by frame members 160 . similarly , the drive belt 120 is supported by structural members 170 . finally , a plurality of work pieces 140 are located on a first workstation 150 . in a typical processing routine , robotic devices 130 are removably attached to the drive belt 120 . the robotic devices 130 are also attached to the track 110 in such a manner that they may glide along track 110 when they are propelled by drive belt 120 . a drive system ( not shown ) controls the speed and direction of drive belt 120 , through driven , rotating spindles 190 . during operation , the drive belt 120 is maintained at a desired speed . the robotic devices 130 travel around the route defined by the track 110 until machine vision control system 180 or some other sensing means determines that a particular robotic device 130 is in an appropriate position to perform process steps on a particular workpiece 140 . at this time , the robotic device 130 is optionally decoupled from the drive belt 120 , and its end effector 210 ( fig2 ) will commence operations on the workpiece 140 . in the embodiment depicted in fig2 the end effector 210 includes a vacuum head which picks up a workpiece 140 . the robotic device 130 subsequently reacquires the drive belt 120 , so that the robotic device 130 and the workpiece 140 are moved along the track 120 . as shown in fig1 at a designated point in the route , for example , at a second designated workstation 155 , the robotic device 130 again optionally decouples from the drive belt 120 , and its end effector 210 ( fig2 ) will again perform operations on the workpiece 140 . in the embodiment depicted in fig1 and 2 , the end effector 210 vacuum head now places the workpiece 140 at an appropriate location on the second workstation 155 , and the vacuum head of the end effector 210 releases the workpiece 140 . the robotic device 130 subsequently reacquires the drive belt 120 , and the robotic device 130 is transported further along the track 120 . in this manner , the robotic device 130 is once more ready to repeat the pick and place operation described supra , or any other operation suitable for a robotic device . it should be noted that the drive belt 120 can maintain a high speed throughout the pick and place operation . this is possible because the robotic device 130 engages and disengages from the drive belt 120 when at an appropriate location , or when commanded to do so by a machine vision control system 180 or the like . this allows a plurality of robotic devices 130 to be in operation simultaneously . the net result is a dramatic increase in throughput for the process line , especially when compared to existing robotic systems . referring now to fig3 a second embodiment is illustrated , wherein each of the numerous robotic devices 130 includes an end effector docking / locking device 310 capable of independently performing complex operations or manipulations on a workpiece 340 . the docking / locking device is further disclosed in u . s . patent application ser . no . 60 / 195 , 064 , filed concurrently , which patent application is hereby incorporated by reference . each docking / locking device 310 is capable of stand alone operation when it is properly docked and locked to a workpiece 340 , and the docking / locking device 310 may either receive command signals and power from the workstation , or from internal sources . the embodiment shown in fig3 is a novel automation device characterized by three important features , namely , high throughput , high precision , and a relatively long process setting time . in fig3 individual docking / locking devices 310 are shuttled around a track 110 by a drive belt 120 . the docking / locking devices 310 are able to pick objects ( not shown ) from trays 340 at a first workstation 370 and subsequently place them in openings 360 of component tray 350 at a second workstation 380 . the docking / locking devices 310 are able to disengage from and reacquire the drive belt 120 at either workstation 370 , 380 . the docking / locking devices 310 are further able to temporarily dock to portions of the workstations 370 , 380 , by mating docking pins 395 to docking holes 390 . once docked at the workstation 370 , 380 and locked into place , the docking / locking devices 310 are able to perform any robotic manipulation necessary to further complete production of the device under assembly . several alternative drive systems contemplated by the inventor will now be discussed . referring to fig4 a , a first embodiment 400 is illustrated . this embodiment 400 incorporates a track 490 ( e . g ., railroad track , i - beam , etc . ), and riding on the track 490 is a truck 415 from which is suspended a robotic device 130 , docking / locking device 310 , or the like . the truck 415 also includes at least one first wheeled carriage 410 to facilitate movement of the truck 415 along the track 490 . a second wheeled carriage 420 can be attached to ride along the opposite side of the track 415 from the first wheeled carriage 410 . this configuration yields improved balance , and smoother operation , when the truck 415 moves along the track 490 . the embodiment 401 of the present invention illustrated in fig4 b builds on the concept of fig4 a . the embodiment 401 includes a drive chain 440 which engages the truck 415 via a drive gear or cog 450 which contains a clutch mechanism ( not shown ). controlled movement of the drive chain 440 thus propels the truck 415 . the truck 415 is thus equipped with a disconnect means ( i . e ., the drive gear or cog 450 containing a clutch mechanism ) which allows the truck 415 to release or reacquire the drive chain 440 as necessary . [ 0054 ] fig4 c depicts another embellishment of the embodiment 401 of fig4 b . in this embodiment 402 , a fixed chain 440 is added to the system . the fixed chain 440 is operatively connected to the truck 415 via a geared braking mechanism 480 . the geared braking mechanism 480 permits the truck 415 to more positively stop when it approaches some desired position where it is to detach from the drive chain 440 . in an alternative model , the fixed chain 440 can be geared to rotate an encoder shaft ( not shown ) to give positional feedback to the robotic system . yet another embodiment 500 is shown in fig5 wherein a double - linked drive chain 510 is used to provide two functions . first , one side of the double - linked drive chain 510 passes over support gears 530 which support the double - linked drive chain 510 . second , the robot drive gear 520 is used to propel a robot - laden truck 415 . referring now to fig6 a drop / pinch cable drive system 600 for transporting robotic devices is shown . in this drive system 600 , a moving cable 640 , maintained in motion , is used to carry the robotic device carriers 630 in place of a drive chain or drive belt . in operation , a plurality of robotic device carriers 630 are positioned as ready spares in a wait zone 610 . the robotic device carriers 630 are positioned above the cable 640 . a pusher mechanism 620 is used to push a robotic device carrier 630 away from the wait zone 610 and onto the moving cable 640 . once on the moving cable 640 , the robotic device carrier 630 operates as explained supra regarding the multi - head tracked robot system 100 . at such time as it becomes desirable to remove a robotic device carrier 630 from the moving cable 640 ( e . g ., for maintenance , no further use , etc .) the robotic device carrier 630 is guided to an unload zone 650 . the unload zone 650 includes a ramp or other means for removing the robotic device carrier 630 from the moving cable 640 . in an alternative embodiment ( not shown ) of this model , a track is used to support the weight of the robotic device carrier 630 , and the robotic device carrier 630 includes a pinching mechanism to grip the moving cable 640 . another alternative embodiment ( not shown ) utilizes a plurality of parallel cables to provide additional structural support and / or room for additional robotic device carriers 630 . the illustrations of fig7 , 9 a , 9 b , 9 c , and 9 d represent versions of the invention adapted for the unloading of the contents of a cargo trailer 720 . in fig7 a multi - head tracked robot system 700 , of the present invention , is shown which is capable of delivering numerous robotic devices 730 to the interior of cargo trailer 720 via a track , moving cable , or the like 710 . as described , supra , each of the robotic devices 730 is capable of picking a single package 725 and placing it on a conveyor or workstation 740 . for instance , the robotic devices 130 may have grippers or suction cups that are faced externally to the track loop . a vision system may be used to guide the robotic devices 130 to the proper package to pick . gripper types can be assigned to ensure the best match between gripper type and package to be picked . also in this embodiment is the capability to move the entire multi - head tracked robot system 700 in three ( x , y , z ) dimensions , namely horizontally , from side to side within , and into and out of , the interior of the cargo trailer 720 , and vertically within the interior . this allows the multi - head tracked robot system 700 to clear packages 725 from anywhere within the cargo trailer . the entire robot system 700 can be placed on rollers or wheels to facilitate this movement . a modification to the apparatus of fig7 is shown in fig8 . the apparatus 800 is similar to that discussed regarding fig7 except that fig8 includes moveable spindles 820 , 840 which are moved forward and backwards , enabling the picking end 860 of the multi - head tracked robot system 800 to move into and out of the cargo trailer 720 . another alternate embodiment of fig7 is presented in fig9 a , 9b , 9 c , and 9 d . rotating spindle 960 has a relatively fixed location , while rotating spindles 920 , 940 , and 950 do not have a fixed location , i . e ., they can move forward and backward , thereby allowing the multi - head tracked robot system 910 to move into ( e . g . fig9 b ) and out of ( e . g . fig9 c ) the cargo trailer 720 . rotating spindles 920 and 960 act in combination to provide a method of taking up slack in the drive belt or chain 915 . [ 0060 ] fig9 d represents a method of bypassing spindle 960 by using a jumper 925 from spindle 920 to belt portion . the jumper 925 is useful to avoid having the drive belt or chain 915 jog in one direction and immediately jog in the other direction while the drive belt or chain 915 reverses direction . still another alternative embodiment is shown in fig1 a , 10b , and 10 c . this embodiment 1000 includes a guide track 1010 upon which the robotic devices 130 ( fig1 ) move . at least one area 1020 of guide track 1010 includes a portion 1030 that is hingedly movable so as to allow branching of the guide track 1010 , which permits rerouting of robotic devices 130 onto a second guide track 1040 . referring now to fig1 , there is shown an embodiment 1100 utilizing a first guide track 1110 with a first drive chain ( not shown ) operating below it . a drive gear 1130 , mounted on the robotic device , operatively and simultaneously connects this first guide track 1110 and first drive chain to a second guide track 1120 and a second drive chain ( not shown ). the gear teeth and the speed of the drive gear 1130 ensure that the first and second drive chains operate at the same speed . this embodiment 1100 ( fig1 ) also includes two track supporting guides 1140 , 1160 mounted on the robotic device ( not shown ) which enable gear 1150 to catch and release either of the first or second guide tracks 1110 , 1120 , respectively , as shown in fig1 b . thus , the robotic device ( not shown ) can use each parallel track for support , and can switch from moving along the first guide track 1110 to moving along the second guide track 1120 . the embodiment 1200 of fig1 is similar to that of fig2 except that fig1 illustrates a spatula - type gripper 210 . when used as an end effector , the spatula - type gripper 210 is useful for lifting up fragile items ( e . g ., cookies or candies ) which may otherwise be damaged , particularly when the end effector does not come to a complete stop while picking the item . the embodiment 1300 depicted in fig1 is that of a multi - head tracked robot system 1310 which utilizes both sides 1314 , 1316 of the track . in a typical operating mode , incoming items 1340 to be singulated are scanned by a machine vision system ( e . g ., a line scan camera ). next , the items 1340 are conveyed , by incoming conveyors 1350 , under the robotic devices 1330 , which pick some or all of the items 1340 and place them on the outgoing conveyors 1360 . under certain circumstances , it is necessary to use a processing technique called “ recirculation ” to deal with a plurality of items which are piled too deeply for the initial vision system scan to determine where all of the items are located . fig1 illustrates one example of this . in the embodiment 1400 , a conveyor 1450 is configured to recirculate the items 1440 back to the initial scanning location 1480 . the recirculation model may include a second vision system ( not shown ) as well as the picking of items 1440 from the recirculation side 1445 of the conveyor 1450 , for higher overall efficiency . two laboratory automation schemes are represented by fig1 . in fig1 , the feet 1535 of the robotic device 1530 are docked to a tray 1520 of a plurality of wells 1525 . the tray 1520 be one of a plurality of trays situated in a pallet ( not shown ). the robotic devices 1530 will dock to the tray 1520 or pallet by mating docking pins 1545 to docking holes 1540 . once the robotic device 1530 or devices have docked to the tray 1520 or pallet , the robotic devices 1530 can dispense simultaneously into the wells 1525 . the robotic devices 1530 are then refilled on the opposite side of the multi - head tracked robotic system 1500 . in a second , similar , laboratory automation scheme , newly filled robotic devices 1530 are cycled in to the filling station , while empty robotic devices 1530 are cycled to the opposite side of the multi - head tracked robotic system 1500 where they are refilled . while preferred and particular embodiments of the present invention have been described herein for purposes of illustration , many modifications and changes will become apparent to those skilled in the art . accordingly , the appended claims are intended to encompass all such modifications and changes as fall within the true spirit and scope of this invention . | 1 |
fig1 depicts a block diagram of a data processing system in which the present invention can be implemented . data processing system 100 includes a computer platform 104 . one or more application programs 102 and an operating system 108 operate on the computer platform 104 . the computer platform 104 includes a hardware unit 112 . the hardware unit 112 includes one or more central processing units ( cpus ) 116 , a random access memory ( ram ) 114 and an input / output ( i / o ) interface 118 . peripheral components such as a terminal 126 , a data storage device 130 and a printing device 134 may be connected to the computer platform 104 . an operating system 108 according to the present invention may provide a service to application programs 102 so the applications 102 , through the service , may explicitly allocate and deallocate memory off of a heap . those of ordinary skill in the art will appreciate that the hardware and basic configuration depicted in fig1 may vary . for example , other devices / components may be used in addition to or in place of the hardware depicted . the depicted example is not meant to imply architectural limitations with respect to the present invention . the presentation of a particular data processing system configuration is therefore not limiting on the scope of the invention . a computer program for implementing various functions or for conveying information may be supplied on media such as one or more dvd / cd - roms and / or floppy disks and then stored on a hard disk , for example . the data processing system shown in fig1 may be connected to a network such as the internet , or a local or wide area dedicated or private network , for example . a program that can be implemented by a data processing system may also be supplied on a telecommunications medium , for example over a telecommunications network and / or the internet , and embodied as an electronic signal . for a data processing system operating as a wireless terminal over a radio telephone network , the telecommunications medium may be a radio frequency carrier wave carrying suitable encoded signals representing the computer program and data . optionally , the carrier wave may be an optical carrier wave for an optical fibre link or any other suitable carrier medium for a telecommunications system . illustrated within memory 114 in fig1 are os 108 and application 102 . application 102 refers to one or more processes being currently run on the data processing system 100 ( by a processor that is not shown ). hereinafter , the term “ process ” is used to refer to any program running on the data processing system . alternatively , application 102 could refer to a process being currently run on a separate data processing system connected to the data processing system 100 , and to which memory 114 is accessible . os 108 is a software ( or firmware ) component of the data processing system 100 which provides an environment for the execution of programs by providing specific services to the programs including loading the programs into memory and running the programs . the os also provides resource allocation when there are multiple users or jobs running simultaneously , including managing the sharing of internal memory among multiple applications and / or processes and handling input and output control , file and data management , communication control and related services . application programs make requests for services to the os through an application program interface ( not shown ). fig2 is a block diagram of a process initiating a memory allocation procedure . there is shown a plurality of computer processes , 50 a . . . 50 n , interacting with an os 108 of the data processing system 100 . the os includes a memory allocation mechanism 54 which controls the allocation of memory to processes 50 a . . . 50 n . the memory allocation mechanism maintains a list , r 1 , of available memory blocks indexed by their size and address ( traditionally the address of the first byte of the available block ), and a list r 2 , of unavailable or allocated memory blocks . herein , the term “ block ” is used to refer to any sized block of memory including a single byte of memory . the memory allocation mechanism may allocate blocks of physical memory or areas of a virtual memory which can be translated into a physical memory block by a memory mapping , as is well known in the art . fig3 is a flowchart illustrating the process of simulating a memory allocation failure according to an embodiment of the present invention . those skilled in the art will appreciate from the following description that although the steps comprising the flowchart are illustrated in a sequential order , many of the steps illustrated in fig3 can be performed concurrently or in an alternative order . at step 302 , a range of memory block sizes which results in a memory allocation failure is determined . the range of memory block sizes can be specified in a memory allocation function , such as a malloc ( ) function in the c programming language . this function may be written in a number of programming languages , including , but not limited to , c ++, java , fortran , cobol , pascal , and any other programming language known to one skilled in the art . below is a simple example of a malloc ( ) function written in the c programming language that specifies a memory size range of memory allocation failure : /* if min_memory_size_failure is set to 11 and max_memory_size_failure is set to 999 , the second malloc will fail , while allowing the other two allocations to succeed . /* char * chunk1 =( char *) libmalloc ( 10 ); char * chunk2 =( char *) libmalloc ( 100 ); char * chunk3 =( char *) libmalloc ( 1000 ); /* insert code here to handle allocation failure and respond accordingly . */ iibfree ( chunk1 ); libfree ( chunk2 ); libfree ( chunk3 ); return 0 ; min_memory_size_failure and max_memory_size_failure values can be set within the function to specify the range of memory sizes which result in a memory allocation failure . the range of memory failures is a pre - determined range of memory block sizes based on simulation criteria for which a failure is being conducted . in an embodiment of the invention , the range of memory sizes which result in a memory allocation failure can be inclusive of the min_memory_size_failure and max_memory_size_failure values . in another embodiment of the invention , the range of memory sizes which result in a memory allocation failure can be exclusive of the min_memory_size_failure and max_memory_size_failure values . thus , the condition for a failure is inversed , and all memory sizes outside of the defined range will result in a memory allocation failure . in step 304 , the application is initialized . the application can be initialized manually or automatically based on an input or pre - defined script . in step 306 , the application is executed . in step 308 , the memory allocation function , such as the malloc ( ) function above , is executed so that that the requested memory sizes for the application are read through the function . in an embodiment of the present invention , the invention can be used in a multithreaded application where step 306 and step 308 can occur concurrently with each other . in a single threaded application , step 306 and step 308 occur sequentially as described above . at step 310 , the function determines if the requested memory size for the application is within the min_memory_size_failure and max_memory_size_failure values defined in the function . in the malloc ( ) function above , the determination is made by the following lines of code , where a “ null ” value results in an error or failure in memory allocation . if the requested memory size is within the specified range , the process continues to step 312 , where a memory allocation failure is returned . however , if the requested memory size is not within the specified range , then the application does not return a memory allocation failure , and a valid memory block is returned at step 314 . by varying the min_memory_size_failure and max_memory_size_failure values in the function , various ranges of sizes can be used to test for error handling during memory allocation failures . furthermore , the range can remain the same , allowing a modification to the system or another area of the software which may affect error handling or performance of the application . the variation of the memory size ranges can be based on a pre - determined range of memory block sizes based on simulation criteria for which a failure is being conducted . in an embodiment of the present invention , multiple memory size ranges can be specified within the function . this allows multiple size ranges to trigger failures , and error handling of an application can be observed for multiple concurrent size requests . while the specification has been disclosed in relation to the exemplary and non - limiting embodiments provided herein , it is noted that the inventive principles are not limited to these embodiments and include other permutations and deviations without departing from the spirit of the invention . | 6 |
referring now more particularly to the drawings , and to those embodiments of the invention here chosen by way of illustration , it will be seen in fig1 of the drawings that the spray dispensing system of the present invention will be described in connection with a squeezable bottle 1 holding a quantity of a liquid or other fluent material 2 . squeezable bottle 1 can be made from any suitable plastic known in the art . a spray dispensing device housing 17 is adapted to be mountable atop a neck 5 of bottle 1 . the device includes a dip tube 3 which is sized so that its bottom open end 4 is disposed near the bottom of bottle 1 when the spray dispensing device is mounted on the bottle . the top end of dip tube 3 receives a restricted conduit 6 of a ballcheck valve 7 . restricted conduit 6 communicates with dip tube so as to allow fluid 2 to pass therethrough . the inner diameter of restricted conduit 6 is smaller than the diameter of ball 8 of ballcheck valve 7 so that ball 8 ordinarily sits atop restricted conduit 6 . when ball 8 is in this position , the ballcheck valve 7 is closed so that the top end of dip tube 3 is also closed . the inner diameter of the remainder of ballcheck valve 7 is larger than the diameter of ball 8 . in this way ball 8 is free to move upward in response to upward movement of fluid in the dip tube to open ballcheck valve 7 . the top of ballcheck valve 7 receives a coaxially disposed feed tube 9 which allows for the passage of fluid from restricted conduit 6 toward valve 10 . feed tube 9 has an inner diameter which is smaller than the diameter of ball 8 so as to limit the movement of ball 8 in an upward direction . therefore , feed tube 9 is positioned a small distance upward from ball 8 so that ball 8 is free to move upward to open ballcheck valve 7 . for simplicity of construction feed tube 9 is an extension of a valve wall 11 of housing 17 . feed tube 9 of valve wall 11 can communicate with a product passageway 12 within valve 10 when valve 10 is in an open position , which will be described . valve wall 11 is also provided with an air orifice 13 which can communicate with an air passageway 14 within valve 10 when valve 10 is in an open position . valve 10 is rotatably received in the cavity between valve walls 11 and 8 of spray dispenser housing 17 . tapered portions 19 and 20 of valve walls 11 and 18 , respectively , define a cavity therebetween which shall be referred to as mixing chamber 15 . product passageway 12 leads to mixing chamber 15 in a generally horizontal direction . air passageway 14 leads to the underside of mixing chamber 15 . tapered portions 19 and 20 terminate before meeting to define spray orifice 16 of mixing chamber 15 . as can be seen from fig1 and fig2 the air passageway 14 is an annular passageway which is concentrically disposed around the section of the product passageway 12 which leads to the mixing chamber 15 . housing 17 is connected to the top of bottle neck 5 by a ring 21 . ring 21 may be a screw cap whose inner surface is provided with helical threads 26 defining grooves which are engageable with helical threads 22 on the outer surface of neck 5 . an outwardly extending lip 23 around the bottom periphery of housing 17 engages with an inwardly extending lip 24 of ring 21 to lock housing 17 onto bottle neck 5 . a foam gasket 25 may be provided between lip 23 and the top of bottle neck 5 for enhanced sealing . the spray dispensing device can be conveniently removed from bottle 1 as a unit by simply unscrewing ring 21 to separate housing 17 from bottle neck 5 . this feature has the advantage of allowing the bottle 1 to be refilled with product 2 . the spray dispensing system is then easily reconnected to bottle neck 5 by ring 21 . valve 10 is housed within the cavity between valve walls 11 and 18 of housing 17 . valve 10 is rotatable about its longitudinal axis between a completely closed position ( fig2 ) and a completely open position ( fig1 ). in the completely closed position ( fig2 ) the product passageway 12 is not aligned with the feed tube 9 . as illustrated in fig2 in this position the body of valve 10 completely seals off feed tube 9 . the structure of valve 10 is such that as the valve is rotated toward the completely open position , the air passageway 14 first becomes aligned with air orifice 13 before product passageway 12 begins to communicate with feed tube 9 . upon continued rotation of the valve toward the completely open position , the product passageway begins to communicate with feed tube 9 , allowing a certain extent of communication between the feed tube and mixing chamber so that a thin stream of liquid can pass to the mixing chamber 15 at a certain flow rate . the flow rate is the volume of liquid which can flow per unit of time through the feed tube , through the product passageway and into the mixing chamber . upon continued rotation of the valve toward the completely open position , the extent of the communication between feed tube 9 and product passageway 12 increases , thereby increasing the extent of communication between the feed tube and the mixing chamber to allow a thicker stream of liquid to pass to the mixing chamber ( i . e ., an increased flow rate ). however , the extent of communication between air orifice 13 and mixing chamber 15 is already at its constant maximum before product passageway 12 even begins to communicate with feed tube 9 . therefore , the ratio of liquid to air which is delivered to the mixing chamber will increase as the valve 10 is rotated toward the completely open position thereby increasing the wetness of the spray in the completely open position of valve 10 , the extent of communication between product passageway 12 and feed tube 9 is at a maximum so that the ratio of liquid to air delivered to the mixing chamber is at a maximum . thus , it can be seen that the wetness of the spray can be controlled by adjusting valve 10 . it should be appreciated by those skilled in the art that variations in the design of valve 10 are possible . for example , instead of being rotatable , the valve may be slidable so that the extent of communication between the product passageway 12 and feed tube 9 varies upon sliding motion of the valve . in the preferred embodiment the valve 10 is rotatable 90 ° from the completely closed position ( fig2 ) to the completely open position ( fig1 and 3 ). the operation of the spray dispensing device of the invention as used with a squeeze bottle will now be explained by describing the path of fluid and air . upon squeezing the bottle 1 the pressure inside the bottle increases urging fluid 2 up dip tube 3 . fluid is forced through restricted conduit 6 and pushes ball 8 upward off of the top of conduit 6 thereby opening ballcheck valve 7 . the fluid is then free to flow into feed tube 9 toward product passageway 12 . from passageway 12 the fluid stream is injected into mixing chamber 15 in a horizontal direction . upon squeezing the bottle the increase in pressure also forces air above the fluid level in the bottle through air orifice 13 into air passageway 14 . it can be seen that the distance which must be travelled by the air to reach the mixing chamber 15 is less than the distance which must be travelled by the liquid so that liquid does not reach the mixing chamber before the air . in this way , it is made certain that the fluid is mixed with air before emanating from orifice 16 . the air stream enters the open underside of mixing chamber 15 . tapered portion 19 of valve wall 11 directs the air stream at an acute angle to the horizontal stream of liquid . when liquid flows into the mixing chamber it is swirled around by the angular flow of air . the liquid is subjected to considerable turbulence which breaks it up and intimately mixes it with the air . the result is that a fine spray is propelled out of orifice 16 . when pressure is released on the container it returns to its original shape as external air is drawn into the container through orifice 16 . the drawing of air through orifice 16 cleans the orifice and the mixing chamber 15 after each squeeze cycle thereby inhibiting clogging of the orifice . this self - cleaning feature of the invention is particularly advantageous in the case of a viscous product where clogging is most frequently encountered . the release of pressure also causes liquid to drop down feed tube 9 which helps ball 8 to drop thereby closing the top of restricted conduit 6 . it will be appreciated that the closing of conduit 6 by ball 8 will trap liquid in feed tube 3 . thus , during the next squeeze cycle product will already be at a very high level in the dip tube so that less time will transpire before spray is emitted . in this way the present invention achieves nearly instantaneous spraying without the need for a pressurized container . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made thereunto without departing from the broader spirit and scope of the invention as set forth in the appended claims . the specification and drawings are accordingly to be regarded in an illustrative rather than a restrictive sense . | 1 |
the present invention relates to a medical examination paper that is comprised of a paper / polymer / paper lamination that is formed together in an embossed quilted pattern . the invention comprises a lamination of paper / polymer / paper that is passed through an embossed nip roll or other similar equipment to form a repeated quilted pattern over the surface of the laminated product . in one embodiment , a sheet of kraft paper with a basis weight of about 8 - 20 lbs . per 3 , 000 sq . ft . is laminated to another sheet of paper comprising kraft paper , non - woven paper or tissue with a basis weight of about 8 - 20 lbs . per 3 , 000 sq . ft . using about 4 - 15 lbs . of low density polyethylene or other polymer and then embossed in a quilted pattern , or repeated logo that repeats across the entire surface of the laminated product . the sheet of paper which comprises kraft paper , non woven paper or tissue paper can be printed on . prior to or after the lamination process , one of the sheets may be printed with a design presenting marketing information , company logos , or other medical or marketing information targeted to the patient audience that uses the medical examination paper . in an embodiment , the medical examination paper is dispensed in rolls to fit the surfaces of medical examination tables used in doctor &# 39 ; s offices or other health care delivery settings . the embossed quilted pattern of the present invention provides both added comfort to the patient who uses the medical examination surface as well as enhanced moisture absorption and barrier characteristics . in an embodiment , the medical examination paper is coated or otherwise applied with a material or coating that provides anti - bacterial or anti - microbial properties to the paper . | 1 |
turning now to the figures , fig2 shows a video playback device 102 which includes a multimedia disc drive 104 , is coupled to a display monitor 106 and a set of speakers 108 , and which may be controlled via a remote control 110 . video playback device 102 includes an audio decoder which advantageously provides programmability of downmix coefficients and which provides for improved audio quality by means of a reconfigurable decoding pipeline . the device 102 accepts multimedia discs in drive 104 , and can read compressed multimedia bitstreams from the multimedia disc . the device 102 can convert the multimedia bitstreams into audio and video signals and present the video signal on display monitor 106 and the audio signals on speaker set 108 . examples of display monitors 106 include : televisions , computer monitors , lcd / led flat panel displays , and projection systems . the speaker set 108 may exist in various configurations . a single center speaker 108c may be provided . alternatively , a pair of left and right speakers 108b , 108e may be provided and used alone or in conjunction with a center speaker 108c . four speakers , 108b , 108c , 108e , 108a may be provided in a left , center , right , surround configuration , or five speakers 108a , 108b , 108c , 108e , 108f may be provided in a left surround , left , center , right , right surround configuration . additionally , a low - frequency speaker 108d may be provided in conjunction with any of the above configurations . in one embodiment , multimedia drive 104 is configured to accept a variety of optically readable disks . for example , audio compact disks , cd - roms , dvd disks , and dvd - ram disks may be accepted . the drive 104 can consequently read audio programs and multimedia bitstreams . the drive 104 may also be configured to write multimedia bitstreams , and may additionally be configured to write audio programs . the drive 104 includes a multimedia decoder which converts read multimedia bitstreams into video displays and audio programs . the drive 104 may also include a multimedia encoder for converting video displays and audio programs into a multimedia bitstream . a user can instruct the device 102 to forward receive video displays and audio programs directly to the display monitor 106 and speaker set 108 for display and audio playback . turning now to fig3 a functional block diagram of one embodiment of a video playback device 102 is shown . the device 102 provides audio and video signals to the display monitor 106 , and can accept audio and video signals from a television tuner or some other source . the received video and audio signals are converted to digital video and audio signals by a / d converters 200 , 201 . the digital audio and video bitstreams are provided to multimedia encoder 202 . multimedia encoder 202 uses synchronous dynamic random access memory ( sdram ) 204 as a frame store buffer while encoding the received signals . the resulting multimedia bitstream is processed by an error correction encoder 206 then converted to a modulated digital signal by modulator 208 . the modulated digital signal is coupled to a digital signal processor ( dsp ) 210 and from there to a power amplifier 212 . amplified signals are coupled to drive motors 214 to spin a recordable multimedia disk 216 , and to a record head 218 to store the modulated digital signal on the recordable multimedia disk 216 . stored data can be read from the recordable multimedia disk 216 by read head 220 which sends a read signal to dsp 210 for filtering . the filtered signal is coupled to channel control buffer 222 for rate control , then demodulated by demodulator 224 . an error correction code decoder 226 converts the demodulated signal into a multimedia bitstream which is then decoded by multimedia decoder 228 . in decoding the multimedia bitstream , the multimedia decoder 228 produces digital audio and video bitstreams which are provided to d / a converters 236 and 238 , which in turn provide the audio and video signals to display monitor 106 . video d / a 238 is typically an ntsc / pal rasterizer for television , but may also be a ramdac for other types of video screens . multimedia encoder 202 operates to provide compression of the digital audio and video signals . the digital signals are compressed individually to form bitstreams which are then divided into packets which are inter - mixed to form the compressed multimedia bitstream . various compression schemes may be used , including mpeg and dolby ac - 3 . in one embodiment , the general nature of the video compression performed by multimedia encoder 202 is mpeg encoding . the video compression may include sub - sampling of the luminance and chrominance signals , conversion to a different resolution , determination of frame compression types , compression of the frames , and re - ordering of the frame sequence . the frame compression may be intraframe compression or interframe compression . the intraframe compression is performed using a block discrete cosine transform with zig - zag reordering of transform coefficients followed by run length and huffman encoding of the transform coefficients . the interframe compression is performed by additionally using motion estimation , predictive coding , and coefficient quantization . audio encoders can be of varying levels of sophistication . more sophisticated encoders may offer superior audio performance and may make operation at lower bitrates acceptable . in one embodiment , the general nature of the audio compression performed by multimedia encoder 202 is mpeg - 2 / ac - 3 encoding . in the mpeg and ac - 3 standards , only a basic framework of the audio encoding process is defined , and each encoding implementation can have its own algorithmic optimizations . ac - 3 audio encoding involves the steps of locking the input sampling rate to the output bit rate ( so that each audio synchronization frame contains 1536 audio samples ), sample rate conversion ( if needed ), input filtering ( for removal of dc components ), transient detection , forward transforming ( includes windowing and time - to - frequency domain transformation ), channel coupling , rematrixing , exponent extraction , dithering strategy , encoding of exponents , mantissa normalization , bit allocation , quantization of mantissas , and packing of ac - 3 audio frames . similarly , mpeg audio encoding involves the steps of filter bank synthesis ( includes windowing , matrixing , and time - to - frequency domain mapping ), calculation of signal to noise ratio , bit or noise allocation for audio samples , scale factor calculation , sample quantization , and formatting of the output bitstream . for either method , the audio compression may further include subsampling of low frequency signals , adaptation of frequency selectivity , and error correction coding . error correction encoder 206 and modulator 208 operate to provide channel coding and modulation for the output of the multimedia encoder 202 . error correction encoder 206 may be a reed - solomon block code encoder , which provides protection against errors in the read signal . the modulator 208 converts the error correction coded output into a modulated signal suitable for recording on multimedia disk 216 . dsp 210 serves multiple functions . it provides filtering operations for write and read signals , and it acts as a controller for the read / write components of the system . the modulated signal provided by modulator 208 provides an &# 34 ; ideal &# 34 ; which the read signal should approximate . in order to most closely approximate this ideal , certain nonlinear characteristics of the recording process must often be compensated . the dsp 210 may accomplish this compensation by pre - processing the modulated signal and / or post - processing the read signal . the dsp 210 controls the drive motors 214 and the record head 218 via the power amplifier 212 to record the modulated signal on the multimedia disk 216 . the dsp 210 also controls the drive motors 214 and uses the read head 220 to scan the multimedia disk 216 and produce a read signal . the channel control buffer 222 provides buffering of the read signal , while demodulator 224 demodulates the read signal and error correction code decoder 226 decodes the demodulated signal . after decoding the demodulated signal , the error correction decoder 226 forwards the decoded signal to multimedia decoder 228 . multimedia decoder 228 operates to decode the output of the error correction decoder 226 to produce digital audio signals and video signals . the operation and structure of multimedia decoder 228 are discussed further below . the digital audio signal and video signals may be converted to analog audio and video signals before being sent to display monitor 106 . turning now to fig4 a block diagram of one embodiment of multimedia decoder 228 is shown . multimedia decoder 228 receives an encoded multimedia bitstream . the encoded multimedia bitstream is provided to a microcontroller 302 which executes software to parse the bitstream syntax and perform elementary operations such as extracting the bit allocation and scaling information from the headers , and applying that information to convert the variable - length encoded data into fixed - length transform coefficients for the hardware to process . the microcontroller ( cpu ) 302 then routes the transform coefficients to an appropriate buffer in memory 204 for further processing . in one embodiment , the memory 204 is a synchronous dynamic random access memory ( sdram ) which is accessed via a sdram interface 304 . data routed to the audio buffer is decoded by audio decoder 318 and sent to audio d / a converter 236 . data routed to the video decoder buffer is decoded by video decoder 306 and the decoded image data may be filtered by filters 308 . data routed to the sub - picture unit buffer is decoded by sub - picture unit 310 ( spu ). the decoded spu signal may be masked onto the filtered image by mixer 312 , and subsequently routed to display controller 314 . the display controller 314 synchronizes the transfer of pixel data to rasterizer 238 for display on monitor 106 . in addition to decompressing the audio data , audio decoder 318 operates to downmix the audio channels so that the number of output audio channels is appropriate for the available speaker configuration . since the speaker configuration may vary ( e . g . due to the purchase of new speakers or the failures of old ones ) it is desirable to provide for the programmability of downmixing coefficients . fig5 shows a matrix representation of the downmixing operation . a set of input channels 50 is combined according to a set of downmixing coefficients 52 to produce a set of output channels 54 . coefficients for certain downmixing configurations ( e . g . 5 - to - 2 ) may be included in the bitstream , and may be used as default values by audio decoder 318 . however , unusual speaker configurations are not specifically provided for . a full six - channel to six - channel mixer would require thirty - six coefficients 52 . however , there is provided herein a standardized set of downmix equations which require only 15 coefficients for full flexibility . these are the coefficients &# 34 ; a &# 34 ;-&# 34 ; k &# 34 ;,&# 34 ; m &# 34 ;,&# 34 ; n &# 34 ;,&# 34 ; p &# 34 ;, and &# 34 ; q &# 34 ; provided in matrix 52 . the empty spaces in matrix 52 are presumed to be zero . examples of the use of this set of equations are provided in copending u . s . patent application ser . no . 09 / 098 , 653 ( p - 3622 ) entitled &# 34 ; audio decoder with programmable downmixing of mpeg / ac - 3 and method therefor &# 34 ;. windowing and downmixing are the final two operations in the audio decoding process . since these operations are both essentially linear , they may in theory be re - ordered without affecting the final result . where the number of output channels is less than the number of encoded source channels , a reduction in memory requirements and required number of computations may be realized by performing downmixing before windowing . however , the fixed length representation of audio samples may introduce some rounding error in the final result when downmixing is performed first . turning now to fig6 a , a flowchart of the audio decompression process is shown . in one embodiment , the audio decoder assumes the availability of a dedicated processor cpu 302 for the audio subsystem . hence a portion of the available processor bandwidth may be utilized to allow some of the less complex audio decoding tasks to be performed by the cpu . the different tasks in the audio decoding algorithms can be analyzed to determine their complexity , and based on such an analysis , the computationally intensive and repetitive tasks of inverse transform ( subband synthesis ), downmixing , and windowing may be allocated to dedicated hardware 318 . the remaining decoding tasks may be allocated to cpu 302 ( shown in fig4 ). an input bitstream 402 is provided to cpu 302 , which parses the bitstream . in step 404 , cpu 302 identifies the audio frames , finds the headers and crc blocks , and performs error detection . in step 406 cpu 302 extracts the side information such as bit allocation , scaling factors , mode flags , cross - coupling parameters , and so on . in step 408 , cpu 302 applies the side information to the compressed audio data to convert the audio data into fixed - length transform coefficients . these coefficients are provided to audio decoder 318 . audio decoder 318 is reconfigurable . a first configuration is shown in fig6 a , and a second configuration is shown in fig6 b . in fig6 a , audio decoder performs an inverse transform in step 410 to produce a set of decompressed audio samples . depending on the compression algorithm , the inverse transform may be an ifft ( inverse fast fourier transform ), e . g . for dolby ac - 3 , or an idct ( inverse discrete cosine transform ), e . g . for mpeg . in step 412 , the audio decoder downmixes the audio samples from different channels , and in step 414 , the audio decoder 318 windows the audio data from each downmixed channel to remove discontinuities . downmixing and windowing are discussed further below . in fig6 b , the audio decoder similarly performs steps 410 , 412 , and 414 , but in a different order so that the audio samples from each channel are windowed before being downmixed . for most speaker configurations , this configuration will require more memory , but will also yield better - quality audio signals . fig7 shows a functional block diagram of one embodiment of audio decoder 318 . audio decoder 318 comprises input memory 502 , input memory interface 504 , data path 506 , control logic 508 , output buffer interface 510 , output buffer 512 , coefficient memory 514 , memory interface 515 , and registers interface 516 . the decompressed transform coefficients are written to an input buffer in input memory 502 by cpu 302 . the transform coefficients are retrieved from input memory 502 via input memory interface 504 by data path 506 under the control of control logic 508 . the transform coefficients are provided in blocks , each block representing the audio samples of one audio channel in one audio frame . under control of control logic 508 , the data path 506 operates on the transform coefficients to transform , window , and downmix data to produce the desired audio output . intermediate results may be written to input memory 502 via input memory interface 504 and to output memory 512 via output memory interface 510 . the final results are written to output memory 512 . control logic 508 operates according to control registers in control logic 508 . control logic 508 uses coefficients stored in coefficient memory 514 to perform the inverse transformation , and subsequently changes mode to perform the windowing and downmix operations . the coefficients are retrieved from memory 514 and provided to data path 506 by memory interface 515 under control of control logic 508 . mode control bits and downmix coefficients are provided to control registers in control logic 508 by cpu 302 via registers interface 516 . in one embodiment , audio decoder 318 is configured to perform ac - 3 audio bitstream decoding . under control of control logic 508 , data path 506 performs inverse transform operations and writes the resulting audio samples back to a buffer in the input memory 502 . after the inverse transform is complete , the audio samples are again retrieved . at this point , if windowing is performed before downmixing , the first half of the audio samples are combined ( windowed ) with delayed audio samples and written to a corresponding channel buffer in output memory 512 via output memory interface 510 , and the second half of the audio samples are stored as delay samples in a corresponding channel buffer in input memory 502 . the inverse transform and windowing is repeated for each of the audio channels in the audio frame . to perform the downmixing , audio samples from each channel buffer in the output memory 512 are retrieved , combined according to the downmix coefficients , and written back to output memory 512 . the memory requirements for this strategy may be summarized as : if downmixing is performed before windowing , the downmix coefficients are used to determine the contribution of the input sample to each output channel . previous contributions are retrieved from output channel buffers in output memory 512 , added to the current contribution , and written back to the output channel buffers . after the samples from all audio channels of the audio frame have been transformed and downmixed , the data path retrieves the samples from the output channel buffers , and combines ( windows ) the first half of the samples with delayed audio samples , and writes the results back to the output channel buffers . the second half of the samples are stored as delayed samples in corresponding channel buffers in the input memory 502 . the memory requirements for this strategy may be summarized as : the maximum number of source channels is six , so when the number of output channels is less than four , downmixing before windowing results in a smaller memory requirement . however , downmixing before windowing involves scaling and adding audio samples from different channels together before they have been set at their proper amplitudes by the windowing process . due to the fixed - length representation of the audio samples , this results in some loss of accuracy in the final audio signals . the error introduced may affect the result in 1 - 3 of the least significant bits , a level which may be acceptable for many inexpensive , reduced quality audio reproduction / playback systems . in another embodiment , audio decoder 318 is configured to perform mpeg - 2 audio decoding . under control of control logic 508 , data path 506 similarly performs inverse transform operations , and downmixing after windowing or downmixing before windowing operations . for windowing , the mpeg - 2 standard uses 512 element &# 34 ; sliding window &# 34 ; vectors for iteratively calculating 32 windowed samples at a time rather than the halfway - overlapping data blocks specified in the ac - 3 standard . each 512 element vector comprises 16 blocks of 32 samples . for downmixing after windowing , each source channel has a corresponding sliding window vector buffer in input memory 502 where inverse - transformed audio samples are stored . each new block of 32 samples for the source channel is used to replace the oldest block in the vector , so that the sliding window vector consists of the 16 most recent blocks of audio samples for the associated source channel . after each update of the sliding window vector , 32 windowed samples are calculated by combining samples from each of the 16 blocks . the first windowed sample is a weighted sum of the first samples from each of the blocks , the second windowed sample is a weighted sum of the second samples from each of the blocks , and so on . for downmixing , the contribution of the windowed sample to each of the output channels is calculated and added to the partial sum in the output channel buffer . for downmixing before windowing , each output channel has a corresponding sliding window vector buffer in input memory 502 where downmixed samples are stored . the contribution of each new block of 32 samples to each of the output channels is calculated and added to the corresponding partial sum being accumulated in place of the oldest block of the corresponding sliding window vector . once the downmixing is complete , the sliding window vectors consist of the 16 most recent blocks of downmixed samples for the associated output channels . for windowing , the 16 blocks of each vector are combined in a weighted sum to form a windowed block of 32 samples which are then written to the appropriate output buffer . fig8 shows a functional block diagram of one embodiment of data path 506 , which comprises registers 602 , multiplier 604 , adder 606 , and multiplexers 608 and 610 . each of these components is provided with one or more control signals to latch inputs , to intiate operations , or to route signals . the control logic 508 implements a state machine for each of the transformation , downmixing , and windowing operations , and provides the control signals to the data path 506 in accordance with the state machines . control logic 510 also controls interfaces 504 and 510 to route input data and output data to and from data path 506 , and accesses coefficient memory 514 to provide multiplier coefficients to data path 506 . depending on the control signals , data path 506 scales , adds , and / or accumulates input values to produce output values . registers 602 is a collection of registers for latching and storing input , output , and intermediate values . input data is routed to registers 602 or multiplexer 608 . multiplexer 608 forwards either the input data value or a stored register value to multiplier 604 . when triggered , multiplier 604 multiplies the forwarded value with a coefficient from control logic 508 . a second multiplexer 610 forwards either the product or the forwarded value from the first multiplexer 608 . when triggered , adder 606 adds a stored register value to the forwarded value from the second multiplexer 610 , and stores the result in one of the registers 602 . one of the registers in register 602 is an output register which latches in accordance with a control signal from control logic 508 . data path 506 is a very flexible module capable of implementing a wide variety of algorithms . the algorithms and the order in which they are implemented is determined by control logic 508 . a state diagram may be used to describe each algorithm which the control logic 508 implements , and a master state diagram may be used to provide selection and ordering of the individual algorithms . fig9 shows a state diagram for the downmixing operation when it is implemented after windowing is completed for all the source channels . state 902 is an idle state where the control logic waits for a trigger signal to initiate the downmixing operation . when a block of windowed audio samples from all audio channels of one audio frame is available , a downmix signal is asserted , causing the control logic to change to state 904 . state 904 performs a check on the downmix coefficient to determine if it is nonzero . if the coefficient equals zero , loop iterations for that channel are skipped . states 904 , 906 , 908 , and 910 form a loop in which a sample is read ( 906 ) from a source channel , multiplied ( 908 ) by a downmix coefficient , and added ( 910 ) to a value in an accumulator . the final value in the accumulator is a downmixed sample for one output channel . after all source channels have contributed to the downmixed sample ( i . e . after max -- sumcnt iterations ), the accumulator value is shifted to an output register in state 912 , and written to the appropriate output buffer in state 914 . in some cases , the audio sample will be written to more than one output buffer . after state 914 , control returns to state 904 so that the next downmix sample for the same output channel can be found . this process is repeated until the downmixing is done for all the samples of the current output channel ( i . e . when loopcnt = max -- loopcnt ), and the control logic enters state 916 . state 916 is an end state in which registers and flags are reset , after which control returns to the idle state 902 . this process is repeated until all source channels in all the audio blocks have been decoded and reproduced as the desired number of output channels . fig1 shows a state diagram for the downmixing operation when it is implemented before the windowing operation . state 952 is an idle state where the control logic waits for a trigger signal to initiate the downmixing operation . when a block of audio samples from a single channel of a single audio frame is available , a downmix signal is asserted , causing the control logic to change to state 954 . state 954 performs a check to determine if the downmix coefficient for the current output channel is zero , and if so , it skips to the next output channel , i . e . skipping through state 965 to state 952 , and incrementing a channel counter which indicates the number of downmixed source audio channels . for the current audio channel , the master state machine proceeds from downmixing to complete the windowing operation ( only the windowing operation for the current audio channel ). however , when the coefficient is nonzero , in state 956 the input audio sample is read , and in state 958 , the input audio sample is multiplied by the downmix coefficient . at the same time , in state 958 , a partial output channel value is read from the output buffer . in state 960 , the contribution from the current input audio channel is added to the appropriate output channel value , and in state 962 the sum is shifted to an output register . in state 964 , the sum is written back to the output buffer , and may additionally be written to other output buffers . control returns to state 954 , and the loop is repeated until the contribution of each of the input audio channel samples to all of the output channels has been calculated ( i . e . until loopcnt = max -- loopcnt ). at this point , control is transferred to end state 966 , in which registers and flags are reset , and then control returns to idle state 952 . numerous variations and modifications will become apparent to those skilled in the art once the above disclosure is fully appreciated . it is intended that the following claims be interpreted to embrace all such variations and modifications . | 6 |
in a preferred embodiment shown in fig1 flooring article 20 has a textile upper surface 14 having yarns 2 and a primary substrate 4 in which yarns 2 are secured ; an adhesive layer 6 positioned between primary backing or substrate 4 and secondary backing or substrate 8 ; a secondary backing or substrate 8 ; and an open mesh layer 16 whose coating 12 is fused into the flooring construction . yarns 2 are comprised of natural and / or synthetic fibers . by way of example , yarns 2 may be nylon , polyester , acrylic , polypropylene , cotton , wool , or any combination thereof . nylon is the preferred fiber type because of its durability , pile resistance , and colorfastness when dyed . alternatively , solution dyed synthetic yarns may also be used . yarns 2 of textile upper surface 14 are preferably attached to and / or through the primary backing or substrate 4 , as will be described . primary substrate 4 , in which yarns 2 are preferably placed , is comprised of any woven or nonwoven material , such as , but not limited to , nylon , polypropylene , polyester , cotton , wool , acrylic , glass , or combinations thereof . one preferred primary substrate is a polyester nonwoven that is coated with nylon and , more preferably , that is dyed a dark color to mask the appearance of the substrate and to emphasize the color of the yarns . speaking of this preferred substrate , the nylon component of substrate 4 tends to accept the dye used for yarns 2 , further masking substrate 4 from users . one important aspect of using a nylon - coated polyester nonwoven substrate is its dimensional stability , particularly during dye processing , during the backing formation process , and during laundering . alternately , a woven polypropylene substrate with either a nonwoven nylon cap or a nonwoven polypropylene cap may also be used . texile upper surface 14 may comprise a tufted cut - pile surface , a tufted loop - pile surface , a tufted multi - level pile , a tufted combination of loop and cut pile , a needle - punched surface , a bonded pile surface , a woven fabric , a knit fabric , a nonwoven fabric , or a combination thereof . preferably , textile upper surface 14 is a tufted cut - pile surface , because of its appearance , softness , and dust control attributes . textile upper surface 14 may further be patterned by methods such as , but not limited to , dye injection , graphic tufting , screen printing , pad dyeing , flocking , or combinations thereof . dye injection printing is preferred because of the ability to create intricate and customized designs . adhesive layer 6 serves to secure yarns 2 in primary substrate 4 . adhesive layer 6 is typically a solid material that softens when subjected to heat and pressure . this softening creates cohesion between primary substrate 4 and secondary backing substrate 8 . adhesive layer 6 may be comprised of any number of materials , including , but not limited to , natural rubbers , synthetic polyisoprene rubbers , styrene - butadiene rubbers , acrylonitrile - butadiene - sytrene rubbers , ethylene propylene rubbers , urethanes , polypropylene , polyethylene , nylon , polyester , acrylonitrile - butadiene - styrene , polyvinyl chloride , thermoplastic elastomers , thermoset plastics , low - melt thin films , or any combinations thereof . the use of thermoplastic elastomer is preferred because of its adhesion properties and its ease of use in manufacturing . secondary backing or substrate 8 is useful in providing a soft backing for flooring article 20 and in providing dimensional stability to flooring article 20 . secondary backing or substrate 8 also decreases the likelihood of adhesive layer 6 cracking or breaking with use of flooring article 20 . in addition , secondary backing or substrate 8 provides a uniform appearance on the reverse side of flooring article 20 . cotton , polyester , polypropylene , nylon , acrylic , or any combinations thereof may be used to create secondary backing substrate 8 , which may be a woven , nonwoven , or knit material . the use of a cotton or polyester woven material is preferred for softness . the final component of flooring article 20 is a mesh fabric 10 that has a coating 12 surrounding the mesh . coated mesh fabric 16 adds dimensional stability to flooring article 20 and prevents flooring article 20 from sliding during use . coated mesh fabric 16 may comprise any woven , nonwoven , or knit material ( shown as fabric 10 in the drawings ), having a substantially open configuration ; woven fabrics are preferred for the uniformity of the mesh . the openings in mesh fabric 10 should preferably be from about 0 . 125 inches to about 1 . 5 inches , and more preferably be about 0 . 5 inches . fabric 10 itself may be comprised of cotton , polyester , polypropylene , nylon , acrylic , or any combination thereof , although cotton or polyester is more preferred . when using cotton or polyester , it may be desirable to pre - shrink the fabric before coating . fabric 10 is coated with , by way of example , natural rubbers , synthetic polyisoprene rubbers , styrene - butadiene rubbers , acrylonitrile - butadiene - sytrene rubbers , ethylene propylene rubbers , urethanes , polypropylene , polyethylene , nylon , polyester , acrylonitrile - butadiene - styrene , polyvinyl chloride , thermoplastic elastomers , thermoset plastics , or any combinations thereof . the coating 12 is shown in fig1 and 2 . the preferred mesh fabric 16 is a woven fabric 10 with a latex coating 12 , in which the fabric component 10 is made from cotton or polyester . it has been found that production of flooring article 20 is most successful when the melting points of coating 12 and adhesive layer 6 are comparable . flooring article 20 is produced by placing the component pieces on top of one another as in a continuous vulcanization press or shuttle vulcanization press . the process may be run continuously or in batch mode . the layers are positioned as follows : coated mesh fabric 16 , secondary backing substrate 8 , adhesive layer 6 , and textile upper surface 14 , which comprises primary substrate 4 and yarns 2 . it should be noted that coated mesh fabric 16 should be positioned toward the heating platen of the vulcanization chamber ( that is , if the heating platen is at the top of the chamber , then the order described above should be reversed ). the pre - assembly is then subjected to heat and pressure , as would be found in a vulcanization chamber . the heat and pressure of the vulcanization environment cause adhesive layer 6 and coating 12 of mesh fabric 16 to melt and fuse the component layers together . temperatures in the range of about 180 ° c . to about 220 ° c . are preferred , while temperatures in the range of about 195 ° c . to about 200 ° c . are more preferred . pressures ranging from about 15 pounds per square inch ( gauge ) ( p . s . i . g .) to about 50 p . s . i . g . are preferred , while a pressure of about 30 p . s . i . g . is more preferred . the composite may be edge - trimmed and a serger may be used to complete the edges of flooring article 20 . alternatively , edging tape may be sewn around the perimeter of flooring article 20 to create a finished edge . yet another alternative is to create a solid edge formed from natural rubbers , synthetic polyisoprene rubbers , styrene - butadiene rubbers , acrylonitrile - butadiene - sytrene rubbers , ethylene propylene rubbers , urethanes , polypropylene , polyethylene , nylon , polyester , acrylonitrile - butadiene - styrene , polyvinyl chloride , thermoplastic elastomers , thermoset plastics , or any combinations thereof . flooring article 20 preferably has a backing that is soft , skid - resistant , and durable . such a backing prevents damage to flooring surfaces on which flooring article 20 is placed and prevents flooring article 20 from sliding during use . | 1 |
the present invention comprises a novel electro - optic system and associated image processing devices . the following description is presented to enable any person skilled in the art to make and use the invention . descriptions of specific applications are provided only as examples . various modifications to the preferred embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . fig1 is a block diagram of an electro - optic system 10 of the present invention . system 10 comprises a position determining means 16 , an attitude determining means 15 , a camera 19 , an image processing unit 14 , and a display 13 . camera 19 comprises an electro - optic device capable of converting a photon input ( from a field of view ) into an electronic image . camera 19 then transmits the electronic image to image processing unit 14 . position determining means 16 determines the position of the camera and transmit the information to image processing unit 14 . similarly , attitude determining means determines the camera pointing attitude of the camera defined by , e . g ., the symmetry axis of the camera field of view . attitude determining means 15 transmits the attitude information to image processing unit 14 . image processing unit 14 analyzes and processes inputs from position determining means 16 , attitude determining means 15 , and camera 19 so as to generate real and augmented images . these images are then transmitted to display 13 for use by the user . various applications and advantages of electro - optic system 10 have been disclosed in the following copending patent applications : ser . no . 08 / 119 , 360 , entitled “ an electro - optic vision system which exploits position and attitude ” and filed sep . 10 , 1993 ; ser . no . 08 / 307 , 360 , entitled “ vision system for viewing a sporting event ” and filed sep . 14 , 1994 ; ser . no . 08 / 335 , 912 , entitled “ vision imaging devices and methods exploiting position and attitude ” and filed nov . 8 , 1994 ; ser . no . 08 / 335 , 940 , entitled “ vision imaging devices and methods having an unlimited zoom range ” and filed nov . 8 , 1994 ; ser . no . 08 / 335 , 710 , entitled “ computer games having optically acquired images which are combined with computer generated graphics and images ” and filed dec . 4 , 1994 ; ser . no . 08 / 441 , 299 , entitled “ augmented reality vision systems which derive image information from other vision systems ” and filed mar . 27 , 1995 ; ser . no . 08 / 480 , 689 , entitled “ vision systems for viewing objects that identify themselves ” and filed jun . 7 , 1995 ; ser . no . 08 / 482 , 943 , entitled “ an electro - optic vision system which exploits position and altitude ” and filed jun . 7 , 1995 ; ser . no . 08 / 482 , 944 , entitled “ vision system computer modeling apparatus ” and filed jun . 7 , 1995 ; ser . no . 08 / 571 , 096 , entitled “ computer vision system which determines identify , position and orientation of objects in a scene and displays augmented images thereof ” and filed dec . 12 , 1995 . these patent applications are incorporated herein by reference . it should be appreciated that electro - optic system 10 of fig1 may contains additional components . for example , it may be desirable to include a set of user inputs so that an user can enter data to image processing unit 14 . other measuring devices , such as temperature gauge , accelerometer , range finder , etc ., can also be coupled to image processing unit 14 . fig2 is a block diagram of an embodiment of an electro - optic system 100 showing the detail structure of its image processing unit . system 100 comprises a video input device , such as a camera 102 , which accepts optical image information and generates a corresponding digital video in the form of ieee 1394 ( firewire ) data . camera 102 can optionally generate information relating to iris , exposure time . zoom ( image magnification ) ratio and stabilizer data ( e . g ., 1 , 2 , or 3 axis acceleration ). firewire is a high speed serial interface bus specification especially tuned for transferring digital video information at rates of up to 400 megabits per second ( mbits / second ). this interface has been implemented in sony corporation &# 39 ; s digital handycam series of camcorders . an exemplary camera contains one or more charged coupled device ( ccd ) area imaging sensors . it produces information which is digitized and encoded to an industry standard video format . this data is then transmitted serially at up to 400 mbits / second via the firewire data bus . control and configuration information can be passed bi - directionally over this bus as well . it should be noted that although ieee 1394 is the presently preferred digital interface for video data , the invention could be implemented using other digital interfaces , now available or to be developed in the future . the output of camera 102 is connected to a firewire video interface chipset 104 . this chipset accepts the ieee 1394 data from camera 102 and generates command and data in a zoom video bus 106 and a peripheral component interconnect ( pci ) bus 108 . zoom video ( or zoomed video ) is an interface standard used by personal computer manufacturing card industry association ( pcmcia ) card manufacturers and graphics controller manufacturers to provide a central processing unit ( cpu ) independent path to a graphics controller for digital video information . it is a bit parallel ( yuv encoded ) serial data interface ( i . e ., the pixels arrive serially for each line ). vertical , horizontal sync as well as dotclock is provided . pci bus 108 is a 32 ( expandable to 64 )- bit high speed parallel databus standard . the bus operates currently at 33 mhz so as to provide up to 132 mbytes / second data transfer rate . future implementations will increase the bus speed . this bus is described in detail in the “ pci specification , version 2 . 1 ” published by the pci special interest group . chipset 104 receives the ieee 1394 serial data stream ( at up to 400 mbits / second ) and converts the data into parallel data suitable for sending over the pci and / or zoom video data busses . the data that goes out on zoom video bus 106 is arranged to fit the yuv encoding format with vertical and horizontal syncs . chipset 104 can also operate as a pci bus master , thus can burst image data to anywhere in the cpu &# 39 ; s main memory or to any pci slave device &# 39 ; s memory . it should again be pointed out that zoom video bus 106 and pci bus 108 are exemplary digital buses . the present invention could be implemented using other high bandwidth buses . the output of chipset 104 is coupled to an image processor ( ip ) 110 . the zoom video bus allows ip 110 to receive video data in parallel with a cpu system , shown in fig2 as reference numeral 114 . ip 110 could perform many tasks , from complex to simple . at the complex end , ip 110 may be responsible for processing video on a frame by frame basis to extract data from , or to enhance the image . an example is the v - lace ™ real time image enhancement algorithm from digivision . at the simple end , ip 110 may be asked to shut down and passively pass the image data through to a 3d graphics accelerator 116 . other examples may involve feature extraction from the image , classification of those features and alerting the main cpu of those results . ip 110 could be implemented as a dsp like subsystem with its own memory , cpu and i / o capability . a high performance parallel execution unit cpu like the tms320c80 is preferably used to execute algorithms which may employ fast fourier transform ( fft ) like calculations . an example of ip 110 is ariel corp &# 39 ; s tms320c80 based griffin pci bus image processing board . zoom video is preferably used to pass the image data in real time to ip 110 and deliver the results to 3d graphics processor 116 . pci bus 108 provides an alternate path for the result or input data . main cpu system 114 may utilize ip 110 as a parallel processor ( to itself ), pre - processor , or post - processor of image information . 3d graphics processor 116 is used to off load time - consuming graphics operations from the cpu . although all functions could be implemented in the main cpu , that would consume a substantial amount of the power of present generation of cpus , leaving little power for other tasks . graphics processor 116 receives image information from zoom video bus 106 . it contains a pci interface , which provides a high bandwidth bus to the cpu for image rendering primitives , background information , text etc . graphics processor 116 provides near real time rendering of the augmentation objects using dedicated hardware specifically designed for 3d graphics operations . alternately , it is possible for video data to flow at full speed , about 27 mbytes per second , from the firewire interface over the pci bus and directly to the memory of graphic processor 116 . the image generated by graphics processor 116 is sent to a display 118 . it converts rgb encoded digital data into light . the preferred display is small size , low power consumption , and high resolution . examples of suitable displays are active matrix color liquid crystal display ( lcd ), lcd projection panel , digital micromirror device ( dmd ), and vacuum fluorescent display ( vfd ). cpu system 114 could be a single cpu . alternatively , it could be a multiprocessing system . examples are mips 10000 , dec alpha , sun ultra sparc . the preferred system is a pentium pro single or multiprocessor system ( this choice is based on costs and availability of development tools ). the preferred cpu system typically requires a core logic chipset ( shown in fig2 as reference numeral 120 ). it provides the interface between cpu system 114 , a main memory 122 , and pci data bus 108 . examples of chipsets are intel &# 39 ; s orion core logic chipset , 440fx , 450gx , and 450kx . the orion chipset provides multi - processing support for up to four processors . a pci bus and an industry standard architecture ( isa ) bus ( shown as reference numeral 126 ) are supported . the preferred cpu system also requires random access memory ( ram ) 122 to provide storage for program execution . it should be noted that the use of 3d graphics processor 116 is optional . some microprocessors contain multimedia instructions which allow multimedia tasks to be easily performed . examples of such microprocessors are intel &# 39 ; s pentium - mmx ( code named the p55c ) and sun &# 39 ; s ultrasparc . it should also be pointed out that graphics processors could be used in combination with this kind of microprocessors ( i . e ., having instructions designed to execute multimedia instructions ) in order to obtain enhanced performance . system 100 comprises a mass storage unit 130 , which is coupled to pci bus 108 by a hard disk interface 131 . examples of interface 131 are an enhanced integrated drive electronics ( eide ) interface and a small computer system interface ( scsi ). unit 130 provides storage space for geographic information systems ( gis ) database information , algorithm and program information for ip 110 , and operating system software for main cpu system 114 . system 100 contains software ( which could be stored in mass storage unit 130 and loaded into ram 122 or burnt into read - only memory ) for searching and retrieving data from the gis database . the searching preferably uses position , attitude , and other data for identifying the location and point of view of camera 102 . although there are mass storage units having several gigabytes of storage , their physical sizes are too large for the present embodiment . the preferred mass storage unit 130 is a balance between size , weight , cost and performance . at the present time , a rotating magnetic medium storage using 1 . 2 gigabyte 2 . 5 ″ technology is considered the preferred storage unit . system 100 also comprises a real time clock ( rtc ) 134 . it provides local timekeeping and ( optionally ) non - volatile storage of system parameters during power off conditions . the design of rtc 134 depends on the requirements of cpu system 114 and core chipset 120 . many companies , such as dallas semiconductors , inc ., benchmarq semiconductors , and chips & amp ; technologies , inc . manufacture rtcs for various cpu system architectures . the connection to various peripheral devices is now described . serial ports ( shown as numerals 136 , 137 and 160 ), such as rs232 , nmea - 183 , and rs422 , could be used to provide the connection . the serial ports provide serial to parallel conversion , which converts asynchronously formatted data ( received from the peripheral devices ) to parallel data . the data is sent over isa bus 126 to cpu system 114 for processing . it should be noted that the present invention is not limited to using asynchronous serial ports as means for interfacing with peripheral devices . for example , parallel ports or synchronous serial ports could also be used . an example of a peripheral device that can be connected to serial ports 137 is a global positioning system ( gps ) 140 . it derives 3 - dimensional position information from a gps satellite navigation system ( not shown ). typically , the 3 - dimensional position information is derived by a “ gps core ” module which measures transit times of the l - band signals broadcast by the twenty four satellites of the gps constellation . in the present embodiment , gps 140 is interfaced via one of the serial ports using nmea 183 format data . as an alternative , a proprietary format may be used from one of the many gps core module makers ( e . g ., motorola , garmin , trimble , furuno , ashtech , rockwell , plessy , canadian marconi , etc .). if it is desirable to improve the accuracy of gps 140 , a differential gps ( dgps ) 141 could be used . it provides correction information to gps receiver 140 in order to increase the accuracy and remove the effects of selective availability . dgps is developed by a precisely surveyed reference gps receiver base station . correction data derived for each satellite is formatted in rctm - 104 format and broadcast via a communications system to the user . these corrections are applied to each of the measurements made in the users gps receiver so as to produce a more accurate result . dgps 141 it is interfaced to the gps receiver via a serial interface supporting rctm - 104 format data . alternatively , devices that can receive gps and / or glonass ( global navigational satellite system ) signals can be connected to serial port 137 . an example of a device that can receive both gps and glonass signals is gg24 developed by ashtech inc . a further alternative embodiment is to use real time kinematic surveying techniques . these techniques are able to achieve higher accuracy than dgps . another peripheral device that may be used in electro - optic system 100 is a spread spectrum ( ss ) radio 144 . it provides wireless communication between peer units or between master and slave units . major advantages of ss are spectrum re - use , simultaneous existence of multiple networks , data security and low probability of intercept . an example of a ss radio is proxim rangelan 2 , which operates at 2 . 4 ghz and has a data rate of 1 . 6 mbits per second . an accelerometer 148 can also be coupled to one of the serial ports . in one embodiment of accelerometer 148 , an integrated circuit ( e . g ., analog devices &# 39 ; adxl05 ) is used to generate an analog voltage which is proportional to the instantaneous acceleration along a specified axis . the analog voltage can be converted to a digital value ( by an analog - to - digital converter ) and then serialized so as to be compatible with a chosen serial port communication protocol . the acceleration information could be used in image stabilization efforts and in augmenting the information from the gps and tri - axial magnetometers . a tri - axial magnetometer , such as a tcm - 2 module from precision navigation inc ., can also be connected to one of the serial ports . such a device provides attitude information , in all three degrees of freedom , regarding the pointing direction of the optical axis of the camera . in fig2 , a laser range finder 162 is connected to serial port 160 . an example of a range finder is leica &# 39 ; s data disto rs232 . system 100 also allows various user interface devices 154 to be connected to isa bus 126 . these interface devices include devices that can accept input signal and generate output signals . examples of user interface devices are control buttons , switches , optical indicators ( e . g ., leds ) and alarms . in the present specification , four exemplary applications of system 100 are described . the first application is an electronic binoculars having a “ text box ” superimposed on a real image . the text box contains text data related to the real image . the second application is “ 0 - 0 ” visibility navigation system which can help a user to navigate a movable object ( e . g ., ships , planes , and vehicles ) under adverse visual environment . the third application is an object identification system which attempts to identify an object under adverse viewing conditions . the fourth application is an advanced image augmentation application which can process , enhance , and augment images . camera 102 is used to capture a view and delivers a corresponding video data to firewire chipset 104 . the data flows to ip 110 . in this application , ip 110 is configured as a pass - through device and just passes the data , without processing , on to graphics processor 116 . cpu system 114 is not used to process the image data , so none flows over pci bus 108 . cpu system 114 sends text data to graphics processor 116 which renders it at points in the image that correspond to the attitude and location “ text boxes .” location data is read from gps 140 and if appropriate , dgps 141 , via serial port 137 . attitude information is read from tri - axial magnetometer 150 via serial port interface 136 . gis data is retrieved from the database on storage system unit 130 . in one embodiment , cpu system 114 sets the optical and electronic zoom factors in camera 102 . zoom factors are read back along with exposure and iris information from the camera via the firewire . information on zoom factors is used by cpu system 114 to properly generate augmentation images . camera 102 is used to capture a view and deliver a corresponding video data to firewire chipset 104 . the data flows to ip 110 , which attempts to extract features from the data using a plurality of frames . location data is read from gps 140 and if appropriate , dgps 141 , via serial port 137 . attitude information is read from tri - axial magnetometer 150 via serial port interface 136 . cpu system 114 retrieves gis data from storage unit 130 relative to the current position . it then sends “ wire frame ” graphics to graphics processor 116 , which renders and textures those wire frames into realistic looking images of what “ should ” be in the field of view of the system . camera 102 is used to capture a view and delivers a corresponding video data to firewire chipset 104 . the data flows to ip 110 . cpu system 114 has previously retrieved ( at the user &# 39 ; s request ) several 3d models of ships that are due to pass by . the 3d models of ships are retrieved from storage unit 130 . this information is sent to ip 110 via pci bus 108 . ip 110 searches the field of view ( obtained from camera 102 ) for objects . upon identifying an object , it is compared with various aspects of the 3d models . upon finding a “ match ,” information is sent to cpu system 114 , which sends a signal to alert the user . camera 102 is used to capture a view and deliver a corresponding video data to firewire chipset 104 . the data flows to ip 110 , which enhances the image and attempts to extract features from the data using a plurality of frames . cpu system 114 has previously loaded ip 110 with the appropriate algorithm and program information . the enhanced image flows to graphics processor 116 ( via zoom video 106 ) and the features to cpu system 114 ( via pci bus 108 ). meanwhile the image data also flows to cpu system 114 ( via pci bus 108 ) which uses the feature locations to identify objects in the image and create a “ mask ” to be used by graphics processor 116 to “ remove ” those features from the final view . cpu system 114 sends the “ masks ” to graphics processor 116 along with text and drawing primitives . graphics processor 116 renders the text , removes the “ masked ” objects , and renders non - existent objects as directed by cpu system 114 . location data is read from gps 140 and if appropriate , dgps 141 , via serial port 137 . attitude information is read from tri - axial magnetometer 150 via serial port interface 136 . cpu system 114 retrieves gis data relative to the current position from storage unit 130 . in this application , camera 102 is configured to achieve a desired stabilization factors . graphics processor 116 is configured to display image data ( received from zoom video bus 106 ) while applying the “ mask ”, text and graphics as overlays . zoom factors are read back along with exposure and iris information from camera 104 via firewire chipset 104 . the invention now being fully described , it will be apparent to one of ordinary skill in the art that any changes and modifications can be made thereto without departing from the spirit or scope of the invention as set forth herein . it should be noted that computing technology is constantly being developed . new developments can be appropriately used to improve the system disclosed herein . for example , a new peripheral bus called the universal serial bus ( usb ) may be advantageously used to connect a large number of peripherals to the system of the present invention . similarly , various solid state memory devices such as synchronous dram , edram , etc . can also be used . cache memory can be attached to the present system to improve the performance . accordingly , the present invention is to be limited solely by the scope of the appended claims . | 6 |
in the present invention , the objective food are water - containing food and raw materials of food having a water content of not less than 5 % by weight and examples thereof include internal fillings of cream puff , eclair , croissant , roll , doughnut and sugar corn ( e . g ., ice confectionery or shell chocolate ); bean jam - containing confectionery , marshmallow , turkish delight , rice cake and the like ; baked bean jam - containing type cookie or the like . in the case of coating , although a disadvantage such as sweating phenomenon is scarcely caused in food or a raw material of food having a water content of less than 15 % by weight , the present invention is effective in a dough having a low water content because , even in food having a water content of about 5 % such as baked bean jam - containing type cookie , conditions that migration of water is readily caused are brought about by baking . further , in general , when the surface to be contacted with chocolate is not permeable to oil - drop , &# 34 ; sweating &# 34 ; improving effect is enhanced . for example , whether the surface is permeable to oil - drop or not can be decided by dropping an oil - drop from a dropping pippet ( outlet : about 1 mm in diameter ) on the surface of the dough to observe whether the oil - drop permeates the dough or not within about one minutes . in general , permeability to oil - drop can be observed within 30 seconds in the case of a sponge cake . in such a product , sweating phenomenon is hardly caused . as the chocolate , there can be used any chocolate such as tempering type , non - tempering type or various colored chocolates and , in general , non - tempering chocolate or various colored chocolates using fats and oils having a wide range of plasticity are used . typically , the fats and oils having a wide range of plasticity are those used for margarine or shortening and examples thereof include vegetable fats and oils such as rapeseed oil , soybean oil , sunflower seed oil , cotton seed oil , peanut oil , rice bran oil , corn oil , sufflower oil , olive oil , kapok oil , sesame oil , evening primerose oil , palm oil , shea butter , sal fat , coconut oil , palm kernel oil , etc . ; and animal fats and oils such as milk fat , beef tallow , lard , fish oil , whale oil , etc . the above fats and oils alone or in combination thereof , or their processed fats and oils having melting point of 15 ° to 45 ° c ., wherein fats and oils subjected to hydrogenation , fractionation , ester interchange treatment are suitable . in the present invention , these fats and oils may be used as all the fat components of chocolate . in the above chocolate , as the sugar material , there can be used sugars having a solubility of not more than 80 ( grams dissolved in 100 g of water at 20 ° c .). when the solubility exceeds 80 , the prevention of the sweating phenomenon or hard mouth feel can scarcely be obtained . as the sugars having the solubility of not more than 80 , for example , there are mannitol , maltose , erythritol , lactose , starch , starch hydrolyzates and the derivatives thereof and the like , and one or more of these materials can be used in an amount of not less than 40 % by weight , based on the total weight of the sugar materials . when the amount to be used is smaller than 40 % by weight based on the total weight of the sugar materials , the effect can scarcely obtained . in the case of coating food such as sponge cake with chocolate , an oily material such as butter cream is primed on the surface of food so that the surface of food becomes flat to easily conduct coating and chocolate coated does not penetrate the food . although this is slightly effective for prevention of sweating phenomenon , the effect thereof is not sufficient in comparison with the present invention . in the present invention , the sweating phenomenon can be fully prevented by simply and directly coating without using any oily layer . in addition , in the specification of japanese patent kokoku no . 54 - 8738 , there is disclosed a process for producing chocolate using β - lactose in order to reduce sweetness and , in this publication , there is no disclosure and suggestion that sweating phenomenon and deterioration of the heat resistance can be controlled because β - lactose has a low solubility to water . further , the purpose of the present invention is not to reduce the sweetness of the chocolate . to the contrary , since the sweetness of sugar having a low solubility is too low , it is preferred that a non - sugar sweetener which has strong sweetness in comparison with saccharide sweeteners is used in combination in order to maintain the sweetness at a normal level . as the non - sugar sweetener , there are known sweeteners , for example , natural sweeteners such as amino acids ( e . g ., glycine , alanine and the like ), stevioside , glycyrrhizin , somatine , etc . and synthetic sweeteners such as saccharin , aspartame , etc . in addition , when the objective food itself is one having a strong sweetness , the chocolate may be suitably used in the state of low sweetness . the following examples and comparative examples further illustrate the present invention in detail but are not to be construed or limited in the scope thereof . in the examples and comparative examples , all &# 34 ; parts &# 34 ; and &# 34 ; percents &# 34 ; are by weight unless otherwise stated . by using cocoa ( 15 parts ), mannitol ( 43 parts ), vegetable fat ( 42 parts ) and a suitable amount of lecithin and flavor , chocolate was produced according to a conventional manner . a commercially available cream puff ( about 80 mm in diameter ; 45 mm in height ; 67 to 70 g in weight ; custard cream having a water content of about 60 % as a filling was contained therein ) was coated with the resulting chocolate . the coating method was as follows . the head part of the cream puff was dipped upside - down into a chocolate bath having a product temperature of about 40 ° c . in which chocolate was melted to coat the head part of the cream puff with chocolate ( about 8 g ). the drying time was 3 minutes and 30 seconds . after drying , some of them were packed in a bag and the other unpacked and they were stored at 10 ° c . and 20 ° c . as a result , after 3 days , no sweating phenomenon was observed on the surface of the chocolate and it showed good gloss . according to the same manner as described in example 1 , chocolate was produced and coating was conducted except for using β - lactose in place of mannitol . as a result , no sweating phenomenon was observed and it showed good gloss , like example 1 . according to the same manner as that described in example 1 , chocolate was produced and coating was conducted except for that sucrose was used in place of mannitol . as a result , regarding both packed chocolates stored at 10 ° c . and 20 ° c ., a sweating phenomenon was observed even after 1 day and the surface of chocolate was changed to dark brown color and gloss was lost . regarding unpacked chocolate , a similar phenomenon was observed after 2 days . according to the same manner as that described in example 1 , chocolate was produced and coating was carried out except for using sucrose in place of one quarter of the amount of mannitol . as a result , no sweating phenomenon was observed even after 2 days and it showed good gloss . by using cacao mass ( 4 parts ), cocoa ( 13 parts ), milk solid ( 5 parts ), mannitol ( 32 parts ), vegetable fat ( 46 parts ) and a suitable amount of lecithin and flavor , chocolate was produced according to a conventional manner . a commercially available cream puff ( about 80 mm in diameter ; 45 mm in height ; 67 to 70 g in weight ; whip cream having a water content of 40 % as a filling was contained therein ) was coated with the resulting chocolate . coating method was as follows . the head part of the cream puff was dipped upside - down into a chocolate bath having a product temperature of about 40 ° c . in which chocolate was melted to coat the head part of the cream puff with chocolate ( about 8 g ). the drying time was 3 minutes and 50 seconds . after drying , chocolate was packed in a bag and then stored at 10 ° c . and 20 ° c . as a result , after 3 days , no sweating phenomenon was observed on the surface of chocolate and it showed good gloss . according to the same manner as that described in example 4 , chocolate was produced and coating was conducted except for using sucrose in place of mannitol . as a result , regarding both packed chocolates stored at 10 ° c . and 20 ° c ., sweating phenomenon was observed even after 1 day and the surface of chocolate was changed to a dark brown color and gloss was lost . according to the same manner as that described in example 4 , chocolate was produced and coating was conducted except for using lactose ( 24 parts ) and sucrose ( 8 parts ) in place of mannitol . as a result , no sweating phenomenon was observed , even after 2 days and it showed good gloss . by using cacao mass ( 12 parts ), cocoa ( 5 parts ), milk solid ( 4 parts ), lactose ( 52 parts ), rapeseed hydrogenated oil ( 27 parts ) and a suitable amount of lecithin , flavor and a sweetener , chocolate was produced according to a conventional method . the resulting chocolate was covered with a cookie dough of 8 g ( water content : 8 %) and was baked with only a high flame at 230 ° c . for 8 minutes . regarding the chocolate - containing cookies thus obtained , the chocolate of the center part did not lose softness thereof , even after 3 days at 20 ° c . and showed a good mouth feel . according to the same manner as that described in example 6 , chocolate was produced and a cookie was baked except for using sucrose in place of lactose . as a result , the resulting chocolate showed a harder mouth feel in comparison with that obtained in example 6 . by using nuts ( 15 parts ), mannitol ( 50 parts ), sugar ( 15 parts ), cocoa butter ( 6 parts ), palm middle melting point fraction ( 14 parts ) and a suitable amount of an emulsifying agent and a flavor , chocolate was produced according to a conventional method . the resulting chocolate as a center filling was covered with danish pastry dough ( water content : 23 %) and was baked in an oven ( 200 ° c . ; 15 minutes ). regarding the chocolate - containing danish pastry thus obtained , the chocolate of the center part did not lose softness after 3 days at 20 ° c . and showed a good mouth feel . according to the same manner as that described in example 7 , chocolate was produced and danish pastry was baked except for using lactose in place of mannitol . as a result , the resulting chocolate showed a softer mouth feel in comparison with that obtained in example 7 . according to the same manner as that described in example 7 , chocolate was produced and danish pastry was baked except for using sucrose in place of mannitol . as a result , chocolate as a center filling showed a harder mouth feel in comparison with that obtained in example 7 . by using whole milk powder ( 7 parts ), skimmed milk powder ( 5 parts ), lactose and β - lactose ( 2 : 8 , 38 parts ), sugar ( 4 parts ), vegetable fat ( 46 parts ) and a suitable amount of lecithin and a flavor , white chocolate was produced according to a conventional method . a commercially available bread ( water content : 28 %) was coated with the resulting white chocolate in a line pattern and stored at 30 ° c . and , as a result , no sweating phenomenon was observed at the surface of chocolate after 3 days and it showed good gloss and maintained the same state as that obtained immediately after coating . to the contrary , regarding chocolate produced by using only sucrose for comparison , a sweating phenomenon was observed at the surface of chocolate and chocolate released after storage . further , chocolate obtained by using a fondant melted after storage and did not maintain the original form . furthermore , the coating of chocolate produced by further adding a sweetener ( stevia : having 125 - fold sweetness in comparison with sucrose ) in various amounts was conducted likewise and sweetness was evaluated by 15 panelists to obtain the following results . ______________________________________ number of persons who haveamount of sweetener judged as good______________________________________0 part 00 . 05 part 20 . 10 part 70 . 15 part 50 . 20 part 1______________________________________ as is clear from the above results , it is preferred that a sweetener ( stevia ) is added in an amount of about 0 . 1 to 0 . 15 parts . by using whole milk powder ( 7 parts ), lactose ( 60 parts ), vegetable fat or oil ( 33 parts ), a sweetener ( stevia ; 0 . 1 parts ) and a suitable amount of lecithin and flavor , white chocolate was produced according to a conventional method . the white chocolate thus obtained was used as a center filling of a turkish delight by using a bean jam - filling machine ant was stored at 25 ° c . and , as a result , no change was observed in a physical property of chocolate after 3 days and it has maintained good state . to the contrary , chocolate produced by using sucrose ( 8 parts ) in place of lactose ( 60 parts ) for comparison became dry up crisp and hard after storage . further , turkish delight itself became hard . by using whole milk powder ( 4 parts ), lactose ( 48 parts ), sugar ( 8 parts ), vegetable fat ( 33 parts ) and a suitable amount of lecithin and flavor , chocolate was produced according to a conventional method . the chocolate thus obtained was used as a center - filling of daifuku rice cake by using a bean jam - filling machine and was stored at 25 ° c . and , as the result , no change was observed in a physical property of chocolate after 3 days and it maintained good state . to the contrary , chocolate produced by using no lactose and sucrose ( 56 parts ) for comparison became dry up crisp and hard after storage . further , the dough of rice cake itself became hard . as described above , by using a specific sugar , sweating phenomenon or hard mouth feel of chocolate itself of confectionaries which is coated with chocolate or filled with chocolate can be prevented . in addition , by a moistureproof effect to a corn container for ice confectionery , crispy mouth feel can be remained . | 0 |
referring to fig1 a signal circuit 1 in an embodiment of the present invention includes : a pull - up resistor 2 ; a light emitting diode 3 ; a light receiving element 4 ; a feedback resistor 5 ; an operational amplifier 6 ; a resistor 7 ; a transistor 8 ; an output terminal 9 ; pull - up resistors 10 and 11 ; an infinity - limit switch 12 which is turned on when a lens l reaches the infinity - point position ; a minimum - focusing - point limit switch 13 which is turned on when the lens reaches the minimum - focusing - point position ; and nand gates 14 and 15 with open collectors . the light emitted by the light emitting diode 3 is projected on a code plate i which has continuous on - off patterns and moves in association with the movement of the lens or on a tooth portion of a gear or the like for driving the lens , and the light receiving element 4 receives the light which passes through or is reflected by the code plate or tooth portion . the circuit constituted by the pull - up resistor 2 , the light emitting diode 3 , the light receiving element 4 , the feedback resistor 5 , the operational amplifier 6 , the resistor 7 and the transistor 8 shows an example of a displacement monitoring signal generator 16 . an infinity limit switch means 17 is constituted by the pull - up resistor 10 , infinity - point limit switch 12 and nand gate 14 . a minimum - focusing - point limit switch means 18 is constituted by the pull - up resistor 11 , minimum - focusing - point limit switch 13 and nand gate 15 . in this embodiment , the displacement monitoring signal generator 16 , infinity limit switch means 17 and minimum - focusing - point limit switch means 18 are connected in parallel with the common output terminal 9 among them . the infinity limit switch 12 and the minimum - focusing - point limit switch 13 are arranged just before the infinity point and minimum focusing point , respectively . drive direction signal input terminals 19 and 20 are connected to the camera body . a lens driving circuit is constituted by these drive direction input terminals 19 and 20 , the elements 21 - 36 and a lens driving motor m . reference numerals 21 and 22 denote and gates ; 23 and 24 denote inverters ; 25 - 28 show resistors ; 29 - 32 represent transistors ; and 33 - 36 denote diodes to prevent the application of the back electromotive force of the lens driving motor m between the collectors and emitters of the transistors 29 - 32 . the operation of this circuit of fig1 will now be described . when a drive direction signal p 1 which indicates the command for moving the lens in the direction of the infinity - point is transferred from the camera , the drive direction signal input terminal 19 becomes higher level . at this time , where the lens locates at the position nearer than the infinity position , since the infinity limit switch 12 is turned off , and a higher - level signal is applied through the pull - up resistor 10 to one input terminal of the and gate 21 , the input of the drive direction signal p 1 causes an output of the and gate 21 to become higher level , and the transistor 30 to be turned on through the resistor 26 . at the same time , an output of the inverter 24 becomes lower level , causing the transistor 31 to be turned on through the resistor 27 . at this time , since the drive direction signal input terminal 20 is at a lower level , the output of the and gate 22 also becomes lower level , and causes the transistor 32 to be turned off through the resistor 28 . an output of the inverter 23 becomes higher level , causing the transistor 29 to be turned off through the resistor 25 . therefore , the lens driving motor m is energized through the transistors 30 and 31 , so that the driving motor m advances the lens in the infinity - point direction . when the lens moves by the operation of the lens driving motor m , the code plate or tooth portion of the gear on which the light is projected by the light emitting diode 3 also moves in association therewith , so that the transmitted light or reflected light to be received by the light receiving element 4 is turned on and off . an output of the light receiving element 4 is amplified by the operational amplifier 6 , and turns the transistor 8 on and off to generate pulse - like displacement monitoring signals consisting of on - off signals representing a number corresponding to the displacement of the lens . at this time , a higher - level signal is applied from the pull - up resistor 10 and the nand gate 14 , and the drive direction signal p 1 having a higher level is also applied thereto from the drive direction signal input terminal 19 so that the nand gate 14 outputs a higher - level signal . a higher - level signal is applied through the pull - up resistor 11 and a lower - level signal is applied through the drive direction signal input terminal 20 to the nand gate 15 , so that the nand gate 15 outputs a higher - level signal . thus , the displacement monitoring signal is generated from the output terminal 9 . in this state , when the lens advancing operation in the infinity point direction is continued and the lens reached the infinity - point position , the infinity - point limit switch 12 is turned on . hence , the output of the and gate 21 is inverted into lower level and the transistors 30 and 31 are turned off , so that the lens driving motor m is stopped . at the same time , since the infinity limit switch 12 is turned on , the output of the nand gate 14 becomes lower level . the lower level signal makes the output terminal 9 become lower level to erase the displacement monitoring signal , thereby transmitting a lower - level signal as a limit signal from the output terminal 9 to the camera . in this way , the detection of infinity - point can be performed . on the other hand , when a drive direction signal p 2 which indicates a command for moving the lens in the direction of the minimum - focusing - point is transmitted from the camera to the minimum - focusing - point , the drive direction signal input terminal 20 becomes higher level . at this time , if the lens is not located at the minimum - focusing - point , the minimum - focusing - point limit switch 13 is turned off and a higher - level signal is applied through the pull - up resistor 11 to one input terminal of the and gate 22 . thus , by the input of the drive direction signal p 2 , the output of the and gate 22 becomes higher level , and the transistor 32 turns on through the resistor 28 . at the same time , the output of the inverter 23 becomes lower level , causing the transistor 29 to be turned on through the resistor 25 . at that time , since the drive direction signal input terminal 19 is at a lower level , the output of the and gate 21 also becomes lower level , this turns off the transistor 30 through the resistor 26 and the output of the inverter 24 becomes higher level , thereby turning off the transistor 31 through the resistor 27 . thus , the lens driving motor m is energized through the transistors 29 and 32 , so that the lens driving motor m advances the lens in the minimum - focusing - point direction . the displacement monitoring signal representing a number of on - off signals corresponding to displacement of the lens is generated by the displacement monitoring signal generator 16 in the same way as above . at this time , since the outputs of the nand gates 14 and 15 are at higher levels , the displacement monitoring signal is transmitted from the output terminal 9 to the camera . the nand gates 14 and 15 are used to apply the directional property to the infinity limit switch means 17 and the minimum - focusing - point limit switch means 18 . now assuming that the lens locates at the infinity position and that the drive direction is the minimum - focusing - point direction , two inputs of the nand gate 14 become lower level and its output becomes higher level , and two inputs of the nand gate 15 become higher level and its output becomes higher level . therefore , a lower - level limit signal is not provided from the output terminal 9 , so that the lens driving operation can be executed . likewise , even if the lens locates at the minimum - focusing - point , and the drive direction is the infinity - point direction , both outputs of the nand gates 14 and 15 become higher level , so that a lower - level limit signal is not provided from the output terminal 9 . in this embodiment , all of the circuits shown in fig1 are equipped within a lens barrel which is detachably connected to the camera . therefore , by attaching the lens to the camera , each of the terminals 9 , 19 and 20 is connected to the terminal corresponding to the terminal 9 , 19 or 20 respectively of the camera . thus , the signals corresponding to the focus detecting operation can be applied from the camera to the terminals 19 and 20 , and the displacement monitoring signal and the limit signal can be transmitted from the terminal 9 to the camera . referring now to fig2 another embodiment of the present invention is shown , in which only the portion different from that of fig1 is illustrated . the other portion is the same as that of fig1 . in this embodiment , the infinity limit switch means 17 and the minimum - focusing - point limit switch means 18 are connected in series to the displacement monitoring signal generator 16 against the common output terminal 9 through and gates 37 and 38 . in this embodiment , when the lens has been moved to the infinity or minimum - focusing - point , the and gate 37 or 38 is closed to shut off the displacement monitoring signal , so that a lower - level limit signal is output from the output terminal 9 . fig3 shows still another embodiment of the present invention , in which only the portion different from that of fig1 is illustrated and the other portion is the same as that of fig1 . in the embodiment of fig3 an infinity point limit switch 39 which is turned off at the infinity point and a minimum - focusing - point limit switch 40 which is turned off at the minimum focusing point are connected in series to the displacement monitoring signal generator 16 against the output terminal 9 . only the infinity limit switch 39 corresponds to the infinity limit switch means , and only the minimum - focusing - point limit switch 40 corresponds to the minimum - focusing - point limit switch means , respectively . in this embodiment , the direction of drive at the infinity or minimum - focusing - point is not considered . it is obvious that the similar effect can be obtained even in the case that a photoelectrical switch or the like as well as a mechanical switch is used as the above - mentioned limit switches 12 , 13 , 39 , and 40 . as described in detail above , in the present invention , when the lens has been moved to the infinity or minimum - focusing - point , the displacement monitoring signal to be generated in accordance with the movement of the lens is inhibited to be transmitted to the output terminal . therefore , for example , it is possible to prevent the occurrence of the false displacement monitoring signal caused by chattering , where the pulse - like displacement monitoring signal is generated by means of the comb tooth - like code plate and brush . consequently , in the present invention , it is possible to provide an automatic focusing lens which can reliably detect that the lens is located at the limit position in an automatic focusing apparatus which discriminates that the lens has been moved to either the infinity or minimum - focusing - point , on the basis that the displacement monitoring signal is not provided for a predetermined period of time during the lens driving operation . the circuit according to the present invention may be preferably applied to a system comprising : a single - lens reflex camera having an automatic focusing apparatus which detects the distance from the camera to an object to be photographed by dividing a picturing light beam transmitted through the lens and detecting a part of the beam divided ; and an automatic focusing lens which is detachably mounted to this camera . | 6 |
referring now to fig1 via a double circuit breaker 103 , two mains terminals 101 and 102 are connected to a control unit 104 and to the commoned first terminals of some elements which are characteristic of the type and function of the apparatus . thus , in a washing machine the element 105 will be an immersion heater , the element 106 a motor , and the elements 108 and 107 two electric valves . the second terminals fo the elements are connected to the control unit . at 1 and 2 , after the switch 103 , the mains is also connected to a rectifier and stabilizer unit 109 which supplies two positive direct voltages vb1 and vb2 , whose common negative pole is connected to ground . via its input channels 112 , 113 , 114 and 115 a multiplexer circuit 111 receives the data necessary for the execution of the program , for example the manual selection of a programme via the line 112 and , depending of the type and function of the apparatus in question , data relating to the value of physical quantities such as the temperature or others via the other channels . an output channel of the multiplexer 111 is connected to a microprocessor 15 to which a read - only memory 160 is connected , said microprocessor comprising two output channels which are respectively connected to the control unit 104 and to a display unit 117 . the positive supply terminals of the multiplexer 111 , of the microprocessor 15 , of the memory 160 and of the display unit 117 are connected to a conductor 11 , which is at the voltage vb1 , while the negative power supply terminals are connected to ground . the microprocessor 15 is also connected to the control device 119 via a two - way channel . the control device is connected to the grounding point via a switch 121 , which is mechanically coupled to the double circuit - breaker 103 . the microporcessor 15 in conjunction with the memory 160 receives instructions and data via the multiplexer 111 and supplies sequential instructions to the control unit 104 for activating the elements which are characteristic of the type and function of the apparatus . in parallel therewith , the microprocessor 15 sends instructions to the unit 117 which displays the nature of the selected program and the progress thereof . one of the principal functions of the control unit 119 is to protect data identifying an interrupted routine , said unit being frequently referred to as salvage unit or device . in the event of a power failure the salvage unit 119 detects a difference in the rate at which the voltage across the conductors 11 and 120 decreases and immediately sends an instruction to the microprocessor to transfer the data of the program in progress before the voltage vb1 has decreased below a specific lower limit value . during the failure condition , the data is stocked in a memory of the unit 119 , which memory is for example of the cmos type with a very low power consumption and is energized by an auxiliary power hold source , for example a storage capacitor which replaces the sources vb1 . when the power returns the duration of the power failure is measured ; indeed , independently of the problem of salvaging the data , it may be desirable to inhibit continuation of the program after a power failure which has persisted too long , be it only for the reason that the apparatus may be without supervision at the moment that the power returns . if a storage capacitor is used as auxiliary power hold source , the duration of the failure is found by measuring the residual voltage across the capacitor , which was fully charged before the occurrence of the failure , said capacitor being suitably the capacitor which energizes the salvage memory incorporated in the unit 119 . the duration of a power failure may also be derived from the reading of a counter , which is actuated when the power failure commences and which counts the number of clock pulses . the duration after which it is desirable to inhibit continuation may also depend on the point to which the program has proceeded at the instant of failure and on the nature of the program . for example , in a cooking appliance , cooking of a dish of vegetables may be resumed after an interruption of a quarter of an hour , while such a duration would be disastrous when baking a bread . if said duration is smaller than a predetermined value , various physical parameters defining the instantaneous state of the apparatus are measured by the microprocessor . the microprocessor compares these physical parameters with reference values corresponding to the phase of the program to which the apparatus has proceeded . the result of this comparison determines the conditions for continuation of the interrupted program . however , if the result of the comparison shows that the conditions for continuation of the program are not satisfied , the microprocessor will not proceed with the program and resets the apparatus to the state existing at the beginning of each program . when power is restored , a code is detected in the data received and returned by the salvage unit 119 , an incorrect code indicating an incorrect data salvage which inhibits the continuation of the program in progress , said code being constituted by a first word entered into a shift register which is kept energised during the power failure and which constitutes the salvage memory of the unit 119 . if the result of the comparison of the state of the apparatus with the reference values shows that the conditions for a continuation of the program are not satisfied , the microprocessor proceeds to restore them . some of said conditions may be physical parameters , in which case the microprocessor allows the program to continue and simultaneously replaces said physical parameters by their reference values in conformity with the said programme ; for example in a washing machine whose operation is controlled by a microprocessor , the microprocessor , after power restoration , instructs the temperature of the washing liquid to be measured and compares said temperature with the reference value corresponding to the phase of the washing programme which the machine has reached and , if the measured temperature is insufficient , gives an instruction to reheat the washing liquid and at the same time continue the program . the microprocessors in certain types of apparatus are programmed in program &# 34 ; steps &# 34 ; in analogy with the operation of electromechanical programming devices employed in a previous generation of apparatus . in this type of apparatus the total operating sequence is divided into a certain number of basic &# 34 ; steps &# 34 ; each corresponding to the execution of a function and proceeding depending various requirements ; a certain number of these &# 34 ; steps &# 34 ;, which are differently situated in the sequence , may be &# 34 ; skipped &# 34 ; depending on the nature of the program selected by the user . for the use of the method in accordance with the invention in such an apparatus when it is found that after comparison of the state of the apparatus with the reference values the conditions for a continuation the program are not satisfied , the microprocessor sets the machine to the state corresponding to a program step which precedes the step during which the power failure occurred . fig2 whose reference numerals correspond to those used in fig1 represents the control device 119 in accordance with the invention within a dashed frame . the two mains terminals 1 and 2 are respectively connected to the commoned anodes and cathodes of two pairs of rectifier diodes 3 , 4 and 5 , 6 . the commoned cathodes of the diodes 3 and 5 are connected to a positive line 7 of a non - stabilized voltage supply , while the commoned anodes of the diodes 4 and 6 are connected to a common ground , a smoothing capacitor 9 being included between the line 7 and earth . the line 7 is connected to the input of a voltage stabilizing circuit 10 , whose output is connected to a positive line 11 carrying a stabilized voltage vb , a smoothing capacitor 12 being included between the line 11 and ground . two power supply pins 13 and 14 of a microprocessor 15 are respectively connected to the line 11 and to the earth , while an output pin 16 of said microprocessor is connected to the base of a pnp switching transistor 18 via a resistor 17 , a resistor 19 and a capacitor 20 being arranged between said transistor and the line 11 . the collector of the transistor 18 is connected to the anode of an isolating diode 21 , whose cathode is connected to a positive line 22 , a storage capacitor 23 being included between said positive line and the grounding point 8 , which storage capacitor is shunted by a switch 24 which is mechanically coupled to the &# 34 ; start - stop &# 34 ; switch of the apparatus . the positive power - supply pin of a shift register 25 is connected to the line 22 and the negative power - supply pin to the ground ; the &# 34 ; data - input &# 34 ; of the register 25 is connected to the output of an &# 34 ; and &# 34 ;- gate 26 , of which one input is connected to a &# 34 ; general data &# 34 ; output pin 27 of the microprocessor 15 , while the &# 34 ; data output &# 34 ; of said register is connected to an input of an &# 34 ; and &# 34 ; gate 28 , whose output is connected to an input pin 29 of the microprocessor 15 . two &# 34 ; coding &# 34 ; output pins 30 , 31 and one clock output pin 32 of the microprocessor 15 are connected to the corresponding input pins of a demultiplexer circuit 33 , whose power - supply pins are respectively connected to the line 11 and the ground . one of the &# 34 ; clock &# 34 ; outputs of the demultiplexer 33 is connected to an input of an &# 34 ; and &# 34 ; gate 34 , whose output is connected to the &# 34 ; clock &# 34 ; input of the register 25 , a resistor 35 being included between the output of said gate and the ground . the anode of an isolating diode 36 is connected to the line 11 , while the cathode is connected to a positive line 37 , a storage capacitor 38 being included between said positive line and the ground . the negative input of the first comparator circuit 39 is connected to a resistor bridge 40 , 41 included between the line 37 and the ground , while the positive input is connected to a further resistor bridge 42 , 43 included between the line 7 and the earth . the output of the comparator 39 , which is connected to an &# 34 ; interrupt &# 34 ; input pin 44 of the microprocessor 15 , is connected to the line 37 via a resistor 45 and to the positive input via a resistor 46 . the positive input of a second comparator circuit 44 is connected to a first resistor bridge 55 , 56 included between the line 11 and the grounding point 8 , while the negative input is connected to a second resistor bridge 57 , 58 included between the line 37 and the ground . the output of the comparator 54 , which is decoupled from ground by means of a capacitor 59 , is connected to the line 11 via a resistor 60 , to the control input of the electronic switch 50 and to the second inputs of the gates 26 , 28 and 34 . the negative input of a third comparator circuit 47 is connected to a resistor bridge 49 , 48 included between the line 37 and the ground , while the positive input is connected to the line 22 via an electronic switch 50 , a resistor 51 being included between said positive input and the ground . the output of the comparator 47 is connected to a &# 34 ; validation &# 34 ; input 52 of the microprocessor 15 and via a resistor 53 to the line 37 . a capacitor 61 is included between a reset input 62 of the microprocessor 15 and the ground , said capacitor being bypassed by the emitter - collector path of a pnp transistor 63 , whose base is connected to the output of the comparator 54 . in order to simplify the following description , only the connections of the microprocessor 15 which directly relate to the data - salvage device in accordance with the invention are shown , to the exclusion of other connections relating to the data inputs and to the outputs for instructions which are specific of the apparatus in which it is incorporated , which may be a laundry or dish - washing machine , a cooking appliance etc . the function of the control device employed in the apparatus in accordance with the invention is to salvage the data stored in the microprocessor 15 at the instant that the current on the mains terminals 1 and 2 is interrupted . referring now to fig3 a and 3b , which respectively represent the voltages on the line 7 ( vr ) and on the line 11 ( vb ), it will be seen that at the instant t 1 at which the failure occurs the voltage vr begins to decrease , while the voltage vb remains stable until the instant t 3 corresponding to that value of vr which no longer permits stabilization ; this is achieved by giving the smoothing capacitor 12 a higher value than the smoothing capacitor 9 . in the case of a nominal supply voltage of 5 v for the microprocessor 15 , this voltage may decrease down to 4 . 5 v without impairing the microprocessor operation ; thus between the beginning of the failure and the critical threshold of the voltage vb a time interval of a few milliseconds is available which is utilized by the data - salvage device in accordance with the invention . during normal operation the voltage applied to the positive input of the comparator 39 from the line 7 is higher than that of the negative input , which is determined by the resistor bridge 40 , 41 via the line 11 ; in this situation the output of the comparator 39 supplies a &# 34 ; high &# 34 ; level to the &# 34 ; interrupt &# 34 ; input 44 of the microprocessor 15 ( fig3 c ). in the case of a power failure the voltage vr on the line 7 begins to decrease at the instant t 1 ( fig3 a ) and , when it reaches 8 v at the instant t 2 , the output of the comparator 39 changes to a &# 34 ; low &# 34 ; level ( fig3 c ) which , when applied to the input 44 of the microprocessor , interrupts the normal program of said microprocessor in order to replace it by a power - outage subroutine . this subroutine allows the clock pulses to be applied from the output 32 to the gate 34 via the demultiplexer 33 by means of a logic code on the outputs 30 and 31 and the &# 34 ; output &# 34 ; of the data necessary for a possible continuation of the normal mode of operation via the pin 27 . during this time the gates 26 , 28 and 34 are open and the switch 40 is closed , their control inputs being &# 34 ; high &# 34 ; ( fig3 e ) owing to the state of the output of the comparator 54 , whose voltage on the positive input is higher than voltage on the negative input ; in this situation the clock pulses are received from the gate 34 , causing the register 25 to be loaded with the data issuing from the gate 26 ( fig3 d ). after a time interval necessary for loading all the data into the register 25 , which interval is approximately 350 μs , the &# 34 ; failure &# 34 ; subroutine of the microprocessor changes the logic code of the outputs 30 and 31 , and also interrupts the loading operation ; it is to be noted that for reasons of clarity this loading sequence is considerably simplified in fig3 d . from the instant t 3 ( fig3 a ) the voltage vb on the line 11 begins to decrease and when it reaches the threshold of 4 . 5 v the output of the comparator 54 changes , thereby closing the gates 26 , 28 and 34 , opening the switch 50 and turning on the transistor 63 ( reset ) ( fig3 e ). simultaneously , the decrease of the voltage vb on the line 11 causes the diode 21 to be cut off , thereby maintaining the high charge of capacitor 23 as a result of this , the c - mos register 25 which has a very low power consumption , remains energized without the possibility of an erroneous read - out via its data inputs and outputs because the gates 26 and 28 are blocked . the decrease of the voltage vb on the line 11 also causes the diode 36 to be cut off , which for a certain time interval maintains the charge of the capacitor 38 which energizes the comparators 39 , 47 and 54 via the line 37 . when the power is restored the voltage vr at the instant t 4 ( fig3 a ) is sufficient to enable the voltage vb to increase again to 4 . 5 v ( fig3 b ) and again energize the comparators , which first of all causes the gates 26 , 28 and 34 to be opened and the switch 50 to be closed ( fig3 e ). however , the transistor 18 is held in the cut - off state by a positive voltage applied to its base from the output 16 of the microprocessor 15 ( fig3 f ); in this situation the capacitor 23 retains its charging voltage , which it held at the instant that power was restored , this residual voltage being applied to the positive input of the comparator 47 via the switch 50 . the value of the residual voltage of the capacitor 23 at the instant that power is restored of course depends on the duration of the power failure ; however , there is a threshold value of the supply voltage of the register 25 below which the preservation of the stored data is no longer guaranteed , for example 3 v . if the residual voltage at the instant that the power supply is restored is higher than said critical value ( dotted lines fig3 g ), the output of the comparator 47 will supply a high level ( fig3 h ) to the &# 34 ; validation &# 34 ; input 52 of the microprocessor 15 at the instant t 4 , which enables a transfer of the salvaged data contained in the register 25 to the microprocessor 15 by way of the input terminal 29 via the gate 28 ( fig3 d ). in the case that the value of the residual voltage is smaller than the threshold level ( dotted line fig3 g ) the output of the comparator 47 will remain &# 34 ; low &# 34 ; ( fig3 i ) and the microprocessor is set to a stand - by position in anticipation of re - programming . the instant at which the choice is made between these two possibilities is the instant t 5 ( fig3 a ) at which the output of the comparator 39 again supplies a &# 34 ; high &# 34 ; level to the &# 34 ; interrupt &# 34 ; input 44 of the microprocessor ; therefore , it is of importance that the transistor 18 is still cut off at this instant , which is realized by delaying the instant at which the signal appears on the output 16 of the microprocessor which turns on transistor 18 ( fig3 f ), which signal enables capacitor 23 to be recharged . steps are taken in order to cope with certain situations which may occur ; thus , after the registers have been loaded , the microprocessor 15 remains in a waiting loop of approximately one second if normal operation could be restored in the case of a mains voltage decrease which is too slow . equally , in order to allow for an erroneous power return , the re - transfer of the data stored in the register to the microprocessor is also effected after a waiting loop of one second . after power has been restored and before the voltage vb feeding the microprocessor has reached a sufficient value , the output level on pin 16 may therefore assume incorrect values ; in order to preclude partial recharging of the capacitor 23 by an accidental turn - on of transistor 18 before the value of the residual voltage has been taken into account , said transistor is kept cut - off by the inclusion of the capacitor 20 , which provides a positive base bias while the voltage vb is increasing . the gate 34 , which is blocked when the voltage vb is lower than 4 . 5 v , prevents any transfer of spurious signals to the clock input of the register 25 , which signals may affect the content of said register and which result from random operation of the microprocessor 15 and of the demultiplexer 33 in the case of an insufficient supply voltage . the switch 24 for short - circuiting the capacitor 23 is mechanically coupled to the common &# 34 ; start - stop &# 34 ; switch ( not shown ) of the apparatus , in such a way that it is closed after the terminals 1 and 2 are no longer energized and which opens before said terminals are connected to the mains ; in this way it is avoided that the device responds to a voluntary power cut - off of the apparatus in the same way as to an accidental mains power failure . the use of the control method and of the data - salvage device in accordance with he invention is illustrated by way of example by its use in a laundry washing machine whose operation is controlled by a microprocessor . the microprocessor ( 15 ) used is commercially available from the signetics company under the reference 8035 , the demultiplexer ( 33 ) being of the type &# 34 ; 74 ls 139 &# 34 ; and the shift register ( 25 ) being formed by a double &# 34 ; 4006 &# 34 ; from the same company . table i , by way of example lists all the program &# 34 ; steps &# 34 ; of a washing machine whose microprocessor is programmed &# 34 ; step by step &# 34 ;. table i______________________________________operations no . of steps functions______________________________________ 1 filling - stirringprewashing 2 heating - stirring 3 stirring 4 draining - stirring 5 filling - stirring 6 heating 7 stirringwashing 8 stirring 9 stirring 10 stirring 11 stirring 12 replenishing 13 draining - stirring 14 filling - stirring1st rinse 15 draining - stirring 16 filling2nd rinse 17 filling + addition detergent 18 stirring 19 draining 20 filling - stirring3rd rinse 21 detection of motor direction 22 draining + fast rotation 23 spin drying 24 filling4th rinse 25 filling + softener addition 26 stirring 27 stip with full tub 28 detection of motor directionspin drying 29 draining + fast rotation 30 spin drying 31 spin drying 32 stop______________________________________ the following flow chart as well as the accompanying description relate to the detailed logic used for this specific use . table ii______________________________________power outage subroutinefailure ## str1 ## ## str2 ## ## str3 ## ## str4 ## ## str5 ## ## str6 ## ## str7 ## ## str8 ## ## str9 ## ## str10 ## ## str11 ## ## str12 ## ## str13 ## ## str14 ## ## str15 ## ## str16 ## ## str17 ## ## str18 ## ## str19 ## ## str20 ## ## str21 ## ## str22 ## ## str23 ## ## str24 ## ## str25 ## ## str26 ## ## str27 ## ## str28 ## ## str29 ## ## str30 ## ## str31 ## ## str32 ## ## str33 ## end of storage operation______________________________________ when the microprocessor 15 receives an interrupt instruction as a result of the detection of a voltage drop on the inputs of the stabilizer 10 , it transfers all the data necessary for a subsequent continuation of the washing sequence to the register 33 , namely : a first eight - bit word containing the number of one of the selected washing programs ( cotton 95 °, synthetic fabrics , woolens , etc .) and the selected options , for example &# 34 ; prewash &# 34 ; on request , an &# 34 ; economy program &# 34 ; with reduced temperature and water level , &# 34 ; half load &# 34 ; also with reduced water level , a second eight - bit word representing the washing temperature and the spin drying speed , a third eight - bit word representing the display data for the washing cycles associated with the program and the selected options ( prewash , wash , four rinsing cycles , stop with full tub , final rinse ), a fourth eight - bit word representing the progress of the washing sequence at the instant of failure ( number of steps from 1 to 32 , table i ). each of the introductory cycles of the said four words is prepared by the output sub - program which is elaborated in table iii . the above data transfer is effected in approximately 350 μs and after a last output sub - program , the microprocessor 15 is set to a one - second waiting loop which serves to prevent the operation of the machine being resumed in the case of a mains voltage which decreases too slowly . the microprocessor 15 , which is reset to the beginning of its program when power is restored proceeds with the following operations : cancellation of the instructions from the control unit 104 ( fig1 ), thereby rendering the machine inoperative , turning off the seven - segment displays and light emitting diodes of the display unit 117 , checking the residual supply voltage of the salvage register 25 by sensing the output of the comparator 47 . if the residual supply voltage of the capacitor 23 is smaller than 3 v , the machine is set to a stand - by state in anticipation of a new washing program ; otherwise operation continues as follows : read - out of the code ; this code is designed to enable a shift to the right of the register and to allow for this during the read - out of the four salvaged words -- which code is written as : 1000 , valid codes : 1000 and 100 , if the first or the second bit which is read is 1 , the salvage operation is invalidated and the machine is also set to stand - by in anticipation of a new washing program . this tolerance of a shift by one position of the register enables the system to allow for the effect of a spurious pulse occurring at the instant at which power is restored and which could be mistaken for a clock pulse by said register . stop - cycle test . in two cases operation should not be continued from the step interruption occurred : ( a ) stopping during a heating step , operation is continued with the preceding filling step in order to avoid heating without water ; ( 2 ) interrupted during a spin drying step , restarting from a preceding filling step , in order to ensure a correct balancing of the load of laundry during spin drying ( start spin drying with full tub ). interruption during step 22 or 23 , restart step 20 interruption during step 29 , 30 or 31 , restart step 26 . stopping with full tub ( step 27 ) will not be effected for a second time if the machine stops at one of the cycles 29 , 30 or 31 , owing to the presence of a bit of the fourth salvaged word , which becomes &# 34 ; 1 &# 34 ; at the instant that the &# 34 ; stop with full tub &# 34 ; function is executed . | 6 |
fig1 shows an exemplary illustrative non - limiting overall online transaction system 50 for providing online classified advertisements and other functionality . fig1 a shows an example overall system flowchart of steps and workflow that system 50 performs . as shown in fig1 , any number of remote users 90 ( 1 ), 90 ( 2 ), 90 ( 3 ), . . . 90 ( n ) use browser - based or other appliances 100 ( 1 ), 100 ( 2 ), 100 ( 3 ) . . . 100 ( n ) to communicate via the internet or other network 102 with an online transaction server ( s ) 104 . appliances 100 ( 1 ), 100 ( 2 ), 100 ( 3 ), . . . 100 ( n ) may comprise personal computers , cellular telephones , pocket pc &# 39 ; s , personal display appliances , web - enabled televisions or set - top boxes , or any type of appliance that can display information and collect and forward user input . server ( s ) 104 stores information in one or more databases 106 ( a ), 106 ( b ), 106 ( c ), 106 ( d ) 106 ( a ), and deliver stored information in the form of classified listings ( 202 ) and , in some implementations , auction - style listings ( 204 ) to users 90 ( 1 ), 90 ( 2 ), 90 ( 3 ), . . . 90 ( n ) on demand or otherwise via the network 102 for display on user appliances 100 ( 1 ), 100 ( 2 ), 100 ( 3 ), . . . 100 ( n ). if the user 90 ( 1 ) is a seller , the user can insert a classified listing into the database 106 a ( fig1 a , left - hand side , blocks 602 , 612 - 622 , 302 - 308 ). other users 90 ( 2 ), 90 ( 2 ), 90 ( 3 ), . . . 90 ( n ) use a search facility 201 ( figure 1a blocks 230 , 604 ) to select and review listings ( search results 230 a ) ( e . g ., based on geographical proximity and / or other criteria ), and may interact with such listings and other displays via keyboards , mice , touch screens or other well - known user input devices ( figure 1a blocks 620 , 624 , 628 ). such real - time user interactivity allows users 90 ( 1 ), 90 ( 2 ), 90 ( 3 ), . . . 90 ( n ) to search for ( 230 ) and select particular listings of items being offered for sale ( 230 a ). users 90 ( 1 ), 90 ( 2 ), 90 ( 3 ), . . . 90 ( n ) may also search for dealer information using “ find your dealer ” search functionality ( block 215 ). in an exemplary illustrative non - limiting implementation , such “ find your dealer ” search functionality searches a database of dealer information ( block 106 e fig1 ) and provides a details page 215 a listing dealers in the user &# 39 ; s geographical area . in the exemplary illustrative non - limiting implementation , the user can narrow his or her search based on keyword searching and / or based on “ specialties and services ” criteria to be explained below in detail . users 90 ( 1 ), 90 ( 2 ), 90 ( 3 ), . . . 90 ( n ) may review selected listings ( figure 1a blocks 232 , 240 , 606 , 608 ). server ( s ) 104 allows sellers to manage their listings ( e . g ., “ my page ” 648 ) through use of seller tools ( 208 ) such as “ view inventory ,” ( 680 ) “ search inventory ,” ( 682 ) “ add / edit inventory ,” ( 684 ) “ add photos ,” ( 304 , 686 ), “ select template ” ( 306 ), “ edit dealer information ,” ( 638 ) and report generation ( see figure 1a blocks 680 - 688 , 212 ). a management module 211 , which allows the seller to manage their listings , can include a “ my account ” module 630 , a “ my ratings ” module 632 , a “ item &# 39 ; s i &# 39 ; m selling ” module 634 , a “ my settings ” module 636 , a “ my bids ” module 638 , which includes modules “ item i lost ” 642 and “ item i won ” 644 , a “ my searches ” module 640 and an “ item i watch ” module 646 . server ( s ) 104 also facilitate direct communication between sellers and potential buyers via email or other forms of communication , to allow and encourage “ out of channel ” price negotiation and other contact ( 610 ). server ( s ) 104 also , in one exemplary illustrative non - limiting implementation , allows buyers to rate sellers ( 206 , 632 ), and provide notification to sellers of such ratings in advance of posting so the sellers can protect their reputation by satisfying dissatisfied buyers who may then withdraw unsatisfactory ratings ( figure 1a block 632 , 209 ). server ( s ) 104 also provides billing services ( 210 ) to bill for listing services figure 1a block 614 ). auction style management tools 211 and registration tools 214 are provided as well . in one example illustrative non - limiting implementation , platform 50 is used to provide online retail automotive services to enable dealers and private sellers to list items for sale but other types of goods are also possible including for example real estate , boats , airplanes , or any other kind of item that can be offered for sale . buyers can have the ability to research sellers &# 39 ; items and past transactions via history reports , inspection service partners and seller ratings . the functionality is that of an open - ended , advertising and transaction mechanism — meaning it is designed to minimize system - imposed rules that could slow down the speed , frequency and efficiency of transactions . the illustrative implementation sacrifices ability to measure conversion rate in some regards to improve ease of use and success for its participants . exemplary illustrative online transaction platform 50 provides ease of use , focus on driving local transactions ( on and offline ), and integrates well with existing / future portfolios of classified listing products 106 a , 202 . the online platform 50 and associated services can be offered as both stand alone services and as part of a bundle of advertising products ( e . g ., including online and print classified advertising ). posting 204 , managing , reporting 202 and billing 210 are synchronized so each can leverage off the other . an online auction - style listing service can be included or not included depending on the business model or other application usage . the illustrative online platform 50 is simple to use for dealers and private sellers and buyers in all functional areas including for example sign in ( 606 a ) registration ( 236 a , 236 b ), listing , management and bidding . fig2 and 2a are flowcharts of an exemplary illustrative non - limiting “ find your dealer ” function that allows a consumer or other user to search for dealer information in a database and display results . in an exemplary illustrative non - limiting implementation , an initial step is performed to collect information about merchants including filtering and other information ( fig2 a block 900 ). this collected information is stored in database 106 e in the form of database records . as will be understood by those skilled in the art , the database records can include any kind of information such as text , photos , videos , links to websites and a variety of other information . in one exemplary illustrative non - limiting implementation , each database record r may include a profile field f including information , e . g ., full text filters or bitmapped based indicating whether the merchant associated with that record is associated with that predetermined characteristic . such profile field information f is available for filtering of retrieved results as will be explained below . in an exemplary illustrative non - limiting implementation , system 50 ascertains , through input or otherwise , geographical information and search criteria from a user ( block 1002 ). system 50 then performs a search against dealer database 106 e ( fig2 block 1004 ; fig2 a block 1002 a ) and retrieves a data set of associated records ( block 1006 ). sorting and / or filtering criteria are applied to the retrieved records to sort and / or filter them ( block 1008 ). the resulted sorted and filtered records are compiled into results that are usedx to generate a presentation such as for example a display on a web page ( block 1010 ). in the exemplary illustrative non - limiting implementation , the user is able to change search , sort , filter and / or presentation criteria after reviewing the displayed results in order to refine or better direct the results ( block 1012 ). in the exemplary illustrative non - limiting implementation , some such changed criteria require a new database search and retrieval operation (“ n ” exit to decision block 1014 , blocks 1004 , 1006 and following ). however , in one exemplary illustrative non - limiting implementation , certain types of changed criteria do not necessitate a new database search but rather can be effected by re - sorting previously retrieved results and / or otherwise re - presenting previously retrieved results in a different way (“ y ” exit to decision block 1014 , blocks 1008 and following ). for example , clicking on a link or button “ view all specialties and services ” or “ hide all specialties and services ” can be implemented if desired by re - displaying previously received information differently ( e . g ., displaying more or less information ). re - presentation of the same information in a re - sorted or re - filtered form can be provided through javascript or applets delivered with a web page in some exemplary illustrative non - limiting implementations . such functionality can provide extremely responsive and user - friendly displays that minimize user wait time even under high load levels . a request by the user to sort results by a different criteria ( e . g ., alphabetic as opposed to distance ) can , if desired , perform a re - sort or a new search and sort , whichever is most efficient and effective . similarly , user selection of a particular “ specialty or service ” ( e . g ., “ loaner car ”) can initiate a new search of the dealer database , or it can re - filter — based on newly specified filtering criteria — previously retrieved results . whether or not a new search is performed may depend on a tradeoff between database search time and intermediate result storage space . fig3 shows an exemplary illustrative non - limiting sequencing of find your dealer page displays . from a home or other page ( see fig4 a ), the user may select a “ find your dealer ” link ( see fig4 b ) to initiate a find your dealer search ( block 1020 ). a find your dealer input page ( see fig4 c ) may then request the user to input information useful for performing a dealer search ( block 1022 ). in one exemplary illustrative non - limiting implementation , the user may be asked to input a zip code plus other optional information such as distance radius and keyword ( s ). in one exemplary illustrative non - limiting implementation , the distance radius can be selected from a pulldown menu ( e . g ., within 10 miles , within 25 miles , within 50 miles , etc .) with a default . in one exemplary illustrative non - limiting implementation , the user may input one or more keywords that are used for full text searching with automatic synonyms ( e . g ., chevy = chevrolet ), boolean and or or functions , and other features . in one exemplary illustrative non - limiting implementation , the user does not need to type “ and ” and the system 50 will automatically search for dealerships with all the keywords the user enters . for example , the search “ financing body shop ” will show dealerships that offer financing and have body shops . the user may be encouraged to enter keywords that describe what you want most from a dealership . the user can search by a dealership name or by dealership features such as financing deals , special offers , loaner cars , shuttle services , body shops and more . example searches might include for example “ john doe autos service center ” or “ bmw parts accessories ”. the system 50 can implement a basic spelling checker , but may not of course find every misspelling , especially misspelled dealership names . the system can prompt the user with a “ did you mean . . . ?” prompt if a dictionary maintained by the system based on database contents indicates the user may have intended to input a different spelling . quotation marks can be used to find exact phrases . if the user enters a string of words with quotation marks around them , the system in one exemplary illustrative non - limiting implementation will search for dealerships with those exact words and in that exact order . for example , entering “ special interest financing ” will give results with the words special , interest and financing — in that exact order . the system can automatically strip out all punctuation , and searches need not case sensitive ( e . g ., so the user will get the same results whether he enters “ service center ”, “ service center ” or “ service center .” once the user completes the input form and clicks on “ search ” ( see fig4 c ), system 50 performed a rapid search against dealer database 106 e and retrieves , sorts , filters and displays the results in a results page ( block 1024 ). an example results page is shown in fig4 d . this results page may indicate how many dealers are located within the specified geographic criteria and display the results by location ( with dealers closest to the user &# 39 ; s inputted zipcode being displayed first ). various criteria can be used to further sort retrieved results that meet the same geographic criteria . if the user inputted keywords , then only those listings that include the specified keywords are displayed in the results page . as can be seen in fig4 d , the exemplary illustrative non - limiting results page includes a predetermined menu of potentially distinguishing of differenting characteristics ( so - called “ services and specialties ” in this particular example ) of additional criteria that can be used to further filter the retrieved data . this menu or checklist is populated with predetermined distinguishing characteristics of pontentially high interest to the consumer such as financing options , services , type of inventory , languages spoken , and other criteria . one example illustrative non - limiting set of such “ services and specialities ” for a car dealership application can comprise the following by way of example only without limitation . financing good credit bad credit no credit services service center factory authorized service center body shop customization detailing parts & amp ; accessories concierge delivery options courtesy shuttle loaner cars rental cars vehicle inventory classic / collector conversion vans handicap - equipped hybrid commercial / fleet amenities business center children &# 39 ; s play area comfortable waiting area handicapped accessible internet access languages spoken american sign language chinese french german italian korean polish russian spanish tagalog vietnamese in the exemplary illustrative non - limiting implementation , a number or other indicator displayed next to each of these criteria indicates how many items retrieved in the current search meet the corresponding criteria . in the example shown , 400 dealerships were returned based on the user &# 39 ; s search (“ honda accord ” key terms within 25 miles of zip code 30076 ) but the page indicates that only 35 of those retrieved items feature a body shop . the checklist or option list thus conveys to the user not only additional search / filter criteria the user may be interested in , but also the number of retrieved listings in the current search that meet such criteria . in the exemplary illustrative non - limiting implementation , clicking on the box next to one of these criteria causes the system 50 to immediate redisplay the results page with only those listings that include the checked characteristic ( the box corresponding to the selected characteristic is “ checked ” with an “ x ” or a check mark ). clicking the same box again may uncheck the box to cause automatic redisplay without the associated characteristic limitation . in the exemplary illustrative non - limiting implementation , each time a redisplay occurs based on a new criteria , the totals next to each displayed criteria change based on the current search results including the selected criteria . the user may select multiple such criteria ( e . g ., “ body shop ” and “ espanol ”) to perform a boolean “ and ” and display only those listings that meet all selected criteria simultaneously . an “ uncheck all ” link may be provided to allow the user to efficiently uncheck all selections . in the exemplary illustrative non - limiting implementation , the data retrieved from database 106 e contains sufficient information so that system 50 can filter it based on the user - selected “ specialties and services ” criteria . this provides an efficient and fast search since the system does not need to search a long string of search criteria . this process of first searching ( based e . g ., on geographical location and keywords if any ) and then filtering ( based on user selection of a menu of predetermined criteria ) facilitates very fast and responsive searches and result presentation . user selection of predetermined specialties and service criteria in one exemplary illustrative non - limiting implementation can be conveyed in the form of a url a user &# 39 ; s browser automatically generates and sends back to a server . an exemplary illustrative non - limiting url including filters for “ good credit ”, “ bad credit ” and “ body shop ” is shown below : in the example above , the first part of the url ( omitted based on uspto restrictions on included active urls in patent specifications ) may designated the name of a server on the internet or other computer network from which the information is to be retrieved . the next portion may reference a java server page , which as well known to those skilled in the art , provides javaserver pages ( jsp ) technology provides a simplified , fast way to create dynamic web content , more information about jsp is readily available from sun microsystems or a variety of other sources . see for example “ the glassfish project : open source java ee 5 application server implementation ” and “ java web services developer pack j2ee 1 . 4 sdk ”, both incorporated herein by reference . as can be seen from reviewing the remainder of the example url , the “ results ” field specifies a database search based on location ( in this case 25 miles from the centroid of zip code 22205 ) and a sort by distance and the occurrence of keyboards ( if specified ). the pagesize parameter specifies 25 listings per page . filters in this particular example are based on predetermined distinguishing characteristics of “ good credit ” and “ no credit ” and “ body shop .” this relatively simply command interface to a world wide web server provides flexible , fast and efficient search , sorting and filtering capabilities that the user can select and change in an easy and user friendly manner . as shown in fig3 , a link may be provided to selectively display or hide the various “ specialties and services ” associated with each displayed listing . selecting “ display specialties and services ” can expand each of the already - displayed listings to provide a listing of applicable specialties and services for each listing as shown in fig4 e . such a feature can be implemented , in a world wide web context , with javascript , applets or any other convenient technology so that no additional search or even server request is needed and representation occurs entirely within the user &# 39 ; s browser view . fig5 shows an exemplary partial structure for merchant database 106 e . in the exemplary illustrative non - limiting implementation a master or key “ owner ” table 1302 is used to index into a number of different conventional database tables ( e . g , security , photos , text , logs , etc .). one of the indexed tables is an owner filter table 1304 that in turn indexes an owner filter record 1306 . the owner filter record 1306 includes a filter - id number , description and display text . such records may encode the predetermined filtering characteristics described above . any number of such tables may be used to provide efficient database lookup . fig5 a shows an exemplary illustrative non - limiting form 1308 a merchant or other data input operator can use to specify the filtering information contents . in one exemplary illustrative non - limiting implementation , merchants are empowered to input and change their own differentiating characteristics . such changes to their profiles can be made quickly and easily by simply calling up page 1308 and checking or unchecking different menu options . some merchants can opt out altogether . in one exemplary illustrative non - limiting implementation , there may be a maximum number of such characteristics a merchant can list , but merchants who are willing to pay a premium price can increase that number if desired . in other exemplary illustrative non - limiting implementations , a third party surveyor or reviewer may maintain control over the profile data entries to maintain them and / or ensure they are accurate . in still other non - limiting implementations , consumers , merchants and third party watchdogs or any subcombination thereof can have input as to what filtering characteristics are associated with which merchants . fig6 shows an example illustrative non - limiting geographic locator (“ geosearch ”) algorithm used to search and sort merchants by distance . in the example shown , a centroid of the user &# 39 ; s inputted zip code is calculated in latitude and longitude , and the system 50 then a bounding box is calculated ( in latitude and longitude coordinates ) is calculated based on the user &# 39 ; s inputted “ distance from ” parameter . these latitude and longitude search coordinates are used to perform a comparison against geographical information stored within database 106 e to locate all merchants within the specified geographic locality . such retrieved records can then be sorted based on how close the merchant is to the user &# 39 ; s zip code centroid and / or other factors . such geosearches can be performed in combination with other search criteria ( e . g ., “ all car dealers with more than 10 minivans in stock on site within 10 miles of me ”). the exemplary illustrative non - limiting implementation provides a dynamic inventory function ( see fig7 ) that can be employed in conjunction with other search criteria to provide such useful and efficient search results . in more detail , at least some of the merchants listed within database 106 e may also maintain updated inventory listings with system 50 . system 50 may thus “ know ” what each of these merchants has in the way of inventory at any given time . such inventory information can be advantageously displayed dynamically ( e . g ., as shown in fig7 ) on a merchant by merchant basis , and may also be used as search criteria . for example , the “ inventory stats ” may include a breakdown of the number of each of various different types of products in inventory at any given time ( e . g ., convertible , coupe , hatchback , sedan , suv , truck , van and wagon for car dealerships ). such inventory information can be , in one exemplary illustrative non - limiting implementation , combined with geographic and other search or filtering criteria to provide very useful search results for consumers shopping for a new item . the inventory statistics may change dynamically as the merchant updates database 106 e ( e . g ., as items are sold to customers and new items come into stock for sale ). techniques such as open source cewolf can be used to build and display the charts automatically . cewolf can be used inside a servlet / jsp based web application to embed complex graphical charts of all kinds into a web page . it provides a full featured tag library to define chart properties . a data collection java class and a chart customization java class can be used to support such functionality . referring back to fig4 d , the “ dealership search results ” page provides useful information about each returned merchant including for example a dealership photo , contact information , a listing of the number of services and specialties ( the details of which can be hidden or displayed as desired ), and a prominent service and specialty in addition , at least some such merchant listings include a “ more info ” link that a user can select to access more detail including inventory information pertaining to that specific merchant . clicking on the “ more info ” link can bring up a merchant detail page such as shown in fig8 . such a merchant detail page can include for example the merchant &# 39 ; s name , the merchant &# 39 ; s address and map link or other geographic locator , a logo , an email popup link , a secure credit application link , a call tracking or click for number link , and a dealer photo . in addition , inventories can also be displayed , in one exemplary illustrative non - limiting implementation , on the merchant detail page such as shown in fig8 . such detail pages can include a variety of different kinds of information and include an ability to view and search through inventory in stock . as shown in fig8 , a particular car dealership has 134 vehicles in stock . the first three vehicles are featured with thumbnail photos , and the total inventory statistics are displayed both graphically and numerically . the inventor can be displayed for example from least expensive to most expensive or in any other desired order . the user can click on arrow buttons ( backwards or forwards ) to scroll through the available inventory ( e . g ., clicking on “ next ” displays photos of the next three items in a dynamic fashion with the photos “ sliding ” to the left across the page in an almost animated way ). the page can also include a listing of “ specialities and services ” presented in an easy to read and understand listing format . clicking on a photo or on an associated link takes the user to a detailed view of that particular item ( see for example fig9 ). such an item detail page can include any number of photos , a written description of the item , and if desired , an “ email seller ” form that allows the user to send an email to the seller asking a question — thereby potentially beginning a sales negotiation or at least creating a “ lead .” such a page can also allow a user to access a slide show of large photos ( see fig1 ) and / or a virtual tour ( movie ) of the vehicle ( see fig1 ) with 3d virtual camera control , zoom or the like . other types of movies ( see fig1 ) can also be accessed and played in a conventional fashion . fig1 and 14 shows search functionality provided in connection with the inventory detail page described above . in one exemplary illustrative non - limiting implementation , it is possible for a user to search through inventory to locate particular items of interest . for example , fig1 shows a display of “ special ” items , whereas fig1 shows a display of items that match the user &# 39 ; s inputted criteria . thus , a user can look at all items in the inventory of a particular merchant , or just particular items of a type the user specifies . 1 . receive values — a user can enter up to 5 types of values for owner search : zip , distance , current page , an optional set of keywords , and an optional set of filters . 2 . setup search — after receiving these 5 parameters from the user , the system begins to setup the search parameters that will be passed to the database . one exemplary illustrative non - limiting implementation follows these steps to setup the search : a . to limit the search results returned — compute the “ bounding - box ” latitude and longitude maximum and minimum coordinates for the search . the box is computed by taking the latitude and longitude of the center of the user &# 39 ; s zip and creating a maximum area square around that center point . the limiting distance is given by applying the user &# 39 ; s requested distance to all sides of the square . the maximum square will be limited to a 300 mile “ radius ” in each direction by the user interface . this computation gives 4 values for min / max lat / long . the system restricts the search by these 4 values to retrieve a smaller set of results . b . to limit the amount of data needed to be retrieved , system 50 executes the search against a limited “ view ” of data . this view returns a very small selection of the owner document data — just enough to compute the search and sort the documents correctly . the view in one exemplary illustrative non - limiting implementation will contain only the following fields — not the entire owner document : c . exemplary conventional search engines provides the capability to sort by owner name and number of benefits directly in the search engine . if either of these sorts are selected , it is possible to add the appropriate parameters to have the search engine order the documents . 3 . check cache — the system checks a server - specific cache based on the search parameters to see if it has executed a similar search . if it has executed this search before ( probably from a paging link )— then the system will return the existing results and skip to step 8 . 4 . execute search — if the search wasn &# 39 ; t found in the cache , the system will execute the search the following parameters . the initial search results will be returned by the search engine . g . sort by owner name or number of benefits if appropriate . 5 . retrieve navigators — the first thing system 50 retrieves via the search engine is a set of navigators that provide aggregated information ( metadata ) about the results of the search . these navigator counts are placed in an aggregate container object that will be shared with the dwsi search system . the navigators returned to the ui are : a . a set of filters with the count of each aggregate &# 39 ; s value . ( stored in a hashset in an aggregate / navigators java object ). 6 . compute distance — if the user selected a distance sort , the system 50 needs to retrieve all documents for a given search . system 50 computes the distance from the center of the user &# 39 ; s zip to the lat / long of the owner . the system 50 then sorts the documents based on this distance value . this sorted list is cached separately from the regular search object . 7 . add to cache — once the system has the sorted list of all owner ids from the search engine view , it places this search result in the server - level cache for retrieval from other similar searches ( mostly from paging .) 8 . retrieve owners — the system next retrieves all the owner information for the user &# 39 ; s selected page of results . it is possible to obtain this owner info from a searchresultproxy class that will cache owners that have been previously seen in using functionality in other portions of the system . the system 50 asks for the set of owners ( usually 20 ) for the current page . the proxy class pulls the owners from cache and retrieves all non - cached owners with one additional combined query . 9 . return results — the system returns to the user interface a searchresult object which contains : 1 . a list of the 20 owners to display on the page . 1 . receive values — this search receives a set of parameters that define an inventory search . 2 . setup search — searches are performed against the an inventory view which will return just the values that of interest . all parameters plus sorting will be passed to the search engine . 3 . check cache — the system checks a server - specific cache based on the search parameters to see if it has executed a similar search . if it has executed this search before ( probably from a paging link )— then it returns the existing results and skip to step 7 . 4 . execute search — if the search wasn &# 39 ; t found in the cache — the system executes the search to the search engine . the current page and # per page will be used to determine the starting value for retrieving results from the search engine . 5 . retrieve navigators — the first thing the system retrieves from the search engine is a set of navigators that gives aggregated information ( metadata ) about the results of the inventory search . the system takes these navigator counts and places them in an aggregate container object that will be shared with the find your dealer search system . the aggregates are used by the inventory search form , and other functions . the navigators we will return to the user interface are : 6 . add to cache — once the system has the results of the search , it places this search result in the server - level cache for retrieval from other similar searches ( mostly from paging .) 7 . retrieve listings — the system now retrieves all the car inventory listing information for the user &# 39 ; s selected page of results . the exemplary illustrative non - limiting implementation rolls through the listings set and parses the car information into cardetail objects . this parsed information can be cached if desired . the system parses the values that are for the user &# 39 ; s current page of results . 8 . return results — the system returns to the user interface a searchresult object which will contain : a . a list of the inventory ( cardetail ) objects to display on the page . b . a navigators object that contains the previously requested navigator information . the search may also be able to “ skin ” or “ style ” its results in multiple views ( html , js , xml ) for different applications . these results can be run through various skinning methods to determine how to output the final view of the inventory . this exemplary illustrative search technique utilizes navigators to retrieve basic information about the dealer &# 39 ; s inventory without retrieving all car details . initial basic information includes makes , models , body styles , spotlights , minimum and maximum price , number of vehicles ( document count ), and type ( new / used / certified ). a java object holds this information . while the technology herein has been described in connection with exemplary illustrative non - limiting embodiments , the invention is not to be limited by the disclosure . for example , although the exemplary illustrative non - limiting implementation emphasizes car dealerships , the system could be used to help users locate any type of merchant or service provider providing any type of goods or services for sale or otherwise , including but not limited to real estate , restaurants , hotels , marine equipment , construction equipment or services , personal services , office equipment , or any other kind of merchants . although the exemplary illustrative non - limiting technology herein provide a world wide web based presentation system via the internet and client server architectures , any type of architecture over any type of network or other communications path using any type of data transmission protocol could be used instead . while the predetermined filtering criteria described above is primarily in conjunction with “ specialties and service ”, any type of distinguishing characteristics could be used . the invention is intended to be defined by the claims and to cover all corresponding and equivalent arrangements whether or not specifically disclosed herein . | 6 |
it can be seen from these figures that the key proposed by the present invention comprises a hollow body , in which a stem 1 is defined for its insertion into the tumbler of the lock , as well as an actuating head . the stem 1 is provided with longitudinal slots 3 , from which the teeth 4 emerge to the outside ; these teeth serve to establish the different adequate combinations which correspond to the different locks that can be opened with the key . in every individual case , the specific position of the teeth 4 is controlled by means of toothed wheels 5 which can be turned at will and are mounted on axles 6 established in the head 2 of the key . as it can be observed in any of the figures , the wheels occupy a position which is very close to the beginning of the stem 1 and each one of them comprises pressure elements 7 which attack them radially , in order to achieve a perfectly defined and controlled step - by - step rotation for them . each pressure element consists in a stem 7 which is retractile against the tension of a spring 8 , having play in the interior of a frame 9 provided with a support leg 10 , through which the set is rigidized to the internal surface of frame 2 of the head of the key in its appropriate place . in this already known structure and in accordance with the present invention , two racks 11 have been provided as transmission means between the toothed wheels 5 and the sets of teeth 4 ; these racks slide in the hollow interior of the key , precisely on guides 12 , and are provided with toothings according to the toothed wheels 5 , so that the latter would act as driving pinions for the racks . as it has been said before , this wheel - rack transmission system forces the toothed wheels 5 to occupy an extreme position in the head 2 , as close as possible to the beginning of the stem 1 , so that the size of the key can be reduced to a minimum . it furthermore determines that the head 2 of the key presents a length at least coinciding with the one of the stem 1 , as in the position of maximum retraction for the teeth 4 practically the entire length of the racks 11 must be housed in the interior of the head 2 . in the preferred embodiment shown in the figures , the guides 12 are materialized in two oblique wings forming a longitudinal groove of throttled inlet , but said guides may obviously adopt any other configuration , whenever they would assure a correct longitudinal sliding of the racks without any slippings . as it is shown in fig2 guides 12 present gaps 13 at the level of the wheels 4 , thereby assuring the correct coupling of these wheels on the whole width of the respective racks . in accordance with another one of the objects of the invention , it has been arranged that the head 2 of the key presents some lateral flanges or wings 14 in its coupling zone to the stem , which are extended in a short sector of the very same stem and which are to be introduced in slots operatively worked in the tumbler of the lock . after introducing the key into the tumbler and setting the blocking lugs of the latter free on behalf of the teeth 4 , the angular stress necessary to carry out the effective opening that is manually applied to the head of the key , is transmitted to the tumbler directly through the flanges 14 . in this way , neither the stem 1 nor the teeth 4 suffer any torsional stress that , may mismatch the teeth . as the heretofore exposed points show , the rigidity and direct fixing of the teeth 4 to the respective racks 11 , the perfect coupling of racks 11 in their guides 12 , and the also direct meshed engagement and adjustment of racks 11 with the toothed wheels 13 , guarantee a maximum degree of precision , when the positional control of the teeth is undertaken which , at the same time , means a most perfect functionality of the key . it has been said before that the head 2 of the key must have a length at least coinciding with the one of the stem 1 , because in a position of maximum retraction for the teeth 4 , practically the entire length of the racks 11 must be housed in the interior of the head . however , in accordance with the representation in a broken line of fig2 there is also the possibility that the head 2 could be shorter ; in this case the area of the head opposite to the stem 1 must have some holes or windows 12 &# 39 ;, through which the racks 11 can emerge to the outside , when a high retraction degree is required for the teeth 4 . in this case the guides 12 are obviously interrupted at the level of the mouth of the holes which means that these guides are not extended to the outside of the head . in accordance with another one of the objects of the present invention ( fig5 to 7 ), a blocking mechanism is incorporated in the key which makes impossible an accidental rotation of the control wheels 5 at the moment of introducing the key into the lock due to the insertion resistance determined by the latter . more precisely speaking , the blocking mechanism is materialized in a &# 34 ; u &# 34 ; shaped slide 15 whose lateral branches 15 &# 39 ;, are spaced according to the separation between the control wheels 5 and are slidably disposed on guide bridges 16 , so that the lateral branches 15 &# 39 ; can adopt an inoperative position , ( fig7 ), in which their ends fit and are locked in the slots 5 &# 39 ; of wheels 5 , causing a rigid blocking of same . to achieve a stable position of &# 34 ; u &# 34 ; shaped slide 15 , it has been arranged that an inclined plane 17 is placed on the corresponding side of the head 2 of the key , this plane being retractile against the tension of a spring 18 . starting with the position shown in fig5 upon pushing slide 15 in the sense of the arrow of fig6 the middle section of the slide moves on the retractile plane 17 , making it tip down . in the limit position shown in fig7 &# 34 ; u &# 34 ; shaped slide 15 surpasses the retractile plane 17 and this one recovers by the effect of spring 18 and determines a retention stage 19 for the slide 15 in blocking position . to set this mechanism free , one just has to push down plane 17 , so that slide 15 can be freely moved away from the control wheels 5 . finally , as a complement of this structure , a guide slot 20 has been provided on the head 2 of the key and a lug 21 has been provided on the lower side of slide 15 . the lug 21 moves along the guide slot 20 , so providing a perfect sliding of the slide 15 without any lateral slippings . when there are three toothed wheels 5 established on one side of the key , there will obviously be three operative branches 15 &# 39 ; of the slide 15 too and this mechanism is repeated on the opposite side of the key , when there are control wheel sets 5 on both sides of same . | 4 |
fig1 shows a pair of tubes 200 stretching across a landscape . the tubes mount on concrete pillars 90 and are shown above ground . above - ground construction reduces costs and eases maintenance and inspections . it can be appreciated that below ground and underwater mounting of the tubes 200 is also viable in accordance with the present invention . the pair of tubes 200 enables simultaneous transport of capsules 300 in opposite directions . fig2 a shows a cross - section of a capsule 300 . the capsule 300 levitates in the tube 200 . the tube includes diverge force elements 194 . the capsule 300 includes switchable diverge force elements 190 . the tube 200 has a circular cross - section and sized having a diameter to accommodate two passengers seated shoulder - to - shoulder . a superconductor ( sc ) element 100 mounts in opposing arrangement on the external surface of the capsule 300 . fig2 b shows a cross - section of the superconductor ( sc ) element 100 , which includes permanent magnets 105 , a mounting element 106 , a levitation gap 108 and a cryostat 110 . the superconductor element 100 also includes coolant 120 , insular mounting elements 140 and removable mounting elements 150 . fig3 a shows a cross - section of the tube 200 holding the permanent magnet element 106 within the evacuated tube way . the cryostat 110 mounts within the interior of the capsule 300 . fig3 b shows an enlarged view of the tube 200 , the permanent magnet element 106 , the capsule 300 and the cryostat 110 mounted within the capsule 300 . the cryostat 110 houses superconductor elements 100 . the cryostat 110 also houses coolant 120 and has expansion mitigation 170 to enable the coolant 122 expand when changing phase . the cryostat 110 also includes insular mounting elements 140 that insulate the cryostat 110 from the ambient environment within the capsule 300 . fig4 a shows the tube 200 at an interchange 202 . in the interchange 202 the tube 200 diverges into two branches . the tube based divergent force elements 194 ( shown with dotted lines ) provide magnetic force to enable the tube based divergent force elements 194 to cooperate with the capsule - based switchable diverge force elements 192 steer the capsule into one of the divergent branches of the tube 200 . the divergent branches of the tube 200 each house permanent magnets 105 to enable continued suspension of a capsule 300 moving within either branch of the tube 200 . fig4 b shows movement of the capsule 300 laterally during movement through the interchange 202 region of the tube 200 . lateral movement of the capsule 300 as shown by the dotted lines steers the capsule 302 one of the divergent regions of the tube 200 . such lateral movement is preprogrammed into the system so there is no need for occupants 20 to steer the capsule 300 . fig5 shows an end view of two tubes 200 and vertical alignment with each other in accordance with fig1 . the tubes 200 curve . accordingly the insular mounting elements 140 are aligned off - center on the top portion and the bottom portion of each tube 200 . this holds each cryostat 110 in off - center alignment with the top portion in the bottom portion of each tube 200 . off - center alignment of the cryostat &# 39 ; s cause any capsule moving through the tube 200 to rotate so as not to cause occupants or cargo in the capsule 300 to shift laterally during movement through a curve . fig6 a , 6 b and 6 c show various configurations of the tubes mounted on pillars 90 . in particular fig6 a shows a configuration of the tubes in a highway median and the tubes 200 are in a typical vertically aligned configuration . fig6 b shows the tubes 200 on an extended pillar 90 to avoid utility lines , or other obstacle positioned on the ground . fig6 c shows a low profile configuration having the tubes 200 in lateral alignment with each other to avoid an obstacle such as an overpass , or to enable the system to fit within a tunnel . fig7 shows two tubes 200 positioned in vertical alignment within the interchange region 202 . in this embodiment the interchange region 202 is a specialized interchange that allows for docking , loading and unloading cargo from each capsule 300 . the interchange region 202 includes an interchange structure 208 for pressurization and depressurization of the interchange region 202 . a transfer mechanism releases and re - attaches fully cooled cryostat 110 on to each capsule 300 while each capsule 300 remains stationary in the interchange region 202 . numerous cryostats 110 are systematically cooled and attached to and detached from capsules 300 and an evacuated environment in the interchange region 202 by means of an automated refreeze equipment 160 . each cryostat 110 attaches to the capsule 300 with a removable mounting element 150 attached at a top portion and bottom portion of the capsule 300 . the interchange structure 208 enables pressurization and the depressurization of the interchange region 202 . ett - htsm lifting force is generated by superconductor elements 100 attached to the capsule . many superconductor materials are known to those versed in the arts , presently the best superconductor material for htsm is bulk yttrium barium copper oxide ( ybco ) crystals or vapor deposited ybco films . ybco requires cryogenic cooling to temperatures below 91 ° k to become superconductive and produce the required levitation force when interacting with permanent magnet elements 105 that mount in the tube 200 . the cryostat 110 is a container designed to stay at the low temperature required to maintain the superconductive state of the superconductor material . it is anticipated that superconductor materials could be developed in the future that will not require cryogenic temperatures , and will be able to enter the superconductive state at ambient room temperature . to omit the need for a heat - sink and / or cryostat does not diminish the other novel objects and advantages of the present invention as will become apparent . the cryostat 110 makes use of a solid - liquid ( sl ) phase change ( melting cycle ) coolant 113 for htsm instead of a liquid - gas ( lg ) phase change ( boiling cycle ). to reduce the material use , thickness , and heat gain , the cryostat 110 is preferably cylindrical in shape and of a uniform diameter along the full length of the capsule 300 to be levitated . the preferred material is non - conductive to electrical energy in order to keep eddy current drag low , and able to provide sufficient strength and stiffness to resist internal pressure , thermal stresses , and levitation forces . there are several heat - sink substances 113 that freeze below the 91 ° k transition temperature of ybco to enter the superconductive state as will be apparent to those versed in the art . for instance , propane ( c 3 h 8 ) melts at 85 . 5 ° k ; this is between the 77 ° k , the boiling point of ln2 and the 91 ° k the critical temperature ( t c ) of ybco . liquids that freeze at lower temperatures have the advantage of reducing the amount of ybco to produce a desired levitation force , but take more energy ( or ln2 ) to refreeze , and may have a critical temperature below room temperature ( resulting in risk of burst or thick heavy containment ). as known to those versed in the arts , the freezing point of propane ( and other appropriate liquids ) can be modified by adding solutes ( much as the freezing point of water is reduced by adding salt or ethylene glycol ). the cryostat 110 can be mounted externally ( fig2 ) or internally ( fig3 ) on the capsule 300 . internal mounting has the advantage of being able to pass through a cylindrical airlock with minimal time and energy ; however the quantity of superconductor material 100 must be greater to provide a desired levitation force and clearance due to the added thickness of the pressure hull , and thermal insulation material . in a preferred embodiment the cryostat 110 removeably mounts external to the capsule 300 , i . e . on an external surface of the capsule 300 . external mounting is preferred for several reasons : any leaking material will not endanger the occupants , the insulation qualities of the evacuated environment are fully exploited to reduce the thermal heat gain thereby reducing the quantity of sl phase change material 120 , more room is available in the capsule 300 , less superconductor material 100 is required to produce a given levitation gap , the cryostat can be easily removed while in the vacuum environment to re - freeze limiting thermal cycling wear and tear . the cryostat 110 for ett - htsm is structurally mounted to the capsule 300 such that the levitation force imparted to the superconductor elements 100 are transferred to the cryostat via a force transfer structure 130 , such as but not limited to adhesive or mechanical means , and from the cryostat to the capsule . the mounting elements 140 in contact with the cryostat are thermally isolated from the capsule by using a structural material that is resistant to thermal energy flow such as ( but not limited to ): aerogels or thermoplastic foams , and / or vacuum insulation as known to those in the arts . in this way , the superconductor material ( such as ybco ) is secured at the proper location in the cryostat with mechanical and / or adhesive means to provide a load path for the levitation force from the superconductor material to the cryostat 110 , from the cryostat 110 to the insulating mounting elements 140 , and ultimately to the capsule 300 , but without providing a heat path from the cryostat 110 to the capsule 300 . magnetic force attachments 150 removeably attach the cryostats 110 to the capsule 300 . this enables rapid removal and replacement of the cryostats 110 . this is advantageous because the magnetic force attachments 150 enable the cryostats 110 to be removed and replaced in the evacuated environment . the evacuated environment is ultra - insulated and ultra - dry to minimize heat transfer to the cryostats 110 so it is preferable that the cryostats 110 are removed and replaced prior to , or after , entry of the capsule into the airlock . this embodiment enables the capsules to be transferred through the airlock at standard temperature and pressure , while quickly enabling removal and replacement of the cryostats 110 with the magnetic force attachments 150 in the evacuated environment of the tube . removable mounting allows automated means to remove any cryostat from inbound capsules , placed it in contact with cryogenic heat transfer fluids ( such as ln2 ) that re - freeze the sl heat - sink material . and then the automated equipment 160 functions to replace any re - frozen , or already frozen reserve cryostat 110 onto outbound capsules 300 . this minimizes airlock cycle time due to greater air displacement by the capsule 300 in the airlock chamber . it also results in fewer failure points or stress risers in the capsule pressure hull . it can be appreciated that the automated equipment 160 have the capability to store a plurality of cryostats 110 in fully operational condition , i . e . fully frozen , to enable faster throughput of capsules 300 through any interchange in systems employing tubes 200 . use of sl phase change produces only a small volume change compared to a lg phase change . the sl heat sink material 120 , preferably propane is placed in a sealed cryostat 110 with an empty or compressible volume 170 as required to allow for expansion and contraction of the liquid ( and / or solid ) material during normal operation and handling , and during the necessary thermal cycling of many melting and re - freezing cycles . the expansion mitigation means 170 can be empty space in the cryostat 110 , a flexible membrane separating a portion of the cryostat 110 , or a billows type of structure to allow for changes in volume without applying damaging pressures to the cryostat cylinder . one function of the expansion mitigation structures is to keep solid or liquid phase heat - sink in contact with the superconductor material 100 at all times . an ett - htsm cryostat 110 can be provided with cooling capacity . a freezer element integral with or operably connected with the cryostat 110 regulates the temperature of the cryostat 100 to optimize operation between interchanges . accordingly the freezer element is only operated when necessary to minimize energy consumption of any system utilizing tubes 200 . one way of powering the freezer element to add additional capacity and cool superconductive elements 100 used for reaction members 180 that move , i . e . rotate or translate with respect to the tube 200 axis . the reaction members 180 operably connect with a linear electric motor ( lem ) or linear electric generator ( leg ) coils 182 mounted on the tube 200 . the stabilizing effect made available by any superconductor element 100 depends on the relative position in relation to the center of gravity of the capsule . superconductor elements 100 mounted close to the capsule ends contribute a greater pitch and yaw restoring moment to the capsule than sc elements 100 situated close to the center of the capsule . a portion of the superconductor elements can be replaced with permanent magnet material 105 such as ndpm to reduce the cost with little loss to the stability while maintaining the required levitation force and suspension levitation gap . the levitation force of htsm is a function of the amount of force applied by the superconductor 100 ( for instance ybco ), and permanent magnet 105 ( for instance ndpm ) that are configured to magnetically interact to levitate the capsule . to minimize cost , it is desirable to reduce the cross - sectional area of the permanent magnet material 105 in the tube . a fixed quantity of superconductor material 100 is required to produce a given levitation force and levitation gap 108 . to minimize the cost , the present invention spreads the required quantity of superconductor elements 100 out over the entire length of the capsule , resulting in a narrow strip of sc material 100 . to have high roll stability , the superconductor material 100 is divided between the extreme top and bottom extremities of the capsule cross - section . this distribution results in high lateral , roll , pitch , and yaw stability ; and also a small sectional area of permanent magnet material 105 in the tube . the permanent magnet material 105 ( for example ndpm arranged in a halbach array ) is secured to the tube with structural permanent magnet mounts 106 that are non - conductive , and allow precision alignment adjustment of the permanent magnet elements 105 in relation to the tube structure to compensate for irregularities of the tube 200 surface or diameter ; while maintaining the permanent magnet elements 105 in the proper alignment to produce uniform levitation force on the capsule components . intentional periodic discontinuities across the linear dimension of the permanent magnet mounts 106 allow for normal thermal expansion and contraction of the tube without introducing misalignment , high stress , or loss of integrity . the permanent magnet material 105 is preferably divided into small units in the linear direction with slight space between the elements enforced by a spacer 107 made from an elastic and dielectric material that is able to continuously compensate for linear movements caused by thermal variations and / or minor geological forces . the elastic material 107 is dielectric to reduce magnetic drag forces , and also mitigate potential damage from electromagnetic pulse ( such as caused by lightning strike ). the dielectric permanent magnet coating material 107 ( and / or permanent magnet mounting structure 106 ) is ideally made of low friction material ( such that the permanent magnet elements 105 are free to slide in the linear direction so linear gap variations between individual permanent magnet elements 105 resulting from linear thermal deflections are uniform , yet accommodated at any expansion joints between tube sections as required by local conditions . for low superconductor 100 and permanent magnet 105 material cost , the levitation gap 108 must be minimized ; however for low construction cost of the reasonable tolerances are necessary indicating need for a large levitation gap 108 . the optimal levitation gap 108 results in the lowest total system cost . ett - htsm allows for reduced gap 108 by : use of support structures that are ultra - stiff in the vertical , lateral , and torsional directions , use of precision alignment adjustment structures ( such as opposing wedges , or locking threads , active alignment measuring and control that maintains the accurate alignment of the permanent magnet elements 105 even if the earth should move ( refer to related application disclosing active alignment ), crash protection may be built into the linear motor components 182 and / or the cryostat 110 as is known to those in the arts . these components sustain damage first to protect the integrity of the pressure hull in the unlikely event of a crash . features of ett - htsm that contribute to low magnetic drag are : a ) avoidance of the use of electrically conductive elements in the capsule . plating of permanent magnet 105 or superconductor 100 elements ; resistive conductivity of permanent magnet elements 105 or superconductor elements 100 ; iron or soft steel pole pieces ; electrically conductive ( metallic or carbon fiber ) mounting materials ; magnetic field flux gradient variations in the linear direction caused by : magnet strength , magnet position variations , and magnet size or shape variations , and / or electrical conductivity variations . in addition stray magnetic fields “ trapped ” or “ pinned ” in the superconductor elements 100 ( such as from earth fields or other fields that may vary according to capsule directional orientation . magnetic hysteresis losses from relative vertical and horizontal motion of the superconductor elements 100 in relation to the permanent magnet elements 105 such as caused by : vibrations of or capsule ; variable vertical and horizontal forces ( such as induced by load movements or curvilinear accelerations , or externally induced movements of earth or wind acting on ; and or those internal to the system such as micro misalignment of permanent magnet material 105 in relation to the , and / or macro misalignment of the ; and finally losses induced by deflections of the earth , alignment mounts , and / or permanent magnet material 105 , and or periodic deflections in the structural elements in the capsule to superconductor elements 100 . eddy currents in the permanent magnet 105 are minimized by using bonded materials that are not electrically conductive ( but this results in less magnetic force and more material ), or by using smaller physical dimensions in the plan view to minimize eddy current area and force . superconductor 100 and permanent magnet 105 elements are preferably coated with a non - conductive material . in another embodiment , the superconductor 100 and permanent magnet 105 are coated with metallic or electrically conductive materials to maximize reflection of heat energy . however , the conductive elements should are oriented to minimize eddy currents , and maximize the distance from magnetic fields ( generated by permanent magnet 105 or superconductor 110 elements in the 200 or capsule 300 ) that move relative to the conductive element . preferably the superconductor 100 and the permanent magnet 105 are coated with reflective materials such as metalized dielectric films to minimize thermal heat gain to the cryostat 110 . this is important because the temperature difference between portions of the capsule and portions of the cryostat 110 creates the potential for significant heat transfer via radiation . when such metalized films are used for thermal radiation mitigation , a small portion or kerf of the reflective material can be burned off by laser ( or photo etched , or masked ) in a micro grid pattern to limit the formation of large eddy currents in the conductive layer but still reflect most thermal radiation energy . when cooling superconductor elements 100 to the point of superconductivity in the presence of a magnetic field ensure that the field shape and distribution is identical to the magnetic flux field in the , and that the earth &# 39 ; s field is either excluded by use of a faraday cage shield , and / or aligned to coincide with the direction of the earth &# 39 ; s field for the major alignment especially those in high speed sections . use non - conductive permanent magnet material 105 for as much of the load carrying as possible ; using just enough superconductor material 100 to achieve sufficient stability in worst case conditions . electrically insulate any conductive permanent magnet element 105 from each other with dielectric materials 107 that also may function elastomerically as linear thermal stress mitigation ( note that this also mitigates emp risks ). by use of accurate tube 200 and permanent magnet 105 alignment to minimize acceleration and levitation force variations ; use accurate and consistent permanent magnet 105 : size , placement , spacing , strength , and field shape consistency . tube 200 and capsule 300 utilize structural components that are very stiff in the vertical and lateral directions to minimize physical deflections . use light weight capsules 300 to minimize tube 200 deflections and to protect capsule 300 and tube 200 from ( or otherwise mitigate ) variable loads such as but not limited to : side - wind loads , aerodynamic oscillations , earth movements , and payload movements . automation of convergence and divergence between traffic flows in intersecting or bifurcating branches at any predetermined fixed design speed at all times in interchange zone , frequency limited only by design speed predetermined capsule spacing , and converge timing and speed matching divergence : predetermined by activation of bi - stable magnetic diverging force elements in the vehicle divergence force changes can only be activated prior to entering divergence zone physically impossible for divergence forces to be modified while capsule is diverging , occupant can request a divergence , however divergence force not directly controlled by occupant . divergence forces balanced through cg and through center of lift : the magnetic gradient generated by the permanent magnet material 105 can be shaped and configured to introduce a limited degree of freedom in the lateral direction as shown in fig5 . the ett - htsm is capable of controlled freedom of movement in the lateral direction with little lateral force applied as shown in the force distribution graph below the progression of permanent magnet 105 and superconductor 100 sections in fig4 . the dotted lines labeled “ nsf ” to indicate normal steering force level , and “ esf ” for exceptional or emergency steering force level . this degree of freedom is dimensionally expanded in the diverge zone so the width of the degree of lateral freedom ( with low lateral force ) becomes a little over double the normal width of the permanent magnet 105 strips in the normal ( non - interchange ) zone of the . this allows additional magnetic elements 105 to be inserted in the middle of the widened the permanent magnet 105 strips ( one along the bottom and top of the evacuated tubes ) such that a magnetic gradient is introduced in the center of the strip creating two parallel zones with reduced lateral freedom , and then the permanent magnet 105 strips can bifurcate into two separate and parallel permanent magnet 105 strips that diverge into two separate tube routes . the converge zone is identical , except the direction of flow is reversed . the permanent magnet 105 strips are typically mounted 180 degrees apart at the top and bottom of the tube in straight sections ( at 12 : 00 and 6 : 00 positions in clock notation ). in curves the permanent magnet 105 strips are smoothly rotated at an angle in curves to correspond to a natural bank angle producing no ( or only slight ) lateral acceleration force due to the curve - linear motion as shown in fig6 . the permanent magnet strips can be of greater cross - section to provide more levitation force as needed in vertical or horizontal curves that cause vertical accelerations on the capsule . the vertical force generating power of the components are not diminished in the converge / diverge zone . selectively polarized magnetic force generators are oriented in or on the capsule ( or cryostats ) to magnetically interact with ferromagnetic ( and / or electromagnetic ) material in corresponding areas in the tube to supply ample steering force to cause the capsule to diverge at any desired interchange . an interchange is a branch bifurcation . preferably , the active components in the vehicle cannot physically be activated during a interchange operation — the interchange operation is predetermined , either before the journey , or during an emergency situation in route . and the active components in the vehicle are not directly controlled by the occupant — the occupants diverge input is filtered by the control system . the lateral force generating magnetic elements 190 in the vehicle can be permanent magnet or electrically energized with dc current . permanent magnets are inherently unstable as their strength diminishes with time . this property of instability virtually guarantees safe operation because the ett switch design uses the instability to advantage to create a bi - stable position — the vehicle is assured it will either continue on the line , or diverge . alternatively a simple dpdt bi - stable electric switch can selectively energize electromagnet switch elements 190 ( or reverse the direction of current flow to reverse the orientation of the magnetic force field ) such that attractive or repulsive force can be selected to diverge or stay on the branch . an interrupter prevents the reorientation of switch elements while the vehicle is approaching and in the diverge zone . for a converge , the capsule switch elements 190 are oriented to create a force that biases the capsule to follow the side of the tube 200 that is opposite the tube 200 to merge with . in this way there is no abrupt change in force when entering the zone of increased lateral freedom . if the switch 190 is improperly oriented by failure , there will be sudden lateral movement across the width of the permanent magnet 105 producing some lateral jerk and light impact force , however the force will be much less than the lateral magnetic restraining force the suspension elements are capable of sustaining . this improper event is sensed by position sensors , and / or accelerometers in the capsule 300 and indicates a likelihood of a component failure in the switch elements 190 in the capsule , and the control system will flag the capsule for removal from service and repair at the next access portal . in the rare event of a mechanical or electric switch failure in the capsule magnetic polarity mechanism or circuit , electromagnets 194 in the tube can be activated to overpower the magnets in the vehicle and force a divergence of the capsule at a desired branch of the tube 200 . another reason for the simplicity and safety of the ett switch 190 is that the tube 200 fully envelopes the capsule 300 . in the extremely improbable event of an ett failure , the vehicle will still continue by momentum down one side or the other of any diverge zone in the vehicle trajectory ( assuming the vehicle is intact ). converge failure is strictly a timing issue , and converge timing may be controlled by motor phase that is hardwired in , and by design will not fail unless two or more exceptionally improbable failures occur at exactly the same time . note that both levitation and steering forces are balanced to pass very close to both the lateral and vertical centers of gravity of the capsule . the two points of magnetic suspension force are vertically separated by maximum distance allowed in the tube to generate a powerful roll couple for high stability in the event that a load shifts ( or passengers jostle around ) in the capsule . it must be recognized that there are many embodiments that fall under the scope of this invention . for instance if other ways are used to ensure load stability ( passenger and load restraints ), then the capsules can be supported only from above ( primarily in attraction ). future materials may obviate the need for the heat sink cyrostat 110 , all the other elements function the same with the same load paths , and operation . | 8 |
the following description is merely illustrative in nature and is in no way intended to limit the disclosure , its application , or uses . as used herein , the phrase at least one of a , b , and c should be construed to mean a logical ( a or b or c ), using a non - exclusive logical or . it should be understood that steps within a method may be executed in different order without altering the principles of the present disclosure . referring now to fig1 and 2 , single - ended arrangements of push - pull class ab amplifiers 50 and 100 are shown . in fig1 , the amplifier 50 is arranged in a common gate configuration . the amplifier 50 includes a first inductor l 1 , a first transistor t 1 , a second transistor t 2 and a second inductor l 2 , which are connected in series . the first transistor t 1 may be an nmos transistor and the second transistor t 2 may be a pmos transistor , although other types of transistors can be used . inputs of the transistors t 1 and t 2 may be connected to ac ground or another bias or reference signal . variable capacitances c 1 and c 2 may be connected in parallel with the inductors l 1 and l 2 , respectively . the inductor l 1 may be connected to a reference potential v dd . the inductor l 2 may be connected to a ground potential v ss . a capacitance c cm may be connected to drain terminals of the first and second transistors t 1 and t 2 . an input signal may be applied via an input capacitance c in to source terminals of the first and second transistors t 1 and t 2 . output signals v o1 and v o2 may be taken across terminals of the capacitance c cm . in fig2 , the push - pull class ab amplifier 100 is shown . the amplifier 100 is arranged in a common source configuration . the source terminals of the transistors t 1 and t 2 may be connected to ac ground or another bias or reference signal . the amplifier 100 is similar to the amplifier 50 except that the input signal v in is applied to gates of the first and second transistors t 1 and t 2 . in both fig1 and 2 , the capacitance c cm removes even harmonics from the output signals v o1 and v o2 due to cancelling of the opposite phase of the even harmonics . the capacitance c cm tends to help transistor mismatch and to reduce distortion . unlike conventional power amplifiers , the amplifiers 50 and 100 can have a voltage swing that is greater than 2v dd . the source node between the transistors t 1 and t 2 is floating and a low side can go below ground . the value of the capacitance c cm may be selected to be larger than the capacitances c 1 and c 2 . the output signals v o1 and v o2 may be recombined in any suitable manner . in one example , inductive coupling via transformers may be used to recombine the output signals v o1 and v o2 , as will be described below . referring now to fig3 , another push - pull class ab amplifier 150 is shown . the capacitance c cm is replaced by one or more series - connected capacitance and resistance pairs , which are connected in parallel across the first and second transistors t 1 and t 2 . in particular , capacitances c 31 , c 32 , . . . , and c 3n are connected in series with resistances r 11 , r 12 , . . . , and r 1n , respectively , where n is an integer greater than zero . in some implementations , the capacitances c 31 , c 32 , . . . , and c 3n are selected to have the same or different values . in some implementations , the resistances r 11 , r 12 , . . . , and r 1n are selected to have the same or different values . using the capacitances and resistances may tend to reduce oscillation . referring now to fig4 , another push - pull class ab amplifier 200 is shown . the amplifier 200 is a differential implementation of the amplifier 150 of fig3 . the amplifier 200 further includes a third inductor l 3 , a third transistor t 3 , a fourth transistor t 4 and a fourth inductor l 4 , which are connected in series . the fourth transistor t 4 may be an nmos transistor and the third transistor t 3 may be a pmos transistor , although other types of transistors can be used . inputs of the transistors t 1 and t 2 and t 3 and t 4 may be connected to ac ground or another bias or reference signal . variable capacitances c 3 and c 4 may be connected in parallel with the inductors l 3 and l 4 , respectively . the inductor l 4 may be connected to the reference potential v dd . the inductor l 3 may be connected to the ground potential v ss . a differential input signal may be applied via an input capacitance c in to source terminals of the third and fourth transistors t 3 and t 4 . output signals v o3 and v o4 may be taken across terminals of the third and fourth transistors t 3 and t 4 . capacitances c 51 , c 52 , . . . , and c 5n are connected in series with resistances r 11 , r 12 , . . . , and r 1n , respectively , where n is an integer greater than zero . one or more pairs of the capacitances c 51 , c 52 , . . . and c 5n and the resistances r 11 , r 12 , . . . and r 1n are connected in parallel across the third and fourth transistors t 1 and t 2 . capacitances c 61 , c 62 , . . . , and c 6n are connected in series with resistances r 21 , r 22 , . . . , and r 2n , respectively , where n is an integer greater than zero . one or more pairs of the capacitances c 61 , c 62 , . . . and c 6n and the resistances r 21 , r 22 , . . . and r 2n are connected in parallel across the third and fourth transistors t 3 and t 4 . referring now to fig5 , another push - pull amplifier 250 is shown . additional capacitances c 5 to c 11 may be provided . the capacitances c 5 and c 6 replace one of the common mode capacitances c cm and are connected in series with each other and in parallel across the transistors t 1 and t 2 . the capacitances c 7 and c 8 replace the other common mode capacitance c cm and are connected in series with each other and in parallel across the transistors t 3 and t 4 . one end of a capacitance c 10 is connected to first terminals of the capacitances c 5 and c 6 and to the source terminals of the transistors t 1 and t 2 . another end of the capacitance c 10 is connected to first terminals of the capacitances c 7 and c 8 and to the source terminals of the transistors t 3 and t 4 . one end of a variable capacitance c 11 is connected to a second terminal of the capacitance c 6 and to the drain terminal of the transistors t 2 . another end of the variable capacitance c 11 is connected to a second terminal of the capacitance c 8 and to the drain terminal of the transistor t 3 . one end of a variable capacitance c 9 is connected to a second terminal of the capacitance c 5 and to the drain terminal of the transistors t 1 . another end of the variable capacitance c 9 is connected to a second terminal of the capacitance c 7 and to the drain terminal of the transistor t 4 . for example , an inductive coupling loop may couple with the inductors l 1 , l 2 , l 3 and l 4 to drive an output such as an antenna . referring now to fig6 , another push - pull class ab amplifier 270 is shown and includes a power combiner 280 . the amplifier 270 includes a first inductor l 1 , a first transistor t 1 , a second transistor t 2 and a second inductor l 2 , which are connected in series . the amplifier 270 further includes a third inductor l 3 , a third transistor t 3 , a fourth transistor t 4 and a fourth inductor l 4 , which are connected in series . capacitances c 1 , c 2 , c 3 and c 4 may be variable capacitances that are arranged in parallel with the inductors l 1 , l 2 , l 3 and l 4 . common mode capacitances c 5 and c 6 are arranged in parallel with transistors t 1 and t 2 and t 3 and t 4 , respectively . the power combiner 280 includes first , second , third and fourth inductors s 1 , s 2 , s 3 and s 4 , respectively , which are coupled to the first , second , third and fourth inductors l 1 , l 2 , l 3 and l 4 , respectively , to create first , second , third and fourth transformers . in some examples , the output may be coupled to an antenna ( not shown ) or another load . referring now to fig7 , an example of an input driver 300 for the single ended amplifier 50 is shown . a matching network 304 includes the capacitance c in and an inductor l 3 . a tank circuit 306 includes an inductor l 4 and a capacitance c 3 . an input signal v in is input to a gate of a transistor t 3 . the tank circuit 306 and the matching network 304 couple the input signal to the sources of the transistors t 1 and t 2 . referring now to fig8 , an example of an input driver 340 for a differential amplifier 350 is shown . the amplifier 350 includes the components of the amplifier 50 . the amplifier 350 further includes a third inductor l 3 , a third transistor t 3 , a fourth transistor t 4 and a fourth inductor l 4 , which are connected in series . inputs of the transistors t 1 , t 2 , t 3 , and t 4 may be connected to ac ground or another bias or reference signal . variable capacitances c 3 and c 4 may be connected in parallel with the inductors l 3 and l 4 , respectively . the inductor l 4 may be connected to the reference potential v dd . the inductor l 3 may be connected to the ground potential v ss . capacitance c 5 , inductor l in and capacitance c 6 are connected in series between the sources of the transistors t 1 and t 2 and the sources of transistors t 3 and t 4 . drains ( or sources ) of the transistors t 5 and t 6 are connected between the inductor l in and the capacitances c 5 and c 6 , respectively . sources ( or drains ) of the transistors t 5 and t 6 are connected to v ss . one polarity of the differential input signal v in + is coupled to a gate of the transistor t 5 and the other polarity of the differential input signal v in − is coupled to a gate of the transistor t 6 . the inductor l in may have a center tap that may be connected to a bias signal , a reference potential or a ground potential . the connection provided by the capacitances c 5 and c 6 and the inductor l in provides source degeneration . the connection provides a low impedance connection such as a short circuit at a center frequency and a higher impedance connection at other frequencies . for example , the connection has high impedance at second and third harmonic frequencies . referring now to fig9 , another push - pull class ab amplifier 600 is shown and includes a power combiner 630 . the amplifier 600 includes a first inductor l 1 , a first transistor t 1 , a second transistor t 2 and a second inductor l 2 , which are connected in series . the amplifier 600 further includes a third inductor l 3 , a third transistor t 3 , a fourth transistor t 4 and a fourth inductor l 4 , which are connected in series . a first capacitance c 1 , an inductor l in and a second capacitance c 2 are connected in series . the first capacitance c 1 is also connected to source terminals of the first and second transistors t 1 and t 2 . the second capacitance c 2 is also connected to source terminals of the third and fourth transistor t 3 and t 4 . capacitance c 3 is connected to drains of the transistors t 1 and t 3 . capacitance c 4 is connected to drains of the transistors t 2 and t 4 . a first polarity of the differential signal v in + is input to gates of transistors t 1 and t 3 . a second polarity of the differential signal v in − is input to gates of transistors t 2 and t 4 . the power combiner 630 includes first , second , third and fourth inductors s 1 , s 2 , s 3 and s 4 , respectively , which are coupled to the first , second , third and fourth inductors l 1 , l 2 , l 3 and l 4 , respectively , to create first , second , third and fourth transformers . in some examples , the output may be coupled to an antenna ( not shown ) or another load . referring now to fig1 , an example layout of the amplifier 600 and the power combiner 630 is shown . a first loop 704 includes the first , second , third and fourth inductors s 1 , s 2 , s 3 and s 4 , respectively . a second loop 708 provides connections to the transistor pairs , v dd and v ss . the first and second loops 704 and 708 may have a circular , elliptical , rectangular , square or other generally closed shape . the inductor l in may be arranged inside or outside of the first and second loops 704 and 708 . the inductor l in may have a figure “ 8 ” shape . the first loop 704 may be arranged inside or outside of the second loop 708 in a plan view . the current in the first loop 704 may flow through the inductors s 1 , s 2 , s 3 and s 4 in the same direction . while two legs are shown for example in fig5 and 6 , additional legs with additional transistor pairs can be used . referring now to fig1 , an example layout of an amplifier 730 and a power combiner 740 for four pairs of transistors is shown . a first loop 744 includes inductors that couple with inductors in a second loop 748 . for example only , the first and second loops 744 and 748 may have a circular , elliptical , rectangular , square or other generally - closed shape . the inductor l in may be arranged inside or outside of the first and second loops 744 and 748 . the first loop 744 may be arranged inside or outside of the second loop 748 in a plan view . the broad teachings of the disclosure can be implemented in a variety of forms . therefore , while this disclosure includes particular examples , the true scope of the disclosure should not be so limited since other modifications will become apparent upon a study of the drawings , the specification , and the following claims . | 7 |
the following detailed description of implementations consistent with the principles of the invention refers to the accompanying drawings . the same reference numbers in different drawings may identify the same or similar elements . also , the following detailed description does not limit the invention . instead , the scope of the invention is defined by the appended claims and their equivalents . implementations consistent with the principles of the invention use gps coordinates from a user device for routing a 9 - 1 - 1 call from the user device to the appropriate psap . in one implementation , the gps coordinates are provided from a gps device that is associated with the user device . implementations consistent with the principles of the invention also allow for periodic updates of automatic location identification ( ali ) information for user devices . fig1 illustrates an exemplary system 100 in which systems and methods , consistent with the principles of the invention , may be implemented . as illustrated , system 100 may include a user device 130 that connects to a 9 - 1 - 1 service provider ( sp ) 140 via a network 110 . 9 - 1 - 1 service provider 140 may connect to a psap 150 and an ali device 160 via a network 120 . the number of user devices , 9 - 1 - 1 service providers , psaps , ali devices , and networks illustrated in fig1 is provided for simplicity . in practice , a typical system could include more or fewer user devices , 9 - 1 - 1 service providers , psaps , ali devices , and networks than illustrated in fig1 . networks 110 and 120 may include a local area network ( lan ), a wide area network ( wan ), a telephone network , such as the public switched telephone network ( pstn ), an intranet , the internet , or a combination of these or other networks . although shown as separate networks , networks 110 and 120 may , in one implementation consistent with the principles of the invention , be implemented as a single network . user device 130 may include a device , such as a personal computer , a lap top , a personal digital assistant ( pda ), a wireless telephone , an internet protocol ( ip ) telephone , etc ., one or more threads or processes running on these devices or other types of devices , and / or one or more objects executable by these devices . in one implementation , user device 130 may allow a user to place calls , including 9 - 1 - 1 emergency calls , using voip . user device 130 may connect to network 110 via any technique , such as wired , wireless , or optical connections . 9 - 1 - 1 service provider 140 may include one or more types of computer systems , such as a mainframe , minicomputer , or personal computer . 9 - 1 - 1 service provider 140 may facilitate the establishment of voip 9 - 1 - 1 calls between user device 130 and psap 150 . in one implementation consistent with the principles of the invention , 9 - 1 - 1 service provider 140 may be associated with a voip provider , network service provider , or another party . 9 - 1 - 1 service provider 140 may connect to networks 110 and 120 via any technique , such as wired , wireless , or optical connections . psap 150 can include one or more devices for receiving and processing emergency calls ( e . g ., 9 - 1 - 1 calls ). for example , psap 150 may include a public entity having personnel ( e . g ., operators or call takers ) and / or equipment for initially answering or fielding incoming 9 - 1 - 1 calls . psap 150 can be located in the vicinity of the source of the emergency call and in the vicinity of emergency service providers to which the call can be forwarded . psap 150 may connect to network 120 via any technique , such as wired , wireless , or optical connections . ali device 160 may include one or more devices that store location information for a user device 130 from which a 9 - 1 - 1 call can be placed . in one implementation consistent with the principles of the invention , ali device 160 may include a database system . ali device 160 may connect to network 120 via any technique , such as wired , wireless , or optical connections . fig2 illustrates an exemplary configuration of user device 130 in an implementation consistent with the principles of the invention . as illustrated , user device 130 may include a bus 210 , processing logic 220 , a memory 230 , an input device 240 , an output device 250 , a gps device 260 , and a communication interface 270 . it will be appreciated that user device 130 may include other components ( not shown ) that aid in receiving , transmitting , and / or processing data . moreover , it will be appreciated that other configurations are possible . bus 210 may permit communication among the components of user device 130 . processing logic 220 may include any type of processor or microprocessor that interprets and executes instructions . in other implementations , processing logic 220 may be implemented as or include an application specific integrated circuit ( asic ), field programmable gate array ( fpga ), or the like . memory 230 may include a random access memory ( ram ) or another type of dynamic storage device that stores information and instructions for execution by processing logic 220 , a read only memory ( rom ) or another type of static storage device that stores static information and instructions for the processing logic 220 , and / or some other type of magnetic or optical recording medium and its corresponding drive for storing information and / or instructions . input device 240 may include a device that permits a user to input information to user device 130 , such as a keyboard , a keypad , a mouse , a pen , a microphone , one or more biometric mechanisms , and the like . output device 250 may include a device that outputs information to the user , such as a display , a printer , a speaker , etc . gps device 260 may include one or more devices for receiving gps - based location information from , for example , a gps satellite . gps device 260 may be included within user device 130 or external to user device 130 . for example , gps device 260 may be implemented as an external gps receiver or a personal computer memory card international association ( pcmcia ) card with integral gps receiver that continuously receives gps - based location information . gps device 260 may store received gps - based location information in , for example , memory 230 , gps device 260 , or some other location . communication interface 270 may include any transceiver - like mechanism that enables user device 130 to communicate with other devices and / or systems . for example , communication interface 270 may include mechanisms for communicating with 9 - 1 - 1 service provider 140 via a network , such as network 110 . as will be described in detail below , user device 130 , consistent with the principles of the invention , may allow a user to place a voip emergency 9 - 1 - 1 call . user device 130 may perform these and other functions in response to processing logic 220 executing software instructions contained in a computer - readable medium , such as memory 230 . a computer - readable medium may be defined as one or more memory devices and / or carrier waves . the software instructions may be read into memory 230 from another computer - readable medium or from another device via communication interface 270 . the software instructions contained in memory 230 may cause processing logic 220 to perform processes that will be described later . alternatively , hardwired circuitry may be used in place of or in combination with software instructions to implement processes consistent with the principles of the invention . thus , systems and methods consistent with the principles of the invention are not limited to any specific combination of hardware circuitry and software . fig3 illustrates an exemplary configuration of 9 - 1 - 1 service provider 140 in an implementation consistent with the principles of the invention . as illustrated , 9 - 1 - 1 service provider 140 may include a voip 9 - 1 - 1 call routing device 310 and an ali update device 320 . it will be appreciated that 9 - 1 - 1 service provider 140 may include other components ( not shown ) that aid in receiving , transmitting , and / or processing data . voip 9 - 1 - 1 call routing device 310 may include one or more devices that receive 9 - 1 - 1 emergency information from user device 130 , identify an appropriate psap , such as psap 150 , for handling the 9 - 1 - 1 call , and transmit the appropriate information to psap 150 for handling the 9 - 1 - 1 call . voip 9 - 1 - 1 call routing device 310 may be implemented in hardware , software , or a combination of hardware and software . ali update device 320 may include one or more device for receiving gps - based location information from user device 130 and updating ali device 160 based on the received gps - based location information . in this way , ali update device 320 may ensure that ali device 160 contains the most recent location information for the user associated with user device 130 . ali update device 320 may be implemented in hardware , software , or a combination of hardware and software . fig4 illustrates an exemplary configuration of psap 150 in an implementation consistent with the principles of the invention . as illustrated , psap 150 may include an ali controller 410 , a workstation 420 , and a telephone 430 . it will be appreciated that psap 150 may include other components than illustrated in fig4 that aid in receiving , processing , and / or transmitting data . the number of ali controllers , workstations , and telephones illustrated in fig4 is provided for simplicity . in practice , a typical psap could include more ali controllers , workstations , and / or telephones than illustrated in fig4 . ali controller 410 may include one or more devices that receive emergency 9 - 1 - 1 information from 9 - 1 - 1 service provider 140 and process the received emergency 9 - 1 - 1 information by , for example , identifying the location from where the call originates . in one implementation consistent with the principles of the invention , ali controller 410 may identify a caller &# 39 ; s location based on gps - based location information received with the 9 - 1 - 1 emergency call . ali controller 410 may , alternatively , retrieve caller location information from ali device 160 and verify the location information using the gps - based location information received with the 9 - 1 - 1 call . workstation 420 may include one or more types of computer systems , such as a mainframe , minicomputer , a personal computer , a lap top , etc . that receive emergency 9 - 1 - 1 information and provide information to an operator in response thereto . the information may include , for example , a callback number ( e . g ., a telephone number , a network address , etc .) and information identifying a location of the person placing the 9 - 1 - 1 call . workstation 420 may , in some situations , forward received calls to an appropriate emergency personnel service , such as a fire department , a police station , etc . telephone 430 may include one or more devices that allow an operator at psap 150 to conduct voice communications with the person placing the 9 - 1 - 1 call . in one implementation consistent with the principles of the invention , telephone 430 may include a plain old telephone system ( pots ) telephone , a session initiation protocol ( sip ) telephone , a wireless telephone device , etc . in another implementation , telephone 430 may be implemented within workstation 420 or another computer device . fig5 illustrates an exemplary configuration of ali device 160 in an implementation consistent with the principles of the invention . as illustrated , ali device 160 may include a database 510 that stores location information for different anis . while only one database is described below , it will be appreciated that database 510 may consist of multiple databases stored at , for example , psap 150 , or stored at one or more locations throughout network 120 . in one implementation consistent with the principles of the invention , database 510 may include a group of entries in the following exemplary fields : ani field 520 and location information field 530 . database 510 may contain additional fields ( not shown ) that aid in identifying a location of a 9 - 1 - 1 caller . ani field 520 may store user device identifiers for user devices 130 in system 100 . for example , the identifiers may include a telephone number , a network address , etc . location information field 530 may store location information for each identifier in ani field 520 . the location information may be stored as latitude / longitude coordinates , street addresses , etc . in one implementation consistent with the principles of the invention , the location information may be used by an operator at psap 150 for determining a location of a 9 - 1 - 1 caller or for verifying a location of a 9 - 1 - 1 caller . fig6 illustrates an exemplary process for handling a voip 9 - 1 - 1 call in an implementation consistent with the principles of the invention . processing may begin with a user placing a voip 9 - 1 - 1 call at a user device , such as user device 130 ( act 610 ). to place the 9 - 1 - 1 call , the user may simply dial 9 - 1 - 1 using user device 130 . in response , user device 130 may capture current gps data ( act 610 ), using , for example , gps device 260 . if user device 130 is unable to capture current gps data , user device 130 may retrieve the most recently captured gps data from , for example , memory 230 . user device 130 may transmit information to 9 - 1 - 1 service provider 140 ( act 620 ). the information may include , for example , the dialed digits ( i . e ., 9 - 1 - 1 ), ani information for user device 130 ( e . g ., a telephone number associated with user device 130 ), and the captured ( or most recently ) gps data . in response to receiving the information from user device 130 , 9 - 1 - 1 service provider 140 may use the gps data to identify a psap to which to direct the 9 - 1 - 1 call ( act 630 ). in one implementation consistent with the principles of the invention , 9 - 1 - 1 service provider 140 may use the gps data to determine the location of user device 130 . 9 - 1 - 1 service provider 140 may then identify a psap that is geographically closest to the location of user device 130 . it is assumed for explanatory purposes that 9 - 1 - 1 service provider 140 identifies psap 150 as the geographically closest psap to the location of user device 130 . 9 - 1 - 1 service provider 140 may obtain a pseudo ani ( pani ) for psap 150 ( act 640 ). in one implementation consistent with the principles of the invention , the pani , like a telephone number , may include a 10 - digit number that cannot be assigned to a user device 130 . network 120 may use the pani to route the 9 - 1 - 1 call from user device 130 to the appropriate psap ( i . e ., psap 150 in the example above ). in one implementation , 9 - 1 - 1 service provider 140 may select an appropriate pani from a group of available panis . in those situations when psap 150 is capable of processing phase i or phase ii wireless 9 - 1 - 1 calls , 9 - 1 - 1 service provider 140 may convert the received gps data to a format that psap 150 may process ( act 650 ). for example , if psap 150 is capable of processing phase ii wireless 9 - 1 - 1 calls , 9 - 1 - 1 service provider 140 may convert the gps data ( if necessary ) to latitude and longitude coordinates and transmit these coordinates to psap 150 as a phase ii - formatted message . psap 150 may , for example , use this location information to verify the accuracy of the caller &# 39 ; s location information in ali device 160 . this will allow psap 150 to avoid instances where the delay cycle associated with updating ali device 160 renders the caller &# 39 ; s ali information useless . 9 - 1 - 1 service provider 140 may forward the formatted location information and the 9 - 1 - 1 call to psap 150 ( act 660 ). as indicated above , the forwarding of the 9 - 1 - 1 call to psap 150 may be based on the pani obtained by 9 - 1 - 1 service provider 140 . psap 150 may then process the 9 - 1 - 1 call from user device 130 by , for example , dispatching the appropriate emergency services personnel to the location of user device 130 . 9 - 1 - 1 service provider 140 may also update ali device 160 based on the gps data received from user device 130 ( act 670 ). in one implementation consistent with the principles of the invention , 9 - 1 - 1 service provider 140 may , for example , forward the ani and gps data received from user device 130 to ali device 160 . ali device 160 may lookup the ani in , for example , database 510 and replace any existing location data in field 530 with the gps data . if necessary , 9 - 1 - 1 service provider 140 or ali device 160 may convert the gps data into a desired format prior to storing the location information in database 510 . for example , 9 - 1 - 1 service provider 140 or ali device 160 may convert the gps data to a physical address ( e . g ., street and city ) prior to storing the location information . 9 - 1 - 1 service provider 140 may update ali device 160 with the current location of user device 130 prior to , in parallel with , or subsequent to providing the information described above with respect to act 660 to psap 150 . the following example illustrates the above processing . fig7 illustrates exemplary processing of a voip 9 - 1 - 1 call in an implementation consistent with the principles of the invention . in this example , assume that a user at user device 130 places a voip 9 - 1 - 1 call by dialing 9 - 1 - 1 . in response , user device 130 may determine its current location by capturing current gps data . if , as set forth above , user device 130 is unable to capture current gps data , user device 130 may retrieve the recently captured gps data from , for example , memory 230 , gps device 260 , or from some other location . assume that the user device 130 captures the following gps data : 89 . 59 . 999 , n , 179 . 59 . 999 , w . user device 130 may transmit the dialed digits ( i . e ., 9 - 1 - 1 ), the ani of user device 130 ( assumed to be “ 555 - 555 - 5555 ” for this example ), and the gps data ( i . e ., 89 . 59 . 999 , n , 179 . 59 . 999 , w ) to 9 - 1 - 1 service provider 140 . in response , 9 - 1 - 1 service provider 140 may use the gps data to identify a psap for handling the 9 - 1 - 1 call . it is assumed for this example that 9 - 1 - 1 service provider 140 identifies psap 150 as the closest psap to the current location of user device 130 . 9 - 1 - 1 service provider 140 may obtain a pani for psap 150 that will be used to route the 9 - 1 - 1 call to psap 150 . 9 - 1 - 1 service provider 140 may also convert the gps data to a format that is capable of being processed by psap 150 . for example , if psap 150 is capable of processing wireless phase i or phase ii calls , 9 - 1 - 1 service provider 140 may convert the gps data to the format used by psap 150 . the formatted gps data is referred to in fig7 as “ location data .” 9 - 1 - 1 service provider 140 may forward the 9 - 1 - 1 call from user device 130 to psap 150 . 9 - 1 - 1 service provider 140 may also forward the location data to psap 150 . 9 - 1 - 1 service provider 140 may update ali device 160 with the current location of user device 130 . 9 - 1 - 1 service provider 140 may , for example , forward the ani of user device 130 ( i . e ., 555 - 555 - 5555 ) and either the gps data ( i . e ., 89 . 59 . 999 , n , 179 . 59 . 999 , w ) or the location data , which may or may not be formatted in a similar manner as the location data forwarded , to psap 150 . fig8 illustrates an exemplary process for updating ali device 160 with current location information for a user device 130 in an implementation consistent with the principles of the invention . processing may begin with user device 130 determining whether user device 130 is on - line ( e . g ., connected to network 110 or another network ) ( act 810 ). if user device 130 is not on - line , processing may return to act 810 with user device 130 periodically determining whether user device 130 is on - line . if user device 130 is determined to be on - line , user device 130 may , at a periodic interval , capture current gps data ( act 820 ). in one implementation , user device 130 may capture current gps data using gps device 260 . the gps data may be in the form of latitude and longitude coordinates or in another form . if user device 130 is unable to capture current gps data , user device 130 may retrieve the most recently captured gps data from , for example , memory 230 , gps device 260 , or some other location . the interval at which the gps data is captured may be configurable by the user of user device 130 . user device 130 may transmit the gps data ( or the most recently captured gps data ) to 9 - 1 - 1 service provider 140 ( act 830 ). the gps data may be transmitted using an ip format , a real time protocol ( rtp ) format , or another format . user device 130 may also transmit ani information ( e . g ., a phone number associated with user device 130 ) to 9 - 1 - 1 service provider 140 ( act 830 ). the ani information may be transmitted with the gps data or separately from the gps data . 9 - 1 - 1 service provider 140 may update ali device 160 ( act 840 ). in one implementation consistent with the principles of the invention , 9 - 1 - 1 service provider 140 may forward the ani information and the gps data to ali device 160 . ali device 160 may lookup the ani information in , for example , database 510 and replace any existing location information with the gps data received from 9 - 1 - 1 service provider 140 . if necessary , 9 - 1 - 1 service provider 140 or ali device 160 may convert the gps data into a desired format prior to storing the location information in database 510 . in this way , 9 - 1 - 1 service provider 140 will be aware of the current location of user device 130 when the user device 130 is on - line . 9 - 1 - 1 service provider 140 may periodically update the location of user device 130 in ali device 160 whether or not a 9 - 1 - 1 call is made from user device 130 . as a result , ali device 160 will store accurate / recent location information for user device 130 , thus providing psaps with actionable dispatch information in cases where the 9 - 1 - 1 caller is unable to verbally relay his / her location information or is temporarily unable to receive a gps signal . implementations consistent with the principles of the invention use gps coordinates from a user device for routing a 9 - 1 - 1 call from the user device to the appropriate psap . in one implementation , the gps coordinates are provided from a gps device that is associated with the user device . implementations consistent with the principles of the invention also allow for periodic updates of ali information for user devices . the foregoing description of exemplary implementations of the invention provides illustration and description , but is not intended to be exhaustive or to limit the invention to the precise form disclosed . modifications and variations are possible in light of the above teachings or may be acquired from practice of the invention . for example , while the above description focused on user device 130 , 9 - 1 - 1 service provider 140 , and psap 150 performing certain acts , it will be appreciated that in other implementations consistent with the principles of the invention , the acts described above may be performed by another device in system 100 . moreover , it will be appreciated that the techniques described herein are equally applicable to non - 9 - 1 - 1 scenarios . for example , one or more of the techniques described above may be used for voip usage tracking and call statistics monitoring / analysis , personalized location - based services ( e . g ., retail location finder , local new / weather , etc . ), and / or geographic information systems ( gis ) based enterprise services ( e . g ., field services , dispatch operations , etc .). while series of acts have been described with respect to fig6 and 8 , the order of the acts may be varied in other implementations consistent with the invention . moreover , non - dependent acts may be implemented in parallel . it will be apparent to one of ordinary skill in the art that aspects of the invention , as described above , may be implemented in many different forms of software , firmware , and hardware in the implementations illustrated in the figures . the actual software code or specialized control hardware used to implement aspects consistent with the principles of the invention is not limiting of the invention . thus , the operation and behavior of the aspects of the invention were described without reference to the specific software code — it being understood that one of ordinary skill in the art would be able to design software and control hardware to implement the aspects based on the description herein . further , certain portions of the invention may be implemented as “ logic ” that performs one or more functions . this logic may include hardware , such as an application specific integrated circuit or a field programmable gate array , software , or a combination of hardware and software . no element , act , or instruction used in the description of the present application should be construed as critical or essential to the invention unless explicitly described as such . also , as used herein , the article “ a ” is intended to include one or more items . where only one item is intended , the term “ one ” or similar language is used . further , the phrase “ based on ” is intended to mean “ based , at least in part , on ” unless explicitly stated otherwise . | 7 |
in the drawing , reference numeral 1 designates a tandem master cylinder , upstream of which a vacuum brake booster 2 is connected which , in turn , is actuatable through a brake pedal 3 . the tandem master cylinder 1 is in communication with an unpressurized supply reservoir 6 via pressure lines 4 , 5 . the tandem master cylinder 1 contains in addition two housing ports 7 , 8 to which pressure lines 9 , 10 are connected . the pressure line 9 is in hydraulic communication with a separating valve 11 , while the pressure line 10 is hydraulically connected to a separating valve 12 . the separating valve 11 disposes of an inlet chamber 13 accomodating an axially slidable piston 14 whose left - hand end , when viewing the drawing , is designed as valve closure member 15 . coaxially relative to the piston 14 , a bore 17 is designed in the housing 16 of the separating valve 11 which bore terminates into the inlet chamber 13 and forms at this port a valve seat 18 adapted to be closed by the valve closure member 15 . the piston 14 is designed as a stepped piston and projects in a sealed manner into a chamber 19 which is constantly unpressurized . the larger piston step 20 of the piston 14 is guided in a cylinder bore 21 , and the right - hand end face , when viewing the drawing , of the larger piston step 20 confines a chamber 22 . a pressure line 23 leads from the bore 17 to an electromagnetically actuatable two - way / two - position valve 24 which , when de - energized , permits free hydraulic passage and is , in turn , connected via a pressure line 25 to wheel brakes 26 , 27 at the rear axle of an automotive vehicle . the separating valve 12 is designed alike the separating valve 11 and disposes of a housing 28 , an inlet chamber 29 and a piston 30 which carries a valve closure member 31 at its right - hand end , when viewing the drawing , and is guided with a larger piston step 32 in a cylinder bore 33 . the separating valve 12 contains furthermore a chamber 34 , which is constantly unpressurized , and a chamber 35 which is confined by the end face of the larger piston step 32 . in addition , the separating valve 12 contains a bore 36 which terminates into the inlet chamber 29 and forms a valve seat 37 opposite to the valve closure member 31 . a pressure line 38 leads from the bore 36 to electromagnetically actuatable two - way / two - position valves 39 , 40 which , in the inactive position illustrated in the drawing , establish a hydraulic connection to wheel brakes 41 , 42 at the front axle of the automotive vehicle . further components of the brake system illustrated in the drawing are brake valves 43 , 44 , to which the pressure prevailing at the housing ports 7 , 8 of the tandem master cylinder is supplied via pressure lines 45 , 46 . the brake valve 43 comprises an inlet chamber 47 in which a piston 48 is axially slidably guided and loaded by a compression spring 49 . the right - hand end of the piston 48 , when viewing the drawing , projects into a control chamber 50 and is designed as valve closure member 51 . the control chamber 50 , on the other hand , is confined by a bore 52 which enlarges radially outwardly and constitutes a valve seat 53 . movable into abutment on the valve seat 53 is a valve closure member 54 which is part of a piston 56 provided with an axial bore 55 and biased against the valve seat 53 by a compression spring 57 . the right - hand end of the piston 56 , when viewing the drawing , projects in a sealed manner into a chamber 58 wherein there is constantly prevailing atmospheric pressure . the brake valves 43 , 44 are of identical design , an inlet chamber 59 of the brake valve 44 being in communication with the housing port 8 of the tandem master cylinder 1 via the pressure lines 46 , 9 . projecting into the inlet chamber 59 of the separating valve 44 is a piston 60 which is loaded by a compression spring 61 . the right - hand end of the piston 60 , when viewing the drawing , projects in a sealed manner into a control chamber 62 and is likewise designed as valve closure member 63 . projecting furthermore into the control chamber 62 is a piston 65 provided with a valve closure member 64 , the said piston disposing of an axial bore 66 and extending with its right - hand end , when viewing the drawing , into a constantly unpressurized chamber 67 . the valve closure member 64 of the piston 65 cooperates likewise with a valve seat 68 of the separating valve 44 and is biased against the valve seat 68 by a compression spring 69 . pressure lines 70 , 71 lead from the control chambers 50 , 62 of the brake valves 63 , 64 to the chambers 22 , 35 of the separating valves 11 , 12 . furthermore , the pressure lines 70 , 71 have connections 72 , 73 to the electromagnetically actuatable two - way / two - position valves 39 , 40 , 24 , with check valves 74 , 75 being inserted in said connections 72 , 73 . in the brake system illustrated in the drawing , a dual - circuit pump aggregate 76 , 77 which is adapted to be driven by an electric motor 78 is provided for making available auxiliary hydraulic energy . said electric motor 78 will for instance be put into operation after the brake pedal 3 has performed an adjustable travel . connected in parallel to the dual - circuit pump aggregate 76 , 77 are pressure - relief valves 79 , 80 which limit the outlet pressures of the pump aggregate 76 , 77 . the suction sides of the pump aggregate 76 , 77 are connected to the unpressurized supply reservoir 6 , while the pressure sides communicate via lines 81 , 82 with the brake valves 43 , 44 . besides , pressure accumulators 83 , 84 are connected to the suction sides of the pump aggregate 76 , 77 which , in turn , are connected via pressure lines 85 , 86 with electromagnetically actuatable two - way / two - position valves 87 , 88 , 89 . said electromagnetically actuatable two - way / two - position valves 87 , 88 , 89 are closed in the de - energized state , thus preventing escape of the pressure fluid supplied to the wheel brakes 41 , 42 , 26 , 27 . the mode of operation of the brake system described will be explained in more detail hereinbelow , starting from the brake &# 39 ; s release condition in which no actuating force is applied to the brake pedal 3 and all movable parts assume their position to be seen in the drawing . when an actuating force is applied to the brake pedal 3 , pressure will develop in the working chambers of the tandem master cylinder 1 assisted by the vacuum brake booster . this pressure is supplied via the housing ports 7 , 8 and the pressure lines 9 , 10 to the separating valves 11 , 12 which are opened at first . via the pressure lines 23 , 38 , the pressure generated in the tandem master cylinder 1 will thus propagate to the wheel brakes 26 , 27 , 41 , 42 . the pressure prevailing in the tandem master cylinder 1 will furthermore be supplied via the pressure lines 45 , 46 to the inlet chambers 47 , 59 of the brake valves 43 , 44 so that the pistons 48 , 60 will be displaced to the right , when viewing the drawing , in opposition to the force of the compression springs 49 , 61 , as a result whereof the valve closure members 51 , 63 shaped at the pistons 48 , 60 will move into abutment on the ports of the axial bores 55 , 66 of the pistons 56 , 65 and isolate the control chambers 50 , 62 from the unpressurized supply reservoir 6 . simultaneously with the application of the brakes , the electric motor 78 will be started and cause the dual - circuit pump aggregate 76 , 77 to generate hydraulic pressure which is supplied via the pressure lines 81 , 82 to the brake valves 43 , 44 . in this arrangement , pressure limitation of the outlet pressures of the pump aggregate 76 , 77 is effected by the pressure - relief valves 79 , 80 which return the pressure fluid delivered by the pump aggregate 76 , 77 to the unpressurized supply reservoir 6 in the event of adjustable pressure values being exceeded . when the actuating force applied to the brake pedal 3 is increased , finally a pressure will be accomplished in the inlet chambers 47 , 49 , upon attainment of which the pistons 56 , 65 will be displaced to the right , when viewing the drawing , in opposition to the compression springs 57 , 69 so that the valve closure members 54 , 64 lift from the valve seats 53 , 68 and pressurized fluid is fed to the control chambers 50 , 62 . the pressure brought about this way in the control chambers 50 , 62 is proportional to the actuating force exerted on the brake pedal and will be supplied via the pressure lines 70 , 71 to the chambers 22 , 35 of the separating valves 11 , 12 , thus causing displacement of the pistons 14 , 30 of the separating valves 11 , 12 to the left , when viewing the drawing , and abutment of the valve closure members 15 , 31 on the valve seats 18 , 37 . the connections between the tandem master cylinder 1 and the wheel brakes 26 , 27 , 41 , 42 will be interrupted in this switching position . pressurization of the wheel brakes will now be performed by the hydraulically actuated brake valves 43 , 44 which supply the pressure prevailing in the control chambers 50 , 62 via the connections 72 , 73 to the wheel brakes 26 , 27 , 41 , 42 . when slip control electronics not shown recognize a critical condition at one or at several of the vehicle wheels , the two - way / two - position valves 39 , 40 , 24 assigned to the vehicle wheels will be switched over so that the pressure in the wheel brakes 41 , 42 , 26 , 27 remains constant . in case it is necessary for preventing a locked condition to decrease the pressure in one or in several of the wheel brakes 26 , 27 , 41 , 42 , the electromagnetically actuatable two - way / two - position valves 87 , 88 , 89 , too , will be switched over so that pressure fluid is taken from the wheel brakes 26 , 27 , 41 , 42 and flows into the pressure lines 85 , 86 . the pressure fluid taken from the wheel brakes 26 , 27 , 41 , 42 will be partly received by the pressure accumulators 83 , 84 . in the process of release of the brake , the course of motion described will be reversed until finally , when the brake is released , the movable parts have re - assumed their position to be seen from the drawing . if on account of a disturbance of the pump aggregate 76 , 77 no pressure develops in the pressure lines 81 , 82 , the separating valves 11 , 12 will remain in an opened position in which the wheel brakes 26 , 27 , 41 , 42 are pressurized by the tandem master cylinder 1 directly . | 1 |
fig1 shows a schematic of a digital system 10 comprising a plurality of processors 102 - 106 ; a memory crossbar 120 ; and a multi - channel memory subsystem 124 which comprises a plurality of memory controllers 130 - 136 , each of the memory controllers 130 - 136 being coupled to a memory channel 140 - 146 . in this embodiment the memory crossbar 120 serves as an interface between the processors 102 - 106 and the multi - channel memory subsystem 124 . other interfaces between the processors and memory channels can also be used . the processors 102 - 106 are each coupled to the crossbar 120 as a master device ( m ) and the memory controllers 130 - 136 are each coupled to the crossbar 120 as a slave device ( s ). the processors 102 - 106 send memory requests to the crossbar 120 , the memory requests are routed to the appropriate memory controller 130 - 136 , the appropriate memory controller 130 - 136 accesses the associated memory channel 140 - 146 to fulfill the memory request and sends any necessary response back to the processor 102 - 106 that initiated the memory request . two important parameters in a digital system are system speed or performance and system power consumption . power consumption is an especially important factor in mobile systems where it directly affects the amount of time a battery charge can power the system . the speed with which the memory requests of the processors 102 - 106 can be fulfilled by the memory subsystem 124 has a significant impact on the overall system speed . thus , it is advantageous to maximize the throughput or bandwidth of the memory system 124 in order to increase the overall speed of the system . however , the memory subsystem 124 also impacts the power consumption of the overall system . the lower the voltage supplied to the memory channel , the lower the power consumed by the memory channel , but the lower the bandwidth of the memory channel , i . e ., the slower the rate at which data can be read from or stored to the memory channel . thus , there is a trade - off between memory bandwidth and memory power consumption . a memory channel consumes different amounts of power depending on its state . the “ power down ” state uses the least power , but during the power down state , the memory channel cannot be accessed and entering and exiting the power down state has a significant performance overhead . in an “ operation ” state the memory channel consumes more power but it is ready to process memory requests . the operation state can have multiple levels or power modes . in general , levels with greater throughput or bandwidth will have greater power requirements . each memory channel can operate in different power modes with different voltage and frequency . an exemplary embodiment of the multi - power mode system has three power modes : ( 1 ) high bandwidth / high power , ( 2 ) medium bandwidth / medium power , and ( 3 ) low bandwidth / low power . the power down feature can also be used as an additional power option in this memory architecture . in the low bandwidth / low channel mode , the memory channel can still be accessed unlike the power down mode . in the embodiment shown in fig1 , the memory controller for each channel controls the power mode of the channel . for example , if the processors 102 - 106 are making frequent memory requests to the memory channel 140 , then it would be desirable for the memory controller 130 to raise the voltage for the memory channel 140 to allow for increased bandwidth or throughput to fulfill the memory requests faster . meanwhile , if the processors 102 - 106 are making less frequent memory requests to the memory channel 146 , then it would be desirable for the memory controller 136 to adjust the voltage for the memory channel 146 to be in a medium or low power mode . and if the processors 102 - 106 are making even fewer memory requests of the memory channel 142 for an extended period of time , then it would be desirable for the memory controller 132 to adjust the voltage for the memory channel 142 to be in low power mode or even in power down mode . as an example of the potential power savings , assume there are four memory channels with requested throughputs of 1 . 5 gigabytes per second ( gb / s ), 1 gb / s , 1 gb / s , and 1 gb / s , respectively . the former method would be to run all channels at the same power mode , for example 1 . 8 v and 333 mhz with a power efficiency of 0 . 4 watts / gb / s , which results in a total power consumption of : assume that the higher throughput , 1 . 5 gb / s , has the above desired power mode but the slower rate of 1 gb / s has a desired power mode with voltage of 1 . 2 v , clock frequency of 266 mhz and power efficiency of 0 . 14 watts / gb / s . by running each channel at its desired power mode , the total power consumption is reduced to : in this example , running the memory channels in multiple power modes reduced the total power consumption by more than 44 %. fig2 shows an exemplary embodiment of a memory controller 202 coupled to a memory channel 204 . the memory controller 202 can be exemplary of any of the memory controllers 130 - 136 . the memory channel 204 can be exemplary of any of the memory channels 140 - 146 . the memory controller 202 receives memory requests through lines 206 which couple the memory controller 202 , directly or indirectly , to the processors 102 - 106 . the memory controller 202 then communicates with the memory channel 204 across lines 208 to fulfill the memory requests . the memory controller 202 includes power control logic ( pcl ) 210 and a voltage regulator ( vr ) 212 . the power control logic 210 keeps track of the requested memory throughput and determines a desired power level for the memory channel 204 based , at least in part , on the requested memory throughput . the desired power level may be determined by various methods , for example , using threshold values , a look - up table , or a function relating power mode to throughput . if the power control logic 210 determines that the power mode of the memory channel 204 should be changed to a new power mode , the power control logic 210 signals the voltage regulator 212 to change to the new power mode . the voltage regulator 212 then adjusts the voltage supplied to the memory channel 204 through a power connection 214 . the voltage or voltages available to the voltage regulator 212 can be generated external to the memory controller 202 , for example by a power management circuit for the system . fig3 shows an alternative exemplary embodiment of a memory controller 302 coupled to the memory channel 204 . the memory controller 302 can be exemplary of any of the memory controllers 130 - 136 . the memory controller 302 receives memory requests through lines 206 which couple the memory controller 302 to the processors 102 - 106 . the memory controller 302 then communicates with the memory channel 204 across lines 208 to fulfill the memory requests . the memory controller 302 includes power control logic ( pcl ) 210 and a voltage selector 312 . in this illustrative schematic , the voltage selector 312 is shown as a switch with three voltage choices : v high , v med and v low . v high can be a high power / high bandwidth power mode ; v med can be a medium power / medium bandwidth power mode ; and v low can be a low power / low bandwidth power mode . as in fig2 , the power control logic 210 keeps track of the requested memory throughput and determines a desired power mode for the memory channel 204 based , at least in part , on the requested memory throughput . if the power control logic 210 determines that the power mode of the memory channel 204 should be changed to a new power mode , the power control logic 210 signals the voltage selector 312 to change to the new power mode . the voltage selector 312 then selects the voltage for the desired power mode which is supplied to the memory channel 204 through power connection 214 . the voltages available to the voltage selector 312 can be generated external to the memory controller 302 , for example by a power management circuit for the system . an alternative system embodiment is shown in fig4 , where the same reference numbers are used for similar elements . fig4 includes the multiple processors 102 - 106 coupled through the memory crossbar 120 to a multi - channel memory system 424 comprising multiple memory controllers 430 , 432 , 434 , 436 each coupled to memory channels 140 , 142 , 144 , 146 , respectively . the memory controllers 430 - 436 do not include power control logic or voltage control . in the system of fig4 , power control logic 402 is external to the memory controllers , and the power control logic 402 is coupled to a power management circuit 404 . the power control logic 402 tracks the power mode of each memory channel . fig4 shows an embodiment where the power control logic 402 is coupled to the memory crossbar 120 for receiving the requested throughput for each memory channel 140 - 146 from the memory crossbar 120 . alternatively , the power control logic 402 can be coupled to each of the memory controllers 430 - 436 and receive the requested throughput for each memory channel 140 - 146 from the memory controllers 430 - 436 . the power control logic 402 determines a desired power mode for each of the memory channels 140 - 146 based , at least in part , on the requested memory throughput of the memory channel . if the power control logic 402 determines that the power mode of a particular memory channel should be changed to a new power mode , the power control logic 402 signals the power management circuit 404 to change to the new power mode for that particular memory channel . the power management circuit 404 then adjusts the voltage supplied to the particular memory channel through the connection between the power management circuit 404 and that particular memory channel . alternatively , the power management circuit 404 can adjust the voltage supplied to both the particular memory channel and the memory controller associated with the particular memory channel . fig5 provides a top - level flow diagram of an exemplary control algorithm for the power control logic ( pcl ) 402 or 210 to determine the power mode for a memory channel . for a multi - channel memory , this control logic can be duplicated for each channel , for example as in fig2 or 3 , or the control logic can control multiple memory channels , for example as in fig4 ; and each channel can be powered at its particular desired power mode . at block 502 , the pcl determines the requested throughput for the memory channel . at block 504 , the pcl determines the desired power mode for the requested throughput level found in block 502 . at block 506 , the pcl checks whether the memory channel is already operating at the desired power level . if the memory channel is already operating at the desired power level then control is passed back to block 502 , otherwise control is passed to block 508 . in an alternative embodiment , if the memory channel is not already operating at the desired power level then control is passed directly to block 516 where the pcl initiates transition of the memory channel to the desired power level , and then control is passed back to block 502 . at block 508 , the pcl again determines the requested throughput for the memory channel . at block 510 , the pcl determines the associated power mode for the requested throughput level found in block 508 . at block 512 , the pcl checks whether the desired power mode determined in block 504 is the same as the associated power mode determined in block 5 10 . if the desired and associated power modes are not the same , then the memory channel is fluctuating between different desired power modes and control is transferred back to block 502 . otherwise , control is passed to block 514 . in an alternative control algorithm , instead of returning directly to block 502 when the desired power mode changes , the algorithm can check whether the memory channel returns to the same desired power level in less than a short threshold time . if the desired power level for the memory channel does return in the short threshold time , the algorithm passes control to block 514 , otherwise it passes control to block 502 . at block 514 , the pcl checks whether the memory channel has been seeking the same desired power mode for at least a threshold period of time . this threshold can be selected to prevent the pcl from rapidly shifting or bouncing between power modes . if the desired power mode has not been sought for the threshold period of time , then control is passed to block 508 to see whether the memory channel stays in the range for the desired power mode . if the desired power mode has been sought for at least the threshold period of time , then control is passed to block 516 where the pcl initiates the transition of the memory channel to the new desired power mode , after which control is passed back to block 502 . fig6 shows an exemplary wireless communication system 600 in which an embodiment of a memory power management system supporting multiple power modes may be advantageously employed . for purposes of illustration , fig6 shows three remote units 620 , 630 , and 650 and two base stations 640 . it should be recognized that typical wireless communication systems may have many more remote units and base stations . any of remote units 620 , 630 , and 650 may include a memory power management system supporting multiple power modes such as disclosed herein . fig6 shows forward link signals 680 from the base stations 640 and the remote units 620 , 630 , and 650 and reverse link signals 690 from the remote units 620 , 630 , and 650 to base stations 640 . in fig6 , remote unit 620 is shown as a mobile telephone , remote unit 630 is shown as a portable computer , and remote unit 650 is shown as a fixed location remote unit in a wireless local loop system . for example , the remote units may be cell phones , hand - held personal communication systems ( pcs ) units , portable data units such as personal data assistants , or fixed location data units such as meter reading equipment . although fig6 illustrates certain exemplary remote units that may include a memory power management system supporting multiple power modes as disclosed herein , the memory power management system is not limited to these exemplary illustrated units . embodiments may be suitably employed in any electronic device in which a memory power management system supporting multiple power modes is desired . while exemplary embodiments incorporating the principles of the present invention have been disclosed hereinabove , the present invention is not limited to the disclosed embodiments . instead , this application is intended to cover any variations , uses , or adaptations of the invention using its general principles . further , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims . | 8 |
it will be readily understood that the components of the present invention , as generally described and illustrated in the drawings herein , could be arranged and designed in a wide variety of different configurations . thus , the following more detailed description of the embodiments of the system and method of the present invention , as represented in the drawings , is not intended to limit the scope of the invention , but is merely representative of various embodiments of the invention . the illustrated embodiments of the invention will be best understood by reference to the drawings , wherein like parts are designated by like numerals throughout . the shoulder support apparatus 10 of the present invention is formed as a single adhesive member comprising a central body portion 12 , an upper load strap 14 , a lower load strap 16 , a first extending member 18 and a second extending number 20 . in certain embodiments , the shoulder support apparatus 10 may comprise a longitudinal length that extends from an outer midsection of the upper load strap 14 to an outer midsection of the lower load strap 16 measuring between about 22 - 28 cm . correspondingly , the shoulder support apparatus 10 of the present invention may comprise a central width extending between the outer midsection of the first extending member 18 and the outer midsection of the second extending member 20 which may measure between about 20 - 25 cm . although the adhesive shoulder support apparatus 10 may be formed as a single , one - piece member , for the purpose of providing a description of its structural and physical characteristics , the shoulder support apparatus 10 may include a central body portion 12 disposed between an upper load strap 14 and a lower load strap 16 , as best shown in fig1 - 3 . the central body portion 12 may be formed having a defined surface area comprising both a width and an elongated length . this surface area of the central body portion 12 may further comprise an upper section 12 b , a lower section 12 c and a middle section 12 a disposed therebetween . in certain embodiments , the middle section 12 a of the surface area of the central body portion 12 may be formed having a width measuring between about 15 - 17 cm . where the load strap 14 engages the upper section 12 b of the surface area of the central body portion 12 , the width of the upper section 12 b may be measured at between about 13 - 15 cm . correspondingly , at the point where the lower section 12 c of the surface area of the central body portion 12 engages the load strap 16 , the width of the lower section 12 c may be measured at between about 12 - 14 cm . the central body portion 12 of the adhesive support apparatus 10 of one embodiment of the present invention may be formed having a middle section 12 a comprising a width that is measured to be larger in dimension as compared to tapering at its width measured at the upper section 12 b upon engagement with the upper load strap 14 and , correspondingly , at the lower section 12 c upon engagement with the lower load strap 16 . additionally , the surface area of the central body portion 12 of the adhesive shoulder support apparatus 10 , in certain embodiments , may include a longitudinal length of between about 16 - 20 cm extending between the upper section 12 b and the lower section 12 c . the shoulder support apparatus 10 of the present invention is formed as a single adhesive member comprising a central body portion 12 , an upper load strap 14 , a lower load strap 16 , a first extending member 18 and a second extending number 20 . in certain embodiments , the shoulder support apparatus 10 may comprise a longitudinal length that extends from an outer midsection of the upper load strap 14 to an outer midsection of the lower load strap 16 measuring between about 22 - 28 cm . correspondingly , the shoulder support apparatus 10 of the present invention may comprise a central width extending between the outer midsection of the first extending member 18 and the outer midsection of the second extending member 20 which may measure between about 20 - 25 cm . although the adhesive shoulder support apparatus 10 may be formed as a single , one - piece member , for the purpose of providing a description of its structural and physical characteristics , the shoulder support apparatus 10 may include a central body portion 12 disposed between an upper load strap 14 and a lower load strap 16 , as best shown in fig1 - 3 . the central body portion 12 may be formed having a defined surface area comprising both a width and an elongated length . this surface area of the central body portion 12 may further comprise an upper section 12 b , a lower section 12 c and a middle section 12 a disposed therebetween . in certain embodiments , the middle section 12 a of the surface area of the central body portion 12 may be formed having a width measuring between about 15 - 17 cm . where the load strap 14 engages the upper section 12 b of the surface area of the central body portion 12 , the width of the upper section 12 b may be measured at between about 13 - 15 cm . correspondingly , at the point where the lower section 12 c of the surface area of the central body portion 12 engages the load strap 16 , the width of the lower section 12 c may be measured at between about 12 - 14 cm . the central body portion 12 of the adhesive support apparatus 10 of one embodiment of the present invention may be formed having a middle section 12 a comprising a width that is measured to be larger in dimension as compared to tapering at its width measured at the upper section 12 b upon engagement with the upper load strap 14 and , correspondingly , at the lower section 12 c upon engagement with the lower load strap 16 . additionally , the surface area of the central body portion 12 of the adhesive shoulder support apparatus 10 , in certain embodiments , may include a longitudinal length of between about 16 - 20 cm extending between the upper section 12 b and the lower section 12 c . referring to fig1 - 2 , the upper load strap 14 may be formed having a central surface area defined by an outer bell - shaped configuration and having opposing rounded ends disposed so as to engage an exterior portion the upper section 12 b of the surface area of the central body portion 12 of the shoulder support apparatus 10 . in certain embodiments , the width of the upper load strap 14 that extends between the rounded opposing ends may be measured between about 17 - 20 cm . the longitudinal length between the upper section 12 b of the surface area of the central body portion 12 to the corresponding outer peripheral edge of the upper load strap 14 may be measured between about 2 . 5 - 5 . 5 cm . in certain embodiments of the present invention , the lower load strap 16 may be formed having a central surface area defined by an outer bell - shaped configuration and opposing rounded ends being disposed so as to engage an exterior portion of the lower section 12 c of the surface area of the central body portion 12 of the shoulder support apparatus 10 . the width of the lower load strap 14 extending between the rounded opposing ends maybe measured between about 14 - 16 cm . the longitudinal length extending between the lower section 12 c of the surface area of the central body portion 12 and the corresponding outer peripheral edge of the lower load strap 16 may be measured between about 2 - 4 cm . as best illustrated in fig1 and 2 , the first extending member 18 of the adhesive support member 10 of the present invention may be formed contiguous a portion of the surface area of the middle section 12 a of the central body portion 12 and extend outwardly therefrom . in design , the first extending member 18 may comprise a shaft section 18 a that protrudes from its engagement with the middle section 12 a , wherein the shaft 18 a includes opposing parallel sides that extend outwardly and form a rounded head portion 18 b attached thereto . in certain embodiments , the shaft section 18 a and the rounded head portion 18 b provide a contact surface area of the first extending member 18 for engagement with a portion of the user &# 39 ; s body to which the adhesive support member 10 is selectively adhesively applied . in certain embodiments , the shaft section 18 a may comprise a longitudinal length measured between about 1 - 3 cm and a width measured between about 2 - 4 cm . correspondingly , the head portion 18 b of the first extending member 18 may be formed having a longitudinal length measured from each rounded opposing end between about 4 - 7 cm and a width measured between about 2 - 4 cm . similar in configuration , the second opposing extending member 20 of the adhesive support member 10 of the present invention may be formed contiguous a portion of the surface area of the middle section 12 a of the central body portion 12 and extend outwardly therefrom . in design , the second extending member 20 may comprise a shaft section 20 a that protrudes from its engagement with the middle section 12 a , wherein the shaft 20 a includes opposing parallel sides that extend outwardly and form a rounded head portion 20 b attached thereto . in certain embodiments , the shaft section 20 a and the rounded head portion 20 b provide a contact surface area of the second extending member 20 for engagement with a portion of the user &# 39 ; s body to which the adhesive support member 10 may be selectively applied . the shaft section 20 a may comprise a longitudinal length measured between about 1 - 3 cm and a width measured between about 2 - 4 cm . correspondingly , the head portion 20 b of the second extending member 20 may be formed having a longitudinal length measured from each rounded opposing end between about 4 - 7 cm and a width measured between about 2 - 4 cm . although not required , certain embodiments of the middle section 12 a of the central body portion 12 of the adhesive shoulder support apparatus 10 of the present invention may comprise a plurality of openings 38 formed therein . the function of the openings 38 formed in the central body portion 12 of the adhesive support apparatus 10 of the present invention is to aid in providing a form of ventilation and breathability to the underlying contact area of the shoulder area and deltoid of the user . disposed within the surface area of the middle section 12 a of the central body portion 12 are a number of openings 38 a . the openings 38 a are generally formed in a spaced - apart relationship to each other . in certain embodiments , the openings 38 a may comprise a rectangular configuration and be aligned horizontally in a first and second row . the first row may include four ( 4 ) openings 38 a disposed above the midsection 13 of the central body portion 12 and in spaced - apart relationship to each other and the second row may include four ( 4 ) corresponding openings 38 a disposed below the midsection 13 and also in spaced - apart relationship to each other . in certain embodiments , the openings 38 a may be formed having a longitudinal length measured between about 1 - 3 cm and a width measured between about 0 . 5 - 1 . 5 cm . the lower edges of the first row of openings 38 a formed in the surface area of the middle section 12 a of the central body portion 12 may be disposed between about 2 - 4 cm from the upper edges of the corresponding openings 38 a found in the second row . elongated openings 38 b - e may also be formed in the central body portion 12 of the shoulder support apparatus 10 . the elongated openings 38 b of one embodiment of the present invention may be designed having an elongated length that extends between first and second opposing ends , wherein at least a portion of the elongated length comprises a substantially rectangular configuration . the second opposing ends of the elongated openings 38 b may be formed having a rounded head portion positioned adjacent the upper load strap 14 . two ( 2 ) elongated openings 38 b may be arranged in the portion of the surface area of the upper section 12 b of the central body portion 12 in a spaced - apart relationship to contiguous openings 38 a formed in the upper row of openings 38 a formed in the middle section of the central body portion 12 of the adhesive shoulder support apparatus 10 . in one embodiment of the present invention , the elongated openings 38 b are disposed in the surface area of the upper section 12 b of the central body portion 12 on the sides adjacent the first and second extending members 14 , 16 , respectively . in certain embodiments , the elongated openings 38 b may be formed having a longitudinal length measured between about 3 - 5 cm and a width measured between about 0 . 5 - 1 . 5 cm . the lower edges of the elongated openings 38 b formed in the surface area of the upper section 12 b of the central body portion 12 may be disposed between about 0 . 5 - 1 . 5 cm from the upper edges of the corresponding openings 38 a found in the first row of openings formed in the middle section 12 a . the surface area of the upper section 12 b of the central body portion 12 may further comprise elongated openings 38 c designed with a slightly longer longitudinal length in comparison to the length of the openings 38 b . the longitudinal length of the elongated openings 38 c extend between first and second opposing ends , wherein at least a portion of the elongated length comprises a substantially rectangular configuration and wherein the respective second opposing ends include a rounded head portion disposed adjacent the upper load strap 14 . two ( 2 ) elongated openings 38 c may be arranged in the surface area of the upper section 12 b of the central body portion 12 in a spaced - apart relationship to contiguous openings 38 a formed in the upper row of openings 38 a formed in the middle section 12 a of the central body portion 12 of the adhesive shoulder support apparatus 10 . in one embodiment of the present invention , the elongated openings 38 c are disposed in the surface area of the upper section 12 b of the central body portion 12 adjacent each another , while each being disposed adjacent an elongated opening 38 b , respectively . in certain embodiments , the elongated openings 38 c may be formed having a longitudinal length measured between about 4 - 6 cm and a width measured between about 0 . 5 - 1 . 5 cm . the lower peripheral edges of the elongated openings 38 c formed in the surface area of the upper section 12 b of the central body portion 12 may be disposed between about 0 . 5 - 1 . 5 cm from the upper edges of the corresponding openings 38 a found in the first row of openings formed in the middle section 12 a . additionally , the central body portion 12 may comprise elongated openings 38 d designed having a longitudinal length that may be slightly smaller than the length of the elongated openings 38 b and larger than the length of the openings 38 a . the elongated openings 38 d of one embodiment of the present invention may be designed having a longitudinal length that extends between first and second opposing ends , wherein at least a portion of the length comprises a substantially rectangular configuration and wherein the second opposing ends include a rounded head portion disposed adjacent the lower load strap 16 . two ( 2 ) elongated openings 38 d may be arranged in the surface area of the lower section 12 c of the central body portion 12 of the adhesive shoulder apparatus 10 . in one embodiment of the present invention , the elongated openings 38 d are disposed in the surface area of the lower section 12 c of the central body portion 12 on the sides adjacent the first and second extending members 14 , 16 , respectively . in certain embodiments , the elongated openings 38 d may be formed having a longitudinal length measured between about 2 - 4 cm and a width measured between about 0 . 5 - 1 . 5 cm . the upper peripheral edges of the elongated openings 38 d formed in the surface area of the lower section 12 c of the central body portion 12 may be disposed between about 0 . 5 - 1 . 5 cm from the lower edges of the corresponding openings 38 a found in the second row of openings formed in the middle section 12 a . further , the central body portion 12 may comprise additional elongated openings 38 e designed having a longitudinal length that may be slightly larger than the length of the elongated openings 38 d and larger than the length of the openings 38 a . the elongated openings 38 d of one embodiment of the present invention may be designed having a longitudinal length that extends between first and second opposing ends , wherein at least a portion of the length comprises a substantially rectangular configuration and wherein the second opposing ends include a rounded head portion disposed adjacent the lower load strap 16 . two ( 2 ) elongated openings 38 e may be arranged in the surface area of the lower section 12 c of the central body portion 12 of the adhesive shoulder apparatus 10 . in one embodiment of the present invention , the elongated openings 38 e are disposed in the surface area of the lower section 12 c of the central body portion 12 adjacent each another , while each being disposed adjacent an elongated opening 38 d , respectively . in certain embodiments , the elongated openings 38 e may be formed having a longitudinal length measured between about 3 - 5 cm and a width measured between about 0 . 5 - 1 . 5 cm . the upper peripheral edges of the elongated openings 38 e formed in the surface area of the lower section 12 c of the central body portion 12 may be disposed between about 0 . 5 - 1 . 5 cm from the lower edges of the corresponding openings 38 a found in the second row of openings formed in the middle section 12 a . in certain embodiments , the longitudinal length and width of the elongated openings 38 d , 38 e , respectively , formed in the lower section 12 c of the central body portion 12 of the adhesive shoulder support apparatus 10 may he identical . accordingly , the dimensional size and shape of the openings 38 that may be formed in the central body portion 12 of the shoulder support apparatus 10 are merely exemplary of certain embodiments of the present invention and are not intended to be restrictive or limiting in construction . referring now to fig3 , one embodiment of the adhesive shoulder support apparatus 10 of the present invention may be selectively applied between an area of the shoulder 40 and along a portion of the longitudinal length of an adjacent deltoid 50 of a user . in design , the adhesive shoulder support apparatus 10 may be used as a conservative form of treatment wherein being selectively applied to the user in such a manner so as to provide control and maintenance to the positioning of the shoulder joint and , accordingly , alleviate joint pressure and stress on the joints and soft tissue structures in order to provide pain relief , while promoting strength , health and recovery to the shoulder injury . the adhesive shoulder support apparatus 10 , when properly applied between the shoulder and deltoid of the user , may provide enhanced support and in effect act as an auxiliary muscle allowing the shoulder to move freely through a normal range of motion . in certain embodiments , a method for applying the adhesive shoulder support apparatus 10 of the present invention may comprise the steps of : ( 1 ) adhering the upper load strap 14 to the injured shoulder 40 contiguous the acromion ; ( 2 ) adhering the central body portion 12 along at least a portion of the longitudinal length of a upper surface area of the deltoid 50 ; ( 3 ) adhering the lower load strap 16 along a lower portion of the deltoid 50 ; and ( 4 ) adhering the first and second opposing extending members 18 , 20 to the underlying skin of the user in sufficient tension to provide linear stabilization to the respective positioning of the adhesive support apparatus 10 . in an effort to maintain the rotator cuff and the tendons in alignment in order to assist in providing stability to the shoulder , the central body portion 12 of the shoulder support apparatus 10 may have its longitudinal length stretched upon its application between the upper load strap 14 and the lower load strap 16 , along lines ab as shown in fig1 , thus providing a load tension sufficient to simulate an auxiliary muscle . due to the flexible characteristics of the shoulder support apparatus 10 , the stretch load or tension applied to the central body portion 12 of the shoulder support apparatus 10 between the upper load strap 14 and the lower load strap 16 may comprise an extended longitudinal length of between about 0 . 5 - 1 . 5 cm . as shown in fig4 , another embodiment of the adhesive shoulder support apparatus 110 of the present invention may be formed as a single adhesive member comprising a central body portion 112 , an upper load strap 114 , a lower load strap 116 , a first extending member 118 and a second opposing extending number 120 . in certain embodiments , the shoulder support apparatus 110 may comprise a longitudinal length that extends from an outer midsection of the upper load strap 114 to an outer midsection of the lower load strap 116 measuring between about 22 - 27 cm . correspondingly , the shoulder support apparatus 110 of the present invention may comprise a central width extending between the outer midsection of the first extending member 118 and the outer midsection of the second extending member 120 which may measure between about 22 - 27 cm . although the adhesive shoulder support apparatus 110 is formed as a single , one - piece member , for the purpose of providing a description of its structural and physical characteristics , the shoulder support apparatus 110 may be formed having a central body portion 112 disposed between an upper load strap 114 and a lower load strap 116 . the central body portion 112 may be formed having a defined surface area comprising both a width and a longitudinal length . this surface area of the central body portion 12 may further include an upper section 112 b , a lower section 112 c and a middle section 112 a disposed therebetween . in certain embodiments , the middle section 112 a of the surface area of the central body portion 112 may be formed having a width measuring between about 14 - 18 cm . where the load strap 114 engages the upper section 112 b of the surface area of the central body portion 112 , the width of the upper section 112 b may be measured at between about 13 - 15 cm . correspondingly , at the point where the lower section 112 c of the surface area of the central body portion 112 engages the load strap 116 , the width of the lower section 112 c may be measured at between about 12 - 14 cm . the central body portion 112 of the adhesive support apparatus 110 of one embodiment of the present invention may be formed having a middle section 112 a comprising a width that is measured to be larger in dimension as compared to the tapering at its width measured at the upper section 112 b upon engagement with the upper load strap 114 and , correspondingly , at the lower section 112 c upon engagement with the lower load strap 116 . additionally , the surface area of the central body portion 112 of the adhesive shoulder support apparatus 110 , in certain embodiments , may include a longitudinal length of between about 16 - 20 cm extending between the upper section 112 b and the lower section 112 c . still referring to fig4 , the upper load strap 114 may be formed having a central surface area defined by an outer bell - shaped configuration and having opposing rounded ends disposed so as to engage an exterior portion the upper section 112 b of the surface area of the central body portion 112 of the shoulder support apparatus 110 . in certain embodiments , the width of the upper load strap 114 that extends between the rounded opposing ends may be measured between about 16 - 20 cm . the longitudinal length between the upper section 112 b of the surface area of the central body portion 112 to the corresponding outer peripheral edge of the upper load strap 114 may be measured between about 2 . 5 - 5 cm . in certain embodiments of the present invention , the lower load strap 116 may be formed having a central surface area defined by an outer bell - shaped configuration and opposing rounded ends being disposed so as to engage an exterior portion of the lower section 112 c of the surface area of the central body portion 112 of the shoulder support apparatus 110 . the width of the lower load strap 116 extending between the rounded opposing ends maybe measured between about 14 - 16 cm . the longitudinal length extending between the lower section 112 c of the surface area of the central body portion 112 and the corresponding outer peripheral edge of the lower load strap 116 may be measured between about 2 - 5 cm . the first extending member 118 of the adhesive support member 110 of the present invention may be formed contiguous a portion of the surface area of the middle section 112 a of the central body portion 112 and extend outwardly therefrom . in design , the first extending member 118 may comprise a shaft section 118 a that protrudes from its engagement with the middle section 112 a , wherein the shaft 118 a includes opposing sides that extend outwardly and form a rounded head portion 118 b attached thereto . in certain embodiments , the shaft section 118 a and the rounded head portion 118 b provide a contact surface area of the first extending member 118 for engagement with a portion of the user &# 39 ; s body to which the adhesive support member 110 is selectively applied . in certain embodiments , the shaft section 118 a may comprise a longitudinal length measured between about 1 - 3 cm and a width measured between about 2 - 4 cm . correspondingly , the head portion 118 b of the first extending member 118 may be formed having a longitudinal length measured from each rounded opposing end between about 5 - 8 cm and a width measured between about 2 - 4 cm . similar in configuration , the second opposing extending member 120 of the adhesive support member 110 of the present invention may be formed contiguous a portion of the surface area of the middle section 112 a of the central body portion 112 and extend outwardly therefrom . in design , the second extending member 120 may comprise a shaft section 120 a that protrudes from its engagement with the middle section 112 a , wherein the shaft 120 a includes opposing parallel sides that extend outwardly and form a rounded head portion 120 b attached thereto . in certain embodiments , the shaft section 120 a and the rounded head portion 120 b provide a contact surface area of the second extending member 120 for engagement with a portion of the user &# 39 ; s body to which the adhesive support member 110 may be selectively applied . the shaft section 120 a may comprise a longitudinal length measured between about 1 - 3 cm and a width measured between about 2 - 4 cm . correspondingly , the head portion 120 b of the second extending member 120 may be formed having a longitudinal length measured from each rounded opposing end between about 5 - 8 cm and a width measured between about 2 - 4 cm . although not required , certain embodiments of the middle section 112 a of the central body portion 112 of the adhesive shoulder support apparatus 110 of the present invention may comprise a plurality of openings 138 formed therein . the function of the openings 138 that may be formed in the central body portion 112 of the adhesive support apparatus 110 of the present invention is to aid in providing a form of ventilation and breathability to the underlying contact area of the shoulder area and deltoid of the user . disposed within the surface area of the upper section 112 b of the central body portion 112 may be a number of openings 138 . the openings 138 are generally formed in a spaced - apart relationship to each other . in certain embodiments , elongated openings 138 a - d may be formed in the central body portion 112 of the shoulder support apparatus 110 . the elongated openings 138 a of one embodiment of the present invention may be designed having an elongated longitudinal length that extends between first and second opposing ends , wherein at least a portion of the elongated length comprises a substantially rectangular configuration . the second opposing ends of the elongated openings 138 a may be formed having a rounded head portion positioned adjacent the upper load strap 114 . in one embodiment of the present invention , the elongated openings 138 a are disposed in the surface area of the upper section 112 b of the central body portion 112 on the sides adjacent the first and second extending members 114 , 116 , respectively . additionally , the elongated openings 138 a may be formed having a longitudinal length measured between about 6 - 8 cm and a width measured between about 0 . 5 - 1 . 5 cm . the surface area of the upper section 112 b of the central body portion 112 may further comprise elongated openings 138 b designed with a slightly longer longitudinal length in comparison to the length of the openings 138 a . the longitudinal length of the elongated openings 138 b extend between first and second opposing ends , wherein at least a portion of the elongated length comprises a substantially rectangular configuration and wherein the respective second opposing ends include a rounded head portion disposed adjacent the upper load strap 114 . in one embodiment of the present invention , the elongated openings 138 b may be disposed in the surface area of the upper section 112 b of the central body portion 112 adjacent each another , while each being disposed adjacent an elongated opening 138 a , respectively . the elongated openings 138 b may be formed having a longitudinal length measured between about 6 - 8 cm and a width measured between about 0 . 5 - 1 . 5 cm . additionally , the surface area of the lower section 112 c of the central body portion 112 may comprise elongated openings 138 c . the longitudinal length of the elongated openings 138 c extends between first and second opposing ends , wherein at least a portion of the length comprises a substantially rectangular configuration and wherein the respective second opposing ends include a rounded head portion disposed adjacent the lower load strap 116 . two ( 2 ) elongated openings 138 c may be arranged in the surface area of the lower section 112 c of the central body portion 112 of the adhesive shoulder apparatus 110 . in one embodiment of the present invention , the elongated openings 138 c are disposed in the surface area of the lower section 112 c of the central body portion 112 on the sides adjacent the first and second extending members 114 , 116 , respectively . in certain embodiments , the elongated openings 138 c may be formed having a longitudinal length measured between about 6 - 8 cm and a width measured between about 0 . 5 - 1 . 5 cm . the upper peripheral edges of the elongated openings 138 c formed in the surface area of the lower section 112 c of the central body portion 112 may be disposed between about 2 - 4 cm from the lower respective edges of the corresponding openings 138 b formed in the upper section 112 b . further , the central body portion 112 may comprise additional elongated openings 138 d designed having a longitudinal length that may be slightly larger than the length of the elongated openings 138 c . the elongated openings 138 d of one embodiment of the present invention may be designed having a longitudinal length that extends between first and second opposing ends , wherein at least a portion of the length comprises a substantially rectangular configuration and wherein the second opposing ends include a rounded head portion disposed adjacent the lower load strap 116 . two ( 2 ) elongated openings 138 d may be arranged in the surface area of the lower section 112 c of the central body portion 112 of the adhesive shoulder apparatus 110 . in one embodiment of the present invention , the elongated openings 138 d are disposed in the surface area of the lower section 112 c of the central body portion 112 on the sides adjacent the first and second extending members 114 , 116 , respectively . additionally , the elongated openings 138 b may be formed having a longitudinal length measured between about 6 - 8 cm and a width measured between about 0 . 5 - 1 . 5 cm . in certain embodiments , the upper peripheral edges of the elongated openings 138 d formed in the surface area of the lower section 112 c of the central body portion 112 may be disposed between about 2 - 4 cm from the lower edges of the corresponding openings 138 a formed in the upper section 112 b . in certain embodiments , the longitudinal length and width of the elongated openings 138 c , 138 d , respectively , formed in the lower section 112 c of the central body portion 112 of the adhesive shoulder support apparatus 110 may be identical . accordingly , the dimensional size and shape of the openings 138 that may be formed in the central body portion 112 of the shoulder support apparatus 110 are merely exemplary of certain embodiments of the present invention and are not intended to be restrictive or limiting in construction . as best illustrated in fig5 , the adhesive shoulder support apparatus 10 in accordance with the present invention may be formed of a resilient material 22 having the physical characteristics of being stretchable , breathable and waterproof in certain embodiments , the resilient material 22 may be comprised of neoprene ( wetsuit material ) and a highly elastic fabric , such as lycra ®, spandex ® or elastane , attached to one side . one benefit of the combination of neoprene and highly elastic fabrics or synthetic fibers is that it provides strength and durable elasticity to the shoulder support apparatus 10 , while being able to be stretched under tension and then return to its original shape . the physical characteristics of the resilient material 22 of the present invention may further provide thermal warmth and breathability to the underlying skin of the user to which the shoulder support apparatus 10 is applied . in one embodiment , the resilient material 22 may be formed having a thickness of between about 58 - 60 mils together with a medical grade acrylic pressure sensitive adhesive backing 30 having a thickness of between about 1 . 5 - 3 mils . ** it is appreciated that the relative thickness of the resilient material 22 and its adhesive backing 30 , respectively , as provided herein is not intended to be a limitation or dimensional restriction , but rather as exemplary of one embodiment of the present invention of the adhesive shoulder support apparatus 10 . in certain embodiments , the resilient material 22 comprising the adhesive shoulder support apparatus 10 includes an exterior surface 24 a , being substantially smooth , and an interior surface 24 b . the interior surface 24 b of the resilient material 22 comprises a surface area that engages an adhesive backing 30 . the adhesive backing 30 may be formed having a first adhesive side 32 a that engages the interior surface 24 b of the resilient material 22 and a second opposing adhesive side 32 b . when the adhesive shoulder apparatus 10 of the present invention is not applied to the shoulder and deltoid area of a user , the second side 32 b of the adhesive backing 30 may include a peel - off backing 37 that can be selectively removed . when applying the adhesive shoulder apparatus 10 of the present invention , the second side 32 b of the adhesive backing 30 may be removed in pre - cut sections , as defined by the pre - cuts 39 a , 39 b , as illustrated in fig2 or as a single piece as illustrated in fig6 . with reference to fig2 , the defined pre - cuts 39 a , 39 b that may be formed in the peel - off backing 37 of one embodiment of the present invention produce four ( 4 ) sectional pieces that can each be removed independent of the other . according to certain methods for applying the adhesive shoulder support apparatus 10 to the desired shoulder area of the user , the sectional piece of the peel - off backing 37 that selectively covers the second side 32 b of the adhesive backing 30 extending between the midsection 13 of the central body portion 12 and the upper load strap 14 may be removed and an upper portion thereof applied to an area of the shoulder 40 contiguous the acromion , as best shown in fig3 . the sectional piece of the peel - off backing 37 that selectively covers the second side 32 b of the adhesive backing 30 extending between the midsection 13 of the central body portion 12 and the lower load strap 16 may then be removed and applied from the point of contact at the area of the shoulder 40 with a stretch load or tension applied to the central body portion 12 of the shoulder support apparatus 10 that extends down to the application of the lower load strap 16 to the portion of surface area of the deltoid 50 . due to the flexible characteristics of the shoulder support apparatus 10 , the stretch load or tension applied to the central body portion 12 of the shoulder support apparatus 10 between the upper load strap 14 and the lower load strap 16 may comprise an extended longitudinal length of between about 0 . 5 - 1 . 5 cm . in an effort to maintain the rotator cuff and the tendons in alignment in order to assist in providing stability to the shoulder , the central body portion 12 of the shoulder support apparatus 10 may have its longitudinal length stretched upon its application between the upper load strap 14 and the lower load strap 16 , along . lines ab as shown in fig1 , thus providing a load tension sufficient to simulate an auxiliary muscle . additionally , the pre - cut sectional pieces of the pre - cut backing 37 which selectively covers the second side 32 b of the adhesive backing 30 that extends over the first and second opposing extending members 18 , 20 may be removed so that the second adhesive side 32 b can be applied to the underlying skin of the user in sufficient tension to provide linear stabilization to the respective positioning of the adhesive support apparatus 10 . turning now to fig7 , the second side 32 b of the adhesive backing 30 may be formed to include a plurality of recessed grooves 34 and raised adhesive contact nodules 36 . in certain embodiments of the present invention , the recessed grooves 34 and the adhesive contact nodules 36 may be formed in a patterned array or configuration . functionally , the patterned array or configuration of the recessed grooves 34 and the raised contact nodules 36 of the second side 32 b may provide elasticity to the adhesive backing 30 sufficient to accommodate the stretchability of the central body portion 12 of the adhesive shoulder support apparatus 10 . the respective height of the raised contact nodules 36 may be sufficient to allow air to flow between the underlying skin of the user and the recessed grooves 34 formed in the second side 32 b of the adhesive backing 30 . correspondingly , the plurality of raised contact nodules 36 are formed and positioned in such a manner so as to provide numerous contact sites between the second side 32 b of the adhesive backing 30 and the underlying surface of the skin of the user . in this regard , the second side 32 b of the adhesive backing 30 exhibits a strong initial bond producing high tack and peel properties to the adhesive shoulder support apparatus of the present invention . as appreciated , the adhesive shoulder support apparatus 10 , 110 may be manufactured in sizes sufficient to extend between a portion of the shoulder and deltoid area of the user . as found in most upper body clothing articles , the shoulder support apparatus 10 , 100 may be manufactured in various sizes , including small , medium , large , extra - large and xxl . it is further appreciated that the measurements provided herein are merely exemplary of certain embodiments of the present invention and are not intended to be interpreted as limiting , in relation to the overall dimensions of the adhesive shoulder support apparatus 10 , 110 . additionally , the adhesive shoulder support apparatus 10 , 110 may be produced in various colors , such as , for example , black , navy , pink , white , green , yellow , red or combinations / variations thereof , just to name a few of the available color options . furthermore , the shoulder support apparatus 10 , 110 of the present invention , if desired , may come with a company design / logo or the name or logo of a college or professional sports team being displayed on the exterior surface 24 a of the resilient member 22 . the present invention may be embodied in other specific forms without departing from its fundamental functions or essential characteristics . the described embodiments are to be considered in all respects only as illustrative , and not restrictive . all changes which come within the meaning and range of equivalency of the illustrative embodiments are to be embraced within their scope . | 0 |
the device of the invention comprises a base or platform . the base can be any size and shape that can stably support a human foot of a person in a sitting position . while the size and shape is not limited , in general the base will be generally rectangular , with a width of about 10 cm to about 25 . 4 cm ( about 4 - 10 inches ) and a length of about 20 cm to about 92 cm ( about 8 - 16 inches ). however , it is to be understood that any size and shape can be used , including , but not limited to square , triangle , round , or a complex shape , such as the shape of a human foot . the base comprises a solid material that is sufficient strong to support a foot of a person in a sitting position . the solid material is not particularly limited , and can be , for example , a piece of wood , plastic , metal , or similar material , or a combination thereof . the base comprises a top or upper surface and a lower surface . the upper surface can be of the same material as the core of the base , or can be made of a different material . in one exemplary embodiment of the invention , the base is designed with a no slip top surface so the patient &# 39 ; s foot does not slip off . for example , the top surface of the base can include a non - slip mat of rubber , plastic vinyl , carpet , or other non - slip covering . in some embodiments where the top surface includes a material that is different than the core of the base , the top surface is easily removable , for example for replacement or cleaning . the lower surface of the base is not particularly limited in composition , and is typically made of the same material as the core of the base . the lower surface serves as a connection point for the rolling means . the rolling means is attached to the lower surface by way of any common fastener , such as , but not limited to , screws , nails , staples , and adhesive . the rolling means is any structure that is suitable for allowing the device as a whole to move with relation to the ground , but only in two directions ( i . e ., forward and backward ). the rolling means can be any of the various known objects that are suitable for attaching to other objects to enable the objects to roll . non - limiting examples of rolling means include wheels , rollers , casters , bearings , and the like . the device of the invention includes at least one rolling means , which can be a single individual rolling object or a combination of two or more rolling objects together in a single housing to form a unit . for example , a rolling means can be configured as a unit of two or more wheels in the fashion of an in - line skate . alternatively , a rolling means can be configured as multiple wheels in a side - by - side alignment across the width of the platform . regardless of the configuration chosen , it is preferred that the rolling means are configured in a way that limits side - to - side rocking of the platform , so as to limit stretching and twisting of the knee of the patient . in exemplary embodiments , the base is attached with two or more wheels mounted on the bottom surface . the wheels are fixed in their orientation such that only front / back motion is possible for the base . turning now to the figures , with reference to fig1 - 2 , there is in accordance with this invention a knee mobility therapy apparatus 5 for use by a patient ( not shown ) sitting with his foot ( not shown ) placed upon the top surface 2 of the device . the apparatus includes a base 1 that is made to only move in the forward / backwards direction by way of locking or otherwise adjusting the wheels 3 such a way as to limit the degrees of motion to only two directions — forward and backward , so as to not damage the knee joint of the patient while the device is in use . the base may include a built in non - slip surface , such as built in groves or bumps , so that the patient &# 39 ; s foot may stay securely on the platform . for example , the base may include a foot mount for the patient to firmly attach the patient &# 39 ; s foot to the base . any of a number of foot mount designs can be used , including , but not limited to , a strap . the present invention has been described with reference to the appended drawings and such description is for illustrative purposes only . the invention is not intended to be limited by the preferred embodiments illustrated in the drawings . those skilled in the art will appreciate that the scope of the invention extends to other comparable embodiments . | 0 |
the most important cost metrics for assessing the suitability of renewable energy systems for generating electric power are $/ installed kw and cents / kwh . both factors are a function of many parameters that range from cost for real estate to hourly wages for maintenance crews . these metrics are also related to the technology used . the technology used in this invention tends to minimize capital and labor - related installation costs as described in the summary . the low environmental impact and the serendipitous linking of advertising revenue for the wind energy versions are other factors which relate to the feasibility of an installation . the operations and maintenance ( o & amp ; m ) side of the equation is more questionable especially for the wind versions using buoyant elements . however , materials advances point to favorable outcomes . nasa &# 39 ; s ultra long duration balloon ( uldb ) project describes a multi - layer composite balloon material known as dp6611 . 25 / pe which can have application to the airfoils and aerostats of this invention . it is a very light weight durable low - permeability fabric with the potential for extending preventive maintenance schedules to attractive intervals . it is a five layer composite with a polyester woven fabric load bearing layer , a 0 . 25 mil mylar film fabric stability / barrier layer , a 0 . 25 mil pe film for toughness / tear resistance / back up barrier , and two adhesive layers . the inventor has personal experience with drogue chutes for the water versions of this invention . experiments using a heavy fabric parachute style drogue chute which can be placed in a low - pull mode by pulling on a center “ dump cord ” ( which causes the chute to fold down into a low crossection profile perpendicular to flow ) showed promise . the ratio of high to low pull at usable river flow velocities were 4 : 1 or greater . the inventor also has personal experience with parasail type airfoils of nylon ripstop construction using attached weather balloons as buoyant elements . these also had acceptable high - pull to low - pull ratios although the lift was limited ; however aerodynamic drag can be used effectively as an surrogate parameter . a variety of airfoil shapes are described in the drawings of this invention . an exhaustive performance comparison or airfoil design for this application has not as yet been performed ; the shapes described are presumed to be sub - optimal . fig1 shows a side view of a water power concept to extract energy from water current 1 using a single drogue chute 4 which is alternately placed in a high pull mode as shown by mode adjuster 6 to pull on tether 5 unwinding from reversing power drum 2 and providing useful torque on shaft 3 . the adjacent low - pull configuration shown attached to a dashed tether 5 is achieved by shortening dump cord 7 . in this configuration , drogue chute 4 is rewound onto power drum 2 . a similar wind system version is shown in fig2 wherein bridle lines 14 are shortened by adjuster 13 to achieve the low - pull configuration shown at the right . on the left , wind from direction 10 is used to provide lift on high - pull configured buoyant airfoil 15 to unwind tether 12 from reversing power drum 13 . tethers 5 and 12 are wound onto and the ends attached to their respective power drums 2 and 11 . fig3 and 4 show two conceptual versions for dual flow engaging elements . the water version of fig3 shows a two section power drum 20 on which tethers 21 and 22 are wound in reverse directions such that when tether 22 is unwinding as shown , tether 21 pulling low - pull configured chute 4 is being pulled back by winding onto drum 20 . similar action is illustrated for a two airfoil wind system as shown in fig4 . power drum 28 within base equipment housing 29 rotates either clockwise or counter - clockwise ( as shown ) depending on the airfoil 15 modes at the instant . fig5 shows a mechanism to convert the reversing rotation of power drum 28 attached to shaft 36 to a unidirectional rotation of shaft 35 . while other known mechanisms using either belts or gears to achieve this purpose are known , the operating principles are similar . although only a mild step - up ratio of a single stage is shown from power drum 28 to generator 47 , in an actual transmission , additional stages would often be used . flywheel 46 is used to provide ride - through during mode switching at the ends of a stroke . gear set 37 and 39 drive shaft 35 at a higher speed than drum 28 but only when drum 28 is turning counter - clockwise . this is accomplished by having one - way clutch 37 decouple gear 37 from shaft 36 whenever it is turning clockwise . similarly , the pulley / belt drive at the distal end incorporating drive pulley 41 , timing belt 45 , and driven pulley 44 drive shaft 35 clockwise when shaft 36 is rotating clockwise ( no reversal ) at the same ratio as the gear set only when shaft 36 is rotating clockwise . this is accomplished by one - way clutch 40 which decouples pulley 41 from shaft 36 when it is turning counter - clockwise . power drum 28 is driven by either tether 26 or tether 27 when they are respectively unwinding from drum 28 . fig6 is an embodiment of an electrically operated mode switching mechanism of this invention for water use . this is the only illustrated embodiment requiring the use of tether 58 which has conductive traces embedded carrying current to operate drive motor 50 ( which is submersible ). motor 50 is an electrically reversible motor with two or more rotation resisting vanes 53 attached to the housing . it drives lead screw 51 in either direction . nut 52 with rotation resisting vanes 54 is urged either left or right depending on the direction of rotation of motor 50 . bridle terminator 56 is coupled via free rotation coupling 57 to the end of screw 51 . dump cord 7 is attached to nut 52 . in operation , brief periods of motor 50 operation in alternate directions select the opposite operating mode of attached drogue chute 4 . this mechanism can be used for either single drogue chute systems or for those using two since electrical synchronization can be used to simultaneously change the modes of both drogue chutes in different directions at the end of a stroke . fig7 shows a different embodiment of a mode changing mechanism which is continuously driven by water current . this embodiment is usable for single chute systems only since there is no means of synchronization . tether 65 which may be conductive or non - conductive is attached to reversing screw 68 via swivel coupling 66 . propeller 67 is rigidly attached to screw 68 and turns it continuously in the same direction as long as water current 10 is flowing . nut 69 with rotation resisting vanes 70 is continuously driven back and forth since the characteristic of a reversing screw is that a nut driven by one changes direction at the end of travel without a change of rotation direction . thus drogue chute 4 is continuously opened and closed at a constant rate for constant current 10 flow . a tension sensor on tether 65 can be used to trigger the rewind phase upon sensing a tension lower than a threshold set into the system ; the latter can be dynamically set as a function of current 10 velocity . fig8 is a side view in partial crossection of a complete system for extracting energy from moving water currents . in this embodiment , the system is mounted within and below a barge 80 which is moored by virtue of tether 80 and anchor 82 on the bottom 99 of the water channel . two drogue chutes 4 are used such that one is always placed in the mode opposite the other with modes synchronously switching at the extreme ends of a stroke . as tether 83 unwinds from reversing power drum 86 , tether 84 wound in the opposite direction is wound back on . outer shaft 85 drives pully 87 which is the power take - off point feeding power to transmission 94 which creates a high rpm unidirectional drive to generator 95 which feeds power conditioner 96 . the output from power conditioner 96 is utility grade power wheeled to shore via cable 98 . control box 97 feeds controlled pulses of current via slip rings 92 to braked motor 91 which drives planetary gearbox 90 driving inner concentric shaft 88 driving mode control drum 89 . since gearbox 90 with motor 91 atop is attached to pulley 87 , it rotates with power drum 86 . shaft 88 can change the length of each dump cord 7 relative to tether 83 or 84 . this is done synchronously every time motor 91 is energized for a short burst at the end of a stroke , then the chute 4 that was closed ( low - pull ) will open simultaneously with the formerly open chute 4 being closed by shortening cord 7 relative to tether 83 . motor 91 has a brake which resists rotation when motor 91 is not energized . in this manner , the lengths of dump cords 7 are dynamically moved with tethers 83 and 84 via drum 89 while maintaining their length differentials relative to tethers 83 and 84 . fig9 illustrates an embodiment for a water pumping system built with low - tech indigenous materials . it uses a single parasail type airfoil and no buoyant elements . this is the only embodiment of this invention that uses a tower . tower 105 is a light weight structure that operationally just has to survive direct wind load and to support airfoil 106 in periods of no wind . practically , it should also safely support the weight of a service person climbing it during initial installation or for maintenance or repair . reciprocating pump cylinder 111 and piston rod 112 constitute the well pump which is operated by long rod 110 ( a long bamboo pole would suffice ). pivot 109 locates and controls the motion of rod 110 . parasail 106 pulls power tether 107 up when parasail 106 is in its high lift / drag configuration as shown and wind is blowing . the rest of the system relates to a low - tech mechanism for mode switching ; a working model has been built . it consists of rod or tube 118 which can be a wooden dowel or a piece of pvc pipe ; its purpose is to guide two hollow elements which ride along it . top element 116 has springy grippers 117 which will grab onto the upper lip of dump cord 108 weight 114 . this hollow weight element 114 has a latch 115 which prevents it from falling due to gravity but can be easily overwhelmed by a medium pull as by top element 116 being lifted by tether 107 while being mated with weight 114 . dump cord 108 is of such length that it is slack at the top resting point of 114 as determined by the length of cord 113 which limits travel . in operation , assume that at the start of a cycle , both 114 and 116 are mated and at ground level . if wind is blowing , it will force airfoil 106 open and start lifting rod 110 , 114 and 116 . when 113 becomes taut , 114 stays at that level while 116 snaps off and continues up until cord 108 becomes taut releasing latch 115 at which point weight 114 falls , thereby closing airfoil 106 . airfoil 106 , distal end of rod 110 , 114 , and 116 all go down and 116 mates with 114 at ground level . the cycle has returned to its starting position . this reciprocating action continues as long as sufficiently strong wind blows ; it operates water pump 111 by this action . fig1 is a detail of another embodiment of a mode control mechanism for single airfoil systems . a model to demonstrate the operation of this mechanism has been built . it is shown in a system with a single non - buoyant airfoil 106 attached to a buoyant aerostat or balloon 144 which has enough buoyant lift to support airfoil 106 as well as mechanism 131 ( which is enlarged relative to 106 to show more detail ). frame 132 is attached to power tether 107 by swivel joint 143 . small wind turbine 134 turns worm gear 135 which is mated with spur gear 136 driving top timing belt pulley 137 . the timing belt which rides between driving pulley 137 and idler pulley 138 has a single nib 139 which goes up and down continuously at a slow rate determined by wind 10 velocity and the gear ratio between worm gear 135 and gear 136 . carrier 148 rides on rail 147 and is biased downward by spring 146 . as shown , it is latched at the top position by latch 140 . when nib 139 reaches latch trip 142 , trip cable 141 will release carrier 148 which is quickly pulled down by spring 146 . since dump cord 130 is attached to carrier 148 , airfoil 106 is closed . it stays closed until nib 139 works it way up engaging arm 149 lifting it toward the latched position and gradually opens airfoil 106 . thus the cycle is repeated . the percentage of on versus off time can be regulated by moving the location of trip point 142 anywhere along the path of nib 139 . tether 107 can be attached to a rod which drives a reciprocating pump as in fig9 . alternatively , tether 107 can be wound around a power drum during low - pull periods and unwound during high - pull periods . note that an advertising logo 145 or message can be emblazoned on aerostat 144 . fig1 shows a two airfoil system using buoyant airfoils . this embodiment is ideal for larger systems but may also be used on small capacity systems . a subsystem 162 adjacent to each airfoil , 160 shown in high lift configuration or 161 shown in a low lift configuration , is used to perform synchronized precision mode switching . as shown , airfoil 160 is lifting tether 171 which is unwinding from a reversing power drum within base equipment housing 168 . at the same time , tether 172 is being rewound on the same power drum thereby pulling down airfoil 161 through remote pulley 170 . the ground separation is used to minimize the chance of tangling of one airfoil around the other in case of exposure to brief cyclonic wind conditions . airfoils 160 and 161 are modeled on skydoc balloons available from big ideas corp . of syracuse , n . y . while probably not optimal , these omnidirectional designs have a fair amount of lift and can be easily placed in a stall position by manipulating the length of part of the bridle . they also have large unencumbered surfaces which are ideal for display of logo &# 39 ; s 174 or other advertising material . the subsystems consist of a bottom swivel coupling to tethers 171 or 172 , a small savonius rotor 165 , housing 175 containing several items , top swivel connector with slip rings 176 , tail shaft and receiver antenna 167 , anti - rotation tail 166 , short electric cable 177 and extendable electric actuator 163 . the items in housing 175 are a small dc generator for charging a storage device such as a large value capacitor and / or storage battery , a radio receiver for receiving mode switch signals , and driver circuitry for operating actuator 163 . note that the savonius rotor 165 adaptively generates more or less electric power as a function of wind velocity ; mode switching power demand ( number of switches per unit time ) is also a function of wind velocity . signals for precise mode change at the extreme ends of a stroke are perfectly synchronized by radio signals from transmitter 169 with antenna 173 attached to the side of housing 168 . note that for safety reasons ( lightning protection ) tethers 171 and 172 are not electrically conductive . subsystem 162 are small and light weight ; power is locally self - generated eliminating the need for long conductive elements . the electronics for subsystems 162 have been proven in hundreds of applications such as industrial controls and radio - controlled model airplanes and cars . in the foregoing description , certain terms and visual depictions are used to illustrate the preferred embodiment . however , no unnecessary limitations are to be construed by the terms used or illustrations depicted , beyond what is shown in the prior art , since the terms and illustrations are exemplary only , and are not meant to limit the scope of the present invention . it is further known that other modifications may be made to the present invention , without departing the scope of the invention , as noted in the appended claims . | 5 |
aside from the preferred embodiment or embodiments disclosed below , this invention is capable of other embodiments and of being practiced or being carried out in various ways . thus , it is to be understood that the invention is not limited in its application to the details of construction and the arrangements of components set forth in the following description or illustrated in the drawings . if only one embodiment is described herein , the claims hereof are not to be limited to that embodiment . moreover , the claims hereof are not to be read restrictively unless there is clear and convincing evidence manifesting a certain exclusion , restriction , or disclaimer . fig1 shows an example of a portion of a pressure transducer in accordance with the subject invention . substrate 10 a ( typically silicon ) includes surface 12 a with annular groove 14 a therein defining diaphragm 18 a . typically , channels 16 a - 16 c cross diaphragm 18 a . channel 16 d is shown intercepting channels 16 a - 16 c and also shown are channels 16 e - 16 j in frame portion 20 a . these channels house resonator structure 22 suspended in the channels as shown . one or more anchor structures as shown at 25 may be provided . fig2 shows a portion of substrate 10 a without the resonator structure . in fig2 , it can be seen that the surface opposite surface 12 a in the substrate includes annular grooves 30 a and 32 a , one on each side of annular groove 14 a in surface 12 a . diaphragm overload stop 40 a is also shown disposed adjacent diaphragm 18 a as shown . there is a small gap between diaphragm 18 a and stop 40 a . two such structures joined together are shown in fig3 . substrate 10 b also includes annular groove 14 b and opposite side annular grooves 30 b and 32 b define diaphragm 18 b . resonator structure 22 resides between diaphragm 18 a and 18 b and may be insulated therefrom via layers of oxide as shown at 150 a and 150 b . diaphragm overload stop structures 40 a and 40 b are also shown in fig3 . such a structure may made by bonding two silicon wafers together which are etched so that a sealed cavity is formed between them as discussed above . this cavity is then evacuated and contains a sensing resonator . the resonator structure may vary in design from that shown in fig1 . the preferred geometry is designed so that the evacuated cavity can withstand a full line pressure , in one particular example , 300 bar on both sides . also , the resonator is coupled to the diaphragm so that a reasonable change of frequency , in one example 20 %, results from a differential pressure of 1 bar . the diaphragms are able to withstand the full line pressure on one side with the provision of the stops at a spacing such as 10 microns from the diaphragm . the flexibility to measure differential pressure results from the system of grooves 14 , 30 , and 32 with an overall racetrack shape , i . e . semicircular ends with a short straight section in between . the resonator can be a variation of the lever of the design shown in european patent no . 1 273 896 , incorporated herein by this reference . one resonator structure 22 typically includes two central tynes 50 a and 50 b , fig1 which form a basic double - ended - tuning - fork which is put into tension by the applied differential . the outer tynes 52 a and 52 b would have a comb drive , not shown , along most of their length . at the ends of the outer tynes there may be sensing levers and a link between the two halves that provides the coupling necessary to differentiate between the in - phase and out - of - phase modes . the remainder of the resonator layers are not shown in the drawings . fig4 shows how the “ tongue ” portion 61 is twisted to give a sideways displacement to the end of a resonator tyne . fig4 shows the deformation caused by the static pressure applied to one side only . most of the stress is compressive for which silicon is very strong . the maximum tensile stress is about 3000 microstrain . the dimensions of the grooves 14 , 30 , and 32 were optimized using a model . in one example , they were 200 microns wide and the wall thickness was 45 microns . the grooves can be formed by a deep reactive ion etching a slot 20 microns wide and then opening the slot by an isotropic etching process . an acid ( hf — hno 3 - acetic ) mixture could be used but the more precise gaseous xef 2 etching technology is preferred . the design of the diaphragm of this invention has the feature that the flexible part 61 is intrinsically strong enough to withstand the full line pressure because it has to support the contained vacuum . this means that stop 40 a need act only on the non - flexing central area 60 a . other sensing means can be used with a diaphragm of this design besides the resonator structure discussed above . one resonator is essentially a stretched string of silicon . this structure could be used instead as a strain gauge by passing a current along it and measuring the change of resistance . also , as shown in fig5 , capacitive sensing could be achieved by replacing the resonator with flat plate 70 suspended around the edges so that it stays in the same position when the diaphragm moves . it extends through a cavity in the central solid region of the diaphragm . the gap between the surface of the plate and the bottom of the cavity is small and changes with diaphragm deflection thus changing the capacitance . the cavity may have an array of props between the two halves of the diaphragm extending through apertures in the plate to support the line pressure . note that the flexible regions 72 a and 72 b are vertical walls which are in overall compression . silicon , like most brittle materials , is considerably stronger in compression . this geometry enables the designer to achieve the sufficient strength combined with the sufficient compliance . note that the wall thickness could be defined by a boron etch stop . only one overload stop is shown at 74 in fig5 . also shown is variable capacitor gaps 80 , oxide insulation layer 82 , support pillar 84 , and aperture 86 in fixed capacitor plate 70 . when an over pressure event occurs , the surface of a diaphragm may be pressed hard against the stop and may stick to the stop . normally , silicon surfaces are optically flat and prone to forming bonds that are typified by bringing optically flat surfaces together . there may be weak chemical bonds forming in which case the diaphragm could stay stuck to the stop or the flow of the pressure medium into the very small gap is slowed by the viscosity effects . thus , it preferred in accordance with the subject invention that either the surface of the stops 40 , fig3 and / or the surface of diaphragms 18 be made rough . there can be a system of grooves in either the stops or the diaphragms , for example , to conduct the pressure medium into the gap . in still another example , the diaphragms and / or the stops could be coated with layers that are not prone to sticking . suitable coatings include , silicon nitride , titanium oxide , and diamond - like carbon which are known to be particularly good for chemical inertness and hardness . the result in any embodiment is a more robust pressure sensor operable in high pressure environments with better resolution and enhanced stability . although specific features of the invention are shown in some drawings and not in others , this is for convenience only as each feature may be combined with any or all of the other features in accordance with the invention . the words “ including ”, “ comprising ”, “ having ”, and “ with ” as used herein are to be interpreted broadly and comprehensively and are not limited to any physical interconnection . moreover , any embodiments disclosed in the subject application are not to be taken as the only possible embodiments . other embodiments will occur to those skilled in the art and are within the following claims . in addition , any amendment presented during the prosecution of the patent application for this patent is not a disclaimer of any claim element presented in the application as filed : those skilled in the art cannot reasonably be expected to draft a claim that would literally encompass all possible equivalents , many equivalents will be unforeseeable at the time of the amendment and are beyond a fair interpretation of what is to be surrendered ( if anything ), the rationale underlying the amendment may bear no more than a tangential relation to many equivalents , and / or there are many other reasons the applicant can not be expected to describe certain insubstantial substitutes for any claim element amended . | 6 |
in fig1 a is shown a semiconductor substrate 10 with an ion implanted well 11 . before implanting the well , an isolation ( field oxidation or shallow trench ) is formed for the peripheral circuits of the memory chip . the well is ion implanted to establish the intrinsic voltage threshold of the well . on top of the substrate is a layer of oxide 12 formed after the well 11 is implanted into the substrate . a layer of polysilicon is deposited on the surface of the substrate and on top of the polysilicon an oxide layer is deposited . the oxide layer and the polysilicon are masked and etched leaving a plurality of floating gate structures over the well comprising of a layer of polysilicon 13 over which is a thick layer of oxide 14 . in fig1 b is shown a layer of material 15 , made from a dielectric ( oxide , a nitride , polysilicon or similar material ) and used to form a disposable spacer 16 ( shown in fig1 c ) on the side walls of the floating gate structures 13 14 . the thickness of the floating gate structure 13 14 provides a spacer size to create an offset that becomes the select channel length under the control gate of the split gate transistor that is being formed . in fig1 c is shown the disposable sidewall spacers 16 that were formed on the walls of the floating gate structure 13 14 . using the floating gate structure 13 14 with the sidewalls 16 as a mask drain region 19 and source region 18 are ion implanted 17 into the substrate 10 . a layer of photoresist 20 is applied , and an area over the source regions 18 and a portion of the floating gate structures 13 14 is masked and photo resist removed 21 , as shown in fig1 d . the exposed sidewall spacers adjacent to the implanted source 18 within the opening in the photo resist are removed leaving the spacers 16 on the drain 19 side of the floating gate stack 13 14 . in fig1 e once the sidewall spacers within the opening 21 in the photoresist 20 have been removed , a double diffused source 22 is ion implanted 22 and going deep into the substrate 10 . the source 18 is then again ion implanted 22 to fill the region 23 under the location of the removed sidewall spacers . this brings the source 18 up to the proximity of the floating gate 13 . after the ion implantation 22 the photoresist 20 is stripped from the substrate 10 . isolation oxide 24 is grown over the drain 19 and source 18 23 regions . as shown in fig1 f . continuing to refer to fig1 f , the sidewall spacer 16 on the drain side on the floating gate structure 13 14 retards oxidation at the sidewall of the floating gate 13 . the disposable sidewall spacers 16 are removed from the drain 19 side of the floating gate structure 13 14 , and inter - polysilicon dielectric 25 is grown to a thickness of approximately about 150 angstroms on the side of the polysilicon floating gate 13 . the second layer 26 of polysilicon is deposited on the surface of the substrate 10 . the second layer 26 of polysilicon is masked and etched to form control gates of the memory cells and at the same time wordlines in a continuous integral combination extending across rows of the memory . the inter - polysilicon dielectric 25 provides a tunneling path between the floating gate 13 and the control gate 26 . the thickness of the dielectric 14 of the floating gate structure 13 14 provides a low coupling between the control gate 26 and the floating gate 13 . this low coupling produces a significant voltage drop across the inter - polysilicon dielectric 25 allowing a rapid charge transfer from the floating gate 13 to the control gate during a fowler - nordheim erase . in fig2 a is shown a four column by three row section of a flash memory using split gate flash memory cells biased for programming . alternate vertical lines are source lines ( sl ) and bit lines ( bl ), each connecting to two adjacent columns where the bit lines connect the drains of the cells in the columns to a sense amplifiers which is not shown . the horizontal lines are wordlines ( wl ) which connect to the control ( select ) gates of each cell in a row of cells . the voltages necessary to program a cell are shown on the opposite end of each line from its letter designation . continuing to refer to fig2 a , a vertical page 40 is shown as a dashed line outline . contained within the vertical page 40 is a split gate flash memory cell 41 to be programmed and outlined as a dashed circle . the split gate flash memory cell 41 transistor has a portion of its channel under a stacked gate configuration where the control gate and the floating gate are stacked together and is called the “ memory transistor ”. the other portion of the channel of the spit gate flash memory cell 41 transistor is below only the control gate and is called “ the select transistor ”. the sl connected to the source of the cell 41 to be programmed is set to a high voltage of approximately about 12v , and the bl connected to the drain of cell 41 is set to 0v . the wl connected to the control gate of the cell 41 to be programmed is set to a value which is approximately equal to the threshold voltage vt of the select transistor of the spit gate flash memory cell . the column to the left of the column containing cell 41 is part of the vertical page 40 , and the bit line connected to the drains of this column is set to the reference voltage , vdd , which is high enough in value to cut off the selector transistor of split gate flash memory cells in this column on the left side of the vertical page . the remaining bit lines ( bl ), source lines ( sl ) and wordlines ( wl ) are connected to 0v to prevent conduction in cells to which they are connected when a cell in these other columns is connected to the wordline voltage vt . continuing to refer to fig2 a , the cell to be programmed 41 is in its un - programmed state has a floating gate threshold that is positive and is non - conducting with the wordline at a reference voltage during a read cycle . during programming the control gate which is connected to the wordline wl is set to a voltage that is approximately equal to the threshold voltage vt . this transfers the drain voltage 0v from the bit line bl across the select transistor portion of the split gate memory cell . a high voltage having a preferred value of approximately about 12v with a minimum value of approximately about 6v , and a maximum value of approximately about 18v is connected to the source of cell 41 causes a voltage differential that generated hot electrons in the channel of the memory cell 41 being programmed . the field between the channel and the floating gate transfers hot electrons from the channel to the floating gate . the programming process is self limiting as electrons accumulate on the floating gate and the channel current is low allowing a charge pump to be used to generate the high source voltage . for multilevel cells ( mlc ) the source bias is ramped from approximately about 6v to approximately about 14v . the wl of the target cell to be programmed 41 is set to vt . once the target cell 41 voltage threshold has been reached , the wl connected to the gate of the target cell 41 is set to 0v , stopping programming . in fig2 b is shown the same four by three matrix of a flash memory that is conditioned by voltages to perform an erase by inducing fowler - nordheim tunneling between the control gate connected to a wl and the floating gate . as can be seen from fig2 b all bl , sl and wl are connected to 0v except the two wordlines connected to a high voltage with a preferred value of approximately about 14v , a minimum value of approximately about 8v , and a maximum value of approximately about 20v . a horizontal page ( block ) 43 is shown outlined in fig2 a containing two rows of flash memory cells . with the voltage conditions shown , the two rows with the wordlines biased to approximately about 14v will be erased . fewer rows or more rows can be erased at once depending on how many wordlines are biased to approximately about 14v . continuing to refer to fig2 b , the sources connected to sl and the drains connected to bl are grounded and the control gates connected to wordlines of the cells to be erased are at a high voltage . the floating gate polysilicon oxidation process provides a high field enhanced tunnel injector to the control gate along the edges of the floating gate to promote fowler - nordheim tunneling . this repeatable manufacturing process produces a consistent oxide integrity and minimizes endurance induced degradation . the thickness of the dielectric on top of the floating gate produces a low coupling to the control gate which in turn promotes a high voltage drop across the inter - polysilicon oxidation with the field generated primarily along the edges of the floating gate . in fig2 c is shown the conditions to read a memory cell 44 . the sl connected to the cell to be read 44 is set to 0v and the bl connected to the drain of the cell to be read is at a preferred value of approximately about 1v with a maximum value of approximately about 5v and a minimum value of approximately about 0 . 5v . all other bit lines bl and source lines sl are set at approximately about 1v . the wl connected to the cell to be programmed 44 is biased to vcc and all other wordlines wl are biased to 0v . if the floating gate of the memory cell being read 44 has not been programmed , the split gate flash memory cell will conduct and current will flow through the sense amplifier indicating a logical one . if the floating gate of the memory cell being read 44 has been programmed , the split gate flash memory cell will not conduct and no current will flow through the sense amplifier indicating a logical zero . continuing to refer to fig2 c , two columns share a common source line , and if the source line is biased at 0v and a word line is biased at vcc , then one of the two cells 44 is read by a sense amplifier if cell 44 is selected to be connected to a sense amplifier . the other cell sharing the same word line and source line is not connected to a sense amplifier and is not read even though the bias conditions are such to permit a read operation . this capability unlike a traditional design is a result of the flash memory array being a virtual ground configuration . in fig3 a is shown an alternative orientation of the split gate flash memory cell as compared to the orientation shown in fig2 a , 2 b and 2 c . in fig3 a the wordlines are horizontal and the bit lines and source lines are vertical allowing vertical pages for programming and horizontal pages / blocks for erasing . the split gate cells 50 , 51 , 52 , 53 in each column have the same orientation such that stacked gate portion of a cell 50 is connected to a bit line bl and the select / control portion of the channel of the cell 50 is connected to a source line sl . in the adjacent column the stacked gate portion of the channel of the cell 51 is connected to a source line sl with the bit line bl connected to the select / control gate portion of the channel . cell 52 and the cells in the column within which it is a member has a similar orientation and connection as cell 50 and cell 53 and the cells in the column within which it is a member is oriented and connected similar to cell 51 . in fig3 b is shown another possible orientation of the split gate flash memory cells that is the opposite of that shown in fig2 a , 2 b , and 2 c . in fig3 b the stacked gate portion of the channel of each cell are connected to a bit line bl , and the select / control portion of the channel of each cell is connected to a source line sl . the orientation of the cells in each column and between columns are such that wordlines are horizontal and the bit lines and source lines are vertical allowing vertical pages for programming and horizontal pages / blocks for erasing . in fig4 is shown typical voltages for programming , erasing and reading the cells in fig3 a and 3 b . to program a cell the wordline connected to the cell is set to vt or ground ( gnd ), the bit line is grounded ( gnd ) and the source line connected to the cell is supplied with approximately about 12v . to erase a cell the wordline connected to the cell is set to approximately about 14v with the bit line and source line connected to the cell to be erased each connected to ground ( gnd ). to read a cell the wordline connected to a cell is set to vcc , the bit line connected to the cell is set to approximately about 1v and the source line id grounded ( gnd ). the voltages in fig4 are the same as shown in fig2 a , 2 b and 2 c . the other bl , sl and wl voltages necessary to inhibit the cells not being programmed are the same as shown in fig2 a . the other bl , sl and wl voltages necessary to inhibit the cells not being erased are the same as shown in fig2 b , and the other bl , sl and wl voltages necessary to inhibit the cells not being read are the same as shown in fig2 a . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the invention . | 6 |
referring to the drawings , fig1 shows gas generation apparatus such as hydrogen generation apparatus in which water is exposed to a potential difference in an electrolysis cell . the discussion that follows will be restricted to this application , although the apparatus of the invention can be used with other liquids to generate other gases . the gas generation apparatus comprises a reservoir 2 for the water which is to be treated . water is discharged from the reservoir 2 through an outlet 4 . the outlet has a conductivity sensor 6 mounted in it by which the presence of impurities in water from the reservoir can be detected . in the event that impurities are detected , by an increase in conductivity above a predetermined level , the power supply to the electrolysis cell can be interrupted . water from the reservoir is pumped by means of a pump 8 through an electrolysis cell 10 which contains an anode , a cathode and a solid polymeric electrolyte which is provided by an ion - exchange membrane , especially a sulphonated perfluorocarbon membrane such as that sold under the trade mark nafion . details of the construction of an electrolysis cell such as might be used in the apparatus of the present invention are disclosed in u . s . pat . nos . 3 , 870 , 616 and 5 , 037 , 518 . water from the anode side of the electrolytic cell is pumped from the electrolytic cell to a first reservoir separator chamber 12 in which oxygen which is associated with the water ( carried by the water in solution or as dispersed bubbles ) can separate from the water . hydrogen is discharged from the cathode side of the electrolysis cell into separator apparatus 20 through a line 22 . the hydrogen that is supplied to the separator apparatus has water associated with it , as droplets or as vapour . the separator apparatus includes a manifold block 201 which is attached a separator chamber 24 and an adsorption chamber 28 . the manifold block includes a first mounting point 202 at which the separator chamber 24 can be physically connected to the block , preferably by means of a screw or bayonet type fitting . the manifold block includes a second mounting point 203 at which the adsorption chamber 28 can be physically connected to the block . the manifold block 201 has a plurality of conduits disposed internally and externally . the conduits enable fluid communication between the separator chamber 24 and the adsorption chamber 28 . the mixture of hydrogen and water is conducted through line 22 to a manifold inlet 204 which is connected to an inlet 206 located at the top of the separator chamber by means of an inlet conduit within the manifold block 201 . line 22 can have a pressure switch 207 in it which closes the line when the pressure in it exceeds a predetermined level , for example in the event that the pressure in the chamber 24 increases because the water outlet line is blocked and water accumulates in the chamber , closing the float valve 27 . the pressure switch may be attached to the manifold block , disposed at the manifold inlet 204 . the hydrogen / water mixture enters the top of the separator chamber 24 through the inlet 206 and liquid water collects at its base . hydrogen can escape from the chamber 24 through an outlet 208 located at the top of the chamber . the discharge of hydrogen from the chamber is controlled by means of a float valve 27 . the float valve is sensitive to the level of water in the chamber . the float valve closes the outlet 208 from the chamber when the level of water reaches a predetermined level , to prevent collected water passing from the chamber into other components of the separator apparatus , for example in the event that water cannot be discharged from the chamber . after passing through the outlet 208 , the hydrogen passes through a connecting conduit 209 within the manifold block to a connector outlet 210 , through which the hydrogen flows into an external conduit 212 disposed outside the manifold block . the external conduit is provided by a drying membrane material , preferably a moisture exchange drying membrane ( for example a membrane made from a sulphonated perfluorocarbon membrane such as that sold under the trade mark nafion ). the use of a drying membrane of this general kind is disclosed in u . s . pat . no . 5 , 037 , 518 . hydrogen which has passed through the external conduit is supplied to a connector inlet 213 in the manifold , through which the hydrogen flows into the connecting conduit 209 within the manifold block . a pressure sensor 214 can be included between the external conduit and the connecting conduit 209 in the manifold block so as to detect undesirable increases in the pressure . it can also detect unwanted reductions in that pressure which can indicate a leak in the line through which hydrogen is supplied to the end use application . the pressure sensor can be disposed in the external conduit or at the connector inlet . preferably , the pressure sensor is attached to the manifold block . a signal can be generated in the event of an undesirable change in pressure . this might be a visible signal or an audible signal . preferably , the signal leads to the supply of power to the electrolysis cell being interrupted . the hydrogen in the connecting conduit then passes into an adsorption chamber 28 through an inlet 216 , the adsorption chamber being physically connected to the manifold block at the second mounting point 203 . preferably , the hydrogen is conducted in a line 215 within the adsorption chamber before being released into the adsorption chamber at the top . the adsorption chamber preferably contains a desiccant such as silica gel or a molecular sieve or both . the adsorption chamber 28 has an outlet 217 located near the bottom of the chamber through which the dried hydrogen is released into a conduit 218 within the manifold block . by locating the inlet 216 and outlet 217 at opposite ends of the adsorption chamber , the hydrogen has to pass through the majority of the length of the adsorption chamber , and therefore its exposure to the adsorbent is maximised . the relative positions of the inlet 216 and outlet 217 may be reversed . the conduit 218 is connected at an outlet 219 to a line 220 through which the hydrogen passes to an outlet 222 that is adapted for connection to an end use appliance . the line 220 can include a valve , preferably a solenoid valve 221 , which can close the outlet 222 when the apparatus is not in use , or when the pressure in the line is either too high or too low ( perhaps due to a leak ). water which collects in the separator chamber 24 is supplied through a line 30 to a second reservoir separator chamber 32 in which hydrogen which is associated with the water ( carried by the water in solution or as dispersed bubbles ) can separate from the water . fig2 , 3 and 4 show a housing 100 which incorporates the reservoir 2 and the first and second reservoir separator chambers 12 , 32 . in relation to the discussion of the housing shown in fig2 and 3 , the reservoir will be referred to as the first chamber , and the first and second reservoir separator chambers will be referred to as second and third chambers , respectively . the housing is formed as a single moulding from a polyolefin such as polyethylene or polypropylene . a preferred technique for forming the housing involves rotational moulding . the housing has an inlet 102 for water to be supplied to the first chamber 2 . the first chamber is connected to the second and third chambers 12 , 32 by means of first and second channels 104 , 106 . the channels can be considered as sections an elongate chamber 108 which extends along the back of the housing , at a level below the base of the first chamber 2 . the second and third chambers 12 , 32 are substantially identical in shape and configuration . each of them communicates with the elongate chamber 108 ( see especially fig2 and 4 ), and has an enlarged head portion 110 which has in it a gas outlet . the chambers are separated by walls 111 which extend downwardly into the chamber . the walls each define a u - shaped trap . when the elongate chamber is filled with water to a depth which covers at least the bottom of each of the walls , the wall and the water in the elongate chamber provide a gas impermeable barrier between adjacent chambers . during normal operation of the apparatus of the invention , water will remain in the elongate chamber to sufficient depth to ensure that it covers at least the bottom of each of the walls because the bottom of each of the walls 111 is below the minimum depth to which the water in the first chamber drops , and because of the step between the water outlet 4 and the second and third chambers 12 , 32 which is higher than the bottom of each of the walls . as shown in fig3 , each of the gas outlets has a vent component 112 mounted in it , to which can be fitted a removable filter cartridge 113 . the filter cartridges prevent ingress of contaminants into the housing . suitable filter materials include activated carbon materials , activated alumina materials , activated silica materials etc . the enlarged head portion 110 of each of the second and third chambers has an inlet 114 for water which has gas associated with it . the water which is admitted to the second chamber 12 has hydrogen associated with it , and the water which is admitted to the third chamber 32 has oxygen associated with it . the water inlets 114 are located at about the mean level of water in the first chamber during normal operation of the apparatus . the housing has openings 116 formed in its back wall and in a wall of the third chamber to receive level sensors for liquid within it . one of the sensors is positioned to detect when the liquid level reaches a predetermined maximum level , and the other of the sensors is positioned to detect when the liquid level reaches a predetermined minimum level . preferably , the minimum level sensor is provided in the second chamber or the third chamber , so that it can detect a reduction of the level of liquid in that chamber which is due to , for example a blocked gas output vent or an explosion condition in that chamber , in addition to a reduction in the level of water in the first chamber . intermediate sensors can be provided to measure when liquid levels reach intermediate levels , for example to provide a warning that a maximum level or a minimum level is soon to be exceeded . an array 118 of light emitting diodes can be provided in a recess 120 in the base of the housing , which can illuminate the housing according to the signals provided to it by sensors , including level sensors , sensors as to the purity or other condition of the liquid etc . the translucence of the material of the housing arising from the use of a polymer such as a polyolefin can encourage the illumination of the housing in this way making the warning signal provided by the diodes readily visible . the signal which is generated when the water reaches the minimum water level causes the supply of power to the electrolysis cell to be interrupted to avoid the cell running with inadequate water : this can damage the cell . a recess 121 in the housing , defined by an inclined face 122 , towards the front of the housing , can facilitate visual inspection of the water level . it can be provided with markings to help with this . the first chamber 2 is generally flat in the sense that its depth is smaller than its width and its length . however , it has a protruding circular protrusion located below the inlet 102 , which has a discharge outlet opening 4 in it through which water can be discharged to the conductivity sensor 6 , for supply to the conductivity cell . the inlet 102 includes an inlet tube which extends into the first chamber to a level which is lower than the lowest level to which the water will drop during normal operation of the apparatus . the inlet tube can be closed by a cap 124 . the inlet tube can contain a filter 126 to minimise the risk of particulate and ionic impurities ( which might damage the electrolysis cell ) being introduced into the first chamber . it can be particularly preferred for a filter in the inlet tube to reduce the ionic content in the water in order to reduce ionic conductivity . the housing has a circular groove 127 cut into its lower face to define a circular area of the wall . the groove represents a line of weakness at which the housing can open in the event of excessive pressure within it , especially in the event of an explosion within the housing . the housing has a number of additional outlet mouldings 128 provided on its lower face . preferably , the housing is moulded with each of the outlet mouldings closed , so that those outlet mouldings which need to be used to drain liquid from the housing which is retained when the housing is emptied through the discharge outlet opening 4 can be opened by removing the tip by cutting ( including drilling ). this applies particularly the outlet moulding 130 on the elongate chamber 108 which provides the first and second channels extending between the chambers 2 , 12 , 32 . one of the outlet mouldings 132 can be used to locate the array 118 of light emitting diodes which is used to provide visible warning signals , which can be retained on the outlet moulding mechanically , for example by means of a circlip . the housing has a number of tie rods 134 moulded within it extending between the opposite top and bottom walls of the first chamber 2 . these can enhance the ability of the housing to withstand internal pressure . the housing has a plurality of internally threaded nuts 136 moulded into its lower face in an array around the recess 121 . these can receive threaded machine screws to fix apparatus for separating hydrogen gas from associated water carried with the gas as droplets or as vapour . separator apparatus is shown in fig4 , which comprises a manifold block 201 with the separator chamber 24 and the adsorption chamber 28 physically connected to it . in the particular embodiment shown the separator chamber is located below the manifold block , and the adsorption chamber is located above the manifold block . the separator apparatus includes pressure sensors 207 and 214 , a solenoid valve 221 , inlets 204 and 213 , and outlets 210 and 222 . the manifold block can have bores extending through it , in the peripheral region outside the separator and adsorption chambers , for receiving fasteners such as machine screws whose ends can be received in the nuts in the bottom face of the housing 100 . separator apparatus with such features is disclosed in an application which is filed with the present application which claims priority from uk patent application no . 0305007 . 7 . subject matter disclosed in the specification of that application is incorporated in this specification by this reference . when the apparatus of the invention is in use , water is maintained at a level in the housing between the maximum and minimum levels provided in the openings 116 in the back wall . if the water level falls between the minimum level , water is supplied from the first chamber 2 of the housing 100 through the outlet 122 to the conductivity sensor 6 . water is fed from the anode side of the electrolytic cell to the third chamber 32 . the water has oxygen associated with it ( in solution or as dispersed bubbles ) which can separate from the water in the third chamber . oxygen which separates from the water can vent to atmosphere through the vent component 112 mounted in it and the filter cartridge 113 . water is fed from the separator apparatus 20 to the second chamber 12 . the water has hydrogen associated with it ( in solution or as dispersed bubbles ) which can separate from the water in the second chamber . hydrogen which separates from the water can vent to atmosphere through the vent component 112 mounted in it and the filter cartridge 113 . water is maintained in the elongate chamber 118 to a depth such that the bottom of each of the walls 111 is immersed in the water . this ensures that gas is not able to pass between adjacent chambers through the elongate chamber , at least during normal operation of the apparatus . accordingly , hydrogen and oxygen are maintained separately in the enlarged head portions of the second and third chambers , from where they can vent to atmosphere . in the event of failure of one of the vents ( in particular if it were to become blocked so that pressure in the respective chamber increases ), or in the event of an explosion condition in a chamber , water in the trap can be displaced so that the gas flows into the next adjacent chamber . this can be detected by a minimum water level detector in the chamber in question , and can lead to the interruption of power to the electrolysis cell . if the failure is in the third chamber 32 , oxygen will flow into the second chamber 12 in which hydrogen has collected . the potentially explosive mixture is contained within a space which is smaller than the corresponding space in the first chamber so that , in the event of an explosion , the quantity of the explosive gas mixture is small . if the failure is in the second chamber 32 , hydrogen will flow into the first chamber and possibly also into the third chamber 12 . the volume of the third chamber is the same as that of the second chamber . in the absence of hydrogen in the first chamber , the risk of explosion as a result of an increase in the oxygen concentration of the collected gas is small . if failures occur in both the second and the third chambers , oxygen and hydrogen can collect in the first chamber . gas can vent from the first chamber through the vent and filter . in the event of an explosion in the first chamber , the bottom wall of the first chamber fails by blowing out the circular region defined by the groove 127 . | 2 |
fig1 shows the preferred embodiment apparatus for a ultra - violet ( uv )- based , complementary overlapping hexagonal scan system for curing of resin matrix composite structures . relative position of optics and composite part are developed by stage ( s ) 99 , shown generalized ; control module ( c ) 100 defines a scan of the composite part . the output of an excimer laser illumination subsystem ( is ) 101 is directed into a turning mirror 102 in a scanning beam processing module 103 . the scanning beam processing module 103 consists of the turning mirror 102 , focusing optics 104 , a beam homogenizer 105 , and a condenser subsystem 106 . the scanning beam processing module 103 is mounted to a large - travel translation stage 99 that is capable of moving the scanning beam processing module 103 over the entire length of the composite part 110 which is to be cured . inside the scanning beam processing module 103 , the turning mirror 102 directs the laser beam 108 from the excimer laser in illumination subsystem 101 down towards the composite part 110 to be cured . the laser beam 108 passes through focusing optics 104 before entering beam homogenizer 105 . the beam homogenizer 105 preferably is a reflective - type system based on anvik &# 39 ; s patented design , comprising a hexagonal light tunnel constructed from high - reflectivity dielectric mirror strips according to u . s . pat . no . 5 , 828 , 505 , optical beam - shaper - uniformizer construction , serial number 08 / 644 , 773 , filed may 10 , 1996 , farmiga , issued oct . 27 , 1998 . in fig1 similarly to fig5 the beam homogenizer 105 serves to uniformize the laser beam 108 while preserving the numerical aperture determined by the focusing optics 104 . the design maximizes the number of internal reflections while minimizing the overall system length , converting the output of illumination subsystem 101 to a uniform , extended light source . furthermore , since it is an entirely reflective system , it maximizes optical efficiency by reducing optical losses . the condenser subsystem 106 projects the output of the beam homogenizer 105 onto the surface of composite part 110 . the condenser subsystem 106 is designed using off - the - shelf optical components to minimize cost and delivery delays . with the exception of the beam homogenizer 105 , all of the optics in the beam processing module 103 can be fabricated from off - the - shelf components . beneath the optical beam processing module 103 the composite part 110 is wrapped around a pre - form , such as mandrel 109 . a drive motor ( not shown ) rotates the mandrel 109 along its axis in only one direction . the optical beam processing module 103 scans continuously at a velocity which is chosen such that , for every complete rotation of the mandrel 109 , the optical beam processing module 103 moves the hexagonal beam field by the effective scan width to illuminate polygonal illumination region 107 so as to overlap previously illuminated regions . fig6 shows apparatus for scanning the beam processing module in a manner which allows the entire structure to be exposed by a single , continuous , helical scan . the resulting ` helix ` from several rotations of the structure achieves the seamless scan . the velocity of the beam processing module 103 , v t , depends on the scanning velocity , v s , as given by the expression : where l h is the length of the side of the illuminating hexagon , and r is the linear distance to complete one rotation of the mandrel . exposing the rotational composite part 110 , on mandrel 109 , in a continuous helical scan offers several speed and convenience advantages over the boustrophedonic ( serpentine ) scanning pattern . for example , at the end of each serpentine scan , the beam processing module 103 must decelerate to a halt , then reverse direction , and accelerate back to the necessary scanning velocity before the composite structure can enter the object field of the condenser subsystem 106 . the acceleration and deceleration occur while the optical beam processing module 103 steps in the orthogonal direction so that the two adjacent scans are separated by the effective scan width . in comparison , when the mandrel 109 is rotated as shown in fig1 the throughput can be effectively increased in two ways : ( 1 ) there is no longer any overhead associated with reversing the scanning direction ; and ( 2 ) the scanning velocity of the mandrel 109 can be significantly greater than what can be accomplished with linear stages . the system shown in fig1 is optimized for those structures that are rotationally symmetric . fig7 shows another embodiment , for uv - curing of large structures or complex parts which cannot conveniently be placed on a round mandrel . examples are aircraft wings , spacecraft structures , distribution manifolds , etc . the output of the illumination subsystem 101 is directed to an additional turning mirror 102 which is mounted on the translation stage 99 which moves the beam processing module 103 for scanning the airfoil which is complex - geometry composite part 112 . the translation stage 99 , not shown in detail , since x , y , z stage means are known , holds the beam processing module 103 and the turning mirror 102 so that the stage steps the entire assembly to scan the complex - geometry composite part 112 . the beam processing module 103 scans the hexagonal beam illumination region 107 across the complex - geometry composite part 112 , here shown as an airfoil . after the completion of a scan , the stage 99 steps the entire assembly by the effective scan width so that the next scan can be seamlessly joined with the images resulting from the previous scan . this serpentine , seamless scan can be employed to cover the entire complex - geometry composite part 112 , whatever its shape may be . this scanning technology can also deliver a higher dose to selected areas of the structure . there may be thickness variations in the complex - geometry composite part 112 that require higher doses in certain regions . there may also be support structures , such as ribs , which require higher doses in order to prevent induced stresses leading to warpage . there are several techniques that can be employed to vary the dose over the composite material . fig8 shows the uniform intensity that results from the seamless joining of two scans that are separated by the effective scan width w , as shown by intensity profile 118 . fig9 shows how it is possible to generate an overlap region 119 , smaller than the scan width , which has a higher dose than in the non - overlap regions 120 . this is accomplished by deliberating choosing a step size that is smaller than the effective scan width w . similarly , it is possible to deliver regions of smaller dose by choosing a step size that is larger than the effective scan width w . fig1 shows how it is possible to deliver higher doses 121 or lower doses 122 over swaths which are larger than the effective scan width w . representative ways to change the dose delivered by a single scan to achieve the effect shown in fig1 , are as follows : all the above techniques achieve the same result of increasing the dose delivered during a scan . the techniques illustrated in fig8 - 10 all show how one can vary the dose transverse to the scan direction . it is also possible to vary the dose along the scan direction by employing similar methods , i . e ., changing pulse energy , scanning speed , or repetition rate . additionally , one may modify the fluence ( energy / area ) of the laser beam by changing the field size with a zooming condenser lens system . the result is a seamless exposure to photo - setting radiation , or , where desired , an exposure to photo - setting radiation which is non - uniform where additional mass or other factors suggest such an exposure to photo - setting radiation . fig1 shows a technique for providing dosages of curing radiation on two different areas simultaneously . the two areas may be opposed top and bottom surfaces of the same complex - geometry composite part 112 , or may be two separate treatment areas of the same surface of complex - geometry composite part 112 , as shown , but the possibilities for variations are many , including more than two beams . illumination subsystem 101 provides the uv - radiation beam , through beam - splitter turning mirror 102 - s and turning mirror 102 to both beam processing subsystem 103 - 1 and beam processing subsystem 103 - 2 . the plural beam processing subsystems 103 - 1 and 103 - 2 direct their controlled radiation patterns 107 - 1 and 107 - 2 , respectively , to the appropriate surface areas of complex - geometry composite part 112 . this type of multiple system offers a number of additional features . the multiple different beam processing modules 103 - 1 , 103 - 2 , . . . 103 - n can deliver different amounts of energies over identically - sized or different - sized radiation beams . this can be used for those applications where it is desirable to selectively cure certain segments of the complex - geometry composite part 112 with a higher dose than for the rest of the part . for example , if there is a seam in an airfoil , the seam may require much higher dose to cure than the rest of the airfoil . there are also applications in which it is desirable to join different parts having different composition or different mass . the joints may require additional doses of uv - curing radiation , greater than is needed for other areas . fig1 shows a uv - based curing system which has been integrated with a conventional thermal curing system such as a convection oven . there are applications where it is desirable to selectively and partially cure certain segments of a part using a uv - based process , then complete the curing process using the conventional approach . there may also be applications where it is desirable to do the partial curing by using the conventional approach and the final curing using the uv - based system . in fig1 the x - y stage , the beam processing module 103 , and the beam steering systems are all enclosed within the conventional oven 113 , while the illumination source 10 remains outside the enclosure of the oven where it can be more effectively operated . fig1 shows how uv - curing may be used for stabilizing a complex - geometry composite part 112 inside a convection oven 113 which then is useful for completing the cure . illumination subsystem 101 provides a beam of uv - radiation , via transparent beam port 114 and directional optics to beam processing subsystem 103 , which directs the controlled radiation pattern as polygonal illumination region 107 onto complex - geometry composite part 112 . fig1 shows how the uv - based curing system can be integrated with a sophisticated control system which can be used to accurately deliver the required dose according to cad data which matches the necessary illumination parameters to the topography or internal structure of the part being cured . the scanning speed of the stage , the laser energy , the repetition rate of the laser , or some other parameter affecting the delivered dose , can be selected and combined to change , in real time , on - the - fly , as the part is being scanned . the dose , which may be deliberately non - uniform , can be varied to optimally cure the part . control module 100 may have all necessary dosage and placement information pre - stored , to control stage 99 , illumination subsystem 101 , and beam processing module 103 according to such dosage and placement information . alternatively , control module 100 may receive feedback signals from embedded thermal sensor 115 or from non - contact sensor 116 , which is sensitive to a parameter such as color or temperature to provide condition - of - cure signals which control module 100 uses to update condition - of - cure information from which dosage and placement information can be recalculated . it is also possible to use non - contact sensors as simple as photocells to sense markings 123 applied to the surface of a composite part ( 110 , 112 ). the externally - applied markings 123 describe the distribution and other parameters of desired photo - cure to be applied to the composite part ( 110 , 112 ). fig1 shows how ultraviolet photo - setting can be applied locally to the small field where composite fiber / resin web , such as tape 117 , is currently being laid up on a previous layer of resin / fiber composite , with the result that the partially - formed complex - geometry composite part 112 is sufficiently stabilized to permit the laying up of additional material without distortion or mess . the application of the ultraviolet radiation can be integrated with this automated shape formation . tape 117 is supplied by supply reel 117 - s which is most conveniently mounted on beam processing module 103 , to assure proper placement of both the tape and the related stabilizing radiation field . all of the systems described above can operate at any of a number of ultraviolet wavelengths . this flexibility can be exploited to allow different types of thermoset resins with different spectral sensitivities to be utilized in the curing of a single part . the fact that different resins may cure at different rates when exposed to the same wavelength can be used to better control the overall curing process . it is also possible to use different wavelengths when exposing a single type of resin to achieve the same effect . uv - scanning system for curing of composite structures . here we summarize the major context of curing very large structures : ( i ) seamless scanning uniformly delivers the required dose over any size structure . ( ii ) this system controls the depth of cure for parts of varying thickness by tailoring the optical dose delivered to the structure according to its geometry . ( iii ) this technology does not contact the part , so there is no concern for contaminating the material or for inducing any mechanical stress . ( iv ) there is no required heating of large thermal masses , so the processing throughput is extremely high , limited only by the power of the laser source and the speed of the scanning stage . ( v ) this technology lends itself very nicely to prototyping of new structures since there is no reliance on molds or on other customized parts . ( vi ) the same system can be utilized to cure both very large and very small parts , which would not be at all practical for oven - based curing systems . ( vii ) for rotationally symmetric structures , the exposure speed is increased further by a continuous helical scan . the throughput is also enhanced because the scanning velocity can be significantly larger than what can be accomplished with linear translation stages for large payloads . ( viii ) this system does not suffer from any of the problems that plague autoclave systems , namely : improper rates of heating ; blown vacuum bags ; or loss of pressure . ( ix ) with its unique hexagonal illumination configuration and maximum field utilization , the system delivers high throughputs using small - size optics modules , thus keeping system costs low . the hexagonal configuration also provides significantly enhanced throughput over other curing techniques . ( x ) the high - throughput , large - volume capability can be delivered with off - the - shelf optical and mechanical components , thereby eliminating the need for development of complex and expensive machines , and reducing commercialization risks . this also helps reduce system costs . ( xi ) the uv - based curing technology is compatible with existing conventional curing approaches so systems can be designed which can incorporate the new uv technology with the conventional curing approaches . ( xii ) the curing process can be dynamically controlled by using cad data stored in the control system , or employing feedback information from sensors embedded within the part or optically derived from the part . ( xiii ) these techniques help enable the user to control the resin - to - fiber ratio and the uniformity of that ratio over the entire part , by directly stabilizing the resin in place . this control directly affects the final properties of the cured part . the above advantages demonstrate that the seamless scanning technology in a uv - based curing system results in an extremely versatile processing tool that can manufacture very large composite structures cost - effectively and at a high throughput . | 8 |
fig1 is a perspective view of an inductive conductivity sensor . sensor 10 is mounted to wall 12 of container 14 . sensor 10 includes arm or strut 16 and body 18 . strut 16 has a proximal end and a distal end . the proximal end is threaded and secured to wall 12 . the distal end supports body 18 within container 14 . alternatively , sensor 10 may be mounted to a wall within a pipe , a tank , or a chemical process stream , for example . body 18 supports first and second toroidal coils 20 and 22 ( shown in phantom ). first and second toroidal coils 20 and 22 each have electrical wires ( not shown ) wrapped around toroidal ferromagnetic cores . first toroidal coil 20 is electrically coupled to alternating current source 24 ( shown in fig2 ). second toroidal coil 22 is electrically coupled to measurement circuit 26 ( also shown in fig2 ). during operation , sensor 10 is immersed in an electrolytic liquid within container 14 . alternating current source 24 electrically excites first toroidal coil 20 to generate a changing magnetic field which induces electrical current loop 28 in the liquid . the magnitude of current loop 28 is representative of the conductivity of the liquid . current loop 28 subsequently induces a current in second toroidal coil 22 . the induced current in coil 22 is indicative of the conductivity of the liquid and is measured by measurement circuit 26 . sensors of the type shown in fig1 and 2 are referred to in the art as toroidal conductivity sensors because of the general shape of the transformer coils . fig3 and 4 are sectional views of sensor 10 . fig3 is taken along line 3 -- 3 of fig1 . fig4 is taken along line 4 -- 4 of fig2 . sensor 10 includes strut 16 , body 18 , first and second toroidal coils 20 and 22 , elastic membrane 30 , and passage 32 . the external surfaces of strut 16 and body 18 are provided with a smooth , rounded shape suitable for receiving the elastic membrane by molding them with a relatively hard plastic . as an alternative to molding , strut 16 and body 18 can be formed with a metal housing , provided that it is split into two portions so that it does not form a shorted turn around first toroidal coil 20 and second toroidal coil 22 . strut 16 and body 18 can also be assembled from machined , molded , or cast parts . elastic membrane 30 is formed on the surface of sensor 10 . when sensor 10 is immersed in the liquid within container 14 ( shown in fig1 ), membrane 30 separates the sensor from the liquid . strut 16 includes groove 44 that accepts ring 46 of membrane 30 . ring 46 creates an airtight seal when strut 16 is secured to wall 12 . in some applications , deposits or solid material may form on the surface of membrane 30 after immersion for an extended period of time . fig5 is a view similar to fig3 but illustrating deposits 34 formed on the surface of membrane 30 . deposits 34 can interfere with electrical current loop 28 ( shown in fig1 ) which measures conductivity of the liquid . prior art sensors must be removed from the liquid and then cleaned to remove the deposits . with the present invention , in contrast , sensor 10 may be cleaned without removal . passage 32 provides a channel in which pressurized fluid can be forced through strut 16 to an opening at an interface between body 18 and elastic membrane 30 . the fluid may be a liquid or a gas . the fluid is supplied by a controlled fluid source such as fluid source 38 shown in fig2 . typically , the fluid is compressed air and fluid source 38 is a plant compressed air line . fig6 illustrates membrane 30 inflated by pressurized fluid 40 . the pressure of fluid 40 must exceed the process pressure to inflate membrane 30 . preferably , the pressure of fluid 40 exceeds the process pressure by about 5 psi to about 20 psi . alternatively , if the fluid is a liquid , a fixed volume of liquid can be pumped into and out of passage 32 to inflate and deflate membrane 30 . during inflation , brittle or crusty deposits 34 will tend to break off the membrane surface . even soft clogging materials , such as pulp stock , will tend to be squeezed and displaced from the surface . to facilitate inflation , membrane 30 is sealed at interface 42 between wall 12 and strut 16 . at the end of a cleaning cycle , pressurized fluid 40 ( e . g . air ) is removed from passage 32 and membrane 30 returns to its original shape shown in fig3 - 5 . the cleaning cycle may be repeated periodically to maintain sensor accuracy . in one embodiment , controlled fluid source 38 initiates periodic cleaning cycles . membrane 30 is molded from a suitable material which is resilient , electrically insulating , non - porous and forms a smooth surface when molded . the material is selected to be compatible with the process conditions for each selected application , i . e ., process fluid characteristics , ph , temperature range , available air pressure for inflation , and so forth . suitable materials can include vulcanized rubber , and various synthetic elastomers , including polyurethanes , thiokol rubbers , polyacrylate elastomers , silicone elastomers , fluorelastomers , ethylene - polypropylene elastomers , and styrene - butadiene ( sbr ) rubbers depending on the application . a preferred material for the membrane is ethylene polypropylene rubber . the thickness of the membrane can be adjusted according to the application , and is preferably in the range of about 2 mm to 3 mm . the present invention provides a self - cleaning inductive conductivity sensor which does not have to be removed from a process , or application , to be cleaned . the present invention significantly reduces maintenance costs associated with conductivity sensors of the prior art . in the embodiment shown , the membrane is inflated to provide cleaning , and deflated during normal operation . it is also within the scope of the invention to provide an inflated membrane during normal operation , and a deflated membrane to provide cleaning . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention . | 6 |
referring to fig1 , a rotor for use with rotor blades for a propulsive thrust device is designated generally by the reference numeral 10 and is hereinafter referred to as “ rotor 10 .” rotor 10 comprises a hub 12 having a plurality of hub arm bores 14 ( or sockets or the like ) equidistantly located about a peripheral surface of the hub and a plurality of studs 16 associated with each hub arm bore . the studs 16 are preferably received in bosses ( shown at 18 in fig2 and 3 ) located around each hub arm bore 14 , movable in the bosses , and can be tensioned therein via nuts ( shown at 17 in fig2 and 3 ). a rotor blade 20 ( only stubs of each rotor blade shown ) is mounted in each hub arm bore 14 , each rotor blade being rotatable about an axis 22 extending through the hub arm bore to effect the changing of rotor blade pitch . movement of the studs 16 is along axes parallel to the axis 22 . tensioning the studs 16 via the nuts 17 ( preferably with common drive tools ) allows for both the retention of a rotor blade 20 in a respective hub arm bore and the loading of two bearing assemblies ( described below as an outer bearing assembly 40 and an inner preload bearing assembly 50 ) associated therewith . the present invention is not limited to the incorporation of eight hub arm bores 14 , as shown , as any suitable number of hub arm bores may be located about the peripheral surface of the hub 12 . furthermore , the present invention is not limited to the use of four studs 16 associated with each hub arm bore 14 , as shown , as any suitable number of studs 16 may be used . as shown in fig2 , each hub arm bore 14 defines a bore 26 into which a shank portion 30 of a rotor blade 20 is received . the outer bearing assembly 40 is located in each hub arm bore 14 to retain the rotor blade 20 in the bore 26 and to facilitate the rotation thereof about the axis 22 in a rotor blade pitch changing operation . the inner preload bearing assembly 50 is also located in each hub arm bore 14 , each inner preload bearing assembly being adjustable via the studs 16 associated therewith . the studs 16 are elongated pin - type members extending through holes in the bosses 18 , the bosses being located equidistantly around each hub arm bore 14 , each stud being engageable with a tab 58 protruding from an outer race 54 of the inner preload bearing assembly 50 . in the engagement of the stud 16 with the tab 58 , a hexagonal shaped head , splined shank , or the like is received into a correspondingly shaped structure to prevent rotation of the stud during tensioning . the present invention is not so limited , however , as the heads of the studs may be integral with the tabs 58 , or the studs may be threadedly received in the tabs . by tensioning the studs 16 , the inner preload bearing assembly 50 is pulled outwardly along the axis 22 , thereby preloading the outer bearing assembly 40 . preloading of the outer bearing assembly , as shown in fig3 a , 3 b , and 3 c , comprises tensioning the studs 16 . before the initial tensioning of the studs 16 ( fig3 a ), the rotor blade 20 is in contact with the inner preload bearing assembly 50 , and a gap g 1 is present between the tabs 58 and receiving surfaces 59 in the hub arm bore 14 . upon initial tensioning of the studs 16 and pulling the inner preload bearing assembly 50 and rotor blade 20 outwardly ( fig3 b ) in the direction of arrow 55 , rolling elements ( shown at 42 in fig5 ) on the inner race ( also shown in fig5 at 46 ) of the outer bearing assembly 40 are urged into initial contact with the outer race ( shown in fig5 at 44 ) formed in the hub arm bore 14 and a gap g 2 is formed . further tensioning ( fig3 c ) causes the elastic deformation of the rolling elements and races of both bearing assemblies ( tabs 58 are brought into contact with receiving surfaces 59 ) until the gap g 2 is eliminated , thereby establishing the predetermined amount of static preload between both bearing assemblies . additional tensioning is imparted to the stud 16 by applying additional torque to inhibit separation of the tabs 58 from the receiving surfaces 59 to provide substantially constant tensile loading on the stud 16 . the amount of static preload is suitably sufficient such that when significant centrifugal loading develops during operation of the rotor 10 ( which can reduce the established static preload force to some degree ), there is sufficient preloading remaining to inhibit the unloading of the rolling elements 52 in the inner preload bearing assembly 50 when bending loads are combined with centrifugal loading . this establishes the bending capacity of the system in operation . as shown in fig4 , the structural material of the inner preload bearing assembly 50 defines a plurality of arches 65 ( or other suitable configuration ) extending between each of the four tabs 58 , as shown . the arches 65 facilitate the distribution of point loads around the outer race 54 when the studs 16 pull the outer race in the outward direction into a preloading position . as shown in fig5 , rolling elements 42 of the outer bearing assembly 40 and rolling elements 52 of the inner preload bearing assembly 50 comprise low - friction ball bearing elements that permit , upon rotation of the rotor blade 20 about the axis 22 , the pitch angle of the rotor blade to be altered when an inwardly protruding pin 61 is moved by a timing mechanism ( not shown ) located in the hub 12 . the present invention is not limited to the use of ball bearing elements , however , as the rolling elements may be tapered roller bearings , or any other suitable type of bearing element . the rolling elements 42 of the outer bearing assembly 40 are captured between an outer race 44 defined by a machined inner surface of the hub arm bore 14 and an inner race 46 defined by a machined surface of the shank 30 of the rotor blade 20 and held therein by a cage 60 . the present invention is not limited to the use of machined surfaces integral to the rotor blade and hub structure , however , as the races may be separate elements . the cage 60 holding and supporting the rolling elements is an elongate flexible member ( e . g ., fabricated of a plastic material or the like ) having pockets for the accommodation of the rolling elements and is referred to hereinafter as “ necklace 69 .” one or both ends of the necklace 69 include a tab with a hole or loop feature . engagement of the hole or loop feature may be made with a separate hook - shaped element to withdraw the necklace 69 from the hub arm bore 14 . when the necklace 69 is in the hub arm bore 14 , the ring structure is formed , and the outer bearing assembly 40 is capable of being preloaded . by tightening the nuts 17 on the studs 16 , the preload force is established and the rotor 10 is operational . when the nuts 17 are loosened to release tension on the studs 16 , the preload force generated by the inner preload bearing assembly 50 is released , and the outer race 54 thereof can move further inward into the hub arm bore 14 , thereby allowing the rotor blade 20 to also move inward . this unloads the outer bearing assembly 40 and provides for sufficient room around the outer bearing assembly ( which is the primary bearing providing support to the rotor blade 20 and further retaining the rotor blade in place ) to permit removal of the necklace 69 . the necklace 69 can be pulled as an elongate element through a loading hole ( shown at 64 in fig1 ) in the side of the hub arm bore 14 located just inboard of where the outer bearing assembly 40 is located in the hub arm bore . during removal of the rotor blade 20 , the inner preload bearing assembly 50 remains inside the hub arm bore 14 , thereby allowing it to be protected from exposure to potential external contamination . a replacement rotor blade 20 can then be inserted into the hub arm bore 14 , and the necklace 69 can be reinserted into the space defined by the outer race 44 defined by the machined inner surface of the hub arm bore 14 and the inner race 46 defined by the machined surface of the shank 30 of the replacement rotor blade 20 . once this is done , the inner preload bearing assembly 50 can be pulled back outward by tightening the studs 16 to the preset torque , thus restoring the preload between both bearing assemblies and rendering a propulsive thrust device into which the rotor 10 is incorporated ready for flight . also as shown in fig5 , angles of contact during operation of the rotor 10 are approximated by lines 70 connecting a first pair of rolling elements 52 in the inner preload bearing assembly 50 and an opposing pair of rolling elements 42 in the outer bearing assembly 40 . these lines 70 define an outer focal point 72 and an inner focal point 74 for all the rolling elements in each bearing assembly . the outer focal point 72 and the inner focal point 74 are coincident with the axis 22 . the distance between the inner focal point 74 and the outer focal point 72 provides a measure of the stability provided by the system of bearings defined herein by the outer bearing assembly 40 and the inner preload bearing assembly 50 in preventing bending and / or “ rocking ” loads from deflecting the retention of the rotor blade 20 , thus augmenting a foundation stiffness for the attachment of a rotor blade 20 to the hub 12 . this foundation stiffness allows resonant frequencies of the rotor blades 20 to be maintained at higher values to avoid undesirable rotor system vibration issues . referring now to all of the figures , protective coatings and / or low friction sleeves can be employed to resist metal - to - metal fretting or surface wear caused by fatigue loading . the coatings and / or low friction sleeves can be provided in regions of the rotor 10 where motion under load is apt to occur . one such region is defined by the contact surfaces of the outer diameter of the inner preload bearing assembly 50 and the inner surface of the arm hub bore 14 , where preferably there is a close tolerance slip fit . in this case , the hub arm bore 14 defines a surface where enhanced strength is desirable . this surface can be protected either by use of a coating thereon and / or by use of a coating on the engaging surface of the outer race 54 of the inner preload bearing assembly 50 . such a coating is preferably a thin layer of a soft metallic or plastic material such as silver plating or other material that can be applied by any suitable means , including , but not limited to , methods such as plasma spraying . as stated above , motion between the stud 16 and the hole in the boss 18 is prevented by applying sufficient torque to the stud so that rotor blade 20 loading does not cause separation between the tabs 58 and the receiving surfaces 59 . although this invention has been shown and described with respect to the detailed embodiments thereof , it will be understood by those of skill in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiments disclosed in the above detailed description , but that the invention will include all embodiments falling within the scope of the foregoing description . | 5 |
now , a description will be given in more detail of preferred embodiments of the invention with reference to the accompanying drawings . a linear guide apparatus according to the present invention will be described in detail hereinbelow by reference to the accompanying drawings . fig1 is a cutaway perspective view showing an example of linear guide apparatus to which the present invention is applied . the linear guide apparatus comprises a track rail 1 having a ball raceway 11 formed therein in a longitudinal direction thereof ; a slider 2 which is engaged with the track rail 1 via a plurality of balls 3 serving as rolling elements ; and a seal member 5 which is attached to an end face at either end of the slider 2 in the direction of movement thereof and which is brought into intimate contact with upper and side surfaces of the track rail 1 . as shown in fig2 the track rail 1 is constructed so as to assume a substantially rectangular cross - sectional profile when taken along the direction perpendicular to the longitudinal direction of the rail 1 . a mount hole 10 to be used for insertion of an anchor bolt is formed at appropriate intervals in the longitudinal direction so as to penetrate through the track rail 1 . two ball race way grooves 11 are formed in an upper surface of the track rail 1 such that the mount holes 10 are interposed between the ball raceway grooves 11 . moreover , one ball raceway groove 11 is formed on either side surface of the track rail 1 . each of the four ball raceway grooves is formed into the form of a deep slot so as to assume a curvature slightly larger than that of a spherical surface of the ball 3 . the slider 2 comprises a metal slide block 21 equipped with amount surface 20 to be used for mounting a slidable member ( not shown ), such as a table , and a pair of plastic end caps 22 , 22 , being fixed to either end face of the slide block 21 . an indentation is formed in the lower surface of the slider 2 such that an upper part of the track rail 1 is to fit into the indentation with play . thus , the slider 2 is constructed to as to have a substantially - saddle - like cross - sectional profile . the slide block 21 has a base section 21 a having the mount surface 20 formed thereon and a pair of skirts 21 b , 21 b extending downward from the respective sides of the base section 21 a . thus , the slide block 21 is constructed so as to assume a substantially saddle - like cross - sectional profile . a plurality of tap holes 20 a to be used for securing a movable member with bolts are formed in the mount surface 20 . two load raceway grooves 23 are formed in the lower surface of the base section 21 a , and one load raceway groove 23 is formed in an inner side surface of each of the skirts 21 b . thus , a total of four load raceway grooves 23 are formed so as to oppose corresponding ball raceway grooves 11 formed in the track rail 1 . the balls 3 travel under load in a position defined between the load raceway groove 23 and the ball raceway groove 11 of the track rail 1 ; namely , a load area . thereby , the slider 2 travels over the track rail 1 . two ball return paths 24 are formed in the base section 21 a of the slide block 21 by means of drilling , and one ball return path 24 is formed in each of the skirts 21 b by means of drilling . the ball return paths 24 are disposed in parallel with respective load raceway grooves 23 . fig3 is a cross - sectional view showing an endless ball circulation path formed in the slider 2 . each of the ball return paths 24 communicates with a corresponding load raceway groove 23 by means of two substantially - u - shaped reverse - of - direction paths 25 ( simply called a “ u - turn paths ”) defined by the respective end caps 22 . more specifically , one u - turn path 25 upwardly guides the balls 3 that have finished rolling through the load raceway groove 23 of the slide block 21 and delivers the balls 3 to the ball return path 24 , and the other u - turn path 25 delivers the balls 3 from the ball return path 24 to the load raceway groove 23 . by means of fastening the end caps 22 to the slide block 21 through use of unillustrated mount bolts , an endless circulation path for the balls 3 is constituted in the slider 2 . as shown in fig3 an end face on either side of the slide block 21 in the direction of movement thereof is covered with a cap attachment section 40 to be used for fixing the end cap 22 . a positioning step section 41 for fitting to an inner side surface of the end cap 22 is formed in the cap attachment section 40 . when the end cap 22 is fixed to the slide block 21 , the positioning step section 41 positions the end cap 22 accurately . the cap attachment section 40 is formed integrally with the slide block 21 by means of a so - called insert molding method , in which melt resin is poured , through injection , into a mold having the slide block 21 provided therein . there may be a case where the cap attachment section 40 is formed through die - casting from light metal , such as aluminum , in lieu of resin . a molding method is not limited to insert molding ; the slide block 21 and the cap attachment section 40 may be formed separately , and they may be assembled together later . a semi - circular guide section 42 — which constitutes a sidewall surface at the inner diameter of the u - turn path - protrudes from the cap attachment section 40 . the guide section 42 constitutes the u - turn path 25 in cooperation with the end cap 22 . a semi - circular guide groove 43 is formed in the end cap 22 and constitutes a sidewall surface at the outer diameter of the u - turn path 25 . when the end cap 22 is fixed to the cap attachment section 40 , the guide section 42 of the cap attachment section 40 is fitted to the guide groove 43 of the end cap 22 , thereby constituting the u - turn path 25 . the cap mount sections 40 attached to both end faces of the slide block 21 are coupled together by way of the ball return path 24 . more specifically , the ball return path 24 is formed by means of coating the inner peripheral surface of the through hole 44 formed in the slide block 21 with a plastic tube - like body 45 . such a tube - like body 45 interconnects the pair of cap mount sections 40 , 40 covering the end faces of the slide block 21 . the tube - like body 45 is formed through insert molding simultaneous with formation of the cap mount section 40 , thereby coating the inner peripheral surface of the slide block 21 . accordingly , the cap attachment sections 40 formed at the end faces of the slide block 21 are integral with each other via the tube - like body 45 penetrating through the slide block 21 . the cap attachment sections 40 are firmly fastened to the metal slide block 21 . a cladding section 46 made of synthetic resin is formed over the lower surface of the base section 21 a of the slide block 21 as well as over the inner surfaces of the skirts 21 b , thereby interconnecting the pair of cap attachment sections 40 , 40 . the cladding section 46 is also formed through insert molding simultaneous with formation of the cap attachment sections 40 and the tube - like bodies 45 . in cooperation with the tube - like body 45 , the cladding section 46 firmly fastens the pair of cap attachment sections 40 , 40 to the slide block 21 . the cladding section 46 is formed to remain away from the load raceway groove 23 for the balls 3 formed in the slide block 21 . the cladding section 46 has the function of guiding a belt section of a ball coupling member to be described later . in the linear guide apparatus , the balls 3 are not incorporated in their present forms into the endless circulation path of the slide 2 ; rather , a plurality of balls 3 are incorporated into the endless circulation path as balls - on - a - string 6 consisting of a string of balls . fig4 shows an example of the balls - on - a - string 6 . the balls - on - a - string 6 are formed from a number of balls 3 tied in a string at predetermined intervals with respect to a coupling belt 60 . the coupling belt 60 has a plurality of spacer sections 61 , each being interposed between adjacent balls 3 . the spacer sections 61 are coupled together by means of a belt section 62 . on either side of each of the spacer section 61 is formed a spherical seat 63 to be brought into contact with a spherical surface of the adjacent ball 3 . each ball 3 is rotatably embraced by a pair of spacer sections 61 located on the respective sides of the ball 3 . in such a state , numerous balls 3 are coupled together by means of the coupling belt 60 . as shown in fig3 the balls 3 are incorporated into each endless circulation path of the slider 2 in the form of a single balls - on - a - string 6 . in order to prevent occurrence of a kink in the coupling belt 60 while the balls 3 are circulating through the circulation path , a pair of slots 47 are formed in the internal peripheral surface of the plastic tube - like body 45 constituting the return path 24 in the direction in which the balls 3 travel . the belt section 62 of the coupling belt 60 is guided along the slots 47 . similar slots 48 are formed in the areas of the cladding section 46 situated on both sides of each load raceway groove 23 of the slide block 21 . fig5 is an enlarged cross - sectional view showing a junction between the load area and the u - turn path 25 within the endless circulation path . after having rolled through the u - turn path 25 in a non - load state in which no load is imposed on the balls 3 , the balls 3 roll into a load area between the load raceway groove 23 of the slider 2 and the raceway groove 11 of the tack rail 1 . in the load area , the balls roll while receiving the load exerted on the slider 2 . the inner diameter of the u - turn path 25 , which is a non - load area , is set so as to become slightly larger than the diameter of the ball 3 . naturally , the entrance of the u - turn path 25 ; namely , a distance d 1 between the sidewall surface 50 at the inner diameter of the u - turn path 25 and the raceway groove 11 of the track rail 1 , is also set so as to become slightly larger than the diameter of the ball 3 . in contrast , in the load area , the balls 3 are sandwiched between the load raceway groove 23 of the slider 2 and the raceway groove 11 of the track rail 1 while receiving load . a maximum of distance d 2 between the load raceway groove 23 and the raceway groove 11 is substantially identical with the diameter of the ball 3 . if load is exerted on the slider 2 or pre - load has been imparted to the balls 3 , the distance d 2 becomes smaller than the diameter of the ball 3 . hence , if the load raceway groove 23 is formed completely in parallel with the track rail 1 over the entire length of the load area , the balls 3 which enter from the non - load area to the load area are abruptly compressed in a boundary between the areas , thereby hindering smooth circulation of the balls 3 . as shown in fig5 a crowing area a is provided in the load raceway groove 23 at either end of the load area . the distance between the load raceway groove 23 and the raceway groove 11 is set so as to gradually broaden while approaching the u - turn path 25 . by means of presence of the crowing area a in the load raceway groove 23 , the balls 3 that have entered the load area from the non - load area are gradually compressed while advancing and are susceptible to load , thereby realizing smooth circulation of the balls 3 and diminishing noise . an upward guide 49 is formed at the end of the guide groove 43 of the end cap 22 adjacent to the end of the track rail 1 for guiding the balls 3 so as to depart from the raceway groove 11 of the track rail 1 . after having been released from load upon entry into the u - turn path 25 from the load area , the balls 3 depart from the raceway groove 11 of the track rail 1 by means of the upward guide 49 and roll into the depth of the substantially - u - turn path 25 . the semi - circular guide section 42 situated at the inner diameter of the u - turn path 25 is fixed to the slide block 21 by means of injection molding in the manner as mentioned above . difficulty is encountered in completely matching the longitudinal edge of the load raceway groove 23 with the sidewall surface 50 of the u - turn path 25 formed in the guide section 42 . if a complete match fails to exists between the load raceway groove 23 and the u - turn path 25 and if the load raceway groove 23 projects from the sidewall surface 50 toward the track rail 1 , the balls 3 , which have entered the load area from the u - turn path 25 , come into collision with the edge of the load raceway groove 23 even when the crowing area a is provided in the manner as mentioned above . as mentioned above , smooth circulation of the balls 3 is hindered , and noise is likely to arise as a result of abrupt collision of the balls 3 with the load raceway groove 23 . as shown in fig5 the linear guide apparatus according to the present embodiment is intentionally provided with the step section 51 , such that the edge of the load raceway groove 23 becomes higher than the sidewall surface 50 at the inner diameter of the u - turn path 25 . even when errors are present in formation of the guide section 42 or formation of the load raceway groove 23 , the load raceway groove 23 is prevented from protruding from the sidewall surface 50 of the u - turn path 25 toward the track rail 1 . the size of the step section 51 is about 5 % the diameter of the ball 3 . as a result , the balls 3 , which enter the load area from the u - turn path 25 , can be prevented from colliding with the edge of the load raceway groove 23 , thereby realizing smooth circulation of the balls 3 . such a construction is effective for a case where the balls 3 are to travel at considerably high speed within the endless circulation path . even when the slider 2 travels at high speed relative to the track rail 1 , a linear guide apparatus adopting such a construction can cause the slider 2 to move with considerably small resistance and minimize generation of noise , which would otherwise be caused at the time of movement of the balls 3 . when the step section 51 such as that mentioned above is present , the edge of the sidewall surface 50 of the u - turn path 25 protrudes beyond the load raceway groove toward the track rail 1 . a width d 1 of the entrance of the u - turn path 25 is greater than the diameter of the ball 3 , as mentioned above . hence , when entering the u - turn path 25 from the load area , the balls 3 are not caught by the step section 51 . the upward guide section 49 formed in the end cap 22 is provided at a position where the ball 3 comes into contact with the guide section 49 after having been released from load upon entry into the u - turn path 25 . even after having been released from load , the ball 3 rolls over the raceway groove 11 of the track rail 1 until reaching the upward guide section 49 . even in this respect , there is no chance that the ball 3 which enters the non - load area from the load area is caught by the step section 51 . even when the step section 51 is not intentionally formed , the crowning area a of the load raceway groove 23 is again ground after the guide section 42 has been formed on the end face of the slide block 21 through injection molding , so that the edge of the load raceway groove 23 can be adjusted so as to match the sidewall surface 50 of the guide section 42 . these operations are performed through use of a router . if the crowning area a of the load raceway groove 23 is again ground , there can be achieved a complete match between the load raceway groove 23 and the sidewall surface 50 at the inner diameter of the u - turn path 25 , without involvement of a step , as shown in fig6 . thus , the load raceway groove 23 and the sidewall surface 50 can be made continuous . hence , smooth circulation of the balls 3 can be ensured , as in the case where the step section 51 is formed . the embodiment has been described through use of the drawings shows an example in which the guide section 42 at the inner diameter of the u - turn path is integrally molded with a metal slide block . however , even in the case of a linear guide apparatus in which the guide section is fixed to the slide block in conjunction with the end cap , smooth circulation of balls can be realized by means of application of the present invention . in the embodiment , the track rail 1 is formed linearly . however , the track rail 1 may be formed in the form of a curve having curvature . as has been described , in the linear guide apparatus according to the present invention , rolling elements which attempt to enter a load area from a u - turn path smoothly enter the load area from a non - load area , and vice versa , without being caught by the edge of a load raceway surface . hence , when the rolling elements roll at high speed within an endless circulation path , there can be prevented occurrence of resistance or noise , which would otherwise be caused by rolling action . there can be achieved considerably smooth and silent , high - speed relative movement between a slider and a track rail . | 5 |
in the following description similar features in different embodiments will be indicated by the same reference numerals . fig1 is a block diagram of an embodiment of a superheterodyne receiver 10 having an antenna 20 coupled to a radio frequency circuit 30 . when a signal is received by the antenna , the radio frequency circuit 30 delivers a radio frequency signal ( rf ) to the inputs 40 , 50 of a mixer 60 . the mixer 60 also has inputs 70 , 80 for receiving a turning oscillator signal from a local oscillator 90 , and outputs 110 , 10 for delivery of an intermediate frequency signal ( if ). the outputs 110 , 10 are coupled to inputs 120 , 130 of an intermediate frequency ( if ) amplifier 140 having outputs for delivering an amplified if signal to a detector circuit 150 . the detector circuit 150 generates an audio - frequency ( af ) signal in response to the if signal , and the af signal is delivered to an audio - frequency amplifier 160 operating to amplify the af signal , and to deliver it to a load 170 , such as a loudspeaker . fig2 is a circuit diagram of an embodiment of the mixer 60 shown in fig1 . the mixer of fig2 has a first transistor q 1 and a second transistor q 2 , the gates of which are coupled to the inputs 40 and 50 , respectively , for receiving the rf signal . the sources of transistors q 1 and q 2 are coupled to signal ground 180 , preferably via a biasing current device 190 . the first lo input 70 is coupled to the gate 233 of a first switch transistor q 3 via an inductor 230 , and to the gate 243 of a second switch transistor q 4 via an inductor 240 . a a capacitor 235 is connected between signal ground and the junction of inductor 230 and the gate 233 of transistor q 3 , such that the lc circuit forms a first low pass filter f 3 . another capacitor 245 is likewise connected between signal ground and the junction of inductor 240 the gate 243 of transistor q 4 , as illustrated in fig2 as to form a second low pass filter f 4 . the inductors 230 and 240 have an inductance and a series resistance . because of the resistance the filter f 3 and f 4 are dampened , thereby avoiding undesired oscillation in the circuitry . the second lo input 80 is coupled to the gate 253 of a third switch transistor q 5 via an inductor 250 , and to the gate 263 of a fourth switch transistor q 6 via an inductor 260 . capacitors 255 and 265 , respectively , are connected between the gates of transistors q 5 and q 6 respectively , and signal ground , as illustrated in fig2 . inductor 250 in combination with capacitor 255 forms a third low pass filter f 5 , and inductor 260 in combination with capacitor 265 forms a fourth low pass filter f 6 . the inductors 250 and 260 also have an inductance and a resistance so as to avoid undesired oscillation in the circuitry . the drain terminals of transistors q 3 and q 4 are connected to the first if signal output 100 , whereas the drain terminals of transistors q 5 and q 6 are connected to the second if signal output 110 . fig3 a is a voltage / time diagram illustrating the temporal progression of the amplitude of the lo signal , i . e . the signal provided by the local oscillator 90 in fig1 . the rise time t r of a positive edge of a signal is usually defined as the duration for the signal amplitude to progress from 20 % of a top value to 80 % of the top value ( see fig3 a ). fig3 b is a more detailed voltage / time diagram illustrating the temporal progression of the amplitude of a positive edge of the lo signal shown in fig3 a . fig3 c is a voltage / time diagram illustrating the temporal progression of the amplitude of the signal at gate 233 ( see fig2 ) in response to the positive edge signal illustrated in fig3 b . with reference to fig2 the transistor q 3 is turned off when the amplitude at the gate is below the level v 1 shown in fig3 b and 3c . when the amplitude at the gate is above the level v 2 shown in fig3 b / 3 c , the transistor q 3 is conducting so well that there is no voltage swing at its output , i . e . the transistor is saturated . by comparing the signal portions shown in fig3 b and 3c it can be clearly seen that the time period t 4 - t 3 in fig3 c is shorter than the time period t 2 - t 1 in fig3 b . as a matter of fact the rise time of the lo signal is shorter after having passed the lo signal through the filter f 3 ( see fig2 ). it can be seen , by comparing fig3 b and 3c that when a positive edge of the lo signal , having a certain slope , is delivered to terminal 70 the amplitude at gate terminal 233 ( see fig2 ) is initially unaffected . during this phase , however , the filter f 3 is charged with reactive energy . hence , the filter f 3 will initially cause a delay , and thereafter the filter will cause the signal level at gate terminal 233 to have a steeper slope than that of terminal 70 . a quicker rise time of the signal causes a quicker transition of transistor q 3 from non - conducting state to conducting state . since the noise contribution from a transistor is predominantly generated during transition between a conducting state and a non - conducting state , the amount of noise is thereby advantageously reduced , when the mixer is provided with filters such as f 3 , f 4 , f 5 and f 6 . according to preferred embodiments the low pass filters f 3 , f 4 , f 5 and f 6 has only passive components , thereby providing a high reliability and a minimal noise contribution . an additional advantage attained with passive components is a low component cost . hence , the mixer 60 , when used in a receiver renders a reliable high fidelity radio signal receiver at a low cost . according to an embodiment the inductance of the inductor 230 and the capacitance of the capacitor 235 in filter f 3 are selected such that the time constant of the filter f 3 has a value similar to the rise time of the lo signal . in this connection the rise time is defined as mentioned in connection with fig3 a above . according to embodiments of the invention the time constant of filter f 3 has a value in the range from 0 , 2 to 10 times the rise time of the lo signal . according to some embodiments of the invention the time constant of filter f 3 has a value in the range from 0 , 5 to 2 times the rise time of the lo signal . according to a preferred embodiment the time constant of the filter is selected in the range from 90 % to 110 % of the rise time of the lo signal . since , normally , the fall time of the lo signal is substantially the same as the rise time thereof , the relation between the fall time and the time constant of the filter will normally be the same . if , however , there is a distinct difference between the rise and fall time of the lo signal , then the above relations should apply to the time constant of the filter as compared to the mean value of the rise and fall time of the lo signal . according to one embodiment of the invention the time constant of the filters is selected to 20 picoseconds for a circuit wherein the lid signal has a rise time of 20 picoseconds . the lo signal may , for example , have a period of 120 ps . an example of a mixer with the circuit diagram of fig2 includes the following component values : each of the inductors 230 , 240 , 250 , 260 has an inductance of 1 nh , and a series resistance of 50 ohm . each of the capacitors 235 , 245 , 255 , 265 has a capacitance of 0 , 03 pf . the time constant of the filter is thus 34 ps , obtained as 2 * pi *. sqrt ( lc ). the lo signal has an input period time of 120 ps , a rise time of 20 ps , and a fall time of 20 ps . the puse width of the lo signal in this example is 40 ps . the above discussion about the relation between the filter time constant and the lo signal is applicable , not only to the fig2 embodiment , but also to the other embodiments of the invention described in this text . fig4 a includes a circuit diagram of another embodiment of the mixer 60 shown in fig1 . fig4 a also illustrates a block diagram of a local oscillator 90 . having a dc bias source 270 and ac signal sources 275 , 280 . the signal source 280 is 180 degrees phase shifted in relation to signal source 275 , as indicated by the polarity references + and − in fig4 a . according to the fig4 a embodiment a filter f is connected to terminals 70 , 80 . the filter f includes a first inductor 300 which is coupled between input terminal 70 and the gates of transistors q 3 and q 4 . a second inductor 310 is coupled between input terminal 80 and the gates of transistors q 5 and q 6 , and a capacitor 320 is coupled between the gates of transistors q 3 / q 4 and q 5 / q 6 , as shown in fig4 . the inductors 300 , 310 are inductive and resistive for the same reason as mentioned for inductor 230 above . fig4 b differs from fig4 a in that two capacitors 321 replaces the single capacitor 320 . each capacitor 321 has twice the capacitance value of capacitor 320 , and the terminal between the capacitors is connected to ground 322 . in this manner the capacitors 321 co - operate to provide a capacitance of the same value as capacitor 320 , but with the additional advantage of being grounded so as to obtain a defined dc - level . fig5 is a circuit diagram of yet another embodiment of the mixer 60 shown in fig1 . according to the fig5 embodiment a first inductor 300 is coupled between input terminal 70 and the gates of transistors q 3 and q 4 and a capacitor 330 is coupled between the gates of transistors q 3 / q 4 and ground , as shown in fig5 . a second inductor 310 is coupled between input terminal 80 and the gates of transistors q 5 and q 6 , and a capacitor 340 is coupled between the gates of transistors q 3 / q 4 and ground . fig6 is a circuit diagram of yet another embodiment of the mixer 60 shown in fig1 . the fig6 embodiment corresponds to the fig2 embodiment , but whereas the capacitors 235 , 245 , 255 , 265 in fig2 are connected to ground , each of the corresponding capacitors 435 , 445 , 455 , 465 in the fig6 embodiment are connected to the drain terminal of the respective transistor . fig7 is a combined block diagram / circuit diagram of an embodiment of the mixer 60 shown in fig1 wherein the filters are represented as blocks . the filters f 3 , f 4 , f 5 and f 6 can consist of a simple passive filter stage having a single inductor and a single capacitor as described with reference to fig2 above . in an alternative embodiment each filter has plural lc pairs , fig8 illustrates an embodiment of the filter f 3 having two inductors and two capacitors . also when the filter has plural lc pairs , as shown in fig8 the above described relation between the filter time constant and the rise time of the lo signal applies . | 7 |
for the purpose of promoting an understanding of the present invention , references are made in the text to exemplary embodiments of a tray with an ergonomically designed handle , only some of which are described herein . it should be understood that no limitations on the scope of the invention are intended by describing these exemplary embodiments . one of ordinary skill in the art will readily appreciate that alternate but functionally equivalent sizes , shapes and materials may be used . the inclusion of additional elements may be deemed readily apparent and obvious to one of ordinary skill in the art . specific elements disclosed herein are not to be interpreted as limiting , but rather as a basis for the claims and as a representative basis for teaching one of ordinary skill in the art to employ the present invention . it should be understood that the drawings are not necessarily to scale ; instead emphasis has been placed upon illustrating the principles of the invention . in addition , in the embodiments depicted herein , like reference numerals in the various drawings refer to identical or near identical structural elements . moreover , the terms “ substantially ” or “ approximately ” as used herein may be applied to modify any quantitative representation that could permissibly vary without resulting in a change in the basic function to which it is related . fig1 shows a side perspective view of an exemplary embodiment of ergonomically designed tray 100 in use . visible are tray 10 and ergonomic handle 50 . the user holds onto ergonomically designed tray 100 by placing his or her palm on handle 50 and wrapping his or her fingers around handle 50 . fig2 shows a bottom perspective view of an exemplary embodiment of ergonomically designed tray 100 without handle 50 . visible is track component 15 which provides a means for attaching handle 50 to tray 10 . in the embodiment shown , base 18 of track component 15 is not orientated along the bottom edge of serving tray 10 but rather base 18 is located at a distance from the bottom edge of serving tray 10 . in the embodiment shown , rim 25 of tray 10 is larger than bottom 28 of tray 10 which allows tray 10 to be efficiently stacked with trays of similar dimensions when handle 50 is not attached to tray 10 . fig3 shows a bottom perspective view of an exemplary embodiment of ergonomically designed tray 100 which consists of tray 10 and handle 50 . in the embodiment shown , tray 10 is a standard large tray with bottom 28 having a diameter of 22 inches and rim 25 having a diameter of 27 inches . in other embodiments , serving tray 10 has a diameter between 11 inches and 30 inches . attached to the bottom of serving tray 10 is track component 15 . in the embodiment shown , track component 15 is orientated along the bottom edge of tray 10 and is made of aluminum and has a triangular shape with base 18 measuring 5 inches . in other embodiments , track component 15 is made of plastic , fiberglass , wood , layers of epoxy another type of metal , or another material , and / or is of another shape and size . in the embodiment shown , track component 15 has rails 20 a , 20 b on the two long sides of track component 15 . rails 20 a , 20 b are contoured to receive handle 50 having interlocking component 55 . in the embodiment shown , rails 20 a , 20 b are ⅝ inches high , have a 2 / 8 inch groove , and are 5 inches apart at base 18 . rails 20 a , 20 b taper inward from base 18 of track component 15 . in other embodiments , rails 20 a , 20 b have varying dimensions and / or are of a different design which corresponds to the size and shape of interlocking component 55 . handle 50 is attached to interlocking component 55 and is selectively attachable to tray 10 . edge 58 of interlocking component is of a height that fits between the grooves of rails 20 a , 20 b on track component 15 . interlocking component 55 and handle 50 are slid in the groove of rails 20 a , 20 b toward the center of serving tray 10 until wedged securely between rails 20 a , 20 b . handle 50 and interlocking component 55 may be selectively detached from tray 10 by moving interlocking component 55 and handle 50 out toward base 18 . in the embodiment shown , interlocking component 55 with handle 50 is secured in the middle of serving tray 10 . in the embodiment shown , interlocking component 55 is circular in shape and is made of metal , with edge 58 having a height that is slightly less than ⅝ inches , the height of rails 20 a , 20 b . in addition , the diameter of interlocking component 55 is greater than the diameter of handle 50 so that it protrudes beyond handle 50 which prevents handle 50 from being damaged and allows interlocking component 55 to be secured between rails 20 a , 20 b . fig4 shows a side perspective view of an exemplary embodiment of an assembled ergonomically designed tray 100 . visible are tray 10 , handle 50 and track component 15 . fig5 shows an exploded view of an exemplary embodiment of handle 50 for ergonomically designed tray 100 . in the embodiment shown , interlocking component 55 is circular in shape and has a diameter of 2 inches . in other embodiments , interlocking component 55 has a diameter of between 1¼ inches to 3½ inches and / or is of a different shape with varying dimensions . the diameter of interlocking component 55 will be larger than the diameter or dimensions of handle 50 and will correspond to the distance between rails 20 a , 20 b . in the embodiment shown , interlocking component 55 is metal . in other embodiments , interlocking component 55 may be made of a material other than metal , such as plastic or any other material which has an edge that is capable of being slid between rails 20 a , 20 b and which is strong enough to be secured between rails 20 a , 20 b and to support serving tray 10 . in the embodiment shown , handle 50 is cylindrical and ergonomically designed having a size and shape to fit any user providing comfort to the user and lessening the strain and fatigue of the user &# 39 ; s wrist . in the embodiment shown , handle 50 has a gripping surface which provides the user with a comfortable grip . in addition , handle 50 is easy to clean and maintain ( e . g ., can be cleaned in a dishwasher ). fig6 shows an exploded view of a second exemplary embodiment of handle 50 for ergonomically designed tray 100 . in the embodiment shown , interlocking component 55 is an isosceles trapezoid and is made of metal . in other embodiments , interlocking component 55 is circular in shape or is of any other shape capable of being wedged between rails 20 a , 20 b in order to secure handle 50 . in other embodiments , interlocking component 55 may be made of a material other than metal , such as plastic or any other material which has an edge that is capable of being slid between rails 20 a , 20 b and which is strong enough to be secured between rails 20 a , 20 b and to support serving tray 10 . in the embodiment shown , handle 50 is d - shaped and is ergonomically designed having a size and shape to fit any user providing comfort to the user and lessening the strain and fatigue of the user &# 39 ; s wrist . in the embodiment shown , the straight portion of handle 50 contains impressions for the four fingers which provide additional support and comfort to the user &# 39 ; s hand and wrist . in addition , handle 50 is easy to clean and maintain ( e . g ., can be cleaned in a dishwasher ). | 8 |
fig1 shows a rechargeable gas filter apparatus 10 which is particularly suitable for use in the nuclear field for removing radioactive constituents from a gas stream . the filter apparatus 10 comprises a housing 11 with an upper gas treating enclosure portion 12 and a lower hopper portion 14 open to the gas treating enclosure portion 12 . a plurality of spaced apart filter cells 16 are disposed within the upper gas treating enclosure portion 12 . each filter cell 16 comprises spaced apart parallel planar foraminous front and back walls 18 and 20 , respectively , an open top face 22 , closed end surfaces 24 and 26 , and an open bottom face 28 . the filter cells 16 are vertically disposed within the gas treating enclosure portion 12 with the foraminous front and back walls 18 , 20 of each filter cell being spaced from and parallel to adjacently disposed filter cells and the open bottom faces 28 of each filter cell facing toward and open to the hopper portion 14 of the filter apparatus 10 . a plurality of alternating dirty gas inlet passageways 30 and clean gas outlet passageways 32 are defined between the spaced apart filter cells 16 . the gas treating enclosure portion 12 of the gas filter apparatus 10 further comprises a plurality of dirty gas inlet apertures 34 formed in its upstream wall 36 , each dirty gas inlet aperture 34 communicating with a different one of the dirty gas inlet passageways 30 . likewise , a plurality of clean gas outlet apertures 38 are formed in the downstream wall 40 of the gas treating enclosure portion 12 , each clean gas outlet aperture 38 communicating with a different one of the clean gas outlet passageways 32 . means for charging the filter cells 16 with uncontaminated solid sorbent gas treating material , such as a granulated charcoal or activated carbon , may be situated in the gas treating enclosure portion 12 of the filter apparatus 10 . such a charging means is illustrated , for exemplary purposes , in the figures as a plurality of openings 42 in the top wall 44 of the gas treating enclosure portion 12 . each opening 42 can be closed by a cover 45 secured in place by virtually any one of a number of conventional means . any one of a number of solid sorbent charging means can be used . however , because the charging means does not comprise any part of the present invention , it will not be further discussed herein . with continued reference to fig1 and 2 , the hopper portion 14 of the filter apparatus 10 has at least two of its facing walls 46 and 48 sloping downwardly toward each other and intersecting each other at their depending edges , generally denoted at the numeral 50 , thus , defining a v - shaped configuration in transverse cross - section . the v - shaped hopper portion 14 is symmetrically disposed relative to the gas treating enclosure portion 12 . preferably , the sloping wall 46 is the wall of the hopper portion 14 which is adjacent the upstream wall 36 of the gas treating enclosure portion 12 and the sloping wall 48 is the wall of the hopper portion 14 which is adjacent the downstream wall 40 of the gas treating enclosure portion 12 so that the intersection of the sloping walls 46 , 48 is oriented transverse to the planar foraminous front and back walls 18 and 20 of the filter cells 16 . referring now to fig1 and 2 , means such as an elongated baffle plate 52 is disposed within the hopper portion 14 and cooperates with the sloping walls 46 , 48 of the hopper portion 10 to define a gas treating material conveying channel . the elongated baffle plate 52 is spaced above the intersection 50 of the sloping walls 46 , 48 of the hopper portion 14 . the baffle plate 52 preferably has a chevron shape in transverse cross - section with the apex of the chevron in line with and projecting upwardly away from the intersection 50 of the sloping walls 46 , 48 . the included angle of the chevron shaped baffle is advantageously approximately 90 °. the baffle plate 52 extends completely across the hopper portion 14 and is attached at one of its ends 56 to one side wall 58 of the housing 11 and at its other end 60 to the opposite side wall 62 of the housing 11 . the baffle plate 52 comprises two generally parallel longitudinal edges 64 and 66 . the longitudinal edge 64 of the baffle plate 52 is spaced from the sloping wall 46 adjacent to it . thus , two mutually parallel elongated slots 68 and 70 are defined , slot 68 between the longitudinal baffle edge 64 and the sloping hopper wall 46 , and slot 70 between the longitudinal baffle edge 66 and sloping hopper wall 48 . these elongated slots 68 and 70 are also parallel to the intersection 50 of the sloping hopper walls 46 and 48 . the interior 72 of the gas treating material conveying channel is thus open to or communicates with the interior of the hopper portion 14 only through the elongated slots 68 and 70 . now with reference to fig1 and 5 , a conveying gas inlet aperture 74 is formed through the filter housing side wall and opens into the interior 72 of the channel at one of the ends of the channel . similarly , a gas treating material and conveying gas outlet aperture 76 is formed through the opposite filter housing side wall 62 and opens into the interior 72 of the channel at the other end of the channel from the inlet aperture 74 . the gas treating material and conveying gas outlet aperture 76 is larger in area than the conveying gas inlet aperture 74 so that a greater negative pressure is created in the channel interior 72 proximate the conveying gas inlet 74 than at the other end of the channel interior 72 proximate the gas treating material and conveying gas outlet 76 . the conveying gas inlet aperture 74 is advantageously rectangular in peripheral shape , while the gas outlet aperture 76 is oval in peripheral shape ; however , other shapes , may be used . preferably , the conveying gas inlet 74 is located so that at least 50 % of its area is in that region , at the end of the channel , which is bounded by an imaginary transverse line a -- a ( see fig4 ) intersecting both the longitudinal edges 64 , 66 of the chevron shaped baffle plate 52 , the sloping surfaces of the chevron shaped baffle plate and the apex of the chevron shaped baffle plate 52 . likewise , the gas treating material and conveying gas outlet aperture 76 is located so that at least 50 % of its area in that region , at the other end of the channel , which is bounded by an imaginary transverse lline b -- b ( see fig5 ) intersecting both longitudinal edges 64 , 66 of the chevron shaped baffle plate 52 , the sloping surfaces of the chevron shaped baffle plate 52 , and the apex of the chevron shaped baffle plate 52 . it is also preferable that the intersection 50 of the sloping hopper walls 46 and 48 is as near to being tangential to the outlet aperture 76 as possible . now with reference to fig1 and 11 , the conveying gas inlet aperture 74 comprises a converging nozzle 78 , the aperture 74 being the outlet opening of the nozzle 78 . the convergent nozzle 78 is fitted through an appropriate opening in the housing side wall 58 and is secured to the side wall 58 , for example , by welding . as can be seen in fig1 , a collar 80 can be fitted around the periphery of the gas treating and conveying outlet aperture 76 so that a pneumatic hose may be connected thereto . fig6 and 7 illustrate another advantageous filter apparatus 110 which is also particularly suitable for use in the nuclear field for removing radioactive constituents from a gas stream . the filter apparatus 110 comprises a housing 111 with an upper gas treating enclosure portion 112 and a lower hopper portion 114 open to the gas treating enclosure portion 112 . a plurality of the filter cells 16 are disposed within the upper gas treating enclosure portion 112 in the same manner as they are in the filter housing 11 previously described , and likewise define the plurality of alternating dirty gas inlet passageways 30 and clean gas outlet passageways 32 therebetween . the gas treating enclosure portion 112 of the filter apparatus 110 further comprises a plurality of dirty gas inlet apertures 134 formed in its upstream wall 136 , each dirty gas inlet aperture 134 communicating with a different one of the dirty gas inlet passageways 30 . similarly , a plurality of clean gas outlet apertures 138 are formed in the downstream wall 140 of the gas treating enclosure portion 112 , each clean gas outlet aperture 138 communicating with a different one of the clean gas outlet passageways 32 . as with filter apparatus 10 , the filter apparatus 110 also includes means for charging or filling the filter cells 16 with fresh or uncontaminated solid sorbent material . the charging means is illustrated for exemplary purposes as the plurality of openings 42 in the top wall 144 of the gas treating portion 112 . each opening 42 can be closed by a cover 45 . because the charging means does not comprise a part of the present invention , and because any one of a number of solid sorbent charging means may be used , it will not be further discussed . with continued reference to fig6 and 7 , the hopper portion 114 of the filter apparatus 110 has at least two of its facing walls 146 and 148 sloping downwardly toward each other from their points of attachment to the upstream wall 136 and downstream wall 140 , respectively , of the gas treating enclosure portion 112 . the sloping walls 146 and 148 each terminate at distal ends 147 and 149 , respectively . elongated trough means 151 having a generally rectangular shape in transverse cross - section is disposed between and connected to , or integrally formed with , the distal ends 147 and 149 of the sloping walls 146 and 148 . elongated trough means 151 is open to the interior of the hopper portion 114 and extends completely across the hopper portion from one side wall 158 of the filter housing 111 to the other side wall 162 of the filter housing 111 with the longitudinal axis of the elongated trough 151 being transverse to the planar foraminous surfaces 18 and 20 of the filter cells 16 disposed in the upper gas treating enclosure portion 112 . still referring to fig6 and 7 , means , such as the elongated baffle plate 52 is disposed within the trough 151 and cooperates with the walls of the trough 151 to define a gas treating material conveying channel . the elongated baffle plate 52 preferably has a chevron shape in transverse cross - section with the apex of the chevron projecting upwardly out of the trough 151 and toward the filter cells 16 located above it in the gas treating enclosure portion 112 . the baffle 52 extends completely across the hopper portion 114 , and therefore the full length of the trough 151 , and is attached at one of its ends 56 to one side wall 158 of the housing 111 and at the other of its ends 60 to the opposite side wall 162 of the housing 111 . the longitudinal edge 64 of the baffle plate 52 is spaced from the wall of the trough 151 adjacent to it , and the other longitudinal edge 66 of the elongated baffle plate 52 is spaced from the walls of the trough 151 adjacent to it . thus , the two mutually parallel elongated slots 68 and 70 are defined , slot 68 between the longitudinal baffle edge 64 and the wall of the trough 151 adjacent thereto , and slot 70 between the longitudinal baffle edge 66 and the wall of the trough 151 adjacent thereto . the interior 72 of the gas treating material conveying channel is thus open to , or communicates with , the interior of the hopper portion 112 only through the elongated slots 68 and 70 . now referring to fig6 and 9 , a conveying gas inlet aperture 74 is formed through the filter housing side wall 158 and opens into the interior 72 of the channel at one of the ends of the channel . similarly , a gas treating material and conveying gas outlet 76 is formed through the opposite filter housing side wall 162 and opens into the interior 72 of the channel from the inlet aperture 74 . the gas treating material and conveying outlet aperture 76 is larger in area than the conveying gas inlet aperture 74 so that a greater negative pressure is created in the channel interior 72 proximate the conveying gas inlet aperture 74 than at the other end of the channel interior 72 proximate the gas treating material and conveying gas outlet aperture 76 . the conveying gas inlet aperture 74 is advantageously rectangular in peripheral shape and the outlet aperture 76 is oval in peripheral shape ; however , other shapes may be used . preferably , the conveying gas inlet aperture 74 is located so that at least 50 % of its area is in that region , at the end of the channel , which is bounded by an imaginary transverse line c -- c ( see fig8 ) intersecting the longitudinal edges 64 and 66 of the chevron shaped baffle plate 52 , the sloping surfaces of the chevron shaped baffle plate 52 , and the apex of the chevron shaped baffle plate . likewise , the gas treating material and conveying gas outlet aperture 76 is located so that at least 50 % of its area is that region , at the other end of the channel , which is bounded by an imaginary transverse line d -- d ( see fig9 ) intersecting both longitudinal edges 64 , 66 of the chevron shaped baffle plate 52 , the sloping surfaces of the chevron shaped baffle plate 52 , and the apex of the chevron shaped baffle plate 52 . it is also preferable that the bottom wall of the trough 151 is as near to being tangential to the outlet aperture 76 as possible . with reference again to fig1 and 11 , as with the filter apparatus 10 , the conveying gas inlet aperture 74 of the filter apparatus 110 comprises the converging nozzle 78 , the inlet aperture 74 being the outlet opening of the nozzle 78 . the convergent nozzle 78 is fitted through an appropriate opening in the housing side wall 158 and is secured to the side wall 158 , for example , by welding . as can be seen in fig1 , a collar 80 can be fitted around the periphery of the gas treating material and conveying gas outlet aperture 76 so that a pneumatic hose may be connected thereto . referring now to fig1 , there is shown a closed loop pneumatic gas treating material removing system , generally denoted as the numeral 210 , which comprises either the gas filter apparatus 10 or 110 . the closed loop pneumatic gas treating material removing system 210 also comprises a blower 213 having its outlet or pressure side 215 operatively connected to the conveying gas inlet aperture 74 into the interior 72 of the gas treating material conveying channel of the filter apparatus 10 , 110 by means of , for example , a conveying gas conduit 217 . the inlet or suction side 219 to the blower 213 is operatively connected to the gas treating material and conveying gas outlet 76 from the interior 72 of the gas treating material conveying channel of the filter apparatus 10 , 110 by means of , for example , a conveying gas conduit 221 . interposed between the blower inlet 219 , and the gas treating material and conveying gas outlet 76 in the conveying gas conduit 221 is a gas treating material separator and reservoir device 223 for separating the contaminated gas treating material , and at least one high efficiency gas filter device 225 . the conveying gas conduit 221 is comprised of three sections : 227 , 229 and 231 . the first section 227 connects the gas treating material and conveying gas outlet aperture 76 with the separator and reservoir device 223 . the end 232 of the conduit section 227 which is connected to the separator and reservoir device 223 projects downwardly through the top 233 of the separator and reservoir device 223 a short distance into its interior . the second conduit section 229 interconnects the separator and reservoir device 223 with the gas filter device 225 . the end 235 of the conduit section 229 connected to the separator and reservoir device 223 also projects downwardly through the top 233 a short distance into its interior . the other end 237 of the second conduit section 229 terminates at the upstream side 239 of the gas filter device 225 . the third conduit section 231 interconnects the downstream side 241 of the filter device 225 and the low pressure inlet 219 of the blower 213 . in operation , in order to evacuate or remove contaminated solid sorbent gas treating material ( indicated by the mottling in the various figures ) from the filter housing 11 , 111 the blower 213 is actuated to provide a flow of high pressure conveying gas , in this instance , air . this flow of high pressure air is conveyed through the conveying gas inlet aperture 74 and into the interior 72 of the gas treating material conveying channel . as the conveying gas stream passes through the conveying nozzle 78 and into the interior 72 of the channel , it is accelerated . as the conveying gas stream flows along the interior of the channel to the gas treating material and conveying gas outlet aperture 76 it causes the solid sorbent gas treating material in the hopper section 14 , 114 to be aspirated through the longitudinal slots 68 , 70 into the interior 72 of the conveying channel first at the end of the channel proximate the inlet aperture 74 , and then progressing along the entire length of the channel . the accelerated conveying gas stream in the channel interior proximate the conveying gas inlet aperture 74 causes a part of the static gas pressure at this point to be converted into velocity pressure thereby increasing the negative static pressure . therefore , there is a greater negative static pressure in the channel interior 72 proximate the inlet aperture 74 than there is toward the other end of the channel interior 72 proximate the outlet aperture 76 and this causes the hopper to be emptied from the end proximate the inlet aperture 74 first . if the negative static pressure in the channel interior 72 was constant along its length , or if the negative static pressure in the channel interior proximate the outlet aperture 76 was greater than the negative static pressure proximate the inlet aperture 74 , solid sorbent gas treating material would aspirate into the channel interior 72 first proximate the outlet aperture 76 but would not progressively aspirate into the channel interior 72 along the longitudinal slots 68 , 70 toward the inlet aperture 74 and the blower 213 would merely suck air instead . the gas treating material within the channel interior 72 is carried by the conveying gas stream out of the channel interior 72 through the gas treating material and conveying gas outlet aperture 76 due to the suction in the conveying gas conduit 221 due to the fact that the conveying gas conduit 221 is interconnected to the suction side of the blower 213 . the conveying gas borne gas treating material passes through the first conduit section 227 to the gas material separator and reservoir device 223 . the gas borne gas treating material exits the first conduit section 227 through its downwardly projecting open end 231 into the interior of the separator and reservoir 223 . because the open end 235 of the second conduit section 229 is covered with a particulate matter separating material ( not shown ) essentially all of the solid sorbent gas treating material is separated out of the conveying gas stream . the conveying gas stream , now relatively free of solid sorbent gas treating material , passes through the second conduit section 229 to the upstream side 239 of the gas filter device 225 , and through the gas filter device 225 from its upstream side 239 to its downstream side 241 wherein any residual gas treating material is separated from the conveying gas stream . upon leaving the downstream side 241 of the filter device 225 the conveying gas enters the third conduit section 231 and passes there along to the inlet or suction side 219 of the blower 213 wherefrom it is recirculated through the pneumatic conveying system 210 . when the gas treating material separator and reservoir 223 become full of separated gas treating material , the blower 213 is temporarily deactivated . the top 233 is removed from the separator reservoir 223 which is then removed from the pneumatic conveying system 210 and disposed of . an empty separator and reservoir device 223 is put in place of the removed full one and the top 233 is put in place over the empty separator and reservoir device 223 . the blower is reactivated and the above described process is continued . the foregoing detailed description is given primarily for clearness of understanding and no unnecessary limitations should be understood therefrom for modifications will be obvious to those skilled in the art upon reading this disclosure any may be made without departing from the spirit of the invention or the scope of the appended claims . | 6 |
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . referring to the drawings , and particularly fig1 and 2 , the invention consists of a fuel pump module having a modular flange 20 with an integrated fuel vapor manifold 22 , for attachment to an automobile fuel tank 11 . the flange 20 of the module 10 is attached to an opening in the fuel tank wall 11 , and seals the interior volume of the fuel tank from the outside atmosphere . as illustrated , the flange 20 comprises an integrated vapor manifold 22 for the collection of fuel vapor 17 from one or more vent valve inlets within the fuel tank 11 and merges them into a single outlet port 26 leading to a remote vapor storage canister 60 or other desired location . optionally , the flange 20 is sealed to the fuel tank 11 by a sealing means 24 , but the scope of invention is not intended to be limited by the means in which the flange 20 is attached to the fuel tank wall 11 . the manifold 22 integrated into the modular flange 20 , consists of a manifold chamber 27 having an aperture at one end passing through the flange 20 defining a receptacle 21 , for receiving the interface portion 46 of an attached vent valve 40 on the bottom side of the modular flange 20 . in the preferred embodiment , the manifold 22 further defines a secondary vapor inlet 90 wherein the vapor collected from a secondary vent valve 50 or other remote source 14 within the fuel tank 11 enters the manifold 22 and combines with the vapor from the primary vent valve 40 . the combined fuel vapors from the multiple of vent valves within the tank 11 illustrated by the arrow 18 , merge and exit the manifold 22 through the outlet tube 26 as indicated . the outlet tube 26 attaches to an external vapor tube 62 which carries the fuel vapor to a remote canister 60 for storage , or holding prior to being routed to the engine and burned . as stated , the flange 20 and incorporated manifold 22 provide for the direct attachment of one or more primary vent valve 40 directly to the bottom side of the flange 20 . each valve 40 is typically cylindrical in shape , and has a vapor inlet 42 wherein fuel vapor 17 travels from the interior of the fuel tank 11 into the valve 40 assembly as shown by the arrow 12 . inside the vent valve 40 but not shown , is a check valve which allows the fuel vapor 17 to exit into the manifold 22 while preventing any fuel 19 that may splash onto the vent valve 40 from traveling up into the manifold chamber 27 . the valve 40 further serves to protect against fuel discharge through the vapor system in the event of inadvertently overfilling the tank 11 during refueling . best illustrated in fig2 , the generally cylindrical interface portion 46 of the upper end of the valve 40 is concisely received by the corresponding valve receptacle 21 located on the manifold 22 . the interface portion comprises a vapor passage from the valve 40 to the manifold 22 , allowing vapor to pass from the valve 40 into the manifold chamber 27 . in the preferred embodiment , a sealing means such as an o - ring 47 , is shown implemented in an annular grove on the interface portion 46 of the valve 40 further preventing fuel 19 from passing up into the manifold chamber 27 . if the frictional fit between the interface portion 46 of the vent 40 , the receptacle 21 on the manifold 22 and the sealing means 47 is tight enough , the valve 40 will be retained securely by the flange 20 , wherein further means of attachment may not be necessary . alternatively , a second means of attaching the valve 40 to the flange 20 as shown in fig2 and 3 utilizes a snap - fit design , wherein a wedge - shaped vertical tab 44 on the exterior of the vent valve 40 biases the wall 32 of the flange 20 outward upon contact as the valve 40 is inserted upwards into the receptacle 21 . once fully inserted , the tab 44 is received through an aperture 25 on the wall 32 allowing the wall 32 to snap back to its original position locking the vent valve 40 in position . this snap - fit means of attachment provides a more secure connection between the valve 40 and the modular flange 20 , which may be preferable in fuel vent applications that expose the fuel pump module 10 to more severe jarring . often times as illustrated in fig1 , it is desirable to have a remotely mounted vapor vent valve 30 for the collection of vapor from a portion of a fuel tank 11 distal to the fuel pump modular flange 20 that may be vaporly compartmentalized due to the design of the tank . the remote vent valve 30 may be mounted to the tank 11 through a second aperture 15 in the tank wall or by some other means , but is not intended to limit the scope of the invention . the vent valve 30 discharges vapor to the internal vent line 34 that carries the vapor 17 from the remote valve 30 to the modular flange 20 , where it connects to a manifold adapter 80 illustrated in fig4 , which attaches to the modular flange 20 at surface 92 . the adaptor 80 comprises a vapor chamber 83 defined by walls 82 , 84 and 86 which is open on the bottom defining a receptacle for receiving a secondary vent valve 50 , attached by similar means as the primary vent valve 40 is attached to the modular flange 20 , shown in fig2 and 3 . additional fuel vapor 17 may enter the secondary vent valve 50 through aperture 52 , as indicated by the arrow 16 . referring to fig3 and 4 together , the manifold adapter 80 comprises a remote vapor inlet tube 87 leading into the vapor chamber 83 , which connects with the internal vent line 34 from the remote vent valve 30 at end 81 . fuel vapor which 17 enters the remote vent valve 30 , travels into the manifold adapter 80 as indicated by the arrow 14 wherein it merges with vapor collected through the secondary valve 50 . the combined vapors exit the manifold adapter 80 through a tapered exit port 89 in the top of the adapter 80 , defined by an extended outlet tube 88 , terminating within the manifold 22 when attached thereto . the adapter 80 in the preferred embodiment is welded to the underside of the manifold 22 , in a manner so as to maintain a small gap or passage around the extended outlet tube 88 as shown in fig3 . the extension of the outlet tube 88 provides for a high point of vapor exit from the manifold adapter 80 into the manifold 22 , while the gap allows fuel 19 that may inadvertently bypass the primary vent valve 40 to drain back into the tank 11 instead of undesirably entering the internal vent line 34 . the fuel vapors collected through arrows 14 and 16 , commingle with each other in the manifold adapter 80 before entering the manifold 22 and commingling with the vapors collected through the primary vent valve 40 as indicated by the arrow 12 . the combined vapors , now indicated by arrow 18 , exit the manifold 22 through the single outlet tube 26 which attaches to the external vapor tube 62 , carrying the fuel vapor to canister 60 for storage , prior to being routed to the engine and burned . there is thus provided a fuel pump module incorporating fuel vapor collected through one or more vapor vent valves both proximal and distal to the modular flange by an integrated manifold having a single outlet , which significantly reduces the potential sources for fuel vapor emissions into the atmosphere . | 1 |
the embodiments of the invention and the various features and advantageous details thereof are more fully explained with reference to the non - limiting embodiments and examples that are described and / or illustrated in the accompanying drawings and set forth in the following description . it should be noted that the features illustrated in the drawings are not necessarily drawn to scale , and the features of one embodiment may be employed with the other embodiments as the skilled artisan recognizes , even if not explicitly stated herein . descriptions of well - known components and techniques may be omitted to avoid obscuring the invention . the examples used herein are intended merely to facilitate an understanding of ways in which the invention may be practiced and to further enable those skilled in the art to practice the invention . accordingly , the examples and embodiments set forth herein should not be construed as limiting the scope of the invention , which is defined by the appended claims . moreover , it is noted that like reference numerals represent similar parts throughout the several views of the drawings . turning now to the invention , fig1 a , 1 b are views of the first embodiment of the invention 1 . a quick actuation valve 20 such as a ball or butterfly valve is attached to the threaded output end of a hose bib 100 . the quick actuation valve 20 includes a body formed of a rigid material and having a first end 21 which comprises a collar having female hose threads that mates with the external threads on a hose bib . the collar is constructed to allow it to rotate relative to the body of the valve 20 . it should be noted that the valve 20 may comprise threads that mate with external threads on a sink faucet or other interior water dispensing device . an o - ring 150 shown in fig5 c is seated within the collar for preventing leaks between the threaded end of the hose bib and the collar . a second end 22 includes external hose threads for accepting a garden or yard hose . the quick actuation valve 20 is installed by mating the threaded collar onto the output end of the hose bib 100 . thereafter , the valve 20 is closed and the handle of hose bib 100 is twisted into the open position allowing water pressure to build within valve 20 . a proximal end of the elongated member 10 includes a handle 12 . in the first embodiment , a distal end 11 of elongated member 10 includes a pair of prongs 13 . each prong 13 includes a flat end 14 . each flat end 14 includes at least one through opening for accepting fastener 25 to affix a distal end of the elongated member 10 to a valve stem 23 of valve 20 via threaded openings 26 in ears 24 which extend outward from valve stem 23 . elongated member 10 further comprises a plurality of nested members , collectively represented as element 15 in the drawings and which telescope to a length of substantially five feet ( 5 ′). each nested member is configured to transfer torque between handle 12 and prongs 13 to allow for the valve stem 23 to be twisted from an open to a closed position and vice versa . during operation , the elongated member 10 may be passed through a bush and extended during use and semi - collapsed back into the bush during nonuse . as can be realized , the handle 12 can be twisted to exert torque onto the valve stem 23 to turn it a short distance , preferably ninety degrees to actuate the valve 20 . in this manner , one is not required to enter into bushes to perform lawn and plant irrigation operations . crimps may be provided along each of the elements 15 to ensure torque transfer between the handle 12 and valve stem 23 . fig2 a , 2 b show a second embodiment of the invention . in this instance , the distal end of the elongate member 10 comprises a circular member 30 having two through holes . fasteners 25 pass through the through holes and into threaded openings 22 in valve stem 23 to fasten the distal end 11 of the elongated member 10 to the valve 20 . the operation of this embodiment is essentially the same as that mentioned above with respect to fig1 a , 1 b . fig3 a , 3 b show a third embodiment of the invention . the distal end 11 includes a machined portion , in this instance , a hexagon shaped end 35 , that mates with a complementary shaped recess 28 of the valve stem . the user inserts end 35 into recess 28 to turn the valve 20 on / off . the operation of this embodiment is the same as mentioned above . fig4 a , 4 b show a fourth embodiment of the invention . the valve stem 23 includes a plurality of undulations 29 which mate with complementary undulations 41 arranged with recess 40 . the valve operation is the same as mentioned previously . fig5 a - 5c show a fifth embodiment of the invention which comprises a coupler 50 having a pair of yokes 51 , 52 linked together with pin 56 and which includes coupling end 53 that adjoins the distal end 11 of the elongated member 10 to the valve stem in a manner such that two axis of rotation are provided to allow the handle to be elevated and traversed simultaneously . this simultaneous movement ability coupled with the telescoping features of the elongated member provides a universal three dimensional adjustment ability to the instant invention . first yoke 51 comprises a recess 54 having a plurality of undulations which are complementary of those shown on the valve stem ( not shown in fig5 a ) and similar to those indicated in fig4 a , 4 b . the body of yoke 51 includes a pair of ears 61 having openings 55 through which pin 56 couples the yokes 51 , 52 together . the second yoke 52 also includes a pair of ears 62 having an opening into which pin 57 is seated . pin 57 passes through opening 58 of coupling end 53 to it to the second yoke 52 . coupling end 53 includes a cylindrical end 59 which is seated in the distal end 11 of elongated member 10 . in this manner , the handle may be raised to a desired elevation and traversed left and right of the hose bib . it should be noted that coupling end 53 is flexible and not attached to ears 62 other than with the pin 57 to allow it to move up / down freely . it is to be understood that the invention is not limited to the exact construction illustrated and described above . various changes and modifications may be made without departing from the spirit and the scope of the invention as defined in the following claims . for instance , the various the coupler having yokes and shown in fig5 a - 5c may be modified to include the various ends that mate with the valve stem of the embodiments shown in fig1 - 4 . | 4 |
the clays used in the present invention are preferably a smectite clay . a smectite clay is a natural or synthetic clay mineral selected from the group consisting of hectorite , montmorillonite , bentonite , beidelite , saponite , stevensite and mixtures thereof . a particularly preferred choice for the smectite is montmorillonite . when these are uniformly dispersed as individual molecules , they form nanocomposites with polymer matrices . in this case they are used to make a water based nanocomposite coating with good properties for the application of pigment retention . the polymers used are preferably transparent or translucent , and weather the outdoors well due to high chemical and uv resistance . they are also water dispersible and water based in their delivery system . the blend of the clay and polymer dispersions into a coating results in exceptional weathering properties while retaining surface pigments on decorative concrete . a preferred embodiment is aliphatic urethane due to it &# 39 ; s low toxicity , ease of handling , and superior weathering properties . other preferred materials include but are not limited to water soluble alkyde resins , epoxies , acrylic resins , polyester styrene acrylic resins , vinyl acrylic resins and other water soluble resins . commercial polyurethane is typically about 30 % polyurethane with the remainder mostly water . in forming the composition of the present invention , an aliphatic polyurethane is added to water to form a more dilute aqueous solution . preferably there is 10 - 300 g of aliphatic urethane per liter of water . to the aqueous solution of polyurethane 1 - 100 g of clay are added . the ratio of clay to aliphatic polyurethane is preferably about ⅓ - 1 . 3 : 1 . more preferably there is 10 wt . % polyurethane and with 1 . 5 - 3 wt % clay in the blend with the remainder water . in still another embodiment the ratio of materials is about 100 grams of clay to 1000 grams of polyurethane in one liter of water . at lower concentrations of polyurethane such as about 1 % by weight polyurethane there is almost as much clay as there is polyurethane , i . e ., about 1 % clay with the remainder water . thus the formulation can be a 50 - 50 blend of polyurethane and clay in an aqueous solution the surface pigments or other surface additives can also be applied to the concrete after the concrete has been cured and no longer in a liquid state . in this approach , hardened concrete is treated with a coating of an aqueous solution of a water soluble polymeric material and a clay . the solution is applied to the concrete by any suitable means . over the coating of the aqueous solution the desired surface pigment or other surface additive is applied . the aqueous solution of the polymeric material can be applied to the concrete by dipping , by a spray , by a brush , or other suitable means . other suitable means includes by robotically applying by an automatic spray booth , a fluidized be process , etc . after the aqueous solution is applied , the concrete article can be air cured at ambient temperature or at higher temperatures to speed the curing . in addition , the concrete can be heated before the application of the aqueous solution . curing of the aqueous solution can be accomplished in a variety of ways such as by radiofrequency or the use of a curing agent with or without an accelerant . the curing agent can be an amine or nitrogen containing organic group susceptible to an addition reaction to the polymer phase . the curing agent could be an alcohol or oxygen containing aldehyde , ketone , carbonyl epoxy , ether , ester , organic and or other oxygen containing reactive group capable of addition reactions to the polymer . artificial stone made from concrete and surface pigmented with iron oxide ( to give a weathered stone appearance ) was made when concrete was poured into a pvc elastomer mold containing the iron oxide pigment on the inner mold surface . the samples were roughly 3 inches by five inches in dimension . one surface bore the pigment , and this surface was treated with an aqueous solution of aliphatic polyurethane at 5 % by weight solids with 5 % by weight sodium bentonite . the 90 % remaining is deionized water . the resulting coating visibly augmented pigment retention after subjecting the coated sample and a control to repeated freeze - thaw cycles . after 9 cycles , the samples were removed and subjected to a cloth wipe at moderate pressure . the control sample visibly lost pigment as evidenced by the staining of the control cloth wipe sample . the sample coated with the composition of the present invention was not releasing pigments as evidenced by a non stained white cloth after a coated sample wipe . the wipe was made with a rough but soft cotton rag and the rub carried out with moderate force (˜&# 39 ; 11 b pressure ). the coated and control samples were both frozen and then subjected to wipe procedures . in another example a formulation consisting of 10 % solids aliphatic polyurethane and 2 % clay was coated onto the above described and manufactured artificial stone and resulted in a shiny version of the coating with similar wipe test results after freeze - thaw . | 2 |
referring first to fig1 and 2 , reference numeral 1 generally indicates a tank or boiler forming part of the system for cooking - cooling food by immersion under forced and diffuse convection of the present invention . the mentioned tank 1 is designed to house the food which will be subjected to a cooking and subsequent cooling treatment , or cooking alone , or cooling alone , or another treatment , such as for example , pasteurization . the food to be treated is typically housed in metal molds arranged in support trays 15 stacked in different stacks 17 a , 17 b , as shown in fig1 a and as will be explained below in relation to fig4 and 5 . the mentioned tank 1 can form part of an installation like the one described in the mentioned international patent application wo 03 / 096815 , of this applicant , and it preferably has a side loading and unloading opening 22 provided with a hermetically sealing side sliding door 23 ( fig2 ) that is able to withstand internal pressure , such as for example , the one described in the mentioned international patent application pct / es 2004 / 000145 , of this applicant . nevertheless , the system and method of the present invention can also be applied to a tank with an upper loading - unloading opening . the tank 1 is provided with filling means 24 for filing said tank 1 with a cooking or cooling liquid and emptying means 25 for draining said cooking or cooling liquid from tank 1 . these filling and emptying means 24 , 25 can usually comprise conduits , valves and pumping means for connecting the tank with other tanks , deposits , other liquid sources , drains , etc . the installation can include heating means and cooling means for heating or cooling the liquid before it is introduced in the tank . in the embodiment shown in the figures , tank 1 includes heating means for heating the liquid inside the tank which comprise , as is known , a series of steam inlets 14 a , 14 b arranged to bubble steam through the cooking liquid inside tank 1 . these steam inlets 14 a , 14 b are incorporated in steam nozzles located strategically inside tank 1 and connected to a steam supply conduit 26 . however , these heating means inside tank 1 are not essential for the application of the system and method of the present invention . tank 1 comprises a first outer side wall 7 and a second outer side wall 8 opposite to and facing the first one , and at least two distinguished regions : a lower region 1 a and an upper region 1 b having respective first lower side wall 7 a and first upper side wall 7 b associated to said first outer side wall 7 and respective second lower side wall 8 a and second upper side wall 8 b associated to said second outer side wall 8 . there is a lower outlet chamber 9 a formed between the first lower side wall 7 a and the first outer side wall 7 of tank 1 , which chamber is communicated through a first duct 11 with an upper inlet chamber 10 b formed between the first upper side wall 7 b and the first outer side wall 7 . in a similar manner , there is an upper outlet chamber 9 b between the second upper side wall 8 b and the second outer side wall 8 , which chamber is communicated through a second duct 12 with a lower inlet chamber 10 a formed between the second lower side wall 8 a and said second outer side wall 8 . each of the first and second lower side walls 7 a , 8 a of the lower region 1 a and of the first and second upper side walls 7 b , 8 b of the upper region 1 b are carried out in respective plates , each of which incorporates a plurality of holes forming corresponding lower outlets and inlets 3 a , 4 a and upper outlets and inlets 3 b , 4 b . pumping means 13 are connected to said first duct 11 to propel the cooking or cooling liquid therein for the purpose of establishing a transverse circulation of the cooking or cooling liquid inside the upper and lower regions 1 a , 1 b of the tank . this circulation is established by taking in the cooking or cooling liquid from the inside of the lower region 1 a through the lower outlets 3 a located in the first lower side wall 7 a and introducing it inside said upper region 1 b through the upper inlets 4 b located in the first upper side wall 7 b , and taking in cooking or cooling liquid from the inside of the upper region 1 b through the upper outlets 3 b located in the second upper side wall 8 b and introducing it inside the lower region 1 a through the lower outlets 4 a located in the second lower side wall 8 a . the mentioned pumping means 13 are adapted and sized so as to force a turbulent circulation of the cooking or cooling liquid inside the lower and upper regions 1 a , 1 b of tank 1 . as indicated by means of arrows in fig1 , the transverse circulation of the cooking or cooling liquid in each of the lower and upper regions 1 a , 1 b preferably occurs in opposite directions . in fig2 , the continuous line arrows indicate the circulation in the upper region 1 b whereas the dotted line arrows indicate the circulation in the lower region 1 a in an opposite direction . this transverse circulation forms a forced and diffuse convection in turbulent flow . for the purpose of diffusing the mentioned transverse circulation in both the upper and lower regions 1 a , 1 b of tank 1 as much as possible , the lower outlets and inlets 3 a , 4 a and the upper outlets and inlets 3 b , 4 b are distributed in a significant area of their corresponding first and second lower side walls 7 a , 8 a and first and second upper side walls 7 b , 8 b . fig3 shows , by way of example , a possible distribution of the upper inlets 4 b of a plate forming the upper side wall 7 b . it will be observed that the upper inlets 4 a comprise a large number of small holes distributed regularly on the entire plate except in a central area 27 which is facing the outfall of the duct 11 in the upper inlet chamber 10 b . thus , a jet of cooking or cooling liquid leaving duct 11 collides with said hole - free central area 27 and the flow is distributed throughout the entire upper inlet chamber 10 b until it leaves through the holes 4 a in a substantially uniform manner . the plates forming the remaining side walls 7 b , 8 a , 8 b of the upper and lower regions 1 a , 1 b have similar dimensions and have a similar configuration and distribution of holes . the vertical circulation of the cooking or cooling liquid between the lower region 1 a and the upper region 1 b of tank 1 is restricted by a plate 5 interposed between them . as will be observed in fig1 , the mentioned emptying means 25 are arranged in relation to the lower region 1 a of tank 1 , and said plate 5 comprises perforations 6 to allow the draining by gravity of the cooking or cooling liquid from both the lower and upper regions 1 a , 1 b through the emptying means 25 . each of the lower and upper regions 1 a , 1 b is provided with one of the mentioned steam nozzles . thus , a lower steam nozzle comprises a plurality of lower steam inlets 14 a arranged to bubble steam through the cooking liquid close to the lower outlets 3 a inside the lower region 1 a of tank 1 , and an upper steam nozzle comprises a plurality of upper steam inlets 14 b arranged to bubble steam through the cooking liquid close to the upper outlets 3 b inside the upper region 1 b . this arrangement prevents the formation of pockets of steam that are detrimental to the cooking process because the steam is mixed with the cooking liquid in the lower and upper intake inlets 3 a , 3 b in the respective lower and upper regions 1 a , 1 b . in reference to fig4 , this figure shows one of the mentioned support trays 15 for supporting the food to be cooked - cooled . the support trays 15 are designed to be stacked forming stacks 17 a , 17 b ( one of which is shown in fig5 ) that are suitable for being handled by automatic handling means and for being loaded and unloaded inside tank 1 , as described in the cited international patent application wo 03 / 096815 . to that end and as shown in fig1 and 1a , tank 1 comprises lower supporting means 16 a for supporting one or more lower stacks 17 a of support trays 15 inside the lower region 1 a and upper supporting means 16 b for supporting one or more upper stacks 17 b of support trays 15 inside the upper region 1 b . in the embodiment shown in fig2 , tank 1 has depth that is enough to house two lower stacks 17 a in the lower region 1 a and two upper stacks 17 b ( shown by means of dotted lines ) in the upper region 1 b . accordingly , the circulation means comprise two lower outlet chambers 9 a ( not shown ) communicated through respective first ducts 11 with two respective upper inlet chambers 10 b , and two upper outlet chambers 9 b communicated through respective second ducts 12 with two respective lower inlet chambers 10 a ( not shown ), for the purpose of generating the transverse circulation of the liquid mainly where the lower and upper stacks 17 a , 17 b are housed . the two first ducts 11 can meet at their middle part for the installation of a single pump 13 . as can be observed in fig1 a , the lower and upper stacks 17 a , 17 b are sized to leave reduced spaces therearound inside tank 1 to contribute to accelerate and direct the circulation of the cooking or cooling liquid . it is evident that the depth of the tank can be enough for a single stack in each region or for more than two . the tank could also be easily extended to more than two regions in the vertical direction by means of one or more additional dividing plates and a corresponding adaptation of the liquid circulation means and heating means . to facilitate the transverse circulation of the cooking or cooling liquid from one side of the support tray 15 to the other , even when the support trays 15 form part of one of the lower or upper stacks 17 a , 17 b in one or the other of the lower and upper regions 1 a , 1 b of tank 1 , each support tray 15 ( fig4 ) includes at least one configuration comprising at least one double bottom 18 joined to a bottom 20 of the support tray 15 by transverse partitions 21 delimiting spaces 19 for the transverse circulation of the cooking or cooling liquid . thus , each lower or upper stack 17 a , 17 b ( one of which is shown in fig5 ) comprises multiple transverse passages allowing the circulation of the liquid therethrough . the present invention also comprises a method suitable to be carried out by means of the system described above . the method for cooking - cooling food by immersion under forced and diffuse convection according to the present invention comprises well known steps , such as first arranging the food to be cooked - cooled inside at least one tank 1 , filling said tank with a cooking or cooling liquid , optionally heating said cooking or cooling liquid inside tank 1 in the event of cooking , and only if necessary , and finally draining the cooking or cooling liquid from tank 1 . the method of the invention also comprises taking in cooking or cooling liquid from the inside of a lower region 1 a of tank 1 through at least one lower outlet 3 a located in a first lower side wall 7 a of said lower region 1 a , and introducing it inside an upper region 1 b of tank 1 through at least one upper inlet 4 b located in a first upper side wall 7 b of said upper region 1 b , and simultaneously taking in cooking or cooling liquid from the inside of the upper region 1 b through at least one upper outlet 3 b located in a second upper side wall 8 b of the upper region 1 b and introducing it inside the lower region 1 a through at least one lower inlet 4 a located in a second lower side wall 8 a of the lower region 1 a . the method further comprises facilitating a transverse circulation in opposite directions of the cooking or cooling liquid in the lower region 1 a and in the upper region 1 b respectively , by arranging said first lower side wall 7 a opposite to and facing said second lower side wall 8 a and said first upper side wall 7 b opposite to and facing said second upper side wall 8 b . for the purpose of diffusing said transverse circulation of the cooking or cooling liquid , the method comprises arranging a plurality of said lower outlets 3 a distributed in a significant area of the first lower side wall 7 a of the lower region 1 a , a plurality of said upper inlets 4 b distributed in a significant area of the first upper side wall 7 b of the upper region 1 b , a plurality of said upper outlets 3 b distributed in a significant area of the second upper side wall 8 b of the upper region 1 b , and a plurality of said lower inlets 4 a distributed in a significant area of the second lower side wall 8 a of the lower region 1 a . the method also comprises forcing a turbulent transverse circulation of the cooking or cooling liquid by connecting the lower outlets 3 a with the upper inlets 4 b through at least one first duct 11 , connecting the upper outlets 3 b with the lower inlets 4 a through at least one second duct 12 , and propelling the cooking or cooling liquid at least inside said first duct 11 by means of pumping means 13 . it is also a part of the present method to restrict a vertical circulation of the cooking or cooling liquid between the lower region 1 a and the upper region 1 b of tank 1 by interposing a plate 5 between them , allowing however the draining of the cooking or cooling liquid from both the lower and upper regions 1 a , 1 b through emptying means arranged in relation to the lower region 1 a of tank 1 by providing perforations 6 in said plate 5 . the method of the invention also comprises arranging the food to be cooked - cooled in a plurality of support trays 15 that are stacked forming at least one lower stack 17 a inside the lower region 1 a and at least one upper stack 17 b inside the upper region 1 b , and accelerating and directing said transverse circulation of the cooking or cooling liquid by sizing said lower and upper stacks 17 a , 17 b so as to leave reduced spaces therearound inside tank 1 . the method further comprises facilitating the transverse circulation through said lower and upper stacks 17 a , 17 b by including in each support tray 15 at least one configuration by way of a suitable channel for the transverse circulation of the cooking or cooling liquid from one side of the support tray 15 to the other even when the support tray 15 forms part of one of the lower or upper stacks 17 a , 17 b in one or the other of the lower and upper regions 1 a , 1 b of tank 1 . the application of the system and method of the present invention considerably increases the temperature distribution and recirculation speeds , while at the same time eliminating any type of fluid dynamic and thermal short - circuits inside the tank or boiler ( that the system itself might create ) thus maximizing the heat transfer between the heating or cooling liquid and the product to be heated or cooled . the efficiency of the cooking and cooling process also increases considerably with the reduction of the cooking and cooling times . depending on the formats , said reduction can be between 15 and 25 % in relation to traditional systems , which offers the possibility of increasing the number of treated batches per day . it also provides a great heat regularity within the entire boiler , thus ensuring the consistency and regularity of the heat process , which ensures the microbiological quality and safety of the end food product . furthermore , the arrangement of a single steam nozzle protected by each region of the tank prevents irregular over - heating in some areas in the products . all of the above entails a lower energy cost of the process . on the other hand , a direct steam feed provides 100 % use of the energy ( enthalpy ) of the steam , since it is mixed directly by injection with the cooking water and since the losses corresponding to the steam - water heat transfer in heat exchangers , plus the corresponding and inevitable heat losses are prevented , which allows obtaining the desired cooking temperature quickly . furthermore , the new design of the support trays of the molds in which the product is arranged allows a transverse circulation flow through the channels optimizing the forced convection and maximizing the energy efficiency and contributing to homogenizing the heat regularity . the application of the system and method of the present invention to an installation like the one described in international patent application wo 03 / 096815 , of this applicant , allows decreasing the daily production time depending on the production mixture proportion , opening up the possibility of using most of the calories and negative calories contained in the hot water after cooking and in the cold water after cooling , by means of storing it in the production tanks or boilers themselves , without requiring the large external deposits for storing and tempering the necessary fluids for the production of the following day in traditional installations . a person skilled in the art will be able to introduce modifications and variations in the embodiments that are shown and described merely by way of a non - limiting and illustrative example without departing from the scope of the present invention as its is defined in the attached claims . | 0 |
referring now to the drawings in greater detail , there is shown generally in fig1 a multiple path drive system in the form of a four - wheel drive vehicle 10 having a prime mover 12 in driving relationship with a suitable manual or automatic transmission 14 . a propeller shaft 16 is in driving engagement with a fixed axle assembly 18 , which in turn supports a pair of ground - engaging wheels 20 . another propeller shaft 22 is in driving engagement with a steerable axle assembly 24 , which in turn supports a pair of ground - engaging wheels 26 . a torque transfer case 28 is in engagement with transmission 14 for receiving torque from prime mover 12 , and is in engagement with propeller shafts 16 and 22 respectively for transmitting torque to ground - engaging wheels 20 and 26 . as shown in fig2 and 4 , transfer case 28 includes a first sprocket 30 and a second sprocket 32 . sprocket 32 defines an interior pocket 34 and includes a flange 36 which in turn defines a plurality of openings 38 extending therethrough and spaced around its periphery to communicate pocket 34 with the exterior thereof . sprocket 32 also includes an annular extension 40 extending outwardly from flange 36 . also forming a portion of sprocket 32 is a flange 42 having an annular extension 44 extending outwardly therefrom . flange 42 is secured to sprocket 32 by means of a locking ring 46 or the like . a suitable chain 48 couples sprockets 30 and 32 . sprocket 30 , chain 48 and sprocket 32 form a chain drive train . an input shaft 50 extends into transfer case 28 and is engaged with sprocket 30 . input shaft 50 is adapted to receive torque , for example , from transmission 14 of vehicle 10 . it should be understood that input shaft 50 may be the output shaft of such a transmission . a rear output shaft 52 is engaged with propeller shaft 16 and extends into transfer case 28 . output shaft 52 is splined to extension 40 of sprocket 32 . a front output shaft 54 is engaged with propeller shaft 22 and extends into transfer case 28 . output shaft 54 defines an upstanding flange 56 and an annular extension 58 within pocket 34 of sprocket 32 . extension 58 defines an outer clutch race 60 of cylindrical configuration . an annular element or cam 62 is splined to output shaft 52 . cam 62 is within pocket 34 and defines an inner clutch race 64 comprising a plurality of flats or ramp surfaces . an annular cage 66 supports a plurality of wedging elements 68 , one of which is associated with each flat of inner race 64 . extension 58 , cam 62 , races 60 and 64 , cage 66 and wedging elements 68 comprise together a double - acting overrunning clutch or freewheel device 70 . in one preferred form of the invention , wedging elements 68 are rollers , and clutch 70 is a roller clutch . as shown in fig3 and 6 , a plurality of spring clips 72 are secured to cage 66 , as at 74 , and extend between adjacent rollers 68 . clips 72 , which may be of beryllium - copper or the like , are in frictional contact with outer race 60 so as to establish smooth frictional engagement therewith . as a result , bias forces are developed which act on cage 66 such that it tends to follow extension 58 . cage 66 defines a plurality of tabs 76 extending through openings 38 of sprocket 32 . turning now to fig3 and 5 , the direction - sensitive latch includes a pin 78 secured to flange 36 of sprocket 32 , and a rocker element 80 pivotally supported by pin 78 . element 80 includes a pair of arms 82 and 84 and a projection 86 . arms 82 and 84 respectively define contoured ends 88 and 90 adjacent two of tabs 76 . a drag ring 92 is contiguous with projection 86 and is in frictional contact with a wear ring 94 , which in turn is pressed to the housing of transfer case 28 . thus , drag ring 92 is in smooth frictional engagement with the housing of transfer case 28 . drag ring 92 is shown spaced from tabs 76 of cage 66 . however , it should be understood that tabs 76 may be piloted on drag ring 92 , if desired . torque is received by input shaft 50 and is transferred through the chain drive train to drive output shaft 52 . output shaft 52 is connected through propeller shaft 16 to drive fixed rear axle assembly 18 and its associated wheels 20 . output shaft 54 is connected through propeller shaft 22 to drive steerable front axle assembly 24 and its associated wheels 26 . extension 58 need not overrun cam 62 in order for clutch 70 to be effective , as clutch 70 is a freewheel device . it should be understood , however , that in a preferred form of the invention overrun may be built into clutch 70 . in any event , extension 58 inherently rotates faster than cam 62 when the vehicle is turning , since the front wheels travel through a larger radius than do the rear wheels . with reference to fig4 and 5 , assume output shaft 52 and cam 62 are rotating in the clockwise direction . output shaft 54 and extension 58 also rotate in the clockwise direction , but tend to overrun . the bias on roller cage 66 , developed by the frictional engagement of spring clips 72 with outer race 60 , causes rollers 68 , in effect , to follow extension 58 in the clockwise direction . rollers 68 tend to advance and wedge between inner race 64 and outer race 60 so as to engage clutch 70 . the direction - sensitive latch disclosed herein is operable independently of speed . initial vehicle movement causes clockwise rotation of sprocket 32 to drive output shaft 52 and cam 62 . pin 78 , secured to flange 36 of sprocket 32 , rotates therewith and with cam 62 . element 80 is carried with pin 78 . drag ring 92 tends to lag pin 78 due to its frictional contact with wear ring 94 . projection 86 , and thus element 80 , are pivoted clockwise about pin 78 . arm 82 is moved inwardly to clear its associated tab 76 , and arm 84 is moved outwardly to block clockwise rotational displacement of its associated tab 76 , and thus cage 66 , beyond the central position . as a result , the tendency of rollers 68 to advance and wedge between races 60 and 64 is blocked . tabs 76 have limited freedom of movement such that cage 66 and rollers 68 are movable counterclockwise to a clutch engaging position , but may not advance clockwise beyond the central position toward the opposite clutch engaging position . torque is transferred to output shaft 52 but not to output shaft 54 . in this condition , the operation is essentially that of a conventional two - wheel drive vehicle . when the rear wheels lose traction , output shaft 52 will speed up . cam 62 will tend to overrun extension 58 . this tendency will cause rollers 68 effectively to wedge between races 60 and 64 . when this takes place , cam 62 and extension 58 will rotate in unison , and torque will be transferred both to output shaft 52 and through clutch 70 to output shaft 54 . in this condition , the operation is essentially that of a conventional four - wheel drive vehicle in locked - up mode . when the rear wheels regain traction , output shaft 52 will slow down , and output shaft 54 will again tend to overrun output shaft 52 , thereby effectively disengaging clutch 70 and restoring the vehicle to the two - wheel drive condition . thus , it will be seen that the transfer case provides for establishment of four - wheel drive automatically , as required , and for establishment of two - wheel drive automatically when four - wheel drive is not required . this automatic engaging and disengaging feature is provided when the vehicle is moving in either the forward or reverse directions ; that is , when output shafts 52 and 54 are rotating in either the clockwise or counterclockwise directions as shown in fig4 and 5 . there is a set of circumstances where the invention herein has an inherent advantage . assume that the vehicle is moving in a turn and a torque reversal is initiated . this could occur , for example , when the vehicle is backing out of a driveway and the driver shifts the transmission selector lever from reverse to drive . the vehicle comes to a stop and starts to accelerate forward . at this point there is no relative motion between extension 58 , cam 62 and the other clutch elements , as clearances and driveline windup had been taken up while the vehicle was moving in reverse . rollers 68 could be trapped on the wrong side of cam 62 when the vehicle moves forward and extension 58 overruns cam 62 . however , in accordance with the invention herein , ends 88 and 90 of arms 82 and 84 , respectively , are contoured such that upon operation of the latch , tabs 76 will be cammed out of the trapped position and moved to the central position , whereupon action of clutch 70 is as described above . the biasing forces developed by spring clips 72 should be relatively small ; large enough so that cage 66 follows outer race 60 but not so large that drag ring 92 must develop excessive drag in order to enable the wedging action of the latch , when required . if considerable overrun is built into clutch 70 , this wedging action may take place even when the vehicle is not in a turning configuration . it should be understood that while a preferred embodiment of the invention has been shown and described , this is illustrative and may be modified by those skilled in the art without departing from the scope thereof , which is to be limited only by the claims herein . | 1 |
fig1 illustrates a magnetic recording tape cartridge 10 comprised of a housing , generally indicated as 12 , which is composed of an upper portion 14 and a lower portion 16 . the mating upper and lower portions 14 and 16 of the housing 12 are usually molded of medium or high impact grade polystyrene or acrylonitrile butadiene - styrene . within the housing 12 are located two tape spools 18 and 20 around which is convolutely wound a magnetic recording tape 22 . the recording tape 22 is directed along and parallel to the front face 24 of the housing 12 by guide means including rollers 26 and 28 adjacent the two front corners of the housing 12 . the front face 24 of the housing 12 and the exposed portion of the magnetic tape 22 is usually covered by a pivoting door which has not been illustrated for the sake of clarity . the particular magnetic recording tape cartridge illustrated is known as a vhs format videotape cassette and is used with a videotape recorder ( not shown ) to record video signals . the recorder includes drive spindles which access the spools 18 and 20 through apertures in the lower portion 16 of the housing 12 and also includes projecting fingers which extend into recesses 30 , 32 and 34 spaced along the front face 24 of the cassette 10 and operate to pull the tape 22 forward and wrap the tape 22 around a rotating magnetic transducer . the recesses 30 , 32 and 34 are connected by coplanar surfaces , or bridges , 36 and 38 which form a portion of the front face 24 of the housing 12 and support the tape 22 . when it is desired to access widely separated portions of the tape 22 , the videotape recorder is placed in either a &# 34 ; fast forward &# 34 ; or &# 34 ; rewind &# 34 ; mode in which one of the tape spools 18 or 20 is rapidly driven to coil the tape 22 quickly from one spool 18 or 20 to the other . in either of these fast forward or rewind modes , the projecting fingers of the videotape recorder are retracted and the tape 22 assumes the position illustrated in fig1 . the surfaces of the bridges 36 and 38 are usually smooth and it has been observed that the magnetic tape 22 is attracted to and frictionally rubs along the surfaces of the bridges 36 and 38 during either of the fast forward or rewind modes . this attraction between the tape 22 and the bridges 36 and 38 is caused by a static electrical charge which is either induced on the housing 12 during the molding operation or generated by frictional contact between the tape 22 and the bridges 36 and 38 . the attraction between the tape 22 and the bridges 36 and 38 causes noise due to periodic contact and release and results in friction between the tape 22 and the bridges 36 and 38 . this friction produces debris from both the tape 22 and the bridges 36 and 38 which may degrade the recording characteristics of the tape and also results in a drag which slows the movement of the tape 22 and opposes the drive motor of the videotape recorder . these problems are worsened during operation because the frictional contact between the tape 22 and the bridges 36 and 38 produces an increased static electrical charge which increases the attraction between the tape 22 and the bridges 36 and 38 . there results a cycle in which the friction between the tape 22 and the bridges 36 and 38 increases the static electrical attraction which in turn increases friction and leads to a yet greater attraction . it has been observed in some cases that this attraction and friction becomes progressively great enough to completely overcome the drive motors of the tape recorder and stop movement of the tape 22 . to prevent this cycle of attraction / friction , the bridges 36 and 38 are provided , according to the invention , with parallel ribs 40 which extend outwardly from the planar surfaces of the bridges 36 and 38 to reduce the area of contact between the tape 22 and the cassette 10 . the ribs 40 are best seen in fig2 and 3 and project a preferred distance of 0 . 25 mm from the flat surface 42 of the bridges 36 and 38 . the ribs 40 are also preferably semi - elliptical or triangular in cross - section and include a rounded tip 44 to reduce abrasion of the tape 22 . the ribs 40 are preferably oriented parallel to each other and perpendicular to the direction of tape travel , although an orientation of between 45 and 90 degrees has been found effective . an &# 34 ; x &# 34 ;- shaped configuration , in which ribs overlap and are oriented at opposite equal angles , might also prove useful . such a configuration would further reduce the possibility of contact between the tape 22 and the flat surfaces 42 of the bridges 36 and 38 . the spacing between successive ribs 40 in the direction of tape travel has been found to be critical in that excessive spacing between successive ribs 40 will allow the tape 22 to be attracted to and contact the flat surface 42 . a spacing between successive ribs 40 of less than about 8 mm has been found necessary to prevent such contact . a spacing of approximately 4 mm is preferred , however , because such a spacing has been shown to cause the production of an air barrier between the tape 22 and the flat surfaces 42 of the bridges 36 ad 38 . this air barrier cushions the tape 22 and prevents contact between the tape 22 and the ribs 40 in addition to preventing contact between the tape 22 and the flat surfaces 42 . thus a minimum spacing between successive ribs 40 of 8 mm has been found necessary to prevent contact between the tape 22 and the flat surfaces 42 and a preferred spacing of 4 mm has been found effective to produce an air barrier which prevents any contact between the tape 22 and the cassette 10 . fig4 illustrates an alternate embodiment of ribs 46 according to the present invention , in which the ribs 46 are produced by cutting or molding semi - elliptical grooves 48 into the surface of the bridges 36 and 38 . although the ribs 46 are formed by the subtraction of material rather than its addition , the ribs 46 of fig4 are equivalent to the ribs 44 of fig2 and 3 in that the area of contact between the tape 22 and the cassette 10 is reduced . although the present invention has been described with respect to only a limited number of preferred embodiments , it is recognized that a number of modifications will be apparent to those skilled in the art . all such modifications falling within the spirit and scope of the appended claims are intended to be included . | 6 |
an exemplary yarn delivery device 1 according to the invention is illustrated in fig1 the yarn delivery device is used for delivering a yarn 2 ( shown in fig2 ) to a knitting station of a knitting machine ( not shown ) or other yarn consumption station . the yarn delivery device 1 has an elongated base body 3 , for example made of a plastic material , which is equipped at one end with a clamp 4 for fastening the yarn delivery device 1 on a ring - shaped support ( machine ring ) of a knitting machine . on its opposite end , the base body 3 is provided with a yarn inlet arrangement 5 that includes an inlet eye 7 ( made for example of a ceramic material ), a knot catcher 8 , a yarn brake 9 and an inlet eye 12 that is immovably maintained on a rigid support 11 , which constitutes a yarn inlet guidance arrangement 13 . a shaft is provided that supports one or more pulleys 14 , 15 on its upper end . the pulleys can be coupled , selectively fixed against relative rotation , with the shaft by means of an axially displaceable coupling ring 16 . the shaft is rotatably seated on or in the base body 3 between the yarn inlet guidance arrangement 13 and the clamp 4 . below the base body 3 , the shaft is connected , fixed against relative rotation , to a yarn delivery wheel 17 , which therefore can be rotatingly driven by the pulleys 14 , 15 . the yarn delivery wheel 17 has an inlet area 18 , which is distinguished in that its diameter relative to the axial direction a x of the yarn delivery wheel 17 becomes smaller as it extends from the top toward the bottom . as can be seen , the inlet area 18 consists of a first tapering section with a small opening angle that makes a curved transition into a second tapering section 18 b with a very large opening angle . the tapering section comprises a guide surface 18 a as a forward feed mechanism for the lap 26 . the shaft is substantially oriented . during slippage - free operation ( positive operation ), a yarn that has not been removed can rotate , sagging toward the bottom , in the manner of a crank , without being wound up backward . a storage area 21 , whose horizontal cross section preferably deviates from a circular shape , adjoins the inlet area 18 , which is configured as a closed surface without interruptions . in the illustrated embodiment , the yarn delivery wheel 17 is formed as a one - piece deep - drawn sheet metal element . in this instance , the storage area 21 comprises a cylindrical section 22 , from which ribs 23 protrude . each of the ribs has a rounded back , against which the yarn 2 rests with individual windings 24 , 25 , as a lap 26 . the windings 24 , 25 lie freely between the individual ribs 23 . yet looked at as a whole , the yarn delivery wheel 17 is free of openings . the storage area 21 is also closed . the storage area 21 can be slightly tapered toward the bottom . starting at the cylindrical section 22 , the diameter of the yarn delivery wheel increases again until it exceeds the outer diameter of the ribs 23 . a yarn run - off edge 27 starts there and widens in a conical manner . in this case , the yarn run - off edge forms a smooth , closed surface , into which the ribs 23 transition without any shoulders . the yarn delivery wheel 17 rotates freely , i . e . it is only in contact with the yarn 2 . no further elements that would touch the yarn delivery wheel 17 or convey the yarn 2 exist . a yarn lifting element 28 is arranged adjoining the yarn delivery wheel 17 , which , in accordance with fig1 , 2 and 3 comprises a u - shaped hoop 29 . the hoop is preferably made of wire . the hoop 29 has two legs 31 , 32 , which are parallel to each other ( fig1 ), and which are connected to each other at their lower free ends by means of a strip 33 . the sections of the legs 31 , 32 adjoining the storage area are configured straight , and they extend at an acute angle or parallel the axial direction a x defined by the axis of rotation of the yarn delivery wheel 17 . in this way the legs 31 , 32 define yarn contact surfaces 34 , 25 ( fig2 ), over which each winding 24 , 25 , 26 of the yarn 2 extends . the yarn contact surfaces 34 , 35 are arched ( for example cylindrically arched ), and each is straight in the longitudinal leg direction r over the entire height of the storage area 21 . the lower ends of the legs 31 , 32 are placed slightly radially outward , so that the strip 33 is angled away from the yarn delivery wheel 17 . the location of the bend lies below the storage area so as to prevent the yarn windings , which rest loosely on the yarn drum , from falling down . the legs 31 , 32 are bent or angled outward at their respective upper ends , preferably above the inlet area 18 ( fig3 ). this arrangement entering yarn windings from getting too far toward the top . in this way yarn windings are also prevented from sliding over the upper drum edge and being wound up by the drum shaft . thus , the upper shoulder of the pins 31 , 32 formed by the bend or angle increases the operational dependability . the hoop 29 can be provided with a ceramic coating , in particular at its contact surfaces 34 , 35 . the longitudinal leg direction r matches the axial direction of the yarn delivery wheel 17 , or forms an acute angle with it . because of this , the length of all windings 24 , 25 , 26 is reduced winding by winding from the inlet side toward the outlet side . as illustrated in fig1 , it is important that an acute angle alpha is formed between the yarn contact surface 34 and a generating line m of the storage area located on the opposite side relative to the yarn delivery wheel 17 . in place of the open space between the legs 31 , 32 , a closed surface can also be provided here . the two upper ends of the legs 31 , 32 are maintained on a support 36 ( fig1 and 3 ), which is pivotally seated on the base body 3 of the yarn delivery device 1 , for example around the axis of rotation d extending in the axial direction ax . the axis of rotation d is vertically arranged . the support 36 has a spring hinge 37 on its outer end , which connects it with the legs 31 , 32 . the spring hinge 37 maintains the legs 31 , 32 in the relaxed state at an acute angle relative to the axis of rotation d . as illustrated in fig3 , an adjustment screw 38 is provided in the close vicinity of the spring hinge 37 . the adjustment screw 38 is supported on the support 36 and provides the option of setting the pivoted position of the hoop 29 in relation to the support 36 . the adjustment screw is seated in a threaded bore of a base section 39 , which is connected via the spring hinge 37 with the support 36 , and which furthermore receives the upper ends of the legs 31 , 32 . alternatively , the adjustment screw can be seated in a threaded bore of the support 36 and be supported on the base section 39 ( fig1 ). the adjustability of the angle of inclination of the hoop 29 allows an adaptation of the forward yarn feed to varying yarn qualities . the support 36 is designed in such a way that it maintains the hoop 29 , and therefore the legs 31 , 32 at a distance of approximately 10 mm to 15 mm from the outer circumference of the storage area 21 of the yarn delivery wheel 17 . this arrangement is illustrated in fig1 . the pin distance a , i . e . the distance of the yarn contact surfaces 34 , 35 from each other ( fig1 ) is preferably approximately 15 mm to 20 mm . this corresponds to a yarn delivery wheel diameter of approximately 45 mm and results in the desired angle of wrap , which is greater than 180 °, but less than 240 °. in any event , the radius of curvature r of the yarn contact surfaces 34 , 35 is less than the distance a . an outlet yarn guidance arrangement 41 includes a hoop 42 , as shown in fig2 and 3 . the hoop 42 is arranged at the side next to the yarn delivery wheel 17 and has a lower horizontal section 43 that guides the yarn 2 and which is maintained laterally below the yarn delivery wheel 17 ( fig3 ). this causes an oblique yarn draw - off . a further hoop 44 and a run - out interrupter 45 , which rests on the yarn 2 between the hoops 42 and 43 , are provided adjoining the outlet yarn guidance arrangement 41 . a run - in interrupter 46 , which monitors the yarn running toward the yarn delivery wheel 17 , can rest on the yarn between the yarn brake 9 and the inlet yarn guidance arrangement 13 . the yarn guidance arrangement 41 , the inlet eye 12 , and the axis of rotation d are located on a common level or plane . as a result , the yarn delivery device 1 has no preferred direction of rotation , the yarn delivery wheel 17 can be operated in a clockwise , as well as in a counterclockwise direction . the yarn delivery device 1 so far described operates as follows : during operation , the yarn delivery wheel 17 is driven for rotation by a belt that runs over the pulley 14 . the yarn 2 is looped around the yarn delivery wheel 17 as shown in fig2 . the windings 24 , 25 , 26 run over the yarn lifting element 28 . in this case , the number of revolutions of the yarn delivery wheel 17 is such that the circumferential speed of the yarn delivery wheel is slightly greater than the desired maximum yarn speed . the windings 24 , 25 , 26 loop around the yarn delivery wheel over a large portion of its circumference , but are raised off the yarn delivery wheel by the yarn lifting element 28 . this reduces the frictional action between the yarn 2 and the yarn delivery wheel 17 , with the friction still being strong enough so that in the normal case the yarn 2 is delivered with only slight slippage . in this case the yarn has a circumferential speed which is 10 % less than the circumferential speed of the delivery wheel 17 . if the yarn consumption station temporarily requires less yarn than is delivered by the yarn delivery device 1 , the required yarn speed clearly falls below the circumferential speed of the yarn delivery wheel 17 . in such a case , the yarn tension between the yarn delivery wheel 17 and the yarn consumption station is reduced . the lifting device 28 acts in a slightly braking manner on the yarn and prevents the yarn from being conveyed at full speed . the lap built up from the windings 24 , 25 , 26 is somewhat loosened , so that the conveying speed is reduced to such an extent that the yarn is delivered with slippage and in accordance with the requirements . the reduced frictional action allows the slippage of the windings 24 , 25 , 26 without a movement or adjustment of the yarn lifting element 28 , so that the yarn 2 generally trails the yarn delivery wheel 17 . the yarn runs clearly slower than would correspond to the circumferential speed of the yarn delivery wheel 17 . this is aided in particular by the ribbed structure of the surface of the storage area 21 . the yarn lifting element 28 is rigidly seated by means of the structure of the displacement mechanism , represented in fig3 and formed by the adjustment screw 38 and the spring hinge 37 . the adjustment screw 38 is supported between the yarn delivery wheel 17 and the hoop 29 is supported between the support 36 and the base section 39 , while the spring hinge 37 is located radially outward . therefore , an increased yarn tension cannot cause the hoop 29 to pivot against the yarn delivery wheel 17 . the support 36 is preferably configured to be removable . in such a case , the yarn delivery device can be operated purely as a positive feed wheel unit without slippage effect or , as described above , as a friction feed wheel unit , wherein the knitting station temporarily accepts less yarn in case of a reduced yarn tension . it is also possible to provide the support 36 with a hinge or a joint , for swiveling or pivoting the yarn lifting element 28 into a rest position where the yarn lifting element performs no function . snap - in or other arresting mechanisms can be provided for maintaining the yarn lifting element either in the working position or the rest position . it is also possible to employ the yarn delivery device 1 in both ways in that the windings 24 , 25 , 26 are selectively placed on or not placed on the yarn lifting element 28 . moreover , the yarn lifting element 28 can be designed to be exchangeable , for example by making different hoops 29 available for different yarns . however , it has been found that all tested yarns within a wide spectrum can run over the same hoop 29 if the aforementioned geometric conditions are observed . a modified embodiment of the yarn delivery device 1 is illustrated in fig4 . except for the yarn delivery wheel 17 , the fig4 embodiment has the same elements as the above described yarn delivery device 1 ( fig1 to 3 ), so that , based on the use of identical reference symbols , reference is made to the above description . in contrast to the above described yarn delivery wheel 17 , the yarn delivery wheel 17 in fig4 has the basic structure of a rod cage . the rod cage is formed by a plurality of straight rods 48 , which replace the ribs 23 and together form a cylindrical cage , or a very slightly tapering cage . the rods 48 are inserted into an end disk 49 , whose tapering outer surface constitutes the yarn run - off edge 27 . openings 51 are formed in the tapering outer surface , into which the rods 48 are inserted . the upper ends of the rods 48 furthermore are maintained in an upper end disk 52 , which forms the inlet area 18 . a further embodiment of the yarn delivery device 1 is shown in fig5 . the fig5 embodiment mainly corresponds to the embodiment shown in fig1 to 3 and only differs therefrom in the design of the yarn run - off edge 27 of the yarn delivery wheel 17 . the yarn run - off edge 27 is designed as a straight truncated cone , i . e . the radius of the yarn run - off edge 27 increases linearly from top to bottom . otherwise the description of its structure and function provided in connection with fig1 to 3 applies and identical reference symbols are used . fig6 illustrates a further embodiment of the yarn delivery device 1 , which is distinguished in that an electric motor is provided for driving the yarn delivery wheel 17 . the motor is seated in or projects from the base body 3 , as can be seen in fig6 . it is also possible to place the electric motor 53 on top of the base body in place of the pulleys 14 , 15 . the yarn delivery wheel 17 can be designed in accordance with any of the above described versions . in this case , the lifting of the yarn from the yarn delivery wheel 17 enables a slippage of the yarn delivery wheel , without the interrupter reacting , when the yarn delivery and the yarn acceptance do not exactly agree , in particular in case of a minimum acceptance . in all of the above described embodiments of the yarn delivery device 1 it is possible to use , instead of one yarn lifting element 28 with two legs 31 , 32 fixed relative to each other , the construction shown in fig8 with two yarn lifting elements 28 a , 28 b . both yarn lifting elements are maintained by their own supports 36 a , 36 b on their own base section 39 a , 39 b . pins 54 , 55 , which have a straight configuration , are used as yarn lifting elements and are arranged , the same as the legs 31 , 32 , substantially parallel with or at an acute angle relative to the axis of rotation d . in this case the pins 54 , 55 are aligned parallel with each other and can , if necessary , be adjusted separately by means of their adjustment screws 38 a , 38 b . the two supports 36 a , 36 b can be pivoted independently of each other , so that the pins 54 , 55 can be set to different distances between each other . by means of this the contact angle at which the yarn 2 rests against the yarn delivery wheel 17 can be manually controlled , so that the yarn delivery device 1 can be adapted to installation requirements and / or yarn properties . this can be seen in fig7 , for example , which illustrates the two supports 36 a , 36 b , which can be pivoted toward or away from each other . fig7 moreover shows the parallel orientation of the pins 54 , 55 , which is maintained independently of the inclination relative to the axis of rotation d . fig9 illustrates a modified embodiment of the yarn lifting element 28 . in contrast to the embodiment illustrated in fig1 to 6 , wherein the yarn lifting element 29 a hoop 29 , the fig9 yarn lifting element comprises a solid strip 56 , which has an elongated cross section with rounded flanks . the rounded flanks define the yarn contact surfaces 34 , 35 . the strip 56 can be made of , for example a hard alloy , a ceramic material , or another wear - resistant material . the strip can also be bent from sheet metal and provided with a coating of a hard material , for example a ceramic material . the strip can be connected rigidly , or by means of an adjustment device and manually adjustable relative to the support 36 , which has a ring - shaped shoulder 57 for fastening on the base support 3 . as shown in fig1 , the strip 56 can have a groove 58 between its yarn contact surfaces 34 , 35 , which is spanned by the yarn 2 . an operation as described in connection with fig1 can be achieved . with the embodiments of the yarn lifting element 28 shown in fig9 and fig1 , the distance between the yarn contact surfaces 34 , 35 preferably lies in the range between 15 mm and 20 mm . in this way the strip 56 operates like and replaces the hoop 29 . a modification of the embodiment in fig7 and 8 is also possible and is shown in fig1 . the fig7 embodiment is based on both pins 54 , 55 being arranged at the same distance from the yarn delivery wheel 17 . therefore the supports 36 a , 36 b have the same length . in contrast , the embodiment in fig1 provides supports 36 a , 36 b of different lengths , so that the two pins 54 , 55 are maintained at different distances from the axis of rotation d and the yarn delivery wheel 17 . this opens up the additional possibility of making the pin 55 inactive by pivoting it into the position 59 shown in dashed lines in fig1 . fig1 illustrates an alternative arrangement in dashed lines . the legs 31 , 32 have been replaced by a single yarn lifting element 28 ′, which is arranged at a great distance from the yarn delivery wheel 17 . this angle is of such a size that the angle beta , which the yarn 2 running toward the leg 31 forms with the yarn 2 running away from the leg 32 remains unchanged . fig1 discloses a further exemplary embodiment of a yarn delivery device with two pins 54 , 55 . these are arranged with an angular spacing of approximately 180 °. the pin 54 is fixed , while the pin 55 can be displaceable in the direction of the arrow 61 . with this arrangement , the pin 54 defines a liftoff zone of for example 70 °, while the other lifting zone is variable . the loop angle gamma is the sum of both partial loop angles gamma 1 and gamma 2 . a yarn lifting element 28 having straight yarn contact surfaces 34 , 35 is provided in a positive feed wheel unit . the position of the surfaces cannot be displaced by the yarn 2 enabling the yarn to slip relative to the yarn delivery wheel 17 if necessary . this permits the positive feed wheel unit to be used in applications which had previously been excluded because of the required synchronicity between the yarn delivery and yarn consumption . | 3 |
in the following detailed description numerous specific details are set forth in order to provide a thorough understanding of the present invention . however , it will be understood by those skilled in the art that the present invention may be practiced without these specific details . in other instances well known methods , procedures , components , and circuits have not been described in detail so as not to obscure the present invention . the present description includes material protected by copyrights , such as illustrations of graphical user interface images which the assignee of the present invention owns . the assignee hereby reserves its rights , including copyright , in these materials , and each such material should be regarded as bearing the following notice : copyright intel corporation . the copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure , as it appears in the patent and trademark office patent file or records , but otherwise reserves all copyright rights whatsoever . some portions of the detailed descriptions which follow are presented in terms of algorithms and symbolic representations of operations on data bits within a computer memory . these algorithmic descriptions and representations are the means used by those skilled in the data processing arts to most effectively convey the substance of their work to others skilled in the art . an algorithm is here , and generally , conceived to be a self - consistent sequence of steps leading to a desired result . the steps are those requiring physical manipulations of physical quantities . usually , though not necessarily , these quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the following discussions , it is appreciated that throughout the present invention , discussions utilizing terms such as “ processing ” or “ computing ” or “ calculating ” or “ determining ” or “ displaying ” or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage , transmission or display devices . fig1 is a block diagram illustrating a network environment in which the present invention may be practiced . as illustrated , network environment 100 includes multiple ( n ) client systems 110 and multiple ( m ) host systems 120 , collectively referred to as networked systems . network environment 100 also includes multiple ( x ) internet service providers ( isps ) 130 , and the internet 140 . each client system 110 can be any of a wide range of “ computing ” devices which provide a user with the ability to access the internet 140 . a client system 110 can access the internet 140 either directly or through an isp 130 as illustrated . examples of such “ computing ” devices include conventional desktop computers as well as internet “ appliance ” devices , such as a webtv ™ internet terminal available from microsoft corporation of redmond , wash ., or webtv networks inc . of palo alto , calif . each isp 130 is typically a computer system having a large amount of storage space ( typically on the order of hundreds of gigabytes or terabytes ) and multiple communication lines for facilitating access to the internet 140 by client systems 110 . each host system 120 is also typically a computer system which can be accessed by client systems 110 . according to one embodiment , each host system 120 includes one or more hypertext markup language ( html ) compatible web pages which can be accessed via the hypertext transfer protocol ( http ) and displayed by an html compatible internet browser running on a client system 110 . in this embodiment , an individual user can access a web page at a host system 120 by entering an identifier , referred to as a uniform resource locator ( url ), of the web page . in addition , each host system 120 may also contain one or more data files which can be accessed by client systems 110 . these data file ( s ) may be accessed via http , or alternatively other protocols , such as the file transfer protocol ( ftp ). the web pages , also referred to as html documents , can be either static or dynamic documents . a static document or static page refers to a web page which does not provide for user interaction with the page . the data of the web page is simply displayed for the user , and does not provide for additional inputs to the page by the user . a dynamic document or dynamic page , also referred to as an internet application , refers to a web page which is not static and , through various controls and scripts , provides for user interaction with the document . a dynamic document can include controls and scripts which execute various applications at the client system . thus , a user is often able to input additional data to the page to which the page , based on its programming , responds . the internet 140 is a combination of multiple conventional hardware components , including computer systems , routers , repeaters , gateways , and communications links spread throughout the world . these hardware components are organized hierarchically to provide multiple logical levels of networks . the hardware components of internet 140 interact to route data from one computer system to another . according to one implementation , data is transferred between computer systems using the well - known transmission control protocol / internet protocol ( tcp / ip ) protocol . the data is typically transferred in units referred to as “ packets ” or “ datagrams ”. typically , each packet includes data , a source address identifying the system which initiated the packet and a target address identifying the system to which the packet is to be sent . additional control information , such as a checksum , may also be included in the packet . the number of bytes of data contained within a packet is dependent on the network protocol being used . the communication links illustrated in fig1 can be any of a wide range of conventional communication media and may be different for different client systems 110 , host systems 120 , and isps 130 . for example , a communication link may be a coaxial cable , a fiber - optic cable , or may represent a nonphysical medium transmitting electromagnetic signals in the electromagnetic spectrum , such as infrared or radio frequency signals . additionally , a communication link may also include any number of conventional routing or repeating devices , such as satellites or electromagnetic signal repeaters . it is to be appreciated that although client systems 110 and host systems 120 are illustrated as being different machines , a single hardware system may be both a client system and a host system . if the hardware system is initiating an access for information to another system then the hardware system is referred to as a client system . however , if the hardware system is being accessed by another system to obtain information from the hardware system then the hardware system is referred to as a host system . it is to be appreciated that additional networks may also be included in the network environment 100 . for example , multiple client systems 110 may be coupled together in an ethernet , token ring , or other conventional network and access an isp 130 through this additional network . fig2 is a simplified block diagram illustrating a system architecture such as may be used with one embodiment of the present invention . as shown , system architecture 200 includes a network browser application 210 , an operating system 220 , a communication interface 230 , persistency control logic 240 , listener logic 250 , and augmented browser control 260 . according to one embodiment of the present invention , one or more client systems 110 of fig1 include a system architecture 200 of fig2 . operating system 220 manages and controls the operation of the client system , including the input and output of data to and from network browser 210 as well as other software applications ( not shown ). operating system 220 provides an interface , such as a graphical user interface ( gui ), between the user and the software applications being executed on the system . according to one embodiment of the present invention , operating system 220 is the windows ™ 95 operating system , available from microsoft corporation of redmond , wash . however , it is to be appreciated that the present invention may be used with other conventional operating systems , such as other versions of microsoft windows ™ ( for example , windows ™ 3 . 0 , windows ™ 3 . 1 , or windows ™ nt ), microsoft dos , os / 2 , available from international business machines corporation of armonk , n . y ., the apple macintosh operating system , available from apple computer incorporated of cupertino , calif ., the nextstep ® operating system available from apple computer incorporated , or the unix operating system , available from santa cruz operations of santa cruz , calif . network browser 210 , also referred to as an information browser , provides a user interface , such as a graphical user interface ( gui ), which allows an individual to send information to and receive information from another networked system . according to one embodiment of the present invention , network browser 210 is an html compatible internet browser , such as internet explorer , available from microsoft corporation of redmond , wash ., navigator ™, available from netscape communications corporation of mountain view , calif ., or hotjava ™, available from sun microsystems of mountain view , calif . it is to be appreciated , however , that browser 210 can be any of a wide variety of conventional interfaces which allow an individual user to access other networked systems . communication interface 230 , according to one embodiment , includes a windows sockets 2 interface , as defined in the windows sockets 2 service provider interface specification , revision 2 . 2 . 0 , dated may 10 , 1996 , the windows sockets 2 application programming interface , revision 2 . 2 . 0 , dated may 10 , 1996 , and the windows sockets 2 protocol - specific annex , revision 2 . 0 . 3 , dated may 10 , 1996 . alternatively , communication interface 230 may include windows sockets 1 . 1 interface , as defined in the windows sockets interface specification , version 1 . 1 , dated jan . 20 , 1993 . communication interface 230 controls communication between the network and browser 210 , persistency control 240 , and augmented browser control 260 . when enabled , persistency control logic 240 registers itself with browser 210 to receive events originated by web browser 210 which include the web page identifiers input to browser 210 . additionally , persistency control logic 240 conditionally prevents browser 210 from replacing the current display with newly identified html documents . in one embodiment , persistency control 240 intervenes in the display of newly requested data such that the new data is co - displayed with the previously received data , thereby providing display persistency . persistency control logic 240 , when enabled , monitors the data requests input to network browser 210 . in the case of the world wide web , these data requests are web page identifiers , also referred to as urls . web page identifiers can be input to browser 210 in any of a wide variety of conventional manners , including a user typing in a specific identifier , hitting a “ back ” or “ forward ” button , selecting an identifier from a list of “ favorites ”, selecting a link in an html document , etc . according to one embodiment of the present invention , the portion of the received data which persists in the web browser is that data corresponding to a dynamic page , also referred to as an internet application . all information related to the internet application , including controls and data such as application - specific executable code , application - specific html content , and application - specific scripts are maintained by the client system . persistency control 240 effectively “ locks ” this information into the client system , thereby preventing it from being erased when a new web page is loaded . in other words , rather than allowing browser 210 to clear the entire display , the persistency control 240 intervenes and in cooperation with augmented browser control 260 displays the new data in an “ unlocked ” portion of the browser &# 39 ; s display window . persistency control logic 240 initiates augmented browser control 260 when persistency control logic 240 is enabled . augmented browser control 260 retrieves and displays the newly requested web pages at the request of persistency control logic 240 . together , the “ locked ” and “ unlocked ” portions allow web pages from two independent non - collaborating web servers to be displayed concurrently . thus , the web page from a first page source persists and the user is able to continue to interact with the persisting web page even though web pages from different sources are being retrieved and browsed . it should be noted that the html documents displayed by augmented browser control 260 can be located locally as well as remotely . thus , a particular identifier may indicate to augmented browser control 260 to access an html document via internet 140 of fig1 , or alternatively the html document may be stored locally at the client system . persistency control logic 240 registers itself , upon its creation , with browser 210 . more specifically , in embodiments where browser 210 is the microsoft internet explorer , persistency control logic 240 accesses an iconnectionpoint interface of browser 210 via an iserviceprovider interface of browser 210 . persistency control logic 240 then registers with browser 210 using an advise command , thereby causing browser 210 to notify persistency control logic 240 of all the browser events . persistency control logic 240 monitors the events received from browser 210 , waiting for either a beforenavigate or framebeforenavigate event . both of these events indicate that browser 210 is about to navigate to a new web page . in other words , each of these events indicates a new identifier has been input to browser 210 by the user . one parameter of each of these events is the identifier of the new page to which browser 210 is about to navigate . thus , persistency control logic 240 is aware of the new page request input to browser 210 . an additional parameter for both the beforenavigate and framebeforenavigate events is a cancel parameter . the cancel parameter can be set by persistency control logic 240 prior to completing processing of the received event , thereby causing browser 210 to cancel retrieving of the new web page . persistency control logic 240 then sends an event indicating the new identifier that has been input by the user . this event is received by scripts executing in the internet application page . these scripts respond to the received event and direct augmented browser control 260 to navigate to the requested page . augmented browser control 260 includes logic , analogous to that of browser 210 , which allows it to access and retrieve the requested web page . in one implementation , the scripts direct augmented browser control 260 to navigate to the requested page by calling a navigate command of augmented browser control 260 . upon receipt of the identifier , augmented browser control 260 retrieves and displays the requested web page . the display of information within the browser window is controlled by both augmented browser control 260 and the internet application which is “ locked ”. scripts in the internet application control the size and display location where the internet application is displayed to the user . control logic within augmented browser control 260 controls the size and display location where the web pages being browsed are displayed to the user . in one embodiment , the scripts of the internet application notify augmented browser control 260 of the size and display location of the internet application , and augmented browser control 260 simply uses the remaining screen location within the window of browser 210 . in one embodiment of the present invention , persistency control logic 240 also monitors the events received from browser 210 for a resize event . the resize event indicates that the window size of browser 210 is being changed . persistency control logic 240 notifies the scripts of the internet application of this change , thereby allowing it to adjust the size and display location where the internet application is displayed to the user . the scripts then notify augmented browser control 260 of the new size and display location of the internet application , thereby allowing augmented browser control 260 to adjust the size and display location where the web pages being browsed are displayed to the user , based on the new size of the browser 210 window . according to one embodiment of the present invention , the internet application which is “ locked ” by persistency control 240 is a web page invoking a video conferencing application , such as a proshare ® personal conferencing application , available from intel corporation of santa clara , calif . other video conferencing applications include , for example , the intel video phone with proshare ® technology , or other intel business video conferencing with proshare ® technology applications . the proshare ® personal conferencing application remains executing and displayed in the context of the browser while at the same time the system user is able to browse different web pages from independent uncollaborated web servers . in another embodiment of the present invention , the internet application which is “ locked ” by persistency control 240 is a web page invoking a video application which provides a video stream to the client system , such as netshow ™, available from microsoft corporation of redmond , wash . this video stream could be , for example , a training video or a demonstration . another example of a web page invoking an internet application that can be “ locked ” by persistency control 240 is a web page listing application . such a listing application maintains a record of each web page which has been accessed by a user during the current browsing session . page identifiers are displayed to the user in any of a variety of manners , such as chronologically or alphabetically . selection of one of the page identifiers by the user causes that identifier to be input to the browser and thus retrieved again for the user . it is to be appreciated that web pages invoking other internet applications can be “ locked ” by persistency control 240 within the spirit and scope of the present invention . examples of such internet applications include chat applications , file transfer applications , flight reservation applications , etc . in one embodiment , internet applications are initiated by selection of a particular link on a web page by the user . by way of example , a particular corporation may include a “ talk to customer representative ” link . selection of the link by a user causes a proshare ® personal conferencing application to execute on the client system and connects to a customer representative of the corporation . in one implementation , the link includes the type of link to establish , the number to call , and the type of conference to establish . the type of link to establish can be an isdn link or tcp / ip link . the number to call will either be a conventional phone number in the case of an isdn link or a network address in the case of a tcp / ip link . the type of conference can be an audio / video conference or an audio / video / data conference . it is to be appreciated that only the application - specific information need be maintained when “ locking ” a particular web page . that is , if a link is selected which causes execution of a proshare ® personal conferencing application , then only the controls and html content necessary to continue executing the proshare ® personal conferencing application need be “ locked ”. any additional html content ( e . g ., unrelated descriptions surrounding the selected link ) does not need to be maintained . however , html content relating to the internet application are maintained , such as instructions or labels of selectable options . in one embodiment of the present invention , augmented browser control 260 includes a function for sending and receiving messages to and from the internet application . in this embodiment , there can be a functional relationship between the “ locked ” internet application and the html documents being browsed in the augmented browser . in one implementation , selection of a particular link on a web page displayed by the augmented browser control causes a message to be sent to the internet application for the internet application to act on . by way of example , selection of a particular option on a training index web page displayed by the augmented browser control can be conveyed to the internet application which displays the appropriate video to the user via the internet application . similarly , in another implementation , selection of a particular option in the internet application causes a message to be sent to the augmented browser to act on . by way of example , selection of a particular block of video , or after a predetermined period of time after start of a video stream , a message is sent to the augmented browser control to obtain another web page . according to another embodiment of the present invention , the “ locked ” application includes a function to synchronize the “ unlocked ” portion of the display with the “ unlocked ” portion of the display on another system . in one implementation , this is referred to as a view synchronization option . the view synchronization option causes the views of the two or more systems to be synchronized . by way of example , if the internet application is a web page invoking a proshare ® personal conferencing application , then the two or more client / host system users that are engaged in the conference can be synchronized to the same web page using the view synchronization option . the view synchronization option can be provided to the user and selected by the user in any of a wide variety of manners , such as a hot button , menu option , command line input , dialog box , etc . in embodiments which support the view synchronization option , scripts of the “ locked ” application maintain a copy of the identifier of the most recently requested web page . thus , upon selection of the view synchronization option by a user , the internet application , knowing the web page currently being viewed by the user , transfers the identifier of this web page to the other systems involved in the internet application . in one embodiment , where the internet application is a web page invoking a proshare ® personal conferencing application , the identifier is transferred via the data channel of the conference to all the users participating in the conference . upon receipt of the identifier , scripts of the internet application at each of the receiving systems directs the augmented browser control at the system to access and retrieve the identified web page . in one embodiment of the present invention , persistency control logic 240 is enabled whenever an internet application is accessed . according to an alternate embodiment , persistency control logic 240 is enabled when a web page is accessed which indicates to enable persistency control 240 . in one implementation this indication is a script in the web page which executes persistency control 240 when the web page is accessed . thus , in this embodiment , web page designers can decide whether to make use of the present invention . in an alternate embodiment , persistency control logic 240 is automatically enabled at the client system , such as at system reset or when web browser 210 is launched . in one implementation , a specific application can be launched , such as a proshare ® personal conferencing application , and be ready to make or receive a video conference call when web browser 210 is launched . alternatively , a portion of the display can remain blank , waiting for an internet application to be accessed . in one embodiment of the present invention an additional monitoring application , listener logic 250 , is also executed . in one implementation , listener logic 250 is executed at system reset . in alternate implementations , listener logic 250 is user executed . listener logic 250 monitors the input signals received by operating system 220 . when listener logic 250 monitors an incoming proshare ® personal conferencing call , it automatically executes browser 210 and persistency control logic 240 , as well as the proshare ® personal conferencing application . thus , listener logic 250 allows a user to make use of the present invention without requiring the user to execute the browser and the proshare ® personal conferencing application every time . fig3 a and 3 b are a flow chart illustrating the steps followed according to one embodiment of the present invention . a web browser 210 is first executed on the client system , step 305 , and a web page request is eventually received from a user , step 310 . web browser 210 accesses and retrieves the requested page , step 315 , loading in the application controls if it is an internet application ( a dynamic page ). if the page is not an internet application , step 320 , then browser 210 displays the requested web page , step 325 . this process continues until a requested page is for an internet application . however , if the page is an internet application , step 320 , then persistency control logic 240 is enabled , step 330 . in the illustrated embodiment , persistency control logic 240 is enabled via a script in the requested web page . as part of being enabled , persistency control logic 240 registers itself with browser 210 to receive web page identifiers when they are input by the user . upon being enabled , persistency control logic 240 creates the augmented browser control , step 335 , which displays the web pages within the browser 210 along with the internet application . persistency control logic 240 then “ locks ” the application , step 340 , thereby causing the application to persist even though the pages being browsed and displayed in the augmented browser may change . eventually , web browser 210 receives another web page request from the user , step 345 . persistency control 240 , having registered with browser 210 , is notified of the web page request , step 350 . persistency control logic 240 then prevents browser 210 from accessing and displaying the requested web page , step 355 . persistency control logic 240 then conveys an identifier of the requested page to the augmented browser control , which accesses and retrieves the page , step 360 . thus , the requested page is displayed along with the “ locked ” application . the “ locked ” portion continues to be displayed until the persistency is disabled , step 365 . in one embodiment , the persistency is disabled by terminating execution of the application which enabled persistency control logic 240 . fig4 , 5 , and 6 illustrate example displays such as may be provided when using one embodiment of the present invention . fig4 illustrates an initial display of an html document 401 which includes link 402 to another web page . html document 401 is displayed in a browser window 400 . selection of link 402 by a user accesses a training session for vcr programming and invokes the persistency control logic of the present invention . fig5 illustrates the display after link 402 of fig4 is selected . a new html document 501 is displayed , as well as a training video application 502 . as illustrated in fig5 , both application 502 and html document 501 are displayed within browser window 400 . note that application 502 continues to display a training audio / video stream while document 501 is displayed . in an alternate embodiment , rather than retrieving a new html document as illustrated in fig5 , html document 401 is displayed along with application 502 in browser window 400 . in this alternate embodiment , an additional link is provided in document 401 which identifies document 501 . fig6 illustrates the display after a new identifier is input to browser window 400 . as illustrated in fig6 , a new url 603 has been input to browser window 400 . the html document 601 identified by url 603 has been retrieved and is displayed along with application 502 in browser window 400 . again , application 502 continues to display a training audio / video stream while document 601 is displayed and during the transition to document 601 from document 501 . thus , as illustrated in fig5 and 6 , application 502 along with its corresponding control information persists while the html documents 501 and 601 are being browsed , with both application 502 and document 501 or 601 appearing to the user in a single browser display window 400 . it is to be appreciated that if the internet application and the html documents being browsed are using the same network interface , data for the two will not be received at exactly the same time due to his sharing . however , the two will appear to the user to be received at approximately the same time . fig7 illustrates another example display such as may be provided according to one embodiment of the present invention . fig7 illustrates the browser window 700 displaying an internet application 701 and an html document 702 . internet application 701 is invoking a proshare ® personal conferencing application which includes a view synchronization option 703 . selection of view synchronization option 703 causes the two or more parties involved in the proshare ® personal conferencing conference to synchronize to the same web page . in the illustrated embodiment , the url of the last web page to be requested by a user is transmitted to the other client systems upon selection of the view synchronization option 703 by the user . fig7 differs from fig4 – 6 in that html document 702 provides local control information for internet application 701 rather than a web page which has been retrieved over a network . html document 702 is stored locally and retrieved by augmented browser control 260 of fig2 upon request of a user . when a user desires to change the various options for internet application 701 , he or she selects the appropriate option which he or she wants to change . internet application 701 includes scripts which , upon selection of an option by the user , are executed and pass the identifier of a corresponding local html document to augmented browser control 260 , which accesses and retrieves the local document . in the illustrated embodiment , internet application 701 is controlling a proshare ® personal conferencing application , and document 702 provides saturation , brightness , contrast , and tint controls for the local image of the proshare ® personal conferencing application , and saturation , brightness , and contrast controls for the remote image of the proshare ® personal conferencing application . these controls are accessible to software and can be freely adjusted . the accessing and setting of these controls are well - known to those skilled in the art and thus will not be discussed further except as it pertains to the present invention . html document 702 as illustrated includes a sliding scale 707 which provides an indication for the current setting of each of the image controls . furthermore , the setting for each of the image controls can be increased or decreased by user selection of either the increment 708 or decrement 709 controls . thus , a more user - friendly environment is maintained by providing the application 701 controls to the user in the screen location where the user is used to interacting , that is , within the browser 700 . it is to be appreciated that although brightness , saturation , contrast , and tint controls are illustrated in fig7 , any of the user - modifiable controls associated with application 701 can be provided to the user via an html document analogous to document 702 . examples of these controls include panning , tilting , zooming in and out , sharpness , display size , volume control , mute options , audio selection ( e . g ., speaker or headphones ), balance , snapshot control , dialing lists , etc . in fig5 , 6 , and 7 , the internet application 502 of fig5 and 6 and 701 of fig7 is illustrated as being displayed on the left side of the browser window . however , it is to be appreciated that in alternate embodiments this location can be different , such as at the top , right side , or bottom of browser window 400 or 700 . fig8 illustrates one embodiment of a hardware system suitable for use with the present invention . in one embodiment , each client system 110 of fig1 is a hardware system 800 of fig8 . in the illustrated embodiment , hardware system 800 includes processor 802 and cache memory 804 coupled to each other as shown . additionally , hardware system 800 includes high performance input / output ( i / o ) bus 806 and standard i / o bus 808 . host bridge 810 couples processor 802 to high performance i / o bus 806 , whereas i / o bus bridge 812 couples the two buses 806 and 808 to each other . coupled to bus 806 are network / communication interface 824 , system memory 814 , and video memory 816 . in turn , display device 818 is coupled to video memory 816 . coupled to bus 808 is mass storage 820 , keyboard and pointing device 822 , and i / o ports 826 . collectively , these elements are intended to represent a broad category of hardware systems , including but not limited to general purpose computer systems based on the pentium ® processor , pentium ® pro processor , or pentium ® ii processor manufactured by intel corporation of santa clara , calif . these elements 802 – 826 perform their conventional functions known in the art . in particular , network / communication interface 824 is used to provide communication between system 800 and any of a wide range of conventional networks , such as an ethernet , token ring , the internet , etc . it is to be appreciated that the circuitry of interface 824 is dependent on the type of network the system 800 is being coupled to . mass storage 820 is used to provide permanent storage for the data and programming instructions to perform the above described functions implemented in the system controller , whereas system memory 814 is used to provide temporary storage for the data and programming instructions when executed by processor 802 . i / o ports 826 are one or more serial and / or parallel communication ports used to provide communication between additional peripheral devices which may be coupled to hardware system 800 . it is to be appreciated that various components of hardware system 800 may be re - arranged . for example , cache 804 may be on - chip with processor 802 . alternatively , cache 804 and processor 802 may be packed together as a “ processor module ”, with processor 802 being referred to as the “ processor core ”. furthermore , certain implementations of the present invention may not require nor include all of the above components . for example , mass storage 820 , keyboard and pointing device 822 , and / or display device 818 and video memory 816 may not be included in system 800 . additionally , the peripheral devices shown coupled to standard i / o bus 808 may be coupled to high performance i / o bus 806 ; in addition , in some implementations only a single bus may exist with the components of hardware system 800 being coupled to the single bus . furthermore , additional components may be included in system 800 , such as additional processors , storage devices , or memories . in one embodiment , the elements of the present invention are implemented as a series of software routines run by hardware system 800 of fig8 . these software routines comprise a plurality or series of instructions to be executed by a processor in a hardware system , such as processor 802 of fig8 . initially , the series of instructions are stored on a storage device , such as mass storage 820 . it is to be appreciated that the series of instructions can be stored on any conventional storage medium , such as a diskette , cd - rom , magnetic tape , dvd 1 , laser disk , rom , etc . it is also to be appreciated that the series of instructions need not be stored locally , and could be received from a remote storage device , such as a server on a network , via network / communication interface 824 . 1 dvd is currently used as an acronym for digital video disk . however , it appears that the usage is changing to digital versatile disk to reflect the ability of dvd technology to be used for data other than video . the instructions are copied from the storage device , such as mass storage 820 , into memory 814 and then accessed and executed by processor 802 . in one implementation , these software routines are written in the c ++ programming language . it is to be appreciated , however , that these routines may be implemented in any of a wide variety of programming languages . in alternate embodiments , the present invention is implemented in discrete hardware or firmware . for example , an application specific integrated circuit ( asic ) could be programmed with the above described functions of the present invention . in the discussions above , reference is made to transferring data via http over the internet . however , in alternate embodiments different protocols can be used . in some of the discussions above reference is made to an internet application being “ locked ” by the present invention . however , in an alternate embodiment a static document is “ locked ” rather than a dynamic document . thus , in this alternate embodiment , one document , such as the results of a web search or an index , remains on the display while the user is able to continue to browse to additional documents . also in the discussions above reference is made to one application being “ locked ” by the present invention . however , in alternate embodiments additional applications are “ locked ”. by way of example , persistency control logic 240 of fig2 may control the “ locking ” of two different applications and still allow a user to browse the web in a third location of the display . thus , the present invention provides for an integrated browser and video conferencing application . the video conferencing application is advantageously displayed to the user in the same window in which the user is able to browse other web pages . furthermore , video conferencing control options are advantageously displayed to the user as web pages , allowing the user to modify the control options through the web pages . thus , an integrated information browsing and video conferencing interface has been described . whereas many alterations and modifications of the present invention will be comprehended by a person skilled in the art after having read the foregoing description , it is to be understood that the particular embodiments shown and described by way of illustration are in no way intended to be considered limiting . references to details of particular embodiments are not intended to limit the scope of the claims . | 8 |
the compounds of the invention and their pharmaceutically acceptable salts may be made using the methods as described and exemplified herein and by methods similar thereto and by methods known in the chemical art . such methods include , but not limited to , those described below . if not commercially available , starting materials for these processes may be made by procedures , which are selected from the chemical art using techniques which are similar or analogous to the synthesis of known compounds . in particular , the intermediates and starting materials for the compounds of the invention may be prepared by methods and processes as described in pct / us2007 / 070551 . all references cited herein are hereby incorporated by reference in their entirety . the compounds of the invention include their enantiomers , diastereoisomers , tautomers and racemates , as well as their polymorphs , hydrates , solvates and complexes . some individual compounds within the scope of this invention may contain double bonds . representations of double bonds in this invention are meant to include both the e and the z isomer of the double bond . in addition , some compounds within the scope of this invention may contain one or more asymmetric centers . this invention includes the use of any of the optically pure stereoisomers as well as any combination of stereoisomers . it is also intended that the compounds of the invention encompass their stable and unstable isotopes . stable isotopes are nonradioactive isotopes which contain one additional neutron compared to the abundant nuclides of the same species ( i . e ., element ). it is expected that the activity of compounds comprising such isotopes would be retained , and such compound would also have utility for measuring pharmacokinetics of the non - isotopic analogs . for example , the hydrogen atom at a certain position on the compounds of the invention may be replaced with deuterium ( a stable isotope which is non - radioactive ). examples of known stable isotopes include , but not limited to , deuterium , 13 c , 15 n , 18 o . alternatively , unstable isotopes , which are radioactive isotopes which contain additional neutrons compared to the abundant nuclides of the same species ( i . e ., element ), e . g ., 123 i , 131 i , 125 i , 11 c , 18 f , may replace the corresponding abundant species of i , c and f . another example of useful isotope of the compound of the invention is the 11 c isotope . these radio isotopes are useful for radio - imaging and / or pharmacokinetic studies of the compounds of the invention . melting points are uncorrected and ( dec ) indicates decomposition . temperature are given in degrees celsius (° c . ); unless otherwise stated , operations are carried out at room or ambient temperature , that is , at a temperature in the range of 18 - 25 ° c . chromatography means flash chromatography on silica gel ; thin layer chromatography ( tlc ) is carried out on silica gel plates . nmr data is in the delta values of major diagnostic protons , given in parts per million ( ppm ) relative to tetramethylsilane ( tms ) as an internal standard . conventional abbreviations for signal shape are used . coupling constants ( j ) are given in hz . for mass spectra ( ms ), the lowest mass major ion is reported for molecules where isotope splitting results in multiple mass spectral peaks solvent mixture compositions are given as volume percentages or volume ratios . in cases where the nmr spectra are complex , only diagnostic signals are reported . the synthetic methods in this invention are illustrated below . the significances for the r groups are as set forth above for formula i unless otherwise indicated . in an aspect of the invention , intermediate compounds of formula iib can be synthesized by reacting a compound of formula iia with a dicarboxylic acid , acetic anhydride and acetic acid mixing with heat for about 3 hours and then cooled : wherein r 1 is h or c 1 - 4 alkyl [ e . g ., methyl ]. intermediate iic can be prepared by for example reacting a compound of iib with for example a chlorinating compound such as pocl 3 , sometimes with small amounts of water and heated for about 4 hours and then cooled : intermediate iid may be formed by reacting a compound of iic with for example a p 1 — x in a solvent such as dmf and a base such as k 2 co 3 at room temperature or with heating : wherein p 1 is a protective group [ e . g ., p - methoxybenzyl group ( pmb )]; x is a leaving group such as a halogen , mesylate , or tosylate . intermediate iie may be prepared by reacting a compound of iid with hydrazine or hydrazine hydrate in a solvent such as methanol and refluxed for about 4 hours and then cooled : alternatively , intermediate iiia may be formed by reacting a compound of iic with for example a r 2 — x wherein x is a leaving group such as a halogen , mesylate , or tosylate , in a solvent such as dmf and a base such as k 2 co 3 at room temperature or with heating : intermediate iiib may be prepared by reacting a compound of iiia with hydrazine or hydrazine hydrate in a solvent such as methanol and heated for several hours and then cooled : intermediate iva may be formed by for example reacting a compound of iiib with pocl 3 and dmf . intermediate ivb may be formed by reacting a compound of iva with for example a r 3 — x wherein x here is a leaving group , e . g ., halogen , mesylate , or tosylate , in a solvent such as dmf and a base such as k 2 co 3 at room temperature or with heating . the thio compounds of the invention , e . g ., formula i wherein l is s or compound ( i )- e may be prepared by reacting a compound ( ivb ) with a disulfide r 4 - l - l - r 4 or a thiol r 4 - lh in the presence of a strong base , such as a lithium reagent ( e . g . lihmds ) in a solvent such as thf . the sulfinyl or sulfonyl derivative , e . g . formula i wherein l is so or so 2 , may be formed by reacting a 3 - thio compounds ( i )- e with an oxidizer such as a peroxide ( e . g . oxone or hydrogen peroxide ) at room temperature in a solvent such as acetonitrile and methanol . alternatively , a compound of formula ( i )- e can be prepared by reacting , for example , compounds 1 - a with , for example , r 3 — x , in a solvent such as dmf and a base such as k 2 co 3 at room temperature or with heating : wherein all the substituents are as defined previously ; x is a leaving group such as a halogen , mesylate , or tosylate . the compounds of the invention are useful in the treatment of diseases characterized by disruption of or damage to camp and cgmp mediated pathways , e . g ., as a result of increased expression of pde1 or decreased expression of camp and cgmp due to inhibition or reduced levels of inducers of cyclic nucleotide synthesis , such as dopamine and nitric oxide ( no ). by preventing the degradation of camp and cgmp by pde1b , thereby increasing intracellular levels of camp and cgmp , the compounds of the invention potentiate the activity of cyclic nucleotide synthesis inducers . the invention provides methods of treatment of any one or more of the following conditions : ( i ) neurodegenerative diseases , including parkinson &# 39 ; s disease , restless leg , tremors , dyskinesias , huntington &# 39 ; s disease , alzheimer &# 39 ; s disease , and drug - induced movement disorders ; ( ii ) mental disorders , including depression , attention deficit disorder , attention deficit hyperactivity disorder , bipolar illness , anxiety , sleep disorders , e . g ., narcolepsy , cognitive impairment , dementia , tourette &# 39 ; s syndrome , autism , fragile x syndrome , psychostimulant withdrawal , and drug addiction ; ( iii ) circulatory and cardiovascular disorders , including cerebrovascular disease , stroke , congestive heart disease , hypertension , pulmonary hypertension , and sexual dysfunction ; ( iv ) respiratory and inflammatory disorders , including asthma , chronic obstructive pulmonary disease , and allergic rhinitis , as well as autoimmune and inflammatory diseases ; ( v ) any disease or condition characterized by low levels of camp and / or cgmp ( or inhibition of camp and / or cgmp signaling pathways ) in cells expressing pde1 ; and / or ( vi ) any disease or condition characterized by reduced dopamine d1 receptor signaling activity , comprising administering an effective amount of a compound of the invention , e . g ., a compound according to any of formula i or 1 . 1 - 1 . 135 , or a composition comprising a compound of the invention , e . g ., a compound according to any of formula i or 1 . 1 - 1 . 135 , or any described in this specification , in free or pharmaceutically acceptable salt form , to a human or animal patient in need thereof . in another aspect , the invention provides a method of treatment of the conditions disclosed above comprising administering a therapeutically effective amount of a compound of formula ii as hereinbefore described , in free or pharmaceutically acceptable salt form , to a human or animal patient in need thereof . in an especially preferred embodiment , the invention provides methods of treatment or prophylaxis for narcolepsy . in this embodiment , pde 1 inhibitors may be used as a sole therapeutic agent , but may also be used in combination or for co - administration with other active agents . thus , the invention further comprises a method of treating narcolepsy comprising administering simultaneously , sequentially , or contemporaneously administering therapeutically effective amounts of ( i ) a pde 1 inhibitor of the invention , e . g ., a compound according to any of formula i or any of 1 . 1 - 1 . 135 , or i ( i ) or i ( ii ), or any described in this specification ; and ( ii ) a compound to promote wakefulness or regulate sleep , e . g ., selected from ( a ) central nervous system stimulants - amphetamines and amphetamine like compounds , e . g ., methylphenidate , dextroamphetamine , methamphetamine , and pemoline ; ( b ) modafinil , ( c ) antidepressants , e . g ., tricyclics ( including imipramine , desipramine , clomipramine , and protriptyline ) and selective serotonin reuptake inhibitors ( including fluoxetine and sertraline ); and / or ( d ) gamma hydroxybutyrate ( ghb ), in free or pharmaceutically acceptable salt form , to a human or animal patient in need thereof . in another embodiment , the invention provides methods of treatment or prophylaxis for narcolepsy as herein before described , wherein the pde1 inhibitor is in a form of a pharmaceutical composition . in still another embodiment , the methods of treatment or prophylaxis for narcolepsy as hereinbefore described , comprises administering a therapeutically effective amount of a compound of formula ii as hereinbefore described , in free or pharmaceutically acceptable salt form , as a sole therapeutic agent or use in combination for co - administered with another active agent . in another embodiment , the invention further provides methods of treatment or prophylaxis of a condition which may be alleviated by the enhancement of the progesterone signaling comprising administering an effective amount of a compound of the invention , e . g ., a compound according to any of formula 1 . 1 - 1 . 135 or formula i , i ( i ) or i ( ii ), or any described in this specification , in free or pharmaceutically acceptable salt form , to a human or animal patient in need thereof . the invention also provides methods of treatment as disclosed here , comprising administering a therapeutically effective amount of a compound of formula ii , in free or pharmaceutically acceptable salt form . disease or condition that may be ameliorated by enhancement of progesterone signaling include , but are not limited to , female sexual dysfunction , secondary amenorrhea ( e . g ., exercise amenorrhoea , anovulation , menopause , menopausal symptoms , hypothyroidism ), pre - menstrual syndrome , premature labor , infertility , for example infertility due to repeated miscarriage , irregular menstrual cycles , abnormal uterine bleeding , osteoporosis , autoimmune disease , multiple sclerosis , prostate enlargement , prostate cancer , and hypothyroidism . for example , by enhancing progesterone signaling , the pde 1 inhibitors may be used to encourage egg implantation through effects on the lining of uterus , and to help maintain pregnancy in women who are prone to miscarriage due to immune response to pregnancy or low progesterone function . the novel pde 1 inhibitors , e . g ., as described herein , may also be useful to enhance the effectiveness of hormone replacement therapy , e . g ., administered in combination with estrogen / estradiol / estriol and / or progesterone / progestins in postmenopausal women , and estrogen - induced endometrial hyperplasia and carcinoma . the methods of the invention are also useful for animal breeding , for example to induce sexual receptivity and / or estrus in a nonhuman female mammal to be bred . in this embodiment , pde 1 inhibitors may be used in the foregoing methods of treatment or prophylaxis as a sole therapeutic agent , but may also be used in combination or for co - administration with other active agents , for example in conjunction with hormone replacement therapy . thus , the invention further comprises a method of treating disorders that may be ameliorated by enhancement of progesterone signaling comprising administering simultaneously , sequentially , or contemporaneously administering therapeutically effective amounts of ( i ) a pde 1 inhibitor , e . g ., a compound according to any of formula i , any of 1 . 1 - 1 . 135 or i ( i ) or i ( ii ), or any described in this specification and ( ii ) a hormone , e . g ., selected from estrogen and estrogen analogues ( e . g ., estradiol , estriol , estradiol esters ) and progesterone and progesterone analogues ( e . g ., progestins ) in free or pharmaceutically acceptable salt form , to a human or animal patient in need thereof . in another embodiment , the invention provides the method described above wherein the pde 1 inhibitor is a compound of formula ii , in free or pharmaceutically acceptable salt form . the invention also provides a method for enhancing or potentiating dopamine d1 intracellular signaling activity in a cell or tissue comprising contacting said cell or tissue with an amount of a compound of the invention sufficient to inhibit pde1 b activity . the invention also provides a method for enhancing or potentiating progesterone signaling activity in a cell or tissue comprising contacting said cell or tissue with an amount of a compound of the invention sufficient to inhibit pde1b activity . the invention also provides a method for treating a pde1 - related , especially pde1b - related disorder , a dopamine d1 receptor intracellular signaling pathway disorder , or disorders that may be alleviated by the enhancement of the progesterone signaling pathway in a patient in need thereof comprising administering to the patient an effective amount of a compound of the invention that inhibits pde1b , wherein pde1b activity modulates phosphorylation of darpp - 32 and / or the glur1 ampa receptor . in another aspect , the invention also provides a method for the treatment for glaucoma or elevated intraocular pressure comprising topical administration of a therapeutically effective amount of a phosphodiesterase type i ( pde1 ) inhibitor of the invention , in free or pharmaceutically acceptable salt form , in an opthalmically compatible carrier to the eye of a patient in need thereof . however , treatment may alternatively include a systemic therapy . systemic therapy includes treatment that can directly reach the bloodstream , or oral methods of administration , for example . the invention further provides a pharmaceutical composition for topical ophthalmic use comprising a pde1 inhibitor ; for example an ophthalmic solution , suspension , cream or ointment comprising a pde1 inhibitor of the invention , in free or ophthamalogically acceptable salt form , in combination or association with an ophthamologically acceptable diluent or carrier . optionally , the pde1 inhibitor may be administered sequentially or simultaneously with a second drug useful for treatment of glaucoma or elevated intraocular pressure . where two active agents are administered , the therapeutically effective amount of each agent may be below the amount needed for activity as monotherapy . accordingly , a subthreshold amount ( i . e ., an amount below the level necessary for efficacy as monotherapy ) may be considered therapeutically effective and also may also be referred alternatively as an effective amount . indeed , an advantage of administering different agents with different mechanisms of action and different side effect profiles may be to reduce the dosage and side effects of either or both agents , as well as to enhance or potentiate their activity as monotherapy . the invention thus provides the method of treatment of a condition selected from glaucoma and elevated intraocular pressure comprising administering to a patient in need thereof an effective amount , e . g ., a subthreshold amount , of an agent known to lower intraocular pressure concomitantly , simultaneously or sequentially with an effective amount , e . g ., a subthreshold amount , of a pde1 inhibitor of the invention , in free or pharmaceutically acceptable salt form , such that amount of the agent known to lower intraocular pressure and the amount of the pde 1 inhibitor in combination are effective to treat the condition . in one embodiment , one or both of the agents are administered topically to the eye . thus the invention provides a method of reducing the side effects of treatment of glaucoma or elevated intraocular pressure by administering a reduced dose of an agent known to lower intraocular pressure concomitantly , simultaneously or sequentially with an effective amount of a pde1 inhibitor . however , methods other than topical administration , such as systemic therapeutic administration , may also be utilized . the optional additional agent or agents for use in combination with a pde1 inhibitor may , for example , be selected from the existing drugs comprise typically of instillation of a prostaglandin , pilocarpine , epinephrine , or topical beta - blocker treatment , e . g . with timolol , as well as systemically administered inhibitors of carbonic anhydrase , e . g . acetazolamide . cholinesterase inhibitors such as physostigmine and echothiopate may also be employed and have an effect similar to that of pilocarpine . drugs currently used to treat glaucoma thus include , e . g ., 1 . prostaglandin analogs such as latanoprost ( xalatan ), bimatoprost ( lumigan ) and travoprost ( travatan ), which increase uveoscleral outflow of aqueous humor . bimatoprost also increases trabecular outflow . 2 . topical beta - adrenergic receptor antagonists such as timolol , levobunolol ( betagan ), and betaxolol , which decrease aqueous humor production by the ciliary body . 3 . alpha 2 - adrenergic agonists such as brimonidine ( alphagan ), which work by a dual mechanism , decreasing aqueous production and increasing uveo - scleral outflow . 4 . less - selective sympathomimetics like epinephrine and dipivefrin ( propine ) increase outflow of aqueous humor through trabecular meshwork and possibly through uveoscleral outflow pathway , probably by a beta 2 - agonist action . 5 . miotic agents ( parasympathomimetics ) like pilocarpine work by contraction of the ciliary muscle , tightening the trabecular meshwork and allowing increased outflow of the aqueous humour . 6 . carbonic anhydrase inhibitors like dorzolamide ( trusopt ), brinzolamide ( azopt ), acetazolamide ( diamox ) lower secretion of aqueous humor by inhibiting carbonic anhydrase in the ciliary body . 7 . physostigmine is also used to treat glaucoma and delayed gastric emptying . for example , the invention provides pharmaceutical compositions comprising a pde1 inhibitor of the invention and an agent selected from ( i ) the prostanoids , unoprostone , latanoprost , travoprost , or bimatoprost ; ( ii ) an alpha adrenergic agonist such as brimonidine , apraclonidine , or dipivefrin and ( iii ) a muscarinic agonist , such as pilocarpine . for example , the invention provides ophthalmic formulations comprising a pde - 1 inhibitor of the invention together with bimatoprost , abrimonidine , brimonidine , timolol , or combinations thereof , in free or ophthamalogically acceptable salt form , in combination or association with an ophthamologically acceptable diluent or carrier . in addition to selecting a combination , however , a person of ordinary skill in the art can select an appropriate selective receptor subtype agonist or antagonist . for example , for alpha adrenergic agonist , one can select an agonist selective for an alpha 1 adrenergic receptor , or an agonist selective for an alpha 2 adrenergic receptor such as brimonidine , for example . for a beta - adrenergic receptor antagonist , one can select an antagonist selective for either β 1 , or β 2 , or β 3 , depending on the appropriate therapeutic application . one can also select a muscarinic agonist selective for a particular receptor subtype such as m 1 - m 5 . the pde 1 inhibitor may be administered in the form of an ophthalmic composition , which includes an ophthalmic solution , cream or ointment . the ophthalmic composition may additionally include an intraocular - pressure lowering agent . in yet another example , the pde - 1 inhibitors disclosed may be combined with a subthreshold amount of an intraocular pressure - lowering agent which may be a bimatoprost ophthalmic solution , a brimonidine tartrate ophthalmic solution , or brimonidine tartrate / timolol maleate ophthalmic solution . in addition to the above - mentioned methods , it has also been surprisingly discovered that pde1 inhibitors are useful to treat psychosis , for example , any conditions characterized by psychotic symptoms such as hallucinations , paranoid or bizarre delusions , or disorganized speech and thinking , e . g ., schizophrenia , schizoaffective disorder , schizophreniform disorder , psychotic disorder , delusional disorder , and mania , such as in acute manic episodes and bipolar disorder . without intending to be bound by any theory , it is believed that typical and atypical antipsychotic drugs such as clozapine primarily have their antagonistic activity at the dopamine d2 receptor . pde1 inhibitors , however , primarily act to enhance signaling at the dopamine d1 receptor . by enhancing d1 receptor signaling , pde1 inhibitors can increase nmda receptor function in various brain regions , for example in nucleus accumbens neurons and in the prefrontal cortex . this enhancement of function may be seen for example in nmda receptors containing the nr2b subunit , and may occur e . g ., via activation of the src and protein kinase a family of kinases . therefore , the invention provides a new method for the treatment of psychosis , e . g ., schizophrenia , schizoaffective disorder , schizophreniform disorder , psychotic disorder , delusional disorder , and mania , such as in acute manic episodes and bipolar disorder , comprising administering a therapeutically effective amount of a phosphodiesterase - 1 ( pde1 ) inhibitor of the invention , in free or pharmaceutically acceptable salt form , to a patient in need thereof . pde 1 inhibitors may be used in the foregoing methods of treatment prophylaxis as a sole therapeutic agent , but may also be used in combination or for co - administration with other active agents . thus , the invention further comprises a method of treating psychosis , e . g ., schizophrenia , schizoaffective disorder , schizophreniform disorder , psychotic disorder , delusional disorder , or mania , comprising administering simultaneously , sequentially , or contemporaneously administering therapeutically effective amounts of : ( i ) a pde 1 inhibitor of the invention , in free or pharmaceutically acceptable salt form ; and ( ii ) an antipsychotic , e . g ., butyrophenones , e . g . haloperidol ( haldol , serenace ), droperidol ( droleptan ); phenothiazines , e . g ., chlorpromazine ( thorazine , largactil ), fluphenazine ( prolixin ), perphenazine ( trilafon ), prochlorperazine ( compazine ), thioridazine ( mellaril , melleril ), trifluoperazine ( stelazine ), mesoridazine , periciazine , promazine , triflupromazine ( vesprin ), levomepromazine ( nozinan ), promethazine ( phenergan ), pimozide ( orap ); thioxanthenes , e . g ., chlorprothixene , flupenthixol ( depixol , fluanxol ), thiothixene ( navane ), zuclopenthixol ( clopixol , acuphase ); clozapine ( clozaril ), olanzapine ( zyprexa ), risperidone ( risperdal ), quetiapine ( seroquel ), ziprasidone ( geodon ), amisulpride ( solian ), paliperidone ( invega ), aripiprazole ( abilify ), bifeprunox ; norclozapine , in free or pharmaceutically acceptable salt form , to a patient in need thereof . in a particular embodiment , the compounds of the invention are particularly useful for the treatment or prophylaxis of schizophrenia . compounds of the invention , in free or pharmaceutically acceptable salt form , are particularly useful for the treatment of parkinson &# 39 ; s disease , schizophrenia , narcolepsy , glaucoma and female sexual dysfunction . in still another aspect , the invention provides a method of lengthening or enhancing growth of the eyelashes by administering an effective amount of a prostaglandin analogue , e . g ., bimatoprost , concomitantly , simultaneously or sequentially with an effective amount of a pde 1 inhibitor of the invention , in free or pharmaceutically acceptable salt form , to the eye of a patient in need thereof . in yet another aspect , the invention provides a method for the treatment or prophylaxis of traumatic brain injury comprising administering a therapeutically effective amount of a pde1 inhibitor of the invention , in free or pharmaceutically acceptable salt form , to a patient in need thereof . traumatic brain injury ( tbi ) encompasses primary injury as well as secondary injury , including both focal and diffuse brain injuries . secondary injuries are multiple , parallel , interacting and interdependent cascades of biological reactions arising from discrete subcellular processes ( e . g ., toxicity due to reactive oxygen species , overstimulation of glutamate receptors , excessive influx of calcium and inflammatory upregulation ) which are caused or exacerbated by the inflammatory response and progress after the initial ( primary ) injury . abnormal calcium homeostasis is believed to be a critical component of the progression of secondary injury in both grey and white matter . for a review of tbi , see park et al ., cmaj ( 2008 ) 178 ( 9 ): 1163 - 1170 , the contents of which are incorporated herein in their entirety . studies have shown that the camp - pka signaling cascade is downregulated after tbi and treatment of pde iv inhibitors such as rolipram to raise or restore camp level improves histopathological outcome and decreases inflammation after tbi . as compounds of the present invention is a pde1 inhibitor , it is believed that these compounds are also useful for the treatment of tbi , e . g ., by restoring camp level and / or calcium homeostasis after traumatic brain injury . ( i ) a compound of the invention for use as a pharmaceutical , for example for use in any method or in the treatment of any disease or condition as hereinbefore set forth , ( ii ) the use of a compound of the invention in the manufacture of a medicament for treating any disease or condition as hereinbefore set forth , ( iii ) a pharmaceutical composition comprising a compound of the invention in combination or association with a pharmaceutically acceptable diluent or carrier , and ( iv ) a pharmaceutical composition comprising a compound of the invention in combination or association with a pharmaceutically acceptable diluent or carrier for use in the treatment of any disease or condition as hereinbefore set forth . therefore , the invention provides use of a compound of the invention for the manufacture of a medicament for the treatment or prophylactic treatment of the following diseases : parkinson &# 39 ; s disease , restless leg , tremors , dyskinesias , huntington &# 39 ; s disease , alzheimer &# 39 ; s disease , and drug - induced movement disorders ; depression , attention deficit disorder , attention deficit hyperactivity disorder , bipolar illness , anxiety , sleep disorder , narcolepsy , cognitive impairment , dementia , tourette &# 39 ; s syndrome , autism , fragile x syndrome , psychostimulant withdrawal , and / or drug addiction ; cerebrovascular disease , stroke , congestive heart disease , hypertension , pulmonary hypertension , and / or sexual dysfunction ; asthma , chronic obstructive pulmonary disease , and / or allergic rhinitis , as well as autoimmune and inflammatory diseases ; and / or female sexual dysfunction , exercise amenorrhoea , anovulation , menopause , menopausal symptoms , hypothyroidism , pre - menstrual syndrome , premature labor , infertility , irregular menstrual cycles , abnormal uterine bleeding , osteoporosis , multiple sclerosis , prostate enlargement , prostate cancer , hypothyroidism , estrogen - induced endometrial hyperplasia or carcinoma ; and / or any disease or condition characterized by low levels of camp and / or cgmp ( or inhibition of camp and / or cgmp signaling pathways ) in cells expressing pde1 , and / or by reduced dopamine d1 receptor signaling activity ; and / or any disease or condition that may be ameliorated by the enhancement of progesterone signaling . the invention also provides use of a compound of the invention , in free or pharmaceutically acceptable salt form , for the manufacture of a medicament for the treatment or prophylactic treatment of : a ) glaucoma or elevated intraocular pressure , b ) psychosis , for example , any conditions characterized by psychotic symptoms such as hallucinations , paranoid or bizarre delusions , or disorganized speech and thinking , e . g ., schizophrenia , schizoaffective disorder , schizophreniform disorder , psychotic disorder , delusional disorder , and mania , such as in acute manic episodes and bipolar disorder , c ) traumatic brain injury . the phrase “ compounds of the invention ” or “ pde 1 inhibitors of the invention ” encompasses any and all of the compounds disclosed within this specification . the words “ treatment ” and “ treating ” are to be understood accordingly as embracing prophylaxis and treatment or amelioration of symptoms of disease as well as treatment of the cause of the disease for methods of treatment , the word “ effective amount ” is intended to encompass a therapeutically effective amount to treat a specific disease or disorder . the term “ pulmonary hypertension ” is intended to encompass pulmonary arterial hypertension . the term “ patient ” include human or non - human ( i . e ., animal ) patient . in particular embodiment , the invention encompasses both human and nonhuman . in another embodiment , the invention encompasses nonhuman . in other embodiment , the term encompasses human . the term “ comprising ” as used in this disclosure is intended to be open - ended and does not exclude additional , unrecited elements or method steps . compounds of the invention are in particular useful for the treatment of parkinson &# 39 ; s disease , narcolepsy and female sexual dysfunction . compounds of the invention may be used as a sole therapeutic agent , but may also be used in combination or for co - administration with other active agents . for example , as compounds of the invention potentiate the activity of d1 agonists , such as dopamine , they may be simultaneously , sequentially , or contemporaneously administered with conventional dopaminergic medications , such as levodopa and levodopa adjuncts ( carbidopa , comt inhibitors , mao - b inhibitors ), dopamine agonists , and anticholinergics , e . g ., in the treatment of a patient having parkinson &# 39 ; s disease . in addition , the novel pde 1 inhibitors of the invention , e . g ., the compounds of the invention as described herein , may also be administered in combination with estrogen / estradiol / estriol and / or progesterone / progestins to enhance the effectiveness of hormone replacement therapy or treatment of estrogen - induced endometrial hyperplasia or carcinoma . dosages employed in practicing the present invention will of course vary depending , e . g . on the particular disease or condition to be treated , the particular compound of the invention used , the mode of administration , and the therapy desired . compounds of the invention may be administered by any suitable route , including orally , parenterally , transdermally , or by inhalation , but are preferably administered orally . in general , satisfactory results , e . g . for the treatment of diseases as hereinbefore set forth are indicated to be obtained on oral administration at dosages of the order from about 0 . 01 to 2 . 0 mg / kg . in larger mammals , for example humans , an indicated daily dosage for oral administration will accordingly be in the range of from about 0 . 75 to 150 mg , conveniently administered once , or in divided doses 2 to 4 times , daily or in sustained release form . unit dosage forms for oral administration thus for example may comprise from about 0 . 2 to 75 or 150 mg , e . g . from about 0 . 2 or 2 . 0 to 50 , 75 or 100 mg of a compound of the invention , together with a pharmaceutically acceptable diluent or carrier therefor . pharmaceutical compositions comprising compounds of the invention may be prepared using conventional diluents or excipients and techniques known in the galenic art . thus oral dosage forms may include tablets , capsules , solutions , suspensions and the like . the synthetic methods for various compounds of the present invention are illustrated below . other compounds of the invention and their salts may be made using the methods as similarly described below and / or by methods similar to those generally described in the detailed description and by methods known in the chemical art . 5 - methyl - 7 - neopentyl - 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione ( 200 mg , 0 . 847 mmol ), 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole ( 202 mg , 0 . 847 mmol ) and k 2 co 3 ( 117 mg , 0 . 847 mmol ) are suspended in 5 ml of anhydrous dmf . the reaction mixture is stirred at room temperature for 5 h , and then evaporated to dryness under reduced pressure . the residue is treated with water , and then extracted with dichloromethane three times . the combined organic phase is dried with anhydrous sodium sulfate , filtered , and then evaporated to dryness to give 337 mg of crude product , which is used in the next step without further purification . ms ( esi ) m / z 394 . 2 [ m + h ] + . 2 -( 4 -( 1h - 1 , 2 , 4 - triazol - 1 - yl ) benzyl )- 5 - methyl - 7 - neopentyl - 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione ( 52 mg , 0 . 132 mmol ) and methyl disulfide ( 12 μl , 0 . 13 mmol ) are dissolved in 2 ml of anhydrous ch 2 cl 2 , and then 1 . 0 m lihmds ( 190 μl , 0 . 19 mmol ) in thf is added dropwise . the reaction mixture is stirred at room temperature for 30 min , and then quenched with saturated ammonium chloride aqueous solution . after routine workup , the obtained crude product is purified by silica gel column chromatography to give pure product as off - white solids . ms ( esi ) m / z 440 . 2 [ m + h ] + . the synthetic procedure of this compound is analogous to example 1 wherein 1 -( bromomethyl )- 4 -( trifluoromethyl ) benzene is used in step 1 instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole . ms ( esi ) m / z 441 . 2 [ m + h ] + . the synthetic procedure of this compound is analogous to example 1 wherein 1 -( bromomethyl )- 4 -( trifluoromethyl ) benzene is used in step 1 instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole , and phenyl disulfide is used in step 2 instead of methyl disulfide . ms ( esi ) m / z 503 . 2 [ m + h ] + . the synthetic procedure of this compound is analogous to example 1 wherein 4 - methoxybenzyl bromide is used in step 1 instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole , and phenyl disulfide is used in step 2 instead of methyl disulfide . ms ( esi ) m / z 465 . 2 [ m + h ] + . 2 -( 4 - methoxybenzyl )- 5 - methyl - 7 - neopentyl - 3 -( phenylthio )- 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione ( 2 . 7 g , 5 . 9 mmol ) is dissolved in ch 2 cl 2 ( 20 ml ) containing tfa ( 4 . 2 ml ) and tfmsa ( 1 . 0 ml ). the mixture is stirred at room temperature overnight . solvents are removed , and the residue is dissolved in ethyl acetate ( 250 ml ), followed by washing with saturate nahco 3 and water successively . after dried over anhydrous sodium sulfate , the organic phase is evaporated to dryness . the obtained crude product is used in the next step without further purification . crude 5 - methyl - 7 - neopentyl - 3 -( phenylthio )- 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione ( 40 mg , 0 . 12 mmol ), 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole ( 28 mg , 0 . 12 mmol ) and k 2 co 3 ( 16 mg , 0 . 12 mmol ) are suspended in 5 ml of anhydrous dmf . the reaction mixture is stirred at room temperature overnight , and then evaporated to dryness under reduced pressure . the residue is purified by silica gel column chromatography to give pure product as white solids . ms ( esi ) m / z 502 . 2 [ m + h ] + . the synthetic procedure of this compound is analogous to example 1 wherein 4 - methoxybenzyl bromide is used in step 1 instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole . ms ( esi ) m / z 403 . 2 [ m + h ] + . the synthetic procedure of this compound is analogous to example 5 wherein 2 -( 4 - methoxybenzyl )- 5 - methyl - 3 -( methylthio )- 7 - neopentyl - 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione is used instead of 2 -( 4 - methoxybenzyl )- 5 - methyl - 7 - neopentyl - 3 -( phenylthio )- 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione , and 1 -( 4 -( bromomethyl ) phenyl )- 1h - pyrazole is used instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole . ms ( esi ) m / z 439 . 2 [ m + h ] + . the synthetic procedure of this compound is analogous to example 5 wherein 1 -( bromomethyl )- 4 -( methylsulfonyl ) benzene is used instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole . ms ( esi ) m / z 513 . 2 [ m + h ] + . the synthetic procedure of this compound is analogous to example 1 wherein 2 -( 4 -( bromomethyl ) phenyl ) pyridine is used in step 1 instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole , and phenyl disulfide is used in step 2 instead of methyl disulfide . ms ( esi ) m / z 512 . 3 [ m + h ] + . the synthetic procedure of this compound is analogous to example 5 wherein 2 -( 4 -( chloromethyl ) phenyl )- 1 - methylpiperidine is used instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole . ms ( esi ) m / z 532 . 3 [ m + h ] + . the synthetic procedure of this compound is analogous to example 5 wherein 2 -( 4 - methoxybenzyl )- 5 - methyl - 3 -( methylthio )- 7 - neopentyl - 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione is used instead of 2 -( 4 - methoxybenzyl )- 5 - methyl - 7 - neopentyl - 3 -( phenylthio )- 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione , and 1 -( bromomethyl )- 4 -( methylsulfonyl ) benzene is used instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole . ms ( esi ) m / z 451 . 1 [ m + h ] + . 5 - methyl - 2 -( 4 -( methylsulfonyl ) benzyl )- 3 -( methylthio )- 7 - neopentyl - 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione ( 11 . 4 mg , 0 . 022 mmol ) is dissolved in ch 2 cl 2 ( 200 μl ) and ch 3 cn ( 100 μl ), and then 30 % h 2 o 2 aqueous solution ( 75 μl , 0 . 66 mmol ) is added , followed by acetic acid ( 6 . 6 mg , 0 . 11 mmol ). the reaction mixture is stirred at room temperature over a weekend , and then purified by a semi - preparative hplc to give 6 mg of product as white solids . ms ( esi ) m / z 467 . 1 [ m + h ] + . 2 -( 4 -( 1h - 1 , 2 , 4 - triazol - 1 - yl ) benzyl )- 5 - methyl - 3 -( methylthio )- 7 - neopentyl - 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione ( 16 mg , 0 . 036 mmol ) is dissolved in ch 2 cl 2 ( 500 μl ) and meoh ( 500 μl ), and then an aqueous solution of oxone ( 22 . 4 mg , 0 . 036 mmol ) is added . the reaction mixture is stirred at room temperature for 2 days , and then purified by a semi - preparative hplc to give 8 mg of product as off - white solids . ms ( esi ) m / z 456 . 2 [ m + h ] + . the synthetic procedure of this compound is the same as example 13 . 2 -( 4 -( 1h - 1 , 2 , 4 - triazol - 1 - yl ) benzyl )- 5 - methyl - 3 -( methylsulfonyl )- 7 - neopentyl - 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione is obtained as a minor product of the reaction . ms ( esi ) m / z 472 . 2 [ m + h ] + . the synthetic procedure of this compound is analogous to example 5 wherein 2 -( 4 - methoxybenzyl )- 5 - methyl - 3 -( methylthio )- 7 - neopentyl - 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione is used instead of 2 -( 4 - methoxybenzyl )- 5 - methyl - 7 - neopentyl - 3 -( phenylthio )- 2h - pyrazolo [ 3 , 4 - d ] pyrimidine - 4 , 6 ( 5h , 7h )- dione , and 2 -( 4 -( chloromethyl ) phenyl )- 1 - methylpiperidine is used instead of 1 -( 4 -( bromomethyl ) phenyl )- 1h - 1 , 2 , 4 - triazole . ms ( esi ) m / z 439 . 2 [ m + h ] + . measurement of pde1b inhibition in vitro using imap phosphodiesterase assay kit phosphodiesterase 1b ( pde1b ) is a calcium / calmodulin dependent phosphodiesterase enzyme that converts cyclic guanosine monophosphate ( cgmp ) to 5 ′- guanosine monophosphate ( 5 ′- gmp ). pde1b can also convert a modified cgmp substrate , such as the fluorescent molecule cgmp - fluorescein , to the corresponding gmp - fluorescein . the generation of gmp - fluorescein from cgmp - fluorescein can be quantitated , using , for example , the imap ( molecular devices , sunnyvale , calif .) immobilized - metal affinity particle reagent . briefly , the imap reagent binds with high affinity to the free 5 ′- phosphate that is found in gmp - fluorescein and not in cgmp - fluorescein . the resulting gmp - fluorescein - imap complex is large relative to cgmp - fluorescein . small fluorophores that are bound up in a large , slowly tumbling , complex can be distinguished from unbound fluorophores , because the photons emitted as they fluoresce retain the same polarity as the photons used to excite the fluorescence . in the phosphodiesterase assay , cgmp - fluorescein , which cannot be bound to imap , and therefore retains little fluorescence polarization , is converted to gmp - fluorescein , which , when bound to imap , yields a large increase in fluorescence polarization ( δmp ). inhibition of phosphodiesterase , therefore , is detected as a decrease in δmp . materials : all chemicals are available from sigma - aldrich ( st . louis , mo .) except for imap reagents ( reaction buffer , binding buffer , fl - gmp and imap beads ), which are available from molecular devices ( sunnyvale , calif .). assay : 3 ′, 5 ′- cyclic - nucleotide - specific bovine brain phosphodiesterase ( sigma , st . louis , mo .) is reconstituted with 50 % glycerol to 2 . 5 u / ml . one unit of enzyme will hydrolyze 1 . 0 μmole of 3 ′, 5 ′- camp to 5 ′- amp per min at ph 7 . 5 at 30 ° c . one part enzyme is added to 1999 parts reaction buffer ( 30 μm cacl 2 , 10 u / ml of calmodulin ( sigma p2277 ), 10 mm tris - hcl ph 7 . 2 , 10 mm mgcl 2 , 0 . 1 % bsa , 0 . 05 % nan 3 ) to yield a final concentration of 1 . 25 mu / ml . 99 μl of diluted enzyme solution is added into each well in a flat bottom 96 - well polystyrene plate to which 1 μl of test compound dissolved in 100 % dmso is added . selected compounds of the invention are mixed and pre - incubated with the enzyme for 10 min at room temperature . the fl - gmp conversion reaction is initiated by combining 4 parts enzyme and inhibitor mix with 1 part substrate solution ( 0 . 225 μm ) in a 384 - well microtiter plate . the reaction is incubated in dark at room temperature for 15 min . the reaction is halted by addition of 60 μl of binding reagent ( 1 : 400 dilution of imap beads in binding buffer supplemented with 1 : 1800 dilution of antifoam ) to each well of the 384 - well plate . the plate is incubated at room temperature for 1 hour to allow imap binding to proceed to completion , and then placed in an envision multimode microplate reader ( perkinelmer , shelton , conn .) to measure the fluorescence polarization ( δmp ). a decrease in gmp concentration , measured as decreased amp , is indicative of inhibition of pde activity . ic 50 values are determined by measuring enzyme activity in the presence of 8 to 16 concentrations of compound ranging from 0 . 0037 nm to 80 , 000 nm and then plotting drug concentration versus δmp , which allows ic 50 values to be estimated using nonlinear regression software ( xlfit ; idbs , cambridge , mass .). the compounds of the invention may be selected and tested in an assay as described or similarly described herein for pde1 inhibitory activity . the exemplified compounds of the invention generally have ic 50 values of less than 5 μm , some less than 1 μm , some less than 250 nm , some with pde1a activities . the effect of pde1 inhibitors on lordosis response in female rats is measured as described in mani , et al ., science ( 2000 ) 287 : 1053 . ovariectomized and cannulated wild - type rats are primed with 2 μg estrogen followed 24 hours later by intracerebroventricular ( icy ) injection of progesterone ( 2 μg ), pde1 inhibitors of the present invention ( 0 . 1 mg , 1 . 0 mg or 2 . 5 mg ) or sesame oil vehicle ( control ). the rats are tested for lordosis response in the presence of male rats . lordosis response is quantified by the lordosis quotient ( lq = number of lordosis / 10 mounts × 100 ). the lq for estrogen - primed female rats receiving compounds of the invention , at 0 . 1 mg , will likely be similar to estrogen - primed rats receiving progesterone and higher than for estrogen - primed rats receiving vehicle . | 0 |
one group of embodiments of the invention disclosed herein is directed to a strake cleaning skid that is designed to fit on an rov , for use in cleaning subsea conduits , such as strakes or fairings . another group of embodiments of the invention disclosed herein is directed to methods of cleaning a subsea conduit using strake cleaninig skid attached to an rov . in one preferred embodiment , the invention comprises a frame 10 comprising a front region , a rear region opposite the front region , and a top region 9 defining a top planar surface , as shown in fig1 and 9b . this embodiment of the invention further comprises a first arm 14 a mounted on the front region of the frame and a second arm 14 b mounted on the front region of the frame , as shown in fig3 . in a preferred embodiment , the first arm and second arm are each pivotally mounted to the frame . in another preferred embodiment , the first arm and the second arm are each extendably and retractably mounted to the frame . the arms are depicted in a retracted configuration in fig1 and 2 , and in an extended configuration in fig3 . this embodiment of the invention further comprises a first brush rotational axis 11 a rotatably mounted on the first arm in an orientation substantially perpendicular to the top planar surface , and a second brush rotational axis 11 b rotatably mounted on the second arm in an orientation substantially perpendicular to the top planar surface , as shown in fig9 a - 9b . in a preferred embodiment , the first and second brushes abrasive elements extend outward in a substantially circular configuration , as shown in fig1 - 5 . this embodiment of the invention further comprises a first motor 16 a operatively coupled to rotate the first brush rotational axis and a second motor 16 b operatively coupled to rotate the second brush rotational axis , as shown in fig1 - 2 . this embodiment of the invention further comprises a plurality of first brush abrasive elements 12 a attached to , and extending radially outward from , the first brush rotational axis , and a plurality of second brush abrasive elements 12 b attached to , and extending radially outward from , the second brush rotational axis brush rotational axis . in another preferred embodiment , the invention further comprises an rov 20 connected to the top of the frame , as shown in fig2 - 4 , 7 , 9 a , and 10 - 11 . the arms can retract and extend from skid for easy deployment . the skid fits on the bottom of rov as shown in fig2 . when the rov deploys for operation the brushes are retracted , as shown in fig1 . another preferred embodiment of the invention further comprises a third arm 14 c mounted on the frame between the first and second arms , as shown in fig4 , and a third brush rotational axis 11 c rotatably mounted on the third arm . this embodiment further comprises a third plurality of third brush abrasive elements 12 c attached to , and extending radially outward from , the third brush rotational axis , as shown in fig4 . in a preferred embodiment , the third brush abrasive elements extend outward in a substantially circular configuration , as shown in fig4 . in a preferred embodiment , the third arm is pivotally mounted to the frame . in another preferred embodiment , the third arm is extendably and retractably mounted to the frame , as shown in fig2 - 3 . this embodiment further comprises a third motor 16 c operatively coupled to rotate the third brush rotational axis . method embodiments of the invention disclosed herein are directed to methods of cleaning a subsea conduit 21 . in one embodiment , the conduit comprises fins 22 . a first method embodiment comprises piloting a remotely operated vehicle with a skid mounted beneath it toward a subsea conduit having a longitudinal axis . the skid comprising at least two motorized brushes , each of which is mounted on a rotational axis that is rotatably mounted to an arm pivotally mounted to the skid , as shown in fig2 . in a second method embodiment , the skid comprises at least two outer motorized brushes and a center motorized brush , each of which is mounted on a rotational axis that is rotatably mounted to an arm that is mounted to the skid , as shown in fig3 . once the rov gets near the subsea conduit to be cleaned , the first and second methods further comprise extending the arms in front of the skid , as shown in fig3 . the first method further comprises pivotally opening the arms , or swinging them outward a sufficient amount to allow the brushes to contact opposite sides of the subsea conduit , as shown in fig4 - 5 . the second method comprises pivotally opening the arms to which the two outer motorized brushes are attached a sufficient amount to allow the two outerbrushes to contact opposite sides of the subsea conduit , as shown in fig4 - 5 . the angle of swing is determined by size of subsea conduit . the first and second methods further comprise operating the motors to rotate each brush about its rotational axis , as shown in fig5 , and operating the motors to rotate the brushes , as shown in fig6 . the first and second methods further comprise positioning the remotely operated vehicle and skid such that the rotating brushes abrasively clean opposite sides of the conduit with the rotational axes oriented substantially parallel to the longitudinal axis of the subsea conduit , as shown in fig6 and 8 . in a preferred embodiment , the first and second methods further comprise piloting the remotely operated vehicle in a direction substantially parallel to the longitudinal axis of the subsea conduit being cleaned , such that the rotating brushes abrasively clean the conduit along its length . this may be accomplished by having the rov thrust up and down in proper sequence to clean the strakes as shown in fig6 . in a preferred embodiment , the first and second methods further comprise ceasing the rotation of the brushes ; and retracting the arms such that the brushes are no longer in contact with the subsea conduit . in a preferred embodiment , the first and second methods further comprise piloting the remotely operated vehicle away from the subsea conduit that was cleaned by the brushes . the foregoing disclosure and description of the inventions are illustrative and explanatory . various changes in the size , shape , and materials , as well as in the details of the illustrative construction and / or a illustrative method may be made without departing from the spirit of the invention . | 1 |
the present preferred embodiments of the invention are described in the following with reference to the fig1 through 20 purely schematically and in the sense of examples merely . it should be understood that various modifications and variations can be made in the invention without departing from the scope and spirit of the invention . for example , features illustrated or described as part of one embodiment can be used in another embodiment to yield still a further embodiment . it is intended that the present invention include such modifications and variations . in the fig1 the row designated 1 concerns the supply of yarn components in which each component supplied either is a yarn component supplied from an extrusion beam and drawn on - line or a drawn yarn component supplied from a package . the reference number 2 designates a row of treating stages in which arrangement , as shown in the fig1 a separate treating device each being provided for each yarn component . a common compacting stage designated with the reference number 3 , as shown in the fig1 jointly treats all yarn components 5 through 5 . 4 , which subsequently are transferred to the collecting stage 4 as a yarn 7 . this collecting stage 4 represents a winding device . as shown in the fig2 the individual yarn components can pass through none or through more than one of the treating stages before the individual yarn components are combined in the compacting stage 3 into a yarn 7 . 1 . in this arrangement , the yarn component 5 is assumed to be treated in one treating stage , the yarn component 5 . 5 in two treating stages , and the yarn component 5 . 6 in none of the treating stages . furthermore , the yarn component 5 . 6 can be either a multifilament yarn or also a staple fibre yarn or any other non - multifilament yarn type desired . the multi - filament yarn can be a yarn already texturized or treated otherwise , or can be any other yarn presenting any yarn characteristic which is suitable to be compacted jointly with at least one other yarn component in a compacting stage . if , as mentioned above , in the fig2 the yarn component 5 . 6 as an alternative is a yarn component which is not to be treated further and which can be compacted jointly with other yarn components , as a rule the yarn components 1 supplied are yarn components which under certain circumstances possibly have been pre - compacted already and as a rule are drawn but as a rule not texturized , the treating stage 2 thus being the first treating stage for yarn components of this type . subsequently , as shown in the fig2 a further treating stage 2 . 1 , which e . g . can be a so - called after - compacting device , can be provided for one yarn component which subsequently is combined with the two other yarn components in the collective compacting device into a yarn 7 . furthermore , there is the possibility to effect the collective compacting twice or more times , which in the fig2 is indicated by the rectangle 3 . 1 shown with broken lines . the same applies where , in the treating stage 2 . 1 an after - compacting process is effected , i . e . an after - compacting process also here can be effected twice or more times , just as it applies for the collective compacting process 3 . 1 . if in the treating stage 2 a texturizing process is effected , known texturizing devices or texturizing methods of any type can be used . the type of the texturizing method , and of the texturizing device respectively , is not an important feature of the present invention . the same applies if in the treating stages 2 or 2 . 1 , or 3 or 3 . 1 , an entangling process is effected , where known entangling devices or entangling methods of any type can be used . the type of the entangling method , and of the entangling device respectively , is not an important feature of the present invention . the same applies if in the treating stages 2 or 2 . 1 , or 3 or 3 . 1 , a false twist process is effected , where known false twisting stages of any type can be used as the type is not an important feature of the present invention . the same applies also to the collecting stages , i . e . any type of winding devices known as such or any type of collecting stages not mentioned herein can be applied . also , one is free to operate the treating stages mentioned above , and the collective compacting stages mentioned above respectively , differently by varying the temperature , the quantity ( kg / h ), and the pressure of the treating gas . in the fig3 an example is shown of an entangling nozzle which can be used in the compacting stage 3 or 3 . 1 respectively . this entangling nozzle corresponds to an entangling nozzle of the heberlein company at wattwil , switzerland . it is understood in this context , as mentioned earlier already , that any entangling nozzle or a false twist nozzle of any make can be considered . in the fig3 the entangling nozzle is designated with the reference number 6 , the entry opening for the yarn components with the reference number 9 , and the gas entering the nozzle with the reference number 8 . as can be seen in the yarn transporting direction , the entangling nozzle is preceded by a guide ring 11 which serves as a guide element for the yarn components 5 to 5 . 6 which , as shown in the fig4 guiding these yarn components each to a different position in the entry opening 9 of the entangling nozzle in such a manner that the yarn components 5 to 5 . 6 are subject to different entangling effects . three yarn components e . g . are shown in this fig4 where in principle the number of yarn components is at least two and where , as mentioned already , any of the yarn components mentioned before can be processed . the guide ring 11 can be shifted in its position , as indicated with the shifting devices 12 , by means of respective , but here not shown means , in such a manner that the position of the yarn components is changed . furthermore , the opening 16 of the guide ring 11 can be formed circular or oval or in any other shape desired in order to obtain different positions of the yarn components in the opening 9 , provided the positions of the guide rolls arranged upstream from the guide ring 11 themselves can not be changed for adapting the positions of the yarn components 5 to 5 . 6 in the opening 9 jointly with the guide ring 11 . the clamping rolls 14 facing the guide rolls 13 , with which they form pairs of clamping rolls , indicate that in combination with a pair of take - off rolls 15 provided downstream from the entangling nozzle , the tension in each yarn components 5 to 5 . 6 can be kept by the same or different respective means . in this arrangement , this yarn tension in each yarn component alone or in combination with the various positions of the yarn components can serve for obtaining a different yarn character of the yarn 7 . in the fig4 a top view of the entangling nozzle 6 is shown along the line i -- i according to the fig3 . in the fig4 the yarn components 5 to 5 . 6 are shown as an example with 3 yarn components . the gas entry is indicated with the gas 8 as shown in connection also with entangling nozzles of the heberlein company mentioned above . in the fig5 through 20 , variations are shown of the application of the treating stages for treating of equal or differing yarn components . the treating stages are shown described already in the european patent application no . ep 0784109 a2 which document thus is an integral part of the present application . in the fig5 through 20 , the same reference signs in part are applied as in the fig1 and 2 which together with the fig3 and 4 are shown and described already in the earlier swiss patent application no . ch 0441 / 97 . the squares designated with the reference number 1 represent yarn components of a endless filament bundle either supplied , from an extrusion beam or from a package , or of a staple fibre yarn component which can be spun from man made fibres or from natural fibres . the squares designated with the reference number 2 concern a pre - compacting process shown and described in the above mentioned european patent application ep - 0784109 a2 , whereas 2 . 1 represents a texturizing process stage and 2 . 2 represents an after - texturizing process stage , which both also are described in the above mentioned euro - application . the drawing stages designated with 4 , and being shown between the pre - compacting process stage and the texturizing process stage , shown and described in the above mentioned european patent application , being as well as the draw rolls designated 33 , 34 and 35 in the above mentioned european patent application which , are not shown here for the sake of simplicity , where in the last - mentioned rolls according to the european patent application are optional elements , however the drawing stages are only optional if the yarn components are supplied from bobbins . all processing stages , as mentioned already in the introduction to the present application , can be operated differently in order to obtain variations in the yarn character , and in the fabric produced therefrom respectively , e . g . in a carpet , in the fig5 the reference sign a1 indicates that a filament bundle from an extrusion beam is treated in a pre - compacting process stage 2 and jointly with a filament bundle a2 from a package of pre - drawn filament is compacted in the collective compacting process stage 3 and subsequently is wound up as a yarn 7 in a collecting stage , e . g . in a winding device . instead of a filament bundle from a package with pre - drawn synthetic filament , either a man - made or a natural fibre staple yarn can be compacted jointly with the filament bundle from the extrusion beam in the collective compacting stage 3 and be wound up as a yarn 7 in the collecting stage 4 . in principle , the filament bundles always are collected as a yarn 7 after the collective compacting stage 3 in the collecting stage 4 , and therefore in the descriptions referring to the further figures repetition of this collecting function is dispensed with . the fig6 differs from the fig5 in that the filament bundle a1 from the extrusion beam after passing through the pre - compacting stage 2 passes through a texturizing stage 2 . 1 before this filament bundle is transferred with bundle or the yarn component from the package a2 into the collective compacting stage 3 . in the fig7 the filament bundle a1 supplied from the extrusion beam is shown , which is treated additionally , compared to the method indicated in the fig6 after the texturizing stage 2 . 1 in the after - compacting stage 2 . 2 , before this filament bundle is transferred with the filament bundle or with the yarn from the package a2 into the collective compacting stage 3 . in the fig8 two filament bundles each supplied from an extrusion beam are shown , each of which is compacted separately in the pre - compacting stage 2 , whereupon the two bundles in the collective compacting stage 3 jointly are compacted into a yarn 7 . in the fig9 two filament bundles a1 supplied from an extrusion beam each are shown , of which the filament bundle shown to the left hand side is processed through a pre - compacting stage 2 and a texturizing stage 2 . 1 , before it is joined with the adjacent filament bundle , which merely is processed through the pre - compacting stage 2 , in the collective compacting stage into a yarn 7 . in the fig1 the filament bundle a1 shown to the left hand side after the pre - compacting 2 and the texturizing stage 2 . 1 is processed through an after - compacting stage 2 . 2 , before it joins the filament bundle a1 , shown to the right hand side , which was processed merely through a pre - compacting stage 2 , and is compacted into a yarn 7 in the collective compacting stage 3 . the fig1 shows , compared to fig1 , that the filament bundle a1 is additionally guided through the texturizing stage 2 . 1 , after passing the pre - compacting stage 2 and before the two filament bundles are connected to a yarn 7 in the collective compacting stage 3 . in the fig1 a filament bundle or a staple fibre yarn supplied from a package a2 is shown , where the staple fibre yarn can be spun from man made fibres or from natural fibres , which together with two filament bundles according to the fig8 or 9 or 10 or 11 is compacted into a yarn 7 in the collective compacting stage 3 . in the fig1 three filament bundles a1 are shown which are supplied from an extrusion beam each , in which arrangement the filament bundle shown to the right hand side is processed alone through all treating stages 2 , 2 . 1 , 2 . 2 before reaching the collective compacting stage 3 , whereas the filament bundle shown to the left and the filament bundle shown in the middle jointly are processed through the after - compacting stage 2 . 2 after having passed the pre - compacting stage 2 and the texturizing stage 2 . 1 and subsequently are compacted together with the filament bundle shown to the right hand side in the collective compacting stage 3 into a yarn 7 . in principle a &# 34 ; right hand side filament &# 34 ; in the context of this description is understood to be a filament bundle which , viewing the figure , is shown to the right hand side of a corresponding middle filament bundle , or of a corresponding &# 34 ; left hand side filament bundle &# 34 ; in the corresponding figure . in the fig1 an alternative solution , differing from the solution shown in the fig1 , is shown in which a left hand side filament bundle and a middle filament bundle after the pre - compacting stage 2 jointly are texturized in the stage 2 . 1 and subsequently are after - compacted in the stage 2 . 2 , whereupon together with the right hand side filament bundle , which is processed through all treating stages 2 to 2 . 2 , they are compacted into a yarn 7 in the collective compacting stage 3 . in the fig1 , a combination is shown of a filament bundle a2 consisting of synthetic fibres or of natural fibres , which in the collective compacting stage 3 is collectively compacted with filament bundles according to the fig1 or to the fig1 into a yarn 7 . in the fig1 , three filament bundles a1 are shown each supplied from an extrusion beam , where the right hand side filament bundle is processed alone through all the treating stages 2 to 2 . 2 , whereas the middle fibre bundle and the left hand side filament bundle jointly are pre - compacted in the treating stage 2 , and subsequently as a jointly pre - compacted filament bundle together are texturized in the stage 2 . 1 and after - compacted in the stage 2 . 2 , before this joint filament bundle is compacted into a yarn 7 in the collective compacting stage 3 . in the fig1 , four filament bundles a1 are shown each being supplied from an extrusion beam , in which arrangement the two right hand side filament bundles jointly are pre - compacted in the stage 2 and subsequently as a joint fibre bundle are processed through the texturizing stage 2 . 1 and after that through the after - compacting stage 2 . 2 , before this joint filament bundle and the two left hand side filament bundles together are collectively compacted into a yarn 7 . in this arrangement , the two left hand side filament bundles each are pre - compacted separately in the stage 2 and subsequently are processed through the after - compacting stage 2 . 2 , before this joint filament bundle and with the two left hand side filament bundles together are compacted in to a yarn 7 . in this arrangement , the two left hand side filament bundles each are pre - compacted separately in the stage 2 and then are jointly texturized in the stage 2 . 1 and jointly are after - compacted in the stage 2 . 2 , whereupon they are , as mentioned before , as a joint filament bundle are collectively compacted with the joint right hand side filament bundle in the stage 3 . in the fig1 , also four filament bundles a1 are shown supplied each form an extrusion beam , where the left hand side filament bundle alone is processed through all stages 2 to 2 . 2 before being compacted with a triple filament bundle combined from the three adjacent individual filament bundles in the collective compacting stage into a yarn 7 . in this arrangement the triple filament bundle is composed of an individual filament bundle a1 and of a double filament bundle combined from two individual filament bundles a1 , where the individual filament bundle is processed alone through the pre - compacting stage 2 , the double filament bundle is processed jointly through a pre - compacting stage 2 each , and subsequently is jointly processed through the texturizing stage 2 . 1 and then through the after - compacting stage 2 . 2 , and then before reaching the collective compacting stage 3 jointly is after - compacted in the stage 2 . 2 . in the fig1 , two right hand side yarns a2 are shown each supplied from a package , where one package can contain a staple fibre yarn spun from synthetic fibres and the other package a2 can contain a staple fibre yarn spun from natural fibres , or both packages can contain synthetic fibre staple yarns of different characteristics or can contain different natural fibre staple yarns . in this arrangement the collected staple yarn in a joint filament bundle together with the filament bundles indicated in the fig1 or 17 or 18 in the collective compacting stage 3 is compacted into a yarn 7 . the fig2 indicates primarily that a further collective compacting stage 3 . 1 is provided , in which the yarn components 5 , 5 . 1 and 5 . 2 are compacted into a pre - yarn 7 . 1 , which together with a further pre - yarn 7 . 2 combined from the yarn components 5 . 3 and 5 . 4 is compacted in the last compacting stage 3 into a yarn 7 which then is collected in the collecting stage 4 , where it is e . g . wound up . the squares shown with dashed lines merely are to be understood as an indication that e . g . the individual yarn components according to the fig8 , 10 and 11 are compacted in a compacting stage 3 . 1 into a pre - yarn , which then according to the fig1 is compacted together with the single yarn component from the stage a2 in the compacting stage 3 into the yarn 7 . the same applies for the yarn components according to the fig1 and 14 or to the fig1 , 17 and 18 , which each are compacted in a compacting stage 3 . 1 into a pre - yarn 7 . 1 , whereupon this pre - yarn according to the fig1 , 15 or 19 together with the single yarn component from the stage a2 according to the fig1 or 15 , or together with the two yarn components from the two stages a2 according to the fig1 , are compacted into a yarn 7 . also , further additional collective compacting stages , not shown here , can be provided in such a manner that more than two pre - yarns can be generated , which together can be compacted in the last collective compacting stage into a yarn 7 . it also is feasible to combine other alternative variations , not shown here , of the pre - yarns 7 . 1 or 7 . 2 respectively . such pre - yarns can be composed , as in the examples shown in the fig1 through 19 , of bundles of endless filaments and of staple fibre yarns , where among the filament bundles as well as among the staple yarns various types can be combined . in principle in the fig2 , as in the fig1 and 2 , as well as 5 through 19 , the treating stages are designated with the reference numbers 1 , 2 , 2 . 1 , 2 . 2 , 3 and 4 as well as the additional treating stage 3 . 1 , which can be provided as a single or as a multiple treating stage . furthermore , for all figures shown , according to the european patent application ep 0784109a2 an oil application stage is to be provided between the stages 1 and 2 for all yarn components composed of fibril bundles . furthermore the various treating stages such as gasdynamically falstwisting , entangling and gasdynamically texturizing can be operated according to the operation variants mentioned initially in order to additionally influence the yarn character of the finished yarn 7 . if among the pre - compacting stages 2 , instead of a gasdynamic false twist device , a disc twisting device , or a friction twist device , using which pre - compacting can be effected , are applied , the variable operation parameters are variations in the rotational speeds of the disc twisting device , or variations of the surface roughness of the individual discs , or of the disc of the twisting device , or the wrapping angle of the filament bundle about the discs or the disc . accordingly there are means for varying said operation parameters , namely means for commanding the pressure , the quantity and the temperature of the texturizing medium , or means for varying said operation parameter of said disc twisting device or generally mechanical false twisting devices . finally the squares shown with dashed lines are indicating that further variants of combinations , which are not contained in the examples shown , are feasible within the scope of the present invention , the present invention therefore not being limited to the examples shown . furthermore the squares shown with dashed lines are an indication that the functions 2 to 2 . 2 are provided interchangeably , i . e . functions can be added or taken off in correspondence with the desired yarn character . it should be appreciated by those skilled in the art that modifications and variations can be made in the present invention without departing from the scope and spirit of the invention . it is intended that the present invention include such modifications and variations as come within the scope of the appended claims and their equivalents . | 8 |
referring now to fig4 a preferred embodiment of a video disc player , in which like symbols represent like components or parts which are employed in the prior art video disc player shown in fig1 will be described . in this video player , the focusing of the laser beam and the arrangement of the motor servo circuit are similar to the prior art device . that is , a horizontal synchronizing signal reproduced and separated by a synchronizing signal separator circuit 14 is compared with a reference horizontal synchronizing signal produced by the synchronizing signal generator 15 and the speed of a motor 8 is controlled in accordance with the phase difference . a tangential mirror servo circuit is so arranged as to deflect the tangential mirror 5 using a mirror control circuit 21 operating in response to the output of a phase comparator 20 which compares the horizontal synchronizing signal reproduced and separated by the synchronizing signal separator circuit 14 with the reference horizontal synchronizing signal from the synchronizing signal generator 15 in the same manner as in the motor servo circuit . in accordance with the invention , a time base variation eliminating circuit 22 is interposed between the output terminal of a video signal demodulator circuit 12 and a video output terminal 13 . the time base variation eliminating circuit 22 is constructed for example as shown in fig5 . reference numeral 24 represents a burst gate circuit for extracting a burst signal from the reproduced video signal and 25 represents a phase comparator which compares the output from the burst gate circuit 24 with a reference color subcarrier signal produced by the synchronizing signal generator 15 . reference numeral 23 represents an electronically - controlled variable delay line the delay time of which is controlled in accordance with an input control signal . reference numeral 26 represents a control circuit which produces a control signal for the delay line 23 in response to the output signal of the phase comparator 25 . if , for example , the delay line 23 is implemented with a charge - coupled device or bucket brigade device , the control circuit 26 produces a transfer clock signal having a frequency determined by the output of the phase comparator 25 . in this case , the control circuit 26 can be implemented with a voltage - controlled oscillator . with the video disc player of the invention , the tangential mirror servo circuit requires no burst signal for control so that the phase comparator 20 can produce a phasse error signal properly even during the vertical blanking interval because the horizontal synchronizing signal is present during the vertical blanking interval . thus , the tangential mirror 5 is prevented from any possible faulty deflection as may arise in prior art devices . this eliminates the possibility of undesireable frequency variations which could otherwise appear in reproduced fm signals and there is no noise , such as may be induced by improper deflection of the tangential mirror 5 , in sound signals reproduced by the sound demodulator circuit 10 . video signals reproduced and made free from time base variations using the tangential mirror servo circuit without the use of the burst signal for control may be satisfactory for black - and - white . for color television , however , good color pictures cannot be produced without uneven color reproduction caused by slight instability or jitter in the timing of reproduced horizontal synchronizing signals due to noise and other factors . such residual jitter is negligible , however , for reproduction of sound signals . on the other hand , the burst signal from the burst gate circuit 24 is compared with the reference color subcarrier signal from the synchronizing signal generator 15 by the phase comparator 25 and the delay time can be controlled so that the reproduced video signal is synchronized with the reference subcarrier signal . thus , time base variations due to such residual jitter are eliminated . time base variations inherently cannot be large with the tangential mirror servo circuit using no burst signal for control factor . generally , any residual time base variation are no more than 1 μs . residual variations of 1 μs or less are eliminated with the time base variation eliminating circuit 22 . elimination of residual time base variations of 1 μor less can be accomplished with the time base variation eliminating circuit 22 using charge - coupled devices as the delay line 23 . only one - fortieth the bit length of the charge - coupled device is needed than would otherwise be required if the tangential mirror 5 were fixed . this makes the device of the invention quite economical . furthermore , an analog delay line composed of a coil and a varactor diode may also be employed as the electronically - controlled variable delay line 23 . in this case , the control circuit 26 is constructed to apply to the varactor diode a voltage which varies in response to the output of the phase comparator 25 wherein the delay time is controlled with the output from the control circuit 26 . fig6 is a block diagram showing another preferred embodiment of the time base variation eliminating circuit 22 . in fig6 reference numeral 27 represents a horizontal synchronizing signal separator circuit and 28 a gate circuit . with the time base variation eliminating circuit of fig6 a horizontal synchronizing signal obtained from a reproduced video signal and separated therefrom by the horizontal synchronizing signal separator circuit 27 is fed to the gate circuit 28 and a color burst signal extracted from the reproduced video signal by a burst circuit 24 is applied to the gate circuit 28 so that the timing edge of the horizontal synchronizing signal thus reproduced is determined by a specific rising or falling pulse edge of the reproduced burst signal . the output of the gate circuit 28 is fed to a phase comparator 25 along with the reference horizontal synchronizing signal from the synchronizing signal generator 15 . the time base variation eliminating circuit of fig6 is similar to the arrangement of the horizontal synchronizing signal separator circuit 14 , burst gate circuit 18 , gate circuit 19 , and phase comparator 20 shown in fig1 and operates in a similar manner to control the delay time whereby the same effect is obtained as with the time base variation eliminating circuit of fig5 . furthermore , in the embodiment shown in fig4 only a single one of the phase comparators 16 and 20 in the motor servo circuit and in the tangential mirror servo circuit need be provided if desired . in this case , the output of the single phase comparator is applied to both the motor control circuit 17 and to the mirror control circuit 21 . still further , the above - described device is applicable not only to optical - type video disc players but also contact - type players . this will be readily apparent from the fact that an arm stretcher employed in the latter type player is equivalent to the electromagnetic actuator for eliminating time base variations in the former . as has been described heretofore , the invention permits reproduction of picture and sound of high quality . particularly in picture reproduction , unevenness in color is effectively reduced compared with that of prior art video disc player devices , especially immediately following the vertical blanking interval , due to elimination of time base variations at two stages of control , namely , in the motor controller and the tangential mirror servo circuit and in the time base variation eliminating circuit . moreover , time base variations in reproduced sound signals , which appeared at every vertical blanking interval in the prior art video disc players , are improved in comparison with the prior art devices . also , the time base variation eliminating circuit for sound signals of the invention is simple and inexpensive . | 6 |
although preferred embodiments of the invention are explained in detail , it is to be understood that other embodiments are contemplated . accordingly , it is not intended that the invention is limited in its scope to the details of construction and arrangement of components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced or carried out in various ways . also , in describing the preferred embodiments , specific terminology will be resorted to for the sake of clarity . it must also be noted that , as used in the specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural referents unless the context clearly dictates otherwise . also , in describing the preferred embodiments , terminology will be resorted to for the sake of clarity . it is intended that each term contemplates its broadest meaning as understood by those skilled in the art and includes all technical equivalents which operate in a similar manner to accomplish a similar purpose . ranges may be expressed herein as from “ about ” or “ approximately ” one particular value and / or to “ about ” or “ approximately ” another particular value . when such a range is expressed , another embodiment includes from the one particular value and / or to the other particular value . by “ comprising ” or “ containing ” or “ including ” is meant that at least the named compound , element , particle , or method step is present in the composition or article or method , but does not exclude the presence of other compounds , materials , particles , method steps , even if the other such compounds , material , particles , method steps have the same function as what is named . it is also to be understood that the mention of one or more method steps does not preclude the presence of additional method steps or intervening method steps between those steps expressly identified . similarly , it is also to be understood that the mention of one or more components in a device or system does not preclude the presence of additional components or intervening components between those components expressly identified . various embodiments of the present invention are directed to stabilizing polymer precursors , preferably to maintain or improve cms membrane performance after pyrolysis . the present invention described hereinafter is described in terms of “ carbon ” for purposes of clarification . it should be noted , however , that the scope of the present invention is not limited to “ carbon ” molecular sieve membrane , as other “ non - carbon ” membranes may be produced using various embodiments of the present invention . various embodiments of the present invention use an improved technique of modifying cms membranes and polymer precursors to cms membranes . as discussed above , various aspects of this disclosure are directed to modification of a polymer precursor to produce a modified polymer precursor . the modified polymer precursor can then be pyrolyzed to produce the cms fiber . as used herein , “ polymer precursor ” is intended to encompass the asymmetric hollow fiber prepared using one of the exemplary polymers discussed previously . the polymer precursor can be prepared according to the dry - jet / wet quench spinning process described previously . however , other processes that might produce an asymmetric hollow fiber can also be used . “ polymer precursor ” as used herein might also be described as a fiber precursor , or simply precursor , or the generic or trade name polymer precursor . for example , matrimid ® precursor , matrimid ® precursor fiber , and asymmetric matrimid ® precursor fiber are all intended to describe a polymer precursor based on the matrimid ® polymer 5 ( 6 )- amino - 1 - 4 ′- aminophenyl - 1 , 3 - trimethylindane . similarly , a modified polymer precursor can be a polymer precursor that has been modified with a modifying agent , and may be similarly designated modified precursor , modified fiber precursor , modified matrimid ® precursor , and so forth . the disclosure , in various embodiments , is an asymmetric carbon molecular sieve membrane formed from a polymer precursor modified using a modifying agent . the modifying agent can also be referred to herein as a chemical modifying agent , and the process of modifying can also be referred to as chemically modifying . in some embodiments , vinyl trimethoxy silane is used as the modifying agent for chemical precursor treatment , but other silanes can also be employed as a modifying agent . in general , the silane for use in this disclosure can be described by a formula r 1 r 2 r 3 r 4 si , where each of r 1 , r 2 , r 3 , and r 4 are independently vinyl , c 1 - c 6 alkyl , — o - alkyl , or halide , with the proviso that the silane contain at least one vinyl group and at least one — o - alkyl or halide . the o - alkyl can be any c 1 to c 6 alkyloxy ( or alkoxy ) group , including , for example , methoxyl , ethoxy , propoxy , butoxy and so forth , preferably methoxy or ethoxy . without wishing to be bound by theory , the modifying agent is thought to be a compound that can generate an si — o — si linkage during modification of the polymer precursor . therefore , the modifying agent can be a monosilane , such as for example , vinyl trimethoxysilane , vinyl triethoxysilane , vinyl dimethoxychlorosilane , vinyl diethoxychlorosilane , vinyl methoxydichlorosilane , vinyl ethoxydichlorosilane , or vinyl trichlorosilane . the modifying agent could also be a short chain oligosiloxane , where one or more of the r 1 r 2 r 3 r 4 is an — o - silyl having similar substitution to the monosilane , for example , a disiloxane or trisiloxane having at least one vinyl and at least one alkoxy or halide on the oligosilane such as vinyl pentamethoxydisiloxane or divinyl tetramethoxydisiloxane . preferably the modifying agent can be a vinyl trimethoxysilane or a vinyl triethoxy silane . in some further embodiments , a precursor polymer is at least partially thermally and / or physically stabilized by exposing vinyl trimethoxysilane ( vtms ) to the precursor . it should be understood that , although various embodiments of the present invention are discussed using vinyl trimethoxy silane and various precursors , the present invention is not limited to the use of vinyl trimethoxy silane or the precursors discussed . other pretreatment chemicals and other precursors suitable for the purposes of various embodiments of the present invention having similar chemical and mechanical characteristics are considered to be within the scope of the present invention . in some embodiments , the modification of the precursor with vtms is performed by adding vtms and precursor fibers in a contacting device for different time durations . further , in some embodiments , the precursor and modification agent are heated in a reaction vessel under auto thermal pressure prior to the actual pyrolysis step . fig9 is an illustration of an exemplary process according to various embodiments of the present invention . precursor fiber 300 is added to a modifying agent 302 , such as vtms , in contacting device 320 . precursor fiber 300 can be various conventional asymmetric hollow fibers suitable for use , including , but not limited to , matrimid ® and 6fda : bpda - dam . for vtms modification on matrimid ® precursor , precursor fibers 300 can be simply immersed in excess of vtms liquid 302 in a sealed contacting device 320 without any additional chemical . contacting device 320 can be maintained at room temperature or can be heated in a heated convection oven (˜ 200 ° c .) for about 30 minutes to allow for the modification process . if heated , after the reaction , reaction tube 320 is cooled down and fibers 304 are removed from the liquid 302 . fibers 304 are then placed at 150 ° c . under vacuum for 6 hours to remove excess modification agent 302 . without being bound to any specific theory of operation , it is believed that the vtms modifies the precursor prior to thermal decomposition of the main polymer precursor to form carbon . it should be noted that the present invention is not limited to precursor fibers having aromatic rings . it should be noted that various other precursor fibers having aromatic rings may also be suitable , and are thus , considered to be within the scope of the present invention . for example , and not by way of limitation , various embodiments of the present invention can use polyimide precursor molecule 6fda : bpda - dam . as discussed prior , a purpose of modifying silane molecules on precursors is to give the stability to the polymer chains during the heat treatment above t g . when using unmodified 6fda : bpda - dam , the membrane collapse can be smaller than other fibers , such as unmodified matrimid ®, because of various differences between the structures . for example , 6fda : bpda - dam has a higher glass transition temperature of than matrimid ®. also , bulkier - cf 3 groups of 6fda : bpda - dam leaves the molecule during pyrolysis . other polyimides made from the 6fda dianhydride monomer are expected to act similar to 6fda : bpda - dam when used as precursors and treated with a modifying agent such as vtms . the glassy polymers used in the study were matrimid ® 5218 and 6fda : bpda - dam . the polymers were obtained from the sources , matrimid ® 5218 from huntsman international llc and 6fda : bpda - dam was lab - custom synthesized from akron polymer systems ( aps ). the vinyl trimethoxy silane was obtained from sigma - aldrich . to obtain the above mentioned polymers one can also use other available sources or synthesize them . for example , such a polymer is described in u . s . pat . no . 5 , 234 , 471 , the contents of which are hereby incorporated by reference . asymmetric hollow fiber membranes comprise an ultra - thin dense skin layer supported by a porous substructure . in the examples used for illustration purposes , asymmetric hollow fiber membranes are formed via a conventional dry - jet / wet quench spinning process , illustrated by way of example in fig4 a . the present invention is not limited to any particular method or process for forming the polymer precursor . the polymer solution used for spinning is referred to as “ dope ”. dope composition can be described in terms of a ternary phase diagram as shown in fig4 b . the formation of defect - free asymmetric hollow fibers was followed from the process described in u . s . pat . no . 4 , 902 , 422 the contents of which are hereby incorporated by reference . for vtms modification on a matrimid ® precursor , the fibers are immersed in excess of vtms liquid in a closed contacting vessel , as illustrated by way of example in fig9 . the modification was performed by soaking the fibers in vtms for 24 hours at room temperature ( 25 ° c .) which gave similar observations as shown in the examples discussed later . in a second embodiment , the vtms was contacted with matrimid ® precursor in a closed cell and heated in a convection oven to 200 ° c . for 30 minutes . after the heating , the cell was cooled down to room temperature (˜ 25 ° c .) and the fibers removed from the liquid . the fibers were then placed at 150 ° c . under vacuum for 6 hours to remove the excess vtms ( boiling point of vtms — 135 ° c .). the polymer fibers were placed on a stainless steel wire mesh and held in place by wrapping a length of wire around the mesh and fibers . the mesh support was loaded to a pyrolysis setup , as illustrated in fig1 . for each polyimide precursor , a different pyrolysis temperature and atmosphere were used . 1 . 50 ° c . to 250 ° c . at a ramp rate of 13 . 3 ° c ./ min 2 . 250 ° c . to 635 ° c . at a ramp rate of 3 . 85 ° c ./ min 3 . 635 ° c . to 650 ° c . at a ramp rate of 0 . 25 ° c ./ min 4 . soak for 2 hours at 650 ° c . a . 50 ° c . to 250 ° c . at a ramp rate of 13 . 3 ° c ./ min b . 250 ° c . to 535 ° c . at a ramp rate of 3 . 85 ° c ./ min c . 535 ° c . to 550 ° c . at a ramp rate of 0 . 25 ° c ./ min d . soak for 2 hours at 550 ° c . the pyrolysis system used in this study is depicted in fig1 . a temperature controller ( omega engineering , inc .,) was used to heat a furnace thermocraft ®, inc . and fiber support kept in the quartz tube ( national scientific co .). an assembly of a metal flange with silicon o - rings ( mti corporation ) was used on both ends of a quartz tube . an oxygen analyzer ( cambridge sensotec ltd ., rapidox 2100 series , cambridge , england with ± 1 % accuracy between 10 − 20 ppm and 100 %) was integrated to monitor an oxygen concentration during the pyrolysis process . cms fibers were tested in a single fiber module and constructed as described in us patent publication no . 2002 / 0033096 a1 by koros et al ., the contents of which are hereby incorporated by reference . cms fiber module were tested in a constant - volume variable pressure permeation system for both pure and mixed gas feeds similar to the one described in us patent publication no . 2002 / 0033096 a1 by koros et al . cms membranes from matrimid ® precursor where prepared as described in the experimental section above . the validation for the example is shown below : sem images of the cms fiber membranes from the vtms modified precursor cms membranes from matrimid ® modified precursors shows an improved morphology under sem . fig1 a and 11 b are sem images showing improved substructure morphology for matrimid ®. the cms module was tested using pure co 2 and pure ch 4 at 100 psig with an evacuated permeate . the permeance of the pretreated cms increased by ˜ 4 × over the untreated cms with almost no change in selectivity , as shown in table 1 . the cms vtms modified 6fda module is tested for both pure gas and mixed gas ( 50 % co 2 - 50 % ch 4 ) streams . comparison of separation performance for pure gas feed with the unmodified cms performance values are shown in table 2 . in order to test the stability of the cms vtms modified 6fda fibers , the cms module was tested for mixed gas up to 800 psia and compared with the performance of cms 6fda : bpda - dam fibers made according to various methods as taught by koros et al . in u . s . pat . no . 6 , 565 , 631 . fig1 a and 13 b show comparisons of the performance of the vtms treated cms of this embodiment and the fibers produced by the method taught in u . s . pat . no . 6 , 565 , 631 . the cms fibers of this embodiment have ˜ 2 × the permeance of the fibers from u . s . pat . no . 6 , 565 , 631 while maintaining a similar selectivity . by using various embodiments of the present invention , the amount of sticking between fibers can be reduced or eliminated while maintaining the good separation performance . a control run with the unmodified matrimid ® precursor fibers was performed where multiple fibers were bundled close to one another during the pyrolysis , shown in fig1 a . after the pyrolysis the cms unmodified fibers were stuck to one another and impossible to separate the fibers without causing serious damage or breakage . the same experiment was performed on matrimid ® precursors modified according to various embodiments of the present invention , as shown in fig1 b . after pyrolysis these cms vtms modified fibers do not stick together and achieve an “ anti - stick ” property . in addition to the “ anti - stick ” property , it can also be desirable that cms fibers have good separation performance . the permeance of bundled fibers was compared to both non - bundled untreated fibers , and bundled non - treated fibers shown in table 3 . the untreated fibers were not testable because they were stuck together . numerous characteristics and advantages have been set forth in the foregoing description , together with details of structure and function . while the invention has been disclosed in several forms , it will be apparent to those skilled in the art that many modifications , additions , and deletions , especially in matters of shape , size , and arrangement of parts , can be made therein without departing from the spirit and scope of the invention and its equivalents as set forth in the following claims . therefore , other modifications or embodiments as may be suggested by the teachings herein are particularly reserved as they fall within the breadth and scope of the claims here appended . | 8 |
in all figures of the drawings , the interengaging portions are shown on an enlarged scale . in the figures of the drawings , a nipple 1 consisting of a mouthpiece 2 , which may have an orthodontically desirable shape , and a tubular portion 3 terminating in a rolled - up rim 4 , are shown . the tubular portion extends through an opening 5 in a guard 6 . the opening 5 conforms in cross - section to the cross - section of the tubular portion 3 . a plug body 7 which has been inserted is similarly shaped in cross - section . on the side facing away from the mouthpiece 2 , the guard is formed around the opening 5 with a projecting portion 8 , which may consist of a rib and to which a base 9 or 10 or 11 is secured , e . g ., in that the rim of the base is adhesively joined to the projecting portion or in that said rim has been caused to snap into profiled clamping portions . the embodiments shown in fig1 to 3 have different bases . the bases may consist of webs , star - shaped elements or the like and consist preferably of a disc . in the embodiment shown in fig1 the rim 12 of the opening 5 is beveled on the side facing the base 9 and tapers toward the mouthpiece 2 . the rolled - up rim 4 of the nipple is disposed adjacent to the beveled surface . the disclike base 9 is resilient and in this embodiment carries projections 13 , e . g ., in the form of a peripheral annular bead adjacent to the rolled - up rim 4 . the disclike base is connected to a centrally disposed plug body 7 , which extends through the tubular portion 3 and holds the latter against the rim of the opening 5 and holds the rolled - up rim between the projections 13 and the beveled edge 12 of the opening . the plug body 7 flares toward its inner end 14 and may be provided there with an outwardly directed bead so that tension applied to the mouthpiece will cause the disclike base to bend inwardly so as to clamp the rolled - up rim with a progressively increasing force . the disclike base 9 consists of a relatively thin disc , which may preferably be made of plastic material or may consist of metal . in the embodiment shown in fig2 the plug body 7 has also a wider inner end and is provided with projections 15 , which may constitute a peripheral annular collar , which holds and clamps the rolled - up rim 4 against the beveled edge 12 of the opening 5 . the plug body 7 has a constricted end portion 16 , which is circular in cross - section , even if the remainder of the plug is flat in cross - section . the end portion 16 is disposed at the center of the disclike base 10 . that disc has a small thickness at its rim , which is secured to the projecting portion 8 , and increases in thickness toward the central portion . that design provides for an adequate resilience . in the embodiment shown in fig3 the guard 6 is formed in the rim of the opening 5 with an outwardly directed , inwardly open recess 17 in the middle of the height of the rim . the projections 18 provided on the plug body may consist of a peripheral annular bead and conform to the recess 17 but are undersize so that the tubular portion 3 when pulled over the plug will have a bulge 19 , which is initially held under a low contact pressure in the recess 17 . the plug has a constricted end portion 16 , which is secured to the disclike base 11 in one of the ways which have been described . the rolled - up rim 4 is disposed on the rear of the guard 6 , below the disclike base 11 . upon a pull on the mouthpiece 2 , the plug body , which is closely embraced by the tubular portion 3 at the bead or at the projections 18 , will be carried along so that a clamping is effected at the inwardly contracting wall surface 20 of the recess 17 and will result in an increase of the strength of the joint as the pull on the mouthpiece 2 is increased . upon a release of the mouthpiece , the arrangement springs back to its centered position . in the embodiment shown in fig3 wave - shaped profiled portions extend around the center of the disclike base and permit an improvement or adjustment of its resilience . the disclike bases 9 to 11 constitute also a centrally disposed cover over the central portion of the guard on that side which faces away from the mouthpiece 2 . in fig4 to 6 , a guard 6 and a base 10 are also apparent and it is seen that the resilient base is connected by a constricted end portion 16 to the flat plug body 22 . the flat plug body is provided at its inserted end portion 23 with the outwardly directed projections 24 , 25 , which are oversize with respect to the clearance between inwardly directed lugs 26 , 27 provided at the narrow ends of the opening in the guard . this is mainly apparent from fig5 . on that side of the lugs which faces away from the mouthpiece 2 , the plug body defines inside the protruding rib 8 a chamber 28 , which contains the rolled - up rim 4 of the nipple . as described hereinbefore , the resilient base 10 bears on the protruding portion 8 , particularly on a step 29 of said portion . as the plug body is inserted into the guard , the projections 24 , 25 moving past the lugs 26 , 27 are forced inwardly by the latter . the projections can yield because the plug body is formed adjacent to the projections 24 , 25 with cavities 30 , 31 , which are defined on the outside by webs 32 , 33 , which can resiliently yield inwardly toward the opening 30 or 31 . that resiliency is improved in that the webs 32 , 33 taper toward the base at 36 or 37 on the outside , behind the projections 24 , 25 , e . g ., owing to the provision of a beveled surface 34 or 35 . that taper promotes the ability of the webs to yield inwardly . the resilient plastic material of the plug body ensures that the webs will stretch after the plug body has been inserted so that the projections 24 , 25 and the lugs 26 , 27 will interengage . it is virtually impossible to take the resulting assembly apart because the projections 24 , 25 and the lugs 26 , 27 have mutually confronting , parallel surfaces 38 and 39 , respectively , and because said beveled surfaces 32 , 33 defining a labyrinthlike passage for the tubular portion ensure that a pull on the mouthpiece will result in an increasingly stronger clamping action . as is apparent from fig4 to 6 , the plug body is provided at its narrow sides with wedgelike surfaces 40 , 41 , which rise toward the base 10 and face beveled surfaces 42 , 43 of the rim of the opening in the guard 6 . the inclinations may be different . this feature will also ensure that the rolled - up rim 4 of the nipple 1 will be increasingly clamped if a pull is exerted on the mouthpiece and that the plug body can yield owing to the resilience of the base . the embodiment shown in fig4 to 6 affords the advantage that the end face of the inserted end portion 23 can be flush with the concave inner boundary surface 44 of the guard 6 because the reliable interengagement and the clamping means are restricted to the short region defined by the thickness of the guard . as is particularly shown in fig5 resilient inserts 45 , 46 may be disposed in the cavities 30 , 31 as resilient backings on the inside of the webs 32 , 33 . such inserts may consist of rubber fillers in the openings , rubber buffers or transverse springs in the openings . instead of rubber , a suitable plastic material may be used . in that case an advantage will be afforded by the fact that the outwardly directed projections 24 , 25 act on the webs 32 , 33 virtually like levers tending to bend the webs 32 , 33 inwardly , particularly because the latter are tapered at 36 , 37 . as in the embodiment shown in fig4 the plug 47 of fig7 comprises a disclike base 10 consisting of a resiliently flexible disc , which is connected to the flat plug body 49 by a constricted neck 48 . the latter is so small in cross - section that the disclike base 10 is hinged to the plug body . the neck 48 is flexible so that when the oversize projections 24 , 25 are threaded in an oblique orientation into the opening in the guard 6 between the inwardly directed lugs 26 , 27 ( fig5 ), the disclike base can be laterally displaced initially over the crest of the rib 8 . as a result , that portion of the plug body 49 which is disposed above the projections 24 , 25 can be reciprocated so that said projections are moved under the lugs 26 , 27 . when this has been accomplished , the rim of the disclike resilient base enters the step - shaped recess 29 at the crest of the rib 8 so that the plug body can be centered in such a manner that the projections 24 , 25 in a symmetric arrangement engage the lugs 26 , 27 from below . in that case the resilience of that part of the tubular portion 3 which extends between the described beveled surfaces and between the projections and lugs ensures a resilient and captive mounting . in this embodiment a plug body having projections 24 , 25 which are substantially oversize can be inserted without exerting a nonpermissible stress on the material of the tubular portion . because the neck 48 is flexible , the elongated plug body 49 is suitably provided at its narrow ends under the disclike base 10 with upstanding abutments 50 , 51 , which are spaced below the base when the latter has been aligned . these abutments limit the pivotal movement of the disclike base 10 . the plug body is also provided on its longitudinal sides with the wedge surfaces 40 , 41 , which have been described with reference to fig6 and rise toward the base 10 . one of said surfaces is shown in fig7 . in all embodiments shown and described , a guard ( 6 ) is provided , which is formed with a through opening ( 5 ) and on one side with axially protruding supporting means ( 8 ) spaced around said opening . a nipple ( 1 ) has a tubular portion ( 3 ), which extends through the opening ( 5 ), and a mouthpiece ( 2 ), which is integral with the tubular portion ( 3 ) and disposed on the other side of the guard ( 6 ). a plug comprises a plug body ( 7 ; 22 ; 49 ) and a base ( 9 ; 10 ; 11 ) connected to the plug body and disposed on said one side of said guard and bearing on said supporting means . the plug body extends into the opening ( 5 ) and is surrounded in part of its length by the tubular portion ( 3 ). the guard is formed with first clamping surfaces ( 12 ; 20 ; 26 , 27 ), which are disposed on the outside of the tubular portion ( 3 ) and face the base . the plug is formed with second clamping surfaces ( 13 ; 15 ; 18 ; 34 , 35 ), which are disposed on the inside of said tubular portion and face said first clamping surfaces . the first and second clamping surfaces comprise beveled surfaces . the tubular portion is in force - transmitting frictional contact with said plug body . the tubular portion ( 3 ) extends between said first and second clamping surfaces and is in force - transmitting frictional contact with said plug body in said opening . said base is resilient in the longitudinal direction of said nipple to permit a movement of said second clamping surfaces toward said first clamping surfaces in said longitudinal direction whereby said tubular portion will be clamped more strongly between said clamping surfaces upon a pull on the mouthpiece . | 0 |
with reference now to the figures , fig1 depicts a pictorial representation of a network of data processing systems in which the present invention may be implemented . network data processing system 100 is a network of computers in which the present invention may be implemented . network data processing system 100 contains a network 102 , which is the medium used to provide communications links between various devices and computers connected together within network data processing system 100 . network 102 may include connections , such as wire , wireless communication links , or fiber optic cables . in the depicted example , a server 104 is connected to network 102 along with storage unit 106 . in addition , clients 108 , 110 , and 112 also are connected to network 102 . these clients 108 , 110 , and 112 may be , for example , personal computers or network computers . in the depicted example , server 104 provides data , such as boot files , operating system images , and applications to clients 108 - 112 . clients 108 , 110 , and 112 are clients to server 104 . network data processing system 100 may include additional servers , clients , and other devices not shown . in the depicted example , network data processing system 100 is the internet with network 102 representing a worldwide collection of networks and gateways that use the tcp / ip suite of protocols to communicate with one another . at the heart of the internet is a backbone of high - speed data communication lines between major nodes or host computers , consisting of thousands of commercial , government , educational and other computer systems that route data and messages . of course , network data processing system 100 also may be implemented as a number of different types of networks , such as for example , an intranet , a local area network ( lan ), or a wide area network ( wan ). fig1 is intended as an example , and not as an architectural limitation for the present invention . referring to fig2 a block diagram of a data processing system that may be implemented as a server , such as server 104 in fig1 is depicted in accordance with a preferred embodiment of the present invention . data processing system 200 may be a symmetric multiprocessor ( smp ) system including a plurality of processors 202 and 204 connected to system bus 206 . alternatively , a single processor system may be employed . also connected to system bus 206 is memory controller / cache 208 , which provides an interface to local memory 209 . i / o bus bridge 210 is connected to system bus 206 and provides an interface to i / o bus 212 . memory controller / cache 208 and i / o bus bridge 210 may be integrated as depicted . peripheral component interconnect ( pci ) bus bridge 214 connected to i / o bus 212 provides an interface to pci local bus 216 . a number of modems may be connected to pci bus 216 . typical pci bus implementations will support four pci expansion slots or add - in connectors . communications links to network computers 108 - 112 in fig1 may be provided through modem 218 and network adapter 220 connected to pci local bus 216 through add - in boards . additional pci bus bridges 222 and 224 provide interfaces for additional pci buses 226 and 228 , from which additional modems or network adapters may be supported . in this manner , data processing system 200 allows connections to multiple network computers . a memory - mapped graphics adapter 230 and hard disk 232 may also be connected to i / o bus 212 as depicted , either directly or indirectly . those of ordinary skill in the art will appreciate that the hardware depicted in fig2 may vary . for example , other peripheral devices , such as optical disk drives and the like , also may be used in addition to or in place of the hardware depicted . the depicted example is not meant to imply architectural limitations with respect to the present invention . the data processing system depicted in fig2 may be , for example , an ibm risc / system 6000 system , a product of international business machines corporation in armonk , n . y ., running the advanced interactive executive ( aix ) operating system . with reference now to fig3 a block diagram illustrating a data processing system is depicted in which the present invention may be implemented . data processing system 300 is an example of a client computer . data processing system 300 employs a peripheral component interconnect ( pci ) local bus architecture . although the depicted example employs a pci bus , other bus architectures such as accelerated graphics port ( agp ) and industry standard architecture ( isa ) may be used . processor 302 and main memory 304 are connected to pci local bus 306 through pci bridge 308 . pci bridge 308 also may include an integrated memory controller and cache memory for processor 302 . additional connections to pci local bus 306 may be made through direct component interconnection or through add - in boards . in the depicted example , local area network ( lan ) adapter 310 , scsi host bus adapter 312 , and expansion bus interface 314 are connected to pci local bus 306 by direct component connection . in contrast , audio adapter 316 , graphics adapter 318 , and audio / video adapter 319 are connected to pci local bus 306 by add - in boards inserted into expansion slots . expansion bus interface 314 provides a connection for a keyboard and mouse adapter 320 , modem 322 , and additional memory 324 . small computer system interface ( scsi ) host bus adapter 312 provides a connection for hard disk drive 326 , tape drive 328 , and cd - rom drive 330 . typical pci local bus implementations will support three or four pci expansion slots or add - in connectors . an operating system runs on processor 302 and is used to coordinate and provide control of various components within data processing system 300 in fig3 . the operating system may be a commercially available operating system , such as windows 2000 , which is available from microsoft corporation . an object oriented programming system such as java may run in conjunction with the operating system and provide calls to the operating system from java programs or applications executing on data processing system 300 . “ java ” is a trademark of sun microsystems , inc . instructions for the operating system , the object - oriented operating system , and applications or programs are located on storage devices , such as hard disk drive 326 , and may be loaded into main memory 304 for execution by processor 302 . those of ordinary skill in the art will appreciate that the hardware in fig3 may vary depending on the implementation . other internal hardware or peripheral devices , such as flash rom ( or equivalent nonvolatile memory ) or optical disk drives and the like , may be used in addition to or in place of the hardware depicted in fig3 . also , the processes of the present invention may be applied to a multiprocessor data processing system . as another example , data processing system 300 may be a stand - alone system configured to be bootable without relying on some type of network communication interface , whether or not data processing system 300 comprises some type of network communication interface . as a further example , data processing system 300 may be a personal digital assistant ( pda ) device , which is configured with rom and / or flash rom in order to provide non - volatile memory for storing operating system files and / or user - generated data . the depicted example in fig3 and above - described examples are not meant to imply architectural limitations . for example , data processing system 300 also may be a notebook computer or hand held computer in addition to taking the form of a pda . data processing system 300 also may be a kiosk or a web appliance . with reference now to fig4 - 6 , diagrams illustrating exemplary hierarchical structure of nodes are depicted in accordance with the present invention . these diagrams use the example of users and desktops to illustrate a reasonable application , however , in other embodiments , other types of nodes could be used . [ 0027 ] fig4 shows a simple hierarchy of nodes . there are no reference associations nor properties shown . fig5 extends fig4 by adding reference associations between the / user branch and / desktop branch of the hierarchy . fig6 extends fig5 by adding properties to some of the nodes . referring first to fig4 in this example , the system has a top node 402 that is divided into two first level child nodes , node / desktop 404 and node / user 406 . however , in other embodiments , the top node 402 could be split into many more sub - nodes than the two depicted here . each of the first level child nodes 404 - 406 is further split into a second level of child nodes . node / desktop 404 has a child node / desktop / standard 408 which in turn is split into two more child nodes , / desktop / standard / finance 410 and / desktop / standard / sales 412 . node / user 406 is split into three child node , / user / fred 414 , / user / john 416 , and / user / jane 418 . these user nodes 414 - 418 correspond to each user on the network . referring next to fig5 each user node 414 - 418 may comprise the hierarchical name of the node as well as a node associated by reference , separated by a special delimiter . for example , node 414 contains node 514 which is a reference association from node “/ user / fred ” to the node “/ desktop / standard / finance ”. in the schema for the hierarchy , the associated node / desktop / standard / finance is separated from the name of the node ( i . e . / user / fred ) by a special delimiter , “//” thus indicating that “ desktop / standard / finance ” is a reference association from the node “/ user / fred ”. this reference association node may contain properties that fred desires for his desktop . thus , the reference association node may participate in coalescing of properties . thus , fig5 demonstrates utilizing the schema of the hierarchy , instead of properties within hierarchy nodes , to create reference associations between nodes . by utilizing this approach , navigation between nodes does not require the inspection of properties within nodes , increasing the efficiency of performing this operation . these diagrams show the use of one reference association , however multiple reference associations may exist within a schema . an example is an application , / application / notes , associated with a desktop , / desktop / standard / finance , associated with a user , user / john . the schema would include reference associations / user / john // desktop / standard / finance , / desktop / standard / finance // application / notes , and / user / john // desktop / standard / finance // application / notes . referring now to fig6 and the process of coalescing properties , two examples will be used to demonstrate coalescing . first , a simple case where the reference association does not contain any properties will be shown . fred &# 39 ; s desktop would have the background set to green and the foreground set to white as found in associated node 610 and the screensaver set to “ on ” as determined by reducing node 610 to node 404 to determine the remaining properties not specified by node 610 . it should be noted that node 608 is a reduced node of node 610 , but since the same properties are specified in node 610 as in node 608 , node 610 supercedes 608 and the node is reduced further to node 404 to find the remaining properties for fred &# 39 ; s desktop . a second example shows a property within the reference association being used in the coalescing operation . in this case , node 416 contains reference association node 616 with a property indicating that john &# 39 ; s desktop has the foreground color set to “ cyan ”. the rest of the desktop properties are found by navigating to “ desktop / standard / sales ” and coalescing within that hierarchy as for the previous example . thus , john &# 39 ; s desktop would have a foreground of cyan with a background of blue as found in the node “ desktop / standard / sales ” 612 , with the screensaver set to “ on ” as determined by reducing node / desktop / standard / sales 612 to node / desktop 404 which contains the remaining properties not specified in node 612 . as shown , both properties in 608 are already assigned before its inspection , so both its property values are ignored . again , in similar fashion , node 418 comprises node 518 which specifies that jane &# 39 ; s desktop properties are found in node 608 . thus , jane &# 39 ; s desktop properties specifies that the background color is yellow and the foreground color is black with the screensaver set to “ on ” as determined by reducing node 608 to node 404 . with reference now to fig7 a diagram illustrating a program flow for determining the properties of a node within a hierarchical schema , such as depicted in fig6 is depicted in accordance with the present invention . once a node representing an element , such as a user within a networked computing environment , is found , it may be determined that it has reference associations to other nodes through inspection of its child nodes ( step 702 ). reference association nodes may be identified , for example , by the presence of a special delimiter , such as , for example , “//”, as described above . the properties found embedded within the reference association node are read into the coalescing results . if no association node is found for the node ( step 704 ), then the process of obtaining the coalesced properties ends . if an association node is found for the node ( step 704 ), then the properties from the reference association node are read into the properties result ( step 706 ). if the association node is completely reduced ( i . e . it is a top level node ) ( step 708 ), then the process of obtaining the node &# 39 ; s properties ends . if the association node is not completely reduced ( step 708 ), then the association node is reduced ( step 710 ) and the unique properties from the reduced association node are appended to the properties result for the node ( step 712 ). the process of reducing the association node and obtaining unique properties from each reduced node continues until the association node has been completely reduced . it is important to note that while the present invention has been described in the context of a fully functioning data processing system , those of ordinary skill in the art will appreciate that the processes of the present invention are capable of being distributed in the form of a computer readable medium of instructions and a variety of forms and that the present invention applies equally regardless of the particular type of signal bearing media actually used to carry out the distribution . examples of computer readable media include recordable - type media such a floppy disc , a hard disk drive , a ram , and cd - roms and transmission - type media such as digital and analog communications links . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art . the embodiment was chosen and described in order to best explain the principles of the invention , the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . | 6 |
fig1 illustrates a data round - off device according to a first embodiment of the present invention , in which an m - bit input signal ( m is a natural number ) is rounded off to ( m - n ) bits ( n is a natural number smaller than m ) by deleting the least n bits . shown in fig1 are an input signal 1 , an adder 2 , an msb ( most significant bit ) 3 of the input signal 1 , an offset value 4 , a shifter 5 , and an output signal 6 . the input signal 1 of m - bit form is summed with the offset value 4 by the adder 2 . the offset value is 2 . sup . ( n - 1 ) - 1 expressed by an ( n - 1 ) number of 1s in binary notation . also , the msb 3 of the input signal 1 is fed to the carry signal input of the adder 2 . the adder 2 is commonly arranged for simultaneously adding a signal of one bit to the least significant bit in summation of two input signals . the one - bit signal is known as a carry signal . if the input signal 1 is negative , the most significant bit is 1 and thus , the carry signal is 1 . hence , the sum of the carry signal 3 and the offset value 4 is now equal to 2 . sup . ( n - 1 ). when the input signal 1 is negative , an output signal of the adder 2 is given as the sum of the input signal 1 and 2 . sup . ( n - 1 ). when the input signal is not negative , the carry signal is 0 and the output of the adder 2 becomes equal to the sum of the input signal 1 and 2 . sup . ( n - 1 ) - 1 . the shifter 5 retrieves the higher ( m - n ) bits from the sum output of the adder 2 and delivers them as the output signal 6 . through an operation of the foregoing arrangement , the least n bits of the value of an input signal are deleted if its absolute value is not more than 2 . sup . ( n - 1 ). if the absolute value is more than 2 . sup . ( n - 1 ), it is rounded up . in a common 0 . 5 round - up procedure , the value is rounded down when the least n bits of the value is less than 2 . sup . ( n - 1 ) and up when equal to or more than 2 . sup . ( n - 1 ). the rounding error of the data round - off device of the present invention becomes equal to that of the common rounding procedure , except when the least n bits are equal to 2 . sup . ( n - 1 ). when the least n bits represent 2 . sup . ( n - 1 ), the two rounding errors become different in the sign from each other but remain the same in the magnitude . as understood , the rounding error of the data round - off device of the present invention will never be greater than that of a conventional data round - off device . for high efficiency encoding of output signals of the data round - off device , the sign of a rounding error is essential . the present invention produces such a rounding error that the absolute value of a signal becomes decreased when the least n bits are equivalent to 2 . sup . ( n - 1 ). in the common rounding procedure , the absolute value when positive is increased thus producing a rounding error . for example , when n is 1 and the input signal 1 also is 1 , the common rounding procedure determines the absolute value to 1 while the data round - off device of the present invention produces the absolute value of 0 . also , when a signal is negative , its absolute value is decreased by the common rounding procedure . hence , the resultant rounding errors are asymmetrical about zero . the data round - off device of the present invention produces rounding errors in symmetry about zero and accordingly , the input signal 1 and the output signal 6 will be identical to each other in the average value . it wound be understood that the data round - off device of the present invention exhibits more advantage when the input signal is such that the smaller its absolute value , the higher the occurrence probability becomes . for example , a video signal which is processed by orthogonal transformation as shown in fig2 exhibits such a specific probability distribution . illustrated in fig2 are an input signal 7 , an orthogonal transformer 8 , and an output signal 9 . the input signal 7 which is a video signal is orthogonally transformed to the output signal 9 by the orthogonal transformer 8 . the occurrence probability of the contents of the output signals 9 orthogonally transformed is expressed in such a distribution curve as shown in fig3 which is almost symmetrical about zero . as is apparent , the occurrence probability is exponentially decreased as the absolute value of a signal becomes great . accordingly , the output signal 9 can be rounded by the data round - off device of the present invention so that its absolute value is decreased without increasing a corresponding rounding error . more particularly , high occurrence probability signals or low absolute - value signals can be encoded with high efficiency and minimum loss by variable length code encoding to short length codes . decreasing of the absolute value of a signal other than orthogonally transformed direct current components of the same is similar to low - pass filter processing thus contributing to the reproduction of an image with no quality declination . although the first embodiment is described with the use of an orthogonally transformed input signal , the data round - off device of the present invention will be eligible in processing any input signal which exhibits a high occurrence probability distribution when its absolute value is small . a second embodiment of the present invention will be described referring to fig4 . a data round - off device of the second embodiment is provided for an m - bit input signal ( m is a positive number ) is rounded to ( m - n ) bits ( n is a natural number smaller than m ) by deleting the least n bits which can be varied by an outside means . it is assumed for ease of explanation that the input signal is a non - negative absolute value . as shown in fig4 there are denoted an input signal 10 , an offset value 11 , a shift number 12 fed from the outside , an adder 13 , an offset shifter 14 , a shifter 15 , and an output signal 16 . the offset value 11 is 2 . sup . ( k - 1 ) - 1 ( where k is a natural number smaller than m but greater than n ) expressed by a ( k - 1 ) number of 1s in binary notation . the offset value 11 can be shifted by the shift number 12 with the offset shifter 14 . for example , if the shift number 12 is n , the offset value 11 is shifted ( k - n ) bits by the offset shifter 14 and thus , its least ( n - 1 ) bits are expressed by 0s and the remaining higher places are expressed by 1s . the resultant bit - shifted offset signal is then supplied to the adder 13 where it is added to the input signal 10 . a sum output of the adder 13 is fed to the shifter 15 where the least bits determined by the shift number 12 which is equal to n is deleted . as the result , the shifter 15 delivers the higher ( m - n ) bits as the output signal 16 . according to the second embodiment , the input signal can be rounded by deleting an arbitrarily determined shift number 12 of bits . hence , adaptive quantization such as high efficiency encoding with the data round - off device of the second embodiment will be feasible . the present invention is not limited to the arrangement shown in fig4 and a variety of other arrangements will be possible . also , the input signal to the data round - off device may be other than an absolute value . fig5 illustrates a data round - off device in accordance with a third embodiment of the present invention , in which a non - negative 8 - bit input signal is rounded to a 4 - bit form by deleting the least significant four bits . denoted in fig5 are an input signal 21 , an or element 22 , an and element 23 , an adder 24 , and an output signal 25 . the third embodiment provides the data round - off device with no use of a shifter . a logic sum of the least 3 bits of the input signal 21 is calculated by the or element 22 and transferred to the and element 23 where it is combined with the fourth bit from the least of the input signal 21 for producing a logic product . the resultant outputs from logic operation with the or and and elements 22 and 23 are listed in fig6 . it is apparent that the output of the and element 23 is 0 when the least 4 bits do not exceed 2 3 and 1 when they exceed . accordingly , when the output is added to the higher 4 bits of the input signal 21 at the adder 24 , the output signal 25 becomes equal to that of the first embodiment where n is 4 and m is 8 . the adder 24 is adapted for adding one bit to the input signal and thus , has a more simple hardware arrangement than the adder 2 of the first embodiment . fig7 is a block diagram in accordance with a fourth embodiment in which the input signal 21 is fed in the form of an 8 - bit signal of two &# 39 ; s complement . the arrangement of fig7 is different from that of fig5 in that the input to an or element 30 is a sum of the input to the or element 22 and the most significant bit ( msb ) of the input signal 21 . the resultant outputs from logic operation with the or and and elements 30 and 23 are listed in fig8 - a and 8 - b . fig8 - a shows a table of the outputs in which the input signal 21 is not negative while fig8 - b shows a like table in which the input signal 21 is negative . as apparent , the outputs in fig8 - a are identical to those in fig6 and the outputs in fig8 - b are similar to those given by the common rounding procedure . it is now understood that the arrangement shown in fig7 constitutes a modification of the data round - off device of the third embodiment in which both non - negative and negative forms of the input signal can be rounded off with equal success . as described , the last two embodiments allow the least four bits of an input signal to be processed by a logic operation with the or and and elements 22 ( 30 ) and 23 , whereby their hardware arrangements are less elaborate than that of the first embodiment . although the input signal is rounded from an 8 - bit form to a 4 - bit form in the third and fourth embodiments , other combinations of bit inputs and rounded outputs are also possible . | 6 |
in the following description right hand and left hand reference is determined by standing to the rear of the bale retrieving and transporting apparatus and facing its direction of movement during its bale retrieving operation . the bale retrieving and transporting apparatus 10 of the present invention includes a lower supporting structure 14 , a rear supporting structure 16 and a bale discharging means 18 . the rear supporting structure 16 generally consists of two portions , a lower bracing structure 20 and an upper extension member 22 . the lower bracing structure includes a steel , or similar material , channel member 24 , upon which is rigidly mounted , by welding or the like , substantially vertically disposed steel box sections 26 . a steel box section 28 is positioned horizontally relative to member 24 . horizontal box section 28 is affixed to the inner portions of vertical box sections 26 . the upper extension member 22 consists of channel members 30 which slide over the outside walls of box sections 26 . channel members 30 are retained in place by nuts and bolts 32 which pass through apertures ( not shown ) contained in both box sections 26 and channel members 30 . as shown in fig2 and 3 , a fastening channel 34 is secured by bolts 36 to horizontal box section 28 . this channel contains flanges ( not shown ) which are welded to its outer end . these flanges are located so as to fit inside channel members 30 . they also contain apertures which , when aligned with apertures in vertical box section 26 , permit bolts 32 to pass therethrough thereby further securing channel members 30 to box sections 26 . interconnecting the uppermost portions of channel members 30 is shaft 40 . this shaft is journalled in openings 42 contained in channel members 30 . rigidly secured , by welding or the like , to shaft 40 is channel member 44 . channel member 44 is situated in front of member 28 and has its lower end 45 positioned substantially adjacent lower supporting structure 14 . a bale contacting plate 46 is welded to end 45 . this contacting plate has rounded edges which do not protrude into the bale . an activating arm 48 has one end rigidly secured to shaft 40 so that any movement of the activating arm will impart a corresponding movement to shaft 40 and channel member 44 . a clevis 50 is welded to the top of fastening channel 34 . this clevis secures the barrel end 52 of controlling hydraulic cylinder 54 to the rear supporting structure 16 . the rod end of cylinder 54 contains clevis 56 which is secured to activating arm 48 by the insertion of pin 58 through both the clevis 56 and an aperture ( not shown ) contained in arm 48 . suitable hydraulic lines ( not shown ) interconnect cylinder 54 and the hydraulic system of tractor 12 . to mount the rear supporting structure to the tractor the box sections 26 contain mounting pins 60 which are positioned through the sections . these pins are adapted to receive ends 62 of rigid links 64 . the other ends 66 of links 64 are connected to the tractor and are hydraulically movable between positions a and b , as illustrated in fig1 . clevis 68 is rigidly secured to the rear of channel 34 . this clevis receives the rod end 70 of hydraulic cylinder 72 and is secured to the rod by pin 74 . the barrel end 76 of cylinder 72 is suitably mounted to tractor 12 . as with cylinder 54 , cylinder 72 has hydraulic lines ( not shown ) which interconnect the hydraulic system of the tractor of this cylinder . the above described interconnection between tractor 12 and the rear supporting structure , consisting of rigid links 64 and hydraulic cylinder 72 , is commonly referred to as a three point hitch . channel member 24 includes triangular shaped notches 78 integrally formed in the member . these notches ar arranged at various positions along the channel member to vary the width of the lower supporting structure . the lower supporting structure 14 consists of tines 80 which have a generally rhombic shape . these tines have tapered end portions 82 which are adapted to be easily inserted under a bale . apertures ( not shown ) are included in both channel member 24 and end 84 of the tines . when these apertures are aligned , bolt assemblies 86 can be inserted therethrough to secure the tines in a substantially horizontally aligned position . removal of bolts 86 will permit tines 80 to be easily removed or adjusted as desired by the operator . in operation , a farmer will back his tractor , containing the bale retrieving and transporting apparatus of the present invention , towards a bale . the tapered ends 82 of tines 80 will then be lowered to their lowest position . the shape of the tines and their position with respect to the bale will permit them to move below the bale . once the bale is positioned on the tines , the operator will raise rigid links 64 and retract the rod 70 of cylinder 72 so that the apparatus is in a transport position . to discharge the bale , the operator will lower tines 80 to their lowest position . then he will activate the controlling hydraulic cylinder 54 so that rod 56 is retracted . the retraction of rod 56 will cause activating arm 48 to move counterclockwise thereby moving channel member 44 and contacting plate 46 along arc c . this movement of channel member 44 will discharge the bale from tines 80 even if the bottom most portion of the bale has become compressed or flattened . while the preferred structure in which the principles of the present invention have been incorporated is shown and described above , it is to be understood that the invention is not to be limited to the particular details , shown and described above , but that , in fact , widely different means may be employed in the practice of the broader aspects of the invention . | 0 |
the present disclosure describes a method for forming an organic device on a substrate with a patterned layer formed by an imprint process , where the organic device includes an active organic layer formed between the substrate and the patterned conductive layer . specifically , a resist bilayer is formed on top of the organic layer , which may or may not have been patterned by a previous process , and this layer is imprinted with a rigid stamp with raised areas . the bilayer consists of a top layer that is a material typically used for imprint lithography processes , and a bottom layer that serves as a buffer layer for the underlying organic material and a sacrificial layer for the end of the process . the resulting relief pattern extends through the top imprint layer and into the buffer layer beneath it in the bilayer , but stops before reaching the organic layer . after the stamp is removed , a fluorous solvent is used to etch away the remaining fluorinated layer at the bottom of the imprint pattern as well as some of the material underneath the top resist layer , creating an undercut profile . a film is then deposited , with material landing in the imprinted area contacting the organic layer , while the resist lands on the resist bilayer . a non - damaging solvent is used to lift off the bilayer , leaving only the deposited material that landed on the organic layer . one embodiment of a method of the present invention for forming an organic device having a patterned conductive layer in contact with and over at least a portion of an organic layer is depicted in the flow diagram of fig1 . fig2 accompanies fig1 and shows an organic device 24 , specifically portions of an organic memory element , at various stages of development during this process . within this method , the conductive layer is deposited over an organic layer such that it is in electrical contact with at least a portion of the organic layer and then patterned . as shown in fig1 , this method includes first providing 2 a substrate 26 as shown at stage 38 in fig2 . one or more layers of organic semiconductor material , is then deposited 4 over the substrate 26 to form one or more organic layers 28 . as shown at stage 40 of fig2 , this forms a uniform layer of the organic layers over the substrate 26 within the active area of the device . a fluorinated layer is coated 6 on the organic layers 28 , as is shown in process diagram 42 to form fluorinated sacrificial layer 30 . this layer is deposited with a solvent that is non - damaging to the underlying organic layers 28 , in this embodiment with a fluorous solvent such as a hydrofluoroether ( hfe ), although this solvent class is not the only one that can be used for this process . the coating process can include spin coating , dip coating , doctor blading , slit coating or a vacuum deposition process . on top of layer 30 , an imprint resist is coated 8 , forming layer 32 as is shown in diagram 44 of fig2 . a stamp is provided 10 , that is made of a rigid or semi - rigid material , with raised features defining the desired pattern on the substrate , as shown in fig2 . the stamp can be made of a variety of materials , including , but not limited to , silicon , glass , pfpe , pdms or metal . the stamp may be transparent or opaque , with the former being necessary for the uv cure step 14 . the stamp may also contain opaque and transparent elements , for example , having chromium metal coating the end of the relief feature so that the uv cure step does not affect the imprinted areas . the stamp is imprinted into the bilayer stack 12 , shown in the diagram 48 . the depth of the imprint is important , as the stamp needs to pass through the top layer 32 into the buffer layer 30 , but not go through that layer into the organic layers 28 . the depth of imprinting can be controlled by the height of the relief features and the action of the imprinting tool ( not shown ) that raises the substrate or lowers the stamp a controlled distance . a uv curing step 14 is optional and is dependent on the composition and properties of both the imprint resist layer 32 and the buffer layer 30 . in many cases , an imprint resist is a uv - cured resin that is cross - linked upon exposure to uv radiation . in this way it can go from a low viscosity state , necessary to let it flow around the stamp , to a high viscosity state , to allow it to how the embossed shape once the stamp is removed . another method is a thermally induced viscosity change , although the temperature swings may be too extreme for many organic materials or plastic substrates . although uv can harm organic materials as well , an absorbing material such as a dye may be added to the buffer layer 30 to prevent penetration of a large amount of uv radiation . it is not necessary for the buffer layer 30 to be uv sensitive . however , uv sensitivity may be used to change the properties of the buffer layer to control its solubility in the subsequent etching with solvent . the change in materials properties of the two bilayer materials is shown in the diagram 52 in fig2 . the stamp is removed from the substrate 16 , leaving the imprinted layers on top of the organic layers 28 . the layers have now been optionally uv irradiated and are labeled as the irradiated buffer layer 30 a and the irradiated imprint layer 32 a . next a non - damaging solvent such as a fluorous solvent is used to etch the buffer layer 18 . the removal and resulting undercut profile are shown 54 . the amount of undercut must be large enough to make a discontinuous film upon deposition , but not so much that adjacent features are connected through a tunnel , undermining the stability of the imprint resist film and causing feature collapse . material is deposited 20 onto the device 24 , as shown in the diagram 56 . material that lands on top of the remaining bilayer structure 34 a is physically disconnected from material 34 b that contacts the organic layers 28 . after the removal of the buffer layer material in the previous step 18 , the deposited layer 34 b can make a clean and intimate contact with the organic layers 28 . the bilayer is stripped or lifted off 22 with a non - damaging solvent , which dissolves or swells the buffer layer 30 , while leaving the organic layers 28 unharmed . the portion of the deposited film 34 a that landed on top of the bilayer is removed , leaving a patterned layer on the organic layers 28 . more layers or processing may be needed to complete the device 24 , which may be accomplished by this or any other method . within the present disclosure , the term “ substrate ” refers to any support on which organic materials can be coated to provide structural integrity . substrates known in the art include rigid substrates , such as those typically formed from glass , and flexible substrates , such as typically formed from stainless steel foil or plastic . the substrate 26 can also provide a portion of an environmental barrier to protect the organic material from moisture or oxygen , but this is not required . the substrate 26 can be opaque , transparent or semitransparent . the substrate 26 can further include one or more inorganic layers , such as metal buss lines or inorganic semiconductor materials for conducting electricity to the organic device . the substrate 26 can include nonconductive layers of organic material to perform functions , such as insulating the active organic layer from conductive elements on the substrate or smoothing the surface of the substrate to permit a uniform layer of active organic materials 28 to be formed . the term “ organic layer ” in the present disclosure refers to a layer of organic chemical compounds that provide an active electrical function . the organic materials from which the organic layers 28 will be formed will commonly be semiconductors and will typically be formed in one or more thin layers , often less than 50 nm in thickness . these organic materials can be small molecule organic materials , monomers , polymers or mixtures of these materials . within some preferred embodiments of the present invention , these organic materials will be blanket coated . that is they will be deposited to uniformly coat a single large area of the substrate 22 to form the organic layer 28 . however , this is not required and in some embodiments , these materials can be patterned on the substrate 26 as they are deposited forming an organic layer 28 that is discontinuous across the surface of the substrate 26 . in a preferred embodiment , it is desirable for the last active organic material to be deposited before coating 6 the buffer layer or coating 20 the conductive layer to contain polymer strands to provide stability to the organic layer . as such , the step of depositing organic materials over the substrate includes depositing at least one polymeric organic material and the buffer layer is coated directly on top of the at least one polymeric organic material . by providing an active electrical function , the organic material serves to conduct electricity , serves as a semiconductor to control the flow of electricity , or serves as an insulator to prevent or reduce the flow of electricity . in examples described in the present disclosure a buffer layer 30 and imprint layer 32 is coated “ over ” the one or more organic layers to form an imprint patternable layer . the term “ over ” is defined such that an organic layer is deposited on the substrate prior to coating the photo - patternable layer . in some embodiments , the photo - patternable layer will be coated immediately on top of one or more organic layers . in another embodiment , one or more organic layers will be deposited and a patterned inorganic layer will be created over the organic layer , covering a portion of the organic layer and the photoresist solution will be coated such that it is in direct contact with a portion of the organic layer , without having any intermediate inorganic layer . in further embodiments , an inorganic layer is formed over the organic layer before applying the buffer layer 30 . although it is possible that the inorganic layer could provide protection to the organic layer , in practical devices voids within the inorganic layer will often prevent such an inorganic layer from providing effective protection to the organic layer from the buffer material solution . therefore , in some embodiments it is important to use the fluorinated buffer material and solvents described in the present disclosure to achieve high yield even in circumstances where the organic layer is deposited onto the substrate prior to exposing the substrate to a buffer material solution even when the organic layer is somewhat protected by an intervening inorganic layer . the terms “ buffer layer ” and “ buffer material ” mean a material that is both safe to use on top of the organic layers 28 , and that can further provide protection from the solvents used to deposit and process the imprint resist layer on top . in one embodiment , a fluorinated polymer material is used as a buffer layer , cast with a solvent such as a hydrofluoroether ( hfe ), such as novec 7600 or novec 7500 from 3m corp . the polymer may be composed of a single fluorinated monomer or be a mixture of one or more fluorinated and non - fluorinated co - monomers . the ratio of fluorinated to non - fluorinated monomers can be used to control the adhesion properties of the buffer layer 30 to the organic layers 28 surface and of the adhesion of the imprint resist 32 to the buffer layer 30 . a photosensitive element may be incorporated into the buffer layer material , which renders it less soluble to the etching solvent . such a property may be found using deprotection scheme found in some photoresist systems . the term “ imprint layer ” refers to materials commonly used in imprint lithography . these materials typically fall into two broad categories : thermoplastic polymers and uv - curable resins . the deposited material can be a conductive layer , an organic layer or an inorganic semiconductor or insulating layer . the preferred embodiment is to deposit a conductive layer in step 20 in order to make a device such as a memory element or a top - contact organic transistor . the term “ conductive layer ” refers to layer or a combination of multiple thin film layers formed after an organic layer , wherein the layer or combination of thin film layers functionally provide a single conductive element which is capable of creating an electrical field within the organic layer . the conductive layer can be transparent , semi - transparent , or opaque . typical conductive layers useful in embodiments of the present invention will have a thickness of between 10 nm to permit the formation of a continuous film and less than 300 nm to permit the film to be permeated by the solvents described in the present disclosure . this conductive layer can be formed from organic or inorganic materials capable of providing electricity to the organic semiconductor layers . however , in some preferred embodiments of the present invention , these conductive layers will include an inorganic metal . this inorganic metal will preferably be applied through vapor deposition or sputtering . typical inorganic materials useful in forming such a conductive layer will include metals such as silver , gold , platinum , copper and aluminum ; as well as certain doped metal oxides , such as indium tin oxide or indium zinc oxide . once again , conductive layers can be formed using multiple methods including printing or sputtering . however , as discussed earlier , it can be desirable in certain embodiments to deposit the inorganic conductive layers using evaporation or other methods that provide line of sight deposition . | 7 |
fig4 a - 4c are schematic block diagrams of exemplary embodiments of polarization independent 2 - port ( 400 ), 3 - port ( 410 ), and 4 - port ( 420 ) isolators / circulators based on a nonreciprocal phase shifter in accordance with the invention . the isolators / circulators include input and output ports , an interferometer , and a polarization - independent nonreciprocal phase shifter ( 430 ). the input and output have either one or two ports to make the device an isolator ( 400 ), a 3 - port circulator ( 410 ), or a 4 - port circulator ( 420 ). the interferometers consist of two couplers ( 440 , 450 ) and two optical paths in between . the first coupler ( 440 ) divides the intensity of the incoming optical signal evenly into the two arms of the interferometer . the two resulting optical signals undergo different phase shifts depending on the propagation direction . the second coupler ( 450 ) transmits light from the two paths into one of the output port ( s ) based on the relative phase difference between the two paths . the nonreciprocal phase shifter ( 430 ) adds 0 ° to the phase difference in the forward direction and 180 ° in the backward direction , or vice versa . fig5 a and 5b are functional block diagrams showing the light paths of a 4 - port circulator using a nonreciprocal phase shifter with 0 ° and 180 ° phase difference , respectively . fig6 a - 6c are functional block diagrams of exemplary embodiments of polarization - independent nonreciprocal phase shifters ( 600 , 620 , 640 ) in accordance with the invention . each of the phase shifters includes first ( 610 ) and second ( 612 ) 90 ° tm nonreciprocal phase shifters that create a ± 90 ° phase shift between the two optical paths with the sign depending on the propagation direction . operation is based on a magneto - optical planar waveguide with geometrical asymmetry in the direction normal to the film plane . the axes are set to be x for the plane normal , y to be along the film boundary , and z to be the beam axis . by applying a magnetic field in the y direction , imaginary - term off - diagonal components in the dielectric tensor are created as shown in fig7 , which presents a schematic diagram of the origin of tm nonreciprocal phase shifts . the presence of off - diagonal components in the dielectric tensor leads to a coupling between er and e ,, and differentiates the propagation constants between the forward and backward directions , i . e ., δβ = β forward − β forward ≠ 0 , as shown in fig7 . for a horizontally symmetric waveguide , δβ for the te mode always cancels out because e x and e z are always symmetric and anti - symmetric , or vice versa , so that their overlap integral becomes zero . for a waveguide that is asymmetric vertically ( or in x - axis ), δβ for the tm mode does not cancel out . by choosing opposing transverse magnetization for each optical path and the proper length for each nonreciprocal phase shifter , such that δβ · l = π / 4 for one path and δβ · l =− π / 4 for the other path , + 90 ° is added to the phase difference between the two arms in the forward propagation direction , and − 90 ° in the backward propagation direction . a typical waveguide length for such a nonreciprocal phase shift , based on currently available magneto - optical material , is ˜ 3 mm . in order to make the device polarization independent , a half - wave plate is placed between the first and the second nonreciprocal phase shifters with its slow axis at 45 °, such that the te and tm components of the optical signal are interchanged . the thickness of commercially available half - wave plates in a thin - film form can be as low as ˜ 15 μm , a value that is small enough to minimize diffraction loss across the film (& lt ; 0 . 2 db ). with this approach , both polarizations undergo nonreciprocal phase shifts , tm in the first magneto - optic waveguide and te in the second magneto - optic waveguide in the propagation direction . depending on the choice of the couplers , this design can be configured as a 3 - port circulator ( fig6 a ), a 4 - port circulator ( fig6 b ) or a simple 2 - port isolator ( fig6 c ). fig8 is a schematic block diagram of an exemplary embodiment of a nonreciprocal phase shifter ( 800 ) that includes multiple faraday rotators ( 802 ) and half - wave retarders ( 804 , 806 ). this configuration is intended for integrating a low - loss nonreciprocal polarization rotator into a planar waveguide structure without using a waveguide faraday rotator . the problem with the existing designs lies in the light guidance across the 45 ° faraday rotator . a typical film is ˜ 0 . 5 mm so that the unguided propagation through such a thick film typically causes diffraction losses on the order of ˜ 5 db . furthermore , the proper angular alignment of the film with respect to the waveguide is extremely critical , since otherwise a huge excess loss arises from the displacement of the beam relative to the waveguide . a tilt angle as low as a few degrees will lead to ˜ 3 db excess loss . these losses can be reduced by having a taper in the waveguide so that the waveguide diameter at the faraday rotator is larger . however , fabrication of waveguide tapers is difficult in most materials and increases the device length considerably . the fabrication of a waveguide faraday rotator , as the alternative , is very difficult because the faraday rotator requires phase matching , or elimination of the birefringence . several sources of birefringence exist , and they include waveguide geometry , stress between layers , and growth - induced birefringence . the total birefringence for a typical faraday rotator requires δβ ˜& lt ; 0 . 0001 rad / μm , however , in most cases the magnitude of each form of birefringence is already much larger than that . although the prior art has demonstrated faraday rotators in waveguide form , the mass production of such devices is difficult . overall , this design is impractical for use in a planar optical circulator . even though many different realizations are possible , the invention is optimized for use in the form of a planar optical circuit . the invention utilizes a magneto - optical film and a half - wave plate , and minimizes the diffraction losses by having multiple thinner faraday rotators with a total thickness equal to a single 45 ° faraday rotator . the absolute faraday rotation is proportional to the beam propagation length so that multiple thinner films operate in the same way as one single film of the same total thickness . since the diffraction loss is a super - linear function of the propagation distance , it is possible to significantly reduce the diffraction loss by using multiple thin films rather than one thick film . fig9 is a graph depicting the waveguide core diameter required to limit the diffraction loss to 0 . 25 db and 0 . 5 db , respectively , when the total film thickness given is 0 . 5 mm . the graph shows clear improvements with multiple films over a single film . for a single faraday rotator , a large mode width of & gt ; 23 μm in diameter is required to curtail the overall diffraction loss to & lt ; 0 . 5 db while the 5 - film counterpart requires only ˜ 12 μm , a value that is close to the typical mode size of silica fibers . fig1 is a functional block diagram of an exemplary embodiment of a nonreciprocal phase shifter ( 1000 ). the phase shifter includes faraday rotators ( 1002 ) and a half - wave retarder ( 1004 ). the 45 ° faraday rotators rotate the input polarization axis by ± 45 ° with the sign depending on the magnetic field direction . by having opposing magnetic fields for both optical paths , 90 ° difference between the axes of polarization in the two paths will be obtained . by placing a half - wave plate in each of the two interferometric paths with an angle of 45 ° between their slow axes , an additional ± 90 ° polarization difference is obtained between the two optical paths , with the sign depending on the propagation direction . the total polarization axis rotation due to the faraday rotators and half - wave retarders results in 0 ° polarization axis difference between the two arms in the forward direction , and 180 ° polarization axis difference in the backward direction , or vice versa . it should be noted that a rotation of the polarization by 180 ° is equivalent to a phase shift of 180 °. this configuration is general so that a 4 - port circulator , a 3 - port circulator , and an isolator can be designed by changing the input and output port numbers accordingly . the shifter is designed to have the same sequence of film devices in both arms . in this way , only the minimal number of grooves ( the number of faraday rotator films and one groove for the half - wave plate ) needs to be fabricated while previous designs require the fabrication of at least one extra groove . fig1 a is a schematic block diagram of an isolator / circulator ( 1100 ) consisting of two mach - zehnder - based polarization splitters and a nonreciprocal polarization converter ( 1100 ) in accordance with the invention . it should be noted that this design allows all 2 - port , 3 - port , and 4 - port structures . the entire device comprises two interferometers , first ( 1102 ), second ( 1104 ) and third ( 1106 ) half - wave retarders , and faraday rotators ( 1108 ). each interferometer has a half - wave retarder in one arm , with the slow axes of the two retarders being at the same angle . the optical path length difference between the two arms is chosen such that light that enters the polarization splitter through one of the two input ports is split at the output ports into two linearly polarized components parallel and perpendicular to the slow axes of the retarders . light that enters the other input port is split into the same linearly polarized components but into the opposite output ports . alternatively , the half - wave plates ( 1102 , 1106 ) in one arm can be replaced by quarter - wave plates ( 1112 , 1114 , 1116 , 1118 ) in each arm with their slow axes perpendicular to each other to form an isolator / circulator ( 1110 ) as shown in fig1 b . the region between the two interferometers has the 45 ° faraday rotators ( 1108 ) and the half - wave retarder ( 1104 ) with the slow axis at 22 . 5 ° relative to either one of the two linear polarization states at the output ports of the polarization splitter . as discussed above , faraday rotation is a nonreciprocal polarization rotation while half - wave retardation is a reciprocal polarization rotation . this arrangement results in the polarization rotation for the two devices canceling each other out in one propagation direction and accumulating to 90 ° rotation in the opposite propagation direction . the overall functionality of this isolator / circulator is as follows . light that enters the device through port # 1 is split into two linearly polarized components . in the forward direction , the polarization remains unchanged by the faraday rotator and the half - wave plate and the subsequent polarization combiner directs both polarizations into port # 2 as shown in fig1 a . in the backward direction , however , the planes of polarization in both arms get rotated by 90 ° when the optical signal traverses the faraday rotator and the half - wave plate , causing an optical signal entering port # 2 to exit through port # 3 and not through port # 1 as would be the case for a reciprocal device . this design functionality is similar to bulk counterparts . however , unlike the bulk counterparts , expensive components such as bulk polarization splitters or lenses are not required for the invention . the present invention has also another advantage over the prior art in that the present design is less affected by the waveguide birefringence of the planar optical circuit . with most fabrication techniques , a residual birefringence on the order of δn ≈ 0 . 0001 cannot be avoided . the presence of said residual birefringence changes the state of polarization of light , unless it coincides exactly with one of the two linearly polarized eigermodes of the waveguide . the existing isolator / circulator designs require arbitrary states of polarization to be maintained throughout the entire length of the interferometer arms . our design , in contrast , imposes this requirement only on the much shorter region between the faraday rotator and the adjacent half - wave retarder . hence , the present invention is more tolerant of birefringence . although the present invention has been shown and described with respect to several preferred embodiments thereof , various changes , omissions and additions to the form and detail thereof , may be made therein , without departing from the spirit and scope of the invention . | 6 |
fig1 shows a truck vehicle 10 having a chassis 12 , including a chassis frame 14 on which a cab body 16 is supported . a hood 18 in front of cab body 16 covers an engine which is part of a powertrain which propels truck vehicle 10 via rear drive wheels 20 . truck vehicle 10 is steered via front steered wheels 22 . to the rear of cab body 16 chassis frame 14 supports a cargo bed 24 which , as shown in fig2 , comprises a horizontal floor 26 , a right side wall 28 , and a left side wall 30 . cargo bed 24 may also comprise a front wall immediately to the rear of cab body 16 and an opposite rear wall . each of the two side walls 28 , 30 comprises multiple side wall panels 34 which can be swung from an upright position outwardly and downwardly as suggested by arrows 36 in fig2 which show one side wall panel 34 swung in excess of 90 ° from upright position . each side wall panel 34 comprises multiple posts 38 ( see fig3 also ) to which sheeting 40 is attached . rigid rectangular steel tubing is a suitable material for posts 38 , and posts 38 may occasionally be referred to as tubes 38 in the following description . stamped sheet steel is a suitable material for sheeting 40 , allowing it to be joined to posts 38 by welding . a side wall panel may also comprise additional structural members such as horizontal rails 42 . fig3 shows a side wall panel 34 which comprises four rectangular steel tubes 38 . two of tubes 38 are outer end posts and the other two are inner intermediate posts . a respective stake 44 is associated with each intermediate post 38 . each stake 44 is movable along the length of the respective post 38 for staking side wall panel 34 to cargo bed 24 when the side wall panel is in upright position and for unstaking the side wall panel from the cargo bed to allow the side wall panel to be swung outwardly and downwardly from upright position and thereafter swung back to upright position . each side wall panel 34 can swing about a common horizontal axis 46 . a bottom end of each outer end post 38 extends beyond a bottom margin of the respective side wall panel &# 39 ; s sheeting 40 and contains a hinge barrel 48 which is exposed in fig5 by the outer end post from the nearer side wall panel having been removed for the purpose of illustration . in this way , confronting ends of adjacent side wall panels have aligned hinge barrels 48 through which a pivot pin 50 extends to enable each side wall panel to swing about axis 46 independently of adjacent side wall panels . each stake 44 comprises a proximal end which contains a round bar 52 extending transversely from opposite sides through respective slots 54 in opposite walls of the respective tube 38 . a stake is moved by applying force to its bar 52 in either a proximal or a distal direction . slots 54 extend lengthwise of each post 38 to guide movement of stake 44 within a range of travel between an extended position shown in fig3 where bars 52 are at or near one limit of the travel range . applying a proximal force to a bar will move it from the illustrated extended position to a retracted position at or near an opposite limit of the travel range . manual access to stakes 44 for staking and unstaking a side wall panel 34 is available on the floor side of the cargo bed . running lengthwise along right and left sides of cargo bed 24 are upwardly open channels 60 each having a horizontal bottom wall 62 , a vertical inner side wall 64 , and a vertical outer side wall 66 . each channel 60 is substantially coextensive in length with a respective side wall panel 34 but is free of interference with the swing of the side wall panel about axis 46 . with a side wall panel in upright position and its stakes 44 in extended position , a distal end portion of each stake is disposed within the respective channel as shown in fig6 . that distal end portion comprises a succession of wedging surfaces 68 which are joined by supporting surfaces 72 on which a wedge 70 can be supported . wedge 70 has supported surfaces 74 via which it can rest on supporting surfaces 72 when the stake is in retracted position . wedge 70 also comprises a succession of wedged surfaces 76 each of which is joined with an adjacent wedged surface 76 by a supported surface 74 . with side wall panel 38 upright and a stake 44 in retracted position , both stake 44 and wedge 70 are clear of channel 60 with the force of gravity causing wedge 70 to rest on the distal end portion of stake 44 . as a stake 44 is moved toward extended position , the weight of wedge 70 keeps it supported on stake 44 as both stake and wedge enter channel 60 . the distance between a flat outer surface 80 of stake 44 and a flat inner surface 82 of wedge 70 is less than the distance between channel side walls 64 and 66 , enabling the stake and wedge to enter channel 60 . wedge 70 extends slightly beyond the distal end of stake 44 and will come into abutment with bottom wall 62 which arrests its movement . continued movement of stake 44 then begins to force stake and wedge apart until surfaces 80 and 82 are forced against walls 66 and 64 respectively , thereby wedging the stake and wedge in the channel and consequently preventing side wall panel 34 from being swung from its upright position . after stake 44 has moved sufficiently toward retracted position to remove both stake and wedge out of channel 60 , side wall panel 34 can be swung down from its upright position . that unwedging of a stake results in wedge 70 being carried by stake 44 out of channel 60 . the size of tube 38 allows some free movement of the stake and wedge within the interior of the tube while preventing wedge 70 from coming off stake 44 . additional forces are being applied to a side wall panel 34 as its stakes 44 are being wedged in channel 60 . those forces are provided by two compression spring mechanisms 90 mounted on cargo bed 24 near the lengthwise ends of the side wall panel . the locations are marked in fig2 and 3 by the reference numerals 90 . fig4 shows an example of such a spring mechanism . a plunger 92 is mounted on a wall of cargo bed 24 for horizontal displacement in a direction transverse to the length of a side wall panel 34 and is biased in an outward direction by a helical compression spring 94 . spring mechanism 90 assumes the condition shown in fig6 when side wall panel 34 has been unstaked and swung out of upright position far enough to lose contact with a head 96 of plunger 92 . as side wall panel 34 is swung back toward upright position , outer end posts 38 will abut heads 96 of plungers 92 before the side wall panel reaches upright position . as the side wall panel continues toward upright position , springs 94 are increasingly compressed , urging the bottom margin of the side wall panel which is within channel 60 outwardly against channel side wall 66 with ever increasing force . by forcing the bottom margin of side wall panel 34 against side wall 66 with large forces , 500 pounds each for example , at locations just above axis 46 , the side wall panel is held secure . the location of each spring mechanism just above axis 46 provides a sufficiently long lever arm to overcome the large spring forces for enabling a person pushing on the top margin of a side wall panel to force the side wall panel to upright position where it can be staked to cargo bed 24 . the coactions of the spring forces applied by spring mechanisms 90 and the wedging forces applied by stakes 44 and wedges 70 collectively cause a side wall panel 34 to be held secure in a geometrically defined position in relation to its channel 60 . a combination of precise dimensional alignment of all channels 60 along each side of cargo bed 24 and of structural rigidity of each side wall panel 34 and channel 60 results in the upper margins of successive side wall panels 34 attaining proper alignment with each other along each side wall 28 , 30 without a latch mechanism for latching the upper margin of each side wall panel to an adjacent one . | 1 |
because the invention will be understood better after further discussion of its currently preferred embodiments , further discussion of said embodiments will now be provided . it is understood that said discussion is being provided without reducing the generality of the invention , since persons skilled in the art can readily imagine many additional embodiments that fall within the full scope of the invention as taught in the summary of the invention section . the currently preferred embodiments of the invention are lightweight thermoset nanocomposite particles possessing high stiffness , strength , temperature resistance , and resistance to aggressive environments . these attributes , occurring in combination , make said particles especially suitable for use in many challenging applications in the construction , drilling , completion and / or fracture stimulation of oil and natural gas wells . said applications include the use of said particles as a proppant partial monolayer , a proppant pack , an integral component of a gravel pack completion , a ball bearing , a solid lubricant , a drilling mud constituent , and / or a cement additive . the thermoset matrix in said particles consists of a terpolymer of styrene ( s , non - crosslinking ), ethyvinylbenzene ( evb , also non - crosslinking ), and divinylbenzene ( dvb , crosslinking ) the preference for such a terpolymer instead of a copolymer of s and dvb is a result of economic considerations . to summarize , dvb comes mixed with evb in the standard product grades of dvb , and the cost of dvb increases rapidly with increasing purity in special grades of dvb . evb is a non - crosslinking ( difunctional ) styrenic monomer . its incorporation into the thermoset matrix does not result in any significant changes in the properties of the thermoset matrix or of nanocomposites containing said matrix , compared with the use of s as the sole non - crosslinking monomer . consequently , it is far more cost - effective to use a standard ( rather than purified ) grade of dvb , thus resulting in a terpolymer where some of the repeat units originate from evb . the amount of dvb in said terpolymer ranges from 3 % to 35 % by weight of the starting mixture of the three reactive monomers ( s , evb and dvb ) because different applications require different maximum possible use temperatures . even when purchased in standard product grades where it is mixed with a large weight fraction of evb , dvb is more expensive than s . it is , hence , useful to develop different product grades where the maximum possible use temperature increases with increasing weight fraction of dvb . customers can then purchase the grades of said particles that meet their specific application needs as cost - effectively as possible . the monarch ™ 280 product grade of nanoscale carbon black supplied by cabot corporation is being used as the nanofiller in said particles . the reason is that it has a relatively low specific surface area , high structure , and a “ fluffy ” product form ; rendering it especially easy to disperse . the use of too low a volume fraction of carbon black results in ineffective reinforcement . the use of too high a volume fraction of carbon black may result in difficulties in dispersing the nanofiller , dispersion viscosities that are too high to allow further processing with available equipment , and detrimental interference in polymerization and network formation . the amount of carbon black ranges from 0 . 1 % to 15 % by volume of said particles because different applications require different levels of reinforcement . carbon black is more expensive than the monomers ( s , evb and dvb ) currently being used in the synthesis of the thermoset matrix . it is , therefore , useful to develop different product grades where the extent of reinforcement increases with increasing volume fraction of carbon black . customers can then purchase the grades of said particles that meet their specific application needs as cost - effectively as possible . suspension polymerization is performed via rapid rate polymerization , as taught by albright ( u . s . pat . no . 6 , 248 , 838 ) which is incorporated herein by reference , for the fabrication of said particles . rapid rate polymerization has the advantage , relative to conventional isothermal polymerization , of producing more physical entanglements in thermoset polymers ( in addition to the covalent crosslinks ). suspension polymerization involves the preparation of an the aqueous phase and an organic phase prior to the commencement of the polymerization process . the monarch ™ 280 carbon black particles are dispersed in the organic phase prior to polymerization . the most important additional formulation component ( besides the reactive monomers and the nanofiller particles ) that is used during polymerization is the initiator . the initiator may consist of one type molecule or a mixture of two or more types of molecules that have the ability to function as initiators . additional formulation components , such as catalysts , inhibitors , dispersants , stabilizers , rheology modifiers , buffers , antioxidants , defoamers , impact modifiers , plasticizers , pigments , flame retardants , smoke retardants , or mixtures thereof , may also be used when needed . some of the additional formulation component ( s ) may become either partially or completely incorporated into the particles in some embodiments of the invention . suspension polymerization produces substantially spherical polymer particles . ( while it is a goal of this invention to create spherical particles , it is understood that it is exceedingly difficult as well as unnecessary to obtain perfectly spherical particles . therefore , particles with minor deviations from a perfectly spherical shape are considered perfectly spherical for the purposes of this disclosure .) said particles can be varied in size by means of a number of mechanical and / or chemical methods that are well - known and well - practiced in the art of suspension polymerization . particle diameters attainable by such means range from submicron values up to several millimeters . hence said particles may be selectively manufactured over the entire range of sizes that are of present interest and / or that may be of future interest for applications in the oil and natural gas industry . optionally , after the completion of suspension polymerization , said particles can be separated into fractions having narrower diameter ranges by means of methods ( such as , but not limited to , sieving techniques ) that are well - known and well - practiced in the art of particle separations . said narrower diameter ranges include , but are not limited to , nearly monodisperse distributions . optionally , assemblies of particles possessing bimodal or other types of special distributions , as well as assemblies of particles whose diameter distributions follow statistical distributions such as gaussian or log - normal , can also be prepared . the optional preparation of assemblies of particles having diameter distributions of interest from any given “ as polymerized ” assembly of particles can be performed before or after any optional heat treatment of said particles . without reducing the generality of the invention , in the currently most preferred embodiments of the invention , any optional preparation of assemblies of particles having diameter distributions of interest from the product of a run of the pilot plant or production plant reactor is performed after the completion of any optional heat treatment of said particles . the particle diameters of current practical interest for various uses in the construction , drilling , completion and / or fracture stimulation of oil and natural gas wells range from 0 . 1 to 4 millimeters . the specific diameter distribution that would be most effective under given circumstances depends on the details of the subterranean environment in addition to depending on the type of application . the diameter distribution that would be most effective under given circumstances may be narrow or broad , monomodal or bimodal , and may also have other special features ( such as following a certain statistical distribution function ) depending on both the details of the subterranean environment and the type of application . said particles are left in the reactor fluid that remains after suspension polymerization if optional heat treatment is to be used . said reactor fluid thus serves as the heat treatment medium . this approach works especially well ( without adverse effects such as degradation and / or swelling ) in enhancing the curing of said particles where the polymer matrix consists of a terpolymer of s , evb and dvb . since the reactor fluid that remains after the completion of suspension polymerization is aqueous while these terpolymers are very hydrophobic , the reactor fluid serves as an excellent heat transfer medium which does not swell the particles . the use of the reactor fluid as the medium for the optional heat treatment also has the advantage of simplicity since the particles would have needed to be removed from the reactor fluid and placed in another fluid as an extra step before heat treatment if an alternative fluid had been required . detailed and realistic simulations based on the solution of the heat transfer equations are often used optionally to optimize the heat exposure schedule if optional heat treatment is to be used . it has been found that such simulations become increasingly useful with increasing quantity of particles that will be heat treated simultaneously . the reason is the finite rate of heat transfer . said finite rate results in slower and more difficult equilibration with increasing quantity of particles and hence makes it especially important to be able to predict how to cure most of the particles further uniformly and sufficiently without overexposing many of the particles to heat . the currently preferred embodiments of the invention will be understood better in the context of a specific example . it is to be understood that said example is being provided without reducing the generality of the invention . persons skilled in the art can readily imagine many additional examples that fall within the scope of the currently preferred embodiments as taught in the detailed description of the invention section . persons skilled in the art can , furthermore , also readily imagine many alternative embodiments that fall within the full scope of the invention as taught in the summary of the invention section . the thermoset matrix was prepared from a formulation containing 10 % dvb by weight of the starting monomer mixture . the dvb had been purchased as a mixture where only 63 % by weight consisted of dvb . the actual polymerizable monomer mixture used in preparing the thermoset matrix consisted of roughly 84 . 365 % s , 5 . 635 % evb and 10 % dvb by weight . carbon black ( monarch 280 ) was incorporated into the particles , at 0 . 5 % by weight , via dispersion in the organic phase of the formulation prior to polymerization . since the specific gravity of carbon black is roughly 1 . 8 while the specific gravity of the polymer is roughly 1 . 04 , the amount of carbon black incorporated into the particles was roughly 0 . 29 % by volume . suspension polymerization was performed in a pilot plant reactor , via rapid rate polymerization as taught by albright ( u . s . pat . no . 6 , 248 , 838 ) which is incorporated herein by reference . in applying this method , the “ dual initiator ” approach , wherein two initiators with different thermal stabilities are used to help drive the reaction of dvb further towards completion , was utilized . the required tests only require a small quantity of particles . the use of a liquid medium ( such as the reactor fluid ) is unnecessary for the heat treatment of a small sample . roughly 500 grams of particles were hence removed from the slurry , washed , spread very thin on a tray , heat - treated for ten minutes at 200 ° c . in an oven in an inert gas environment , and submitted for testing . the glass transition temperature of these “ heat - treated ” particles , and the liquid conductivity of packings thereof , were then measured by independent testing laboratories ( impact analytical in midland , mich ., and fractech laboratories in surrey , united kingdom , respectively ). fig5 provides a process flow diagram depicting the preparation of the example . it contains four major blocks ; depicting the preparation of the aqueous phase ( block a ), the preparation of the organic phase ( block b ), the mixing of these two phases followed by suspension polymerization ( block c ), and the further process steps used after polymerization to obtain the “ as - polymerized ” and “ heat - treated ” samples of particles ( block d ). the following subsections will provide further details on the formulation , preparation and testing of this working example , to enable persons who are skilled in the art to reproduce the example . an aqueous phase and an organic phase must be prepared prior to suspension polymerization . the aqueous phase and the organic phase , which were prepared in separate beakers and then used in the suspension polymerization of the particles of this example , are described below . the aqueous phase used in the suspension polymerization of the particles of this example , as well as the procedure used to prepare said aqueous phase , are summarized in table 1 . the organic phase used in the suspension polymerization of the particles of this example , as well as the procedure used to prepare said organic phase , are summarized in table 2 . note that the nanofiller ( carbon black ) was added to the organic phase in this particular example . the aqueous phase was added to the reactor at 65 ° c . the organic phase was then introduced over roughly 5 minutes with agitation at the rate of 90 rpm . the mixture was held at 65 ° c . with stirring at the rate of 90 rpm for at least 15 minutes or until proper dispersion had taken place as manifested by the equilibration of the droplet size distribution . the temperature was ramped from 65 ° c . to 78 ° c . in 10 minutes . it was then further ramped from 78 ° c . to 90 ° c . at the rate of 0 . 1 ° c . per minute in 120 minutes . it was then held at 90 ° c . for 90 minutes to provide most of the conversion of monomer to polymer , with benzoyl peroxide ( half life of one hour at 92 ° c .) as the effective initiator . it was then further ramped to 115 ° c . in 30 minutes and held at 115 ° c . for 180 minutes to advance the curing with taec ( half life of one hour at 117 ° c .) as the effective initiator . the particles were thus obtained in an aqueous slurry . fig6 shows the variation of the temperature with time during polymerization . the aqueous slurry was cooled to 40 ° c . it was then poured onto a 60 mesh ( 250 micron ) sieve to remove the aqueous reactor fluid as well as any undesirable small particles that may have formed during polymerization . the “ as - polymerized ” beads of larger than 250 micron diameter obtained in this manner were then washed three times with warm ( 40 ° c . to 50 ° c .) water three sets of “ heat - treated ” particles , which were imposed to different thermal histories during the post - polymerization heat treatment , were prepared from the “ as - polymerized ” particles . in preparing each of these heat - treated samples , washed beads were removed from the 60 mesh sieve , spread very thin on a tray , placed in an oven under an inert gas ( nitrogen ) blanket , and subjected to the desired heat exposure . sample 10m200c was prepared with isothermal annealing for 10 minutes at 200 ° c . sample 40m200c was prepared with isothermal annealing for 40 minutes at 200 ° c . to explore the effects of extending the duration of isothermal annealing at 200 ° c . sample 10m220c was prepared with isothermal annealing for 10 minutes at 220 ° c . to explore the effects of increasing the temperature at which isothermal annealing is performed for a duration of 10 minutes . in each case , the oven was heated to 100 ° c ., the sample was placed in the oven and covered with a nitrogen blanket ; and the temperature was then increased to its target value at a rate of 2 ° c . per minute , held at the target temperature for the desired length of time , and finally allowed to cool to room temperature by turning off the heat in the oven . some particles from each sample were sent to impact analytical for the measurement of t g via dsc . particles of 14 / 16 u . s . mesh size were isolated from sample 40m200c by some additional sieving . this is a very narrow size distribution , with the particle diameters ranging from 1 . 19 mm to 1 . 41 mm . this nearly monodisperse assembly of particles was sent to fractech laboratories for the measurement of the liquid conductivity of its packings . a reference sample was also prepared , to provide a baseline against which the data obtained for the particles of the invention can be compared . the formulation and the fabrication process conditions used in the preparation of the reference sample differed from those used in the preparation of the examples of the particles of the invention in two key aspects . firstly , carbon black was not used in the preparation of the reference sample . secondly , post - polymerization heat treatment was not performed in the preparation of the reference sample . consequently , while the examples of the particles of the invention consisted of a heat - treated and carbon black reinforced thermoset nanocomposite , the particles of the reference sample consisted of an unfilled and as - polymerized thermoset polymer that has the same composition as the thermoset matrix of the particles of the invention . some particles from the reference sample were sent to impact analytical for the measurement of t g via dsc . in addition , particles of 14 / 16 u . s . mesh size were isolated from the reference sample by sieving and sent to fractech laboratories for the measurement of the liquid conductivity of their packings dsc experiments ( astm e1356 - 03 ) were carried out by using a ta instruments q100 dsc with nitrogen flow of 50 ml / min through the sample compartment . roughly nine milligrams of each sample were weighed into an aluminum sample pan , the lid was crimped onto the pan , and the sample was then placed in the dsc instrument . the sample was then scanned from 5 ° c . to 225 ° c . at a rate of 10 ° c . per minute . the instrument calibration was checked with nist srm 2232 indium . data analysis was performed by using the ta universal analysis v4 . 1 software . dsc data for the heat - treated samples are shown in fig7 . t g was defined as the temperature at which the curve for the heat flow as a function of the temperature went through its inflection point . the results are summarized in table 3 . it is seen that the extent of polymer curing in sample 10m220c is comparable to that in sample 40m200c , and that the extent of polymer curing in both of these samples has advanced significantly further than that in sample 10m200c whose t g was only slightly higher than that of the reference sample . a fracture conductivity cell allows a particle packing to be subjected to desired combinations of compressive stress ( simulating the closure stress on a fracture in a downhole environment ) and elevated temperature over extended durations , while the flow of a fluid through the packing is measured . the flow capacity can be determined from differential pressure measurements . the experimental setup is illustrated in fig8 . ohio sandstone , which has roughly a compressive elastic modulus of 4 mpsi and a permeability of 0 . 1 md , was used as a representative type of outcrop rock . wafers of thickness 9 . 5 mm were machined to 0 . 05 mm precision and one rock was placed in the cell . the sample was split to ensure that a representative sample is achieved in terms of its particle size distribution and then weighed . the particles were placed in the cell and leveled . the top rock was then inserted . heated steel platens were used to provide the correct temperature simulation for the test . a thermocouple inserted in the middle port of the cell wall recorded the temperature of the pack . a servo - controlled loading ram provided the closure stress . the conductivity of deoxygenated silica - saturated 2 % potassium chloride ( kcl ) brine of ph 7 through the pack was measured . 1 . a 70 mbar full range differential pressure transducer was activated by closing the bypass valve and opening the low pressure line valve . 2 . when the differential pressure appeared to be stable , a tared volumetric cylinder was placed at the outlet and a stopwatch was started . 3 . the output of the differential pressure transducer was fed to a data logger 5 - digit resolution multimeter which logs the output every second during the measurement . 4 . fluid was collected for 5 to 10 minutes , after which time the flow rate was determined by weighing the collected effluent . the mean value of the differential pressure was retrieved from the multimeter together with the peak high and low values . if the difference between the high and low values was greater than the 5 % of the mean , the data point was disregarded . 5 . the temperature was recorded from the inline thermocouple at the start and at the end of the flow test period . if the temperature variation was greater than 0 . 5 ° c ., the test was disregarded . the viscosity of the fluid was obtained from the measured temperature by using viscosity tables . no pressure correction is made for brine at 100 psi . the density of brine at elevated temperature was obtained from these tables . 6 . at least three permeability determinations were made at each stage . the standard deviation of the determined permeabilities was required to be less than 1 % of the mean value for the test sequence to be considered acceptable . 7 . at the end of the permeability testing , the widths of each of the four corners of the cell were determined to 0 . 01 mm resolution by using vernier calipers . these results are shown in fig9 . they demonstrate clearly the advantage of the particles of the invention in terms of the enhanced retention of liquid conductivity under a compressive stress of 4000 psi at a temperature of 190 ° f . | 2 |
fig1 shows an objective arrangement that consists of a central lens unit lz , in which it may be a case of a usual viewing object of a microscope . in a housing h , outside the lens unit lz , light guides lf are provided in which parallel illumination beams ls 1 , ls 2 run in the direction of the sample , at first parallel to the optical axis a of viewing in lz . the illumination beams ls 1 , ls 2 arrive at the reflectors r 1 , r 2 , mounted on housing h , which can be imaging mirrors with small aperture , and focus the illumination beams in a direction perpendicular to the optical viewing axis in a point p of the optical axis of the objective lz . as shown in fig1 a , r 1 , r 2 can also be flat reflecting mirrors and then display elements with small aperture can be provided in the light guides lf , whereby r 1 , r 2 are used only for deflection in the direction of the sample and the focus in the sample will be generated by the imaging elements . because of the small aperture , the waist of the illumination runs almost parallel in the area of the sample and generates , in the sample , a thin illumination line that is imaged in objective pupil p 3 . objective pupil p 3 , objective lz and the sample focus p are located here in a 2f arrangement , i . e . in each case at a distance from each other that equals the simple focal length f , so that the distance between the objective pupil p 3 and the sample focus p is 2f ( represented in fig1 as “ f ”). because of this , the objective can be used for telecentric scanning , for example of an illumination line in the sample . in fig2 a , which applies to the objective pupil p 3 , a light source lq is mounted below a beam splitter t that creates two parallel partial beams ls 1 , ls 2 that are reflected over a beam splitter mdb and are transferred over a scanner p 2 for movement of the illumination beams over the sample in one direction , scanning optics so and a tube lens tl for transfer of an intermediate image zb onto the objective pupil p 2 . the beam splitter mdb lies in the conjugate plane of the objective pupil , this beam splitter having on its edge opposite circular reflecting partial sections ( fig2 b ). advantageously , the attachment of the objective according to the lens takes place over the pupil p 3 to the beam of a line scanner , which has an appropriately designed beam splitter , as already described in de10257237 a 21 , and the transmitting or reflecting surfaces of which can be used . the illumination line described here is moved through the sample by way of the scanner p 2 ( in the pupil p 3 ) of the line scanner . the viewing beam is dotted , the illumination beam is a solid line . the image of the sample in the intermediate image zb is descanned by way of a tube lens , scanning optics and scanner and is imaged onto a slot shutter sb ( optional here ) in front of a line detector de , through the surface of the beam splitter mdb necessary for the sample irradiation ( except for the circular reflecting points ) by means of pinhole optics po . fig3 a shows the cross section of the objective pupil on the mdb with the illumination channels bk and the effective area fb for the viewing . fig3 b shows the illuminated line l in the object plane , on which focusing is carried out with the objective and by means of which the detection is recorded . the thickness of the line is adjusted , in that the effective numerical aperture of the lateral optics that is focused with variation along the beam direction in the sample . if this na is decreased , the line width increases accordingly . the manipulation of the numerical aperture can also be e . g . by a variable ring shutter in the pupil that is not shown , arranged around the illumination channel . by moving the scanner p 2 perpendicular to the longitudinal direction ( x axis ), the line is moved perpendicular in y direction on the sample . fig4 a shows the arrangement for wide field illumination . in this case a splitter can be used for illumination of the sample from two irradiation directions . fig4 b shows the plane of the objective pupil on the beam splitter mdb with wide field illumination . this advantageously has two line - shaped transmitting areas b 1 , b 2 that are opposite each other on the outer edge , each of which transfers a line - shaped area of the illumination ( dotted line ) in the direction of the outer area of the objective . these areas are imaged with the reflectors in the direction of the sample with small aperture and form a quasi - parallel surface light area of small thickness through the sample . the adjustment of the thickness is carried out , in turn , by a shutter in the pupil , which is not shown , that contracts the pupil of the illumination channel along the x axis at the location of the pupil . the objective according to the invention is advantageously connected by way of a pupil p 3 as in fig2 a to the beam of a line scanner . the illumination is focused in the y direction by a cylinder lens . optionally a splitter t ( e . g . double - refractive medium ) can be located in the illumination beam to generate 2 partial beams . fig4 c shows the scanned light area in the sample plane ( focal plane of the objective ). the sample light ( in dotted lines ) goes over the beam splitter mdb ( reflecting ) in the direction of an area detector de . a powell aspherical can optionally be used in front of the cylinder optics zl 1 in fig4 a for homogenizing the illumination along the y - axis . the invention described represents an important expansion of the application possibilities of fast confocal laser scanning microscopes . the importance of such a further development can be understood from reading the standard cell biology literature and the fast cellular and subcellular processes described there and the testing methods used there with a large number of dyes . b . alberts et al . ( 2002 ): molecular biology of the cell ; garland science . g . karp ( 2002 ): cell and molecular biology : concepts and experiments ; wiley text books . r . yuste et al . ( 2000 ): imaging neurons — a laboratory manual ; cold spring harbor laboratory press , new york . r . p . haugland ( 2003 ): handbook of fluorescent probes and research products , 10th edition ; molecular probes inc . and molecular probes europe bv . the invention has especially great importance for the following processes and procedures : the invention described is suitable , among other things , for the examination of development processes , which are mainly characterized by dynamic process in the range of tenths of a second to hours . example applications on the level of symplasts and complete organisms are described here as an example : abdul - karim , m . a . et al . describe , in 2003 in microvasc . res ., 66 : 113 - 125 , a long - term analysis of blood vessel changes in the living animal , wherein fluorescence images were recorded at intervals over several days . the 3d data records were evaluated with adaptive algorithms in order to schematically represent movement trajectories . soll , d . r . et al . describe , in 2003 in scientific world journ . 3 : 827 - 841 , a software - based movement analysis of microscopic data of nuclei and pseudopods of living cells in all 3 spatial dimensions . grossmann , r . et al . describe , in 2002 in glia , 37 : 229 - 240 a 3d analysis of the movements of rat microglial cells , whereby the data were recorded over up to 10 hours . at the same time , there were also fast reactions of the glia after traumatic , so that a high data rate and corresponding data volume occurred . analysis of living cells in 3d environment , whose adjacent cells react sensitively to laser illumination and have to be protected from the illumination of the 3d - roi ; analysis of living cells in 3d environment with labels , that will be selectively bleached by laser light in 3d , e . g . fret experiments ; analysis of living cells in 3d environment with labels , that will be selectively bleached by laser light in 3d and simultaneously will also be observed outside the roi , e . g . frap and flip experiments ; selective analysis of living cells in 3d environment with labels and pharmaceuticals that exhibit manipulation - related changes due to laser illumination , e . g . activation of transmitters in 3d ; selective analysis of living cells in 3d environment with labels that exhibit manipulation - related color changes due to laser illumination , e . g . pagfp , kaede ; selective analysis of living cells in 3d environment with very weak labels that e . g . require an optimum balance of confocality and detection sensitivity . living cells in a 3d tissue structure with varying multiple labels , e . g . cfp , gfp , yfp , dsred , hcred , etc . living cells in a 3d tissue structure with labels , that have color changes depending on function , e . g . ca +- marker living cells in a 3d tissue structure with labels , that have color changes due to development , e . g . transgenic animals with gfp living cells in a 3d tissue structure with labels , that have manipulation - related color changes due to laser illumination , e . g . pagfp , kaede living cells in a 3d tissue structure with very weak labels that require a restriction of the confocality in favor of the detection sensitivity . the latter - named point in combination with the preceding . | 6 |
an automated device for measuring mechanical properties of a material ( such as elastic stiffness and mechanical strength ) at a controlled location on the surface of a sample may be better understood with reference to fig1 a and fig1 b . fig1 a shows the functional elements of the device in schematic form . a positioning system 12 may move the measurement components to a selected position in the x , y ( horizontal ) plane of the device , e . g ., slip rod 20 , with mass 22 and instrumented probe tip 24 attached at a lower end thereof . the slip rod 20 may be slideably disposed within a linear bearing 18 , and have a pincher or jaws ( not shown in fig1 a ) to selectively release the slip rod to be accelerated by gravity into a material sample 26 . the slip rod 20 , linear bearing 18 , and a support rod 16 may be functionally coupled to a lift cylinder 14 . the lift cylinder 14 may be raised to lift a frame ( 14 a in fig3 a ) and lowered when the frame and probe tip 24 are in the correct position for making a measurement . the jaws ( not shown in fig1 ) may hold the slip rod 20 in place for subsequent release so that the probe tip 24 accelerates toward the sample . fig1 b shows the system pictorially . fig2 shows an oblique view of the system including the x - y positioning system 12 with associated position sensors 12 a , 12 b mounted in a frame 10 . the position sensors may be any type known in the art including proximity sensors , linear variable differential transformers or rotary encoders . the frame 10 may be configured to hold any selected number of samples 26 of material to be examined . the measurement portion of the system is shown in more detail in fig3 a . a grip arm 17 and pneumatic jaws 19 may lift and hold the slip rod ( 20 in fig1 ) in position until it is time to drop the slip rod ( 20 in fig1 ). the foregoing components as well as the lift cylinder 14 may be disposed in a frame 14 a . the frame 14 a may include a rubber bumper or disc 14 b on a bottom thereof to hold the sample from moving during the measurement and avoid damaging samples as the frame 14 a is lowered into position for an impact experiment . fig3 b shows an example probe tip 24 coupled to the slip rod 20 . the probe tip 24 may include an accelerometer and a force measuring gauge such as a resistance - type strain gauge . an example sensing device that may be used in some embodiments is known commercially as an “ impedance head .” a non limiting example of impedance head is sold commercially under model number 5860b by dytran instruments , inc . 21592 marilla street , chatsworth , calif . 91311 . signals from the x - y position sensors ( 12 a , 12 b in fig2 ) and the probe tip 24 sensors may be recorded by a processor ( 21 in fig1 ) for analysis as will be explained below . the processor may also control movement of the x - y positioning system , which may use as motive force motors with friction wheels , motors with worm gears , hydraulic cylinders or any other device known in the art for imparting precisely controllable movement within the two directions in a plane . by making multiple measurements at various locations , the spatial variation in stiffness and mechanical properties can be quantified . this information can be used to predict the mechanical properties of the material when subjected to different boundary conditions , such as the prediction of the material behavior at a larger scale ( e . g . the borehole scale ) and / or the prediction of the material behavior when subjected to different stress conditions . the same information can also be used to classify mechanical subtypes within a sample , used either alone or in conjunction with other measurement devices mounted to the same platform . some elements of the example device according to the present disclosure may include : ( a ) the capability to measure the force - time function of the impact of the probe tip with a sample of material to be tested . the force - time function of the impact can be analyzed in the context of a physical model to determine the mechanical properties of the material , such as its elastic stiffness . an example measurement and its interpretation in the context of elastic impact is shown in fig4 ; ( b ) the ability to measure the acceleration of the measurement device to provide a trigger signal for data acquisition and / or to provide more information concerning the physical details of the impact ; ( c ) the ability to automate the measurements , either repeatedly at a single location , or sequentially at multiple locations ; ( d ) the ability to firmly hold the sample onto the table , thus keeping the sample from moving when the measurement is made ; and ( e ) the ability to precisely locate the device on the sample so that measurements can be made : at a particular location , repeatedly at the same spot , and / or repeatedly at the same spot after changing adjustable parameters of the device such as the tip geometry , the velocity of the impact , or the mass used for the measurement and repeatedly in a pattern such as a linear profile or a grid in order to quantify spatial variations . in mechanical properties of the material being tested . the device may also have the capability to change the tip that impacts the sample in order to change the physical parameters of the measurement . in some uses of the device , measurements may be made on the same material at the same or similar position using different tips ( 24 in fig1 ) each with a different geometry or physical properties . as an example , by comparing the results of the measurements using multiple tips each with different geometries and / or different selected physical properties , additional information about the mechanical properties of the material can be determined than can be determined using only one tip . in one example , the tip may be made from hardened stainless steel . in another example , the tip may be made from tungsten carbide . the foregoing are only example and are not intended to limit the scope of materials that may be used for the tip . in one use of the device , measurements may be made using tips each having a different curvature and the results may be used to determine if the response of the material is consistent with the modeled elastic impact . if the results are consistent with predictions of elastic impact , it can be concluded that the mechanical strength of the material has not been exceeded and that the elastic stiffness of the material can be determined from the results . if the results are inconsistent with elastic property predictions , it can be concluded that damage has occurred as a result of the measurement , and thus the mechanical strength or elastic yield point of the material has been exceeded . each of these observations may be used alone to place constraints on the mechanical strength of the material . both of these observations made in combination may be used to further constrain the mechanical properties of the material , including its elastic stiffness and / or placing limits on its strength . the device may also have the capability to change other attributes of the measurement , such as the velocity of the impact ( e . g ., by setting the drop height ) and / or the mass of the impacting device , and / or as explained above the material properties of the impact tip . the observed changes in response of the material sample to the changes in mass or velocity used in the measurement can be used to better determine the properties of the material in the same or similar way to the observed changes due to changes in tip geometry as described above ( e . g . to check for consistency and / or breakdown with the predictions of the response predicted by elastic theory ). in one version of the invention , the velocity of impact is controlled by controlling the height from which the sensor head is dropped . the device measurement may provide the ability to characterize the strength of a material and / or the relative strengths of two different materials . fig4 shows a graph of the measured force time function , at curve 40 of an impact on polyetherimide ( pei ) plastic using the device , compared with a fit to a model at curve 42 . because the modeled force time function curve and measured force time function curve show good agreement , the elastic stiffness e * can be directly related to the elastic stiffness of the sample . fig5 shows graphs of an example of the use of two measurements made on the same material ( pei ) using different tip geometry for each test . a initial measurement , curve 50 was made using a tip radius of 3 . 81 mm and the data was fit to a model , curve 52 , that resulted in a prediction of the mechanical stiffness of the sample . the predicted stiffness of the material was used to predict the response to an impact using a tip of a different geometry , at curve 54 . a measurement was made using that different geometry , shown at curve 56 . the agreement between the prediction and the measured value are used to confirm that the material is responding elastically and thus the material strength has not been exceeded . fig6 shows an example of the use of the device to make two measurements on the same material ( pei ) using different tip geometry . a initial measurement was made using a tip radius of 3 . 81 mm , at curve 60 , and the data was fit to a model at curve 62 that resulted in a prediction of the mechanical stiffness of the sample . the predicted stiffness of the material was used to predict the response to an impact at curve 64 using a tip of a different geometry , in this case for a tip with smaller radius . a measurement was made using that different geometry as shown at curve 66 . the lack of agreement between the prediction at 64 and the measured value of the force time curve at 66 were used to confirm that the material is responding inelastically to the impact by the tip of smaller radius and thus the material strength has been exceeded . for cases where damage occurs , the force above which the measured data deviates from the predicted value can be related to the strength of the material . fig7 a and 7b show , respectively , examples of measurements on two different materials using the same measurement parameters . the predictions of the elastic response for the two materials based on the known material properties of those materials is shown for comparison . in fig7 a the impact on the pei plastic as measured at curve 72 may be observed to fit elastic theory , as shown at curve 70 and no visual evidence of damage is observed , providing a lower limit constraint on its strength . in fig7 b , the force time function , impact curve 76 , on a porous ceramic sample deviates from modeled elastic response at curve 74 indicating that damage occurs during impact . clear visual evidence of damage to the porous ceramic sample was observed . for cases where damage occurs , the force above which the measured data deviates from the predicted value can be related to the strength of the material . the comparison of the two different responses may provide a comparison of mechanical properties of the two materials . example implementations of the device may include the ability to record , store , plot , present , and analyze the results as they are collected so that the measurements can be interpreted immediately or stored by a recording device for analysis at a later time . some example uses of the device may also include making measurements on core plug samples , thus providing information on the stiffness and / or strength of the cores without damaging the cores . in another example use of the device , the samples are rock cores of irregular geometry , such as a slabbed core sample , and the measurements are made as a function of position on the slabbed surface of the sample to quantify the variation in mechanical properties as a function of position such as depth from within the earth . in another example use of the device , the force time measurements may be combined with measurements from other measurement probes to discover and quantify relationships between different properties and / or to provide the basis for a classification of physical subtypes within the sample . as one non - limiting example , the results from force time measurements made at selected distances ( e . g ., every 2 mm ) along the length of a formation core sample may be analyzed along with other physical property measurements such as ftir ( fourier transform infrared spectroscopy ) spectral reflection data and acoustic velocity data . the combined measurements may be used to identify section of the core sample that are physically similar , and to relate mechanical properties to those sections . this type of information can be used to constrain physical models of the sub - surface , such as for the engineering of hydrocarbon reservoirs . referring to fig8 , the foregoing process as explained with reference to fig1 - 7a and 7b , can be embodied in computer - readable code . the code can be stored on a non - transitory computer readable medium , such as solid state memory card 164 , cd - rom 162 or a magnetic ( or other type ) hard drive 166 forming part of a general purpose programmable computer . the computer , may be in signal communication with the processor ( 21 in fig1 b ) to process acquired and recorded signals from the probe tip and the x - y positioning system sensors ( 12 a , 12 b in fig2 ). the computer , as known in the art , may include a central processing unit 150 , a user input device such as a keyboard 154 and a user display 152 such as a flat panel lcd display or cathode ray tube display . according to this aspect of the disclosure , the computer readable medium includes logic operable to cause the computer to execute acts as set forth above and explained with respect to the previous figures . the computer or parts thereof may be in the processor ( 21 in fig1 b or may be any other computer . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . accordingly , the scope of the invention should be limited only by the attached claims . | 6 |
turning now to more details on the system 1 , as shown in fig1 , a patient &# 39 ; s mouth and dentition 10 is illustrated showing one possible location for removably attaching two - way communication assembly 14 upon or against at least one tooth , such as a molar 12 . the patient &# 39 ; s tongue tg and palate pl are also illustrated for reference . an electronics and / or transducer assembly 16 may be attached , adhered , or otherwise embedded into or upon the assembly 14 , as described below in further detail . the two way communication assembly 14 can have a microphone array with paired microphones 15 a and 15 b to pick up sound . the microphones 15 a and 15 b can be mounted on the oral appliance , on the rear molars or alternatively on the lingual side of the front teeth . in other embodiments , the microphones 15 a and 15 b can be intraoral microphones or extraoral microphones . in one embodiment , the microphones can be mounted on an oral appliance , on the rear molars or alternatively on the lingual side of the front teeth . in fig1 , microphones 15 a - 15 b are mounted on the buccal surface of an appliance such as a retainer and the microphones 15 a - 15 b point toward the wearer &# 39 ; s cheek . these microphones pick up the wearer &# 39 ; s own sound . in this configuration the wearer &# 39 ; s sound is picked from outside of oral cavity . also shown in fig1 are alternate microphone pairs 15 c - 15 d positioned near the front of the wearer &# 39 ; s mouth . similar to microphones 15 a - 15 b , microphones 15 c - 15 d face the wearer &# 39 ; s cheek . the intra oral microphones 15 c - 15 d are also installed on the buccal surface of teeth touching the surface of cheeks to pick sounds conducted by the wearer &# 39 ; s head including the wearer &# 39 ; s own voice . the microphone cancels environmental noise and transmits a user &# 39 ; s voice to a remote user , station or building . this embodiment provides the ability to cancel environmental noises while transmitting subject &# 39 ; s own voice to the remote station such as another user or a call center . as the microphone is in a fixed location ( compared to ordinary wireless communication devices ) and very close to user &# 39 ; s own voice , the system can handle environmental noise reduction that is important in working in high noise areas . as such , the two way communication device can be used by workers in loud environments such as a professional entertainer or athlete and / or support personnel , a soldier , a medic , a fireman , an emergency worker , among others . in one embodiment , the mouth wearable communication assembly 14 has a housing having a shape which is conformable to at least a portion of at least one tooth ; an actuatable transducer disposed within or upon the housing and in vibratory communication with a surface of the at least one tooth ; and a wireless communication transceiver coupled to the transducer to provide received sound to the user and to provide communication for the user . the two way communication device can be an oral appliance having a shape which conforms to the at least one tooth . an electronic assembly can be disposed within or upon the housing and which is in communication with the transducer . in one embodiment , the microphones 15 a and 15 b face outwardly away from the mouth to focus on the sound coming out of the mouth only and the microphone pair would cancel any sounds not directly in front of the mouth . this embodiment would be used as a communication device for picking up the user &# 39 ; s voice . in one embodiment , the microphone pair can include a cardioid - type directional microphone and an omni - directional microphone combined in an acoustically coupled way . the two microphones , together with an adaptive control circuit , produce a very narrow 3 - dimensional beam for acquiring the desired speech signal . in addition to microphones , accelerometers or other devices applicable for detecting sound waves can be used . in another embodiment , the microphones 15 a and 15 b face in opposite directions with one facing inwardly toward the mouth and the other facing outwardly away from the mouth . in another embodiment , the microphones 15 a and 15 b face in opposite directions with one facing inwardly toward the mouth and the other facing outwardly away from the mouth . in one embodiment , the paired microphones 15 a - 15 b detect ambient noise in a first sound waveform , and convert the waveform to electrical signals . an onboard processor processes the recorded signal so that it is exactly out of phase with the ambient noise detected by the microphones 15 a - 15 b , thus canceling ambient noise and leaving only the user &# 39 ; s speech . in one duo - microphone embodiment , both microphones can be positioned near the front of the user &# 39 ; s mouth to pick - up the user &# 39 ; s voice as the primary desired signal as well as external noise as a secondary signal . since the speech is very close to the microphone pair , the speech signal picked up by the microphones can be separated using clustering techniques into a strong signal ( speech ) and a distant , weak signal ( noise ) pair . the weak signal can be discarded and only the strong signal is used as the speech signal . in another duo - microphone embodiment , one microphone can be pointed toward the throat to pick - up the user &# 39 ; s voice as the desired source , and another microphone can be pointed away from the mouth to pick up external noise source . the signal picked up by the microphone pointed toward the throat can be used to adaptively cancel the noise signal from the signal picked up by the microphone pointed away from the mouth . other noise cancellation arrangements can be used . for example , in a single microphone embodiment , one microphone is used to pick up the desired speech signal with noise . the noise spectrum is estimated and subtracted from the speech signal ( containing the noise ) picked up by the microphone . in this way , the desired speech signal is separated from the noise . a further embodiment uses more than two microphones . this embodiment uses a spatial and temporal filtering method to enhance the desired speech signal from a specific direction and over an interested frequency band , and suppress signals from other directions . the desired signal obtained with this system has a high signal to noise ( snr ) ratio . alternatively , two microphones can be used to form a first - order microphone system for noise cancellation . this microphone system uses the differential property of sound field to form a fixed beam pattern in front of the user &# 39 ; s mouth . in one embodiment , the system of fig1 provides an electronic and transducer device that can be attached , adhered , or otherwise embedded into or upon a removable oral appliance or other oral device to form a two - way communication assembly . the communication assembly 14 can be used by emergency and security personnel , medical personnel , municipal workers , industrial plant workers , individuals in loud environments that require communications ( musicians , athletes and their support personnel ), and the military , among others . in another embodiment , the device of fig1 provides an electronic and transducer device that can be attached , adhered , or otherwise embedded into or upon a removable oral appliance or other oral device to form a medical tag containing patient identifiable information . such an oral appliance may be a custom - made device fabricated from a thermal forming process utilizing a replicate model of a dental structure obtained by conventional dental impression methods . the electronic and transducer assembly may receive incoming sounds either directly or through a receiver to process and amplify the signals and transmit the processed sounds via a vibrating transducer element coupled to a retainer , an appliance , a tooth or other bone structure , such as the maxillary , mandibular , or palatine bone structure . in one embodiment , the retainer can be fitted over the tooth to provide sound transmission to the bone . for example , the device can include sensors that detect chemicals present in the user &# 39 ; s saliva and provide medical information on the user . the device can also sense heart rate , ekg , and other bio - signals that can be picked up within the mouth . additionally , the device 1 can communicate with a medical data collection module that can collect vital signs such as temperature , heart rate , ekg , respiration rate , and other vital signs or medical information . an exemplary process to collect medical information from the user ( such as fire fighting personnel ) and for supporting bone - conduction two way communication can be as follows : periodically collect vital sign and other medical information check to see if the user is using the long range transceiver for talking if long range transceiver is not used for talking , upload medical history of the user to a remote computer over the long range transceiver remote computer detects if the medical data falls outside of an acceptable range that requires medical intervention alarm sound is generated to the user alerting him / her that there is a potential problem and that he / she should contact command post if medical intervention is required , the remote computer alerts the user &# 39 ; s commander for action to assist the user self - help instructions can be sent through the transceiver to the bone conduction communication device fig2 a shows a perspective view of the patient &# 39 ; s lower dentition illustrating the hearing aid assembly 14 comprising a removable oral appliance 18 and the electronics and / or transducer assembly 16 positioned along a side surface of the assembly 14 . in this variation , oral appliance 18 may be fitted upon two molars 12 within tooth engaging channel 20 defined by oral appliance 18 for stability upon the patient &# 39 ; s teeth , although in other variations , a single molar or tooth may be utilized . alternatively , more than two molars may be utilized for the oral appliance 18 to be attached upon or over . moreover , electronics and / or transducer assembly 16 is shown positioned upon a side surface of oral appliance 18 such that the assembly 16 is aligned along a buccal surface of the tooth 12 ; however , other surfaces such as the lingual surface of the tooth 12 and other positions may also be utilized . the figures are illustrative of variations and are not intended to be limiting ; accordingly , other configurations and shapes for oral appliance 18 are intended to be included herein . fig2 b shows another variation of a removable oral appliance in the form of an appliance 15 which is placed over an entire row of teeth in the manner of a mouthguard . in this variation , appliance 15 may be configured to cover an entire bottom row of teeth or alternatively an entire upper row of teeth . in additional variations , rather than covering the entire rows of teeth , a majority of the row of teeth may be instead be covered by appliance 15 . assembly 16 may be positioned along one or more portions of the oral appliance 15 . fig2 c shows yet another variation of an oral appliance 17 having an arched configuration . in this appliance , one or more tooth retaining portions 21 , 23 , which in this variation may be placed along the upper row of teeth , may be supported by an arch 19 which may lie adjacent or along the palate of the user . as shown , electronics and / or transducer assembly 16 may be positioned along one or more portions of the tooth retaining portions 21 , 23 . moreover , although the variation shown illustrates an arch 19 which may cover only a portion of the palate of the user , other variations may be configured to have an arch which covers the entire palate of the user . fig2 d illustrates yet another variation of an oral appliance in the form of a mouthguard or retainer 25 which may be inserted and removed easily from the user &# 39 ; s mouth . such a mouthguard or retainer 25 may be used in sports where conventional mouthguards are worn ; however , mouthguard or retainer 25 having assembly 16 integrated therein may be utilized by persons , hearing impaired or otherwise , who may simply hold the mouthguard or retainer 25 via grooves or channels 26 between their teeth for receiving instructions remotely and communicating over a distance . generally , the volume of electronics and / or transducer assembly 16 may be minimized so as to be unobtrusive and as comfortable to the user when placed in the mouth . although the size may be varied , a volume of assembly 16 may be less than 800 cubic millimeters . this volume is , of course , illustrative and not limiting as size and volume of assembly 16 and may be varied accordingly between different users . in one variation , with assembly 14 positioned upon the teeth , as shown in fig3 , an extra - buccal transmitter assembly 22 located outside the patient &# 39 ; s mouth may be utilized to receive auditory signals for processing and transmission via a wireless signal 24 to the electronics and / or transducer assembly 16 positioned within the patient &# 39 ; s mouth , which may then process and transmit the processed auditory signals via vibratory conductance to the underlying tooth and consequently to the patient &# 39 ; s inner ear . the transmitter assembly 22 , as described in further detail below , may contain a microphone assembly as well as a transmitter assembly and may be configured in any number of shapes and forms worn by the user , such as a watch , necklace , lapel , phone , belt - mounted device , etc . fig4 illustrates a schematic representation of one variation of communication device such as a hearing aid assembly 14 utilizing an extra - buccal transmitter assembly 22 , which may generally comprise microphone 30 for receiving sounds and which is electrically connected to processor 32 for processing the auditory signals . processor 32 may be connected electrically to transmitter 34 for transmitting the processed signals to the electronics and / or transducer assembly 16 disposed upon or adjacent to the user &# 39 ; s teeth . the microphone 30 and processor 32 may be configured to detect and process auditory signals in any practicable range , but may be configured in one variation to detect auditory signals ranging from , e . g ., 250 hertz to 20 , 000 hertz . with respect to microphone 30 , a variety of various microphone systems may be utilized . for instance , microphone 30 may be a digital , analog , and / or directional type microphone . such various types of microphones may be interchangeably configured to be utilized with the assembly , if so desired . power supply 36 may be connected to each of the components in transmitter assembly 22 to provide power thereto . the transmitter signals 24 may be in any wireless form utilizing , e . g ., radio frequency , ultrasound , microwave , blue tooth ® ( bluetooth sig , inc ., bellevue , wash . ), etc . for transmission to assembly 16 . assembly 22 may also optionally include one or more input controls 28 that a user may manipulate to adjust various acoustic parameters of the electronics and / or transducer assembly 16 , such as acoustic focusing , volume control , filtration , muting , frequency optimization , sound adjustments , and tone adjustments , etc . the signals transmitted 24 by transmitter 34 may be received by electronics and / or transducer assembly 16 via receiver 38 , which may be connected to an internal processor for additional processing of the received signals . the received signals may be communicated to transducer 40 , which may vibrate correspondingly against a surface of the tooth to conduct the vibratory signals through the tooth and bone and subsequently to the middle ear to facilitate hearing of the user . transducer 40 may be configured as any number of different vibratory mechanisms . for instance , in one variation , transducer 40 may be an electromagnetically actuated transducer . in other variations , transducer 40 may be in the form of a piezoelectric crystal having a range of vibratory frequencies , e . g ., between 250 to 20 , 000 hz . power supply 42 may also be included with assembly 16 to provide power to the receiver , transducer , and / or processor , if also included . although power supply 42 may be a simple battery , replaceable or permanent , other variations may include a power supply 42 which is charged by inductance via an external charger . additionally , power supply 42 may alternatively be charged via direct coupling to an alternating current ( ac ) or direct current ( dc ) source . other variations may include a power supply 42 which is charged via a mechanical mechanism , such as an internal pendulum or slidable electrical inductance charger as known in the art , which is actuated via , e . g ., motions of the jaw and / or movement for translating the mechanical motion into stored electrical energy for charging power supply 42 . in another variation of assembly 16 , rather than utilizing an extra - buccal transmitter , hearing aid assembly 50 may be configured as an independent assembly contained entirely within the user &# 39 ; s mouth , as shown in fig5 . accordingly , assembly 50 may include an internal microphone 52 in communication with an on - board processor 54 . internal microphone 52 may comprise any number of different types of microphones , as described above . processor 54 may be used to process any received auditory signals for filtering and / or amplifying the signals and transmitting them to transducer 56 , which is in vibratory contact against the tooth surface . power supply 58 , as described above , may also be included within assembly 50 for providing power to each of the components of assembly 50 as necessary . the removable oral appliance 18 may be fabricated from various polymeric or a combination of polymeric and metallic materials using any variety of methods . for instance , in one variation of fabricating an oral appliance , a three - dimensional digital scanner may be used to image the dentition of the patient , particularly the tooth or teeth th upon or about which the oral appliance is to be positioned . the scanned image may be processed via a computer to create a three - dimensional virtual or digital model 60 of the tooth or teeth th , as shown in fig6 a and 6b . various three - dimensional scanning modalities may be utilized to create the three - dimensional digital model 60 . for instance , intra - oral cameras or scanners using , e . g ., laser , white light , ultrasound , mechanical three - dimensional touch scanners , magnetic resonance imaging ( mri ), computed tomography ( ct ), other optical methods , etc ., may be utilized . once the three - dimensional image has been captured , the image may then be manipulated via conventional software to create a direct three - dimensional print of the model . alternatively , the image may be used to directly machine the model . systems such as computer numerical control ( cnc ) systems or three - dimensional printing processes , e . g ., stereolithography apparatus ( sla ), selective laser sintering ( sls ), and / or other similar processes utilizing three - dimensional geometry of the patient &# 39 ; s dentition may be utilized . in another alternative , a mold may be generated from the print to then allow for thermal forming of the appliance directly upon the created mold . and yet in other variations , the three - dimensional image may be used to create an injection mold for creating the appliance . each of these processes are described in further detail below . once the scanned image has been processed to create a three - dimensional virtual or digital model 60 of the tooth or teeth th , the housing 62 for the electronics / transducer assembly may be digitally imposed or created in the digital model 60 . alternatively , a physical model of the housing may be positioned upon the appropriate tooth or teeth th and the dentition with the housing may be scanned to create the digital model 60 . in either case , the resulting digital model 60 may be utilized to create a three - dimensional virtual or digital model of the appliance 64 having the housing 62 integrated therewith , as shown in the partial cross - sectional view in fig6 c . the digital model of the appliance 64 may then be used to print or create the physical oral appliance 66 , as shown in fig6 d . accordingly , an oral appliance 66 which conforms to the patient &# 39 ; s dentition may be formed to ensure secure contact upon or against the dentition while maintaining comfort to the user . in another alternative method , once the three - dimensional model of the appliance 64 has been created , as shown in fig7 a to 7c , oral appliance 68 may be machined directly , e . g ., utilizing computer numerical control machining , from polymeric materials to create the appliance 68 , as shown in fig7 d . in yet another alternative , once the appropriate tooth or teeth th has been three - dimensionally scanned and the housing 62 has been included , as shown in fig8 a and 8b , a physical model of the dentition 70 may be created utilizing any of the processes above , such as three - dimensional printing , machining , etc , as shown in fig8 c . with the model of the dentition 70 , oral appliance 72 may be thermal formed or otherwise molded about dentition 70 to create oral appliance which conforms securely and comfortably to the patient &# 39 ; s dentition , as shown in fig8 d . another alternative is illustrated where once the three - dimensional virtual or digital model 60 has been created from the patient &# 39 ; s dentition , as shown in fig9 a and 9b , an forming mold 74 may be fabricated having an outer mold portion 76 and an inner mold portion 78 which forms a cavity or void 80 therebetween , as shown in fig9 c . the cavity or void 80 may be entirely filled with a settable polymer which when cured forms oral appliance 82 , as shown in fig9 d , which may be removed from the mold portions 76 , 78 to form appliance 82 which conforms securely and comfortably to the patient &# 39 ; s dentition . as mentioned above , although the housing for the electronics and / or transducer assembly may be digitally created on the three - dimensional digital model generated from the patient &# 39 ; s scanned dentition , a housing replica 84 may alternatively be adhered temporarily to a patient &# 39 ; s tooth or teeth th prior to scanning the dentition , as shown in fig1 a and 10b . in this manner , the three - dimensional scanner may create the digital image having the housing replica 84 already included . aside from digital imaging and scanning of a patient &# 39 ; s dentition , an alternative mechanism for creating a conformable oral appliance may utilize impression molding of the appropriate dentition . one example is shown in fig1 a and 11b where an impression 92 of a patient &# 39 ; s dentition may be formed by utilizing a mold 90 filled with a suitable impression material , e . g ., alginate , plaster , polyvinylsiloxane , polyurethane , polyacrylate , ethylene vinyl acetate , and blends or combinations thereof , etc . an impression of the dentition may also be formed after a replica of housing mold 84 has been affixed temporarily to the tooth or teeth th , as shown in fig1 a , prior to forming an impression 94 having the housing formed therein , as shown in fig1 b . in either case , once the impression 92 , 94 has been formed , the mold 90 may be filled with a plaster to create a permanent , three - dimensional mold or model of the appropriate dentition , which may then be used to thermally form an oral appliance or which may be scanned digitally to utilize any of the forming or machining processes , as described above . alternatively , the impression 92 , 94 itself may be scanned to render a three - dimensional model of the appropriate dentition and / or housing for processing , also as above . as illustrated in fig1 c to 11f , mold 90 having impression 92 formed therein may be used to form the three - dimensional mold or model 95 , as mentioned above and as shown in fig1 d . in the case of mold or model 95 , an electronics and / or transducer housing 97 may be attached or adhered to the mold or model 95 , as shown in fig1 e , and the oral appliance 98 may then be thermal formed directly thereupon resulting in the oral appliance 98 appropriately formed having a housing , as shown in fig1 f . likewise , if mold 90 has an impression 94 already having a housing formed therein , as shown in fig1 c , a mold or model 99 may be formed , e . g ., from plaster , resulting in a three - dimensional mold or model 99 , as shown in fig1 d . the oral appliance 98 may then be thermal formed directly over the mold or model 99 , to result in the appliance 98 of fig1 e . in the case of utilizing the mold 90 to create a physical mold or model , the resulting mold or model may alternatively be scanned to create a digital image of the dentition , as described above , rather than thermal forming directly upon the mold or model . in another variation , the mold 90 having an impression 92 formed therein may have an electronics and / or transducer assembly 96 impressed into the mold 90 , as shown in fig1 a and 13b . with the assembly 96 desirably positioned , the mold material may be cured or otherwise activated to harden , after which oral appliance 98 may be machined or formed therefrom resulting in an appliance 98 which conforms with the user &# 39 ; s dentition , as shown in fig1 c . likewise , once an impression 94 has been formed with the housing mold included , as shown in fig1 a , electronics and / or transducer assembly 96 may be positioned within the appropriate mold location , as shown in fig1 b , and the mold 90 may be cured or otherwise activated to harden . from this hardened mold 90 , oral appliance 98 may likewise be formed via machining or forming while having the assembly 96 contained therein , as shown in fig1 c . in yet another variation for forming or fabricating a conforming oral appliance , a dental tray 100 having a channel 102 for the user &# 39 ; s dentition may be provided having an electronics and / or transducer housing 104 pre - formed along a lingual or buccal orientation of the dental tray 100 . the example of fig1 a illustrates a full dental tray 100 having housing 104 located along a buccal surface of the tray 100 , although partial trays may alternatively be utilized and other locations for housing 104 may also be implemented . an electronics and / or transducer assembly 106 may be pre - positioned within housing 104 while held via one or more temporary spacers 108 , as shown in the partial cross - sectional view of fig1 b . to form the oral appliance , tray 100 may be filled with any of the settable or curable materials 112 described above or may comprise a moisture - activated hydrogel utilizing , e . g ., a dispenser 110 , until the materials 112 fill any spaces or voids around assembly 106 to encapsulate assembly 106 . the user may then place the tray 100 upon the appropriate portion of the dentition until the tooth or teeth th is positioned sufficiently within tray 100 , as shown in fig1 c . the tray 100 may be maintained upon the tooth or teeth th until the material 112 has set and hardened . the tray 100 with the conforming impression may then be removed from the patient &# 39 ; s mouth and the resulting oral appliance 114 and assembly 106 may be removed from tray 100 and trimmed or machined as appropriate , as shown in fig1 d . alternatively , oral appliance 114 may be formed about the patient &# 39 ; s dentition without assembly 106 , which may be integrated , attached , or otherwise affixed , e . g ., via adhesives , after oral appliance 114 has been formed . in yet another alternative , tray 100 may comprise a preformed tray made from , e . g ., ethylene vinyl acetate or polyethylene material , which may be heated or boiled to activate the tray 100 . once activated , the user may bite into tray 100 to at least partially mold or conform tray 100 to the user &# 39 ; s dentition . assembly 106 may be included or integrated after the tray 100 has been conformed . the applications of the devices and methods discussed above are not limited to the treatment of hearing loss but may include any number of further treatment applications . moreover , such devices and methods may be applied to other treatment sites within the body . modification of the above - described assemblies and methods for carrying out the invention , combinations between different variations as practicable , and variations of aspects of the invention that are obvious to those of skill in the art are intended to be within the scope of the claims . | 1 |
the present invention relates to phenylpiperazines , to their preparation and to compositions containing them . u . s . pat . spec . no . 3 , 637 , 705 disclosed that the compounds of the formulae ( i ) and ( ii ): ## str1 ## wherein a is f , cl or br and a &# 39 ; is h or tetrahydropyranyl have unusually strong anorexigenic properties . we have found that other phenylpiperazines may be prepared that have different pharmacological properties , namely tranquillizing activity . accordingly the present invention provides the compounds of the formula ( iii ): ## str2 ## wherein r 1 is f , cl , ch 3 , no 2 , oh , och 3 , cn , nh 2 , nh . ch 3 or n ( ch 3 ) 2 and r 2 is a hydrogen atom or a tetrahydropyranyl group or a c 1 - 4 alkyl group or a group co . r 3 or co 2 r 3 where r 3 is a hydrogen atom or a c 1 - 4 alkyl group ; and acid addition salts thereof . one particularly suitable group of compounds of the formulae ( iii ) are those of the formulae ( iv ): ## str3 ## and acid addition salts thereof wherein r 1 is as defined in relation to formula ( iii ). another particularly suitable group of compounds of the formulae ( iii ), are those of the formulae ( v ): ## str4 ## wherein r 2 is as defined in relation to formula ( iii ) and acid addition salts thereof . particularly suitable values for r 1 for inclusion in the compounds of the formulae ( iii ) and ( iv ) include f , cl , ch 3 , oh and och 3 , especially f , cl and ch 3 . suitable values for r 2 for inclusion in the compounds of the formulae ( iii ) and ( v ) include the hydrogen atom and the methyl , ethyl and co 2 r 3 groups . a particularly suitable value for r 2 for inclusion in the compounds of the formulae ( iii ) and ( v ) is the hydrogen atom . the preferred compounds of this invention is that of the formula ( vi ): ## str5 ## and its pharmaceutically acceptable acid addition salts . acid addition salts of the compounds of the formulae ( iii )-( vi ) will normally be those with pharmaceutically acceptable inorganic or organic acids such as hydrochloric , hydrobromic , sulphuric , orthophosphoric , methanesulphonic , toluenesulphonic , acetic , propionic , succinic , salicylic , acetylsalicylic , ascorbic , lactic , citric , gluconic , tartaric and the like . the present invention also provides pharmaceutical compositions which comprise a compound of the invention and a pharmaceutically acceptable carrier . the compositions of the invention are specially useful in treating adverse mental states such as , for example , psychoses or anxiety states . for such treatment , the compounds are generally administered orally although parenteral methods of administration may also be used . typical oral formulations will include tablets , pills , capsules , sachets , granules , powders , suspensions , emulsions and solutions . particularly suitable oral formulations are tablets and capsules . where appropriate , the formulations may include conventional diluents , binding agents , dispersing agents , surface - active agents , lubricating agents , coating materials , flavouring agents , colouring agents , solvents , thickening agents , suspending agents , sweeteners or any other pharmaceutically acceptable additives , for example , gelatin , lactose , starch , talc , magnesium stearate , hydrogenated oils , polyglycols and syrups . where the formulations are tablets or capsules and the like , they will represent pre - measured unit doses but in the case of granules , powders , suspensions and the like , the formulations may be presented as pre - measured unit doses or in multi - dose containers from which the appropriate unit dose may be withdrawn . injectable compositions may be as aqueous or non - aqueous solutions suspensions or emulsions in a pharmaceutically acceptable liquid ( e . g . sterile pyrogen - free water or parenterally acceptable oils ) or mixtures of liquids which may contain bacteriostatic agents , antioxidants or other preservatives , buffers , ( preferably in the physiological ph range of 6 . 5 - 7 . 0 ), solutes to render the solution isotonic with the blood , thickening agents , suspending agents or other pharmaceutically acceptable additives . such forms will be presented in unit dose forms such as ampoules or disposable injection devices or in multi - dose forms such as a bottle from which the appropriate dose may be withdrawn , or as a solid form or concentrate which can be used to quickly prepare an injectable formulation . in general , the compositions of the invention will usually have associated with them , directions for use as anxiolytic or anti - psychotic medications . preferred dosage forms of the composition will be conventional tablets or capsules containing a pre - measured dose for oral administration . such dosage forms will normally contain between 1 and 100 mgs . of compound of formula ( iii ) and generally between 2 . 5 and 75 mgs . preferably from about 5 to about 50 mgs . such dosage forms will normally be taken from 1 to 6 times daily . the maximum daily dose for a 70 kg . adult will not normally exceed 360 mgs . and will not usually exceed 250 mgs . a daily dose of not more than 150 mgs . is generally preferred . normally , the daily dose for a 70 kg , adult will be at least 2 . 5 mgs ., usually at least 5 mgs . the compositions of the invention may be prepared by conventional methods of mixing , blending , tabletting and the like . normally the compound of the formula ( iii ) used in the composition will be a solid and often an acid addition salt . the present invention also provides a process for the preparation of compounds of the invention which process comprises the reaction of a compound of the formula ( vii ): ## str6 ## wherein r 1 is a defined in relation to formula ( iii ); with a compound of the formula ( viii ): ## str7 ## or an acid addition salt thereof wherein r 2 is hydrogen or a c 1 - 4 alkyl group and x and y are groups readily displaced by nucleophiles and thereafter if desired when r 2 is hydrogen , acylating the resulting piperazine in known manner . suitable groups x and y include i , br , cl , oso 2 ch 3 , oso 2 c 6 h 4 ch 3 , oco 2 tc 4 h 9 and their chemical equivalents . most suitably the groups x and y are both chlorine or bromine atoms . the process of this invention will normally be carried out in an organic solvent such as a lower alkanol , for example ethanol , normal butanol or the like . in general it is necessary to carry out the reaction at an elevated temperature for example 30 °- 150 ° c . although temperatures outside this range can be used . favourably the reaction is carried out at a temperature of about 75 °- 130 ° c . if desired an acid acceptor may be used to consume the acid liberated by the condensation . suitable acid acceptors include sodium carbonate and potassium carbonate . an alternative process involves reaction of a compound of the formula ( vii ) with a compound of the formula ( viii ) or an acid addition salt thereof wherein r 2 is hydrogen or a c 1 - 4 alkyl group and x and y are both hydroxyl groups in the presence of eitherconcentrated ( 37 %) hydrochloric or concentrated ( 48 - 66 %) hydrobromic acid . in general it is necessary to carry out the reaction at an elevated temperature , for example 60 °- 300 ° c . favourably the reaction is carried out at a temperature of about 160 °- 260 ° c . it will be appreciated that this process could be interpreted as forming the compound of the formula ( viii ) in situ prior to its reaction with the compound of the formula ( vii ). the compounds of the formula ( iii ) may be converted to their acid addition salts ( usually mono salts ) by reaction with an acid in conventional manner . similarly , the free bases may be liberated by neutralisation in conventional manner . this invention also provides a process for the preparation of those compounds of the formula ( iii ) wherein r 2 is a group cor 3 or co 2 r 3 which comprises the acylation or carboalkoxylation in a known manner of the corresponding compound wherein r 2 is a hydrogen atom . generally this involves the reaction of the appropriate piperazine derivative with cl . co . r 3 or cl . co 2 r 3 or their chemical equivalent at a non - extreme temperature in a conventional organic solvent . the present invention also provides a process for the preparation of those compounds of the formula ( iii ) wherein r 2 is a hydrogen atom which process comprises the hydrolysis of a corresponding compound of the formula ( iii ) wherein r 2 is a -- co . oa group such that co . oa represents an esterified carboxyl group . the preceding reaction is preferably carried out on a compound of the formula ( iii ) wherein r 1 is chlorine . the group a may be any convenient organic esterifying moiety but it is preferred to use a lower alkyl group such as a methyl , ethyl or like group or a benzyl or like group . the hydrolysis may be effected by treatment with an acid , for example a mineral acid such as hydrobromic , hydrochloric or the like . such reactions are frequently carried out at from about 0 ° to about 110 ° c ., for example 15 ° to 100 ° c . and conveniently at the reflux temperature of the medium . the compounds of the formula ( iii ) where r 2 is co . oa group may be prepared by the reaction of a compound of the formula ( iii ) wherein r 2 is a benzyl group , with a compound of the formula zco 2 a , wherein z is a group readily displaceable by a nucleophile , for example , a chlorine atom . such reactions are suitably carried out in an inert solvent such as benzene or toluene at an elevated temperature , for example at the reflux temperature . the compounds of the formula ( iii ) wherein r 2 is a benzyl group may be prepared by the reduction of a corresponding compound of the formula ( ix ): ## str8 ## wherein r 1 is as defined in relation to formula ( iii ). such reductions may be brought about by the method of d . w . henry , j . het . chem ., 1966 , vol . 3 , page 503 or by the general procedure of description 3 herein . the present invention also provides a process for preparing the compounds of the formula ( iii ) wherein r 2 is an alkyl group which process comprises the alkylation of the corresponding compound wherein r 2 is a hydrogen atom . such reactions may be carried out by conventional methods of n - alkylating piperazines such as reaction with an alkyl iodide or the like in a solvent such as acetone . this invention also provides a process for the preparation of compounds of the formula ( iii ) wherein r 2 is a hydrogen atom , which process comprises the hydrogenation of the corresponding compound wherein r 2 is a hydrogenolysable group . normally , the hydrogenation will be carried out in the presence of a transition metal catalyst , for example , palladium , at approximately atmospheric pressure . 3 , 4 , 5 - trichloroanaline ( 19 . 6g , 0 . 1 mole ) and bis ( 2 - chloroethyl ) amine hydrochloride ( 17 . 8g . 0 . 1 mole ) were dissolved in butan - 1 - ol ( 100 ml ) and boiled under reflux for 2 days . the solution was allowed to cool and anhydrous potassium carbonate ( 13 . 8g , 0 . 1 mole ) was added carefully and the resulting mixture was boiled under reflux with stirring for a further 2 days . the mixture was filtered hot and the filtrate allowed to cool to yield 1 -( 3 , 4 , 5 - trichlorophenyl ) piperazine hydrochloride ( 1 . 6g ), m . p . 272 °- 275 ° c . 3 , 4 , 5 - trichloroanaline may be prepared by the method of s . n . johary , s . s . guha and p . c . guha , j . indian inst . sci ., 34 , 287 ( 1952 ). 1 -( 3 , 4 , 5 - trichlorophenyl )- 4 - benzylpiperazine ( 13 . 75g ), dry toluene ( 350 ml ) and ethyl chloroformate ( 31 . 21g ) were refluxed together overnight . the reaction was cooled , diluted with water , the organic layer separated and washed with water ( 3 × 150 ml ) till neutral , and finally washed with brine ( 1 × 150 ml ). the organic layer was dried ( anh . na 2 so 4 ) and evaporated giving the intermediate ethyl carbamate as a pale brown solid ( 12 . 37g ). the solid can be crystallised from ethanol as beige needles ( m . p . 142 °- 143 . 5 ° c ). 1 -( 3 , 4 , 5 - trichlorophenyl )- 4 - ethoxycarbonylpiperazine ( 12 . 3g ) was refluxed with 48 % hydrobromic acid ( 100 ml ) overnight . the reaction was cooled , water added followed by aqueous sodium hydroxide solution ( 600 ml ; 10 %). the product was extracted into ether ( 3 × 100 ml ), the ether extracts combined , washed with water ( 3 × 100 ml ) till neutral , dried ( anh . na 2 so 4 ) and evaporated giving a brown oil which soon solidified ( 10 . 14g ). the free base was converted to the hydrochloride ( 9 . 42g ) by dissolving in dry ethanol and adding ethereal hcl till the hydrochloride precipitated out . to a stirred mixture of 1 -( 3 , 4 , 5 - trichlorophenyl ) piperazine ( 0 . 5g ) and anhydrous potassium carbonate ( 0 . 26 g ) in dry acetone ( 5 ml ) was added , slowly , ethyl iodide ( 0 . 29g ) and the resulting mixture was stirred under reflux for 2 hr . then filtered . removal of the solvent gave a pale brown solid which was dissolved in ether and treated with ethereal hydrogen chloride to give 1 -( 3 , 4 , 5 - trichlorophenyl )- 4 - ethylpiperazine hydrochloride ( 0 . 4g , 67 %), m . p . 265 °- 270 ° ( from ethanol - ether ). a mixture of 1 -( 3 , 4 , 5 - trichlorophenyl ) piperazine ( 0 . 5 g ) and acetic anhydride ( 0 . 4 ml ) in ethanol ( 10 ml ) was left to stand overnight at ambient temperature . the solvent was removed in vacuo and the residue was crystallised from ethyl acetate - light petroleum ( b . p . 40 °- 60 °) to give 1 - acetyl - 4 -( 3 , 4 , 5 - trichlorophenyl ) piperazine ( 0 . 43g , 76 %), m . p . 133 °- 136 °. a mixture of 3 , 5 - dichloro - 4 - methylaniline ( 6g , prepared by the method of w . davies , j . chem . soc . 1922 , 806 ) and bis - 2 - chloroethylamine hydrochloride ( 6 . 05g ) in n - butanol ( 25 ml ) was stirred under reflux for 24 hr . anhydrous potassium carbonate ( 4 . 69g ) was added and the mixture was stirred under reflux for a further 48 hr . then filtered and allowed to cool . the resulting solid was removed by filtration and crystallised from ethanol - ether to give 1 -( 3 , 5 - dichloro - 4 - methylphenyl ) piperazine hydrochloride ( 0 . 82g ) m . p . 280 °- 287 °. 3 , 5 - dichloro - 4 - methoxyaniline , m . p . 77 °- 79 °, was prepared by the catalytic hydrogenation ( 10 % pd - c ) of 2 , 6 - dichloro - 4 - nitro - anisole in ethyl acetate at ambient temperature and atmospheric pressure . a mixture of 3 , 5 - dichloro - 4 - methoxyaniline ( 16 . 0g ) and bis -( 2 - chloroethyl ) amine hydrochloride ( 14 . 77g ) in n - butanol ( 100 ml ) was stirred under reflux for 48 hr . anhydrous potassium carbonate ( 11 . 45g ) was added and the resulting mixture was stirred under reflux for a further 24 hr ., then filtered hot . the solid which precipitated on cooling was crystallised from ethanol - ether to give 1 -( 3 , 5 - dichloro - 4 - methoxyphenyl ) piperazine hydrochloride ( 3 . 7g ) m . p . 252 °- 255 °. 1 -( 3 , 4 , 5 - trichlorophenyl ) piperazine hydrochloride [ compound a ] was tested in various conventional screens used for determining the effect of major tranquillizors . in these tests chlopromazine was used as a positive control . the results obtained were as follows : ______________________________________ compound a chlorpromazine______________________________________1 . anti - catapresan ed . sub . 50 6 mg / kg p . o . ed . sub . 50 2 . 8 mg / kg p . o . test ( mouse ) 2 . shuttlebox ( conditioned avoidance behav - - 73 % at - 67 % at iour in the rat ). 5 mg / kg p . o . 10 mg / kg p . o . % inhibition of crossing rate . 3 . induction of catalepsy in 0 % at 54 % at the rat . 40 mg / kg s . c . 10 mg / kg i . p . ______________________________________ the activity of compound a in the anti - catapresan induced fighting test and the inhibition of conditioned avoidance responses in the shuttlebox tests indicate that compound a has potential neuroleptic / anxiolytic activity in man . the lack of cataleptic activity suggests that compound a will not induce the extrapyramidal side effects typical of neuroleptics of the chloropromazine type . the potency relative to chloropromazine in animal tests indicates that compound a will be active in man at similar daily doses to chlorpromazine , that is 0 . 2 - 10 mg / kg orally . 1 -( 3 , 4 , 5 - trichlorophenyl ) piperazine hydrochloride , magnesium stearate , microcrystalline cellulose and sodium starch glycollate may be blended together and granulated . these granules may then be used in a conventional rotary tabletting machine to produce 5000 tablets which on average contain the following : ______________________________________1 -( 3 , 4 , 5 - trichlorophenyl )- piperazine hydrochloride 25 mg . microcrystalline cellulose 163 mg . sodium starch glycollate 10 mg . magnesium stearate 2 mg . ______________________________________ 1 -( 3 , 4 , 5 - trichlorophenyl )- 4 - benzylpiperazine ( 1 . 71g .) in methanol ( 70 ml ) was shaken with 10 % pd / c ( 0 . 17g .) under hydrogen at atmospheric pressure for 5 . 0 hrs . g . l . c . analysis of the reaction mixture demonstrated the presence of n -( 3 , 4 , 5 - trichlorophenyl )- piperazine ( 33 %). n - benzyliminodiacetic acid anhydride ( 31 . 87g ) was dissolved in dry benzene ( 300 ml ) and filtered through celite to remove any tarry material that might be present . this solution was then treated at room temperature with 3 , 4 , 5 - trichloroaniline ( 27 . 57g ) in dry benzene ( 200 ml ). the n - benzyliminodiacetic acid monocarbox -( 3 , 4 , 5 - trichlorophenyl )- amide started to precipitate out almost immediately as a beige solid . the reaction mixture was warmed briefly and then left to cool . the product was isolated by filtration and washed with dry ether to remove any unreacted 3 , 4 , 5 - trichloroaniline . it was obtained as a beige powder ( 38 . 27g ). * n - benzyliminodiacetic acid monocarbox -( 3 , 4 , 5 - trichlorophenyl )- amide ( 38 . 27g ; 0 . 0953 moles ) was heated at reflux in acetic anhydride ( 191 . 3g ; 177 ml ) for at least 0 . 5 hr . the excess acetic anhydride and acetic acid were removed in vacuo to give a brown crystalline solid ( 36 . 80g ). the n - benzylpiperazinedione was crystallised from ethanol ( 850 ml ) as pale brown needles ( 22 . 26g ; m . p . 153 . 5 °- 154 . 5 ° c .). concentration of the mother liquor gave a second crop ( 3 . 65g ). aluminum chloride ( 38 . 93g ) in dry ether ( 460 ml ) -- ( caution : exothermic reaction ) -- was added dropwise to lithium aluminum hydride ( 11 . 08g ) suspended in dry ether ( 460 ml ). during the addition , the reaction refluxed gently . n - benzylpiperazinedione ( 22 . 26g ) in dry tetrahydrofuran ( 170 ml ) was then added to the lithium aluminum hydride / aluminum chloride mixture at such a rate as to maintain gentle refluxing . when the addition of the dione was completed the reaction was decomposed with aqueous sodium hydroxide solution ( 200 ml ; 10 %). the layers were separated and the aqueous layer was extracted with ether ( 3 × 200 ml ). the combined organic layers were washed with water ( 3 × 200 ml ) till neutral , dried ( anh . na 2 so 4 ) and evaporated to give a pale brown oil ( 16 . 87g ; 96 % purity by g . l . c .) with solidified upon cooling . | 2 |
referring to fig1 , a block diagram of a pump controller is shown generally by numeral 10 . a variable speed pumping unit 12 extracts crude oil from a well bore 14 , which is then pumped via a conduit 16 to a holding tank 18 , or the like . the pump control system includes a sensor 20 which is placed in the path of the oil flow in the conduit 16 , in a manner to be described below . the sensor 20 provides an electrical signal indicative of flow via a cable 22 to a main control unit 24 . the control unit 24 provides a control signal 26 to control the variable speed pump unit 12 . the control signal 26 maintains the pump speed at an optimal level in order to ensure efficient extraction of crude oil from the well bore 14 . an external computer 28 may be connected to the controller unit 24 in order to download or control parameters of the controller . furthermore , the computer 28 includes a graphical display system for displaying information on the controller performance . each of these elements will be discussed in detail below . referring to fig2 , a cross - section of the sensor 20 in fig1 , is shown . the sensor 20 is a passive device in that it must be powered from the controller 24 . the sensor includes a cylindrical body section 30 and a lower threaded section 32 for installing in a bore of a t - pipe section 15 in the conduit 16 . generally , the sensor is installed relatively close to the well head . a pair of probes 34 and 36 project from one end of the body 30 so that when the sensor is inserted into the conduit 16 , oil can flow over each of the probes uniformly . the actual orientation of the probes within the conduit is not critical , however , the probes should project generally perpendicularly to the direction of flow in the conduit . the probes 34 and 36 are each comprised of a hollow polished stainless steel tube and each contain a heating element 38 , 42 and a temperature sensing element 40 , 44 , respectively . a heating current derived from the controller 24 is provided to the heating element 38 and 42 via a suitable electrical conductor 46 and temperature measurement signals are returned from the temperature sensing elements to the controller via a pair of conductors 48 . the conductor 46 and 48 are attached to a connector 49 which may be attached to cable 22 . the sensor operates on a thermal dispersion principle based on newton &# 39 ; s law of cooling . one of the probes is selected and its heating element is supplied with a constant energy , which radiates out as heat . we generally refer to this probe as the energized probe . its counterpart probe or unheated probe is generally called the ambient probe . both the probes provide a temperature signal from their respective temperature sensing elements . thus , it may be shown that the heat input rate into a medium may be expressed by the equation q = hδt , where h is the convection heat transfer co - efficient and δt is the temperature difference between the heat source and the medium . in this case , δt is the temperature difference between the heated and ambient probes . the value h is a function of the flow rate of the medium . hence , h is not constant . thus it may be seen that the temperature differential between the probes is inversely proportional to the flow rate of the medium for a given heat input rate q . it may be more accurately stated that the velocity of the fluid is a function of the inverse of the square of the difference in temperatures between the two probes . by heating one of the probe tips at a constant rate , the difference in temperature between the probe tips provides a relative temperature measurement independent of the ambient temperature of the fluid . the calculated velocity of the fluid is proportional to the square of the energy transfer into the probe . therefore , it is important that the energy supplied to the probe is stable over a wide range of ambient conditions . furthermore , in situations were high flow exist , most of the radiated heat is absorbed by the passing fluid and carried down stream . the temperature thus recorded at either of the energized or ambient probe is approximately the same . however , with reduced fluid movement across the probes , residual heat builds up along the tip of the energized probe thus resulting in a higher temperature measurement relative to the ambient probe . by comparing the energized probe temperature to the ambient probe temperature , the flow rate can be estimated to produce a value which is substantially independent of the temperature of the oil flowing past the probe . additional compensation for the variation of constant fluid properties from well to well with temperature is implemented in the controller 24 . referring now to fig3 , the controller 24 is shown in greater detail . the sensor electronics is shown schematically by block 20 . the controller 24 , includes a heater constant current source supply 51 which provides a constant current to the heater elements 38 and 42 located in the sensor 20 . each of the heater elements 38 and 42 are connected to a respective switch 54 and 56 . these switches 54 and 56 are selectively controlled via a microcontroller 58 for selecting either one of the heater elements 38 or 42 to be heated . as described earlier , each of the heater elements has in close proximity thereto a temperature sensing element 40 and 44 . the temperature sensors in this case are platinum rtds ( resistance - to - temperature devices ). as may be seen in fig3 , each of the rtds 40 and 44 have one of their inputs 59 connected via a switching multiplexer 60 to an rtd constant current source 66 . the output of the temperature sensor resistors 40 and 44 are connected via the multiplexer 60 to the analog input of an analog - to digital converter 64 through a buffer amplifier 65 . the analog - to - digital converter 64 provides a digital input to the micro - controller 58 which is indicative of the temperature measured by a respective rtd 40 or 44 . as seen in fig4 , the rtd devices are linear devices and are capable of exhibiting a linear resistance change over an approximate temperature range of − 19 ° c . to 150 ° c . the micro - controller 58 then processes this input data described with reference to fig6 ( a ), 6 ( b ) and fig7 . a digital - to - analog converter 67 has its digital inputs driven by an output of the micro - controller 58 to produce an output analog signal indicative of a speed control signal 26 for control of the pumping unit 12 shown in fig1 . in addition , an rs232 interface and driver support circuitry 72 is provided for communication with the micro - controller 58 by the external computer 28 . additional e 2 prom 73 is provided for storage of constants and additional parameters . referring to fig4 , a resistance - to - temperature graph 74 illustrating the relationship between the resistance and temperature of the rtd is shown generally by numeral 80 . it may be seen that the relationship is relatively linear over a large temperature range . this has the advantage in that over a period of time , the temperature of the resistor may be sampled by the analog - to - digital converter 64 and an integer interpolation routine may be used to determine values of resistance between the sampled points . thus , it is not required that a large amount of memory be utilized in the micro - controller in order to store a lookup table , as for example , when a non - linear thermistor is used as temperature sensing element . by providing heating elements in each of the probes of the sensor 20 , allows for each of the probes to be periodically made the energized probe . in the case of oil wells with high paraffin wax content , if only one of the probes is heated , then over a long period of time , wax would tend to accumulate on the unheated probe . this would result in skewed temperature readings . however , by providing heaters in both probes and providing a means for switching between the heaters in the probes reduces wax build up on the probes . furthermore , the lifespan of the sensor is extended by switching the heating elements between the probes since constant heating of only one of the probes results in sever degradation of the lifespan of that probe . fig5 is a detailed circuit diagram of the controller 24 , wherein the micro - controller is a type 68hc705 . referring now to fig6 a and 6 b , an algorithm implemented by the micro - controller 58 for controlling the output signal 26 to the pump , is indicated generally by numeral 90 . the micro - controller switches the constant power source 57 to one of the heaters 30 or 42 by activating one of the switches 54 or 56 . the micro - controller then obtains a first t 1 and second t 2 digitalized temperature measurement from the input signal received from the analog - to - digital converter 64 by sending a signal to the multiplexer 60 to select in sequence the temperature probe 40 or 44 . the difference between these temperatures δt is calculated and is indicative of a flow measurement . these flow measurements or temperature differentials are combined into an average of most recent samples called a rolling flow average . the micro - controller samples the temperature approximately once ever second . the controller stores a sixteen element rolling window of samples . once sixteen samples have been included in a rolling window , the newest sample replaces the older sample prior to the latest average being calculated . that is , a rolling average is calculated over a sample of sixteen elements every second with each element being discarded after 16 seconds . the process of obtaining flow measurements is continuous and proceeds in parallel with other processing by the micro - controller . once this flow is obtained by the micro - controller , the oil flow at the well head is controlled in accordance with the sequence of steps illustrated in fig6 ( a ) and 6 ( b ). initially , an auto reset clock 92 is set to count time down from 48 hours or any other convenient time . this clock serves to reset the parameters of the controller in order to accommodate drops in motor efficiency over time and to switch the heated probe . the microcontroller maintains a speed table of entries having rows of measured flow rates m i and pump speed s i . thus , at a step 94 , this table is initialized . an initial wait time is then set at step 96 . this period is initially set between 8 to 12 minutes . it may be noted that for variable speed control applications , the digital - to - analog converter delivers 4 to 20 milliamps output signal . by convention , 4 milliamps represents the lowest speed setting s 0 of the pump , while 20 milliamps represents the highest speed s n setting of the pump . an increment or step in speed is generally designated as 1 milliamp representing the least step up or step down for change in speed . in implementing the variable speed control , it is assumed that each increase in speed corresponds to some increase in the maximum potential delivery rate of the pump . thus it is the goal to operate the pump at the lowest speed with the delivery rate above the current production rate measured for the well . thus , in order to achieve this , the speed table , as described earlier , keeps track by way of the rolling flow average of the maximum delivery rate obtained thus far for each selected speed of the pump . changes in speed occur on the basis of time intervals . the length of each interval is called the settled time t s . its purpose is to allow changes in the pump speed and the well &# 39 ; s production rate to be reflected in the rolling flow average . by default , the length of the settle time is 2 minutes . at the end of each interval , depending on whether the rolling average has increased , decreased or stayed the same , a corresponding change in speed is initiated . these changes in speed may be made as a single increment or as an arbitrary number of increments per interval . thus , referring back to step 98 in fig6 , an initial speed s i of the pump is set . the controller waits a predetermined time at step 99 . a new speed is then set at step 100 according to the algorithm of fig6 ( b ). the table is initially built from the lowest speed s 0 upward , first , the speed is set to s 0 and an initial flow m 0 is obtained for speed s 0 . the speed is then stepped up to s 1 and a corresponding flow m 1 is obtained . this is repeated for successive values of speed increments . it is assumed , however , that each step between a speed s 1 and a speed s i − 1 corresponds to a corresponding step in the maximum potential flow rate . therefore , if upon obtaining m i + 1 at speed s i + 1 , it is recognized that m i + 1 ≦ m i , then it is clear that the well &# 39 ; s current production rate is below what the pump can deliver at speed s i + 1 . for example , if m i + 1 is equal to m i , it indicates that the well at this time is producing at a constant rate which corresponds to a speed s i . otherwise , if m i + 1 is less than m i , it indicates that during the settle interval at s i + 1 , production from the well has decreased . in this case , s i may represent a greater speed than is required to support the lowered production rate . therefore , a search of the table is performed beginning at s i down to s 0 until the lowest speed having a maximum delivery rate above the current production rate is found . it may therefore be seen that building the speed control table occurs in conjunction with varying the pump speed . when production levels or flow rates from the well increase , the table is refined while the speed is increased . conversely , when lower flow rates are measured from the well , the table is searched for the minimum speed required to sustain that flow rate . to illustrate how the process of building a table is performed after a drop in flow rate is detected , let s p represent the last speed prior to detecting a drop in flow rate , and let s i be the current speed . for example , s p might be 12 ma and s i might be 9 ma . as flow rate from the well increases , the production rate at speed s i as measured by the rolling flow average will begin to approach m i , which is the estimated maximum flow rate at s i . at the end of an interval , if the production rate is found to be closer to m i , then the speed is incremented up to s i + 1 . assuming production levels continue to improve , the speed is successively increment up to s p . as this point , the table is continued to be built until either flow rate decreases or the maximum speed s n is reached . alternatively , if at the end of the interval at speed s i , the production rate may be greater than m i . in this case , m i is no longer the best estimate to the maximum flow rate at s i . the new flow rate is then substituted for the old value of m i . the change to m i can also impact m i + 1 , if the new value for m i is also greater than m i + 1 . therefore , the table is rebuilt for s i + 1 . thus , it may be seen that changes can precipitate through entries in the table thus allowing the controller to constantly fine tune its estimates based on better information over time . this is illustrated more clearly in fig6 ( b ). once the new speed s i is set at step 100 , a new settle time is set at step 102 . besides the settled time , there are two other timing intervals involved in variable speed control . these are the initial wait and automatic reset time . the initial wait time is simply the settling time for the very first interval in building the table . as such , it only occurs once just after the instrument is reset or powered on . the initial wait is typically longer than the settled time . the automatic reset time is not directly related to variable speed control . instead , it is simply a background timer which upon time out at step 104 initiates an automatic reset of the controller . this causes the speed table to be rebuilt . the automatic rest serves several purposes as described earlier . referring now to fig7 , a process flow for controlling an on / off type pump is shown generally by numeral 170 . in this case , the micro - controller 58 may send a signal to the digital - to - analog converter 67 one of two signals , namely , a value corresponding to a pump - off signal or a value corresponding to a pump - on signal . alternatively , a relay 67 may be provided which turns the pump 12 on or off . the process is divided into four steps , namely , establish flow 172 , regulate flow 174 , timing - out 176 and shut - in 178 . it is to be noted that each step is associated with a single control parameter which directs the process of that step . a default setting is assigned to each control parameter . however , these parameters may be easily changed via the external computer 20 . the parameters associated with these steps are establish flow period , regulate flow cutoff point , timing - out period and shut - in period . generally , these parameters are set at a default value of 15 minutes , 25 %, 1 minute and 30 minutes , respectively . the establish flow step 172 starts the pump and settles into an interval of time called the establish flow period 173 . this establish flow period is indicative of a flow of the current state of the well . for example , this interval generally covers the time required for oil to make its way to the surface and past the probes . although flow samples are obtained by the controller during this period , output signals to control the pump are not provided during the establish flow period . once the establish flow period has expired at step 173 , the process moves onto the regulate flow step 174 . in the regulate flow period 174 , an ongoing flow sample is combined into a rolling average called the rolling flow average as described earlier . however in this case , a rolling flow average is compared against a regulated flow cutoff point 175 . if the rolling flow average remains above the cutoff point , a process control cycle remains at this step . however , should the rolling flow average drop below the regulated flow cutoff point , this signals a pumpoff has occurred and the process moves on to the timing - out step 176 . in the time out step 176 , a short period called the time out period is provided to confirm whether or not the well has actually pumped off . this avoids instances where trapped gas pockets are within the line or short segments of dry pumping have occurred . during timing out , the ongoing rolling flow average continues to be compared against the regulated flow cutoff point 177 . if the rolling average moves back above the cutoff point before timing out period expires , then the process moves back to the regulate flow step 174 . otherwise , at the end of the timing out period , the process moves to the next step which is the shut - in step 178 . in the shut - in step 178 , the pump is stopped and the well enters an idle state allowing time for the well bore to be refilled from the surrounding formation . the length of time the well remains idle is determined by the shut in period . once the shut in period expires , the process control begins at the establish flow step 172 . while the invention has been described in connection with a specific embodiment thereof and in a specific use , various modifications thereof will occur to those skilled in the art without departing from the spirit of the invention as set out in the claims . the terms and expressions which have been employed in the specification are used as terms of description and not of limitations , there is no intention in the use of such terms and expressions to exclude any equivalents of the features shown and described or portions thereof , but it is recognized that various modifications are possible within the scope of the invention as set out in the claims . | 4 |
referring now to fig1 there is illustrated a block diagram of a coupling queue architecture , according to a disclosed embodiment . the disclosed architecture provides two input coupling queues : a first coupling queue 100 ( also denoted as queue a ), and a second coupling queue 102 ( also denoted as queue b ) which share ( or support ) one virtual output queue 104 . a first input port 106 is connected to provide 32 - bit data into the first coupling queue 100 , and a second input port 108 connects to provide 32 - bit data into the second coupling queue 102 . thus each input port 106 and 108 has a corresponding and independent input coupling queue 100 and 102 which temporarily stores the input data . retrieving ( or reading ) logic 110 operates to retrieve ( or read ) the contents of the coupling queues 100 and 102 according to a predetermined selection algorithm , and pass the retrieved contents on to the virtual output queue 104 . thus the retrieving logic 110 connects to the output of the first coupling queue 100 to retrieve data therefrom across an associated 64 - bit data bus 112 at a speed which is approximately twice the speed in which 32 - bit data is being input to ( or written into ) the first coupling queue 100 . similarly , the retrieving logic 110 connects to the output of the second coupling queue 102 to retrieve data therefrom across a corresponding 64 - bit data bus 114 at a speed which is approximately twice the speed in which 32 - bit data is being input to the second coupling queue 102 . in general , the reading speed for retrieving data from the coupling queue 100 ( or 102 ) is approximately twice the speed in which the data is being written into the coupling queue 100 ( or 102 ). writing to the virtual output queue 104 from the retrieving logic 110 is fragment - based , i . e ., when reading commences from one of the input coupling queues 100 ( or 102 ), the read operation does not stop until the end of the current data fragment is detected . the reading logic 110 then forwards the 64 - bit data across a connection 116 to the virtual output queue 104 at approximately twice the speed at which the data was written into the coupling queue . data latency is minimized such that once a data fragment enters the coupling queue , the read / write process to the virtual output queue 104 begins . additionally , the enqueued data is read as fast as possible to prevent the occurrence of an overflow state in either of the coupling queues 100 and 102 . the size of each input coupling queue size is approximately twice the maximal data fragment size . the minimal data fragment size is preferably approximately { fraction ( 1 / 16 )} th of the maximal data fragment size . the size of the input data fragment preferably ranges from approximately { fraction ( 1 / 16 )} th of the maximal data fragment size up to and including the maximal data fragment size . the reading algorithm neither utilizes a traditional ping - pong method based on the fragment size to read the enqueued data nor reads the enqueued data based upon which input queue ( 100 or 102 ) has more data . either implementation causes increased latency for certain types of data resulting in the overflow of one or both coupling queues 100 and 102 . for example , use of the traditional simple ping - ping method where the first queue 100 buffers short data fragments and the second queue 102 buffer long data fragments will ultimately result where the first queue 100 will be reach an overflow state . in another example , if there is a 256 - byte data fragment being written into the first coupling queue 100 , 64 bytes are already in the first queue 100 , and a 32 - byte fragment is already in the second queue 102 , then the data in the first queue 100 is longer than data in the second queue 102 . thus if the reading method utilized is that which operates based on which queue has more data , the first queue would be chosen for reading . however , in this case , it is preferable to first read the data from the second queue 102 since reading from the first queue 100 cannot end until the complete fragment is read . the read operation of the second queue 102 for the smaller fragment would start and complete in a much shorter period of time , and reduce the potential for latency in that second queue 102 . on the other hand , the read operation of the first queue 100 would initially be at approximately twice the input writing speed for the beginning of the fragment data , but would slow down to the same speed as the writing speed for the remaining data of the larger fragment as the read operation catches up to the input write speed . if time t 1 is the total time for reading data from both the first and second queues 100 and 102 , and time t 2 is the total time required if first reading from the second queue 102 , then apparently t 1 & gt ; t 2 . referring now to fig2 there is illustrated a flow chart of the general algorithm of the retrieval logic , in accordance with a disclosed embodiment . flow begins at a starting point 200 and continues to a decision block 202 to determine if both of the coupling queues 100 and 102 are empty . if so , flow is out the “ y ” path to the input of the decision block 202 to continue monitoring for such a condition . if either the first queue 100 or the second queue 102 , or both queues 100 and 102 have enqueued data , flow is out the “ n ” path of decision block 202 to function block 204 to interrogate and selectively read the queues 100 and 102 according to predetermined criteria . the queue read operation , which includes all processing necessary to extract one or more complete data fragments from the queue being read , continues until both the first queue 100 and the second queue 102 are empty , at which time flow is from function block 204 to the input of decision block 202 . note also that the size of the data fragments vary according to the particular application . thus the disclosed architecture can read enqueued data fragments of varying sizes . the queue selection operation occurs only after finishing the current fragment reading . referring now to fig3 there is illustrated a more detailed flow chart of the algorithm for monitor and control of data in both input queues . flow begins at a start block and continues to a decision block 300 to determine if both coupling queues 100 and 102 are empty . if so , flow is out the “ y ” path and loops back to the input to continue monitoring the status of both queues 100 and 102 . if either one has a enqueued data , flow is out the “ n ” path of decision block 300 to a decision block 302 to determine if the first queue 100 is empty . if not , flow is out the “ n ” path to a function block 304 to read the first queue 100 . flow continues then to a decision block 306 to determine if the amount of data enqueued in the second queue 102 has exceeded 25 % of its total queue capacity . if so , flow is out the “ y ” path to a function block 307 to read the enqueued data fragments from the second queue 102 . detailed discussion of this portion of the flow chart will continue hereinbelow after completion of the discussion for the first queue 100 . as indicated hereinabove , the disclosed architecture efficiently moves data from the two input coupling queues to the virtual output queue with good data latency and minimal input coupling queue size , and never allows input coupling queue overflow . this is accomplished by ensuring that overflow in either input queue 100 or 102 is prevented . thus it is important to first check on parameters indicating that a particular queue is reaching capacity . to that end , the disclosed algorithm first checks on the 25 %- full trigger , and then the full - fragment criteria . these or any other criteria can be adjusted to the particular application , as desired , as well as the order , so long as overflow is prevented . if the amount of data in the second queue 102 has not exceeded 25 % of the queue capacity , flow is out the “ n ” path of decision block 306 to a decision block 308 to determine if the amount of data enqueued in the first queue 100 has exceeded 25 % of the total queue capacity . if so , flow is out the “ y ” path to function block 304 to then read the first queue 100 until it is empty . if not , flow is out the “ n ” path to a decision block 310 to determine if the second queue 102 has enqueued therein a full data fragment . if a full fragment is enqueued , flow is out the “ y ” path to function block 307 to read the second queue 102 until it is empty . if a full fragment is not enqueued , flow is out the “ n ” path to a decision block 312 to determine if the first queue 100 has enqueued therein a full data fragment . if so , flow is out the “ y ” path to function block 304 to read the first queue 100 until it is empty . if not , flow is out the “ n ” path of decision block 312 to a decision block 314 to determine if the second queue 102 has enqueued therein any data . if the second queue 102 has any data , flow is out the “ y ” path to function block 307 to read the second queue 102 until it is empty . if not , flow is out the “ n ” path to a decision block 316 to determine if the first queue 100 has enqueued therein any data . if so , flow is out the “ y ” path to function block 304 to read the first queue 100 until it is empty . if not , flow is out the “ n ” path of decision block 316 to a decision block 318 to determine if the second queue 102 is empty . if it is not empty , flow is out the “ n ” path to function block 307 to read the second queue 102 until it is empty . if it is empty , flow is out the “ y ” path to a decision block 320 to determine if the first queue 100 is empty . if so , flow is out the “ y ” path , and loops back to the input of decision block 318 to again determine of the second queue 102 is empty . on the other hand , if the second queue 102 is empty , but the first queue 100 is not empty , flow is out the “ n ” path of decision block 320 to function block 304 to read the first queue 100 until it is empty . note that if any of the criteria are met in decision blocks 306 , 310 , 314 , or 318 , flow jumps over to function block 307 read data from the second queue 102 . continuing with the flowchart from function block 307 , flow is then to a decision block 309 to determine if the amount of data enqueued in the first queue 100 has exceeded 25 % of its total queue capacity . if so , flow is out the “ y ” path to function block 304 to read the enqueued data fragments from the first queue 100 . if the amount of data in the first queue 100 has not exceeded 25 % of the queue capacity , flow is out the “ n ” path of decision block 309 to a decision block 311 to determine if the amount of data enqueued in the second queue 102 has exceeded 25 % of its total queue capacity . if so , flow is out the “ y ” path to function block 307 to then read the second queue 102 until it is empty . if not , flow is out the “ n ” path to a decision block 313 to determine if the first queue 100 has enqueued therein a full data fragment . if so , flow is out the “ y ” path to function block 304 to read the first queue 100 until it is empty . if not , flow is out the “ n ” path to a decision block 315 to determine if the second queue 102 has enqueued therein a full data fragment . if so , flow is out the “ y ” path to function block 307 to read the second queue 102 until it is empty . if not , flow is out the “ n ” path of decision block 315 to a decision block 317 to determine if the first queue 100 has enqueued therein any data . if so , flow is out the “ y ” path to function block 304 to read the first queue 100 until it is empty . if not , flow is out the “ n ” path to a decision block 319 to determine if the second queue 102 has enqueued therein any data . if so , flow is out the “ y ” path to function block 307 to read the second queue 102 until it is empty . if not , flow is out the “ n ” path of decision block 319 to a decision block 321 to determine if the first queue 100 is empty . if not , flow is out the “ n ” path to function block 304 to read the first queue 100 until it is empty . if so , flow is out the “ y ” path to a decision block 323 to determine if the second queue 102 is empty . if so , flow is out the “ y ” path , and loops back to the input of decision block 321 to again determine of the first queue 100 is empty . on the other hand , if the first queue 100 is empty , but the second queue 102 is not empty , flow is out the “ n ” path of decision block 323 to function block 307 to read the second queue 102 until it is empty . the disclosed architecture utilizes an algorithm which reads the data based upon both the status of the data fragment and which queue has more data , and which is exemplified as follows . although the preferred embodiment has been described in detail , it should be understood that various changes , substitutions and alterations can be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
fig1 - 4 show a first assembly of the invention in the form of a fiber optic jewelry clasp 10 . its parts include a small , disc - shaped + 3 - volt battery 11 such as the cr1220 available from panasonic , which is mounted behind a decorative cover 12 with central hub 13 and multiple lobes 14 radiating from the central hub 13 . the battery 11 is fixed to the back of cover 12 , and post 14 , seen in fig2 is integrally formed with base 15 , which in turn is adhesively attached to battery 11 . clip 16 of a known type slides over post 14 to capture a piece of clothing ( not shown ) and hold the clasp 10 in place on a wearer . fig5 shows another example of a clasp 25 in which a cover 26 totally covers and hides the battery 11 and other parts of the assembly . extending from battery 11 is a fiber optic tail assembly . this includes an led 19 , the bulb portion being seen best in fig3 as it is received in one end of stretchable and shrinkable tubing 20 . one end of fiber optic ribbon 21 is inserted in the other end of the tubing 20 . leads 17 , 18 extend from the bulb potion to contact the battery 11 as seen in fig2 . the fiber optic ribbon 21 contains a plurality of fiber optic strands 22 in a web of translucent , synthetic resinous or plastic material . light from the led 19 is beamed through the fiber optic ribbon 21 , and will normally only be emitted at the ends of strands 22 as indicated at reference 24 in fig1 . in the invention , however , a discontinuity is created between the anchored end of the ribbon 21 and the free end , with this discontinuity being in the shape of one or more alphanumeric symbols or letters . in fig1 and 4 , the letter is &# 34 ; r &# 34 ;. in fig5 the symbol is the number &# 34 ; 1 &# 34 ;. graphical symbols and shapes can also be used . the discontinuity can be formed by abrading the ribbon 21 or heat stamping the desired shape , as represented by the stippled regions in fig1 and 5 . as seen in fig4 light is now emitted along edges of the letter nearer to the battery 11 , but as the discontinuity is short , in terms of line width of the letters or numbers , it appears as if light is filling the letters , or that the letters are glowing . light is also emitted at the end of the ribbon 21 as indicated by reference 24 . light is emitted in the color selected for the led 19 , red , for example . it should also be apparent that a small capacitor or flasher can be included in the circuit , if desired . besides the symbols formed in the ribbon 21 and the end of the ribbon 21 , light from the led 19 will not be emitted from the ribbon 21 , and the ribbon will retain it original appearance , which is non - colored translucence in this embodiment . to switch the glowing parts of the ribbon &# 34 ; on &# 34 ; and &# 34 ; off &# 34 ; in fig2 the leads 17 and 18 are selected to be flexible and yieldable , so that the fiber optic tail can be slid on and off the battery 11 . opposite sides of the battery 11 are of different polarity (+ or -) and the leads 17 and 18 connect to the anode and cathode of the led . when the positive (+) contact on the battery 11 is connected to the anode of the led 19 , the led 19 will conduct current and turn on . when the positive (+) contact on the battery 11 is connected to the cathode of the led 19 , the led 19 is blocking current and will not be illuminated . by pulling the leads 17 , 18 away from battery 11 , reversing the facing position of the tail between front and back , and pushing the leads 17 , 18 back into contact with the battery 11 , the tail can be turned &# 34 ; on &# 34 ; and &# 34 ; off &# 34 ; without the need for bulky switches . it should also be apparent that the battery 11 can be made removable and reversible relative to the leads 17 , 18 to accomplish the same result . fig6 - 10 show a backlit electronic jewelry clasp 30 in which the number &# 34 ; 90 &# 34 ; is inscribed on fiber optic ribbon 33 in the manner described for the symbols in fig1 - 5 . cover 31 can carry a graphic or remain a solid color . cover 31 has an aperture 32 cut into it in the shape of the number &# 34 ; 90 &# 34 ;. the aperture 32 is aligned with the number &# 34 ; 90 &# 34 ; illuminated on a piece of fiber optic ribbon 33 of the type described for the first assembly 10 of fig1 - 4 . it should be apparent that although an aperture 32 is disclosed , this is but one form of transparent or translucent window that can be employed over symbol &# 34 ; 90 &# 34 ; to provide a backlit clasp 30 . battery 34 is mounted on the back side of cover 31 , so as to be hidden from view when the clasp 30 is worn . two leads 35 from an led hidden in stretchable and shrinkable tube 37 slide over the positive and negative contacts on battery 34 . as seen best in fig8 post 38 projects laterally from vertically disposed cover 31 , and clip 39 of a known type slides over post 38 to secure the clasp 30 on a person &# 39 ; s clothing . fig9 illustrates a portion of the aperture 32 which allows the illuminated number &# 34 ; 90 &# 34 ; to be seen through the cover 31 . fig1 shows a portion of the ribbon 33 hidden in fig5 . it should now be apparent that the invention provides new and improved fiber optic jewelry , with enhanced visual effects and convenient features of construction . this has been a description of an of how the invention can be carried out . those of ordinary skill in the art will recognize that various details may be modified in arriving at other detailed embodiments , and these embodiments will come within the scope of the invention . therefore , to apprise the public of the scope of the invention and the embodiments covered by the invention , the following claims are made . | 8 |
the following description is intended to refer to specific embodiments of the invention illustrated in the drawings and is not intended to define or limit the invention , other than in the appended claims . also , the drawing is not to scale and various dimensions and proportions are contemplated . referring to fig1 a system for removing biochemical oxygen demand ( bod ) and / or nh 3 / nh 4 + is shown . the system includes a tank t 1 located adjacent tank t n − 1 , which is located adjacent to tank t n . although the tanks are shown directly adjacent to one another , it is not necessary that they be in contact , so long as they are operatively connected and that wastewater may flow between tanks t 1 and t n − 1 on the one hand , and tanks t n − 1 and t n on the other hand . also , all tanks should preferably include means to introduce air into the wastewater , such as with an air diffuser or the like . tank t 1 is connected to an influent line i 1 and tank t n is connected to an influent line i n . tank t 1 is connected to an outlet line o 1 and tank t n is also connected to an outlet line o n . each of the outlet lines o 1 and o n connect to a filter unit which are preferably membranous - type filters , f 1 and f n , respectively . also , each filter f 1 and f n has a means for cleaning the filter , which ( over time ) can and / or does become laden with particulate matter . the particular details , structure and operation of the cleaning aspect of the filter is not important , so long as the cleaning capability is present . filters f 1 and f n are membrane type filters which are depicted within tanks t 1 and t n but which do not necessarily have to be located within tanks t 1 and t n but which could be located outside of the tanks but operatively connected to tanks t 1 and t n respectively . tank t 1 is provided with an nh 3 / nh 4 + detector ad 1 as well as a tss detector td 1 . similarly , tank t n is provided with an nh 3 / nh 4 + detector ad n and a tss detector td n . preferred detectors ad are made by myratek , inc . and preferred detectors td are made by royce instrumentation corp ., for example . it is also possible to supplement or substitute for detectors ad 1 and ad n with our ( oxygen uptake rate ) detectors od 1 and od n as shown in fig1 . the system is also provided with a controller , which typically comprises an on - line computer system with appropriately programmed software , that connects to the various components i 1 , i n , o 1 , o n , ad 1 , ad n , td 1 and td n to monitor and control operation of the system . the controller operates in alternating cycles c 1 and c 2 depending on the detected conditions within the system . for example , in cycle c 1 , inlet i 1 and outlet o n are opened so that wastewater can flow into the system at tank t 1 and out of the system at tank t n . inlet i n is closed as is outlet o 1 . filter f 1 is most preferably caused to enter into a cleaning mode during each cycle , although it may not enter the cleaning mode on any given cycle depending on need or system set up . the system operates in cycle c 1 until detector ad 1 or td 1 detects a concentration of nh 3 / nh 4 + or tss , respectively , that is greater than or equal to selected concentrations x and y , respectively . representative values for concentration x include about 1 ppm to about 10 ppm , for example , and for concentration y about 3000 ppm to about 20 , 000 ppm , although concentrations outside these ranges may be possible depending on the conditions . when those concentrations are exceeded , the controller switches from cycle c 1 to cycle c 2 . cycle c 2 changes a number of operational parameters wherein inlet i n and outlet o 1 are opened to cause wastewater to flow into tank t n , through tank t n − 1 and into tank t 1 and , finally , outwardly through outlet o 1 . inlet i 1 is closed as is outlet o n . filter f n is most preferably placed into a cleaning mode , although it may not enter the cleaning mode on any given cycle depending on need or system set up . the system operates in cycle c 2 until detector ad n or td n detects a concentration of nh 3 / nh 4 + or tss , respectively , greater than or equal to the selected concentrations x and y , at which point the system switches back from cycle c 2 to cycle c 1 . typically , the concentrations x and y vary from the ranges mentioned above , but can be outside of those ranges , depending on a wide variety of circumstances . although the previous description contemplates the use of detectors and a controller to alternate between cycles c 1 and c 2 , it is entirely possible that the alternating between cycles c 1 and c 2 could be initiated by timer control . referring to fig2 another preferred nutrient - removal system is shown . fig2 depicts a system having five separate tanks t 1 , t 2 , t 3 , t n − 1 and t n . while that particular system has five tanks , additional tanks are contemplated depending on the circumstances . in principal , the system of fig2 operates similarly to the system of fig1 except that it has a greater number of tanks and also has additional capabilities with respect to tanks t 2 and t n − 1 . again , all tanks most preferably include means to introduce air into the wastewater as well as means to mix the tank contents without aeration . in the same manner , as noted above , there are a series of adjacent tanks t 1 . . . t n that are operatively connected to one another . as before , they need not literally be adjacent to one another , but are shown as such for matters of convenience and as a preferred form that minimizes the footprint of the system and construction materials . wastewater is accordingly free to flow between the individual adjacent tanks , but ultimately is capable of flowing from tank t 1 to tank t n and vice versa . tanks t 1 and t n have inlets i 1 and i n , as well as outlets o 1 and o n as the previous system . the outlets are connected to the filter units in a manner similar to that shown in fig1 . tank t 2 is additionally provided with an no 3 detector nd 2 , as is tank t n − 1 ( nd n − 1 ). a preferred no 3 detector may be obtained from myratek , inc ., for example . further , tanks t 2 and t n − 1 are provided with a connection to inlets i 1 and i n so that they are capable of receiving wastewater from either of those sources . the no 3 detectors nd 2 and nd n − 1 , as well as the inlets i 2 and i n − 1 are connected to the controller in addition to the inlets i 1 and i n , the outlets o 1 and o n , nh 3 / nh 4 + detectors ad 1 and ad n and tss detectors td 1 and td n . the system shown in fig2 also operates in a two - cycle mode wherein in cycle c 1 , inlet i 1 and outlet o n are placed in the on position to receive wastewater into tank t 1 and discharge treated effluent from outlet o n . inlet i n is closed , as is outlet o 1 . preferably , filter f 1 is placed into the clean mode . however , additionally , j and k percent of the amount of wastewater flowing into tank t 1 through inlet i 1 is introduced into tanks t 2 and t n − 1 , respectively . cycle c 1 continues in operation until detector ad 1 detects concentrations of nh 3 / nh 4 + greater than or equal to x , or detector td 1 detects concentrations of tss less than or equal to y , at which point cycle c 1 switches to cycle c 2 . as before , x and y represent concentrations of nh 3 / nh 4 + and tss , respectively . also , cycle c 1 switches to cycle c 2 when the additive concentration detected by detectors nd n − 1 + ad n exceeds or is equal to z , which is the concentration of no 3 + nh 3 detected in tank t n − 1 . further , the controller is connected to the air supply system and , when the concentration a of no 3 in tank t 2 exceeds a selected level , then the air supply is turned off in tank t 2 + 1 . air is off in tanks t 2 and t n − 1 in cycle c 1 . cycle c 2 includes opening inlet i n and outlet o 1 such that wastewater enters into tank t n and flows through the system towards tank t 1 and outwardly thereof . inlet i 1 is off as is outlet o n . preferably , the filter f n is placed into the cleaning mode . also , 1 and m percent of the quantity of wastewater flowing into tank t n through inlet i n is introduced into tanks t 2 and t n − 1 , respectively , through inlets i 2 and i n − 1 , wherein 1 and m are selected percentages of the total quantity of wastewater flowing through inlet i n . air is off in tanks t 2 and t n − 1 in cycle c 2 . the system continues to operate in cycle c 2 until detector ad n or td n detect concentrations of nh 3 / nh 4 + or tss greater than or equal to x or less than or equal to y , respectively , at which point cycle c 2 switches to cycle c 1 . similarly , the system switches from cycle c 2 to cycle c 1 when the concentration of no 3 in tank t 2 plus the concentration of nh 3 / nh 4 + in tank t 1 as detected by detectors nd 2 and ad 1 exceeds or is equal to z , which is a selected concentration . finally , air is supplied to tank t n − 2 until the concentration of no 3 detected by detector nd n − 1 is greater than or equal to concentration a , at which point air is then turned off . referring to fig3 another preferred nutrient removal system is arranged to remove phosphorus . fig3 depicts a system having 5 separate tanks , t 1 , t 2 , t 3 , t n − 1 and t n . while the depicted system has five tanks , any number of additional tanks are contemplated depending on the circumstances . in principal , the system of fig3 operates similarly to the system of fig1 except that it has a greater number of tanks and also has additional capabilities with respect to tanks t 1 and t n . again , all tanks most preferably include means to introduce air into the wastewater as well as means to mix the tanks without aeration . in the same manner , as noted above , there are a series of adjacent tanks t 1 . . . t n that are operatively connected to each other . as before , they do not need to be literally adjacent to one another , but are shown as such for matters of convenience and as a preferred form that minimizes the footprint of the system . wastewater is accordingly free to flow between the individual tanks but ultimately is capable of flowing from tank t 1 to tank t n and vice versa . tanks t 1 and t n have inlets i 1 and i n as well as outlets o 1 and o n as the previous system . the outlets are connected to the filter units in a manner similar to that shown in fig1 . tank t 1 is additionally provided with po 4 detector , pd 1 , as is tank t n ( pd n ). a preferred po 4 detector is chemscan , inc . for example . tanks t 1 and t n are also equipped with tss detectors . the po 4 detectors , pd 1 and pd n as well as the inlets , i 1 and i n , the outlets o 1 and o n , and tss detectors td 1 and td n are connected to the system controller . the system shown in fig3 also operates in a two - cycle mode wherein in cycle c 1 , inlet i 1 and outlet o n are placed in the “ on ” position to receive wastewater into tank t 1 and discharge effluent from outlet o n . inlet i n is closed as is outlet o 1 . preferably , filter f 1 is placed into the clean mode . cycle c 1 continues in operation until detector pd 1 detects a concentration of phosphate less than or equal to x , or detector td 1 detects a concentration of tss less than or equal to y or detector pd n detects a concentration of phosphate greater than or equal to z , at which cycle c 1 switches to cycle c 2 . x and z both represent certain concentrations of phosphate and y represents a concentration of tss . further , the controller is connected to the air supply and influent flow control system such that in cycle c 1 , the air is off and anaerobic conditions are present in t 1 and i 1 and o n are on . also , the air is on in subsequent tanks t 2 through t n . in the same fashion , in cycle c 2 , the air is off and anaerobic conditions are present in t n and i n and o 1 are on . also , the air is on in subsequent tanks t n − 1 through t 1 . cycle c 2 includes opening inlet i n and outlet o 1 such that wastewater enters into tank t n and flows through the system towards tank t 1 and outwardly thereof . inlet i 1 is off as is outlet o n . preferably , the filter f n is placed into the cleaning mode . air is off in tank t n and on in subsequent tanks in cycle c 2 . the system continues to operate in cycle c 2 until detector pd n detects a concentration less than or equal to x or detector td n detects a concentration less than or equal to y or detector pd 1 detects a concentration greater than or equal to z , at which point cycle c 2 switches to cycle c 1 . the above two - cycle operation for the systems shown in fig1 and 3 , as well as other systems contemplated herein , although not shown in the drawings , provides significant advantages over prior systems . the above - described systems provide wastewater that is treated to the degree that it is “ nearly ” potable and could be rendered potable simply by passage of the water through a reverse osmosis membrane , for example . additionally , the above systems do not require the utilization of clarifiers which are commonly used in prior art wastewater treatment systems . this provides the advantage of having an overall system with a smaller footprint , greater reliability , reduced capital expenditures as well as operational and maintenance costs . also , the above - described systems can be highly automated , which reduces the amount of human operator attention required , thereby further reducing operational costs and further reducing operational uncertainties . a still further advantage in the reduction of initial capital investment as well as operational costs is the elimination of the traditional recycle / return systems utilized in conventional systems . also , elimination of such recycle / return systems results in an increase in hrt relative to conventional systems . also , by preselecting or setting the various detector levels , the treated water can virtually be assured of compliance with permits for the particular facility at issue . finally , the system provides for the capability of nutrient removal , which is lacking in many of the prior art systems and provides for the ability to achieve and maintain higher mlss concentration , i . e . 2 - 3 times that of conventional systems , thereby resulting in an increase in treatment capacity per unit volume . although this invention has been described with reference to specific forms of apparatus and method steps , it will be apparent to one of ordinary skill in the art that various equivalents may be substituted , the sequence of steps may be varied , and certain steps may be used independently of others , all without departing from the spirit and scope of the invention defined in the appended claims . | 2 |
the inventive pattern inspection system of the present invention employs a means for fast and efficient storing of enormous circuit - pattern data and a means for fast retrieval of the circuit - pattern data and comparing it with an actual circuit - pattern to be inspected . in fig1 showing the arrangement of the inventive inspection system of the present invention , a reference printed wiring board 1a with the formation of a reference circuit - pattern to be memorized is placed on an x - y stage ( table ) 2 . the circuit - pattern is projected by a convergent lens 3 onto an image sensor 4 ( the illumination system is not shown in the figure ). the x - y stage 2 has its position controlled by a stage controller 5 so that a circuit - pattern at an arbitrary position on the board 1a can viewed by the image sensor 4 . the image sensor 4 is of the auto - scanning type , such as a television camera or linear image sensor , and its scanning operation is controlled by the synchronizing signal 7a produced by the stage controller 5 . the reference image ( pattern ) signal 11a produced by the image sensor 4 is fed through a binary circuit 15 , subjected to data compression in mh system , mr system or m 2 r system by means of a data compressor 6 , and stored in a storage 8 . the storage 8 can be a semiconductor memory , magnetic disk , magnetic tape , or optical disk . the optical disk is particularly suited to store a vast amount of circuit - pattern data . next , the reference board 1a is replaced with a printed wiring board 1b under test on the x - y stage 2 . in inspecting the board 1b , a circuit - pattern at a specific position is picked up by the image sensor 4 and a produced detected pattern signal 11b is compared by means of a comparing inspection circuit 10 with an expanded reference pattern signal 11c equivalent to the reference pattern signal 11a of the same portion which has been stored . the comparing inspection circuit 10 is described in detail in u . s . pat . no . 4 , 148 , 065 . the reference pattern signal 11a is stored in a compressed form in the storage 8 , and therefore it is converted back to the original reference pattern signal by means of a data expander 9 for the sake of comparison with the pattern signal 11b . in order for the data expander 9 to provide pattern data of the same portion as of the detected pattern data 11b , it receives a synchronizing signal 7b from the stage controller 5 . the comparing inspection circuit 10 compares the detected pattern signal 11b with the expanded reference pattern signal 11c . by repeating these operations for several normal printed wiring boards generally having normal patterns , it is possible to confirm that pattern data stored in the storage represent normal printed wiring board . then , the operations are repeated , by using the stored pattern data as a reference pattern data , sequentially for the circuit pattern inspection . in the above system , the data compressor 6 and data expander 9 can be configured as a unitary component . the following describes the synchronization of the expanded reference pattern signal 11c with the detected pattern signal 11b . the detected pattern signal 11b is produced as a result of bidirectional scanning on the surface of the printed wiring board 1b with the image sensor 4 as shown in fig3 b . the image sensor 4 is designed to implement an auto - scanning operation of one line following the advancement of the stage 2 in the y - direction by 1 - pixel interval ( dimensioned by a p ) in response to the synchronizing signal 7a generated by the stage controller 5 . accordingly , when the image sensor 4 picks up a circuit - pattern and the binary data forming circuit 5 transforms the video signal into a binary pixel data , the image data of the circuit pattern , a part of which is shown in fig3 a , is obtained . the image stored in a compressed form has its pixel size ( coordinate value ) in the y direction equal to p , and it is stored with a coordinate y + r retarded by a certain number r of scanning lines , which can be scanned during the time interval corresponding to the process time of the data companding element 12 ( i . e ., a scanning line coordinate generated by the synchronous signal generating means ). in this manner , each pixel is given coordinates , i . e ., addresses , in the x and y directions . next , the comparing inspection for the detected pattern signal 11b resulting from the printed wiring board 1b under test with respect to the expanded reference pattern signal 11a derived from the stored image data is carried out as follows . since the image sensor 4 implements auto - scanning and data expansion in response to the scanning line synchronizing signal 7b which is generated at each advancement of the stage 2 by one pixel interval ( p ), the two signals 11c and 11b are in complete synchronism . namely , the storage reads out pattern data which precedes the current scanning line by a certain number r of lines , i . e ., on line y + r - r = y , and consequently both signals are in synchronism at the comparing means even though time is expended for data compression and expansion . in entering data of the reference printed wiring board 1a , a positioning mark on the board is used to store pattern data at a specified position , while in positioning the inspection start point on the printed wiring board 1b under test , a positioning mark provided at the same position is used , whereby both printed wiring boards 1a and 1b are brought to complete alignment with each other . next , the data compressing , storing and expanding circuits for the reference pattern signal 11a will be described . these circuits are the application of the pattern data companding device ( described in nikkei electronics , p . 193 , published on jan . 28 , 1985 ) which was first marketed in a recent year . as shown in fig2 the reference pattern signal 11a is fed through a read / write switch 13 ( the figure shows the switch in write mode ) to an a1 / a2 selector switch 14 . the a1 / a2 selector switch 14 sends the reference pattern signal 11a in the form of binary pixel data to a buffer memory a1 ( or a2 ) until it is full , and then switches the signal destination to another buffer memory a2 ( or a1 ). the pattern data stored in the buffer memories a1 and a2 is subjected to data compression by data companding elements 12 , as shown in fig5 . fig5 shows on the left - hand side a binary image which has been produced by the binary circuit 15 and stored in the buffer memories a1 and a2 . the hatched portion has a logical value of &# 34 ; 1 &# 34 ; indicating the presence of circuit - pattern , while the blank portion has a logical value of &# 34 ; 0 &# 34 ; indicating the absence of circuit - pattern . fig5 also shows at its right - hand side the compressed pattern data . as shown in fig5 no pattern exists in the scanning line y m - 1 and hence the compressed pattern data is represented by , for example , &# 34 ; 0 &# 34 ;. in the scanning line y m , a signal &# 34 ; 1 &# 34 ; appears at an address x n + 3 and hence a code a indicative of a start address x n + 3 and an end address x n + 3 is obtained from compression of the original data . next , in the scanning line y m + 1 , a signal &# 34 ; 1 &# 34 ; continues from x n + 2 to x n + 4 and hence the data is compressed in the x - direction and represented by a code b indicative of a start address x n + 2 and an end address x n + 4 . in the next scanning line y m + 2 , a code c , for example , is obtained by similar compression of the pattern data . in the scanning line y m + 3 , a code d indicative of a start address x n and an end address x n + 6 is obtained from compression of the data . the next scanning line y m + 4 includes the same pattern as that of the scanning line y m + 3 and hence the data of this line is represented by , for example , a code o indicative of &# 34 ; the same as the preceding line &# 34 ;. the content of the next line y m + 5 , which is different from the content of the line y m + 4 , is represented by the code c indicative of a start address x n + 1 and an end address x n + 5 which is the same as the code of the line y m + 2 . in the next line y m + 6 , the code b is again produced to indicate a start address x n + 2 and an end address x n + 4 , which continues from y m + 6 to y m + 9 . thus , each of the lines y m + 7 to y m + 9 is represented by the code α as mentioned above . the scanning line y m + 10 is represented by the code c indicative of a starting address x n + 1 and an end address x n + 5 . the lines on and after y m + 11 , which include no pattern , are each represented by a compressed pattern data &# 34 ; 0 &# 34 ;. in the process of data compression as mentioned above , it is convenient to represent the code α by a shortest binary code , for example &# 34 ; 1 &# 34 ;. further , the quantity of data after compression can be reduced by representing each of the codes a , b , c . . . by a binary code whose length is determined depending on the frequency in appearance of the corresponding line pattern such that a shorter binary code is used for representing a line pattern which appears more frequently and a longer binary code is used for representing a line pattern which appears less frequently . incidentally , it should be noted that the line address y in the y - direction stored in the memory 8 is represented by the actual address plus r such as y m + r , y m + 1 + r , . . . . the value r is the number of scanning lines necessary for process of data compression and storing , and it is provided by the synchronous signal generating means . through the data compression described above , the amount of data of the original pattern signal 11a can be reduced down to about 4 %. this data reduction to about 4 % is attributable to a large amount of pattern areas that linearly extend along the scanning direction ( x direction ) and the direction ( y direction ) at right angles with the x direction in the case of circuit - patterns on printed wiring boards . each data companding element 12 has a maximum processing speed of 5 mhz , and therefore the use of four elements in parallel can achieve data compression for the reference pattern signal 11a received at a maximum data rate of 20 mhz . the compressed reference binary image data is stored in units of divided regions ( p , q , r and so on ) in a buffer memory b1 ( or b2 ) as shown in fig4 . a b1 / b2 selector switch 15 selects the buffer memories b1 and b2 alternately to transfer the compressed reference binary image data to the storage 8 by way of an interface 16 . in inspecting a printed wiring board 1b , the reference binary image data is retrieved from the storage 8 , expanded back to the original reference binary image data 11a by data companding elements 12 , and it is stored in the buffer memories a1 and a2 . this expanding operation can be accomplished using the data companding elements in a reverse manner thereby taking compressed data and expanding it to its original form . these elements are controlled by the synchronizing signal ( a synchronizing signal causing the image sensor 4 to make an auto - scanning following the advancement of the stage 2 by one pixel ( p )) provided by the stage controller 5 . next , the operation of compressing reference image data and storing the result in the storage 8 will be described with reference to fig4 . in a reference pattern image 20 , an image p produced as a result of scanning for l lines is transferred to the buffer memory a1 . this transfer operation corresponds to the entry of reference pattern signal 11a in fig2 . the data compressor 12 performs compression for data in the buffer memory a1 . in this case , if the stage moves continuously , transfer of the reference pattern signal 11a would continue , but actually the a1 / a2 selector switch 14 is operated to the a2 side so that image data q shown in fig4 is transferred to the buffer memory a2 . these operations are repeated and the detected reference pattern image data 20 is compressed continuously without being lost , whereby fast processing is made possible . in this embodiment , the buffer memories a1 , a2 , b1 and b2 are each divided into four sections so as to achieve parallel processings in data compression from a1 to b1 and data compression from a2 to b2 , with the intention of further speedup of operation . compressed image data 21 is fed through the b1 / b2 selector switch 15 and interface 16 and stored in the storage 8 . as will be appreciated from fig4 the reference pattern image data 20 before compression and the image data 21 after compression are in one - to - one correspondence , and therefore if the reference pattern signal 11a and detected signal 11b are in synchronism , the reference pattern 1a and the pattern 1b under test are brought to a complete alignment , allowing the comparing inspection circuit 10 to detect defects through the comparison of both signals . although in the above embodiment two sets of buffer memories and data companding devices are used , further speedup of operation is of course possible by the provision of more memories and devices . conversely , it is also possible for the system to have only one set of buffer memory and data companding device . it is also possible to operate more data companding elements in parallel , or conversely the number of elements can be reduced to unity . with the intention of easiness of system construction or enhancement of inspection reliability , it is possible to have the coordinates of the starting pixel 22 in each region ( p , q , r , etc .) ( divided into groups of a certain number of lines in the y direction ) of the reference pattern image 20 , appended to the compressed data . the coordinates of the starting pixel 22 is available from the stage controller 5 shown in fig1 . according to this embodiment , the reliability of alignment between the reference printed wiring board 1a and the printed wiring board 1b under test is improved . moreover , the compressed image data 21 has coordinate information for each unit region , and this is effective for readily constructing the function of visual confirmation of pattern shape by expanding the image data . according to this invention , as described above , the capacity of storage for storing data at a resolution of 10 μm - pixel for a printed wiring board with a 600 - by - 500 mm size can be reduced to about 15m bytes from the case without data compression which requires a 375m byte capacity . an optical disk having a capacity of 1 . 31g bytes on one side can store circuit - pattern data of more than 150 printed wiring boards . if a relatively small number of printed wiring boards needs to be memorized , a semiconductor memory or magnetic tape can be used . the introduction of the inventive system of the present invention allows prerecording of circuit - pattern data for small - volume variety products , and inspection can be run without waiting for the manufacturing of the printed wiring board to be compared . the inventive system is particularly suitable for the inspection of printed wiring boards in rich - variety , small - volume production . the comparing inspection for circuit - patterns ensures the reliability of inspection . for a volume production of single - type printed wiring board , the first board is used to memorize reference circuit - pattern data , and it can be applied to the inspection of the following products . | 6 |
reference will now be made in detail to exemplary embodiments of the invention , which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . below examples are used to further describe the invention . the invention is not limited by these examples . dissolved nickel sulfonate and manganese sulfonate in water with a molar ratio of 5 : 5 to get homogenous 1m nickel manganese sulfonate solution . under fast stirring , added the sulfonate solution together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh / ammonia with ph = 11 - 12 . the system ph value was kept at 11 - 12 and temperature was kept at 45 - 55 ° c . the sulfonate solution had been added for 6 hours . then the system had be kept stirring for another 6 hours . the reaction was carried out under nitrogen atmosphere . the reactant was allowed to store in stationary for 36 hours at room temperature . the reactant was then washed using water till ph value reached 7 . it was filtered , and the solid was heat dried at 80 ° c . for 72 hours . the precursor , c - 1aq : ni 0 . 5 mn 0 . 5 ( oh ) 2 , was thus derived . c - 1aq precursor and lithium carbonate ( li 2 co 3 ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in air . the temperature was first increased to 680 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 6 hours , followed increased to 850 - 980 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 15 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material , c1 - a : lini 0 . 5 mn 0 . 5 o 2 , was thus derived . a commercial precursor c - 1 bq : ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh ) 2 ( yuyao sanheng electric power co . ltd .) and lithium mono hydroxide ( lioh — h 2 o ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in oxygen containing atmosphere . the temperature was first increased to 450 - 470 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 6 hours , followed increased to 700 - 800 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 15 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material , cl - b : lini 0 . 8 co 0 . 1 mn 0 . 1 o 2 , was thus derived . the c - 1a and c - 1 b were mixed with equal ratio by ball milling under dry air for 60 minutes . the cathode material c - 1 : 0 . 5 lini 0 . 8 co 0 . 21 mn 0 . 1 o 2 + 0 . 5 lini 0 . 5 mn 0 . 5 o 2 , was thus derived . its xrd spectrum was shown in fig3 . the splits between the diffraction peaks of ( 006 ) and ( 012 ) plane ( 274 ≈ 38 °), and between the diffraction peaks of ( 018 ) and ( 110 ) plane ( 2θ ≈ 65 °) were not clear , indicating low structural regularity . dissolved nickel sulfonate , cobalt sulfonate and manganese sulfonate in water with a molar ration of 6 . 5 : 0 . 5 : 3 to get homogenous 1m nickel cobalt manganese sulfonate solution . under fast stirring , added the sulfonate solution together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh / ammonia with ph = 11 - 12 . the system ph value was kept at 11 - 12 and temperature was kept at 45 - 55 ° c . the sulfonate solution had been added for 6 hours . then the system had be kept stirring for another 6 hours . the reaction was carried out under nitrogen atmosphere . the reactant was allowed to store in stationary for 36 hours at room temperature . the reactant was then washed using water till ph value reached 7 . it was filtered , and the solid was heat dried at 80 ° c . for 72 hours . the precursor , c - 2q : ni 0 . 65 co 0 . 05 mn 0 . 3 ( oh ) 2 , was thus derived . the precursor c - 2q and lithium mono hydroxide ( lioh — h 2 o ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in oxygen containing atmosphere . the temperature was first increased to 450 - 470 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 6 hours , followed increased to 750 - 850 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 15 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material , c - 2 : lini 0 . 65 co 0 . 05 mn 0 . 3 o 2 , was thus derived . its xrd spectrum showed a typical layered structure ( in fig3 ). the splits between the diffraction peaks of ( 006 ) and ( 012 ) plane ( 2θ ≈ 38 °), and between the diffraction peaks of ( 018 ) and ( 110 ) plane ( 2θ ≈ 65 °) were not clear , indicating poor structural regularity . a commercial precursor c - 3q : ni 0 . 33 co 0 . 33 m 0 . 33 ( oh ) 2 ( yuyao sanheng electric power co . ltd .) and lithium carbonate ( li 2 co 3 ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in air . the temperature was first increased to 650 - 680 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 6 hours , followed increased to 850 - 950 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 15 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material , c - 3 : lini 0 . 33 co 0 . 33 mn 0 . 33 o 2 , was thus derived . its xrd spectrum showed a typical layered structure ( fig3 ). the precursor c - 1aq in comparative example 1 and commercial precursor c - 1 bq : ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh ) 2 ( yuyao sanheng electric power co . ltd .) were homogenously mixed with an 1 : 1 ratio . then , the mixture and lithium mono hydroxide ( lioh — h 2 o ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in oxygen containing atmosphere . the temperature was first increased to 450 - 470 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 6 hours , followed increased to 700 - 850 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 15 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material , c - 4 : 0 . 5 lini 0 . 5 co 0 . 1 mn 0 . 1 o 2 + 0 . 5 lini 0 . 5 mn 0 . 5 o 2 , was thus derived . there was no splits between the diffraction peaks of ( 006 ) and ( 012 ) plane ( 2θ ≈ 38 °), and between the diffraction peaks of ( 018 ) and ( 110 ) plane ( 2θ ≈ 65 °) observed in its xrd spectrum ( fig3 ), indicating very poor structural regularity . dissolved nickel sulfonate , cobalt sulfonate and manganese sulfonate in water with a molar ration of 8 : 1 : 1 to get homogenous 4 liters 1m nickel cobalt manganese sulfonate solution ( i ). dissolved nickel sulfonate and manganese sulfonate in water with a molar ration of 5 : 5 to get homogenous 4 liters 1m nickel manganese sulfonate solution ( ii ). under fast stirring , added 2 liters the solution ( i ) with a flow rate of 17 ml / minute together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution with ph = 11 - 12 . the system temperature was kept at 45 - 55 ° c . and ph value was kept at 11 - 12 . after adding the solution ( i ) for 120 minutes , stopped adding solution and stirred for 10 minutes . under fast stirring , added 2 liters the solution ( ii ) with a flow rate of 17 ml / minute together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution with ph = 11 - 12 . the system temperature was kept at 45 - 55 ° c . and ph value was kept at 11 - 12 . after adding the solution ( ii ) for 120 minutes , stopped adding solution and stirred for 10 minutes . the above procedures were repeated one more time , and the total transition metal moles in added solution ( i ) were allowed to equal to the total transition metal moles in added solution ( ii ). after finishing adding all salt solutions , the reactants were stirred for 6 hours . all above reactions were carried out in nitrogen atmosphere . the reactant was allowed to store in stationary for 36 hours at room temperature . the reactant was then washed using water till ph value reached 7 . it was filtered , and the solid was heat dried at 80 ° c . for 72 hours . the precursor , s - 1q : 0 . 5ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh ) 2 - 0 . 5ni 0 . 5 mn 0 . 5 ( oh ) 2 was thus derived . the average composition of the precursor determined by atomic absorption spectrometer ( aas ) was : ni 0 . 652 co 0 . 058 mn 0 . 290 ( oh ) 2 . using x - ray diffraction spectrometer ( xrd ) to analyze the commercial precursor ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh ) 2 , ni 0 . 5 mn 0 . 5 ( oh ) 2 , and precursor s - 1q ( fig1 ), a diffractin peak appeared at around 2θ ≈ 52 ° in s - 1q , which only appeared in ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh ) 2 . this indicated that the precursor s - 1q already had the pre - determined composite structures . the sem measurement showed that precursor s - 1 q had a near spherical morphology ( fig2 a ). the precursor s - 1q and lithium mono hydroxide ( lioh - h 2 o ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in oxygen containing atmosphere . the temperature was first increased to 450 - 470 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 4 hours , followed increased to 750 - 850 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 15 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material s - 1 , 0 . 5lini 0 . 8 co 0 . 1 mn 0 . 1 o 2 - 0 . 5lini 0 . 5 mn 0 . 5 o 2 was thus derived . the average composition of s - 1 determined by atomic absorption spectrometer ( aas ) was : li 1 . 02 ni 0 . 645 co 0 . 06 mn 0 . 295 o 2 . its xrd pattern had typical layered structure ( fig3 ). and it had a near spherical morphology ( fig2 b ). the split between the diffraction peaks of ( 006 ) and ( 012 ) plane ( 2θ ≈ 38 °) was clear , and the split between the diffraction peaks of ( 018 ) and ( 110 ) plane ( 2θ ≈ 65 °) was also clear , indicating good structural regularity . but the above peak splits in comparative example c - 1 , c - 2 and c - 4 were not clear , indicating their poor structural regularity . dissolved nickel sulfonate , cobalt sulfonate and manganese sulfonate in water with a molar ration of 8 : 1 : 1 to get homogenous 4 liters 1m nickel cobalt manganese sulfonate solution ( i ). dissolved nickel sulfonate and manganese sulfonate in water with a molar ration of 5 : 5 to get homogenous 4 liters 1m nickel manganese sulfonate solution ( ii ). under fast stirring , added the solution ( i ) and ( ii ) with the same flow rate ( 34 ml / minute ) respectively together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution with ph = 11 - 12 . the system temperature was kept at 45 - 55 ° c . and ph value was kept at 11 - 12 . after allowing the solution ( i ) and ( ii ) to react with alkaline solution respectively for a short period of time ( not over 30 minutes ), the reactant of solution ( i ) and ( ii ) were mixed . the total transition metal moles in added solution ( i ) were allowed to equal to the total transition metal moles in added solution ( ii ). after finishing adding all salt solutions , the reactants were stirred for 6 hours . all above reactions were carried out in nitrogen atmosphere . the reactant was allowed to store in stationary for 36 hours at room temperature . the reactant was then washed using water till ph value reached 7 . it was filtered , and the solid was heat dried at 80 ° c . for 72 hours . the precursor , s - 2q : 0 . 5ni 0 . 8 co 0 . 1 mn 0 . 1 . ( oh ) 2 - 0 . 5ni 0 . 5 mn 0 . 5 ( oh ) 2 was thus derived . the average composition of the precursor determined by atomic absorption spectrometer ( aas ) was : ni 0 . 652 co 0 . 058 mn 0 . 290 ( oh ) 2 . in its xrd spectrum a diffraction peak appeared at around 2θ52 ° ( fig1 ), indicating that the precursor s - 2q already had the pre - determined composite structures . precursor s - 2q and lithium carbonate ( li 2 co 3 ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in air . the temperature was first increased to 650 - 680 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 6 hours , followed increased to 750 - 850 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 18 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material s - 2 , 0 . 5lini 0 . 8 co 0 . 1 mn 0 . 1 o 2 - 0 . 5lini 0 . 5 mn 0 . 5 o 2 , was thus derived . the average composisiton of s - 2 determined by atomic absorption spectrometer ( aas ) was : li 1 . 02 ni 0 . 660 co 0 . 06 mn 0 . 280 o 2 . its xrd pattern had typical layered structure ( fig3 ). similar to s - 1 , in its xrd the split between the diffraction peaks of ( 006 ) and ( 012 ) plane ( 2θ ≈ 38 °) was clear , and the split between the diffraction peaks of ( 018 ) and ( 110 ) plane ( 2θ65 °) was also clear , indicating good structural regularity . dissolved nickel sulfonate , cobalt sulfonate and manganese sulfonate in water with a molar ration of 8 : 1 : 1 to get homogenous 4 liters 1m nickel cobalt manganese sulfonate solution ( i ). dissolved nickel sulfonate , magnesium sulfonate and manganese sulfonate in water with a molar ration of 4 . 5 : 0 . 5 : 5 to get homogenous 4 liters 1m nickel magnesium manganese sulfonate solution ( ii ). under fast stirring , added the solution ( i ) and ( ii ) with the same flow rate ( 34 ml / minute ) respectively together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution with ph = 11 - 12 . the system temperature was kept at 45 - 55 ° c . and ph value was kept at 11 - 12 . after allowing the solution ( i ) and ( ii ) to react with alkaline solution respectively for a short period of time ( not over 30 minutes ), the reactant of solution ( i ) and ( ii ) were mixed . the total transition metal moles in added solution ( i ) were allowed to equal to the total transition metal moles in added solution ( ii ). after finishing adding all salt solutions , the reactants were stirred for 6 hours . all above reactions were carried out in nitrogen atmosphere . the reactant was allowed to store in stationary for 36 hours at room temperature . the reactant was then washed using water till ph value reached 7 . it was filtered , and the solid was heat dried at 80 ° c . for 72 hours . the precursor , s - 3q : 0 . 5ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh 2 - 0 . 5ni 0 . 45 mg 0 . 05 mn 0 . 5 ( oh ) 2 was thus derived . the average composition of the precursor determined by atomic absorption spectrometer ( aas ) was : ni 0 . 615 mg 0 . 25 co 0 . 56 mn 0 . 304 ( oh ) 2 . in its xrd spectrum a diffraction peak appeared at around 2θ ≈ 52 ° ( fig1 ), indicating that the precursor s - 3q already had the pre - determined composite structures . precursor s - 3q and lithium carbonate ( li 2 co 3 ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in air . the temperature was first increased to 650 - 680 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 6 hours , followed increased to 750 - 850 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 18 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material s - 3 , 0 . 5lini 0 . 8 co 0 . 1 mn 0 . 1 o 2 - 0 . 5lini 0 . 5 mg 0 . 05 mn 0 . 5 o 2 , was thus derived . the average composition of s - 2 determined by atomic absorption spectrometer ( aas ) was : li 1 . 02 ni 0 . 613 mg 0 . 026 co 0 . 058 mn 0 . 303 o 2 . its xrd pattern had typical layered structure ( fig3 ). similar to s - 1 , in its xrd the split between the diffraction peaks of ( 006 ) and ( 012 ) plane ( 2θ ≈ 38 °) was clear , and the split between the diffraction peaks of ( 018 ) and ( 110 ) plane ( 2θ ≈ 65 °) was also clear , indicating good structural regularity . the precursor s - 1q and lithium mono hydroxide ( lioh - h 2 o ) and lithium fluoride were mixed homogeneously in a proportion of : [ lif ]([ lioh - h 2 o ]+[ lif ])= 0 . 01 , and a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in oxygen containing atmosphere . the temperature was first increased to 450 - 470 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 4 hours , followed increased to 750 - 850 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 15 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material s - 4 , 0 . 5lini 0 . 8 co 0 . 1 mn 0 . 1 o 1 . 99 f 0 . 01 - 0 . 5lini 0 . 5 mn 0 . 5 o 1 . 99 f 0 . 01 , was thus derived . the average composition of s - 1 determined by atomic absorption spectrometer ( aas ) was : li 1 . 02 ni 0 . 655 co 0 . 05 mn 0 . 295 o 1 . 99 f 0 . 01 . dissolved nickel nitrate , cobalt nitrate and manganese nitrate in water with a molar ration of 8 : 1 : 1 to get homogenous 3 liters 1m nickel cobalt manganese nitrate solution ( i ). dissolved nickel nitrate and manganese nitrate in water with a molar ration of 5 : 5 to get homogenous 3 liters 1m nickel manganese nitrate solution ( ii ). under fast stirring , added 1 liter the solution ( i ) with a flow rate of 5 ml / minute together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution with ph = 9 - 11 . the system temperature was kept at 25 - 40 ° c . and ph value was kept at 9 - 11 . after adding the solution ( i ) for 200 minutes , stopped adding solution and stirred for 40 minutes . under fast stirring , added 1 liter the solution ( ii ) with a flow rate of 5 ml / minute together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution . the system temperature was kept at 25 - 40 ° c . and ph value was kept at 11 - 12 . after adding the solution ( ii ) for 200 minutes , stopped adding solution and stirred for 40 minutes . the above procedures were repeated two more times , and the total transition metal moles in added solution ( i ) were allowed to equal to the total transition metal moles in added solution ( ii ). after finishing adding all salt solutions , the reactants were stirred for 8 hours . all above reactions were carried out in nitrogen atmosphere . the reactant was allowed to store in stationary for 48 hours at room temperature . the reactant was then washed using water till ph value reached 7 . it was filtered , and the solid was heat dried at 80 ° c . for 72 hours . the precursor , s - 1q : 0 . 5ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh ) 2 - 0 . 5ni 0 . 5 mn 0 . 5 ( oh ) 2 was thus derived . the average composition of the precursor determined by atomic absorption spectrometer ( aas ) was : ni 0 . 652 co 0 . 058 mn 0 . 290 ( oh ) 2 . its xrd was the same as s - 1q in example 1 , indicating that they were the same precursors . the precursor s - 1q and lithium mono hydroxide ( lioh - h 2 o ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in oxygen containing atmosphere . the temperature was first increased to 450 - 470 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 1 hour , followed increased to 600 - 800 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 6 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material s - 1 , 0 . 5lini 0 . 8 co 0 . 1 mn 0 . 1 o 2 - 0 . 5lini 0 . 5 mn 0 . 5 o 2 , was thus derived . the average composition of s - 1 determined by atomic absorption spectrometer ( aas ) was : li 1 . 02 ni 0 . 645 co 0 . 06 mn 0 . 295 o 2 . its xrd was the same as s - 1 in example 1 , indicating that they were the same cathode materials . dissolved nickel sulfonate , cobalt sulfonate and manganese sulfonate in water with a molar ration of 8 : 1 : 1 to get homogenous 9 liters 1m nickel cobalt manganese sulfonate solution ( i ). dissolved nickel sulfonate and manganese sulfonate in water with a molar ration of 5 : 5 to get homogenous 9 liters 1m nickel manganese sulfonate solution ( ii ). under fast stirring , added 4 . 5 liters the solution ( i ) with a flow rate of 10 ml / minute together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution with ph = 11 - 12 . the system temperature was kept at 55 - 65 ° c . and ph value was kept at 11 - 12 . after adding the solution ( i ) for 450 minutes , stopped adding solution and stirred for 30 minutes . under fast stirring , added 4 . 5 liters the solution ( ii ) with a flow rate of 10 ml / minute together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution . the system temperature was kept at 65 ° c . and ph value was kept at 11 - 12 . after adding the solution ( ii ) for 450 minutes , stopped adding solution and stirred for 30 minutes . the above procedures were repeated one more time , and the total transition metal moles in added solution ( i ) were allowed to equal to the total transition metal moles in added solution ( ii ). after finishing adding all salt solutions , the reactants were stirred for 2 hours . the reactant was allowed to store in stationary for 6 hours at room temperature . the reactant was then washed using water till ph value reached 7 . it was filtered , and the solid was heat dried at 80 ° c . for 72 hours . the precursor , s - 1q : 0 . 5ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh ) 2 - 0 . 5ni 0 . 5 mn 0 . 5 ( oh ) 2 was thus derived . the average composition of the precursor determined by atomic absorption spectrometer ( aas ) was : ni 0 . 652 co 0 . 058 mn 0 . 290 ( oh ) 2 . its xrd was the same as s - 1 q in example 1 , indicating that they were the same precursors . the precursor s - 1q and lithium mono hydroxide ( lioh - h 2 o ) were mixed homogeneously with a 1 . 1 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in oxygen containing atmosphere . the temperature was first increased to 450 - 470 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 1 hours , followed increased to 600 - 900 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 48 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material s - 1 , 0 . 5lini 0 . 8 co 0 . 1 mn 0 . 1 o 2 - 0 . 5lini 0 . 5 mn 0 . 5 o 2 , was thus derived . the average composition of s - 1 determined by atomic absorption spectrometer ( aas ) was : li 1 . 02 ni 0 . 645 co 0 . 06 mn 0 . 295 o 2 . its xrd was the same as s - 1 in example 1 , indicating there were the same cathode materials . dissolved nickel oxalate , cobalt oxalate and manganese oxalate in water with a molar ration of 8 : 1 : 1 to get homogenous 4 liters 1m nickel cobalt manganese oxalate solution ( i ). dissolved nickel oxalate and manganese oxalate in water with a molar ration of 5 : 5 to get homogenous 4 liters 1m nickel manganese oxalate solution ( ii ). under fast stirring , added the solution ( i ) and ( ii ) with the same flow rate ( 34 ml / minute ) respectively together with 5m naoh and 10m ammonia solution into alkaline solution containing naoh and ammonia solution with ph = 11 - 12 . the system temperature was kept at 50 - 65 ° c . and ph value was kept at 11 - 12 . after allowing the solution ( i ) and ( ii ) to react with alkaline solution respectively for a short period of time ( not over 30 minutes ), the reactant of solution ( i ) and ( ii ) were mixed . the total transition metal moles in added solution ( i ) were allowed to equal to the total transition metal moles in added solution ( ii ). after finishing adding all salt solutions , the reactants were stirred for 1 hours . all above reactions were carried out in nitrogen atmosphere . the reactant was allowed to store in stationary for 12 hours at room temperature . the reactant was then washed using water till ph value reached 7 . it was filtered , and the solid was heat dried at 80 ° c . for 72 hours . the precursor , s - 2q : 0 . 5ni 0 . 8 co 0 . 1 mn 0 . 1 ( oh ) 2 - 0 . 5ni 0 . 5 mn 0 . 5 ( oh ) 2 was thus derived . the average composition of the precursor determined by atomic absorption spectrometer ( aas ) was : ni 0 . 652 co 0 . 058 mn 0 . 290 ( oh ) 2 . in its xrd was the same as s - 2q in example 2 , indicating that they were the same precursors . precursor s - 2q and lithium carbonate ( li 2 co 3 ) were mixed homogeneously with a 1 . 05 ratio of lithium ion moles and total transition metal moles in the precursor . the mixture was sintered in air . the temperature was first increased to 650 - 680 ° c . with a heating rate of 5 ° c ./ min , and kept at this temperature for 6 hours , followed increased to 750 - 850 ° c . with a heating rate of 2 ° c ./ min , and kept at this temperature for 18 hours . then it was cooled down to room temperature naturally . the sintered product was milled and sieved by 300 mesh sieve . the cathode material s - 2 , 0 . 5lini 0 . 8 co 0 . 1 mn 0 . 1 o 2 - 0 . 5lini 0 . 6 mn 0 . 5 o 2 , was thus derived . the average composition of s - 2 determined by atomic absorption spectrometer ( aas ) was : li 1 . 02 ni 0 . 660 co 0 . 06 mn 0 . 280 o 2 . its xrd was the same as s - 2 in example 2 , indicating the they were the same cathode materials . 94 weight parts of s - 1 , 3 weight parts of conducting reagent acetylene carbon black superp , 3 weight parts of adhesive reagent pvdf were added into 50 weight parts of n - methyl - 2 - pyrrolidone ( nmp ) solvent under stirring to form slurry . the slurry was coated on a 15 micron thick aluminum foil . after drying at 150 ° c . for 30 minutes to remove the solvent , followed by pressing the coated foil by a calendar roll , electrodes with a diameter of 1 . 6 centimeter were made . the coating thickness of the electrode was approximately 60 micrometers , and the coating weight was approximately 30 mini grams . the coin cell size was cr2016 . the anode was a lithium foil with a diameter of 1 . 6 centimeters . the separator was a 150 micron thick porous glass fiber with a diameter of 1 . 8 cm . the electrolyte was ec / dmc / emc - lipf 6 1m . the coin cell was charged to 4 . 30v with a constant current of 15 ma / g ( 0 . 1c ) at ambient temperature ( 22 ° c . ), followed by constant voltage charging at 4 . 30v with charging termination when the current reached 3 ma / g . after resting 10 minutes , it was discharged with a constant current of 15 ma / g ( 0 . 1c ) to 2 . 90v . the 1 st cycle charging and discharging curves of coin cells were shown in fig4 . the measured specific capacity of cathode material s - 1 was 168 mah / g , and the 1 st cycle columbic efficiency was 88 %, which are significantly higher than comparative example s ( table 1 ). 86 weight parts of s - 1 , 7 weight parts of conducting reagent acetylene carbon black superp , 7 weight parts of adhesive reagent pvdf were added into 55 weight parts of n - methyl - 2 - pyrrolidone ( nmp ) solvent under stirring to form slurry . the slurry was double - side coated on a 15 micron thick aluminum foil by a blade in a coater . after drying at 150 ° c . to remove the solvent in an oven , followed by pressing the foil using a calendar roll , electrodes with a length of 54 cm and width of 4 . 2 cm were made . the coating thickness of the electrode was approximately 120 micrometers , and the press density of the composite electrode was 2 . 7 g / cc . the separator was a polyethylene with a thickness of 20 micrometers , the electrolyte was ec / dmc / emc - lipf 6 1m , and the anode was a modified natural graphite ( btr 818 - mb ). the designed capacity of the cell was 700 mah . the cell after processes of drying , electrolyte injection , aging , formation and sealing was charged with a 700 ma ( 1 c ) current to 4 . 2v at ambient temperature ( 22 ° c . ), followed by constant voltage charging at 4 . 2v with charging termination when the current reached 35 ma . the specific capacity of s - 1 cathode material was 142 mah / g measured at 1 c discharging rate . at 5 c current discharging rate , the delivered capacity at 5 c / the delivered capacity at 1 c = 93 %. the charging and discharging curves were shown in fig5 a and 5b . the cycling curves of cells with cycling at 1 c charging and discharging rate were in fig6 . all these properties are significantly improved in comparison to comparative example 1 , 2 and 4 ( table 2 ). accelerating rate calorimetry ( arc ) is a better technique for analysis of the thermal stability of a material and system ( maleki et al ., j . electrochem . soc ., 146 , 3224 ( 1999 )). by measuring exothermic reactions of a system precisely under adiabatic conditions , including generated heat , heat generating rate , the temperature and time for the system thermal runaway and exothermic reaction rate and mechanisms can be derived . the prismatic cell made of s - 1 cathode material at a 4 . 2v fully charged state was loaded in an arc ( thermal hazard technology ). it was heated with a rate of 3 ° c ./ min from a starting point of 30 ° c . the waiting time was set to be 15 min . the self - heating rate curves measured were shown in fig7 . the cell made of s - 1 cathode material had a much lower self - heat rate than comparative examples , indicating it had higher thermal stability and safety than comparative examples . coin cells and prismatic cells made of cathode material s - 2 in example 2 were fabricated measured using the same methods and conditions as in implementing effect example 1 . the specific capacity of cathode material s - 2 was 170 mah / g measured by coin cells at 0 . 1 c ( 15 ma / g ) charging and discharging rate ( charging and discharging range of 2 . 90 - 4 . 30v ), and 1 st cycle columbic efficiency was 88 %, which are significantly higher than comparative example s ( fig4 and table 1 ). the specific capacity of cathode material s - 2 was 157 mah / g measured in prismatic cells at 1 c ( 700 ma ) charging and discharging rate ( charging and discharging range of 2 . 75 - 4 . 20v ). at 5 c current discharging rate , the delivered capacity at 5 c / the delivered capacity at 1 c = 96 %, which is significantly higher than comparative example s ( table 2 ). the charging and discharging curves were shown in fig5 a and 5b . coin cells made of cathode material s - 3 in example 3 were fabricated measured using the same methods and conditions as in implementing effect example 1 . the specific capacity of cathode material s - 3 was 166 mah / g measured by coin cells at 0 . 1 c ( 15 ma / g , charging and discharging range of 2 . 90 - 4 . 30v ), and 1 st cycle columbic efficiency was 85 %, which are significantly higher than comparative example s ( fig4 and table 1 ). coin cells made of made of cathode material s - 4 were fabricated measured using the same methods and conditions as in implementing effect example 1 . the specific capacity of cathode material s - 3 was 164 mah / g measured by coin cells at 0 . 1 c ( 15 ma / g , charging and discharging range of 2 . 90 - 4 . 30 v ), and 1 st cycle columbic efficiency was 85 %, which are significantly higher than comparative example s ( fig4 and table 1 ). implementing effect example 5 measurement of properties of cathode material c - 1 , c - 2 , c - 3 and c - 4 coin cells and prismatic cells made of cathode material c - 1 in comparative example 1 were fabricated measured using the same methods and conditions as in implementing effect example 1 . the specific capacity of cathode material c - 1 was 155 mah / g measured by coin cells at 0 . 1 c ( 15 ma / g ) charging and discharging rate ( charging and discharging range of 2 . 90 - 4 . 30v ), and 1 st cycle columbic efficiency was 85 % ( fig4 and table 1 ). the specific capacity of cathode material c - 1 was 135 mah / g measured in prismatic cells at 1 c ( 700 ma ) charging and discharging rate ( charging and discharging range of 2 . 75 - 4 . 20v ). at 5 c current discharging rate , the delivered capacity at 5 c / the delivered capacity at 1 c = 92 % ( table 2 ). the charging and discharging curves were shown in fig5 a and 5b , and the cycling curve was shown in fig6 . the prismatic cell made of c - 1 cathode material at a 4 . 2v fully charged state was loaded in an arc . it was heated with a rate of 3 ° c ./ min from a starting point of 30 ° c . the waiting time was set to be 15 min . the self - heating rate curves measured were shown in fig7 . coin cells and prismatic cells made of cathode material c - 2 in comparative example 2 were fabricated measured using the same methods and conditions as in implementing effect example 1 . the specific capacity of cathode material c - 2 was 155 mah / g measured by coin cells at 0 . 1 c ( 15 ma / g ) charging and discharging rate ( charging and discharging range of 2 . 90 - 4 . 30v ), and 1 st cycle columbic efficiency was 87 % ( fig4 and table 1 ). the specific capacity of cathode material c - 1 was 108 mah / g measured in prismatic cells at 1 c ( 700 ma ) charging and discharging rate ( charging and discharging range of 2 . 75 - 4 . 20v ). at 5 c current discharging rate , the delivered capacity at 5 c / the delivered capacity at 1 c = 86 % ( table 2 ). the charging and discharging curves were shown in fig5 a and 5b , and the cycling curve was shown in fig6 . coin cells and prismatic cells made of cathode material c - 3 in comparative example 3 were fabricated measured using the same methods and conditions as in implementing effect example 1 . the specific capacity of cathode material c - 3 was 161 mah / g measured by coin cells at 0 . 1 c ( 15 ma / g ) charging and discharging rate ( charging and discharging range of 2 . 90 - 4 . 30v ), and 1 st cycle columbic efficiency was 87 % ( fig4 and table 1 ). the specific capacity of cathode material c - 3 was 146 mah / g measured in prismatic cells at 1 c ( 700 ma ) charging and discharging rate ( charging and discharging range of 2 . 75 - 4 . 20v ). at 5 c current discharging rate , the delivered capacity at 5 c / the delivered capacity at 1 c = 96 % ( table 2 ). the charging and discharging curves were shown in fig5 a and 5b . the prismatic cell made of c - 3 cathode material at a 4 . 2v fully charged state was loaded in an arc . it was heated with a rate of 3 ° c ./ min from a starting point of 30 ° c . the waiting time was set to be 15 min . the self - heating rate curves measured were shown in fig7 . coin cells made of cathode material c - 4 in comparative example 4 were fabricated measured using the same methods and conditions as in implementing effect example 1 . the specific capacity of cathode material c - 4 was 88 mah / g measured by coin cells at 0 . 1 c ( 15 ma / g , charging and discharging range of 2 . 90 - 4 . 30v ), and 1 st cycle columbic efficiency was 57 % ( table 1 ). | 7 |
all patent applications , patents , and literature references cited in this specification are hereby incorporated by reference in their entirety . in the case of conflict , the present description , including definitions , is intended to control . 1 . “ nucleic acid ” or “ polynucleotide ” as used herein refers to purine - and pyrimidine - containing polymers of any length , either polyribonucleotides or polydeoxyribonucleotides or mixed polyribopolydeoxyribo nucleotides . this includes single - and double - stranded molecules , i . e ., dna - dna , dna - rna and rna - rna hybrids , as well as “ protein nucleic acids ” ( pna ) formed by conjugating bases to an amino acid backbone . this also includes nucleic acids containing modified bases ( see below ). 2 . “ complementary dna or cdna ” as used herein refers to a dna molecule or sequence that has been enzymatically synthesized from the sequences present in a mrna template , or a clone of such a dna molecule . a “ dna construct ” is a dna molecule or a clone of such a molecule , either single - or double - stranded , which has been modified to contain segments of dna that are combined and juxtaposed in a manner that would not otherwise exist in nature . by way of non - limiting example , a cdna or dna which has no introns , i . e ., is free from non - coding sequences , is inserted adjacent to , or within , exogenous ( e . g ., heterologous ) dna sequences . 3 . a plasmid or , more generally , a vector or “ expression vector ”, is a dna construct containing genetic information that may provide for its replication when inserted into a host cell . a plasmid generally contains at least one gene sequence to be expressed in the host cell , as well as sequences that facilitate such gene expression , including promoters and transcription initiation sites . it may be a linear or closed circular molecule . inserted coding sequences do not occur naturally in the organism from which the vector is derived . 4 . nucleic acids are “ hybridizable ” to each other when at least one strand of one nucleic acid can anneal to another nucleic acid under defined stringency conditions . stringency of hybridization is determined , e . g ., by a ) the temperature at which hybridization and / or washing is performed , and b ) the ionic strength and polarity ( e . g ., formamide ) of the hybridization and washing solutions , as well as other parameters . hybridization requires that the two nucleic acids contain substantially complementary sequences ; depending on the stringency of hybridization , however , mismatches may be tolerated . typically , hybridization of two sequences at high stringency ( such as , for example , in an aqueous solution of 0 . 5 × ssc , at 65 ° c .) requires that the sequences exhibit some high degree of complementarity over their entire sequence . conditions of intermediate stringency ( such as , for example , an aqueous solution of 2 × ssc at 65 ° c .) and low stringency ( such as , for example , an aqueous solution of 2 × ssc at 55 ° c . ), require correspondingly less overall complementarily between the hybridizing sequences . ( 1 × ssc is 0 . 15 m nacl , 0 . 015 m na citrate ). 5 . an “ isolated ” nucleic acid or polypeptide as used herein refers to a component that is removed from its original environment ( for example , its natural environment if it is naturally occurring ). an isolated nucleic acid or polypeptide contains less than about 50 %, preferably less than about 75 %, and most preferably less than about 90 %, of the cellular components with which it was originally associated . 6 . a “ probe ” refers to a nucleic acid that forms a hybrid structure with a sequence in a target region due to complementarily of at least one sequence in the probe with a sequence in the target region . 7 . a nucleic acid that is “ derived from ” a designated sequence refers to a nucleic acid sequence that corresponds to a region of the designated sequence . this encompasses sequences that are homologous or complementary to the sequence , as well as “ sequence - conservative variants ” and “ function - conservative variants ”. sequence - conservative variants are those in which a change of one or more nucleotides in a given codon position results in no alteration in the amino acid encoded at that position . function - conservative variants of c2gnt3 are those in which a given amino acid residue in the polypeptide has been changed without altering the overall conformation and enzymatic activity ( including substrate specificity ) of the native polypeptide ; these changes include , but are not limited to , replacement of an amino acid with one having similar physico - chemical properties ( such as , for example , acidic , basic , hydrophobic , and the like ). 8 . a “ donor substrate ” is a molecule recognized by , e . g ., a core - β1 , 6 - n - acetylglucosaminyltransferase and that contributes an n - acetylglucosaminyl moiety for the transferase reaction . for c2gnt3 , a donor substrate is udp - n - acetylglucosamine . an “ acceptor substrate ” is a molecule , preferably a saccharide or oligosaccharide , that is recognized by , e . g ., an n - acetylglucosaminyltransferase and that is the target for the modification catalyzed by the transferase , i . e ., receives the n - acetylglucosaminyl moiety . for c2gnt3 , acceptor substrates include without limitation oligosaccharides , glycoproteins , o - linked core 1 - glycopeptides , and glycosphingolipids comprising the sequences galβ1 - 3galnac , or glcnacβ1 - 3galnac . 9 . in accordance with the present invention there may be employed conventional molecular biology , microbiology , and recombinant dna techniques within the skill of the art . such techniques are explained fully in the literature . see for example , sambrook , fritsch , maniatis , molecular cloning : a laboratory manual , second edition ( 1989 ) cold spring harbor laboratory press , cold spring harbor , n . y ); dna cloning : a practical approach , volumes i and ii ( d . n . glover ed . 1985 ); oligonucleotide synthesis ( m . j . gait ed . 1984 ); nucleic acid hybridization b . d . hames & amp ; s . j . higgins eds . ( 1985 ); transcription and translation b . d . hames & amp ; s . j . higgins eds ( 1984 ); animal cell culture r . i . freshney , ed . ( 1986 ); immobilized cells and enzymes irl press , ( 1986 ); and b . perbal , a practical guide to molecular cloning ( 1984 ). 10 . the terms “ sequence similarity ” or “ sequence identity ” refer to the relationship between two or more amino acid or nucleic acid sequences , determined by comparing the sequences , which relationship is generally known as “ homology ”. identity in the art also means the degree of sequence relatedness between amino acid or nucleic acid sequences , as the case may be , as determined by the match between strings of such sequences . both identity and similarity can be readily calculated ( computational molecular biology , lesk , a . m ., ed ., oxford university press new york , 1988 ; biocomputing : informatics and genome projects , smith , d . w . ed ., academic press , new york , 1993 ; computer analysis of sequence data , part i , griffin , a . m ., and griffin , h . g . eds . humana press , new jersey , 1994 ; sequence analysis in molecular biology , von heinje , g ., academic press , new york , 1987 ; and sequence analysis primer , gribskov , m . and devereux , s ., eds . m . stockton press , new york , 1991 ). while there are a number of existing methods to measure identity and similarity between two amino acid sequences or two nucleic acid sequences , both terms are well known to the skilled artisan ( sequence analysis in molecular biology , von hinge , g ., academic press , new york , 1987 ; sequence analysis primer , gribskov , m . and devereux , j ., eds . m . stockton press , new york , 1991 ; and carillo , h ., and lipman , d . siam j . applied math ., 48 . 1073 , 1988 ). preferred methods for determining identity are designed to give the largest match between the sequences tested . methods to determine identity are codified in computer programs . preferred computer program methods for determining identity and similarity between two sequences include but are not limited to the gcg program package ( 20 ), blastp , blastn , and fasta ( 21 ). identity or similarity may also be determined using the alignment algorithm of dayhoff et al . ( methods in enzymology 91 : 524 - 545 ( 1983 )]. preferably the nucleic acids of the present invention have substantial sequence identity using the preferred computer programs cited herein , for example greater than 40 %, 45 %, 50 %, 60 %, 70 %, 75 %, 80 %, 85 %, or 90 % identity ; more preferably at least 95 %, 96 %, 97 %, 98 %, or 99 % sequence identity to the sequence shown in seq id no : 1 and fig1 . 11 . the polypeptides of the invention also include homologs of a c2gnt3 polypeptide and / or truncations thereof as described herein . such homologs include polypeptides whose amino acid sequences are comprised of the amino acid sequences of c2gnt3 polypeptide regions from other species that hybridize under selected hybridization conditions ( see discussion of hybridization conditions in particular stringent hybridization conditions herein ) with a probe used to obtain a c2gnt3 polypeptide or to seq id no : 1 . these homologs will generally have the same regions which are characteristic of a c2gnt3 polypeptide . it is anticipated that a polypeptide comprising an amino acid sequence which has at least 40 % identity , at least 45 %, or at least 60 % similarity , preferably at least 60 - 65 % identity or at least 80 - 85 % similarity , more preferably at least 70 - 80 % identity or at least 90 - 95 % similarity , most preferably at least 95 % identity or at least 99 % similarity with the amino acid sequence shown in seq id no : 2 and fig1 and 2 , will be a homolog of a c2gnt3 polypeptide . a percent amino acid sequence similarity or identity is calculated using the methods described herein , preferably the computer programs described herein . the present invention provides the isolated dna molecules , including genomic dna and cdna , encoding the udp - n - acetylglucosamine : n - acetylgalactosamine β1 , 6 n - acetylglucosaminyl - transferase 3 ( c2gnt3 ). c2gnt3 was identified by analysis of genomic survey sequences ( gss ), and cloned based on a genomic clone obtained from a human foreskin fibroblast library . the cloning strategy may be briefly summarized as follows : 1 ) isolation and sequencing of gss clone cit - hsp - 2288b17 . tf ( gss genbank accession number aq005888 ); 2 ) synthesis of oligonucleotides derived from gss sequence information , designated tshc96 and tshc101 ; 3 ) identification , cloning and sequencing of genomic p1 clone gs22597 # 844 / b1 ; 4 ) identification of a novel cdna sequence corresponding to c2gnt3 ; 5 ) confirmatory sequencing of a cdna clone obtained by reverse - transcription - polymerase chain reaction ( rt - pcr ) using human thymus poly a - mrna ; 6 ) construction of expression constructs ; 7 ) expression of the cdna encoding c2gnt3 in sf9 ( spodoptera frugiperda ) cells . more specifically , the isolation of a representative dna molecule encoding a novel third member of the mammalian udp - n - acetylglucosamine : β - n - actylgalactosamine β1 , 6 - n - acetylglucosaminyltransferase family involved the following procedures described below . database searches were performed with the coding sequence of the human c2 / 4gnt ( c2gnt2 ) sequence ( 13 ) using the blastn and the tblastn algorithm with the gss database at the national center for biotechnology information , usa . the blastn algorithm was used to identify clones representing the query gene ( identities of ≧ 95 %), whereas tblastn was used to identify non - identical , but similar gss sequences . gsss with 50 - 90 % nucleotide sequence identity were regarded as different from the query sequence . two gss clones with several apparent short sequence motifs and cysteine residues arranged with similar spacing were selected for further sequence analysis . gss clone cit - hsp - 2288b17 . tf ( gss genbank accession number aq005888 ), derived from a putative homologue to c2 / 4gnt ( c2gnt2 ), was obtained from research genetics inc ., usa . sequencing of this clone revealed a partial open reading frame with significant sequence similarity to c2 / 4gnt ( c2gnt2 ). the coding region of human c2gnt - l ( c2gnt1 ), c2 / 4gnt ( c2gnt2 ) and a bovine homologue was previously found to be organized in one exon (( 22 ),( 15 )). since the 3 ′ sequence available from the c2gnt3 gss was incomplete but likely to be located in a single exon , the missing 3 ′ portion of the open reading frame was obtained by sequencing a genomic p1 clone . the p1 clone was obtained from a human foreskin genomic p1 library ( dupont merck pharmaceutical co . human foreskin fibroblast p1 library ) by screening with the primer pair : tshc96 ( 5 ′- ggtttcaccgtctccaacata - 3 ′, seq id no : 3 ) and tshc101 ( 5 ′- tcgtaaggcacctgatactt - 3 ′, seq id no : 6 ). one genomic clone for c2gnt3 , gs22597 # 844 / b1 was obtained from genome systems inc . dna from p1 phage was prepared as recommended by genome systems inc . the entire coding sequence of the c2gnt3 gene was represented in the clone and sequenced in full using automated sequencing ( abi377 , perkin - elmer ). confirmatory sequencing was performed on a cdna clone obtained by pcr ( 30 cycles at 95 ° c . for 10 sec ; 55 ° c . for 15 sec and 68 ° c . for 2 min 30 sec ) on cdna from human thymus poly a - mrna with the sense primer : the composite sequence contained an open reading frame of 1359 base pairs encoding a putative protein of 453 amino acids with type ii domain structure predicted by the tmpred - algorithm at the swiss institute for experimental cancer research ( isrec ). an expression construct designed to encode amino acid residues 39 - 453 of c2gnt3 was prepared by pcr using p1 dna , and the primer pair : tshc100 ( 5 ′- cgaggatccgcaaaaagacatttacttggtt - 3 ′, seq id no : 5 ) and tshc121 ( 5 ′- agcgaattcttactatcatgatgtggtagtg - 3 ′, seq id no : 9 ) with bamh1 and ecori restriction sites , respectively ( fig2 ). the pcr product was cloned between the bamhi and ecori sites of pacgp67a ( pharmingen ), and the insert was fully sequenced . pacgp67 - c2gnt3 - sol was co - transfected with baculo - gold ™ dna ( pharmingen ) as described previously ( 23 ). recombinant baculovirus was obtained after two successive amplifications in sf9 cells grown in serum - containing medium , and titers of virus were estimated by titration in 24 - well plates with monitoring of enzyme activities . transfection of sf9 - cells with pacgp67 - c2gnt3 - sol resulted in marked increase in glcnac - transferase activity compared to uninfected cells or cells infected with a control construct . c2gnt3 showed significant activity with disaccharide derivatives of o - linked core 1 ( galβ1 - 3galnacα1 - r ). in contrast , no activity was found with core 3 structures ( glcnacβ1 - 3galnacα1 - r ), lacto - n - neotetraose as well as glcnacβ1 - 3gal - me as acceptor substrates indicating that c2gnt3 has no core4gnt and ignt - activity . additionally , no activity could be detected wih α - d - galnac - 1 - para - nitrophenyl indicating that c2gnt3 does not form core 6 ( glcnacβ1 - 6galnacα1 - r ) ( table i ). no substrate inhibition of enzyme activity was found at high acceptor concentrations up to 20 mm core 1 - para - nitrophenyl . c2gnt3 shows strict donor substrate specificity for udp - glcnac , no activity could be detected with udp - gal or udp - galnac ( data not shown ). table i substrate specificities of c2gnt3 and c2gnt1 c2gnt3 a c2gnt1 substrate 2 mm 10 mm 2 mm 10 mm nmol / h / mg nmol / h / mg β - d - gal -( 1 - 3 )- α - d - galnac 6 . 6 14 . 3 9 . 6 19 . 0 β - d - gal -( 1 - 3 )- α - d - galnac - 1 - p - nph 18 . 1 26 . 1 16 . 2 23 . 6 β - d - glcnac -( 1 - 3 )- α - d - galnac - 1 - p - nph & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 α - d - galnac - 1 - p - nph & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 d - galnac & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 lacto - n - neo - tetraose & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 β - d - glcnac -( 1 - 3 )- β - d - gal - 1 - me & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 & lt ; 0 . 1 controls included the pacgp67 - galnac - t3 - sol ( 24 ). the kinetic properties were determined with partially purified enzymes expressed in high five ™ cells . partial purification was performed by consecutive chromatography on amberlite ira - 95 , deae - sephacryl and sp - sepharose essentially as described ( 25 ; 25 ). a human rna master blot containing mrna from fifty healthy human adult and fetal organs ( clontech ) and a human multiple tissue northern blot ( mtnii from clontech ) were probed with a 32 p - labeled probe corresponding to the soluble fragment of c2gnt3 ( base pairs 115 - 1359 ). the autoradiographic analyses showed expression of c2gnt3 predominantly in lymphoid organs and in organs of the gastrointestinal tract with high transcription levels observed in thymus , and lower levels in pbls , lymph node , stomach , pancreas and small intestine ( fig3 a and 3b ). the size of the single transcript was approximately 5 . 5 kilobases , which correlates to the transcript size of 5 . 4 kilobases of the biggest of three transcripts of human c2gnt1 ( fig3 c ). multiple transcripts of c2gnt1 have been suggested to be caused by differential usage of polyadenylation signals , which affects the length of the 3 ′ utr ( 13 ). the c2gnt3 enzyme of the present invention was shown to exhibit o - glycosylation capacity implying that the c2gnt3 gene is vital for correct / full o - glycosylation in vivo as well . a structural defect in the c2gnt3 gene leading to a deficient enzyme or completely defective enzyme would therefore expose a cell or an organism to protein / peptide sequences which were not covered by o - glycosylation as seen in cells or organisms with intact c2gnt3 gene . described in example 5 below is a method for scanning the coding exon for potential structural defects . similar methods could be used for the characterization of defects in the non - coding region of the c2gnt3 gene including the promoter region . in practicing the present invention , many conventional techniques in molecular biology , microbiology , recombinant dna , and immunology , are used . such techniques are well known and are explained fully in , for example , sambrook et al ., 1989 , molecular cloning a laboratory manual , second edition , cold spring harbor laboratory press , cold spring harbor , new york ; dna cloning : a practical approach , volumes i and ii , 1985 ( d . n . glover ed . ); oligonucleotide synthesis , 1984 , ( m . l . gait ed . ); nucleic acid hybridization , 1985 , ( hames and higgins ); transcription and translation , 1984 ( hames and higgins eds . ); animal cell culture , 1986 ( r . i . freshney ed . ); immobilized cells and enzymes , 1986 ( irl press ); perbal , 1984 , a practical guide to molecular cloning ; the series , methods in enzymology ( academic press , inc . ); gene transfer vectors for mammalian cells , 1987 ( j . h . miller and m . p . calos eds ., cold spring harbor laboratory ); methods in enzymology vol . 154 and vol . 155 ( wu and grossman , and wu , eds ., respectively ); immunochemical methods in cell and molecular biology , 1987 ( mayer and waler , eds ; academic press , london ); scopes , 1987 , protein purification : principles and practice , second edition ( springer - verlag , n . y .) and handbook of experimental immunology , 1986 , volumes i - iv ( weir and blackwell eds .). the invention encompasses isolated nucleic acid fragments comprising all or part of the nucleic acid sequence disclosed herein as set forth in fig1 . the fragments are at least about 8 nucleotides in length , preferably at least about 12 nucleotides in length , and most preferably at least about 15 - 20 nucleotides in length . the invention further encompasses isolated nucleic acids comprising sequences that are hybridizable under stringency conditions of 2 × ssc , 55 ° c ., to the sequence set forth in fig1 ; preferably , the nucleic acids are hybridizable at 2 × ssc , 65 ° c . ; and most preferably , are hybridizable at 0 . 5 × ssc , 65 ° c . the nucleic acids may be isolated directly from cells . alternatively , the polymerase chain reaction ( pcr ) method can be used to produce the nucleic acids of the invention , using either chemically synthesized strands or genomic material as templates . primers used for pcr can be synthesized using the sequence information provided herein and can further be designed to introduce appropriate new restriction sites , if desirable , to facilitate incorporation into a given vector for recombinant expression . the nucleic acids of the present invention may be flanked by natural human regulatory sequences , or may be associated with heterologous sequences , including transcriptional control elements such as promoters , enhancers , and response elements , or other sequences such as signal sequences , polyadenylation sequences , introns , 5 ′- and 3 ′- noncoding regions , and the like . preferably , although not necessarily , any two nucleotide sequences to be expressed as a fusion polypeptide are inserted in - frame . the nucleic acids may also be modified by many means known in the art . non - limiting examples of such modifications include methylation , “ caps ”, substitution of one or more of the naturally occurring nucleotides with an analog , internucleotide modifications such as , for example , those with uncharged linkages ( e . g ., methyl phosphonates , phosphotriesters , phosphoroamidates , carbamates , etc .) and with charged linkages ( e . g ., phosphorothioates , phosphorodithioates , etc .). nucleic acids may contain one or more additional covalently linked moieties , such as , for example , proteins ( e . g ., nucleases , toxins , antibodies , signal peptides , poly - l - lysine , etc . ), intercalators ( e . g ., acridine , psoralen , etc . ), chelators ( e . g ., metals , radioactive metals , iron , oxidative metals , etc . ), and alkylators . the nucleic acid may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage . furthermore , the nucleic acid sequences of the present invention may also be modified with a label capable of providing a detectable signal , either directly or indirectly . exemplary labels include radioisotopes , fluorescent molecules , biotin , and the like . according to the present invention , useful probes comprise a probe sequence at least eight nucleotides in length that consists of all or part of the sequence from among the sequences as set forth in fig1 or sequence - conservative or function - conservative variants thereof , or a complement thereof , and that has been labelled as described above . the invention also provides nucleic acid vectors comprising the disclosed sequence or derivatives or fragments thereof . a large number of vectors , including plasmid and fungal vectors , have been described for replication and / or expression in a variety of eukaryotic and prokaryotic hosts , and may be used for gene therapy as well as for simple cloning or protein expression . recombinant cloning vectors will often include one or more replication systems for cloning or expression , one or more markers for selection in the host , e . g . antibiotic resistance , and one or more expression cassettes . the inserted coding sequences may be synthesized by standard methods , isolated from natural sources , or prepared as hybrids , etc . ligation of the coding sequences to transcriptional regulatory elements and / or to other amino acid coding sequences may be achieved by known methods . suitable host cells may be transformed / transfected / infected as appropriate by any suitable method including electroporation , cacl 2 mediated dna uptake , fungal infection , microinjection , microprojectile , or other established methods . appropriate host cells included bacteria , archaebacteria , fungi , especially yeast , and plant and animal cells , especially mammalian cells . also included are avian and insect cells . of particular interest are saccharomyces cerevisiae , schizosaccharomyces pombe , pichia pastoris , hansenula polymorpha , neurospora spec ., sf9 cells , c129 cells , 293 cells , and cho cells , cos cells , hela cells , and immortalized mammalian myeloid and lymphoid cell lines . preferred replication systems include m13 , cole1 , 2μ , ars , sv40 , baculovirus , lambda , adenovirus , and the like . a large number of transcription initiation and termination regulatory regions have been isolated and shown to be effective in the transcription and translation of heterologous proteins in the various hosts . examples of these regions , methods of isolation , manner of manipulation , etc . are known in the art . under appropriate expression conditions , host cells can be used as a source of recombinantly produced c2gnt3 derived peptides and polypeptides . advantageously , vectors may also include a transcription regulatory element ( i . e ., a promoter ) operably linked to the c2gnt3 coding portion . the promoter may optionally contain operator portions and / or ribosome binding sites . non - limiting examples of bacterial promoters compatible with e . coli include : β - lactamase ( penicillinase ) promoter ; lactose promoter ; tryptophan ( trp ) promoter ; arabinose bad operon promoter ; lambda - derived p 1 promoter and n gene ribosome binding site ; and the hybrid tac promoter derived from sequences of the trp and lac uv5 promoters . non - limiting examples of yeast promoters include 3 - phosphoglycerate kinase promoter , glyceraldehyde - 3 phosphate dehydrogenase ( gapdh ) promoter , galactokinase ( gal1 ) promoter , galactoepimerase ( gal10 ) promoter , metallothioneine ( cup ) promoter and alcohol dehydrogenase ( adh ) promoter . suitable promoters for mammalian cells include without limitation viral promoters such as that from simian virus 40 ( sv40 ), rous sarcoma virus ( rsv ), adenovirus ( adv ), and bovine papilloma virus ( bpv ). mammalian cells may also require terminator sequences and poly a addition sequences and enhancer sequences which increase expression may also be included ; sequences which cause amplification of the gene may also be desirable . furthermore , sequences that facilitate secretion of the recombinant product from cells , including , but not limited to , bacteria , yeast , and animal cells , such as secretory signal sequences and / or prohormone pro region sequences , may also be included . these sequences are known in the art . nucleic acids encoding wild type or variant polypeptides may also be introduced into cells by recombination events . for example , such a sequence can be introduced into a cell , and thereby effect homologous recombination at the site of an endogenous gene or a sequence with substantial identity to the gene . other recombination - based methods such as nonhomologous recombinations or deletion of endogenous genes by homologous recombination may also be used . the nucleic acids of the present invention find use , for example , as probes for the detection of c2gnt3 in other species or related organisms and as templates for the recombinant production of peptides or polypeptides . these and other embodiments of the present invention are described in more detail below . the present invention encompasses isolated peptides and polypeptides encoded by the disclosed cdna sequence . peptides are preferably at least five residues in length . nucleic acids comprising protein - coding sequences can be used to direct the recombinant expression of polypeptides in intact cells or in cell - free translation systems . the known genetic code , tailored if desired for more efficient expression in a given host organism , can be used to synthesize oligonucleotides encoding the desired amino acid sequences . the phosphoramidite solid support method of ( 26 ), the method of ( 27 ), or other well known methods can be used for such synthesis . the resulting oligonucleotides can be inserted into an appropriate vector and expressed in a compatible host organism . the polypeptides of the present invention , including function - conservative variants of the disclosed sequence , may be isolated from native or from heterologous organisms or cells ( including , but not limited to , bacteria , fungi , insect , plant , and mammalian cells ) into which a protein - coding sequence has been introduced and expressed . furthermore , the polypeptides may be part of recombinant fusion proteins . methods for polypeptide purification are well known in the art , including , without limitation , preparative discontiuous gel elctrophoresis , isoelectric focusing , hplc , reversed - phase hplc , gel filtration , ion exchange and partition chromatography , and countercurrent distribution . for some purposes , it is preferable to produce the polypeptide in a recombinant system in which the protein contains an additional sequence tag that facilitates purification , such as , but not limited to , an affinity ligand , reactive group , and / or a polyhistidine sequence . the polypeptide can then be purified from a crude lysate of the host cell by chromatography on an appropriate solid - phase matrix . alternatively , antibodies produced against a protein or against peptides derived therefrom can be used as purification reagents . other purification methods are possible . the present invention also encompasses derivatives and homologues of polypeptides . for some purposes , nucleic acid sequences encoding the peptides may be altered by substitutions , additions , or deletions that provide for finctionally equivalent molecules , i . e ., function - conservative variants . for example , one or more amino acid residues within the sequence can be substituted by another amino acid of similar properties , such as , for example , positively charged amino acids ( arginine , lysine , and histidine ); negatively charged amino acids ( aspartate and glutamate ); polar neutral amino acids ; and non - polar amino acids . the isolated polypeptides may be modified by , for example , phosphorylation , sulfation , acylation , or other protein modifications . they may also be modified with a label capable of providing a detectable signal , either directly or indirectly , including , but not limited to , radioisotopes and fluorescent compounds . the present invention encompasses antibodies that specifically recognize immunogenic components derived from c2gnt3 . such antibodies can be used as reagents for detection and purification of c2gnt3 . c2gnt3 specific antibodies according to the present invention include polyclonal and monoclonal antibodies . the antibodies may be elicited in an animal host by immunization with c2gnt3 components or may be formed by in vitro immunization of immune cells . the immunogenic components used to elicit the antibodies may be isolated from human cells or produced in recombinant systems . the antibodies may also be produced in recombinant systems programmed with appropriate antibody - encoding dna . alternatively , the antibodies may be constructed by biochemical reconstitution of purified heavy and light chains . the antibodies include hybrid antibodies ( i . e ., containing two sets of heavy chain / light chain combinations , each of which recognizes a different antigen ), chimeric antibodies ( i . e ., in which either the heavy chains , light chains , or both , are fusion proteins ), and univalent antibodies ( i . e ., comprised of a heavy chain / light chain complex bound to the constant region of a second heavy chain ). also included are fab fragments , including fab ′ and f ( ab ) 2 fragments of antibodies . methods for the production of all of the above types of antibodies and derivatives are well known in the art . for example , techniques for producing and processing polyclonal antisera are disclosed in mayer and walker , 1987 , immunochemical methods in cell and molecular biology , ( academic press , london ). the antibodies of this invention can be purified by standard methods , including but not limited to preparative disc - gel elctrophoresis , isoelectric focusing , hplc , reversed - phase hplc , gel filtration , ion exchange and partition chromatography , and countercurrent distribution . purification methods for antibodies are disclosed , e . g ., in the art of antibody purification , 1989 , amicon division , w . r . grace & amp ; co . general protein purification methods are described in protein purification : principles and practice , r . k . scopes , ed ., 1987 , springer - verlag , new york , n . y . anti c2gnt3 antibodies , whether unlabeled or labeled by standard methods , can be used as the basis for immunoassays . the particular label used will depend upon the type of immunoassay used . examples of labels that can be used include , but are not limited to , radiolabels such as 32 p , 125 i , 3 h and 14 c ; fluorescent labels such as fluorescein and its derivatives , rhodamine and its derivatives , dansyl and umbelliferone ; chemiluminescers such as luciferia and 2 , 3 - dihydrophthalazinediones ; and enzymes such as horseradish peroxidase , alkaline phosphatase , lysozyme and glucose - 6 - phosphate dehydrogenase . the antibodies can be tagged with such labels by known methods . for example , coupling agents such as aldehydes , carbodiimides , dimaleimide , imidates , succinimides , bisdiazotized benzadine and the like may be used to tag the antibodies with fluorescent , chemiluminescent or enzyme labels . the general methods involved are well known in the art and are described in , e . g ., chan ( ed . ), 1987 , immunoassay : a practical guide , academic press , inc ., orlando , fla . the nucleic acid molecules , c2gnt3 polypeptide , and antibodies of the invention may be used in the prognostic and diagnostic evaluation of conditions associated with altered expression or activity of a polypeptide of the invention or conditions requiring modulation of a nucleic acid or polypeptide of the invention including thymus - related disorders and proliferative disorders ( e . g . cancer ), and the identification of subjects with a predisposition to such conditions ( see below ). methods for detecting nucleic acid molecules and polypeptides of the invention can be used to monitor such conditions by detecting and localizing the polypeptides and nucleic acids . it would also be apparent to one skilled in the art that the methods described herein may be used to study the developmental expression of the polypeptides of the invention and , accordingly , will provide further insight into the role of the polypeptides . the applications of the present invention also include methods for the identification of substances or compounds that modulate the biological activity of a polypeptide of the invention ( see below ). the substances , compounds , antibodies etc ., may be used for the treatment of conditions requiring modulation of polypeptides of the invention ( see below ). a variety of methods can be employed for the diagnostic and prognostic evaluation of conditions requiring modulation of a nucleic acid or polypeptide of the invention ( e . g . thymus - related disorders , and cancer ), and the identification of subjects with a predisposition to such conditions . such methods may , for example , utilize nucleic acids of the invention , and fragments thereof , and antibodies directed against polypeptides of the invention , including peptide fragments . in particular , the nucleic acids and antibodies may be used , for example , for : ( 1 ) the detection of the presence of c2gnt3 mutations , or the detection of either over - or under - expression of c2gnt3 mrna relative to a non - disorder state or the qualitative or quantitative detection of alternatively spliced forms of c2gnt3 transcripts which may correlate with certain conditions or susceptibility toward such conditions ; or ( 2 ) the detection of either an over - or an under - abundance of a polypeptide of the invention relative to a non - disorder state or the presence of a modified ( e . g ., less than full length ) polypeptide of the invention which correlates with a disorder state , or a progression toward a disorder state . the methods described herein may be performed by utilizing pre - packaged diagnostic kits comprising at least one specific nucleic acid or antibody described herein , which may be conveniently used , e . g ., in clinical settings , to screen and diagnose patients and to screen and identify those individuals exhibiting a predisposition to developing a disorder . nucleic acid - based detection techniques and peptide detection techniques are described below . the samples that may be analyzed using the methods of the invention include those that are known or suspected to express c2gnt3 nucleic acids or contain a polypeptide of the invention . the methods may be performed on biological samples including but not limited to cells , lysates of cells which have been incubated in cell culture , chromosomes isolated from a cell ( e . g . a spread of metaphase chromosomes ), genomic dna ( in solutions or bound to a solid support such as for southern analysis ), rna ( in solution or bound to a solid support such as for northern analysis ), cdna ( in solution or bound to a solid support ), an extract from cells or a tissue , and biological fluids such as serum , urine , blood , and csf . the samples may be derived from a patient or a culture . the nucleic acid molecules of the invention allow those skilled in the art to construct nucleotide probes for use in the detection of nucleic acid sequences of the invention in biological materials . suitable probes include nucleic acid molecules based on nucleic acid sequences encoding at least 5 sequential amino acids from regions of the c2gnt3 polypeptide ( see seq id no : 1 ), preferably they comprise 15 to 50 nucleotides , more preferably 15 to 40 nucleotides , most preferably 15 - 30 nucleotides . a nucleotide probe may be labelled with a detectable substance such as a radioactive label that provides for an adequate signal and has sufficient half - life such as 32 p , 3 h , 14 c or the like . other detectable substances that may be used include antigens that are recognized by a specific labelled antibody , fluorescent compounds , enzymes , antibodies specific for a labelled antigen , and luminescent compounds . an appropriate label may be selected having regard to the rate of hybridization and binding of the probe to the nucleotide to be detected and the amount of nucleotide available for hybridization . labelled probes may be hybridized to nucleic acids on solid supports such as nitrocellulose filters or nylon membranes as generally described in sambrook et al , 1989 , molecular cloning , a laboratory manual ( 2nd ed .). the nucleic acid probes may be used to detect c2gnt3 genes , preferably in human cells . the nucleotide probes may also be used for example in the diagnosis or prognosis of conditions such as thymus - related disorders and cancer , and in monitoring the progression of these conditions , or monitoring a therapeutic treatment . the probe may be used in hybridisation techniques to detect a c2gnt3 gene . the technique generally involves contacting and incubating nucleic acids ( e . g . recombinant dna molecules , cloned genes ) obtained from a sample from a patient or other cellular source with a probe of the present invention under conditions favourable for the specific annealing of the probes to complementary sequences in the nucleic acids . alter incubation , the non - annealed nucleic acids are removed , and the presence of nucleic acids that have hybridized to the probe if any are detected . the detection of nucleic acid molecules of the invention may involve the amplification of specific gene sequences using an amplification method ( e . g . pcr ), followed by the analysis of the amplified molecules using techniques known to those skilled in the art . suitable primers can be routinely designed by one of skill in the art . for example , primers may be designed using commercially available software , such as oligo 4 . 06 primer analysis software ( national biosciences , plymouth , minn .) or another appropriate program , to be about 22 to 30 nucleotides in length , to have a gc content of about 50 % or more , and to anneal to the template at temperatures of about 60 ° c . to 72 ° c . genomic dna may be used in hybridization or amplification assays of biological samples to detect abnormalities involving c2gnt3 nucleic acid structure , including point mutations , insertions , deletions , and chromosomal rearrangements . for example , direct sequencing , single stranded conformational polymorphism analyses , heteroduplex analysis , denaturing gradient gel electrophoresis , chemical mismatch cleavage , and oligonucleotide hybridization may be utilized . genotyping techniques known to one skilled in the art can be used to type polymorphisms that are in close proximity to the mutations in a c2gnt3 gene . the polymorphisms may be used to identify individuals in families that are likely to carry mutations . if a polymorphism exhibits linkage disequalibrium with mutations in the g2gnt3 gene , it can also be used to screen for individuals in the general population likely to carry mutations . polymorphisms which may be used include restriction fragment length polymorphisms ( rflps ), single - nucleotide polymorphisms ( snp ), and simple sequence repeat polymorphisms ( sslps ). a probe or primer of the invention may be used to directly identify rflps . a probe or primer of the invention can additionally be used to isolate genomic clones such as yacs , bacs , pacs , cosmids , phage or plasmids . the dna in the clones can be screened for sslps using hybridization or sequencing procedures . hybridization and amplification techniques described herein may be used to assay qualitative and quantitative aspects of c2gnt3 expression . for example rna may be isolated from a cell type or tissue known to express c2gnt3 and tested utilizing the hybridization ( e . g . standard northern analyses ) or pcr techniques referred to herein . the techniques may be used to detect differences in transcript size that may be doe to normal or abnormal alternative splicing . the techniques may be used to detect quantitative differences between levels of full length and / or alternatively splice transcripts detected in normal individuals relative to those individuals exhibiting symptoms of a disease . the primers and probes may be used in the above described methods in situ i . e directly on tissue sections ( fixed and / or frozen ) of patient tissue obtained from biopsies or resections . oligonucleotides or longer fragments derived from any of the nucleic acid molecules of the invention may be used as targets in a microarray . the microarray can be used to simultaneously monitor the expression levels of large numbers of genes and to identify genetic variants , mutations , and polymorphisms . the information from the microarray may be used to determine gene function , to understand the genetic basis of a disorder , to identify predisposition to a disorder , to treat a disorder , to diagnose a disorder , and to develop and monitor the activities of therapeutic agents . the preparation , use , and analysis of micro arrays are well known to a person skilled in the art . ( see , for example , brennan , t . m ., et al . ( 1995 ), u . s . pat . no . 5 , 474 , 796 ; schena et al . ( 1996 ), proc . natl . acad . sci . 93 : 10614 - 10619 ; baldeschweiler et al . ( 1995 ), pct application wo95 / 251116 ; shalon , d ., et al . ( 1995 ), pct application wo95 / 35505 ; heller , r . a ., et al . ( 1997 ), proc . natl . acad . sci . 94 : 2150 - 2155 ; and heller , m . j ., et al . ( 1997 ), u . s . pat . no . 5 , 605 , 662 .) antibodies specifically reactive with a c2gnt3 polypeptide , or derivatives , such as enzyme conjugates or labeled derivatives , may be used to detect c2gnt3 polypeptides in various biological materials . they may be used as diagnostic or prognostic reagents and they may be used to detect abnormalities in the level of c2gnt3 polypeptides , expression , or abnormalities in the structure , and / or temporal , tissue , cellular , or subcellular location of the polypeptides . antibodies may also be used to screen potentially therapeutic compounds in vitro to determine their effects on a condition such as a thymus - related disorder or cancer . in vitro immunoassays may also be used to assess or monitor the efficacy of particular therapies . preferably , antibodies for use in a detection assay have a dissociation constant lower than 1 μm , even more preferably lower than or about 10 nm . the antibodies of the invention may also be used in vitro to determine the level of c2gnt3 polypeptide expression in cells genetically engineered to produce a c2gnt3 polypeptide . the antibodies may be used to detect and quantify polypeptides of the invention in a sample in order to determine their role in particular cellular events or pathological states , and to diagnose and treat such pathological states . in particular , the antibodies of the invention may be used in immuno - histochemical analyses , for example , at the cellular and sub - subcellular level , to detect a polypeptide of the invention , to localize it to particular cells and tissues , and to specific subcellular locations , and to quantitate the level of expression . the antibodies may be used in any known immunoassays that rely on the binding interaction & gt ;& gt ; between an antigenic determinant of a polypeptide of the invention , and the antibodies . examples of such assays are radio immunoassays , enzyme immunoassays ( e . g . elisa ), immunofluorescence , immunoprecipitation , latex agglutination , hemagglutination , and histochemical tests , cytochemical techniques known in the art for localizing antigens using light and electron microscopy may be used to detect a polypeptide of the invention . generally , an antibody of the invention may be labelled with a detectable substance and a polypeptide may be localised in tissues and cells based upon the presence of the detectable substance . various methods of labelling polypeptides are known in the art and may be used . examples of detectable substances include , but are not limited to , the following : radioisotopes ( e . g ., 3 h , 14 c , 35 s , 125 i , 131 i ), fluorescent labels ( e . g ., fitc , rhodamine , lanthanide phosphors ), luminescent labels such as luminol , enzymatic labels ( e . g ., horseradish peroxidase , β - galactosidase , luciferase , alkaline phosphatase , acetylcholinesterase ), biotinyl groups ( which can be detected by marked avidin e . g ., streptavidin containing a fluorescent marker or enzymatic activity that can be detected by optical or calorimetric methods ), predetermined polypeptide epitopes recognized by a secondary reporter ( e . g ., leucine zipper pair sequences , binding sites for secondary antibodies , metal binding domains , epitope tags ). in some embodiments , labels are attached via spacer arms of various lengths to reduce potential steric hindrance . antibodies may also be coupled to electron dense substances , such as ferritin or colloidal gold , which are readily visualised by electron microscopy . the antibody or sample may be immobilized on a carrier or solid support which is capable of immobilizing cells , antibodies , etc . for example , the carrier or support may be nitrocellulose , or glass , polyacrylamides , gabbros , and magnetite . the support material may have any possible configuration including spherical ( e . g . bead ), cylindrical ( e . g . inside surface of a test tube or well , or the external surface of a rod ), or flat ( e . g . sheet , test strip ). indirect methods may also be employed in which the primary antigen - antibody reaction is amplified by the introduction of a second antibody , having specificity for the antibody reactive against a polypeptide of the invention . by way of example , if the antibody having specificity against a polypeptide of the invention is a rabbit igg antibody , the second antibody may be goat anti - rabbit gamma - globulin labelled with a detectable substance as described herein . where a radioactive label is used as a detectable substance , a polypeptide of the invention may be localized by radioautography . the results of radioautography may be quantitated by determining the density of particles in the radioautographs by various optical methods , or by counting the grains . a polypeptide of the invention may also be detected by assaying for c2gnt3 activity as described herein . for example , a sample may be reacted with an acceptor substrate and a donor substrate under conditions where a c2gnt3 polypeptide is capable of transferring the donor substrate to the acceptor substrate to produce a donor substrate - acceptor substrate complex . the methods described herein are designed to identify substances and compounds that modulate the expression or biological activity of a c2gnt3 polypeptide including substances that interfere with or enhance the expression or activity of a c2gnt3 polypeptide . substances and compounds identified using the methods of the invention include but are not limited to peptides such as soluble peptides including ig - tailed fusion peptides , members of random peptide libraries and combinatorial chemistry - derived molecular libraries made of d - and / or l - configuration amino acids , phosphopeptides ( including members of random or partially degenerate , directed phosphopeptide libraries ), antibodies [ e . g . polyclonal , monoclonal , humanized , anti - idiotypic , chimeric , single chain antibodies , fragments , ( e . g . fab , f ( ab ) 2 , and fab expression library fragments , and epitope - binding fragments thereof )], polypeptides , nucleic acids , carbohydrates , and small organic or inorganic molecules . a substance or compound may be an endogenous physiological compound or it may be a natural or synthetic compound . modulation of a c2gnt3 polypeptide can be evaluated , for instance , by evaluating the inhibitory / stimulatory effect of an agent on c2gnt3 biological activity in comparison to a control or reference . the control or reference may be , e . g ., a predetermined reference value , or may be evaluated experimentally . for example , in a cell - based assay where a host cell expressing recombinant c2gnt3 is incubated in a medium containing a potential modulating agent , a control or reference may be , e . g ., a host cell incubated with an agent having a known effect on c2gnt3 expression / activity , a host cell incubated in the same medium without any agent , a host cell transfected with a “ mock ” vector not expressing any c2gnt3 polypeptide , or any other suitable control or reference . in a cell - free assay where c2gnt3 polypeptide is incubated in a medium containing a potential modulating agent , a control or reference may be , for example , medium not containing c2gnt3 polypeptide , medium not containing any agent , medium containing a reference polypeptide or agent , or any other suitable control or reference . substances which modulate a c2gnt3 polypeptide can be identified based on their ability to associate with a c2gnt3 polypeptide . therefore , the invention also provides methods for identifying substances that associate with a c2gnt3 polypeptide . substances identified using the methods of the invention may be isolated , cloned and sequenced using conventional techniques . a substance that associates with a polypeptide of the invention may be an agonist or antagonist of the biological or immunological activity of a polypeptide of the invention . the term “ agonist ” refers to a molecule that increases the amount of , or prolongs the duration of , the activity of the polypeptide . the term “ antagonist ” refers to a molecule which decreases the biological or immunological activity of the polypeptide . agonists and antagonists may include proteins , nucleic acids , carbohydrates , or any other molecules that associate with a polypeptide of the invention . substances which can associate with a c2gnt3 polypeptide may be identified by reacting a c2gnt3 polypeptide with a test substance which potentially associates with a c2gnt3 polypeptide , under conditions which permit the association , and removing and / or detecting the associated c2gnt3 polypeptide and substance . substance - polypeptide complexes , free substance , or non - complexed polypeptides may be assayed . conditions which permit the formation of substance - polypeptide complexes may be selected having regard to factors such as the nature and amounts of the substance and the polypeptide . the substance - polypeptide complex , free substance or non - complexes polypeptides may be isolated by conventional isolation techniques , for example , salting out , chromatography , electrophoresis , gel filtration , fractionation , absorption , polyacrylamide gel electrophoresis , agglutination , or combinations thereof . to facilitate the assay of the components , antibody against a polypeptide of the invention or the substance , or labelled polypeptide , or a labelled substance may be utilized . the antibodies , polypeptides , or substances may be labelled with a detectable substance as described above . a c2gnt3 polypeptide , or the substance used in the method of the invention may be insolubilized . for example , a polypeptide , or substance may be bound to a suitable carrier such as agarose , cellulose , dextran , sephadex , sepharose , carboxymethyl cellulose polystyrene , filter paper , ion - exchange resin , plastic film , plastic tube , glass beads , polyamine - methyl vinyl - ether - maleic acid copolymer , amino acid copolymer , ethylene - maleic acid copolymer , nylon , silk , etc . the carrier may be in the shape of , for example , a tube , test plate , beads , disc , sphere etc . the insolubilized polypeptide or substance may be prepared by reacting the material with a suitable insoluble carrier using known chemical or physical methods , for example , cyanogen bromide coupling . the invention also contemplates a method for evaluating a compound for its ability to modulate the biological activity of a polypeptide of the invention , by assaying for an agonist or antagonist ( i . e . enhancer or inhibitor ) of the association of the polypeptide with a substance which interacts with the polypeptide ( e . g . donor or acceptor substrates or parts thereof ). the basic method for evaluating if a compound is an agonist or antagonist of the association of a polypeptide of the invention and a substance that associates with the polypeptide is to prepare a reaction mixture containing the polypeptide and the substance under conditions which permit the formation of substance - polypeptide complexes , in the presence of a test compound . the test compound may be initially added to the mixture , or may be added subsequent to the addition of the polypeptide and substance . control reaction mixtures without the test compound or with a placebo are also prepared . the formation of complexes is detected and the formation of complexes in the control reaction but not in the reaction mixture indicates that the test compound interferes with the interaction of the polypeptide and substance . the reactions may be carried out in the liquid phase or the polypeptide , substance , or test compound may be immobilized as described herein . the agent can be selected from compounds , compositions , antibodies or antibody fragments , antisense sequences and ribozyme nucleotide sequences for c2gnt3 polypeptide . it will be understood that the agonists and antagonists i . e . inhibitors and enhancers , that can be assayed using the methods of the invention may act on one or more of the interaction sites an the polypeptide or substance including agonist binding sites , competitive antagonist binding cites , non - competitive antagonist binding sites or allosteric sites . the invention also makes it possible to screen for antagonists that inhibit the effects of an agonist of the interaction of a polypeptide of the invention with a substance which is capable of associating with the polypeptide . thus , the invention may be used to assay for a compound that competes for the same interacting site of a polypeptide of the invention . substances that modulate a c2gnt3 polypeptide of the invention can be identified based on their ability to interfere with or enhance the activity of a c2gnt3 polypeptide . therefore , the invention provides a method for evaluating a compound for its ability to modulate the activity of a c2gnt3 polypeptide comprising ( a ) reacting an acceptor substrate and a donor substrate for a c2gnt3 polypeptide in the presence of a test substance ; ( b ) measuring the amount of donor substrate transferred to acceptor substrate , and ( c ) carrying out steps ( a ) and ( b ) in the absence of the test substance to determine if the substance interferes with or enhances transfer of the sugar donor to the acceptor by the c2gnt3 polypeptide . suitable acceptor substrate for use in the methods of the invention are a saccharide , oligosaccharides , polysaccharides , polypeptides , glycopolypeptides , or glycolipids which are either synthetic with linkers at the reducing end or naturally occuring structures , for example , asialo - agalacto - fetuin glycopeptide . acceptors will generally comprise β - d - galactosyl - 1 , 3 - n - acetyl - d - galactosaminyl -. the donor substrate may be a nucleotide sugar , dolichol - phosphate - sugar or dolichol - pyrophosphate - oligosaccharide , for example , uridine diphospho - n - acetylglucosamine ( udp - glcnac ), or derivatives or analogs thereof . the c2gnt3 polypeptide may be obtained from natural sources or produced used recombinant methods as described herein . the acceptor or donor substrates may be labeled with a detectable substance as described herein , and the interaction of the polypeptide of the invention with the acceptor and donor will give rise to a detectable change . the detectable change may be colorimetric , photometric , radiometric , potentiometric , etc . the activity of c2gnt3 polypeptide of the invention may also be determined using methods based on hplc ( koenderman et al ., febs lett . 222 : 42 , 1987 ) or methods employed synthetic oligosaccharide acceptors attached to hydrophobic aglycones ( palcic et al glycoconjugate 5 : 49 , 1988 ; and pierce et al , biochem . biophys . res . comm . 146 : 679 , 1987 ). the c2gnt3 polypeptide is reacted with the acceptor and donor substrates at a ph and temperature effective for the polypeptide to transfer the donor to the acceptor , and where one of the components is labeled , to produce a detectable change . it is preferred to use a buffer with the acceptor and donor to maintain the ph within the ph range effective for the polypeptides . the buffer , acceptor and donor may be used as an assay composition . other compounds such as edta and detergents may be added to the assay composition . the reagents suitable for applying the methods of the invention to evaluate compounds that modulate a c2gnt3 polypeptide may be packaged into convenient kits providing the necessary materials packaged into suitable containers . the kits may also include suitable supports useful in performing the methods of the invention . substances that modulate a c2gnt3 polypeptide can also be identified by treating immortalized cells which express the polypeptide with a test substance , and comparing the morphology of the cells with the morphology of the cells in the absence of the substance and / or with immortalized cells which do not express the polypeptide . examples of immortalized cells that can be used include lung epithelial cell lines such as mvllu or hek293 ( human embryonal kidney ) transfected with a vector containing a nucleic acid of the invention . in the absence of an inhibitor the cells show signs of morphologic transformation ( e . g . fibroblastic morphology , spindle shape and pile up ; the cells are less adhesive to substratum ; there is less cell to cell contact in monolayer culture ; there is reduced growth - factor requirements for survival and proliferation ; the cells grow in soft - agar of other semi - solid medium ; there is a lack of contact inhibition and increased apoptosis in low - serum high density cultures ; there is enhanced cell motility , and there is invasion into extracellular matrix and secretion of proteases ). substances that inhibit one or more phenotypes may be considered an inhibitor . a substance that inhibits a c2gnt3 polypeptide may be identified by treating a cell which expresses the polypeptide with a test substance , and assaying for complex core 2 - based o - linked structures ( e . g . repeating gal [ β ] 1 - 4glcnac [ β ]) associated with the cell . the complex core 2 - based o - linked structures can be assayed using a . substance that binds to the structures ( e . g . antibodies ). cells that have not been treated with the substance or which do not express the polypeptide may be employed as controls . substances which inhibit transcription or translation of a c2gnt3 gene may be identified by transfecting a cell with an expression vector comprising a recombinant molecule of the invention , including a reporter gene , in the presence of a test substance and comparing the level of expression of the c2gnt3 polypeptide , or the expression of the polypeptide encoded by the reporter gene with a control cell transfected with the nucleic acid molecule in the absence of the substance . the method can be used to identify transcription and translation inhibitors of a c2gnt3 gene . the substances or compounds identified by the methods described herein , polypeptides , nucleic acid molecules , and antibodies of the invention may be used for modulating the biological activity of a c2gnt3 polypeptide , and they may be used in the treatment of conditions mediated by a c2gnt3 polypeptide . in particular , they may be used to t - cell development and lymphocyte homing and they may be used in the prevention and treatment of thymus - related disorders . therefore , the present invention may be useful for diagnosis or treatment of various thymus - related disorders in mammals , preferably humans . such disorders include the following : tumors and cancers , hypoactivity , hyperactivity , atrophy , enlargement of the thymus , and the like . other disorders include disregulation of t - lymphocyte selection or activity and would include but not be limited to disorders involving autoimmunity , arthritis , leukemias , lymphomas , immunosuppression , sepsis , wound healing , acute and chronic in action , cell mediated immunity , humor immunity , th1 / th2 imbalance , and the like . the substances or compounds identified by the methods described herein , antibodies , and polypeptides , and nucleic acid molecules of the invention may be useful in the prevention and treatment of tumors . tumor metastasis may be inhibited or prevented by inhibiting the adhesion of circulating cancer cells . the substances , compounds , etc . of the invention may be especially useful in the treatment of various forms of neoplasia such as leukemias , lymphomas , melanomas , adenomas , sarcomas , and carcinomas of solid tissues in patients . in particular the composition may be used for treating malignant melanoma , pancreatic cancer , cervico - uterine cancer , cancer of the liver , kidney , stomach , lung , rectum , breast , bowel , gastric , thyroid , neck , cervix , salivary gland , bile duct , pelvis , mediastinum , urethra , bronchogenic , bladder , esophagus and colon , and kaposi &# 39 ; s sarcoma which is a form of cancer associated with hiv - infected patients with acquired immune deficiency syndrome ( aids ). the substances etc . are particularly useful in the prevention and treatment of tumors of the immune system and thymus and the metastases derived from these tumors . a substance or compound identified in accordance with the methods described herein , antibodies , polypeptides , or nucleic acid molecules of the invention may be used to modulate t - cell activation and immunodeficiency due to the wiskott - aldrich syndrome or aids , or to stimulate hematopoietic progenitor cell growth , and / or confer protection against chemotherapy and radiation therapy in a subject . accordingly , the substances , antibodies , and compounds may be formulated into pharmaceutical compositions for administration to subjects in a biologically compatible form suitable for administration in vivo . by biologically compatible form suitable for administration in vivo is meant a form of the substance to be administered in which any toxic effects are outweighed by the therapeutic effects . the substances may be administered to living organisms including humans , and animals . administration of a therapeutically active amount of the pharmaceutical compositions of the present invention is defined as an amount effective , at dosages and for periods of time necessary to achieve the desired result . for example , a therapeutically active amount of a substance may vary according to factors such as the disease state , age , sex , and weight of the individual , and the ability of antibody to elicit a desired response in the individual . dosage regima may be adjusted to provide the optimum therapeutic response . for example , several divided doses may be administeted daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation . the active substance may be administered in a convenient manner such as by injection ( subcutaneous , intravenous , etc . ), oral administration , inhalation , transdermal application , or rectal administration . depending on the route of administration , the active substance may be coated in a material to protect the compound from the action of enzymes , acids and other natural conditions that may inactivate the compound . the compositions described herein can be prepared by methods known per se for the preparation of pharmaceutically acceptable compositions which can be administered to subjects , such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle . suitable vehicles are described , for example , in remington &# 39 ; s pharmaceutical sciences ( remington &# 39 ; s pharmaceutical sciences , mack publishing company , easton , pa ., usa 1985 ). on this basis , the compositions include , albeit not exclusively , solutions of the substances or compounds in association with one or more pharmaceutically acceptable vehicles or diluents , and contained in buffered solutions with a suitable ph and iso - osmotic with the physiological fluids . after pharmaceutical compositions have been prepared , they can be placed in an appropriate container and labeled for treatment of an indicated condition . for administration of an inhibitor of a polypeptide of the invention , such labeling would include amount , frequency , and method of administration . the nucleic acids encoding c2gnt3 polypeptides or any fragment thereof , or antisense sequences may be used for therapeutic purposes . antisense to a nucleic acid molecule encoding a polypeptide of the invention may be med in situations to block the synthesis of the polypeptide . in particular , cells may be transformed with sequences complementary to nucleic acid molecules encoding c2gnt3 polypeptide . thus , antisense sequences may be used to modulate c2gnt3 activity or to achieve regulation of gene function . sense or antisense oligomers or larger fragments , can be designed from various locations along the coding or regulatory regions of sequences encoding a polypeptide of the invention . expression vectors may be derived from retroviruses , adenoviruses , herpes or vaccinia viruses or from various bacterial plasmids for delivery of nucleic acid sequences to the target organ , tissue , or cells . vectors that express antisense nucleic acid sequences of c2gnt3 polypeptide can be constructed using techniques well known to those skilled in the art ( see for example , sambrook , fritsch , maniatis , molecular cloning , a laboratory manual , second edition ( 1989 ) cold spring harbor laboratory press , cold spring harbor , n . y ). genes encoding c2cnt3 polypeptide can be turned off by transforming a cell or tissue with expression vectors that express high levels of a nucleic acid molecule or fragment thereof which encodes a polypeptide of the invention . such constructs may be used to introduce untranslatable sense or antisense sequences into a cell . even if they do not integrate into the dna , the vectors may continue to transcribe rna molecules until all copies are disabled by endogenous nucleases . transient expression may last for extended periods of time ( e . g . a month or more ) with a non - replicating vector or if appropriate replication elements are part of the vector system . modification of gene expression may be achieved by designing antisense molecules , dna , rna , or pna , to the control regions of a c2gnt3 polypeptide gene i . e . the promoters , enhancers , and introns . preferably the antisense molecules are oligonucleotides derived from the transcription initiation site ( e . g . between positions − 10 and + 10 from the start site ). inhibition can also be achieved by using triple - helix base - pairing techniques . triple helix pairing causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases , transcription factors , or regulatory molecules ( see gee j . e . et al ( 1994 ) in : huber , b . e . and b . i . carr , molecular and immunologic approaches , futura publishing co ., mt . kisco , n . y .). ribozymes , enzymatic rna molecules , may be used to catalyze the specific cleavage of rna . ribozyme action involves sequence - specific hybridization of the ribozyme molecule to complementary target rna , followed by endonucleolytic cleavage . for example , hammerhead motif ribozyme molecules may be engineered that can specifically and efficiently catalyze endonucleolytic cleavage of sequences encoding a polypeptide of the invention . specific ribosome cleavage sites within any rna target may be initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences : gua , guu , and guc . short rna sequences of between 15 and 20 ribonucleotides corresponding to the region of the cleavage site of the target gene may be evaluated for secondary structural features which may render the oligonucleotide inoperable . the suitability of candidate targets may be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays . therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or with experimental animals , such as by calculating the ed 50 ( the dose therapeutically effective in 50 % of the population ) or ld 50 ( the dose lethal to 50 % of the population ) statistics . the therapeutic index is the dose ratio of therapeutic to toxic effects and it can be expressed as the ed 50 / ld 50 ratio . pharmaceutical compositions which exhibit large therapeutic indices are preferred . the invention also provides methods for studying the function of a c2gnt3 polypeptide . cells , tissues , and non - human animals lacking in c2gnt3 expression or partially lacking in c2gnt3 expression may be developed using recombinant expression vectors of the invention having specific deletion or insertion mutations in a c2gnt3 gene . a recombinant expression vector may be used to inactivate or alter the endogenous gene by homologous recombination , and thereby create a c2gnt3 deficient cell , tissue or animal . null alleles may be generated in cells , such as embryonic stem cells by deletion mutation . a recombinant c2gnt3 gene may also be engineered to contain an insertion mutation which inactivates c2gnt3 . such a construct may then be introduced into a cell , such as an embryonic stem cell , by a technique such as transfection , elcctroporation , injection etc . cells lacking an intact c2gnt3 gene may then be identified , for example by southern blotting , northern blotting or by assaying for expression of a polypeptide of the invention using the methods described herein . such cells may then be used to generate transgenic non - human animals deficient in c2gnt3 . germline transmission of the mutation may be achieved , for example , by aggregating the embryonic stem cells with early stage embryos , such as 8 cell embryos , in vitro ; transferring the resulting blastocysts into recipient females and ; generating germline transmission of the resulting aggregation chimeras . such a mutant animal may be used to define specific cell populations , developmental patterns and in vivo processes , normally dependent on c2gnt3 expression . the invention thus provides a transgenic non - human mammal all of whose germ cells and somatic cells contain a recombinant expression vector that inactivates or alters a gene encoding a c2gnt3 polypeptide . further the invention provides a transgenic non - human mammal , which does not express a c2gnt3 polypeptide of the invention . a transgenic non - human animal includes but is not limited to mouse , rat , rabbit , sheep , hamster , guinea pig , micro - pig , pig , dog , cat , goat , and non - human primate , preferably mouse . the invention also provides a transgenic non - human animal assay system which provides a model system for testing for an agent that reduces or inhibits a pathology associated with a c2gnt3 polypeptide comprising : ( a ) administering the agent to a transgenic non - human animal of the invention ; and ( b ) determining whether said agent reduces or inhibits the pathology in the transgenic non - human animal relative to a transgenic non - human animal of step ( a ) to which the agent has not been administered . the agent may be useful to treat the disorders and conditions discussed herein . the agents may also be incorporated in a pharmaceutical composition as described herein . a polypeptide of the invention may be used to support the survival , growth , migration , and / or differentiation of cells expressing the polypeptide . thus , a polypeptide of the invention may be used as a supplement to support , for example cells in culture . the invention relates to a method for preparing an oligosaccharide comprising contacting a reaction mixture comprising an activated donor substrate e . g . glcnac , and an acceptor substrate in the presence of a polypeptide of the invention . examples of acceptor substrates for use in the method for preparing an oligosaccharide are a saccharide , oligosaccharides , polysaccharides , glycopeptides , glycopolypeptides , or glycolipids which are either synthetic with linkers at the reducing end or naturally occurring structures , for example , asialo - agalacto - fetuin glycopeptide . the activated donor substrate is preferably glcnac which may be part of a nucleotide - sugar , a dolichol - phosphate - sugar , or dolichol - pyrophosphate - oligosaccharide . in an embodiment of the invention , the oligosaccharides are prepared on a carrier that is non - toxic to a mammal , in particular a human such as a lipid isoprenoid or polyisoprenoid alcohol . an example of a suitable carrier is dolichol phosphate . the oligosaccharide may be attached to a carrier via a labile bond allowing for chemical removal of the oligosaccharide from the lipid carrier . in the alternative , the oligosaccharide transferase may be used to transfer the oligosaccharide from a lipid carrier to a polypeptide . the following examples are intended to further illustrate the invention without limiting its scope . a : identification of cdna homologous to c2gnt3 by analysis of gss database sequence information . database searches were performed with the coding sequence of the human c2 / 4gnt ( c2gnt2 ) sequence using the blastn and tblastn algorithms against the gss database at the national center for biotechnology information , usa . the blastn algorithm was used to identify gsss representing the query gene ( identities of ≧ 95 %), whereas tblastn was used to identify non - identical , but similar gss sequences . gsss with 50 - 90 % nucleotide sequence identity were regarded as different from the query sequence . composites of the sequence information for two gsss were compiled and analysed for sequence similarity to human c2 / 4gnt ( c2gnt2 ). a gss clone cit - hsp - 2288b17 . tf ( gss genbank accession number aq005888 ), derived from a putative homologue to c2 / 4gnt ( c2gnt2 ), was obtained from research genetics inc ., usa . sequencing of this clone revealed a partial open reading frame with significant sequence similarity to c2 / 4gnt ( c2gnt2 ). the coding region of human c2gnt - l ( c2gnt1 ), c2 / 4gnt ( c2gnt2 ) and a bovine homologue was previously found to be organized in one exon (( 22 ),( 15 )). since the 3 ′ sequence available from the c2gnt3 gss was incomplete but likely to be located in the single exon , the missing 3 ′ portion of the open reading frame was obtained by sequencing a genomic p1 clone . the p1 clone was obtained from a human foreskin genomic p1 library ( dupont merck pharmaceutical co . human foreskin fibroblast p1 library ) by screening with the primer pair : tshc96 ( 5 ′- ggtttcaccgtctccaacata - 3 ′, seq id no : 3 ) and tshc101 ( 5 ′- tcgtaaggcacctgatactt - 3 ′, seq id no : 6 ). one genomic clone for c2gnt3 , gs22597 # 844 / b1 was obtained from genome systems inc ., usa . dna from p1 phage was prepared as recommended by genome systems inc . the entire coding sequence of the c2gnt3 gene was represented in the clone and sequenced in full using automated sequencing ( abi377 , perkin - elmer ). confirmatory sequencing was performed on a cdna clone obtained by pcr ( 30 cycles at 95 ° c . for 10 sec ; 55 ° c . for 15 sec and 68 ° c . for 2 min 30 sec ) on cdna from human thymus poly a - mrna with the sense primer : the composite sequence contained an open reading frame of 1359 base pairs encoding a putative protein of 453 amino acids with type ii domain structure predicted by the tmpred - algorithm at the swiss institute for experimental cancer research ( isrec ). ( http :// www . ch . embnet . org / software / tmpred_form . html ). an expression vector construct designed to encode amino acid residues 39 - 453 of c2gnt3 was prepared by pcr using p1 dna , and the primer pair : tshc100 ( 5 ′- cgaggatccgcaaaaagacatttacttggtt - 3 ′, seq id no : 5 ) and tshc121 ( 5 ′- agcgaattcttactatcatgatgtggtagtg - 3 ′, seq id no : 9 ) with bamh1 and ecori restriction sites , respectively ( fig2 ). the pcr product was cloned between the bamhi and ecori sites of pacgp67a ( pharmingen ), and the insert was fully sequenced . pacgp67 - c2gnt3 - sol was co - transfected with baculo - gold ™ dna ( pharmingen ) as described previously ( 23 ). recombinant baculo - viruses were obtained after two successive amplifications in sf9 cells grown in serum - containing medium , and titers of virus were estimated by titration in 24 - well plates with monitoring of enzyme activities . transfection of sf9 - cells with pacgp67 - c2gnt3 - sol resulted in marked increase in glcnac - transferase activity compared to uninfected cells or cells infected with a control construct . standard assays were performed using culture supernatant from infected cells in 50 μl reaction mixtures containing 100 mm mes ( ph 6 . 5 ), 0 . 1 % nonidet p - 40 , 150 μm udp -[ 14 c ]- glcnac ( 2 , 000 cpm / nmol ) ( amersham pharmacia biotech ), and the indicated concentrations of acceptor substrates ( sigma and toronto research laboratories ltd ., see table i for structures ). reaction products were quantified by chromatography on dowex agi - x8 . a human rna master blot ( clontech ) was used for expression analysis . the cdna - fragment of soluble c2gnt3 was used as a probe for hybridization . the probe was random primer - labeled using [ α 32 p ] datp and and the strip - ez dna labeling kit ( ambion ). the membrane was probed for 6 h at 65 ° c . following the protocol of the manufacturer ( clontech ) and washed five times for 20 min each at 65 ° c . with 2 × ssc , 1 % sds and twice for 20 min each at 55 ° c . with 0 . 1 × ssc , 0 . 5 % sds . a human multiple tissue northern blot mtn ii ( clontech ), was probed as described ( 24 ), and washed twice for 10 min each at room temperature with 2 × ssc , 0 . 1 % sds ; twice for 10 min each at 55 ° c . with 1 × ssc , 0 . 1 % sds ; and once for 10 min with 0 . 1 × ssc , 0 . 1 % sds at 55 ° c . pcr analysis of c2gnt3 expression in resting and activated human blood cell fractions was performed using the primer pair : tshc118 ( 5 ′- gagtcagtgtggaattgaatac - 3 ′, seq id no : 7 ) and tshc126 ( 5 ′- caacagtctcctcaaccctg - 3 ′, seq id no : 11 ). pcr amplifications with primers specific for human c2gnt3 ( c2gnt3 ) or gapdh ( g3pdh , supplied by the manufacturer ) were performed on a normalized human blood cell cdna panel ( mtc from clontech ) for 31 cycles . expression of c2gnt3 transcript was detected in all peripheral blood mononuclear cell ( pbmc ) fractions with particularly high levels of expression in cd4 and cd8 positive t - lymphocytes ( fig4 ). tshc123 ( 5 ′- gggcagcatttgcctagtatg - 3 ′, seq id no : 10 ) and tshc119 ( 5 ′- gatctctgatttggctcagtg - 3 ′, seq id no : 8 ) as described in fig5 have been used for pcr amplification of individual sequences of the coding exon . each pcr product was subcloned and the sequence of 10 clones containing the appropriate insert was determined assuring that both alleles of each individual are characterized . polymorphism of the amplified dna can be analyzed using , e . g ., dna sequencing , single - strand conformational polymorphism ( sscp ) or mismatch mutation . from the foregoing it will be evident that , although specific embodiments of the invention have been described herein for purposes of illustration , various modifications may be made without deviating from the spirit and scope of the invention . 1 . clausen , h . and bennett , e . p . a family of udp - galnac : polypeptide n - acetylgalactosaminyltransferases control the initiation of mucin - type o - linked glycosylation . glycobiology 6 : 635 - 646 , 1996 . 2 . piller , f ., piller , v ., fox , r . i ., and fukuda , m . human t - lymphocyte activation is associated with changes in o - glycan biosynthesis . j . biol . chem . 263 : 15146 - 15150 , 1988 . 3 . yang , j . m ., byrd , j . c ., siddiki , b . b ., chung , y . s ., okuno , m ., sowa , m ., kim , y . s ., matta , k . l ., and brockhausen , i . alterations of o - glycan biosynthesis in human colon cancer tissues . glycobiology 4 : 873 - 884 , 1994 . 4 . yousefi , s ., higgins , e ., daoling , z ., pollex - kruger , a ., hindsgaul , o ., and dennis , j . w . increased udp - glcnac : gal beta 1 - 3galnac - r ( glcnac to galnac ) beta - 1 , 6 - n - acetylglucosaminyltransferase activity in metastatic murine tumor cell lines . control of polylactosamine synthesis . j . biol . chem . 266 : 1772 - 1782 , 1991 . 5 . fukuda , m . possible roles of tumor - associated carbohydrate antigens . cancer res . 56 : 2237 - 2244 , 1996 . 6 . brockhausen , i ., yang , j . m ., burchell , j ., whitehouse , c ., and taylor - papadimitriou , j . mechanisms underlying aberrant glycosylation of muci mucin in breast cancer cells . eur . j . biochem . 233 : 607 - 617 , 1995 . 7 . brockhausen , i ., kuhns , w ., schachter , h ., matta , k . l ., sutherland , d . r ., and baker , m . a . biosynthesis of o - glycans in leukocytes from normal donors and from patients with leukemia : increase in o - glycan core 2 udp - glcnac : gal beta 3 galnac alpha - r ( glcnac to galnac ) beta ( 1 - 6 )- n - acetylglucosaminyltransferase in leukemic cells . cancer res . 51 : 1257 - 1263 , 1991 . 8 . higgins , e . a ., siminovitch , k . a ., zhuang , d . l ., brockhausen , i ., and dennis , j . w . aberrant o - linked oligosaccharide biosynthesis in lymphocytes and platelets from patients with the wiskott - aldrich syndrome . j . biol . chem . 266 : 6280 - 6290 , 1991 . 9 . saitoh , o ., piller , f ., fox , r . i ., and fukuda , m . t - lymphocytic leukemia expresses complex , branched o - linked oligosaccharides on a major sialoglycoprotein , leukosialin . blood 77 : 1491 - 1499 , 1991 . 10 . springer , g . f . t and tn , general carcinoma autoantigens . science 224 : 1198 - 1206 , 1984 . 11 . kumar , r ., camphausen , r . t ., sullivan , f . x ., and cumming , d . a . core2 beta - 1 , 6 - n - acetylglucosaminyltransferase enzyme activity is critical for p - selectin glycoprotein ligand - 1 binding to p - selectin . blood 88 : 3872 - 3879 , 1996 . 12 . williams , d . and schachter , h . mucin synthesis . i . detection in canine submaxillary glands of an n - acetylglucosaminyltransferase which acts on mucin substrates . j . biol . chem . 255 : 11247 - 11252 , 1980 . 13 . bierhuizen , m . f . and fukuda , m . expression cloning of a cdna encoding udp - glcnac : gal beta 1 - 3 - galnac - r ( glcnac to galnac ) beta 1 - 6glcnac transferase by gene transfer into cho cells expressing polyoma large tumor antigen . proc . natl . acad . sci . u . s . a . 89 : 9326 - 9330 , 1992 . 14 . schwientek , t ., yeh , j . c ., levery , s . b ., keck , b ., merkx , g ., van kessel , a . g ., fukuda , m ., and clausen , h . control of o - glycan branch formation . molecular cloning and characterization of a novel thymus - associated core 2 beta1 , 6 - n - acetylglucosaminyltransferase . j . biol . chem . 275 : 11106 - 11113 , 2000 . 15 . schwientek , t ., nomoto , m ., levery , s . b ., merkx , g ., van kessel , a . g ., bennett , e . p ., hollingsworth , m . a ., and clausen , h . control of o - glycan branch formation . molecular cloning of human cdna encoding a novel beta1 , 6 - n - acetylglucosaminyl - transferase forming core 2 and core 4 . j . biol . chem . 274 : 4504 - 4512 , 1999 . 16 . yeh , j . c ., ong , e ., and fukuda , m . molecular cloning and expression of a novel beta - 1 , 6 - n - acetylglucosaminyltransferase that forms core 2 , core 4 , and i branches . j . biol . chem . 274 : 3215 - 3221 , 1999 . 17 . baum , l . g ., pang , m ., perillo , n . l ., wu , t ., delegeane , a ., uittenbogaart , c . h ., fukuda , m ., and seilhamer , j . j . human thymic epithelial cells express an endogenous lectin , galectin - 1 , which binds to core 2 o - glycans on thymocytes and t lymphoblastoid cells . j . exp . med . 181 : 877 - 887 , 1995 . 18 . perillo , n . l ., marcus , m . e ., and baum , l . g . galectins : versatile modulators of cell adhesion , cell proliferation , and cell death . j . mol . med . 76 : 402 - 412 , 1998 . 19 . perillo , n . l ., pace , k . e ., seilhamer , j . j ., and baum , l . g . apoptosis of t cells mediated by galectin - 1 . nature 378 : 736 - 739 , 1995 . 20 . devereux , j ., haeberli , p ., and smithies , o . a comprehensive set of sequence analysis programs for the vax . nucleic acids res . 12 : 387 - 395 , 1984 21 . altschul , s . f ., gish , w ., miller , w ., myers , e . w ., and lipman , d . j . basic local alignment search tool . j . mol . biol . 1990 , oct . 5 ., 215 : 403 - 410 , 22 . bierhuizen , m . f ., maemura , k ., kudo , s ., and fukuda , m . genomic organization of core 2 and i branching beta - 1 , 6 - n - acetylglucosaminyltransferases . implication for evolution of the beta - 1 , 6 - n - acetylglucosaminyltransferase gene family . glycobiology 5 : 417 - 425 , 1995 . 23 . almeida , r ., amado , m ., david , l ., levery , s . b ., holmes , e . h ., merkx , g ., van kessel , a . g ., rygaard , e ., hassan , h ., bennett , e ., and clausen , h . a family of human beta4 - galactosyltransferases . cloning and expression of two novel udp - galactose : beta - n - acetylglucosamine beta1 , 4 - galactosyltransferases , beta4gal - t2 and beta4gal - t3 . j . biol . chem . 272 : 31979 - 31991 , 1997 . 24 . bennett , e . p ., hassan , h ., and clausen , h . cdna cloning and expression of a novel human udp - n - acetyl - alpha - d - galactosamine . polypeptide n - acetylgalactosaminyltransferase , galnac - t3 . j . biol . chem . 271 : 17006 - 17012 , 1996 . 25 . wandall , h . h ., hassan , h ., mirgorodskaya , e ., kristensen , a . k ., roepstorff , p ., bennett , e . p ., nielsen , p . a ., hollingsworth , m . a ., burchell , j ., taylor - papadimitriou , j ., and clausen , h . substrate specificities of three members of the human udp - n - acetyl - alpha - d - galactosamine : polypeptide n - acetylgalactosaminyltransferase family , galnac - t1 , - t2 , and - t3 . j . biol . chem . 272 : 23503 - 23514 , 1997 . 26 . matteucci , m . d . and caruthers , m . h . j . am . chem . soc . 103 : 3185 - 3191 . 1981 . 27 . yoo , y ., rote , k ., and rechsteiner , m . synthesis of peptides as cloned ubiquitin extensions . j . biol . chem . 264 : 17078 - 17083 , 1989 . met lys ile phe lys cys tyr phe lys his thr leu gln gln lys val asn val arg arg leu phe pro gln lys asp ile tyr leu val glu tyr ser leu ser thr ser pro phe val arg asn arg tyr thr his val lys asp glu val arg tyr glu val asn cys ser gly ile tyr glu gln glu tyr gln thr leu arg gly tyr ala gln lys leu val ser lys glu glu lys ser phe pro ile ala tyr ser leu val val his lys asp ala ile met val glu arg leu ile his ala ile tyr asn gln his asn ile tyr cys ile his tyr asp arg lys ala pro asp thr phe lys val ala met glu ala val glu tyr ala his ile ser arg leu gln ala asp leu asn asn leu cys gly gln asp phe pro leu lys ser asn phe glu leu val pro pro asn ser lys leu glu arg phe thr tyr his his glu leu arg arg val pro tyr glu tyr val lys leu pro ile arg thr asn ile ser lys glu ala pro pro his asn ile gln ile phe val gly ser ala tyr val gln asp phe phe ala trp ser lys asp thr tyr ser pro asp glu his phe trp ala thr leu ile arg val pro gly ile pro gly glu ile val lys trp asn tyr tyr glu gly phe phe tyr pro ser cys thr gly ser his leu arg ser val cys ile tyr gly ala ala glu leu arg trp leu ile lys asp gly his trp phe ala asn lys phe asp ser lys val arg asp trp ile thr leu pro ser glu lys leu phe met asp arg asn arg ile his gln lys pro glu phe val ser val arg his leu glu leu ala gly glu asn pro ser ser asp ile asn cys thr lys val leu gln lys phe lys lys arg pro arg trp thr pro asp asp tyr ile asn met thr ser asp cys ser ser phe ile lys arg arg lys tyr ile val glu val his his lys ile glu met leu asp arg leu leu arg ala ile tyr met pro gln asn phe tyr cys val his val asp thr lys ser glu asp ser tyr leu ala ala val met gly ile ala ser cys phe ser asn val val gln ala asp leu asn cys met lys asp leu tyr ala met ser ala asn trp lys tyr leu ile asn leu cys gly met asp phe pro ile lys asn leu glu thr glu arg met pro ser his lys glu glu arg trp lys lys met leu pro pro leu glu thr pro leu phe ser gly ser ala tyr phe val val ser arg glu tyr val gly tyr val leu gln asn glu lys ile gln lys leu met glu trp ala gln asp thr tyr ser pro asp glu tyr leu trp ala thr ile gln arg ile pro glu val pro gly ser leu pro ala ser his lys tyr asp leu ser asp met gln ala val ala arg phe val lys trp gln tyr phe glu gly asp val ser lys gly ala pro tyr pro pro cys asp gly val his val arg ser val cys ile phe gly ala gly asp leu asn trp met leu arg lys his his leu phe ala asn met val gln trp lys arg leu cys gln leu his tyr leu trp ala leu gly cys tyr met leu leu ala thr val ala leu lys leu ser phe arg ser gln tyr cys arg asn ile leu tyr asn phe leu lys leu pro ala lys arg ser ile asn cys ser gly val thr arg gly asp gln glu ala pro phe thr asp thr his tyr leu ser leu thr arg asp cys glu his val glu phe pro ile ala tyr ser met val ile his glu lys ile glu asn phe glu arg leu leu arg ala val tyr ala pro gln asn ile tyr cys val his val asp glu lys ser pro glu thr phe lys glu ala val cys met glu asp leu leu gln ser ser val pro trp lys tyr phe leu asn thr cys gly thr asp phe pro ile lys ser asn ala glu met val gln ala leu lys met leu asn gly arg asn ser met glu ser glu val asn leu thr met phe thr gly asn ala tyr ile val ala ser arg asp phe val gln his val leu lys asn pro lys ser gln gln leu ile glu trp val lys asp thr tyr ser pro asp glu his leu trp ala thr leu gln arg ala arg trp met pro gly ser val pro asn his pro lys tyr asp ile ser asp met thr ser ile ala arg leu val lys trp gln gly his glu gly asp ile asp lys gly ala pro tyr ala pro cys ser gly ile his gln arg ala ile cys val tyr gly ala gly asp leu asn trp met leu gln asn his his leu leu ala asn lys phe asp pro lys val phe gln arg leu asn ile ser asp pro leu arg leu thr gln val cys met ile his glu lys ser ser cys lys glu tyr leu thr gln ser his tyr ile thr ala pro leu ser lys glu glu ala asp phe pro leu ala tyr ile met val ile his his his phe asp thr phe ala arg leu phe arg ala ile tyr met pro gln asn ile tyr cys val his val asp glu lys ala thr thr glu phe lys asp ala val glu gln leu leu ser cys phe pro asn ala phe leu ala ser lys met glu pro val val tyr gly ala phe glu val ser trp lys tyr val ile asn thr cys gly gln asp phe pro leu lys thr asn lys glu ile val gln tyr leu lys gly phe gly arg thr lys tyr val his gln glu his leu gly lys glu leu ser tyr val ile arg thr thr ala leu lys pro pro pro pro his asn leu thr ile tyr phe gly ser ala tyr val ala leu ser arg glu phe ala asn phe val leu his asp pro arg ala val asp leu leu gln trp ser lys asp thr phe ser pro asp glu his phe trp val thr leu asn arg leu arg ala ile lys trp ser asp met glu asp arg his gly gly cys arg thr leu asn gln ser glu thr ala ile gln pro ser trp tyr phe | 0 |
the present invention enables the signals from the detector array of a hybrid focal plane to be partially multiplexed on the detector chip prior to the transfer of those signals to the signal multiplexing chip , thereby significantly increasing the maximum number of pixels which may be employed in such an array , leading to improved resolution and a wider field of view for the focal plane . the structure and operation of this invention can be described most effectively by first discussing the method in which a detector array can be fabricated according to the invention . fig1 - 12 illustrate the sequence of steps which may be followed in the process , with the odd numbered figures showing a plan view of a portion of the device and the even numbered figures a corresponding cross - sectional side view of the device . the process begins with the selection of a semiconducting layer 10 , as shown in fig1 and 2 . this material is chosen according to the wavelength of the radiation which is to be detected . in the case of infrared radiation , for example , an appropriate choice would be hg 1 - x cd x te with x equal to 0 . 29 . the basic material conductivity type in this case is p , with a doping density of 10 15 - 10 16 cm - 3 . in the preferred embodiment , the layer 10 is grown epitaxially to a thickness of 15 μm on a transparent substrate ( which is not shown ). this technique permits backside illumination of the device , so that the processing and signal multiplexing circuits do not obscure the incoming radiation . the layer 10 is masked to define an array of junction regions , such as the junction region 12 , in the surface of the layer 10 . the junction regions are doped to an opposite conductivity , i . e ., n type junctions are formed . this doping may be accomplished by techniques known in the art , such as ion implantation of b or diffusion of hg . next , a first level of insulation 14 is deposited over the surface of the layer 10 , as shown in fig3 and 4 . ( fig4 is a cross - sectional side view along the line iv -- iv of fig3 .) the insulating layers for this device may be fabricated by evaporating zns or photo - depositing sio 2 . the insulation 14 is removed over each junction region , as in the area 16 , and first level metal is deposited . a mask is then used to etch the first level metal , as shown in fig5 and 6 , thereby defining contacts over each junction region , such as the contact 18 , and defining a number of conducting plates , such as the conducting plates 20 , 22 , 24 , and 26 , around each junction region . a second level of insulation 28 is deposited over the first level metal , as shown in fig7 and 8 . the insulation 28 is removed over each junction region , as in the area 30 , and over each conducting plate , as in the areas 32 , 34 , 36 , and 38 . second level metal is then deposited , as shown in fig9 and 10 , and a mask is used to etch the second level metal and define control lines and junction contacts . control lines 40 , 42 , 44 , and 46 contact corresponding conducting plates 20 - 26 in the areas 32 - 38 . junction contacts , such as the junction contact 48 , contact the corresponding second level connecting metal over each junction region . the detector array is then completed by depositing a third level of insulation 50 , shown in fig1 and 12 , over the junction contacts , the control lines , and the second level of insulation . the third level of insulation is removed over the junction contacts , such as contact 48 , so that an interconnection can be made between the completed detector array and a multiplexing chip . a schematic illustrating one possible scheme for connecting the control lines of such a detector array is shown in fig1 . for ease of illustration , the array depicted here is a 6 × 6 detector array , with each four detectors being coupled to a common junction region , but those skilled in the art will appreciate that operational detector arrays will generally incorporate a much larger number of detectors . in the arrangement of fig1 , each junction region , such as the region 52 , defines a unit cell with four induced junctions surrounding it , such as the induced junctions 54 , 56 , 58 , and 60 . control lines 62 , 64 , and 66 are connected to the conducting plates in the first quadrant of each unit cell by control line contacts , such as the contact 68 . the control lines are connected in turn to a first bus line 70 which terminates in a pad 72 . similarly , the conducting plates in quadrants 2 , 3 , and 4 of each cell are connected to second , third , and fourth lines 74 , 76 , and 78 . in this manner , the detectors in each quadrant of the array can be selectively addressed , as further described below in connection with the operation of the detector array . this interconnect scheme requires no additional processing , since the bus lines may be defined at the same time as the control lines . the processing of the detector is completed by adding interconnect bumps to each of the junction contacts , such as junction contact 48 in fig1 , and to each of the control line pads , such as pad 72 in fig1 . corresponding interconnect bumps are located on the signal multiplexer chip . the focal plane is assembled by using a flip chip hybrid fabrication technique which results in the physical and electrical mating of the detector and multiplexer arrays , with a one - to - one match between respective interconnect sites . in operation , light enters the detector through a transparent substrate ( not shown ) and is absorbed in the semiconductor layer 10 , where the photons excite charges across the bandgap . the induced junctions , such as induced junction 80 in fig1 , detect the incoming radiation by collecting this excited charge . the collected charge is read out through the junction regions , such as junction region 12 , and thence to the signal multiplexer through the junction contacts , such as the junction contact 48 . this invention provides a technique for achieving a small scale pre - multiplexing of the detector array while retaining a photovoltaic structure . in the center of each unit cell is a small junction , as in the junction region 52 shown in fig1 or the junction region 12 shown in fig1 and 12 . there are four mis ( metal - insulator - semiconductor ) capacitors which surround and extend over each junction . these capacitors are formed by a combination of the semiconductor layer 10 , the first level insulation 14 , and the conducting plates , such as the plates 20 - 26 in fig1 and 12 . each of the four capacitors within a unit cell may be biased separately by means of the control lines , i . e ., control lines 40 - 46 in fig1 and 12 or the bus lines 70 and 74 - 78 in conjunction with the control lines , such as lines 62 - 66 , in fig1 . the signal multiplexer may be used to cause the correct signals to be placed on the control lines to perform this pre - multiplexing . by inverting any one of these capacitors , the central junction area may be extended into the corresponding quadrant of the unit cell . the control lines themselves do not form induced injunctions as readily , because they are located on a relatively thick layer of insulation which acts as a channel stop . thus , by cycling the control lines to selectively create field induced junctions , such as the field induced junction 80 in fig1 , under each of the capacitors , the effective collection area for the incoming radiation will cycle about the unit cell . consequently , the number of resolution elements on the focal plane is multiplied . in the embodiment illustrated , for example , the number of resolution elements is a factor of four higher than the number of unit cells . where four induced junctions are provided per unit cell , one fourth of each frame time for the focal plane may be spent integrating the signal from each of the four quadrants , with the signal being transferred and read out after each integration time . thus a 16 ms frame time would be composed of four separate 4 ms integration times with signal transfer . the readout of the signal from one quadrant may take place while the integration period has started for the next quadrant . in the preferred embodiment , the detector design of this invention is used in conjunction with a charge coupled device ( ccd ) signal multiplexer , which receives the incoming signal charge by a direct injection circuit . thus if the infrared diode is slightly reverse biased , the mis capacitor will not be required to store charge , since the charge will be collected in the multiplexer as soon as it is generated . therefore the bias on these capacitors may be kept low , eliminating tunnelling currents and minimizing thermal currents . fig1 is a cross - sectional side view similar to fig1 , but illustrating an alternative embodiment of a detector array built in accordance with the present invention . here , the semiconducting layer 10 , the junction region 12 , the first level insulation 14 , the contact 18 , the second level of insulation 28 , the control line 42 , the junction contact 48 , and the third level of insulation 50 are similar in structure and performance to the same elements in the embodiment illustrated in fig1 . the conducting plates , however , such as the plate 22 , are reduced in size and are used to provide a connection between the junction region 12 and an auxiliary junction region , such as the region 82 , formed in the layer 10 . where the layer 10 is p type hgcdte , for example , the auxiliary junction regions , such as the region 82 , would be doped to an n type conductivity , with the smaller induced junction regions , such as the region 80 , being sequentially activated to read out charge from the auxiliary junction regions through the junction region 12 . although some typical embodiments of the present invention have been illustrated and discussed above , modifications and additional embodiments of the invention will undoubtedly be apparent to those skilled in the art . the number of induced junctions surrounding each junction region , for example , may be varied to suit particular applications . in addition , the small scale multiplexing technique of this invention may also be implemented in other ways . if one uses only mis capacitors , for example , they may be multiplexed in a similar manner , with the signal being read to the multiplexer using a direct - capacitively - coupled ( dcc ) detector / multiplexer interface . changes may be made in the configurations , sizes , and arrangements of the components of the invention without departing from the scope of the invention . furthermore , equivalent elements may be substituted for those illustrated and described herein , parts or connections might be reversed or otherwise interchanged , and certain features of the invention might be utilized independently of the use of other features . consequently , the examples presented herein , which are provided to teach those skilled in the art how to construct the apparatus and perform the method of this invention , should be considered as illustrative only and not inclusive , the appended claims being more indicative of the full scope of the invention . | 7 |
traditional methods of allocating assets in a dynamic environment have suffered from a number of different problems . these problems have created inefficiencies within the system which inhibit the optimal allocation of available assets . the transport asset management ( tam ) system described herein overcomes these prior art problems by integrating a number of innovative software and hardware features that promote the efficient allocation of assets . the tam system enables the efficient allocation of a variety of different assets to complete a plurality of different services . one problem with the allocation of assets in the prior art is that there exists no way to efficiently allocate assets to perform the plurality of services . real - time information regarding the status , location and capability of assets has been unavailable . moreover , tools that could use real - time information to optimally allocate available assets have not been made available . the scope of this problem continues to increase . as assets become more intelligent , have greater capabilities , and have more access to communications channels , the challenges of this environment are expected increase . the tam system allows an operator to control a number of assets within a predefined area , irrespective of ownership of the asset . one of the innovative advantages of the tam system is that it does not require ownership of an asset in order to exert control over the asset . the innovative model of control without ownership allows for cooperative real - time sharing of assets without the user of the tam system actually owning all of the available assets . in addition , the tam system allows for back end control of operational cost by unifying individual assets into a pool that may be used to achieve the best allocation of assets . finally , the tam system allows for enhanced visualization of the allocation of assets . as shown in fig1 , one of the innovative elements of the tam system . 100 is the ability to designate a boundary or operational “ area ” 108 and control of assets 104 , 106 within the operational area 108 . the tam system 100 includes a controller 102 for asserting operational control when the asset 104 , 106 enters the operational area 108 . in the example shown in fig1 , the operational area 108 is illustrated by a circle ( e . g ., a single gps point and a radial distance from that point ). in implementation , the operational area 108 can be defined in a variety of manners , including proximity to a predefined point ( e . g . a specific shipyard ), proximity to a temporary or mobile landmark ( e . g . a cargo barge ), within a specified geographic region ( e . g . a shipyard or city ), or a group of locations with shared attributes ( e . g . hostile areas , manufacturing sites , or shipping locations ). it is expressly understood that the operational area 108 can be defined by any number of points , with any relationship between the points , and may take many shapes . for the purpose of clarity , it is understood that the assets described herein may be used for one or more different services or purposes . for example , these may include the transportation of goods and the performance of service ( s ) at a particular location , or any exertion of control over any asset for any purpose . the term “ service ” is further intended to be inclusive of any function that an asset may perform . these services may include performing repairs , providing transportation , or any other function that an asset may perform . further , it will be understood that an “ operator ” is an entity that can exercise control of an asset by specifying the use of asset capabilities to perform a specific purpose or service . examples include warehouse managers , dispatchers , maintenance personnel , manufacturers and shippers . the term “ asset ” is intended to refer to a plurality of different types of assets , including containers , trucks , products , or any other item that are capable of performing a service . it is understood that assets can have a series of capabilities that provide both information for local action , and control / status information for operator access . these capabilities include , but are not limited to , location awareness , power awareness , application awareness , destination awareness , temperature awareness , acceleration awareness , time awareness , and sensor awareness . location awareness includes the ability to notify operators based upon areas being entered or exited . examples of location awareness include transitioning into or out of a geofence ( as determined by gps functionality ) or location ( as determined other wireless transmitters ). power awareness includes information related to power consumption or power availability to be used to take appropriate action . for instance , an operator may decrease polling of the asset in response to power failure or to low battery power . application awareness includes the ability of an operator to tailor behavior of all or part of the asset based upon the application that is currently being performed by the asset ( transportation of produce , hazardous materials , etc .). for instance , if a hazardous material is being transported , additional sensors may be activated and polled to check the consistency or integrity of the containers transporting the hazardous material . destination awareness includes information that may be used to aid in the routing and delivery of a product . time awareness includes the ability of a controller to initiate or schedule time based events . embodiments of time based events may be asset initiated or operator initiated . asset initiated may be where an asset may change roles , ownership or other features at a predetermined time or time interval . operator initiated may be where an operator may require asset reallocation at predetermined times or time intervals . in embodiments where a scheduled time event is programmed into an asset , the asset may change roles , ownership , or other feature at a predetermined time . temperature awareness includes the tracking of both internal and external temperatures . this tracking may be used to provide historical logs and real time notification of the asset environment . for instance , during the transportation of frozen materials , a notification may be sent to an asset upon the temperature exceeding a safe condition . acceleration awareness includes the monitoring of asset vibration , shock , tilting and acceleration for determining , measuring and reporting forces experienced by the asset . acceleration awareness may be maintained through one or more sensors capable of determining the acceleration of an asset . while temperature and acceleration are two examples of conditions or parameters which may be measured , it is expressly understood that additional sensors operable for measuring other conditions or parameters may be used consistent with the present disclosure . for example , sensors may be utilized for enabling the monitoring and control of generic inputs and outputs assigned to operator specific applications such as controlling pumps , doors , photosensors , air pressure transducers , compass transducers , or other devices . in one embodiment , the tam system 100 uses a plurality of wireless base stations enabled by any type of technology known by one skilled in the art to create a wireless network capable of communication with a plurality of assets . the tam system 100 further may incorporate global positioning system ( gps ) data or wireless network based location functionality to determine an operational area and positioning information . the assertion of operational control by the controller 102 is made when that particular asset 104 , 106 enters the defined operational area 108 . this assertion is initiated by the asset using location awareness to determine entry into the operational area 108 . registration of a particular asset in the tam system 100 ( and to the controller 102 ) may be made in any way known to those skilled in the art . it is understood this registration process may take place using either an active or passive model . in an active model , the asset identifies itself as entering into the operational area controlled by the tam system 100 and transmits a message to the controller 102 indicating the availability of the asset . in a passive model , the asset is continuously tracked by the tam system 100 and no registration message is required . the selection of a particular model may be made either by the asset or by the tam system 100 . in the active model , when the particular asset 104 , 106 enters the operational area 108 , the asset 104 , 106 sends a registration message to the controller 102 indicating or alerting of the presence of the asset 104 , 106 . it is understood the registration message sent to the controller 102 may comprise additional information including information relating to capabilities , availability and location of the asset . other messages may also be sent . in the passive model , when the asset enters the operational area 108 , that event is detected by the controller 102 . the asset reports the status and availability to the controller 102 and is registered as an asset within the operational area 108 . in fig1 , the tam system controller 102 controls the operational area 108 having the asset 104 therein . once the asset 104 has registered , the tam system controller 102 maintains or exercises control over the asset . this control occurs regardless of whether or not the tam system 100 ( user ) owns the asset 104 . for the purpose of clarity , “ control ” includes the controlling any capability of the asset 104 . the allocation of “ control ” can include any subset of capabilities of the asset . this “ control ” without “ ownership ” model may allow a single operator to designate how and where the resource , or portions of the resource should be used regardless of ownership . in addition to control based upon location awareness , control may also be based upon power awareness , application awareness , destination awareness , time awareness , or temperature awareness , or any combination of these . in some embodiments , assets can send and receive configuration and control data to provide both immediate control and status , and to configure the asset to take actions based upon local events . for example , these actions may include notification , gpio activation , or beaconing based upon specific events . local events may be detected using asset resources , including but not limited to location awareness , power awareness , application awareness , destination awareness , time awareness , and temperature awareness . the ability to take specific actions using specific events has several applications . for example , destination awareness information may provide routing assistance and notification of arrival to an operator . in one embodiment , upon the approach of an asset to a specific destination , the asset may be routed to a particular location or bay for unloading of cargo . in another embodiment , the asset may be routed around a construction site or other obstacle to the destination . in another example , acceleration awareness may be used to provide information to a controller or the asset of movement or tilt . a warning may be given to the operator of the asset of the excess movement , tilt , or acceleration to give the operator an opportunity to adjust or correct . in other embodiments , the operator with control over the asset may remotely deactivate the engine or other component of the asset to correct acceleration or movement . in yet another example , systems and methods may be used to detect temperature extremes allowing for the potential prevention of damage to cargo . this temperature may be due to a variety of causes ( faulty hardware , operator error , a door to a freezer left open , etc .). this notification may allow the controller of the asset to take corrective action ( notify the asset of the problem , alter the operation of refrigeration within the asset , etc .). in the event of an asset &# 39 ; s proximity to specified devices , other assets , or operators , appropriate notification and behavior modification can be provided ( automatic tripping of alarms , automatic modification of reporting intervals , etc .). an asset may be configured to accept control from a specified set ( one or more ) of operators . in addition , sets of operators may be restricted to specific functions . examples of functions which may be limited include power , security , quality or shipping functions . for example , operators responsible for battery changes may be restricted to power status only , security personnel are provided prioritized access to hazardous materials , quality control personnel are restricted to temperature and acceleration history , and shipping personnel and manufacturers are allowed access to current location and destination configuration . operators can also be mobile , and control of assets can be passed to operators based upon proximity or some other device derived information . examples of environments with this capability include situations in an operator retains control of specific assets until a designated operator enters the proximity of the asset . the original operator then relinquishes control . an additional example would be when a mobile operator has control of an asset and transfers ownership to another mobile operator ( e . g ., a train engine transferring control of a train car ). a further example may be if a mobile operator enters a specified area , the asset is deposited to local control . the operator responsible for the area assumes control of the asset . a further example is if a temperature extreme is exceeded and control of an asset is transferred to support personnel that can address device specific issues . operators may be granted full or partial control of an asset . a centralized operator can allocate responsibility to multiple operators , each responsible for a subset of control . one example of this would be in a shipyard . one group of operators responsible for shipping would receive access to destination control , location information , and shipment status . another group of managers for a region may be responsible for power , security and environmental control to receive access to power status , container security issues , temperature , and acceleration information . similarly , shippers may be responsible for delivering an asset from an origination point to a destination point and receive access to location information and destination information . in a different embodiment , operators can be grouped into functional entities . for example , a trucking company being labeled as a group of operators , with each having possession of a group of assets . in this embodiment , inventory control could be considered as the aggregation of all manufacturing facilities . a site manager could be responsible for management of a location , but access to specific subsets of capabilities could be allocated across all sites for limited access . areas can be grouped by common site attribute , based upon operator determined groupings , and managed as a single entity . one embodiment of this is when a group of locations is labeled as “ hostile areas ” ( locations that stolen assets are typically stored ), and responsibility passed to recovery teams or law enforcement . a second embodiment may be when a group of locations is labeled as a manufacturing site and placed under control of inventory management . a third embodiment may be when a group of locations is labeled as belonging to a specific shipping company and information regarding this site could be shared with the shipping company . assets can be grouped based upon operator determined groupings by a common asset : attribute . one embodiment of this is when assets hosting hazardous materials are placed under control of the security operation . a second embodiment may be when assets requiring temperature control are placed under control of a refrigeration control operator . a third embodiment may be when assets requiring periodic servicing ( e . g ., plants requiring water , fuel in generators , battery recharging ) are placed under control of a maintenance operator . operators , areas , and assets can be allocated based upon a multidimensional , multilevel architecture . an embodiment of this is when a subset of operators responsible for watering plants are assigned control of maintenance of a subset of assets requiring water across multiple areas . a second embodiment may be when a subset of operators responsible for security are assigned responsibility for locations of a subset of assets requiring hazardous material classification across multiple areas . a third embodiment may be when a subset of products is monitored by a subset of assets ( e . g ., manufacturers ) across multiple areas ( e . g ., united states ). a fourth embodiment may be when all areas not specified by geofences are accessed by all assets not responsible for maintenance . fig2 is an example of a transport asset management ( tam ) system 200 operated within an operational area 210 using a plurality of wireless transceivers . located within the operational area 210 are assets 104 , 106 . the tam system 200 also includes the controller 102 and a secondary controller 206 . an asset 204 is shown located outside the operational area 210 . it will be understood that , for purposes of illustration , the asset 204 is not under the control of the tam system 200 . though the tam system 200 may be aware of the status and location of the asset 204 , it may not exert control over the asset until the asset 204 enters the operational area 210 . this approach allows for the tam system 200 to be aware of assets in an extended region outside the operational area 210 , even if those assets are not immediately available , and to have a secondary source of available assets . in essence , in the event a task request enters the tam system 200 which cannot be met by available assets under control of the tam system 200 , the tam system 200 may issue a request for an additional asset to be used that is not under control of the tam system 200 . in this way , the tam system 200 has expandability to acquire other assets that are not directly under its control . another innovative element of the present disclosure is the ability to utilize a plurality of transceivers located anywhere — either within or outside of designated operational area — which track , communicate , and / or monitor assets within and outside the area . this enables differently sized and shaped operational areas to be monitored and controlled by a single transport asset management system . the transceivers may be configured at wireless cellular base stations , wireless transceivers , satellite communications links , and the like , or any other suitable technology which can be used for communication . fig3 illustrates a tam system 300 having a plurality of different operational areas 210 , 310 of different size / shape that may be used to control a number of different assets . one of the innovative elements of the present disclosure is the ability to use a plurality of controllers in order to control assets within a number of areas . in this example , the asset 106 within the area 210 is controlled by controller 102 and the asset 104 is controlled by controller 304 . in some applications , it may be necessary to instruct a particular asset to exit one operational area and enter a different operational area . an asset 302 , in the example shown in fig3 , has been instructed to leave one operational area 210 / 310 and enter the other respective operational area 310 / 210 . in one embodiment , the controller ( s ) may instruct a particular asset to leave one operational area and enter the second operational area . in such a case , control may switch from the controller 102 / 304 to the other respective controller 304 / 102 . certain operational modes may give a special status to an asset as it enters an operational area . this status may include a “ predispatched ” status . for example , in the event a truck has a load to deliver to a site within the operational area of another tam controller , the current tam controller will be unable to give instructions to the truck until after the load has been delivered . in another example , in the event a service repair crew has been dispatched to perform a repair , until the repair is complete , a particular tam controller may not exert control over the service repair crew . other rules or modes may be implemented through the tam system as may be required to promote the overall efficiency of the tam system . fig4 is a flowchart illustrating a process 400 for allocating asset ( s ). a call is received requesting a particular service ( block 402 ). a determination is made to identify all assets capable of performing the requested service ( block 404 ). of these assets , a determination is made identifying / selecting an asset to perform the requested service ( block 406 ). various factors know to those skilled in asset allocation may be considered . thereafter , the selected asset is deployed and the service is performed . as will be appreciated , a requested service may include one or more services , and the selected asset may include one or more assets . now turning to fig5 , there is illustrated in table format a set of information that might be utilized with the tam system . for example , the set of information may include asset name , class of the asset , and other fields that describe the asset . it is understood that the name of the asset may be used as a unique field within the table . the class of the asset may be used to identify the type of service that the asset is capable of performing . for exemplary purposes , class a will refer to a small truck asset designed to provide plumbing repair services , class b will be used to designate a large truck asset designed to provide public utility repair services , and class t will be used to designate transportation devices ( such as a freight truck ). another of the innovative elements of the present disclosure is the ability to allocate assets based only upon the class of the asset which is indicative of the type of service the asset may perform , or based on the actual operational abilities of the particular asset . this may be important in transportation applications since a plurality of assets may be used for transportation purposes but may have substantially different operational abilities . for instance , a large truck and a small truck may both be used in order to transport an item , however , transporting large quantities may only be performed by a certain model of asset . the tam controller takes into account not only the class of the asset , but the particular parameters relating to the particular asset . in this way the controller and system can accurately and optimally deploy assets into the field . as illustrated in . fig4 , one of the steps in the allocation of particular assets is the determination of which assets may be used ( capable ) for a particular purpose . it will be understood that a subset of assets within a particular class of assets may have additional information about that subset of assets . for example , and turning to fig6 , additional information is given about each of the transportation assets ( assets 4 , 5 and 6 ). this additional information may include ( and is not limited to ) status , range of the asset , notes relating to the asset , ownership , and the operational cost for transportation purposes . some or all of this information may be used by a particular class of assets but not necessarily by every class of assets . in this way the databases are optimally configured to store only additional information that is relevant to that class of assets actually deployed for each asset within the database system . fig7 is a flowchart illustrating a process 700 for determining / selecting an asset for the requested service . in block 702 , there is a determination of the parameters or conditions necessary for the requested service ( block 702 ). these parameters or conditions may include , for instance , the amount of fuel required for vehicle operation versus the cargo capability of the vehicle . next , critical paths are determined ( block 704 ). a critical path may include timing problems , for instance , deadlines that must be met within the transportation schedule . these critical paths may also include , but are not necessarily limited to , additional information which may be stored within the tam controller . on the subset of available assets able to perform the requested service , a comparative analysis is performed ( block 706 ) and one asset is selected ( bock 708 ). in this way , a determination may be made about which asset us best suited for a particular service / task based upon the relative cost of other assets also available to perform the request service / task ( a discussion of determining the cost of an asset is set forth below ). once an asset is selected , a determination may be made whether the solution selected may preclude completion or interfere with any other previously requested services . if such determination is made , the process may be restarted to select another asset ( or use the second best asset ) for the requested service . the selection of the best asset for a particular service may be made based upon a determination of the total cost of the asset . for instance , the tam controller may make a determination of the total cost of deploying a particular asset based upon the marginal cost for use of an asset and compare this with the total cost of a second asset . the total cost associated with the ownership of asset , as well as other factors that affect the total cost of the asset , may be considered . for instance , for a transportation asset , the total cost for the asset may be the sum of the cost to operate the asset per mile , plus the costs already associated with the asset . these associated costs may include , but are not limited to , whether the tam system owns the asset . another one of the innovative elements of the present disclosure is the ability to allocate assets based on the current position of the assets . one problem that may be encountered in the prior art method ( s ) of allocating assets for a particular service is that the precise location of the asset may not be known while planning to allocate the assets at a particular time . the present system overcomes this by allowing the tam system to combine real - time information related to the location / position and status of the assets with the status of a plurality of requested services which require completion . by combining these two elements , a small allocation of resources may be made to perform a plurality of services within a plurality of separate classes . one of the advantages of the present disclosure is the ability to take into consideration the ownership of an asset and costs of utilizing an asset . for instance , if a light truck is needed for s service / task , and the operator only has access to a heavy truck , it may be more cost effective to use a contractor not owned by the operator to perform the service / task . in one embodiment , the tam system 100 may be operated by a trucking company or by a pool of companies . in the pool example , no assets are owned by operator ( s ) of the tam system 100 , while in the trucking company example , some or all of the assets may be owned by trucking company ( the operator of the tam ). data available to the tam system 100 may be displayed to the operator to provide a visual representation of the location of each asset within the operational area . in addition , it will be understood that additional visual representations ( colors , icons , flashing , etc .) may further provide other information regarding the status , class , etc . regarding each asset within the operational area . as described below , class indicates the capabilities of the asset , and status indicates the current operational state of the asset . for example , an asset that is available for assignment to particular service may be colored in green . an asset which has been assigned to a particular service may be colored in blue . an asset that is out of service may be colored in red . the assignment of a color may be made based upon a plurality of different conditions . for instance , an asset which is both available but not owned by the operator of the tam system 100 may be colored in purple . the examples of colors are given for exemplary purposes only . other visual representations may be utilized . for instance , an asset that is flashing a certain color may be in the process of being taken control of . in another instance , an asset that is flashing another color may indicate an alert condition ( equipment failure , leaving of a geofence , unauthorized access to cargo , etc .). therefore , the map may simultaneously display class , status , ownership , etc . of the assets . the tam system 100 described above may be implemented on any computer system with sufficient processing power , memory resources , and network throughput capability to handle the necessary workload placed upon it . fig8 illustrates a typical computer or computer system 804 suitable for implementing one or more embodiments disclosed herein . the computer system 804 includes a processor 822 ( which may be referred to as a central processor unit or cpu , and implemented as one or more cpus ) in communication with memory 820 ( that may include one or more of the many different types of memory , such as read only memory ( rom ), flash , random access memory ( ram ), and the like ). the computer system 804 further includes input / output ( i / o ) device ( s ) 830 and a network connectivity module 808 ( with one or more network interface devices ). secondary storage ( not shown ) may also be included and typically includes one or more disk or tape drives and are used for non - volatile storage of data and as an over - flow data storage device if the memory 804 is not large enough to hold all working data . in addition , secondary storage may be used to store certain programs that are loaded into memory 820 when such programs are selected for execution , while memory 820 may be used to store instructions and perhaps data that are read during program execution . the i / o device ( s ) 830 may include printers , displays ( monitors , liquid crystal displays ( lcds ), touch screen displays ), keyboards , keypads , switches , dials , mice , track balls , voice recognizers , card readers , paper tape readers , or other well - known input devices . the network module 808 and network devices may take the form of modems , modem banks , ethernet cards , universal serial bus ( use ) interface cards , serial interfaces , token ring cards , fiber distributed data interface ( fddi ) cards , wireless local area network ( wlan ) cards , radio transceiver cards such as code division multiple access ( cdma ) and / or global system for mobile communications ( gsm ) radio transceiver cards , and other well - known network devices . these network devices 808 may enable the processor 822 to communicate with an internet or one or more intranets . with such a network connection , it is contemplated that the processor 822 will receive / transmit information from / to a network in the course of performing the above - described method steps . such information , which is often represented as a sequence of instructions to be executed using processor 822 , may be received from and outputted to the network , for example , in the form of a computer data signal embodied in a carrier wave . the memory 820 may store one or more settings 818 and a routing table 824 . settings 818 may be used to store elements relating to the configuration of the tam system 100 . these elements include , but are not limited to , the definitions of classes and types for assets as well as other information used the allocation of assets . the tam system 100 may also include various remote communications devices , such as one or more base stations 812 . the tam system 100 may further include any number of other connections to other systems and networks . the network module 808 may include wireless communication capabilities to provide wireless communication functionality between the tam system 100 and the base station 812 and / or a remote device such as a host server ( not shown ). the network module 808 in the tam system 100 may utilize any wireless technology including , but not limited to , code division multiple access ( cdma ), global system for mobile ( gsm ) communications , worldwide interoperability for microwave access ( wimax ), or any other wireless standard . through the network module 808 , the tam system 100 is able to communicate with other remote communication devices via an air interface . while several embodiments have been provided in the present disclosure , it should be understood that the disclosed systems and methods might be embodied in many other specific forms without departing from the spirit or scope of the present disclosure . the present examples are to be considered as illustrative and not restrictive , and the intention is not to be limited to the details given herein . for example , the various elements or components may be combined or integrated in another system or certain features may be omitted , or not implemented . also , techniques , systems , subsystems and methods described and illustrated in the various embodiments as discrete or separate may be combined or integrated with other systems , modules , techniques , or methods without departing from the scope of the present disclosure . other products shown or discussed as directly coupled or communicating with each other may be coupled through some interface or device , such that the products may no longer be considered directly coupled to each other but may still be indirectly coupled and in communication , whether electrically , mechanically , or otherwise with one another . other examples of changes , substitutions , and alterations are ascertainable by one skilled in the art and could be made without departing from the spirit and scope disclosed herein . it should be understood that although an exemplary implementation of one embodiment of the present disclosure is illustrated above , the present system may be implemented using any number of techniques , whether currently known or in existence . the present disclosure should in no way be limited to the exemplary implementations , drawings , and techniques illustrated above , including the exemplary design and implementation illustrated and described herein , but may be modified within the scope of the appended claims along with their full scope of equivalents . | 6 |
the cellulose containing particles are generally of paper and / or vegetable matter origin . when paper is present in the aggregates , it can be present over a wide range . for example , the paper can be present in an amount to provide the aggregate with a paper content in the range of from about 1 % to about 99 % by weight . any paper can be used , but the invention will probably have its greatest benefit when applied to recycled paper , including newspapers , telephone books , magazines , computer paper , corrugated paper , etc . waste or excess paper or pulp recovered from manufacturing processes can also be used . the selection of the desired paper is an economic one , rather than a technical one . vegetable matter which can be employed as cellulose - containing particles includes wastes from the timber and wood products industry , such as wood , wood chips , lumber and sawdust , wastes from landscaping work such as brush , branches , grass clippings , leaves , and other yard wastes , wastes from agricultural operations such as straw , stalks and leaves ; wastes from the processing of agricultural products , such as gin trash , bagasse , grain hulls , peels , sorghum , sugar cane , animal byproducts , food industry sludge , paper industry sludge , clothing industry wastes , or consumer wastes such as discarded clothing and furniture . generally speaking , the particles will be of relatively small size . for example , it is expected that utilizing particles which have a maximum size in the range of 1 mm to about 20 mm for a major portion , on a weight basis , of the particles in the aggregates will provide a good result . to provide the particles with this size , it is generally necessary to grind up the starting material . generally , the paper or other material to be utilized is ground to a screen size of 10 cm or less , usually , to screen size of 3 cm or less , and preferably to a screen size of between about 0 . 2 and about 2 cm . hammer mills can be used . by aggregate is meant a cluster of cellulose - containing particles . generally speaking , the aggregates are formed from consolidated particles . preferably , the aggregate is consolidated by compacting ground paper and / or vegetable matter particles under conditions of added moisture , for example by pelletizing or briquetting , to form pellets or briquettes of cellulose - containing particles . for certain applications , however , the aggregate may be in the form of crumb or broken cake . for these applications , broken up pellets or briquette form a highly suitable material . in a case of sprayable insulation or ground cover , the particles are aggregated or consolidated into a mass by spraying them onto the desired surface along with an optional binder and permitting them to dry . the particle size and shape of the individual aggregates depends on the desired application . generally speaking , larger aggregate sizes and highly consolidated aggregates will release their added ingredients over a longer period of time than smaller sized or loosely consolidated aggregates . aggregates which are exposed to the weather , such as on a highway right of way , will lose their added ingredients more quickly than aggregates which are sheltered , such as in an attic or under a foundation . generally speaking , the particle size , as expressed in terms of average volume of a major portion of the aggregates , can range from about 0 . 01 cc to about 1200 cc . usually , the aggregates will have a volume in the range of from about 0 . 1 cc to about 800 cc . preferably , the aggregates will have a volume in the range of from about 0 . 5 cc to about 150 cc , because it is believed that aggregates having a volume in this range will be useful for most applications . however , for some applications , such as for mulch or ground cover , it may be desirable to form mixtures of aggregates with a volume in the range of 0 . 5 cc to 150 cc with smaller aggregates which may be in crushed or crumbled form such as those having a size in the range of from about 0 . 02 cc to about 0 . 5 cc ., although even smaller aggregates such as those having a volume as small as 0 . 005 cc may also be used . the aggregates can also be described as having a major dimension and a minor dimension . the minor dimension is preferably less than 5 cm to aid in breakdown and release of the additives . the major dimension is preferably less than about 30 cm to aid in mixing in the soil with standard agricultural implements . the minor dimension is preferably greater than about 0 . 15 cm and the major dimension is preferably greater than about 0 . 3 cm for reasons of economy in production and handling . generally speaking , the aggregates are produced in pellet or briquette form , and can have any desired configuration , such as circular , square , or flattened cross section . the currently preferred aggregate is presently an elongated extrudate with a circular cross - section , because it has been tested with good results . the presently preferred aggregate is generally arcuately shaped and has a length in the range of about 0 . 1 to about 30 cm and a diameter in the range of from about 0 . 1 to about 5 cm . even more preferably , the extrudate has a length in the range of from about 1 to about 15 cm and a diameter in the range of from about 0 . 2 to about 1 . 0 cm . an extrudate having a length closely encompassed by the range of from about 2 to about 5 cm and a diameter in the range of from about 0 . 3 to about 0 . 8 cm and crumb formed from such an extrudate has been tested in several applications with good results . the aggregates will generally have an apparent bulk density in the range of from about 110 kg / m 3 to about 550 kg / m 3 at a moisture level in the range of from about 4 - 20 % by weight . the formation of pellets of ground paper is known , but not commonly used in the paper recycling industry . a pelletizing machine which extrudes pellets in the form of an extrudate has been used with good results . it is also believed that a briquetting machine , such as is used for the manufacture of charcoal briquettes , would also be useful , as well as equipment for pelletizing animal feeds . to form the aggregates , the selected cellulose - containing material or mixture thereof is first ground to a particle size suitable for pellet or briquette formation . generally , the material is ground to a screen size of 10 cm or less , usually , to a screen size of 3 cm or less , and preferably to a screen size of between about 0 . 2 and about 2 cm . hammer mills can be used . the aggregates thus contains discrete particles of cellulose waste material in comminuted form . the material is then pelletized or briquetted , or in the case of sprayable materials , generally further ground to a screen size of less than about 2 mm . if necessary , moisture is added in an amount sufficient to facilitate the completion of pellet or briquette formation . small sized aggregates can be formed , if desired , by crumbling the pellets or briquettes . the aqueous medium may contain a binding agent to facilitate pelletizing . binding agents include paper products , clay , ash , polymer , or starch - based adhesives , for example . for non - paper cellulose products , the binding agent can comprise paper prepared as hereinabove described . the aqueous medium can be selected from a wide range of sources . water is generally suitable . for agricultural and horticultural uses , where the objective is not weed suppression , other aqueous mediums containing organic matter are also suitable . sewer sludges , paper pulp sludges , sludges containing animal wastes such as chicken litter and / or cattle manure , and slaughterhouse wastes are all suitable . if desired , a growth promoter such as a source of assimilable nitrogen , for example , which is sufficient to provide the pellet product with a ratio of nitrogen to biodegradable carbon in the range of from about 1 : 10 to about 1 : 60 , on an atomic basis ( elemental weight ) basis can be incorporated into the product during the pelletizing process . ammonium nitrate or other commercial fertilizer or chicken litter are suitable . in another embodiment of the invention , there is provided a method for controlling termite infestation employing the aggregates as described above . in accordance with the method , an area to be protected from the termite infestation is selected and aggregates of cellulose - containing particles containing at least one anti - termite agent are applied around the area to be protected . the duration of anti - termite agent effectiveness is greatly increased over current methods due to its being incorporated into the aggregates and being released over the decomposition period of the product . in essence , this method of applying a termiticide permits it to become a slow release , long acting product . the method is also safer for workers since it eliminates the handling and potential breathing of liquids and sprays of concentrated dangerous chemicals during application . normally , the area to be protected will contain a building . however , in certain parts of the country , such as new orleans , termite damage to trees is a major problem , and it is within the scope of the invention to protect trees . preferably , the area to be protected is surrounded with the aggregates . in the case of building , it is contemplated that the aggregates will be placed near the foundation . in the case of trees , it is contemplated that the aggregates will be positioned near the base of the tree . generally speaking , the ground around the area to be protected will be covered with the aggregates . if desired , the aggregates can be buried in the ground around the area to be protected , such as by trenching or tilling techniques . for new construction , the aggregates can be placed under the area to be occupied by the slab or foundation . the aggregates containing the anti - termite agent are expected to function as a termite “ bait ”— where the termites are attracted to the product as a feed where they pick up the toxin and return to the colony to wipe it out , or as a “ repellent ”— where the termites either are repelled by a barrier of product or pick up toxins by contacting the product and are killed . the product is expected to be highly effective when applied as a landscape mulch in flower beds surrounding residences and other structure to be protected , such as on an annual basis . the product is expected to be highly protective when buried in the soil , forming a barrier or bait to eradicate and / or repel subterranean termites . for use as a bait , it is preferred that the aggregates contain wood products . the anti - termite agent is incorporated into the products by spraying liquid types onto the aggregates and mixing granular types with the aggregates . generally speaking , the aggregates will contain less than 15 % by weight of the anti - termite agent , usually less than 1 % but greater than 0 . 01 %. anti - termite agents generally include toxins and repellents . the toxin can be of the bait type . anti - termite agents ( primarly repellents ) which can be incorporated into the product an exemplary wt % amount to incorporate into the aggregates include fmc biflex tc ( bifenthrin — 0 . 06 %), fmc talstar f ( bifenthrin — 0 . 06 %), dowelanco dursban tc ( chlorpyrifos — 0 . 5 to 2 . 0 %), whitmire duraguard ( chlorpyrifos 1 - 2 %), whitmire optem tc ( cyfluthrin 0 . 05 - 0 . 25 %), zeneca demon tc ( cypermethrin 0 . 25 %), fmc prevail ft ( cypermethrin 0 . 25 - 1 . 0 %), agrevo 25 sc ( deltamethrin 0 . 075 - 0 . 125 %), agrevo tribute ii ( fenvalerate 0 . 5 - 1 . 0 %), bayer premise 2 ( imidacloprid 0 . 1 %), fmc f3697 ( imidacloprid 0 . 01 - 0 . 1 %), zeneca karate ( lambda - cyhalothrin 0 . 25 %), zeneca commodore ( lambda - cyhalothrin 0 . 25 %), zeneca prelude ( torpedo ) ( perethrin 0 . 05 - 1 . 0 %), and fmc dragnet ft ( perethrin 0 . 3 %). boric acid or borax can also be used if desired . anti termite agents ( primarily “ baits ”) which can be incorporated into the product and an exemplary wt % amount to incorporate into the aggregates include dowelanco sentricon ( hexaflumuron 0 . 5 %), am cyanamid co . subterfuge ( hydramethyinon 0 . 3 %) and fmc firstline gt ( sulfuramid 0 . 01 %). in a field test , a one inch thick bed of aggregates containing either 0 . 1 % deltamethrin , 0 . 001 % deltamethrin , or no deltamethrin were positioned on ground surface in an area known to be infested with termites and a weighted board was positioned on the top of the bed . after one year , the boards on the treated beds had been totally protected from termite attack , while the board on the untreated bed had suffered a 50 % termite attack . thus , at least for deltamethrin , a toxin level of 0 . 001 wt % appears both effective and long lived . in another aspect of this embodiment of the invention , aggregates of cellulose - containing particles which are employed as building insulation can incorporate insecticides such as those described above to prevent infestations of roaches , termites , ant , or other insects in the building . the aggregates can be in the form of a pourable crumb as is known in the art to be well suited for providing insulation above ceiling and in walls or in the form of a sprayed on insulation as is known in the art to be well suited for insulating under roofs , ceilings and floorings . the aggregates could also be blown onto the surface via an air or other gas stream or carried onto the surface via water or other liquid slurry . because the insecticide applied in this manner will be somewhat protected from the environment ; it should remain active for long periods of time , and additionally be safer for applicators than current techniques which use liquid sprays or gasses . in another embodiment of the invention , the aggregates of cellulose particles as described above can be employed in a method for controlling fire ants . the method is carried out by selecting an area in which fire ant control is desired and applying aggregates of cellulose - containing particles containing a fire ant toxin to the area . generally speaking , the area to be treated will be either a fire ant mound or a horticultural area . for fire ant mounds , generally from about 1 cc to about 500 cc of the aggregates will be applied , depending on the effectiveness of the toxin carried by the aggregates . for horticultural area , the aggregates will either be dispersed around the area to be protected , similar to that described above for termite control , or , more preferably , mixed with the soil . for example , fire ants can be prevented from nesting in potted plants or planters by mixing an effective amount of the aggregates containing the toxin with the soil contained in the pot or planter , or by utilizing the aggregates containing the toxin as a cover mulch for the pot or planter . the same techniques can be applied to gardens or larger agricultural areas . for lawns , the aggregates can simply be broadcast on the surface . the toxin can be added to the aggregates in the same manner as the anti - termite agents as described above . suitable toxins are well known in the art . examples include ciba logic ( fenoxycarb ), ciba award ( fenoxycarb ), am . cyanamid co . amdro ( hydramethylnon ), ciba diazinon granules ( diazinon ), whitmire ascend ( abermectin ), us borax ( boric acid ), zeneca fireban ( tefluthrin ), and fmc talstar ( bifenthrin ). the amounts of toxin are similar to that described above for the termite application . in another embodiment of the invention , the aggregates of cellulose particles as described above can be employed in a method for controlling plant growth . the method is carried out by selecting an area in which plant growth control is desired and applying aggregates of cellulose - containing particles containing a plant growth inhibitor to the area . generally , the type of plant growth desired to be inhibited will be weed growth or grass growth . the area to be treated will generally comprise a horticultural area . in such case , the plant growth inhibitor will generally comprise a herbicide . it is believed that best results will be achieved in this embodiment of the invention where the horticultural area contains growing plants of the desired variety . the aggregates are applied around the growing plants so as to achieve coverage of the ground . generally speaking , the area around the growing plants where plant growth inhibition is desired will be covered to a depth of at least 0 . 05 inches , generally from about 0 . 1 inches to about 5 inches , usually from about 0 . 25 to about 1 inches . the method is believed particularly well suited for application to potted plants , planters , beds and garden areas . the plant growth toxin can be added to the aggregates during the manufacturing process as hereinabove described . for such uses , it is preferred that the aggregates contain plant nutrients , and , for paper - based products , a complexing agent to slow the release of aluminum . in this embodiment of the invention , the duration of the herbicide &# 39 ; s effectiveness is greatly increased over current method due to its being incorporated into the aggregate and being released over the decomposition period of the aggregate . in essence , this method of applying the herbicide allows it to become a slow release herbicide . the method of incorporation and application uses less herbicides than the standard methods because none , or very little , is lost during the application to the target area . currently 40 % or more of the herbicides never effectively reach their target area due to wind , rain and water runoff . the ability of a given amount of herbicide to prevent and / or eradicate weeds is therefore increased . the method for application is also safer for workers since it eliminates the handling and potential breathing of liquids and sprays of concentrated dangerous chemicals during application . the method also eliminates the necessity of prolonged waiting periods ( 8 or more hours ) before safe entry into an enclosed building which has recently been treated with herbicide . the training required for safe herbicide use in accordance with the invention is also lower than that currently required . suitable plant toxins are well known and are generally termed herbicides . they are usually incorporated into the aggregates in an amount which constitutes less than about 10 wt % of the applied material . examples include surflan as ( oryzalin ), gallery 75df ( isoxaben ), snapshot 2g ( trifluralin ), factor ( prodamine ), oh - 2 ( oxyfurofen + pendimethalin ), ronstar 50 wp ( oxadiazon ), ronstar g ( oxadiazon ), ornamental weed grass ( pendimethalin ), xl 2g ( benefrin + oryzalin ), 0 - 0 ( oxyfurofen + oxidiazon ), rout ( oxyfurofen + oxidiazon ), pennant 85 . 1 ( metolachlor ). in another embodiment of the invention , aggregates of cellulose - containing particles are used to promote revegetation of denuded areas , such as highway right of ways . the aggregates can be generally in the form of a pourable crumb or in the form of a sprayed on covering similar to that is known in the art to be well suited for insulating under roofs , ceilings and floorings . the aggregates are employed in conjunction with a nutrient solution and vegetation seeds , such as grass seed , and preferably further contain assimilable nitrogen and other plant nutrients . this aspect of the invention is especially beneficial when applied to steeply sloped ground surfaces , such a ground surface having a slope ( run : rise ) of at least 10 : 1 , such as a slope of 4 : 1 or greater . the aggregates can be carried onto the surface in a stream of water or air , or mechanically applied if desired . this aspect of the invention has been tested with good results on simulated highway right of way plots having grades of 3 : 1 and 2 : 1 . a layer of cellulose containing aggregates in the form of crumbled ground paper pellets containing assimilable nitrogen and other plant nutrients was applied to the denuded ground surface of the test plots to form a bed of particles about ½ inch thick . this corresponds to an application rate of about ½ pound per square foot . the bed was then wetted with a seed / nutrient solution . the aggregates swelled and formed a mat over the test plot surface , enhancing seed germination and reducing water erosion over untreated plots and plots treated by different techniques . it is believed that the application to the ground surface of a thick slurry of seed and cellulose particles in nutrient solution would provide similar results in a more cost effective manner . in another embodiment of the invention , seeds are adhered to an outer surface of an aggregate as hereinbefore described by use of an adhesive substance such as starch or clay . seeds germinate poorly if simply dispersed over unturned ground and by adhering the seeds to aggregates of cellulose which are then dispersed , germination can be improved . this technique is well suited for dry broadcast techniques , for example , aerial seeding of large areas . the aggregates , preferably in pelletized or briquette form , hold moisture upon exposure to rainfall , which facilitates germination . also , because the aggregates are resistant to being moved by wind or rain , the seeds tend to remain close to where they land and better avoid migration to and concentration in low areas . the aggregates carrying the seeds on their outer surface are preferably further provided with a source of assimilable nitrogen , such as fertilizer , as hereinbefore described . the amount of nitrogen is greatly reduced over the amount required by large area application , since it is located precisely where needed . initially , the seed can and will germinate and grow on the pellet . the root system eventually penetrates the earth beneath the pellet , and over time the pellet will break down and become part of the soil . because the pellet will not easily blow or wash , the aggregates with attached seeds can be used to seed even steeply sloped areas . the adhesive is preferably applied to the pellets by being sprayed onto the pellets in solution form , and the seeds are brought into contact with the pellets either in slurry form with the solution , or by mixing the wetted pellets with dry seeds , followed by drying under mild conditions . adhering the seeds to the aggregate after pellet formation in this manner avoids exposure of the seeds to high pressure during the pelletizing process and to elevated temperatures during the drying process , both of which could reduce germination . examples of seeds which may be utilized include grass seeds such as fescue , rye , bermuda , buffalo , bahia , blue , centipede , zoysia , blue corama , and big bluestem , grains such as wheat , oats , maize , barley and corn , and tree seeds such as pine . in arid areas , for example , the seeding could be carried out aerially , preferably , but not necessarily , shortly prior to periods of expected precipitation . examples of starches which may be utilized in the invention include corn starch , wheat starch , and potato starch . clay - based adhesives such as bentonite have been tested with good results . the amount of adhesive used can vary , but will generally be in the range of from about 1 % to about 10 % of the total weight of the pellet , after evaporation of the carrier fluid ( generally water ). the seeds are adhered to the pellets in approximately the same percentage , based on weight . for grasses and grains , the pellets carrying the seeds are preferably applied to the soil so as to result in good ground coverage after the seeds have germinated . generally speaking , pellets carrying bermuda , rye , or millet are applied at an application rate to result in from about 10 - 200 pounds of seeds per acre . pellets carrying smaller seeds , such as bahia or native grasses , are generally applied at a rate to result in from about 1 - 50 pounds of seeds per acre . in another embodiment of the invention , insect repellants are incorporated into the cellulose containing aggregates . the repellant can generally be incorporated into the pellets using the techniques generally stated herein for other additives . the repellent is preferably incorporated into the liquid used in the pelletizing process . other additives , such as waxes and oil , can also be included in the pelletizing liquid , to provide a slower release of the repellent during conditions of use . for example , the repellent is released as the pellet breaks down during environmental conditions , mostly rainfall , encountered during use . pellet integrity can be improved under wet conditions by incorporating wax or oil into the pellets during the pelletizing process and by the addition of binder agents , such as bentonite , into the mix used to form the pellets . pellet integrity can also be improved by adjusting pellet size , as larger pellets are more stable . synthetic repellants , such as deet ( n , n - diethyl - meta - toluamide ) can be used if desired . preferably , the insect repellants are natural repellants . examples of natural repellants include citrus oil , cedar oil , liquid garlic , cloves , citronella oil , white pepper , borax , and boric acid . more preferably , the repellant comprises an extract from a natural source . examples of extracts include citrus oil , cedar oil , citronella oil , catnip oil , soybean oil , rosemary oil , pennyroyal oil , garlic extract , and clove extract . the amount of repellant used in the pellet is generally sufficient to provide the finished pellet with in the range of from about 0 . 1 to about 15 percent by weight of the repellant , preferably in the range of from about 0 . 5 to about 5 percent by weight of the repellant . the pellets can be used indoors or outdoors , wherever insects are a problem . indoors , the pellets can be used as animal bedding , or in cushions for animal bedding , to keep the bedding area free of fleas . the pellets are also effective to keep insects , especially flies and gnats , away from litter , such as cat or chicken litter , and will also counteract the odors of the litter . a residential room can be treated to repel insects , especially mosquitos , by pouring a small amount of the treated pellets into a dish , or in a pot or planter in the room , and in this application can also serve as plant mulch and as a nutrient carrier for the plants , especially when plant growth promoters have been incorporated in the pellets as taught else where herein it is expected that larger amounts of pellets are be used indoors to drive essentially all insects away , providing an alternative to fumigation , for example . outdoors , the pellets can be used to keep an area free of mosquitos , for example , by simply broadcasting the pellets over the area in a specific example , a residential backyard can be treated to repel mosquitos for several weeks , depending on weather conditions , by broadcasting about 7 pounds ( 3 kilograms ) of pellets containing about 2 percent by weight of cedar oil over the area . generally speaking , it is expected that the application rate for area broadcasts of this type will be in the range of from about 10 to about 200 pounds per acre . because the pellets break down and are assimilated beneficially into the soil over time , buildup of pellets is avoided , and since the pellets are lightweight , soft and frangible , they do not present a mowing hazard . use of the treated pellets in planters and gardens will provide similar benefits over a wide area the pellets are also useful to repel ants from an area in which they are not desired . the pellets have a pleasant smell and raise few environment concerns , as contrasted to many insect killers presently on the market . while certain preferred embodiments of the invention have been described herein , the invention is not to be construed as so limited , except to the extent that such limitations are found in the claims . | 2 |
the present invention relates to methods and compositions for reducing drag in multiphase flowlines ( for example oil / water , water / oil , oil / water / gas ) in oil and gas production systems . it is expected that the invention could apply to any hydrocarbon fluid flowing in a pipeline , whether or not water is present . it will be appreciated that by the term “ hydrocarbon fluid ”, it is expected that oxygenated hydrocarbons such as methanol , ethanol , ethers , and the like may be included within the definition . the term “ hydrocarbon fluid ” also means any fluid that contains hydrocarbons , as defined herein to also include oxygenated hydrocarbons . many oil and gas production systems ( e . g . those found in deep water rigs of the gulf of mexico ) are limited in their production due to pressure drop in the flowlines under turbulent flow regime . the drag reducing methods of the invention comprise applying maleated fatty acids or its esters and salts to the system by either batch or continuous treatments at high enough concentrations to produce the desired reduction in drag and / or increase in flow for the same amount of motive energy . the compositions containing maleated fatty acids are used effectively by maintaining drag reduction effectiveness over an extended period of time . the use of these anionic types of surfactants present distinct advantages over the use of conventional polymeric drag reducers including the facts that they are not shear sensitive and do not cause undesirable changes in emulsion , foaming or fluid quality . without wishing to be limited to any particular mechanism of operation , the microstructures or associations between the molecules of the inventive additives are believed to reform after the fluid is sheared . reduction in pressure drop in gas and oil multiphase flowlines using maleated fatty acid surfactants allows operators to increase production . the oil / water solubility and / or dispersibility characteristics of the maleated fatty acids can be varied to allow their use in a broad range of oil / water ratios . a mixture of maleated fatty acids with various oil / water solubilities can be used to cover a wide range of applications . the drag reducing additives of this invention have the basic chemical structures of the maleated fatty acid drag reducers given below : and esters of these maleated fatty acids may also be employed , having structures such as : where r is an organic moiety including alkyl , aryl , aralkyl , alkaryl or amine groups ; r 1 is a generally linear organic moiety of from about 2 to about 20 carbon atoms ; r 2 is hydrogen or a generally linear organic moiety of up to about 20 carbon atoms , where the total number of carbon atoms in r 1 and r 2 are from about 10 to about 20 carbon atoms ; r 3 is an alkylene or alkenylene group of from about 2 to about 15 carbons ; and r 4 is an alkylene or alkenylene group of from about 2 to about 15 carbons ; and inorganic , organic , and amine salts thereof . by “ alkenylene ” is meant a hydrocarbon moiety bonded on either end to the shown structures ( similar to alkylene ) but which is unsaturated with at least one c ═ c double bond . in water , compounds of structures i and ii hydrolyze to form compounds of structures iii and iv , respectively , where r ═ h . such compounds are considered to be within the scope of the invention . in non - limiting , preferred embodiments , r has from about 1 to about 20 carbon atoms , preferably from about 1 to about 5 carbon atoms . most of the substituents containing amine groups expected to be useful are expected to contain primary amine groups . the r substituent is that moiety from the alcoholic composition used to make the esters ( iii ), ( iv ), ( v ) and / or ( vi ). the alcoholic reactant roh may be an ethoxylated alcohol or phenol in one non - limiting embodiment . in another non - limiting embodiment of the invention , r 1 may preferably have from 2 to about 18 carbon atoms , r 2 is hydrogen or an organic moiety of up to 18 carbon atoms ; and the total number of carbon atoms in r 1 and r 2 ranges from about 10 to about 20 carbon atoms . in another non - limiting but preferred embodiment , r 3 and r 4 may independently range from about 2 to about 13 carbon atoms . specific maleated fatty acids and esters thereof include , but are not necessarily limited to , maleated oleic acid , maleated linoleic acid , and mixtures thereof . in one non - limiting embodiment of the invention , the additive is any one or more of structures iii , iv and / or v where r is isopropyl . organic and inorganic salts of maleated fatty acids are also part of this invention , such as sodium and potassium salts as well as various amine salts ( e . g . imidazolines ). suitable maleated fatty acids and salts thereof expected to be useful in the drag reducing methods of this invention include , but are not necessarily limited to imidazoline salts of ; primary , secondary , and tertiary amine salts of ; alkoxylated amine salts of ; heterocyclic amine salts of maleated fatty acids and maleated fatty acid esters and mixtures thereof . specific salts of maleated fatty acids or salts of maleated fatty acid esters thereof include , but are not necessarily limited to , amine salts , amide salts , imidazoline salts , alkanolamine salts , and mixtures thereof . in one non - limiting embodiment of the invention , the drag reducing additives herein are added in the absence of any polymeric drag reducing additive . in another non - limiting embodiment of the invention , the drag reducing additives are employed in the absence of any other drag reducing additive , i . e . one that does not fall within the definitions of this invention . on the other hand , there may be situations or environments where it is advantageous to employ other drag reducing additives together with those of this invention in effective mixtures , such mixtures being within the bounds of this invention . mixtures of additives falling within the scope of this invention may of course be used . compounds such as these are also known corrosion inhibitors ( e . g . u . s . pat . nos . 4 , 927 , 669 ; 5 , 385 , 616 ; 5 , 582 , 792 ) that have been used extensively . the use of maleated fatty acids as drag reducers that are the subject of this invention , however , requires substantially lower use concentrations than those for corrosion inhibition . the typical use levels in the actual system for drag reduction is approximately 5 – 10 times lower than that for corrosion inhibition , based on total system fluid , i . e from about 100 to 1000 ppm for methods of this invention , preferably from about 150 to about 600 , and most preferably from about 200 to about 500 ppm . the maximum drag reduction effects observed , including both pressure reduction ( δp ) and flow increase ( q ), in the laboratory testing were between 5 – 20 %, depending on oil / water ratio , flow rates and type of test ( torque vs . flow loop ). it will be appreciated that it is virtually impossible to predict in advance what an effective amount of drag reducing agent would be in any particular circumstance since , as noted , there are a number of interrelated factors that must be considered including , but not necessarily limited to , the type of fluid having its friction characteristics modified , the flow rate of the fluid , the temperature of the fluid , the nature of the dra , etc . thus , the dosage ranges given above and used in the examples should be understood as illustrative only . the preferred manner of practicing the invention is batch treatment between two pigs or continuous treatment at the well head or pipeline through umbilical or capillary . in the continuous treatment , the product solution is used at high enough concentration to produce the desired drag reduction without causing emulsion , foaming or other oil / water quality problems . the maleated fatty acids , esters and salts thereof may be combined with any suitable solvent prior to use as a drag reducing agent . such solvents include , but are not necessarily limited to , aromatic solvents , aliphatic solvents , alcohols , ethers , sulfoxides , and compatible mixtures thereof . to further illustrate the invention , the inventive method will be additionally described by way of the following non - limiting examples , which are intended only to further show specific embodiments of the invention . the initial screening of potential dra candidates selected based on their chemistry was performed in the torque test . in this experiment , a cylinder spins at a constant rate in a cylindrical container , which contains the fluid . the cylinder is attached to a torque meter , which sends an analog voltage signal to an a / d converter that feeds a computer , percent drag reduction for a particular dra / solvent system is calculated from the changes in torque with and without dra . the results of this example for a maleated fatty acid a , and the ester b thereof at different concentrations in a synthetic hydrocarbon are shown in table i . both compounds exhibited measurable reduction in torque at 200 ppm . the final tests were carried out in the dra flow loop with different oil / brine ( o / b ) ratios . a recirculated dra flow loop was used to measure drag reduction properties ( δp , flow , fluid density ) of dras . the flow loop circulated 30 liters of fluid through a ½ - inch id stainless steel pipe ( 4 - foot long section ) equipped with a differential pressure transducer . differential pressure ( δp ), flow rate ( q ), fluid density , pressure and temperature were measured continuously during the test . only the reduction in δp accompanied with a corresponding increase in q as a result of the addition of dra was considered as an indication of drag reduction . the mass flow rate and density of fluids were measured using a mass flow meter , while δp was measured using a differential pressure transducer . the concentration of dra was varied from 75 – 300 ppm . all experiments were carried out at 140 ° f . and 100 psi co 2 . the pressure drop ( δp ), flow rate ( q ), change in pressure drop ( δδp ), change in flow rate ( δq ) and calculated fanning friction factor ( f ) were obtained using a and b drag reducers as shown in table ii . the reduction in fanning friction factor for these two chemicals in 70 / 30 oil / brine mixture was close to 25 %. many modifications may be made in the composition and implementation of this invention without departing from the spirit and scope thereof that are defined only in the appended claims . for example , the exact combination of drag reducing additive ( s ) and liquid having its friction properties modified may be different from those used here . additionally , derivatives other than those specifically mentioned may find utility in the methods of this invention . various combinations of maleated fatty acids , esters and / or salts thereof alone or together with other materials , are also expected to find use as drag reducing agents . | 5 |
present invention provides materials , methods and apparatus to fabricate conductive layers or contact layers for thin film solar cells , especially for those solar cells that employ group ibiiiavia compound absorbers . based on the brief review above one can conclude that irrespective of the specific approach employed in growing a cigs ( s ) or cu ( in , ga )( s , se ) 2 type absorber film , the conductive layer 13 ( or the contact layer ) of fig1 needs to have certain properties . these properties include , but are not limited to the following : i ) the contact layer surface 13 a should make a good ohmic contact to the absorber layer 12 , ii ) the contact layer 13 or the contact layer surface 13 a should be stable in the reaction environments in which the absorber layer 12 is formed , i . e . they should not extensively react with group via materials to the extent that they loose their ohmic nature or cause mechanical peeling problems , iii ) the contact layer 13 or the contact layer surface 13 a should not react extensively with the group lb and group iiia materials present in the absorber layer 12 . for example , for a cigs ( s ) absorber , the contact layer to this absorber should not react extensively with cu , in , ga , se and s and still make good ohmic contact with excellent adhesion to the cigs ( s ) material . u . s . patent application ser . no . 11 / 266 , 013 filed nov . 5 , 2005 entitled “ technique and apparatus for depositing layers of semiconductors for solar cell and module fabrication ”; u . s . patent application ser . no . 11 / 462 , 685 filed aug . 4 , 2006 entitled “ technique for preparing precursor films and compound layers for thin film solar cell fabrication ”; and u . s . provisional appln . ser . no . 60 / 820 , 333 filed jul . 26 , 2006 entitled “ tandem solar cell structures and methods of manufacturing same ”, have identified the group of materials ( such as elements , alloys , compounds , mixtures etc .) comprising at least one of ru , ir and os as new contact materials to group ibiiiavia compound layers . therefore , materials comprising at least one of ru , ir and os may be used in the solar cell structure of fig1 as the conductive layer 13 or such materials may be provided at the contact layer surface 13 a . in prior art ru layers have been used as durable , low - tarnish coatings on electrical connectors such as reed switch contacts ( see e . g . r . vadimsky et al ., j . electrochemical society , vol : 126 , p . 2017 , 1979 and t . jones , “ electrodeposition and electroless deposition of the precious metals ”, p . 69 , finishing publications limited , 2005 ). other applications of this material include color finishing in jewelry , cutlery , sanitary fittings etc . a recent application of ru is in copper interconnect fabrication for si wafers . in this application , a thin layer of ru is deposited on patterned wafer surface as a barrier layer and then cu is directly electroplated on the ru surface to fill the features or gaps in a bottom - up fashion , one wafer at a time ( see for example , t . moffat et al ., j . electrochemical society , vol . 153 , p . c37 , 2006 , and y . kim et al ., electrochemical and solid state letters , vol . 9 , p . c19 , 2006 ). it has been stated that for certain ru plating electrolytes , it is recommended that ru is electroplated over a gold or palladium flash layer ( a . weisberg , metal finishing , volume 101 , number 1a , p . 243 , 2003 ). in addition to being good ohmic contact materials to group ibiiiavia compounds , materials comprising at least one of ru , ir and os may also be deposited using low cost wet techniques with near 100 % materials utilization . these wet techniques include , but are not limited to ink deposition of inks ( made from nano - particles comprising at least one of ru , ir or os ), electrodeposition and electroless plating . furthermore , high throughput roll - to - roll processing approaches may be used for depositing these materials using the wet techniques . we will now describe electroplated conductive layers or contact layers using the preferred contact material ru as the example . it should be noted that these arguments are valid for ir and os as well as many other materials with compositions of ru - m , os - m , ir - m , where m may be any material comprising at least one element except those elements belonging to the groups viia and viiia of the periodic table . fig2 a shows a multi - film contact 20 that may be employed in a group ibiiiavia compound solar cell such as a cigs ( s ) solar cell structure . in that respect the multi - film contact 20 acts as the conductive layer 13 or contact layer of fig1 . the multi - film contact 20 is deposited on the substrate 11 in the form of multiple films , comprising a bottom film 21 a , a top film 21 n and intermediate films 21 b , 21 c , etc . between the bottom film 21 a and the top film 21 n . the bottom film 21 a and the intermediate films 21 b , 21 c , etc ., provide a foundation on which the top film 21 n is electroplated or electroless plated in a uniform and continuous manner , without defects such as pinholes . the top film 21 n comprises at least one of ru , ir and os , at least at its surface 20 a where ohmic contact to the cigs ( s ) layer of the finished solar cell would be made . it should be noted that although the top film 21 n maybe directly electroplated or electroless plated on the substrate 11 , the preferred approach is to have at least one film between the top film 21 n and the substrate 11 . for brevity , we will continue to describe the invention using as an example a two - film contact 30 with a bottom film 21 a and a top film 21 n , as shown in fig2 b . the top film 21 n of fig2 b comprises at least one of ru , ir and os , at least at its surface 20 a , and it is electroplated or electroless plated . preferably , the top film 21 n is electroplated . the bottom film 21 a of fig2 b may comprise a wide variety of conductive materials including , but not limited to , materials from the periodic table groups of iiib , ivb , vb , vib , viib , viii , ib , iib , iiia , iva , va and via ( cas notation is used for identification of groups ; see periodic table of elements in crc handbook of chemistry and physics , 85 th edition , 2004 - 2005 ). the preferred materials for the formation of the bottom film 21 a are cu , ni , sn , zn , rh , pt , rh , mn , fe , co , cr , au , ag , pd , w , mo , ta , ru , ir , os and / or their alloys , compounds or mixtures with each other or with other materials . the bottom film 21 a may be deposited on the substrate 11 by various techniques such as sputtering , evaporation , atomic layer deposition , chemical vapor deposition , etc . atomic layer deposition ( ald ) has die capability to coat the substrate surface in a conformal manner and form a robust diffusion barrier , free of pinholes and other defects . however , ald is a slow process having typical growth rates in the range of 0 . 1 - 1 nm / min . therefore , having a bottom film 21 a deposited by ald and electroplating intermediate films and a top film 21 n , or just a top film 21 n over die ald deposited bottom film 21 a is attractive in terms of higher throughput , cost lowering and good diffusion barrier performance of the multi - film contact . it should be noted that cigs ( s ) devices get negatively affected by impurities that may diffuse from the substrate 11 of fig1 , through die conductive layer 13 or the contact layer , into the cigs ( s ) layer . if an ald process is used for the deposition of a bottom film 21 a ( see fig2 a and 2b ), it is preferable that the bottom film 21 a is a good diffusion barrier for elements in the substrate composition that can negatively impact device performance . such elements include fe for stainless steel substrates and al for al - based substrates . diffusion barrier materials that may be used as bottom film 21 a include ru , ir , os , cr , mo , w , their alloys with each other and other materials , etc . in a preferred embodiment the bottom film 21 a is deposited by an electrodeposition or electroless deposition approach . the motivations for an approach where both the bottom film 21 a and the top film 21 n of fig2 b are electroplated or electroless plated , are lowering of the cost , as well as improving the coverage of the surface of the substrate 11 . techniques such as evaporation and sputtering do not yield conformal coatings . the surface coverage problem in such techniques is due to the directional deposition and shadowing effect of the substrate surface irregularities which may be in the form of surface roughness in the order of 50 - 200 nm . wet chemical deposition techniques such as electroplating and electroless deposition are more conformal and cover such surface roughness or features . furthermore , additives such as organic additives may be included in the electrodeposition baths of the bottom film 21 a so that the surface of the bottom film 21 a is much smoother than the surface of the substrate 11 . for example , the surface roughness of the bottom film 21 a may be in the range of 10 - 50 nm . this way the top film 21 n is deposited on the smooth surface of the bottom film 21 a in a defect free manner . electroplating and electroless plating may be used to deposit numerous metallic elemental or alloy films as the bottom film 21 a . if the substrate is conductive , electroplating is more suitable than electroless plating . in the case of a nonconductive substrate , an initial conductive seed layer could be deposited using electroless deposition . this then may be followed by an electrodeposition step . we will now continue our discussion of an embodiment of the present invention concentrating on a conductive substrate and electrodeposited films to form the contact layer structures shown in fig2 a and 2b . preparation of the surface of a substrate for electrodeposition of a bottom film 21 a comprises removing all foreign matter or contaminants ( soil , dirt , corrosion products , oxides , tarnish and others ), and then providing a clean and chemically active substrate surface for plating . the removal of foreign contaminants can be accomplished by using chemical cleaners such as alkaline cleaners , electropolishing , detergent cleaners etc . voltage may be applied between an electrode and the substrate rendering the substrate surface either anodic or cathodic during the cleaning step . it is also possible to apply a pulsed voltage with periodic reverse current during this cleaning process . after cleaning , activation of the substrate surface may be achieved by exposing it to a concentrated acid solution . surface preparation for a stainless steel substrate surface , for example , may be carried out in multiple steps comprising , alkaline cleaning , water rinsing , alkaline deoxidizing with periodic reverse current , water rinsing , and surface activation with 20 - 60 % hcl . after activation of the substrate surface a bottom film 21 a ( see fig2 b ) may be electroplated . for stainless steel substrates the bottom film 21 a may preferably be a ni layer , a cu layer , a co layer , an au layer or alloys of these materials with each other or with other materials . one exemplary bottom film to electroplate on a surface of a stainless steel substrate is a ni film that may be deposited on activated steel surface through use of a ni - chloride + hcl bath known as “ woods ni bath ”. a ni layer deposited this way provides an active surface over which a top film 21 n comprising at least one of ru , ir and os may be electroplated . in the case of al or al - alloy substrates , the substrate surface may first be cleaned and acid pickled for activation . a thin layer of zn may then be deposited on the surface of the al - based substrate using immersion deposition by displacement from an alkaline zincate solution an exemplary formulation of a zincate bath comprises zinc oxide ( 50 - 100 g / l ) and sodium hydroxide ( 250 - 500 g / l ). the thin zn layer may act as the bottom film 21 a of fig2 b . a top film 21 n may then be electrodeposited over the thin zn layer . it should be noted that once a bottom film such as a ni layer or a zn layer is formed on a stainless steel or al substrate , respectively , intermediate films may also be electroplated ( see fig2 a ) over the bottom film 21 a before electrodeposition of the top film . this way all - electroplated contact layer structures including , but not limited to ni / pd — co / ru , ni / co / ru , co / ni / ru , ni / cu / ru , cu / ni / ru , ni / cu / co / ru , etc . may be fabricated . if intermediate films are not used contact layer structures such as ni / ru , zn / ru , cu / ru , co / ru , cr / ru etc . may be obtained . the exemplary ru layer of a top film 21 n of fig2 a and 2b may be electroplated on any intermediate film or bottom film using an exemplary electroplating formulation comprising 0 . 01 - 0 . 1 m rucl 3 . 3h2o , 0 . 01 - 0 . 1 m hcl , and 0 . 01 - 0 . 1 m nh 2 so 3 h at a temperature of 20 - 80 c . ru electrodeposition may be performed at current densities ranging from 0 . 5 ma / cm 2 to 50 ma / cm 2 . thickness of a bottom film , and an intermediate film may be in the range of 10 - 500 nm , preferably in the range of 20 - 200 nm . the thickness of a top film comprising at least one of ru , ir and os may be 1 - 500 nm , preferably 20 - 200 nm . there are other ru electroplating electrolyte available based on acidic or high ph formulations . ru - oxide may also be substituted for ru in this invention . as described above , the novel contact layers of the present invention may be electroplated and / or electroless plated on a substrate to form a base on which a group ibiiiavia compound solar cell may be fabricated . growth of the group ibiiiavia compound absorber may be carried out by various different methods including sputtering , evaporation , two - stage processing , ink deposition etc . one preferred approach is the use of electroplating on the electrodeposited contact , a precursor layer comprising group ib , group iiia and optionally group via materials , and then annealing and / or reacting the precursor with at least one group via material to form the compound absorber . in an exemplary process , a top surface of a 5 - mil thick stainless steel substrate was cleaned and activated as described above . a 200 nm thick ni bottom film was electroplated on the top surface using the woods ni bath . after rinsing the deposited ni surface , a 100 nm thick ru film was electroplated on the ni surface . this way an all - electroplated ni / ru contact layer was obtained on the top surface of the stainless steel substrate . to prepare a precursor film comprising cu , in and ga , the following procedures were carried out . a 200 nm thick cu layer was electroplated on the ru surface . a 100 nm thick ga layer was electroplated on the cu surface . this was then followed by the deposition of a 350 nm thick in layer out of a sulfamate electrolyte supplied by the indium corporation of america . electrolytes for the cu and ga deposition have been disclosed in u . s . patent application ser . no . 11 / 462 , 685 filed aug . 4 , 2006 entitled “ technique for preparing precursor films and compound layers for thin film solar cell fabrication and apparatus corresponding thereto ” and u . s . patent application ser . no . 11 / 535 , 927 filed sep . 27 , 2006 entitled “ efficient gallium thin film electroplating methods and chemistries ”. these procedures yielded a stainless steel / ni / ru / cu / ga / in structure where all layers on the stainless steel substrate were electrodeposited . the structure was reacted with se at 500 c for 20 minutes yielding a stainless steel / ni / ru / cigs stack that could then be used for solar cell fabrication using steps commonly known in the field . these steps include deposition of a cds layer on the cigs surface followed by zno deposition and finger pattern deposition . it should be noted that the present invention is suited for high throughput , low cost roll - to - roll processing approaches . in roll - to - roll processing , the substrate is in the form of a flexible web or wire . the substrate is fed from a supply spool and travels through various process units before it is rolled onto a return spool . the process steps of electroplated contact layer formation approach described above may be carried out in various process units of a roll - to - roll process system . cleaning of the substrate surface , its activation , deposition of a bottom film , deposition of intermediate films , deposition of a top film , and thus formation of a multi - film contact may be achieved roll - to - roll on a web or wire substrate as the substrate travels through various electroplating units . further , the system may comprise other process units to continue electrodeposition over the top film of the multi - film contact to form a precursor layer comprising cu . in , ga and optionally se . annealing units , cleaning units etc . may also be added to these systems to carry out a large number of process steps in a roll - to - roll configuration . examples of such system configurations have been disclosed in applicant &# 39 ; s co - pending u . s . patent application ser . no . 11 / 081 , 308 filed mar . 15 , 2005 entitled “ technique and apparatus for depositing thin layers of semiconductors for solar cell fabrication ,”; u . s . patent application ser . no . 11 / 560 / 321 , filed nov . 15 , 2006 entitled “ composition control for roll - to - roll processed photovoltaic films ” and u . s . provisional appln . ser . no . 60 / 862 , 164 filed oct . 19 , 2006 entitled roll - to - roll electroplating for photovoltaic film manufacturing ”. although the present invention is described with respect to certain preferred embodiments , modifications thereto will be apparent to those skilled in the art . | 7 |
the present invention is more particularly described in the following examples that are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art . various embodiments of the present invention are now described in detail . fig2 a shows a first embodiment of the present invention which comprises a first input terminal vin , a second terminal vxin , a first power supply terminal v dd , a second power supply terminal v ss , a first tft 201 , a second tft 203 , a third tft 205 , a fourth tft 207 , a fifth tft 209 , a sixth tft 211 , and an output terminal vout . the first input terminal vin is configured to input a first input signal and the second input terminal vxin is configured to receive a second input signal , wherein the first input signal and the second input signal are complementary . in other words , a device ( not shown ) is configured to generate the first input signal and the second input signal to the first input terminal vin and the second terminal vxin , respectively . the first input terminal vin and the second input terminal vxin are configured to receive the first input signal and the second input signal , and to transmit the first input signal and the second input signal . the output terminal vout outputs an output signal . the first tft 201 , second tft 203 , third tft 205 , fourth tft 207 , fifth tft 209 , and sixth tft 211 are p - type in the first embodiment . those skilled in the art can easily realize that n - type tfts are also available . moreover , the materials of the tfts , such as amorphous silicon , poly - crystal silicon , micro - crystal silicon , single - crystal silicon , or combinations thereof , and the formations of the tfts , such as top gate tfts , bottom gate tfts , or the like are not a limitation to the present invention . the connections among these elements are described below . the drain 201 a of the first tft 201 is electrically coupled to the first input terminal vin and the gate 201 c thereof . the source 203 b of the second tft 203 is electrically coupled to the first power supply terminal v dd . the gate 203 c of the second tft 203 is electrically coupled to the source 201 b of the first tft 201 . the source 205 b of the third tft 205 is electrically coupled to the drain 203 a of the second tft 203 . the drain 205 a of the third tft 205 is electrically coupled to the second power supply terminal v ss . the source 207 b of the fourth tft 207 is electrically coupled to the gate 203 c of the second tft 203 . the drain 207 a of the fourth tft 207 is electrically coupled to the second power supply terminal v ss . the gate 207 c of the fourth tft 207 is electrically coupled to the gate 205 c of the third tft 205 . the gate 209 c and the drain 209 a of the fifth tft 209 are electrically coupled to the second input terminal vxin . the source 209 b of the fifth tft 209 is electrically coupled to the gate 207 c of the fourth tft 207 . the gate 211 c of the sixth tft 211 is electrically coupled to the first input terminal vin . the drain 211 a of the sixth tft 211 is electrically coupled to the second power supply terminal v ss . the source 211 b of the sixth tft 211 is electrically coupled to the source 209 b of the fifth tft 209 . the output terminal vout is electrically coupled to the source 205 b of the third tft 205 . fig2 b , 2 c , and 2 d show simulation voltage versus time waveforms of the first input terminal vin and the output terminal vout under three different tft threshold voltages , respectively . fig2 b shows the waveforms under a first threshold voltage , substantially − 1v , fig2 c shows the waveforms under a second threshold voltage , substantially − 2 . 5v , and fig2 d shows the waveforms under a third threshold voltage , substantially − 4v . meanwhile , the simulation conditions for deriving the waveforms in fig2 b , 2 c , and 2 d are that : the first power supply terminal v dd is substantially equal to − 6v , the second power supply terminal v ss is substantially equal to 9v , the first input terminal vin swings from about 0v to about 5v , the electron mobility of the pmos tfts is about 60 cm 2 / vsec , and an output load has about 20 pf capacitance . as shown in fig2 b , the low level of the output terminal vout is far apart from the voltage level of the first power supply v dd , but the high level of the output terminal vout is close to the voltage level of the second power supply v ss when the threshold voltage is about − 1v . as shown in fig2 c , the low level and high level of the output terminal vout are more acceptable when the threshold voltage of tft is about − 2 . 5v . as shown in fig2 d , although the low level of the output terminal vout can reach the voltage level of the first power supply v dd , it takes approximately 20 μs , and the rising time of the output signal is longer when the threshold voltage of tft is about − 4v . fig3 a shows a second embodiment of the present invention , which comprises a first input terminal vin , a second input terminal vxin , an output terminal vout , a first power supply terminal v dd , a second power supply terminal v ss , a first input unit 31 , a second input unit 33 , a first tft 301 , a disable unit 35 , a feedback unit 37 , and a second tft 303 . the first input terminal vin is configured to input a first input signal . the second input terminal vxin is configured to input a second input signal . the output terminal vout is configured to output an output signal . the first input signal and the second input signal are complementary , and the output signal of the output terminal vout and the first input signal are substantially in phase . the connections among these elements are described below . the first input unit 31 receives the first input signal via the first input terminal vin , and outputs a first switching control signal 300 . the second input unit 33 , electrically coupled to the second power supply terminal v ss , receives the second input signal via the second input terminal vxin , and outputs a second switching control signal 302 . the gate 301 c of the first tft 301 , electrically coupled to the first input unit 31 , receives the first switching control signal 300 . the drain 301 a of the first tft 301 is electrically coupled to the output terminal vout . the source 301 b of the first tft 301 is electrically coupled to the first power supply terminal v dd . the disable unit 35 , electrically coupled to the first input unit 31 , the second input unit 33 , the first tft 301 , and the second power supply terminal v ss , receives the second switching control signal 302 and disables the first tft 301 . in other words , the disable unit 35 can control the first tft 301 to disable ( namely turned off ). the feedback unit 37 respectively transmits feedback signals 304 and 306 to the first input unit 31 and the disable unit 35 in response to the output signal of the output terminal vout . the gate 303 c of the second tft 303 , electrically coupled to the second input unit 33 , receives the second switching control signal 302 . the source 303 b of the second tft 303 is electrically coupled to the output terminal vout . the drain 303 a of the second tft 303 is electrically coupled to the second power supply terminal v ss . in other words , the second tft 303 receives the second switching control signal 302 . the first input unit 31 comprises a third tft 305 and a fourth tft 307 . the second input unit 33 comprises a fifth tft 309 and a sixth tft 311 . the disable unit 35 comprises a seventh tft 313 and an eighth tft 315 . the feedback unit 37 comprises a ninth tft 317 and a tenth tft 319 . all the tfts included in the second embodiment are p - type . those skilled in the art can easily realize that n - type tfts are also available . the materials of the tfts , such as amorphous silicon , poly - crystal silicon , micro - crystal silicon , single - crystal silicon , or combinations thereof , and the formations of the tfts , such as top gate tfts , bottom gate tfts , or the like are not a limitation to the present invention . the connections among these elements are described below . the gate 305 c of the third tft 305 is electrically coupled to the first input terminal vin and the drain 305 a thereof . the gate 307 c of the fourth tft 307 is electrically coupled to the gate 305 c of the third tft 305 . the source 307 b of the fourth tft 307 is electrically coupled to the gate 301 c of the first tft 301 . the drain 307 a of the fourth tft 307 , electrically coupled to the source 305 b of the third tft 305 , receives the feedback signal 304 . the gate 309 e of the fifth tft 309 is electrically coupled to the second input terminal vxin and the drain 309 a of the fifth tft 309 . the source 309 b of the fifth tft 309 , electrically coupled to the gate 303 c of the second tft 303 , transmits the second switching control signal 302 . the gate 311 c of the sixth tft 311 is electrically coupled to the first input terminal vin . the source 311 b of the sixth tft 311 is electrically coupled to the gate 303 c of the second tft 303 and the source 309 b of the fifth tft 309 . the drain 311 a of the sixth tft 311 is electrically coupled to the second power supply terminal v ss . the source 313 b of the seventh tft 313 is electrically coupled to the gate 301 c of the first tft 301 . the source 315 b of the eighth tft 315 , electrically coupled to the drain 313 a of the seventh tft 313 , receives the feedback signal 306 . the gate 315 c of the eighth tft 315 and the gate 313 c of the seventh tft 313 , electrically coupled to the gate 303 c of the second tft 303 , receive the second switching control signal 302 . the drain 315 a of the eighth tft 315 is electrically coupled to the second power supply terminal v ss . in other words , the eighth tft 315 receives the second switching control signal 302 . the gate 317 c of the ninth tft 317 is electrically coupled to the output terminal vout and the drain 317 a of the ninth tft 317 . the source 317 b of the ninth tft 317 , electrically coupled to the source 305 b of the third tft 305 , provides the feedback signal 304 . the source 319 b of the tenth tft 319 , electrically coupled to drain 313 a of the seventh tft 313 and the source 315 b of the eighth tft 315 , provides the feedback signal 306 . the gate 319 c of the tenth tft 319 is electrically coupled to the output terminal vout and the drain 319 a of the tenth tft 319 . fig3 b , 3 c , and 3 d show simulation voltage versus time waveforms of the first input terminal vin and the output terminal vout under three different tft threshold voltages in accordance to the second embodiment , respectively . fig3 b shows the waveforms under a first threshold voltage , substantially − 1v , fig3 c shows the waveforms under a second threshold voltage , substantially − 2 . 5v , and fig3 d shows the waveforms under a third threshold voltage , substantially − 4v . meanwhile , the simulation conditions for deriving the waveforms in fig3 b , 3 c , and 3 d are that : the first power supply terminal v dd is substantially equal to − 6v , the second power supply terminal v ss is substantially equal to 9v , the first input terminal vin swings from about 0v to about 5v , the electron mobility of the pmos tfts is about 60 cm 2 / vsec , and an output load has about 20 pf capacitance . as shown in fig3 b , the low level of the output terminal vout is close to the voltage level of the first power supply v dd when the threshold voltage is about − 1v . as shown in fig3 c , the low level and high level of the output terminal vout are more acceptable when the threshold voltage of tft is about − 2 . 5v . as shown in fig3 d , the output signal of the output terminal vout still requires long time to reach the low level and the high level when the threshold voltage of tft is about − 4v . fig4 a shows a third embodiment of the present invention . in contrast to the second embodiment , the first input unit 31 and the second input unit 33 of the third embodiment are different . as fig4 a shows , the first input unit 31 further comprises an eleventh tft 401 and a twelfth tft 403 , and the second input unit 33 further comprises a thirteenth tft 405 . the connections among these elements are described below . the drain 305 a of the third tft 305 is electrically coupled to the first input terminal vin , the source 307 b of the fourth tft 307 is electrically coupled to the gate 301 c of the first tft 301 and the disable unit 35 . the gate 307 c of the fourth tft 307 is electrically coupled to the gate 305 c of the third tft 305 . the gate 307 a of the fourth tft 307 is electrically coupled to the source 305 b of the third tft 305 . the gate 401 c of the eleventh tft 401 is electrically coupled to the first input terminal vin and the second input unit 33 . the drain 401 a of the eleventh tft 401 is electrically coupled to the first input terminal vin . the gate 401 b of the eleventh tft 401 is electrically coupled to the gate 307 c of the fourth tft 307 . the gate 403 c of the twelfth tft 403 is electrically coupled to the gate 305 c of the third tft 305 . the source 403 b of the twelfth tft 403 is electrically coupled to the first input terminal vin . the drain 403 a of the twelfth tft 403 is electrically coupled to the gate 305 c of the third tft 305 . the source 309 b of the fifth tft 309 is electrically coupled to the gate 303 c of the second tft 303 . the drain 309 a of the fifth tft 309 is electrically coupled to the second input terminal vxin . the gate 311 c of the sixth tft 311 is electrically coupled to the first input terminal vin . the drain 311 a of the sixth tft 311 is electrically coupled to the second power supply terminal v ss . the source 311 b of the sixth tft 311 is electrically coupled to the gate 303 c of the second tft 303 . the gate 405 c of the thirteenth tft 405 is electrically coupled to the second input terminal vxin . the source 405 b of the thirteenth tft 405 is electrically coupled to the gate 309 c of the fifth tft 309 . the drain 405 a of the thirteenth tft 405 is electrically coupled to the second input terminal vxin . the rest connections of the elements in the third embodiment are similar to those in the second embodiment so they are not repeated herein . the eleventh tft 401 and the twelfth tft 403 cause a bootstrap effect . they , as well as the thirteenth tft 405 of the second input unit 33 , are capable of improving the performance of the whole circuit . fig4 b , 4 c , and 4 d show simulation voltage versus time waveforms of the first input terminal vin and the output terminal vout under three different tft threshold voltages in accordance to the third embodiment , respectively . fig4 b shows the waveforms under a first threshold voltage , substantially − 1v , fig4 c shows the waveforms under a second threshold voltage , substantially − 2 . 5v , and fig4 d shows the waveforms under a third threshold voltage , substantially − 4v . meanwhile , the simulation conditions for deriving the waveforms in fig4 b , 4 c , and 4 d are that : the first power supply terminal v dd is substantially equal to − 6v , the second power supply terminal v ss is substantially equal to 9v , the first input terminal vin swings from about 0v to about 5v , the electron mobility of the pmos tfts is about 60 cm 2 / vsec , and an output load has about 20 pf capacitance . one can observe that the waveforms of the output terminal vout are excellent no matter the threshold voltage is low or high . fig5 a shows a fourth embodiment of the present invention . in contrast to the third embodiment , the second input unit 33 of the fourth embodiment is modified . the second input unit 33 further comprises a fourteenth tft 501 , a fifteenth tft 503 , a sixteenth tft 505 , a seventeenth tft 507 , an eighteenth tft 509 , a nineteenth tft 511 , a twentieth tft 513 , and a twenty - first tft 515 . all of the tfts are p - type . the connections among those elements in the second input unit 33 are described below . the drain 309 a of the fifth tft 309 is electrically coupled to the first input terminal vin . the gate 311 c of the sixth tft 311 is electrically coupled to the second input terminal vxin . the source 311 b of the sixth tft 311 is electrically coupled to the source 309 b of the fifth tft 309 . the drain 311 a of the sixth tft 311 is electrically coupled to the second power supply terminal v ss . the gate 405 c of the thirteenth tft 405 is electrically coupled to the first input terminal vin . the source 405 b of the thirteenth tft 405 is electrically coupled to the gate 309 c of the fifth tft 309 . the drain 405 a of the thirteenth tft 405 is electrically coupled to the first input terminal vin . the drain 501 a of the fourteenth tft 501 is electrically coupled to the second input terminal vxin . the source 501 b of the fourteenth tft 501 is coupled to the gate 303 c of the second tft 303 . the source of 503 b the fifteenth tft 503 is electrically coupled to the gate 303 c of the second tft 303 . the drain 503 a of the fifteenth tft 503 is electrically coupled to the second power supply terminal v ss . the gate 503 c of the fifteenth tft 503 is electrically coupled to the source 309 b of the fifth tft 309 . the source 505 b of the sixteenth tft 505 is electrically coupled to the gate 501 c of the fourteenth tft 501 . the gate 505 c of the sixteenth tft 505 is electrically coupled to the source 309 b of the fifth tft 309 . the gate 507 c of the seventeenth tft 507 is electrically coupled to the gate 505 c of the sixteenth tft 505 . the drain 507 a of the seventeenth tft 507 is electrically coupled to the second power supply terminal v ss . the source 507 b of the seventeenth tft 507 is electrically coupled to the drain 505 a of the sixteenth tft 505 . the gate 509 e of the eighteenth tft 509 is electrically coupled to the source 501 b of the fourteenth tft 501 and the drain 509 a of the eighteenth tft 509 . the source 509 b of the eighteenth tft 509 is electrically coupled to the drain 505 a of the sixteenth tft 505 . the source 511 b of the nineteenth tft 511 is electrically coupled to the source 505 b of the sixteenth tft 505 . the gate 513 c of the twentieth tft 513 is electrically coupled to the gate 511 c of the nineteenth tft 511 and the drain 513 a of the twentieth tft 513 . the source 513 b of the twentieth tft 513 is electrically coupled to the drain 511 a of the nineteenth tft 511 and the second input terminal vxin . the gate 515 c and the drain 515 a of the twenty - first tft 515 are electrically coupled to the second input terminal vxin . the source 515 b of the twenty - first tft 515 is electrically coupled to the drain 513 a of the twentieth tft 513 . the rest connections of the elements in the fourth embodiment are identical to those of the third embodiment so they are not repeated herein . fig5 b , 5 c , and 5 d show simulation voltage versus time waveforms of the first input terminal vin and the output terminal vout under three different tft threshold voltages in accordance to the fourth embodiment , respectively . fig5 b shows the waveforms under a first threshold voltage , substantially − 1v , fig5 c shows the waveforms under a second threshold voltage , substantially − 2 . 5v , and fig5 d shows the waveforms under a third threshold voltage , substantially − 5v . meanwhile , the simulation conditions for deriving the waveforms in fig5 b , 5 c , and 5 d are that : the first power supply terminal v dd is substantially equal to − 6v , the second power supply terminal v ss is substantially equal to 9v , the first input terminal vin swings from about 0v to about 5v , the electron mobility of the pmos tfts is about 60 cm 2 / vsec , and an output load has about 20 pf capacitance . one can observe that the waveforms of the output terminal vout are excellent no matter the threshold voltage is low or high . table 1 shows the currents flowing through the first power supply terminal v dd of third embodiment and fourth embodiment under the different threshold voltages . one can observe that the current flowing through v dd of the fourth embodiment is apparently smaller than that of the third embodiment . therefore , the fourth embodiment saves more power . the present invention discloses voltage level shifters formed by single - typed tfts . when integrating the voltage level shifters into a substrate of a tft display , the manufacturing processes are simplified . besides , power is saved . the embodiments were chosen and described in order to explain the principles of the invention and their practical application so as to enable others skilled in the art to utilize the invention and various embodiments and with various modifications as are suited to the particular use contemplated . alternative embodiments will become apparent to those skilled in the art to which the present invention pertains without departing from its spirit and scope . accordingly , the scope of the present invention is defined by the appended claims rather than the foregoing description and the exemplary embodiments described therein . | 6 |
the conventional prior art wheelset 10 is shown in fig1 and is comprised of the horizontal axle 12 with wheels 14 a and 14 b adjacent its opposite ends . the wheels 14 a and 14 b are each rigidly secured to axle 12 by being pressed on the axle up against bosses 18 , respectively . a preferred differential action railroad car wheelset is shown in fig2 , 4 , 5 and 6 . with reference to fig2 the right - hand wheel 14 b is affixed to the axle 12 in the same manner that wheel 14 b was secured to the axle 12 in fig1 . however , at the other end of axle 12 in fig2 a hub 20 is integral with the axle 12 . hub 20 has an annular flange 22 of increased diameter . with reference to fig3 hub 20 has a cylindrical bearing surface 24 and a vertical bearing surface 26 adjacent thereto . a vertical circular face 28 on hub 20 has a plurality of threaded apertures 30 . a cylindrical flat planar thrust bearing 32 is mounted on bearing surface 24 and when assembled , bears against bearing surface 26 . a cylindrical sleeve bearing 34 is then mounted on bearing surface 24 adjacent the thrust bearing 32 . in assembly , the wheel 14 a which has a large diameter center bore 36 is slidably mounted on the sleeve bearing 34 ( fig5 ). the center bore 36 of wheel 14 a has an annular groove 38 on the outboard side thereof . a circular metal conductor plate 40 with the center opening 42 and a plurality of apertures 44 ( equal in number and size to apertures 30 in face 38 of hub 20 ) is mounted within annular groove 38 . a retainer plate 46 ( fig3 and 5 ) is also mounted in annular groove 38 . retainer plate 46 has a center opening 48 and a plurality of apertures 50 . conventional threaded bolts 52 extend through the registering apertures 50 ( in retainer plate 46 ); 44 ( in conductor plate 40 ); and 30 ( in hub 20 ). it should be noted ( fig4 ) that a space 54 exists between the bearing surface 24 of hub 20 and the center opening or bore 36 in wheel 14 a . this space is normally occupied by sleeve bearing 34 . however , in an modified form of the invention , the space 54 can be filled with a lubricating coating ( not shown ), in lieu of the sleeve bearing 34 . wheel bore 36 can be adjusted in diameter as required . there are available in the industry synergistic coatings ( e . g ., hi - t - lube ®) which become an integral part of the top layer of a base metal rather than merely a surface cover . this lubricating coating has a hard interface metal layer adjacent the base metal ; a semi - soft , compressible metal layer adjacent the base metal ; a semi - soft , compressible metal layer adjacent the hard interface layer ; a hard , thin oxide layer adjacent the compressible layer ; and an outer malleable , dry lubricant layer on the outer surface of the thin oxide layer . this lubricating layer can resist wear of the base metal by up to 15 times under cryogenic conditions . this and other lubricating coatings in the industry in environments from room temperature up to 1000 degrees fahrenheit can withstand high applied loads at relatively high speeds and frequent reversal in direction . under such conditions , these products performed effectively for long periods of time where other lubricants and combinations of materials failed in a relatively short period of time . the thickness of the coating ( and the radial height of space 54 ) can be in the order of 0 . 0003 inches - 0 . 001 inches in thickness and has a coefficient of friction in the range of 0 . 03 and can withstand high compression loads in excess of 150 , 000 psi . hardness of available material is up to an equivalent of rc 55 .- r c 85 . these materials are not , per se , a part of this invention and have not been previously used in the application of bearings for railway wheelsets but the present invention makes provision for this technology . it should be understood that the space 54 normally occupied by a bearing sleeve 34 could be occupied by the lubricating coating described heretofore instead of the sleeve bearing 34 . it is therefore seen that the wheelsets of this invention can be easily assembled and can easily create a wheelset with a single rigid wheel at one end of the axle and an independently rotatable wheel at the other end of the axle . the electrical continuity through the wheelset is guaranteed by the presence of conductor plate 40 which can maintain this electrical continuity without having to pass through the wheel bearings themselves . with reference to fig2 the electrical continuity between the rails upon which wheels 14 a and 14 b are mounted is completed from the rail under wheel 14 b through wheel 14 b and thence through axle 12 , through conductor plate 40 , and into wheel 14 a to the opposite rail . as previously indicated , when the axle is provided with one or more independently rotatable wheels , it is possible for the axle to rotate about its vertical centerline if one of the wheels rotates in one direction and the other wheel rotates in the opposite direction . if the axle with the independently rotatable wheels is mounted in a short wheelbase two - axle truck , it may be possible for the two wheels on one side of the truck to move in one direction , while the two wheels on the other side of the truck rotate in the opposite direction . this action may result in derailing the truck and will be more pronounced and prevalent in a short wheelbase two - axle truck than in a long wheelbase two - axle truck . to prevent the independently rotatable wheel from rotating in the opposite direction from the other wheel , an automatic locking means is provided to prevent the rotation of the independently rotatable wheel when stopped or when operating at low speeds . when the rotation of the locked independently rotatable wheel reaches a predetermined rotational speed , the locking means automatically releases and the differential action can again be utilized . with references to fig7 - 11 , an independently rotatable wheel 14 c is shown . the axle retainer hub 56 has been modified to provide engagement teeth 58 for releasable engagement with a plurality of pivoting latches 60 which are equipped with self - lubricating bearings 62 mounted on pivot pins 64 . each latch 60 has engagement teeth 61 adapted to nest at times between teeth 58 on hub 56 . each pivot pin 64 is equipped with self - lubricating thrust bearing latch retainers 66 which are in turn secured by means of stainless steel snap rings 68 or equivalent . each pivot pin 64 is securely inserted into a latch boss 70 made integral with the wheel . the latch boss may be deleted when a separate latch pin mounting plate is used , attached to the wheel as shown in fig1 and 19 , as discussed hereafter . also integral with and offset from the wheel are a plurality of latch stops 72 which restrict the travel of the pivoting latches 60 from excessive outward travel . fig9 shows the configuration of the rotatable latch 60 when acted upon by gravity when the independently rotatable wheel 14 c is rotating slowly or is at rest in a motionless state . fig1 shows the position of the rotatable latches 60 when acted upon by centrifugal force and restrained from further outward motion by integral latch stops 72 . the foregoing structure of fig7 - 11 provide means for locking the independently rotatable wheel to the axle rigidly when the rotation of the wheel ceases , or when the wheel is rotated slowly . this locking means automatically releases when the wheel and axle reach a predetermined speed of rotation , at which time the differential action of the independently rotating wheel is again permitted . a typical speed at which this takes place is 5 - 10 mph or a wheel speed of 50 - 100 rpms . this is accomplished by the axle retainer hub 56 being provided with teeth 58 for releasable engagement by the rotatable latches 60 pivotally mounted on pivot pins 64 , said rotatable latches engaging the toothed retainer hub 36 by gravitational action when the wheel 14 c is not rotating or rotating at slow speed , and the rotatable latches 60 disengaging teeth 58 due to centrifugal force when the wheel 14 c rotates beyond a predetermined speed . an alternate embodiment of the foregoing invention is shown in fig1 , 13 and 14 . with reference to fig1 , 13 and 14 , the wheel 14 c is capable of independent rotation with respect to axle 12 , as previously described . the axle retainer hub 56 a has been modified to provide engagement teeth 58 a , each with a near - radial bearing surface on the clockwise side 59 , and a sloping surface 59 a on the counter - clockwise side . these engagement teeth 58 a are for releaseable engagement with a plurality of pivoting double - arm latches 60 a which are equipped with self - lubricating bearings 62 mounted on pivot pins 64 . ( fig8 ). each latch has an engagement tooth 61 a adapted to nest at times between teeth 58 a on hub 56 a . as with the structure of fig9 - 11 , each pivot pin 64 is equipped with self - lubricating thrust bearing latch retainers 66 which are in turn secured by means of stainless steel snap rings 68 or equivalent . each pivot pin 64 is securely inserted into a latch boss 70 made integral with the wheel . also integral with and offset from the wheel are a plurality of latch stops 72 which restrict the travel of the pivoting latches 60 a from excessive outward travel . centrifugal force acting on the weighted end 60 b of the pivoting latches 60 a tends to keep the engagement teeth 61 a of these latches in proper position with respect to the axle retainer hub engagement teeth 58 a , when the wheel rotates , or , when the wheel is stopped or operating at very slow speeds , gravitational force acting on the weighted ends 60 b of the double - arm latches 60 a tends to keep the engagement teeth 61 a of these latches in engaged position . in fig1 , it is to be noted that the arrow indicating direction of rotation relates to the rotation of the axle 12 and axle retainer hub 56 a with respect to possible rotation of the independently rotatable wheel 14 c and not to the rotation of the wheel with respect to a non - rotating axle . the wheel 14 c cannot rotate in a counter - clockwise manner with respect to the axle as shown in fig1 . fig1 shows the above components in play when rotation is in the opposite direction . although the centrifugal and gravitational forces tend to keep the engagement teeth 61 a of the pivoting double - arm latches 56 a in proper position for engagement with the teeth 58 a of the toothed axle retainer hub 56 a , the sloping surface 59 a of the teeth of the axle retainer hub prevent the proper engagement of the teeth and permit the wheel to rotate independently in the clockwise direction . again , it is to be noted that the rotation depicted in fig1 relates to the rotation of axle 12 and the axle retainer hub 56 a with respect to possible rotation of the independently rotatable wheel 14 c , and not to the rotation of the wheel with respect to a non - rotating axle . the wheel 14 c can rotate in a clockwise manner with respect to the axle as shown in fig1 . since the differential rotation of one wheel with respect to the other wheel of a wheelset is not expected to ever exceed 15 rpm , wear to the teeth 61 a of the pivoting double - arm latches 60 a or to the toothed axle retainer hub is expected to be minimal . fig1 is a diagram showing placement of the independently rotatable wheels and locking mechanisms for the wheelsets in a railroad car truck t . fig1 a shows how both wheels on the axles can rotate independently and be locked in reverse direction . the foregoing structure of fig1 - 14 provide means for automatically locking the independently rotatable wheel 14 c to the axle 12 rigidly in one direction , and automatically disengaging the independently rotatable wheel from the axle when rotation is in the opposite direction . this is accomplished by the axle retainer hub 56 a being provided with teeth 58 a with a near - radial bearing surface 59 on one side to resist rotation toward that surface , and a sloping bearing surface 59 a on the other side to permit rotation toward that surface . pivotable latches 60 a with teeth 61 a engage the teeth 58 a of the axle retainer hub , urged by centrifugal and gravitation forces , but the near - radial and sloping surfaces either augment or prevent the locking action . the locking and disengaging action is automatic at all times . fig1 shows that the rotatable latches of this alternate design have been rotated by centrifugal force and that the teeth of these latches are in contact with the near - radial sides of the teeth of the toothed integral axle retainer , and that the wheel is not free to rotate in this direction . fig1 shows that the rotatable latches of this alternate design have been rotated by centrifugal force but that the teeth of these latches are in contact with the sloping sides of the teeth of the toothed integral axle retainer , and that the wheel is free to rotate in this direction . with reference to fig1 a , 15 b , 15 c , 15 d and 15 e , a further alternate form of the invention is shown . an outer clutch plate 73 is bolted to the inner face of a wheel such as wheel 14 a by suitable bolts extending through holes 74 ′ shown in fig1 b . an inner clutch plate 76 ′ is bolted to the inner face of a hub by suitable bolts through holes 78 ′ ( fig1 a ). fig1 a shows groups of slots 82 in the face of inner clutch plate 76 ′. the slots 82 a , 82 b , 82 c , 82 d and 82 e are radially and laterally spaced so that the arc between opposite ends of slots 82 e is approximately 3 °. groups of one - way clutch teeth 84 comprised of teeth 84 a , 84 b , 84 c , 84 d and 84 e are radially aligned on outer clutch plate 73 and are adapted to engage slots 82 a - 82 e in inner clutch plate 76 ′ to restrict the rotation of one wheel in one direction with respect to the wheel on the other end of the wheel . a left hand clutch and a right hand clutch will be required , one for each wheel . these clutches are shown in u . s . pat . nos . 5 , 070 , 978 and 5 , 597 , 057 , except that they do not have the above 3 ° increment of engagement . the groups of teeth 84 are positioned on radii separated typically at 30 ° intervals . with reference to fig1 e and 15d , ( see the &# 39 ; 978 patent , fig5 and 6 ), a typical tooth 84 c is pivotally mounted in an underlying tapered slot 84 c ′. each tooth in group 84 pivots about fulcrum 85 dwelling in slot 86 of compatible shape . while as any given slot such as 82 c is not in radial alignment with any given slot such as 84 c ′, the tooth 84 c will remain entirely recessed in slot 84 c ′. each tooth can be spring - biased as disclosed in &# 39 ; 057 patent fig6 - 9 . thus , if plate 73 is rotated clockwise , as indicated by arrow 88 in fig1 c , the tooth 84 c will pass over the slot 82 c without engaging the slot 82 c . if the plate 73 is rotated fast enough , the teeth will not even have much time to momentarily pivot into slots 82 c . on the other hand , if plate 73 is rotated counterclockwise , in the opposite direction to arrow 88 , there will be a first slot 84 c which radially aligns itself with slot 82 c before any other slots do so . when this occurs , the tooth 84 c in that first slot 84 c ′ will pivot upward towards its biased position until its forwardmost lengthwise edge 90 engages slot 82 c , thereby causing plate 76 ′ to rotate with plate 73 . again , this phenomenon is shown by the &# 39 ; 978 and &# 39 ; 057 patents . it will be understood that alternative automatically operating latching mechanisms and restraints may be employed as mechanical equivalents without departing from the spirit of the invention . fig1 e shows the foregoing clutch plates 73 and 76 adapted to press - on hubs . a further alternate form of the invention is shown in fig1 e and 17 . a press - on hub 60 ′ has a cylindrical body 62 ′, an inner bore 64 ═, opposite faces 66 ′ and 68 ′, and a plurality of threaded apertures 70 ′ in each of the faces ( fig1 e and 16 and 17 ). the diameter of bore 64 ′ frictionally receives the outer diameter of an axle which is force - fit within bore 64 ′. the hub 60 ′ is shown in assembled condition in fig1 e . among the advantages of press - on hubs 60 ′ are the following : 1 . they are less expensive than integral hubs because much machining is eliminated . 2 . hubs 60 ′ reduce the diameter of the axle , which further reduces cost . 3 . most parts can be identical for all wheel diameters with hubs 60 ′. 4 . the hubs 60 ′ can be replaced without replacing the axle . 5 . the hubs 60 ′ can be made of different material than the axle , and different suppliers of hubs are then available for a given axle . a further embodiment of the invention is shown in fig1 - 20 . this embodiment is similar to that of fig1 and 14 except that a bolt - on latch pin plate 72 b is mounted adjacent plate 76 and secured to wheel 14 a by bolts 74 b ( fig2 ). threaded apertures 72 c ( fig2 ) receive threaded latch plate pins 72 d . two - piece ratchet gear elements 76 b ( fig1 - 20 ) with abutting edges 73 c are secured to hub 60 ′ by bolts 78 b . creating two ratchet gear elements permits them to be installed after other components without disturbing the other components . rotating latches 60 are omitted from fig2 for clarity . this invention herein can be applied to locomotive and / or powered axles as well as to railroad car axles . from the foregoing , it is seen that all the objectives of this invention are met . | 1 |
fig1 is an exploded perspective view partially showing an electronic component series 13 according to an embodiment of the present invention , and fig2 is an enlarged sectional view taken along the line ii -- ii in fig1 . fig3 is a plan view of the electronic component series 13 . the electronic component series 13 as shown in fig1 to 3 includes elements substantially similar to those of the electronic component series 1 as shown in fig1 . namely , the electronic component series 13 comprises a plurality of electronic components 14 , a receiving tape 15 and a cover tape 16 . the receiving tape 15 is formed with a plurality of receiving concavities 17 which are distributed in the longitudinal direction thereof for receiving the electronic components 14 respectively . a plurality of feeding perforations 18 are distributed along the longitudinal direction of the receiving tape 15 , along one of the side edges thereof . the receiving tape 15 is formed on its upper surface with stepped portions 19 , which linearly extend along the longitudinal direction of the receiving tape 15 . the stepped portions 19 are positioned inside regions to be in contact with the cover tape 16 for sealing , i . e ., seal regions 20 , and define boundaries between the seal regions 20 and regions lower than the same , i . e ., lower regions 21 . in this embodiment , the receiving concavities 17 are equalized in width to the lower regions 21 . when the cover tape 16 is heat - sealed to the receiving tape 15 through the sealing iron 9 as shown in fig1 and 15 , heat - sealed portions 22 are formed in cross - hatched regions as shown in fig3 . as obvious from fig3 the heat - sealed portions 22 correspond to the seal regions 20 , and respective inner sides thereof are defined by the stepped portions 19 . thus , the heat - sealed portions 22 are obtained substantially in even width . fig4 is a plan view showing a receiving tape 15a which is employed in another embodiment of the present invention , and fig5 is an enlarged sectional view taken along the line v -- v in fig4 . this embodiment is carried out by slightly modifying the embodiment as hereinabove described with reference to fig1 to 3 , and the following description is made only with respect to characteristic portions with similar reference numerals allocated to corresponding parts , for easy understanding of the comparison . in this embodiment , lower regions 21 are formed only in the vicinity of the stepped portions 19 . therefore , each of the lower regions 21 is separated in two parts , so that a region held between the two parts of the lower region 21 remains at the same level with seal regions 20 . fig6 is a plan view showing a receiving tape 15b which is employed in still another embodiment of the present invention , and fig7 is an enlarged sectional view taken along the line vii -- vii in fig6 . in this embodiment , the receiving tape 15b is provided with receiving concavities 17a which are relatively small particularly in size in the cross direction . in this case , stepped portions 19 are formed in positions outside the receiving concavities 17a at prescribed intervals . therefore , the receiving concavities 17a are provided in lower regions 21 which are formed inside the stepped portions 19 . seal regions 20 , which are formed in the exterior of the stepped portions 19 , are located on the receiving tape 15b and sized substantially identically to the seal regions 20 in the respective embodiments as shown in fig3 and 4 , and hence the same can be sealed by a similar heat sealing means such as the sealing iron 9 . the receiving tapes 15 , 15a and 15b employed in the respective embodiments as hereinabove described are made of sheets of thermoplastic resin , which are embossed to form the receiving concavities 17 and 17a , the stepped portions 19 and the like . however , the present invention is also applicable to another type of electronic component series . an example of such an electronic component series is now described with reference to fig8 . fig8 is a perspective view partially showing another type of electronic component series 23 . in the electronic component series 23 , a receiving tape 24 is formed by a relatively thick material such as cardboard or a strip of synthetic resin . the receiving tape 24 is formed with through - holes 25 which are distributed in its longitudinal direction . a lower tape 26 is adhered to the receiving tape 24 to cover the through - holes 25 , thereby to define receiving concavities 27 in the through - holes 25 respectively . the receiving concavities 27 are adapted to receive electronic components 28 . the receiving tape 24 is further provided along one of its side edges with a plurality of feeding perforations 29 . the feeding perforations 29 pass through the lower tape 26 . the lower tape 26 may be in the same width as a cover tape as hereinafter described , and in this case , no feeding perforation 29 passes through the lower tape 26 . the receiving tape 24 is provided on its upper surface with stepped portions 30 . thus , seal regions 31 and lower regions 32 are bounded by the stepped portions 30 . a cover tape 33 of thermoplastic resin is arranged along the longitudinal direction of the receiving tape 24 . the cover tape 33 can be heat - sealed within the range of the seal regions 31 through use of the sealing iron 9 as shown in fig1 and 15 . thus , the heat - sealed portions are formed substantially in constant width . although the present invention has been described with reference to several embodiments as shown in the drawings , further modifications can be carried out within the scope of the present invention . for example , the aforementioned four embodiments can be modified as shown in fig9 to 12 respectively . fig9 corresponds to fig2 and fig1 corresponds to fig5 while fig1 corresponds to fig7 and fig1 corresponds to fig8 respectively . in each of the embodiments as shown in fig9 to 11 , two protrusions 119 are formed with stepped portions provided on both sides thereof . further , in the embodiment as shown in fig1 , two protrusions 130 are formed with stepped portions provided on both sides thereof . other configurations of these embodiments are similar to those of the said corresponding embodiments , and hence the corresponding parts are shown by the same reference numerals , while overlapping description is omitted . the protrusions 119 and 130 as shown in fig9 to 12 extend linearly along the longitudinal directions of receiving tapes 115 , 115a , 115b and 124 in parallel with each other in prescribed widths . the protrusions 119 as shown in fig9 to 11 can be readily formed by embossing simultaneously with receiving concavities 17 . the protrusions 130 as shown in fig1 can be readily formed in a step of molding the receiving tape 124 by resin . the upper surfaces of the protrusions 119 and 130 are made relatively flat , to be formed with regions to be in contact with cover tapes 16 and 33 for sealing , i . e ., seal regions 20 and 31 . the upper surfaces of the protrusions 119 and 130 are made flat in order to ensure adhesion of the cover tapes 16 and 33 , but the same are not necessarily flat . the cover tapes 16 and 33 are heat - sealed to the receiving tapes 115 , 115a , 115b and 124 by the sealing iron 9 as shown in fig1 and 15 , whereby heat - sealed portions 22 correspond to the seal regions 20 and are defined in width by the protrusions 119 and 130 . the protrusions 119 as shown in fig9 to 11 may not be formed by embossing , but by partially increasing the sheets of thermoplastic resin in thickness . although the electronic components 14 and 28 are extremely roughly illustrated in the aforementioned embodiments , such electronic components are generally intended to be chip - like ones , such as monolithic capacitors or resisters . however , the present invention can also be applied to electronic component series in which electronic components having protruding lead terminals are received in concavities . further , although the cover tapes 16 and 33 employed in the aforementioned embodiments themselves are formed by thermoplastic resin , such thermoplastic resin may be provided in at least on surfaces opposite to the receiving tapes in order to attain heat sealing , and the cover tapes may be prepared by other materials coated with thermoplastic resin . in addition , the receiving tapes 24 and 124 as shown in fig8 and 12 may be integrally formed with bottom walls corresponding to the lower tapes 26 . such a receiving tape provided with receiving concavities 27 within the thickness thereof and having covered bottom surfaces can be easily manufactured by , e . g ., resin molding . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the scope of the present invention being limited only by the terms of the appended claims . | 1 |
the overall method of phosphorous reduction in stormwater runoff of the present invention uses barriers , liners or structures of iron humate ( fehu ), hereinafter referred to as iron humate filters submerged in an fluid retention area down stream of the stormwater runoff to absorb phosphorous from the stormwater runoff . in the exemplary embodiment , the stormwater runoff flows or is channeled to the fluid retention area from non - point sources ( e . g ., dairy farms , sugar cane fields ). the fluid retention area may be a retention pond 40 or 240 , as best seen in fig1 and 3 , wetland reservoir 140 with vegetation , as best seen in fig2 or an agricultural ditch 340 , as best seen in fig4 . referring now to the iron humate filter , fehu has a strong ability to adsorb ( chemically retain ) phosphorous . hence , i have determined that with the problems of high nitrogen and phosphorous levels in florida &# 39 ; s waters , a structure of fehu , which allows stormwater runoff to flow therethrough , chemically retains phosphorous found in the stormwater runoff . thereby , the fehu can be used to reduce phosphorous from non - point sources of stormwater runoff ( e . g ., dairy farms , sugar cane fields ). since the fehu chemically absorbs phosphorous or phosphorous compounds , the iron humate filter will become saturated . when the iron humate filter becomes saturated , the iron humate filter should be removed and replaced with another iron humate filter . as will be described in more detail below , alternately , the saturated iron humate in the iron humate filter may be replaceable with a clean or non - saturated iron humate instead of removing the filter . referring now to fig1 the method of phosphorous reduction in a stormwater runoff , is best seen in fig1 where a iron humate filter installation 20 is employed downstream of a dairy farm or other non - point stormwater runoff source 30 . the iron humate filter installation 20 includes a retention pond 40 which is positioned to down stream the surface stormwater runoff flow arrow 50 and slows the surface stormwater runoff flow arrow 50 down . the stormwater runoff filters through the iron humate filter 60 . the iron humate filter installation 20 further includes a retention pond drain pipe 80 which discharges or channels filtered stormwater runoff into a control ditch 70 on the output side of the iron humate filter 60 . the filtered stormwater runoff in the control ditch 70 has a significantly lower level of phosphorous . thereafter , the fluid solution in the control ditch 70 can then be funneled to other water ways or used appropriately . eventually , the iron humate in the iron humate filter 60 will reach “ breakthrough ” or a phosphorous saturation stage — a stage where it cannot retain any more phosphorous — and a fresh iron humate filter 60 would be needed . the saturated or phosphorous - laden fehu could then be sold or processed into fertilizer . referring now to fig2 an alternate embodiment for carrying out the method of the present invention that includes iron humate filter installation 120 downstream of a non - point stormwater runoff source 30 ( fig1 ) is shown . the iron humate filter installation 120 includes a wetland reservoir 140 which is positioned to slow down surface stormwater runoff flow arrow 50 into the wetland reservoir 140 . the wetland reservoir 140 is lined , including its perimeter sides 142 and bottom floor 145 , with a iron humate filter liner 160 which filters the stormwater runoff flow arrow 50 . as is well known , fehu , a known fertilizer , provides iron and other nutrients for vegetation . thus , the iron humate filter liner 160 promotes vegetation growth 147 in the wetland reservoir 140 while also absorbing phosphorous , thereby also promoting further phosphorous reduction by plant uptake . the iron humate filter liner 160 further includes iron humate filter mounds 165 spaced along the iron humate filter liner 162 . the discharge from the wetland reservoir 140 is sent downstream to control ditch 70 . as described above , eventually , the iron humate will reach “ breakthrough ” or a phosphorous saturation stage — a stage where it cannot retain any more phosphorous — and a fresh iron humate or iron humate filter liner 160 and mounds 165 would be needed . referring now to fig3 an iron humate filter installation 220 employing a retention pond 240 to carrying out the method of the present invention in combination with a turnkey treatment plant fehu system 210 is shown . the iron humate filter installation 220 includes an upstream retention pond 240 , pump 245 and an iron humate - packed filter 260 . the surface stormwater runoff flow arrow 50 flows down to the upstream retention pond 240 , where the stormwater runoff is pumped under pressure through pump 245 to the iron humate - packed filter 260 . the discharge of the iron humate - packed filter 260 on outlet port 264 is channeled downstream to control ditch 70 . referring now to fig4 an iron humate filter installation 320 employing an agricultural ditch 340 to carrying out the method of the present invention is shown . the agricultural ditch 340 has an aqueous solution flow arrow 350 a and agricultural surface runoff flow arrows 350 b and 350 b ′. downstream from the aqueous solution flow arrow 350 a and the agricultural surface runoff flow arrows 350 b and 350 b ′, iron humate filters 360 are stacked and positioned across the width of agricultural ditch 340 to create a filtering wall 325 . in the exemplary embodiment , there are two walls 325 and 327 adjacent to each other at approximately 500 feet - 1000 feet spacing . the discharge from the second wall 327 can be sent downstream to control ditch 370 which flows into a natural creek , stream or river in the direction of arrow 350 c . referring now to fig5 a iron humate filter 360 is shown . the iron humate filter 360 includes in general a basket or cage housing 380 made of mesh which is adapted to be filled with iron humate 365 . in the exemplary embodiment , the basket or cage housing 380 includes a lid or cover 385 also preferably made of mesh to permit the flow of stormwater runoff to flow therethrough . the lid or cover 385 allows the saturated iron humate 365 to be removed from time - to - time and processed remotely or , alternately , sold . the basket or cage housing 380 is lined with a geotextile fabric 385 with a permittivity of about 100 - about 200 gal / sf / min , or , as designed hydraulically to allow water to flow through the system , geotextile fabric 385 holding iron humate 365 inside of cage housing 380 and allowing water to pass therethrough . in the exemplary embodiment , the basket or cage housing 380 includes a mesh opening of 3 ″× 3 ″ ( 7 . 5 cm .× 7 . 5 cm ) with a mesh wire of 0 . 106 — us gauge 12 ( 2 . 7 mm ). the mesh is pvc coated with a minimum thickness of 0 . 0150 ″ per side and a nominal thickness of 0 . 0216 ″ per side . the length l of the basket or cage housing 380 is approximately 6 feet , the width w is approximately 3 feet , the height h is approximately 3 feet . however , the basket or cage housing 370 can have any number of cells or compartments for the placement of the iron humate 365 . the compartments are created by the baffle walls also made of mesh . as can be appreciated , the iron humate filter 60 and a iron humate filter liner 160 with mounds 165 are created filters similar to the iron humate filter 360 but may vary with size . iron humate filter 260 differs from the submerged iron humate filters 20 , 160 , and 360 and requires a closed housing for maintaining the fluid pumped therethrough . furthermore , the iron humate filter 260 requires inlet and outlet ports 262 and 264 . referring now to fig6 - 9 , an iron humate filter assembly 400 is shown . iron humate filter assembly 400 fits into a half - round spillway or l - shaped conduit 420 typically constructed of corrugated metal pipe and widely commercially available . assembly 400 includes a riser frame 410 with a plurality of cross brace angles 415 supporting an upright tubular channel 422 of l - shaped conduit 420 . the tubular channel 422 has a closed bottom 425 and intersects perpendicularly with horizontal tubular channel 427 . in the exemplary embodiment , the horizontal tubular channel 427 is semicircular shaped so that the bottom half can lay on the ground or other horizontal surface . the iron humate filter assembly 400 further includes an iron humate filter 450 which fits in the bottom of the upright tubular channel 422 wherein stormwater runoff flows down the tubular channel 422 through the iron humate filter 450 to horizontal tubular channel 427 . the iron humate filter 450 includes a smaller basket or cage housing 480 made of expanded metal mesh which is adapted to be lined with a geotextile fabric 485 and filled iron humate . the geotextile fabric 485 assists in maintaining the iron humate in the basket or cage housing 480 . the basket or cage housing 480 includes a top handle 488 to permit the removal of the iron humate filter 450 and may include a rigid metal frame 482 supporting walls of an expanded metal cage 484 . iron humate filter assembly 400 may further include a steel or aluminum grate 490 positioned at the top of the vertical tubular channel 420 . in an alternate usage or method of deployment , iron humate filters wrapped in geotextile filter fabrics can be fitted inside manholes and other types of stormwater inlets to filter runoff from urban areas , such as streets , parking lots and grassed swales . further , flow rates through iron humate may be increased by adding pine bark , rocks or other materials that are more permeable than the iron humate . the specific ratio for a iron humate - pine bark mixture will by necessity be site specific . because many varying and differing embodiments may be made within the scope of the inventive concept herein taught and because many modifications may be made in the embodiment herein detailed in accordance with the descriptive requirement of the law , it is to be understood that the details herein are to be interpreted as illustrative and not in a limiting sense . | 2 |
the invention will be described with respect to a particular embodiment as disclosed in the attached drawings in which fig1 is a partially diagrammatic flow chart of the fluidized bed operation . fig2 is a top view of a portion of chain link fencing taken on lines 2 -- 2 of fig1 fig3 is a portion of chain link fencing taken on lines 3 -- 3 of fig1 showing the strands separated during the fluidized operation , fig4 is an enlarged detail of fig1 taken on lines 4 -- 4 of fig3 and , fig5 is an enlarged detail taken on lines 5 -- 5 of fig3 . for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . as shown best in fig2 and 3 , a chain link is woven by taking two wires 41 , 42 , twisting them as shown at 45 and then weaving them together and with the previously woven wire to create an additional link or course the width of the chain . the chain link is woven to the final width desired , usually from 3 to 12 feet . when the chain is mounted in place on uprights , horizontal tension keeps the joints 46 closed . as shown in fig3 the chain link may easily be compressed and the joints separated as at 47 , with only the twisted end portions 45 remaining permanently adhered to each other . the elements of my fluidized bed dryer are shown in fig1 in which the woven chain link 40 travels from left to right . the woven wire goes first through a cleaning station 10 , then a heating station 11 , then is primed at 12 , accumulated at 13 , passes the fluidized bed 14 to the take - up station 15 . i employ two types of rollers for the chain link during this operation . first are plain rollers whose only purpose is to hold the wire in position and change its direction , such as roller 20 in the cleaning station , and rollers 21 and 22 in the heating station . interspersed are drive rollers such as 30 pulling the chain link out of the cleaning station and 31 pulling it out of the heating station . these drive rollers may have a conventional cleat arrangement to fit in the chain link , such as disclosed in the above cited harter patent . a drive roller 32 feeds the chain link into the fluidized bed and drive roller 33 removes it from the fluidized bed where it is rolled up again at take - up station 15 . the accumulation stage 13 allows the prime coat to dry and also allows for some slack between the cleaning , heating and priming stages and the fluidized bed , since the tension in the fluidized bed is critical and is not critical in the stages prior thereto . in the fluidized bed are four rollers 23 , 24 , 25 , and 26 . rollers 23 and 26 serve to change the direction of the chain link while rollers 24 and 25 are compression or squeeze rollers which may be separated to insert the chain but are then biased by conventional means not shown towards each other to squeeze the chain . drive rollers 32 and 33 are indexed to slightly compress the chain , or relieve tension , during the passage through fluidized bed dryer 14 . roller 32 starts first for a selected displacement and then roller 33 begins . during operations both rollers operate at the same speed . as each link is passed between squeeze rollers 24 and 25 , the force of the rollers holds the links so that inner surfaces 42 and 44 between roller 23 and rollers 24 and 25 are separated due to the above described indexing allowing the powder polymer to coat them and adhere to the surface prior to the surfaces again contacting each other forming flexible joint 46 as shown in fig2 . the fluidized bed dryer may be of any conventional type , comprising a tank - like vessel 50 containing at the bottom an air plenum 51 into which heated air is pumped through conventional heating and valving means not shown . above the air plenum is a porous or foraminous plate 52 which separates the air into vertical streams . into this area above plate 52 is inserted , through conventional means not shown , the thermoplastic polymer which is heated to near its fusing point , as is well known . the powdered polymer adheres to the heated chain link fabric as it passes under rollers 23 , past rollers 24 , 25 and under roller 26 . this occurs because the air pressure is sufficient to raise the cloud of semi - molten polymers above the level of the above - mentioned rollers , creating an apparent fluidized bed of these partly molten polymer powders . as the polymer coated fabric exits from the fluidized bed , cooling streams of air , not shown , may be advantageously applied to the chain link fabric to cool the coating and strengthen it prior to passage over drive roller 33 and the rolling operation at take - up station 15 . although the present invention has been described with reference to a particular embodiment thereof , it should be understood that those skilled in the art may make many other modifications and embodiments thereof which will fall within the spirit and scope of the principles of this invention . | 1 |
the following discussion describes the preferred embodiment of the invention and other embodiments , but there are many other possible embodiments of the invention that fall within the scope of the invention , and one of skill in the art would recognize the various alterations that would fall within the scope of the invention . in one embodiment , as shown in fig1 - 3 , skimmer 10 is comprised of two generally rectangular wooden sides or side panels 12 and 14 that are approximately 5 ″× 11 ″× 0 . 75 ″ ( height × length × thickness ) in size and are generally parallel to each other ( which can encompass embodiments where the sides are exactly parallel to each other or are within 10 ° of being parallel to one another ). these panels could also be made of metal , plastic , composites , or a variety of other different materials or combination of materials , and they can be in different shapes and sizes . side panels 12 and 14 are connected via three wooden cross pieces — front cross piece 16 , top cross piece 18 , and back cross piece 20 . again , cross pieces 16 , 18 , and 20 can also be made of metal , plastic , composites , or a variety of other different materials or combination of materials , and they can have different cross sections , such as circular , square , rectangular , or hexagonal , among other things . side panels 12 and 14 have front ends 84 and 88 , which are the portions of the panels towards the front of each side panel ( e . g ., nearer front cross piece 16 ), and back ends 86 and 90 , which are the portions of the panels towards the back of each side panel ( e . g ., nearer back cross piece 20 ). front cross piece 16 is roughly rectangular in cross section with dimensions of 0 . 75 ″× 1 . 5 ″× 22 . 5 ″ ( height × width × length ). it is connected towards the lower front end of skimmer 10 and extends from one side panel to the other . top cross piece 18 is cylindrical in shape with a radius of 0 . 75 ″ and a length of 22 . 5 ″. it is located towards the upper middle of skimmer 10 and extends from one side panel to the other . back cross piece 20 is cylindrical in shape with a radius of 0 . 75 ″ and a length of 22 . 5 ″. it is located towards the upper back end of skimmer 10 and extends from one side panel to the other . while cross pieces 16 , 18 , and 20 are attached to side panels 12 and 14 via a connecting mechanism , such as a screw , nail , bolt , rivet , clip , or glue , for example , they could also be integral with one or both of sides 12 and 14 . cross pieces 16 , 18 , and 20 can be solid or hollow ( in order to adjust the overall weight of skimmer 10 or to increase or decrease its buoyancy ) or filled with a lightweight or buoyant material . other numbers of cross pieces ( such as 2 , 4 , 5 , 6 , 10 , etc .) could also be used and fall within the scope of the invention . for example , top cross piece 18 could be removed from this embodiment , as shown in fig1 , or it could be moved to the back and below cross piece 20 . skimmer 10 contains two wooden 0 . 75 ″× 3 . 5 ″× 13 ″ ( height × width × length ) elongated flotation devices 22 and 24 connected to the bottom of side panels 12 and 14 and extend from the front of skimmer 10 to the back . it has been found that the optimal configuration for maneuverability and operation is such that flotation devices 22 and 24 should not extend beyond front cross piece 16 , although the invention can still function if flotation devices 22 and 24 extend in front of front cross piece 16 or are configured in a different manner . flotation devices 22 and 24 can be made from a variety of buoyant materials or combinations of buoyant materials , such as wood , cork , plastic , foams ( e . g ., polyvinyl chloride , polyethylene , and polystyrene ), aerogels , nano - cellulose , styrofoam , and sealed air containers , among other things . alternatively , floatation devices 22 and 24 could be integral with sides 12 and 14 ( respectively ), below sides 12 and 14 ( respectively ), or next to or beside sides 12 and 14 ( respectively ), among other things , and fall within the scope of the invention . floatation devices 22 and 24 are designed to keep skimmer 10 floating at the top of the water &# 39 ; s surface 96 when it is in pool or pond 98 . thus , the operator does not have to support the weight of skimmer 10 while it is in pool 98 . at the same time , the overall buoyancy of skimmer 10 is such that some or all of it can be submerged with relative ease should the operator push down on the front of skimmer 10 via pole 38 described below . a 15 ″× 22 . 5 ″ ( length × width ) screening medium 26 in the form of a net runs along the bottom of skimmer 10 and is attached to cross pieces 16 and 20 . net 26 is also connected to sides 12 and 14 , either by being directly attached to or abutting sides 12 and 14 or by being indirectly attached to another member ( such as a frame or bar ) that is attached or next to the sides . because front cross piece 16 is in the lower front of skimmer 10 and back cross piece 20 is in the upper back of skimmer 10 , debris that floats into skimmer 10 will generally become and remain trapped in skimmer 10 during operation . net 26 can be attached to cross pieces 16 and 20 and sides 12 and 14 in a variety of manners , such as via glue , screws , nails , rivets , friction fits , clamps , glue , buttons , zippers , snaps , splines , or velcro - type materials . in this particular embodiment , net 26 is attached to front cross piece 16 and back cross piece 20 by a rubber spline strip inserted into a groove in the cross pieces . net 26 can be permanently attached to skimmer 10 , or it can be removably attached in order to facilitate cleaning or repair of skimmer 10 or net 26 . net 26 can be made from a variety of materials , such as string , cord , plastic , polyethylene , polypropylene , polyester , nylon , or other types of polymer plastics . in this particular embodiment , net 26 is made of polyester . the mesh of the net should be small enough that the debris will remain trapped in net 26 , but sufficiently porous enough so that it will allow the water to flow through the net during operation or removal of skimmer 10 from the water . in other embodiments , screening medium 26 could be a screen , a strainer , or other type of material that allows water to readily pass through while containing the debris to be removed . in order to operate and direct the movement of skimmer 10 in pool or body of water 98 , there are two cord attachment points 28 and 30 located in the top , front corners of side panels 12 and 14 . in this embodiment , these cord attachment points are 0 . 3125 ″ diameter holes offset by approximately 0 . 25 ″ from the top front corners of side panels 12 and 14 , but other forms and locations of attachment points could be used ( such as an eyelet , loop , ring , clasp , screw , or hook , among other things ). cord ends 72 and 74 of a 0 . 25 ″ diameter by 32 ″ long flexible cord ( or rope ) 32 are connected to side panels 12 and 14 at cord attachment points 28 and 30 . flexible cord 32 can be made of other materials besides rope , such as chain , cord , or wire , among other things , and be of different diameters and lengths . in order to control the operation of skimmer 10 , pole 38 connects to skimmer 10 via control attachment point 34 , which is located at roughly the middle ( the mid - point ) of rope 32 , and , in this embodiment , is a spring - loaded clip fastened to rope 32 . control attachment point 34 can be variety of mechanisms or means on rope 32 and fall within the scope of the invention . for instance , control attachment point 34 could just be the middle of rope 32 that is grasped , tied to , or otherwise connected to or by coupling point 36 or pole 38 . control attachment point 34 could also be an eyelet , loop , ring , clasp , screw , hook , carabiner , or any of a number of devices or means on rope 32 by which pole 38 ultimately connects to rope 32 . control attachment point 34 could encompass multiple attachment points along rope 32 , such as two or more points equally spaced along or from the middle of rope 32 . the ends of rope 32 are tied to cord attachment points 28 and 30 in order to secure the ends of rope 32 to side panels 12 and 14 . alternatively , other chemical or mechanical devices could be used to secure rope 32 to cord attachment points 28 and 30 , such as clips , loops , screws , bolts , rivets , rings , staples , clasps , ferrules , glues , and other chemical means , among many other things . in addition , control attachment point 34 could also take other forms , such as a loop , screw , eyebolt , ring , clasp , eyelet , hook , etc . cord attachment points 28 and 30 should be located in the front half of skimmer 10 in order to facilitate movement of skimmer 10 , but can be located in different positions than those shown in fig1 - 3 and still fall within the scope of the invention . in this embodiment , pole 38 connects to control attachment point 34 via coupling point 36 . in one embodiment , pole 38 is a 15 ′ long by 1 ″ diameter aluminum pole with a handle on the opposite end from coupling point 36 . coupling point 36 is an eyebolt attached to the end of pole 38 , which allows pole 38 to attach to rope 32 ( and , therefore , skimmer 10 ) via control attachment point 34 . alternatively , coupling point 36 could take other forms , such as a hole , loop , clip , or other mechanism attached to or in pole 38 . using a spring - loaded clip for control attachment point 34 allows skimmer 10 to be easily decoupled from coupling point 36 / pole 38 for storage , repair , or replacement purposes ( for example , to connect a longer or shorter pole ). pole 38 can be made from a variety of materials and be a variety of lengths and sizes and can be telescopically - adjustable or fixed in length . another embodiment is shown in fig4 - 7 . in this embodiment , skimmer 10 is comprised of two generally rectangular wooden side panels 12 and 14 that are approximately 5 ″× 11 ″× 0 . 75 ″ ( height × width × thickness ) in size . side panels 12 and 14 are connected via two wooden cross pieces 16 and 20 . front cross piece 16 is roughly rectangular in cross section with dimensions of 0 . 75 ″× 1 . 5 ″× 22 . 5 ″ ( height × width × length ). it is connected towards the lower front of skimmer 10 and extends from one side panel to the other . back cross piece 20 is a rectangular panel comprised of four pieces — top and bottom horizontal bars 40 and 42 with dimensions of 0 . 75 ″× 1 ″× 22 . 5 ″ ( height × width × length ) and left and right vertical support bars 44 and 46 with dimensions of 2 . 375 ″× 1 ″× 0 . 75 ″ ( height × width × length ). back cross piece 20 is located towards the back of skimmer 10 and extends from one side panel to the other and is generally perpendicular to net 26 . cross pieces 16 and 20 are attached to side panels 12 and 14 via a connecting mechanism , such as a screw , nail , bolt , rivet , clip , or glue , for example . as discussed above , sides 12 and 14 and cross pieces 16 and 20 can be made from a variety of materials and take a variety of forms . in this embodiment , skimmer 10 contains two wooden 0 . 75 ″× 3 ″× 13 . 5 ″ ( height × width × length ) elongated flotation devices 22 and 24 located on the bottom of and connected to side panels 12 and 14 . these flotation devices can be made from a variety of buoyant materials or combinations of buoyant materials , as discussed above . a 14 ″× 22 . 5 ″ ( width × length ) polyester net 26 ( screening medium ) runs along the bottom of skimmer 10 and is attached to cross pieces 16 and 20 . net 26 is attached to front cross piece 16 and the bottom of back cross piece 20 via slots with rubber splines . a secondary screening or filtering medium 48 extends from the bottom to the top of back cross piece 20 in order to help trap debris in skimmer 10 . in this embodiment , second screening medium 48 is perpendicular to net 26 ( meaning that it is roughly at a 90 ° angle , but it does not have to be precisely 90 °). screening medium 48 could be an additional net , or it could be one or a series of 0 . 25 ″- thick porous scouring pads held in a vertical alignment in slots in back cross piece 20 . one of ordinary skill in the art would recognize that additional sizes and types of screening or filtering materials , such as geotex tile fabric , screens , nets , or filters , among others could be used for either net 26 or second screening medium 48 and still fall within the scope of the invention . in order to operate and direct the movement of skimmer 10 in pool or body of water 98 , there are two cord attachment points 28 and 30 located in top , front corners of side panels 12 and 14 . these cord attachment points are 0 . 3125 ″ diameter holes offset by 0 . 75 ″ from the top front corners of side panels 12 and 14 . the ends of a 0 . 25 ″ diameter by 32 ″ long rope ( flexible cord ) 32 pass through cord attachment points 28 and 30 before coming together at control attachment point 34 , which is a spring - loaded clip fastened to the center of rope 32 . the ends of rope 32 are tied to cord attachment points 28 and 30 in order to secure the ends of rope 32 to side panels 12 and 14 . as discussed above , flexible cord 32 can take a variety of forms and be attached to skimmer 10 in a variety of ways . as shown in fig8 , in order to attach pole 38 to skimmer , an adapter 50 fits into the end of pole 38 . the end of adapter 50 that fits into pole 38 is comprised of a 0 . 75 ″ diameter × 5 ″ long piece of pvc pipe with plastic spring clips 52 that secure adapter 50 onto pole 38 . the other end of adapter 50 is comprised of a 0 . 25 ″× 1 ″ stainless steel eyebolt 54 . a spring - loaded clip 34 attaches to eyebolt 54 in order to attach skimmer 10 to pole 38 . as discussed above , other attachment mechanisms can be used . in an alternative embodiment , as shown in fig4 , 6 , and 7 , brushes 56 and 58 can be placed on the sides of skimmer 10 in order to allow easy cleaning of the sides of the pool by rubbing brushes 56 or 58 along the sides or edges of the pool . some or all of brushes 56 and 58 can be part of skimmer 10 . for example , skimmer 10 could only have brushes 56 and 58 on the sides , just brush 56 , just brush 58 , or brushes in different locations , such as the top , front , or back , in addition to or instead of brushes 56 and 58 . in one embodiment , the brushes could be 4 ″× 1 ″× 0 . 5 ″ in dimension and made of stainless steel , pvc , fabric , or any other common brush material . in another embodiment , brushes 56 or 58 could be removable , by being screwed , bolted , slotted , snapped , tied , velcroed , or connected by latches ( among other things ) into the sides or top of skimmer 10 . in this way , the operator could choose when to use or not use the brushes or remove them for easier cleaning . in still another embodiment shown in fig1 , 4 ″× 1 ″× 0 . 25 ″ fabric pads 104 , 106 , 108 , and 110 can be placed on the corners of skimmer 10 in order to help protect pool 98 from skimmer 10 . these pads soften the contact between skimmer 10 and the sides of pool 98 so that skimmer 10 does not scratch or damage pool 98 if skimmer 10 bumps into the sides of pool 98 . other combinations and configurations of pads are possible and can fall within the scope of the invention . for instance , different numbers ( more or less ) could be used , such as using only pads 104 and 106 . additional pads could be placed along the edge of skimmer 10 . a single , long pad could extend along the entire length of side 12 ( and a corresponding single pad could extend along the entire length of side 14 ). these pads can be made from a variety of materials , such as fabric , rubber , plastic , and foam , among other things , and can be attached through a variety of mechanical or chemical means , such as screws , velcro , or glue , among other things . in addition , brushes 56 and 58 could serve double duty , by acting both as cleaning devices and as pads to protect the pool . as with the prior embodiment , one of ordinary skill in the art would recognize that the components of this embodiment similarly could be made out of different materials or combinations of materials , made in different dimensions , connected in different manners , or be placed in different configurations and still fall within the scope of the invention . the skimmer could be made in larger or smaller sizes depending on the needs of the user and the size of the pool being cleaned . additionally , features from the various embodiments could by combined or varied and still fall within the scope of the invention . in order to operate skimmer 10 , an operator attaches pole 38 to skimmer 10 via control attachment point 34 and coupling point 36 , as shown in fig9 . skimmer 10 is then placed in the water ( or , alternatively , the attachment occurs while skimmer 10 is already in the water ). because of the fin - shaped nature of floatation devices 22 and 24 and the coupling of pole 36 towards the front of skimmer 10 , as the operator moves pole 38 , skimmer 10 will readily follow the end of pole 38 . this design allows the operator to readily move skimmer 10 across surface 96 of pool 98 in order to collect debris in net 26 . skimmer 10 will sharply turn in response to the movement of pole 38 due to the change in tension on rope 32 . occasionally , debris will be floating just below surface 96 of the water . because rope 32 is closely connected to the end of pole 38 and the front of skimmer 10 , the operator can plunge the end of pole 38 under surface 96 of the water and skimmer 10 will follow , as shown in fig1 and 11 . this allows the operator to lower the entrance of the skimmer to below the debris floating under surface 96 and then direct the skimmer back up and out of the water to capture the debris in net 26 . the buoyancy of floatation members 22 and 24 ( among other things ) causes skimmer 10 to float back to the surface 96 of the water once pole 38 is raised . with some practice , an operator can precisely control skimmer 10 , including just partially submerging the front of skimmer 10 ( fig1 ) or completely submerging skimmer 10 ( fig1 ). in addition , the operator can pull skimmer 10 backwards along surface 96 of the water 98 without lifting skimmer 10 in order to move skimmer 10 to wherever the operator desires . the high maneuverability of skimmer 10 provides a significant advantage over other prior - art devices , which cannot be as easily moved along the water , moved below the water , and transitioned between the surface of the water and below the water . experiments with embodiments of skimmer 10 have shown that there is an optimal range of balance between the buoyancy of front end 92 of skimmer 10 ( meaning the forward part of skimmer 10 before cord attachment points 28 and 30 ) in relation to back end 94 of skimmer 10 ( meaning the backward part of skimmer 10 after cord attachment points 28 and 30 ). in some embodiments , front end 92 of skimmer 10 is almost neutrally buoyant , meaning that only a small amount of force is needed to submerge front end 92 of skimmer 10 below water line 96 , whereas back end 94 of skimmer 10 is more buoyant and is more difficult to submerge . in this configuration , the operator can easily submerge front end 92 of skimmer 10 below water line 96 by pushing pole 38 below the water line . as shown in fig1 , this allows the operator to collect debris that is floating just below surface 96 with minimal effort , while back end 94 of skimmer 10 ( and thus the back end of net 26 and / or secondary screening mechanism 48 ) remains above water line 96 so that the debris does not flow out of skimmer 10 . the exact buoyancy balance required depends on the precise configuration , size , and materials used in skimmer 10 . in other embodiments , the buoyancy of skimmer 10 can be such that the front end of skimmer 10 is still less buoyant than back end 94 of skimmer 10 , but the overall buoyancy of skimmer 10 is such that the entire skimmer 10 can be easily submerged under water line 96 when the operator pushes pole 38 below the water line , as shown in fig1 . in this configuration , the higher buoyancy of back end 94 of skimmer 10 maintains back end 94 in a more upright position , helps contain the debris in net 26 , and facilitates the maneuverability of skimmer 10 under the water . this configuration is more desirable for circumstances in which debris may be present further below the water line than can be reached when just back end 94 of skimmer 10 remains above water . in general , it is desirable to have the buoyancy of front end 92 be less than the buoyancy of back end 94 so that back end 94 will be preferentially inclined to remain closer to water line 96 than front end 92 when skimmer 10 is in operation ( especially when it is used below the surface of the water ). the front - back buoyancy balance of skimmer 10 can be adjusted in a variety of ways . for example , material could be added or removed from the front and back ends , more or less dense materials could be used in the front and back ends , the location of cord attachment points 28 and 30 could be shifted forwards or backwards in skimmer 10 , or the configuration of the components of skimmer 10 could be adjusted , among other things . in these disclosed embodiments , the length of rope 32 is less the twice the separation distance between side panels 12 and 14 in order to facilitate the movement of skimmer 10 , although the precise length could be different . if rope 32 is too long , it is more difficult to control skimmer 10 , and it requires greater movement of pole 38 in order to turn skimmer 10 or to cause it to descend under the water . the length of rope 32 could be between one and three times the separation distance between side panels 12 and 14 for optimal operations , although the shorter end of the range has been found to be more desirable in most circumstances . in yet another embodiment of the invention , shown in fig1 - 13 , skimmer 10 can be attached to side 70 of pool 98 by attaching it to bracket 60 . in one embodiment shown in fig1 , bracket 60 attaches to skimmer 10 via coupling point 62 and control attachment point 34 . coupling point 62 can take a variety of forms , such as an eyelet , loop , hook , carabiner , string , chain , and rope , among other things . alternatively , as shown in fig1 , bracket 60 can be attached to skimmer 10 via attachment members 100 and 102 ( in one example , rope ) that tie to the top of skimmer 10 . for example , one end of rope 100 can be tied to the top of the front end 84 of side piece 12 , which then loops up to and through bracket 60 , and then the other end of rope 100 can be tied to the top of the back end 86 of side piece 12 ( and the same is true for rope 102 and side 14 ). other types of attachment members are also possible , including , for example , ( 1 ) using four ropes that attach to sides 12 and 14 and bracket 60 , ( 2 ) using rigid members ( e . g ., wooden , metal , or plastic shafts or rods , among other things ) that connect into or are fixed to side pieces 12 and 14 , or ( 3 ) using rigid members that are integral with side pieces 12 and 14 , among other things . other materials besides rope could also be used , such as chain , cord , string , or wire , among other things . thus , attachment members 100 and 102 can be comprised of a variety of flexible or rigid connectors or combination of these flexible or rigid connectors in order to connect skimmer 10 to bracket 60 . as shown in fig1 , bracket 60 can be either permanently fixed to side 70 of pool 98 or can be temporarily attached / fixed to pool 98 via a clamp , slot , hole , bolt , mounting panel , or other types of attachment mechanisms . as shown in fig1 and 14 , bracket 60 could even be attached to or part of a heavily weighted object or stand 76 that rests on the surface 78 of a pool deck or the ground next to the pool or attached to or part of a long stake , post , or pole 80 that is sunk into or affixed to the ground 82 beside pool 98 . bracket 60 could be integral with post 80 , such as being a part of a curved or l - shaped post with coupling point 62 at its one end , or a piece separate from ( but connected to ) stand 76 or post 80 . bracket 60 can take on a variety of forms and be fixed in a variety of other manners such that it can support and restrain the movement skimmer 10 and still fall within the scope of the invention . by fixing skimmer 10 to bracket 60 , the pool can be cleaned without operator intervention . as debris floats into skimmer 10 , the debris will be caught in skimmer 10 to be removed later by an operator or individual . skimmer 10 can also be designed such that it can function on the end of pole 38 or be removed and connected to bracket 60 . this versatility is advantageous because an operator can use skimmer 10 to manually clean a pool and then , when finished , connect skimmer 10 to bracket 60 to continue cleaning the pool while the operator is away instead of having to purchase two separate skimming devices . in still another embodiment of the invention , as shown in fig4 , 5 , and 12 , sinker bar 64 can be attached to the front of skimmer 10 and is generally parallel to front cross piece 16 . sinker bar 64 is especially useful for embodiments that are fixed to or beside the side of the pool . as water flows past sinker bar 64 , it creates resistance in the water that effectively reduces the buoyancy of front end 92 and causes front end 92 to dip down into the water , which facilitates the debris being captured by effectively by skimmer 10 . in this circumstance , front end 92 of skimmer 10 would be below the water , while back end 94 of skimmer 10 would remain above water . as the water stops flowing past sinker bar 64 , front end 92 of skimmer 10 would rise back up above water line 96 . debris that floats into skimmer 10 would then be trapped . sinker bar 64 can be made of a variety of materials that are denser than water . sinker bar 64 should be designed in such a way so as to sink front end 92 of skimmer 10 below surface 96 of the water when water flows past skimmer 10 / sinker bar 64 , but not be so heavy that it will cause skimmer 10 to sink or the front of skimmer 10 to remain below the water when there is no water flowing past skimmer 10 / sinker bar 64 . the precise density / weight required will depend on the weight , size , and configuration of skimmer 10 and sinker bar 64 , among other things . in one embodiment , sinker bar 64 is made of a 20 ″ long × 1 ″ diameter hollow pvc rod that is attached to front cross piece 16 via cords 66 and 68 that tie to two sides of front cross piece 16 and two ends of sinker bar 64 . other materials , dimensions , and attachment mechanisms can be used and fall within the scope of the invention . for instance , sinker bar 64 could be attached to front cross piece 16 by rope , chain , or wire that passes through the middle of sinker bar 64 . sinker bar 64 could also be attached to other parts of skimmer 10 , such as the front ends of side panels 12 and 14 . instead of being tied to front cross piece 16 , sinker bar 64 could be attached by screws , bolts , slots , snaps , velcro , or latches , among other things . sinker bar 64 could also be made of other materials or combinations of materials , such as metal , rubber , or weighted or high - density plastic tubes , among other things . sinker bar 64 could be permanently attached to skimmer 10 , or it could be a removable attachment . for example , sinker bar 64 could be attached to side panels 12 and 14 ( or front cross piece 16 ) using spring - loaded clips , rope that can be untied , snaps , velcro , or other types of removable securing mechanisms . the foregoing description has been presented for purposes of illustration and description , and is not intended to be exhaustive or to limit the invention to the precise form disclosed . the descriptions were selected to explain the principles of the invention and their practical application to enable others skilled in the art to utilize the invention in various embodiments and various modifications as are suited to the particular use contemplated . although particular constructions of the present invention have been shown and described , other alternative constructions will be apparent to those skilled in the art and are within the intended scope of the present invention . | 4 |
the present invention is now described in more detail in conjunction with preferred embodiments which are illustrated in fig1 - 22 . turning to fig1 - 18 , examples of screen displays that may be presented in certain embodiments of the present invention are illustrated . fig1 illustrates an “ input fra switch deal ” window 100 . in this window , a party can enter information regarding an fra switch that the party desires to buy or sell . as can be seen , this information may include an identifier 102 , a customer name 104 , whether the party wants to buy or sell 106 , one or more near dates 108 , one or more far dates 110 , a currency 112 , an amount 114 , a price convention 116 , whether the price is based on points per day or total points 118 , whether to use a default price 120 , buy and sell prices 122 if a default price is not to be used , the status 124 of the fra for matching ( i . e ., whether it is available to be matched ( live ), no longer available to be matched ( pending ), or being removed from the matching system ( deleted )), and any comments 126 . also within window 100 , a party can use buttons 128 to reset or clear window 100 , present a list of fra switch identifiers for switches entered into the matching system , insert the display switch as a new switch , modify an entered switch with changes made in window 100 , delete the displayed switch , or import switch information from another application or a file . to get switch information for a particular switch , a party can search for the switch by entering a switch &# 39 ; s identifier in find field 130 . once found , the switch &# 39 ; s information will be displayed in window 100 . the party can also enter limits for the matching process , enter filters and settings that modify how the matches are generated and displayed , initiate the matching process , view switches entered in the system , and generate switch match reports using a “ generate fra switches list ” window 132 that is also shown in fig1 . limits may include a range of match dates 134 , a limit on the number of ways matches are formed 136 , and whether to allow the same party to participate in a match twice ( yes ), prohibit the same party from participating in a match twice ( no ), or prohibit the same party from having matching buy and sell dates in a match ( mod ) 138 . filters include a tolerance on the match price 140 , whether a minimum amount per matching transaction is required 142 , whether to exclude certain counter - parties 144 , whether to include only certain counter - parties 146 , whether certain other rules 148 apply ( such as whether to rank matches based upon which matches would transact the maximum amount ( maximum amount rule ), which matches involve the maximum number of customers ( a maximum fills rule ), which matches give the best price matching ( a minimum spreads rule ), and which matches give the largest commission ), and whether to solve potential matches 150 by looking for fras that can be created to enable one or more matches to occur or that can be created to form a match that will provide a benefit that wouldn &# 39 ; t have otherwise existed . the default buy and sell prices for those switches that are designated as using default pricing using entry 120 may be entered by the operator in field 152 . matching may be initiated by pressing button 154 . a list of switches and the corresponding switch information , such as that displayed in fig5 , may be displayed by pressing button 156 . finally , a report of switch matches , such as that in fig6 , may be generated by pressing button 158 . another illustration of these windows is shown in fig3 . although not shown in fig1 , the present invention may also enable a party to specify whether the execution of any proposed matches containing one or more switches is conditional upon the simultaneous , prior , or subsequent execution of proposed matches containing one or more other switches . for example , a party may only be willing to execute matches when at least five of a set of ten switches that that party would like to match are in fact matched . in such a case , when given the option to execute matches , a user of the present invention may be required to indicate that that user would like to execute matches containing all of the required switches before any of matches containing those switches is executed . also , although a particular set of matching limits , filters , and settings are shown , the present invention may be implemented with any suitable additional or alternative limits , filters , and / or settings . fig4 shows a partial view of a display of switches entered into one embodiment of the present invention . as can be seen , a summary 400 of the fra switch information that was entered into window 100 of fig3 is displayed . also , displayed is an indication of the day count 402 for each price convention given the appropriate holidays , etc ., and a total price 404 given the day count 402 and price 122 for the switch ( fig3 ). as shown in fig2 , an “ input fra customer info ” window 200 is illustrated . the information entered in this window may include a customer identifier 202 , a full customer name 204 , an abbreviated customer name 206 , a minimum amount of currency per transaction 208 , a list of excluded counter - parties 210 and 212 , a status for the customer 214 ( active or suspended ), a customer contact 216 , a customer phone number 218 , and any comments 220 . using buttons 222 , a party may reset or clear the information displayed in window 200 , enter the information in window 200 as a new customer , modify an existing customer with the information displayed in window 200 , delete the customer corresponding to the displayed information , or view a list of customer identifiers . to retrieve a customer &# 39 ; s information , a party may enter the customer &# 39 ; s identifier in field 202 and press the “ find ” hypertext 224 . to return to the display of fig1 , a party may press “ go to switch match ” hypertext 226 . fig5 shows a more complete view 500 of the display of switches entered into the embodiment of the present invention that is illustrated in fig4 . as shown , four switches 502 , 504 , 506 , and 508 have been entered . by pressing “ match ” hypertext 510 , a party can initiate matching on the four switches in the system . the party can also delete one or more switches by selecting the switch in column 518 and pressing “ delete ” hypertext 512 . the party can sort the list based upon the characteristic in any of the columns displayed by pressing the corresponding column heading hypertext 516 . advanced sorting that may involve sorting by the characteristics of multiple columns may be effected by pressing the “ advanced sort ” hypertext 514 . as shown by the arrows 520 displayed in fig5 , when matching is performed on switches 502 , 504 , and 506 , these switches will form a transaction match . this fact is more clearly shown in fig6 . as illustrated , these switches form match “ m01 ” as indicated in fields 602 , 604 , 606 , and 608 . column 610 indicates that the switches in match “ m01 ” have a net price differential of zero because the combined two buy prices 612 and 614 match the sell price 616 . also shown in fig6 is the fact that switch 618 cannot be matched with any other of the switches entered into the matching system . fig6 further illustrates that after a match has been transacted , the present invention may confirm the transaction as shown in portion 620 . fig7 illustrates a larger list 702 of fra switches to be matched than that shown in fig5 . here the switches indicated by arrows 704 , i . e ., switches 706 , 708 , and 710 , form a matched set . as can be seen more easily in fig8 , these switches correspond as to their near and far dates and form a match “ m01 ”. as indicated in field 802 , this match represents an inverted market because the buyer ( switch id . 000235 ) is willing to pay more ( 160 ) than the total that the sellers ( switch ids . 000533 and 000550 ) are asking for ( 144 ). when there is such an inverted market , the present invention may provide the buyer with the benefit ( i . e ., give the buyer a price of 144 ), provide the sellers with the benefit ( i . e ., give the sellers a total price of 160 ), or split the price difference between the buyer and sellers using any suitable method ( e . g ., split the price difference evenly at 152 ). the present invention may alternatively use the value in the price difference to enable another switch to be added to the match ( e . g ., by extending the near or far date on one or more of the switches to allow other switches to participate in the match ). as should be clear from the previous example , the present invention preferably does not require that the total buy and sell prices for the switches to match in order for a match to be formed . nevertheless , the present invention could be implemented so that price matching , or matching of any other characteristic of the items , is required . fig9 shows that a new fra switch entry has the same parameters except for price as that in switch id . 000235 shown in fig8 . in this case , the present invention may determine which fra switch takes priority when trying to match these switches with other switches in the matching system . as shown in portion 1002 of fig1 , the present invention may select switch id . 000235 because the switch has a higher buy price ( i . e ., the buyer is willing to pay more money ). as shown in portion 1004 of fig1 , the present invention may also simply list all of the transaction matches and allow the user to select the desired match . as yet another possibility , the invention may base preference in selecting switches on order of entry . fig1 shows yet another match list that could be analyzed by the present invention . as shown in fig1 , a variety of transaction matches 1202 , 1204 , 1206 , 1208 , and 1210 ( m 01 - m 05 ) can be constructed from this list . also shown in column 1212 of fig1 are the other matches in which each particular switch indicated in the corresponding row would be used , and thus which matches are mutually exclusive . turning to fig1 , it can be seen that for each of the switches with near and far date pairs shown , the number of “ fixing days ” or day count for the fra switches are calculated as 3 , 2 , and 1 ( see column “ dc ” 1302 to see that each switch is an “ f ” type date convention and column “ s / f / b / a ” 1304 to see that each day count is 3 , 2 , and 1 for “ f ”) for switches 1308 , 1310 , and 1312 , respectively . in these fra switches , because the price is set based upon points per day a per day amount of 8 points , the total price is calculated as 24 , 16 , and 8 points , respectively , as shown in column 1306 . similarly , in fig1 , settlement days are used in the date convention shown in the “ dc ” column 1402 , and accordingly 6 , 4 , and 2 settlement days for each of switches 1408 , 1410 , and 1412 are determined as being applicable as shown in column 1404 . based on these numbers of settlement days , and the price being set at 8 points per settlement day , the switches have prices of 48 , 32 , and 16 points , respectively , as shown in column 1406 . although the date convention for a matched set can be uniform as shown in fig1 and 14 , the date conventions can also be entered in mixed formats and the present invention will calculate the corresponding prices and forms matches as shown in fig1 . turning to fig1 , a switch with a default price entry selection is shown . more particularly , the switch is designated as using the default system price by having a check in box 120 of fig1 . when matching is performed on this switch , the present invention preferably will retrieve the appropriate price ( in this example , the buy price ) from the default buy and sell prices entered in fields 152 . in this way , many switches that all use a default price could be entered into a matching system in accordance with the present invention , and the market price can be easily submitted at the time of matching without having to manually adjust the price for each switch . as shown in column 1702 of fig1 , when multiple switches are displayed , each switch could be indicated as using the default price or not . in this case , an asterisk is present next to each price that is calculated using the default price . once a party has viewed the various transaction matches generated by the present invention , the party could elect to transact a transaction match by clicking on the match id . hypertext 1502 shown in fig1 . alternatively , qualifying matches could automatically be transacted by the present invention without requiring party intervention . after a match has been transacted , the customers involved in the transaction may be automatically notified using any suitable mechanism , such as email . also after the match has been transacted , the invention may present a display 1800 such as that shown in fig1 . as illustrated , the matched switches in the match ( switches 1802 and 1804 ) and a transaction date and time 1806 may be shown . a field 1808 may also be available to document notes relating to the transaction . the party may further be given an opportunity to reverse the transaction by selecting “ unmatch ” hypertext 1810 . as is evident from the illustrations above , with certain types of items , such as ndfss and fras , the present invention can “ break up ” the legs associated with the items , and then match those legs in any way . for example , with an fra where a party is obligated to deliver currency on a near date and then is entitled to receive currency on a far date , and that party wants to sell the obligations and entitlements under that fra , the present invention can separate the obligation to deliver currency from the entitlement to receive currency . in such a case , for the obligation leg , the present invention may simply look for a corresponding leg in another item where a potential counter - party wants an obligation to deliver currency . and , for the entitlement leg , the present invention may simply look for a corresponding leg in the other item , or in yet another item , where the potential counter - party , or any other party , wants an entitlement to receive currency . one embodiment of a process 1900 that could be used to perform the functions illustrated in fig1 - 18 is shown in fig1 . as can be seen , once process 1900 begins at step 1902 , the process displays a main menu at step 1904 . this main menu may include options to input a switch , input customer information , and initiate a matching process . at step 1906 , process 1900 determines if any of these options have been selected , and if so , process 1900 branches accordingly . if the option to input a switch is selected , the process branches to step 1908 where switch entry prompts and matching setting prompts may be displayed . fig1 illustrates an example of a screen that may be displayed at this point in process 1900 . next , process 1900 receives inputs at step 1910 . these inputs may include responses to any of the prompts previously displayed at step 1908 . at step 1912 , the process determines whether matching has been selected , and , if so , process 1900 branches to step 1924 to perform the matching process . if matching has not been selected , however , process 1900 performs any other functions that may have been selected at step 1914 . these other functions may include finding a particular switch , resetting or clearing the prompts , listing entered switches , inserting a new switch , modifying an entered switch , deleting an entered switch , importing a switch , viewing the entered switches , or generating a report of the switches and / or matches . once any functions may have been performed , process 1900 determines at step 1916 whether to return to the main menu or continuing receiving switch entries and match settings . if it is determined at step 1916 that the main menu is to be displayed , process 1900 branches back to step 1904 . otherwise process 1900 branches to step 1908 . if the option to input customer information is determined to have been selected at step 1906 , process 1900 branches to step 1918 where customer information entry prompts may be displayed as illustrated in fig2 , for example . next , at step 1919 , process 1900 receives inputs in response to the prompts displayed in step 1918 . once these inputs have been received , any functions selected in response to these prompts may be performed at step 1920 . such functions may include resetting or clearing the prompts displayed in step 1918 , inserting new customer information , modifying existing customer information , deleting existing customer information , viewing a list of entered pieces of customer information , and finding a particular customer &# 39 ; s or set of customers &# 39 ; information . once this function has been performed , process 1900 determines whether to return to the main menu at step 1922 . if it is determined at step 1922 that the main menu is to be displayed , process 1900 branches back to step 1904 . otherwise process 1900 branches to step 1918 . finally , if the option to initiate the matching process is determined to have been selected at step 1906 , process 1900 may branch to step 1924 where the matching process may be performed as discussed above in connection with fig1 - 18 . an example of a process for matching and for proposing items to complete matches ( i . e ., a solver ) is shown in fig2 . once the matching process has been completed , the match results may be displayed at step 1926 as illustrated in fig6 , 8 , 10 , and 12 - 15 . after the match results have been displayed , process 1900 may execute one or more of the transaction matches at step 1928 . as is stated above , execution may be manually or automatically initiated . once the matches have been executed , process 1900 may then confirm at step 1930 the transactions as shown in fig1 . this confirmation may include notifying the party running the matching process and / or the customers to the transaction . finally , after the transactions have been confirmed , process 1900 may loop back to the main menu at step 1904 . turning to fig2 , a process 2000 for matching and for proposing items to complete matches ( i . e ., a solver ) is shown . as illustrated , at step 2002 items with specific traits and parameters are entered into the matching process . in the case of the items being switches as discussed above , these switches may be entered as shown in fig1 , the traits may be near and far dates , and the parameters may be buy / sell intentions for the switches . next at step 2004 , the items are put into a table that is indexed by the traits and parameters . such a table may be implemented in an sql database . next at steps 2006 and 2008 , the items are grouped by like items into one or more other tables . like items include items that may be exchanged for each other . for example , in the case of switches as illustrated above , like items may include switches for corresponding currencies . these steps are preferably performed to speed the subsequent matching process . an illustration of a table 2100 that may be generated through the processing of steps 2004 and 2006 is shown in fig2 . as can be seen , table 2100 includes trait and parameter information for eight switches 2101 - 2108 . for each of switches 2101 - 2108 , a buy / sell intention parameter (“ buy ” or “ sell ”), a near date trait (“ n ”) and a far date trait (“ f ”) are indicated . as illustrated , the dates are numbered 1 - 10 . this choice of date designation is merely for purpose of illustration and any suitable date designation scheme may be implemented in accordance with the present invention . also shown is a proposed switch 2110 that may be used to complete a match of some of the switches shown in table 2100 . referring back to fig2 , process 2000 next searches through the items in each table for items that have matching traits but with opposite interest at step 2010 . in the case of switches 2101 - 2108 illustrated in fig2 , this would involve searching through the switches for switches with a matching date designation but an opposite buy / sell intention . more particularly , for example , switch 2101 might be matched with switch 2103 because they have corresponding date traits and opposite buy / sell intentions . when matching first starts , a first item will be selected . that first item will then be compared to subsequent items with a matching trait and opposite interest . for example , switch 2101 would be compared to switches 2103 and 2108 because their near dates match and their buy / sell intentions are opposite . for the comparisons made , the matching process then looks for other items that can close the match . for example , with switches 2101 and 2108 , the process would then look for one or more switches to close the far dates on each . in performing steps 2004 , 2006 and 2008 , and 2010 , process 2000 may apply limits to the items processed at any of these steps to keep processing to a desired level . as shown with limits 134 , 136 , and 138 of fig1 , such limits may include a range of match dates , a limit on the number of ways matches are generated , and whether to allow same customer matches . for example , when performing step 2004 , process 2000 may only put only switches withing a range of match dates into the initial table . alternatively , process 2000 may only apply the range of match dates in subsequent steps . next at step 2012 , process 2000 then determines for each proposed match whether the match was closed . if so , then at step 2014 an indexed match table is created for the match . this match table may then be available for viewing as shown in fig6 or processing in order to execute the match transaction . however , if a match is determined to not be closed at step 2012 , then process 2000 proceeds to step 2016 to look for possible solutions to the match . this part of the process 2000 implements one embodiment of the “ solver ” function of the present invention . as shown , at step 2016 , process 2000 puts the open match items in an “ open ” traits table . next at step 2018 , the process proposes one or more items to close the match . these items will have traits that match other items in the match that previously only had one trait matched . then process 2000 determines one or more attributes of the proposed item that will make the match desirable at step 2020 . in order to be desirable , these attributes should make the match better in at least one regard than another proposed match or a closed match stored in a match table at step 2014 . finally , at step 2022 , process 2000 presents one or more proposed matches to a user who can then decide whether or not to create one of the corresponding items in order to close the open match . each of the proposed matches may be indicated as having a quality that makes that match different from another match ( e . g ., such as having a higher or lower commission ). an example of the processing of the “ solver ” portion of the matching process is illustrated in fig2 . referring to switches 2106 - 2108 , it can be seen that the near dates for switches 2106 and 2108 match and the far dates for switches 2107 and 2108 match . the far date of switch 2106 and the near date of switch 2107 , however , are open . in order to complete the match , process 2000 may propose creating a switch 2110 to sell with a near date that matches the far date of switch 2106 and a far date that matches the near date of switch 2107 . in this way , proposed switch 2110 could be used to complete the match . alternatively or additionally to proposing switches that could be used to close a match , the present invention may determine the best available existing switch that could be used to close the match as much as possible . for example , the invention may find an existing switch that has a near date that matches an open far date and a far date that is only one day off from an open near date . once matches are formed , the present invention may apply filters to the matches . as explained in connection with fig1 , these filters may include requiring a tolerance on the match price , a minimum amount per matching transaction , an exclusion of certain counter - parties , an inclusion of only certain counter - parties , ranking matches based upon which matches would transact the maximum amount , ranking matches based upon which matches involve the maximum number of customers , ranking matches that give the best price matching , and ranking matches based upon which matches give the largest or smallest commission or markup or markdown . as will be evident to one of ordinary skill in the art , the present invention can be implemented on a wide variety of computer systems and networks . in one embodiment , the present invention could be implemented on a single computer or processor , wherein all of the data entry , processing , and display is done on the single computer or processor . in other embodiments , the present invention could be implemented on two or more computers communicating over one or more computer networks . these networks could be local area networks , wide area networks , the internet , or any other suitable network . in such embodiments , the processing may be performed by a server or processor on the network and the data entry and display may be performed by computers and / or browsers connected to the network and in communication with the server or processor . one example of a system 2200 for implementing the present invention is shown in fig2 . as illustrated , system 2200 may include a server 2202 that is connected by a communication link 2204 to the internet 2206 and / or that is connected by a communication link 2212 to an intranet 2214 . when implemented with the internet 2206 , one or more web browsers 2208 may be coupled to server 2204 through the internet and communication links 2210 . when implemented with an intranet 2214 , one or more web browsers 2216 may be coupled to server 2204 through the intranet and communication links 2218 . in system 2200 , server 2202 may be any suitable server , processor , computer , or data processing device , or combination of the same . internet 2206 and intranet 2214 may be any suitable computer networks and may include any suitable computer network equipment . web browsers 2208 and 2216 may be any suitable web browsers or display terminals , and may implemented as software running on general purpose computers , as dedicated hardware , or in any suitable manner . finally , communication links 2204 , 2210 , 2212 , and 2218 may be any suitable mechanisms for coupling server 2202 to internet 2204 , intranet 2214 , and / or web browsers 2208 and 2216 . these mechanisms may include dial - up connections , dedicated connections , cable modems , digital subscriber lines , t1 connections , t3 connections , etc . it will be understood that the foregoing is only illustrative of the principles of the invention and that various modifications can be made by those skilled in the art without departing from the scope and spirit of the invention , which is limited only by the claims that follow . | 6 |
referring to fig2 an illustrative form of the invention employs a grid 10 of imaginary reference points arrayed over a line art image . the spacing between points is 250 μm in the illustrated arrangement , but greater or lesser spacings can of course be used . associated with each grid point is a surrounding region 12 , shown in fig3 . as described below , the luminosity ( or reflectance ) of each of these regions 12 is slightly changed to effect the subliminal encoding of binary data . region 12 can take various shapes ; the illustrated rounded - rectangular shape is representative only . ( the illustrated shape has the advantage of encompassing a fairly large area while introducing fewer visual artifacts than , e . g ., square regions .) in other embodiments , squares , rectangles , circles , ellipses , etc ., can alternatively be employed . [ 0033 ] fig4 is a magnified view of an excerpt of fig3 showing a line 14 passing through the grid of points . the width of the line , of course , depends on the particular image of which it is a part . the illustrated line is about 25 μm in width ; greater or lesser widths can naturally be used . in a first embodiment of the invention , shown in fig5 the width of the line is controllably varied so as to change the luminosity of the regions through which it passes . to increase the luminosity ( or reflectance ), the line is made narrower ( i . e . less ink in the region ). to decrease the luminosity , the line is made wider ( i . e . more ink ). whether the luminance in a given region should be increased or decreased depends on the particular watermarking algorithm used . any algorithm can be used , by changing the luminosity of regions 12 as the algorithm would otherwise change the luminance or colors of pixels in a pixelated image . in an exemplary algorithm , the binary data is represented as a sequence of − 1s and 1s , instead of 0s and 1s . ( the binary data can comprise a single datum , but more typically comprises several . in an illustrative embodiment , the data comprises 100 bits .) each element of the binary data sequence is then multiplied by a corresponding element of a pseudo - random number sequence , comprised of − 1s and 1s , to yield an intermediate data signal . each element of this intermediate data signal is mapped to a corresponding sub - part of the image , such as a region 12 . the image in ( and optionally around ) this region is analyzed to determine its relative capability to conceal embedded &# 39 ; data , and a corresponding scale factor is produced . exemplary scale factors may range from 0 to 3 . the scale factor for the region is then multiplied by the element of the intermediate data signal mapped to the region in order to yield a “ tweak ” value for the region . in the illustrated case , the resulting tweaks can range from − 3 to 3 . the luminosity of the region is then adjusted in accordance with the tweak value . a tweak value of − 3 may correspond to a − 5 % change in luminosity ; − 2 may correspond to − 2 % change ; − 1 may correspond to − 1 % change ; 0 may correspond to no change ; 1 may correspond to + 1 % change ; 2 may correspond to + 2 % change , and 3 may correspond to + 5 % change . ( this example follows the basic techniques described in the real time encoder embodiment disclosed in u . s . pat . no . 5 , 710 , 834 .) in fig5 the watermarking algorithm determined that the luminance of region a should be reduced by a certain percentage , while the luminance of regions c and d should be increased by certain percentages . in region a , the luminance is reduced by increasing the line width . in region d , the luminance is increased by reducing the line width ; similarly in region c ( but to a lesser extent ). no line passes through region b , so there is no opportunity to change the region &# 39 ; s luminance . this is not fatal to the method , however , since the watermarking algorithm redundantly encodes each bit of data in sub - parts spaced throughout the line art image . the changes to line widths in regions a and d of fig5 are exaggerated for purposes of illustration . while the illustrated variance is possible , most implementations will modulate the line width 3 - 50 % ( increase or decrease ). ( many watermarking algorithms routinely operate within a signal margin of about +/− 1 % changes in luminosity to effect encoding . that is , the “ noise ” added by the encoding amounts to just 1 % or so of the underlying signal . lines typically don &# 39 ; t occupy the full area of a region , so a 10 % change to line width may only effect a 1 % change to region luminosity , etc . banknotes are different from photographs in that the art need not convey photorealism . thus , banknotes can be encoded with higher energy than is used in watermarking photographs , provided the result is still aesthetically satisfactory . to illustrate , localized luminance changes on the order of 10 % are possible in banknotes , while such a level of watermark energy in photographs would generally be considered unacceptable . in some contexts , localized luminance changes of 20 , 30 , 50 or even 100 % are acceptable .) in the illustrated embodiment , the change to line width is a function solely of the tweak to be applied to a single region . thus , if a line passes through any part of a region to which a tweak of 2 % is to be applied , the line width in that region is changed to effect the 2 % luminance difference . in variant embodiments , the change in line width is a function of the line &# 39 ; s position in the region . in particular , the change in line width is a function of the distance between the region &# 39 ; s center grid point and the line &# 39 ; s closest approach to that point . if the line passes through the grid point , the full 2 % change is effected . at successively greater distances , successively less change is applied . the manner in which the magnitude of the tweak changes as a function of line position within the region can be determined by applying one of various interpolation algorithms , such as the bi - linear , bi - cubic , cubic splines , custom curve , etc . in other variant embodiments , the change in line width in a given region is a weighted function of the tweaks for adjoining or surrounding regions . thus , the line width in one region may be increased or decreased in accordance with a tweak value corresponding to one or more adjoining regions . in the foregoing embodiments , it is sometimes necessary to trade - off the tweak values of adjoining regions . for example , a line may pass along a border between regions , or pass through the point equidistant from four grid points (“ equidistant zones ”). in such cases , the line may be subject to conflicting tweak values — one region may want to increase the line width , while another may want to decrease the line width . ( or both may want to increase the line width , but differing amounts .) similarly in cases where the line does not pass through an equidistant zone , but the change in line width is a function of a neighborhood of regions whose tweaks are of different values . again , known interpolation functions can be employed to determine the weight to be given the tweak from each region in determining what change is to be made to the line width in any given region . in the exemplary watermarking algorithm , the average change in luminosity across the image is zero , so no generalized lightening or darkening of the image is apparent . the localized changes in luminosity are so minute in magnitude , and localized in position , that they are essentially invisible ( e . g . inconspicuous / subliminal ) to human viewers . an alternative embodiment is shown in fig6 in which line position is changed rather than line width . in fig6 the original position of the line is shown in dashed form , and the changed position of the line is shown in solid form . to decrease a region &# 39 ; s luminosity , the line is moved slightly closer to the center of the grid point ; to increase a region &# 39 ; s luminosity , the line is moved slightly away . thus , in region a , the line is moved towards the center grid point , while in region d it is moved away . it will be noted that the line on the left edge of region a does not return to its nominal ( dashed ) position as it exits the region . this is because the region to the left of region a also is to have decreased luminosity . where possible , it is generally preferable not to return a line to its nominal position , but instead permit shifted lines to remain shifted as they enter adjoining regions . so doing permits a greater net line movement within a region , increasing the embedded signal level . again , the line shifts in fig6 are somewhat exaggerated . more typical line shifts are on the order of 3 - 50 μm . one way to think of the fig6 embodiment is to employ a magnetism analogy . the grid point in the center of each region can be thought of as a magnet . it either attracts or repels lines . a tweak value of − 3 , for example , may correspond to a strong - valued attraction force ; a tweak value of + 2 may correspond to a middle - valued repulsion force , etc . in fig6 the grid point in region a exhibits an attraction force ( i . e . a negative tweak value ), and the grid point in region d exhibits a repulsion force ( e . g . a positive tweak value ). the magnetic analogy is useful because the magnetic effect exerted on a line depends on the distance between the line and the grid point . thus , a line passing near a grid point is shifted more in position than a line near the periphery of the region . each of the variants discussed above in connection with fig5 is likewise applicable to fig6 . combinations of the embodiments of fig5 and 6 can of course be used , resulting in increased watermark energy , better signal - to - noise ratio and , in many cases , less noticeable changes . in still a further embodiment , the luminance in each region is changed while leaving the line unchanged . this can be effected by sprinkling tiny dots of ink in the otherwise - vacant parts of the region . in high quality printing , of the type used with banknotes , droplets on the order of 3 μm in diameter can be deposited . ( still larger droplets are still beyond the perception threshold for most viewers .) speckling a region with such droplets ( either in a regular array , or random , or according to a desired profile such as gaussian ), can readily effect a 1 % or so change in luminosity . ( usually &# 39 ; dark droplets are added to a region , effecting a decrease in luminosity . increases in luminosity can be effected by speckling with a light colored ink , or by forming light voids in line art otherwise present in a region .) in a variant of the speckling technique , very thin mesh lines can be inserted in the artwork — again to slightly change the luminance of one or more regions . although not previously mentioned , it is contemplated that the banknote will include some manner of calibration information to facilitate registration of the image for decoding . this calibration information can be steganographic or overt . several techniques for steganographically embedding calibration information are disclosed in my prior patents and applications . other techniques can be found in others of the cited work . to decode watermark data , the encoded line art image must be converted into electronic form for analysis . this conversion is typically performed by a scanner . scanners are well known , so a detailed description is not provided here . suffice it to say that scanners conventionally employ a line of closely spaced photodetector cells that produce signals related to the amount of the light reflected from successive swaths of the image . most inexpensive consumer scanners have a resolution of 300 dots per inch ( dpi ), or a center to center spacing of component photodetectors of about 84 μm . higher quality scanners of the sort found in most professional imaging equipment and photocopiers have resolutions of 600 dpi ( 42 μm ), 1200 dpi ( 21 μm ), or better . taking the example of a 300 dpi scanner ( 84 μm photodetector spacing ), each 250 μm region 12 on the banknote will correspond to about 3 × 3 array of photodetector samples . naturally , only in rare instances will a given region be physically registered with the scanner so that nine photodetector samples capture the luminance in that region , and nothing else . more commonly , the line art is skewed with respect to the scanner photodetectors , or is longitudinally misaligned ( i . e . some photodetectors image sub - parts of two adjoining regions ). however , since the scanner oversamples the regions , the luminance of each region can unambiguously be determined . in one embodiment , the scanned data from the line art is collected in a two dimensional array and processed — according to one of the techniques disclosed in my prior patents and applications — to detect the embedded calibration information . the array is then processed to effect a virtual re - registration of the image data . a software program then analyzes the statistics of the re - registered data ( using the techniques disclosed in my prior writings ) to extract the bits of the embedded data . ( again , the reference to my earlier watermark decoding techniques is exemplary only . once scanning begins and the data is available in pixel form , it is straightforward to apply any other watermark decoding technique to extract a correspondingly - encoded watermark .) in a variant embodiment , the scanned data is not assembled in a complete array prior to the processing . instead , it is processed in real - time , as it is generated , in order to detect embedded watermark data without delay . ( depending on the parameters of the scanner , it may be necessary to scan a half - inch or so of the line art image before the statistics of the resulting data unambiguously indicate the presence of a watermark .) in accordance with another aspect of the invention , various hardware devices are provided with the capability to recognize embedded watermark data in any line art images they process , and to respond accordingly . one example is a color photocopier . such devices employ a color scanner to generate sampled ( pixel ) data corresponding to an input media ( e . g . a dollar bill ). if watermark data associated with a banknote is detected , the photocopier can take one or more steps . one option is simply to interrupt copying , and display a message reminding the operator that it is illegal to reproduce currency . another option is to dial a remote service and report the attempted reproduction of a banknote . photocopiers with dial - out capabilities are known in the art , ( e . g . u . s . pat . no . 5 , 305 , 199 ) and are readily adapted to this purpose . the remote service can be an independent service , or can be a government agency . yet another option is to permit the copying , but to insert forensic tracer data in the resultant copy . this tracer data can take various forms . steganographically encoded binary data is one example . an example is shown in u . s . pat . no . 5 , 568 , 268 . the tracer data can memorialize the serial number of the machine that made the copy and / or the date and time the copy was made . to address privacy concerns , such tracer data is not normally inserted in photocopied output , but is so inserted only when the subject being photocopied is detected as being a banknote . ( such an arrangement is shown in fig7 .) desirably , the scan data is analyzed on a line - by - line basis in order to identify illicit photocopying with a minimum of delay . if a banknote is scanned , one or more lines of scanner output data may be provided to the photocopier &# 39 ; s reprographic unit before the banknote detection decision has been made . in this case the photocopy will have two regions : a first region that is not tracer - marked , and a second , subsequent region in which the tracer data has been inserted . photocopiers with other means to detect not - to - be - copied documents are known in the art , and employ various response strategies . examples are detailed in u . s . pat . nos . 5 , 583 , 614 , 4 , 723 , 149 , 5 , 633 , 952 , 5 , 640 , 467 , and 5 , 424 , 807 . another hardware device that can employ the foregoing principles is a standalone scanner . a programmed processor ( or dedicated hardware ) inside the scanner analyzes the data being generated by the device , and responds accordingly . yet another hardware device that can employ the foregoing principles is a printer . a processor inside the device analyzes graphical image data to be printed , looking for watermarks associated with banknotes . for both the scanner and printer devices , response strategies can include disabling operation , or inserting tracer information . ( such devices typically do not have dial - out capabilities .) again , it is desirable to process the scanner or printer data as it becomes available , so as to detect any banknote processing with a minimum of delay . again , there will be some lag time before a detection decision is made . accordingly , the scanner or printer output will be comprised of two parts , one without the tracer data , and another with the tracer data . banknotes presently include various visible structures that can be used as aids in banknote detection ( e . g . the seal of the issuing central bank , and various geometrical markings ). in accordance with a further aspect of the present invention , a banknote is analyzed by an integrated system that considers both the visible structures and watermark - embedded data . visible banknote structures can be sensed using known pattern recognition techniques . examples of such techniques are disclosed in u . s . pat . nos . 5 , 321 , 773 , 5 , 390 , 259 , 5 , 533 , 144 , 5 , 539 , 841 , 5 , 583 , 614 , 5 , 633 , 952 , 4 , 723 , 149 and 5 , 424 , 807 and laid - open foreign application ep 766 , 449 . in photocopiers ( and the like ) equipped to detect both visible and watermarked banknote markings , the detection of either causes one or more of the above - noted banknote responses to be initiated . again , scanners and printers can be equipped with a similar capability — analyzing the data for either of these banknote hallmarks . if either is detected , the software ( or hardware ) responds accordingly . identification of banknotes by watermark data provides an important advantage over recognition by visible structures — it cannot so easily be defeated . a banknote can be doctored ( e . g . by white - out , scissors , or less crude techniques ) to remove / obliterate the visible structures . such a document can then be freely copied on either a visible structure - sensing photocopier or scanner / printer installation . the removed visible structure can then be added in via a second printing / photocopying operation . if the printer is not equipped with banknote - disabling capabilities , image - editing tools can be used to insert visible structures back into image data sets scanned from such doctored bills , and the complete bill freely printed . by additionally including embedded watermark data in the banknote , and sensing same , such ruses will not succeed . ( a similar ruse is to scan a banknote image on a non - banknote - sensing scanner . the resulting image set can then be edited by conventional image editing tools to remove / obliterate the visible structures . such a data set can then be printed — even on a printer / photocopier that examines such data for the presence of visible structures . again , the missing visible structures can be inserted by a subsequent printing / photocopying operation .) desirably , the visible structure detector and the watermark detector are integrated together as a single hardware and / or software tool . this arrangement provides various economies , e . g ., in interfacing with the scanner , manipulating pixel data sets for pattern recognition and watermark extraction , electronically re - registering the image to facilitate pattern recognition / watermark extraction , issuing control signals ( e . g . disabling ) signals to the photocopier / scanner , etc . ( to provide a comprehensive disclosure without unduly lengthening the following specification , applicants incorporate by reference the patent documents cited above .) from the foregoing , it will be recognized that embodiments according to the present invention allow line art images to serve as subliminal carriers for binary data . additionally , existing deterrents to banknote counterfeiting have been enhanced to prevent common work - arounds . having described and illustrated the principles of my invention with reference to several illustrative embodiments , it will be recognized that these embodiments are exemplary only and should not be taken as limiting the scope of my invention . guided by the foregoing teachings , it should be apparent that other watermarking , decoding , and anti - counterfeiting technologies can be substituted for , and / or combined with , the elements detailed above to yield similar effects . while the invention has been described with reference to embodiments employing regular rectangular arrays of grid points , those skilled in the art will recognize that other arrays of points — neither rectangular nor regular — can alternatively be used . while the invention has been described with reference to embodiments that scale the embedded energy in accordance with local image characteristics , in other embodiments a manually crafted energy profile can be implemented . that is , a mask defining embedded signal magnitudes at different parts of the image can be manually devised , and employed to tailor the change in luminance in each region . in view of the many possible embodiments to which the principles of the invention may be put , it should be recognized that the detailed embodiments are illustrative only and should not be taken as limiting the scope of my invention . rather , i claim as my invention all such embodiments as may come within the scope and spirit of the following claims and equivalents thereto . | 6 |
referring now to the discussion that follows and also to the drawings , illustrative approaches to the disclosed systems and methods are shown in detail . although the drawings represent some possible approaches , the drawings are not necessarily to scale and certain features may be exaggerated , removed , or partially sectioned to better illustrate and explain the present disclosure . further , the descriptions set forth herein are not intended to be exhaustive or otherwise limit or restrict the claims to the precise forms and configurations shown in the drawings and disclosed in the following detailed description . moreover , a number of constants may be introduced in the discussion that follows . in some cases illustrative values of the constants are provided . in other cases , no specific values are given . the values of the constants will depend on characteristics of the associated hardware and the interrelationship of such characteristics with one another as well as environmental conditions and the operational conditions associated with the disclosed system . what is disclosed is a hose coupling for securing a hose or tube to the coupling body using a hose nipple having at least one coupling barb . a retention spring is mounted on the hose coupling body to provide a hose coupling that is one piece prior to assembly of a hose or tube onto the hose coupling . the retention spring at partially covers the hose nipple and is retained on the body of the hose coupling at a first end and has a spring collar on a second end . the spring collar has a chamfer which contacts and presses against the hose at the hose hose nipple after the spring is first compressed for assembly of the hose onto the hose nipple and over the barb . the retention spring generates both an axial and a vertical force component on the hose which clamps it to the coupling barb . when the retention spring is compressed , the hose is pressed over the hose nipple and the coupling barb and against a hose stop formed in the hose hose nipple . then the retention spring is released and allowed to axially extend and force the spring collar against the hose at the coupling barb . this applies a clamping force on the hose thereby securing the hose to the coupling barb and to the hose hose nipple of the hose coupling . this clamping force is maintained as the hose thickness increases or decreases due to changes in the operating pressures . the exemplary hose coupling exhibits a radial compliance that allows for variance in the wall thickness of the hose or tube . the hose coupling also exhibits an axial compliance that allows for variance in the axial dimensions of the hose and the hose coupling when relatively high internal pressures create high tensile and axial stresses within the hose or tube wall that can result in strain induced stretching of the hose . the exemplary hose coupling has some axial compliance which automatically adjusts for the axial variations . the spring collar is shown as having a chamfer that contacts the hose when the hose is installed on the hose nipple and the retainer spring is released . the angle of the chamfer interacts with the geometry of the hose nipple barb and the geometry of the hose to determine the level of axial and vertical forces applied to the hose by the retention spring . these dimensions and specific geometry and the spring characteristics can be varied and selected depending on the specific application to provide the required clamping force of the hose on the hose coupling . now referring to fig1 of the drawings , a cross - section of an exemplary hose coupling 12 is shown . the hose coupling assembly 10 is comprised of a hose coupling 12 , a hose 22 and a retention spring 20 . note that the exemplary hose coupling 12 can be used to connect with a tube or a hose . for example , a single or multiple layer elastomeric or polymeric hose can be used for a polymeric tube or any combination of materials or layers can be used with the hose coupling as disclosed herein . the hose coupling 12 is made up of a coupling body 14 and a retention spring 20 . the hose nipple 16 extends from and is part of the coupling body and the hose nipple 16 includes a hose stop 18 formed therein . the hose stop 18 functions to prevent the hose 22 from being inserted past the location of the hose stop 18 by abutting the hose 22 . extending from the coupling body 14 is a cylindrical coupling collar 19 which provides a mounting surface and support for retention spring 20 which is attached to the coupling collar 19 at the spring base 36 . axially extending along the central axis 25 of the hose coupling 12 is passageway 24 which carries the fluid that is to be transported . to seal the hose coupling 12 to some other fluid device such as a pump , valve or other coupling ( not shown ) are seal grooves 26 that accommodate some type of sealing element such as an o - ring . typically , devices such as o - rings are positioned within the seal grooves 26 , one within each groove 26 to provide a secure sealing function so that the fluid being transported does not leak outside of the hose coupling 12 . extending from and as part of the hose nipple 16 is at least one hose barb 28 which can have a variety of shapes including that shown in fig1 . the hose barb 28 provides a surface on the hose nipple 16 that has an increased thickness for providing an area of increased sealing between the hose nipple 16 and the hose 22 ( see fig5 ). the barb 16 also provides a surface that interacts with the hose 22 to deflect it upward so that the spring collar 32 can apply both axial and vertical force components on the hose 22 to increase the sealing clamp force on the hose 22 against the hose nipple 16 . now referring to fig2 of the drawings , a plan view of the retention spring 20 is shown . the retention spring 20 as shown , is comprised of a triple helical spring 34 which is made up of a number of spring coils 34 a , 34 b , 34 c which are connected at their terminations by , at one end , the spring collar 32 and at the other end by a spring base 36 . the spring base 36 is mounted to the collar 19 on the coupling body 14 ( see fig1 ). the spring collar 32 has a spring chamfer 33 at its inner edge where the spring chamfer 33 contacts the hose 22 at the hose barb 28 to apply an axial and a vertical force components with a resulting clamping force on the hose 22 to the hose nipple 16 . example specifications for the retention spring 20 and the tubing 22 are as follows : the tubing is a 12 . 5 mm diameter having a 1 . 0 mm wall thickness and made out of nylon - 12 material . the spring rate of the retention spring 20 depends on the alloy used for the retention spring 20 but is in the range of 120 to 150 lbs / in if the retention spring 20 is made from 15 - 5 ph cres at condition 1025 or a 17 - 7 ph spring condition . the specifications for the hose coupling assembly calls for the retention spring 20 to be compressed by approximately 0 . 3 inches when it is released after assembly and is applying an axial and a compressive force to the hose 22 at the hose nipple barb 28 . this equates to a compressive force ( perpendicular to the axis of the coupling body 12 ) of 37 lbs to 50 lbs . note that a separate spring compression tool is required at assembly to compress the retention spring 20 a sufficient distance to allow the hose 22 to be inserted onto the hose hose nipple 16 under the retention spring 20 in its compressed state . the retention spring 20 provides a relatively constant clamping force on the hose 22 at higher pressures since as the axial load increases on the hose coupling assembly 10 due to mechanical forces and due to pressure of the fluid . the retention spring 20 increases its installed length to compensate for the reduction in wall thickness of the hose 22 due to stretching of the hose 22 and at very high pressures , the total hose coupling assembly 10 . the retention spring 20 is shown in fig2 as a three lead hybrid spring consisting of spring coils 34 a , 34 b and 34 c . the spring coils 34 a , 34 b and 34 c begin at the spring collar 32 and extend downwardly to the spring base 36 . the spring coils 34 a , 34 b and 34 c can be any type of known spring types such as a helical spring having some type of appropriate coil cross section such as round , rectangular , hexagonal or octagonal wire or a compression spring , a wave spring , a belleville spring washer or any other type of material or configuration as long as the force characteristics required for this application are satisfied and the teachings of this disclosure are followed . now referring to fig3 of the drawings , a perspective view of the retention spring 20 is shown . the retention spring 20 is comprised of a helical spring 34 which is made up of a number of spring coils 34 a , 34 b , 34 c which are connected at their terminations by , at one end , the spring collar 32 and at the other end by a spring base 36 . the retention spring 20 is shown in fig2 & amp ; 3 as a three lead hybrid spring consisting of spring coils 34 a , 34 b and 34 c . the spring coils 34 a , 34 b and 34 c begin at the spring collar 32 and extend downwardly to the spring base 36 . the spring coils 34 a , 34 b and 34 c can be any type of known spring types such as a helical spring having some type of appropriate coil cross section such as round , rectangular , hexagonal or octagonal wire or a compression spring , a wave spring , a belleville spring washer or any other type of material or configuration as long as the force characteristics required for this application are satisfied and the teachings of this disclosure are followed . now referring to fig4 of the drawings , the hose coupling 12 is shown with the retention spring 20 fully compressed to allow the tube or hose 22 to be installed . hose coupling 12 is comprised of a coupling body 14 which has a hose nipple 16 extending therefrom . the retention spring 20 is shown attached to the coupling body 14 at a coupling collar 19 by a spring base 36 formed at one end of the retention spring 20 . the hose coupling 12 includes the coupling body 14 where the coupling nipple 16 has a hose stop 18 formed therein . the hose stop 18 functions to prevent the hose 22 from being inserted past the location of the hose stop 18 by abutting the hose 22 . extending from the coupling body 14 is the cylindrical coupling collar 19 which serves as a mounting platform for the retention spring 20 at its spring base 36 . axially extending along a central axis 25 of the hose coupling assembly 10 is passageway 24 which carries the fluid that is to be transported . to seal the hose coupling 12 to some other fluid device such as a pump , valve or other coupling ( not shown ) are seal grooves 26 which carry some type of sealing device such as o - rings which are positioned within the seal grooves 26 , one within each groove 26 to provide a secure sealing function so that the fluid being transported does not leak outside of the hose coupling 12 . now referring to fig5 , a cross - section of the exemplary hose coupling 12 is shown having the hose 22 fully pushed onto the hose nipple 16 . to assemble the hose coupling assembly 10 , the retention spring 20 is compressed by some type of spring compression tool so that the spring collar 32 is pushed back past the hose nipple barb 28 far enough to provide clearance for the hose 22 to be pushed onto the coupling nipple 16 at the nose chamfer 30 , then over the hose nipple barb 28 and then up to the hose stop 18 . the hose 22 deforms and is shown as hose bump 23 to at least partially conform to the hose nipple barb 28 . as shown in fig6 , the retention spring 20 is then released and the retention spring 20 axially moves to contact the hose 22 at the hose bump 23 . there is a circumferential clamping force applied to the hose at the hose bump 23 that traps the hose 22 between the spring collar 32 of the retention spring 20 and the hose nipple barb 28 . there is both an axial force and a radial compressive force applied to the hose 22 forcing it against the hose nipple barb 28 to seal the hose 22 with the hose coupling 12 at the coupling nipple 16 and more specifically at the hose nipple barb 28 . it is contemplated that additional hose nipple barbs could be used and the shape of the hose nipple barbs could be altered to tailor the performance of the hose coupling assembly 10 . now referring to fig7 of the drawings , an alternate embodiment of the hose coupling 52 is shown which is comprised of a hose coupling body 54 , a hose nipple 56 and a retention spring 60 . the hose coupling 52 is made up of a coupling body 54 which has a hose nipple 56 where the hose nipple 56 includes a hose stop 58 . extending from the coupling body 54 is a cylindrical coupling collar 59 which supports the retention spring 60 which is attached to the coupling collar 59 at a spring base 76 . there is a spring chamfer 61 formed on the end of the spring collar 72 that serves to contact the hose 22 at the hose bump 63 . the angle of the spring chamfer 61 , the characteristics of the hose 62 and the geometry of the hose barb 68 largely determine the amplitude of the axial and vertical force components applied to the hose 62 by the retention spring 60 . these geometries must be determined for each specific application and for each particular component material and other characteristics of the hose coupling assembly 50 . axially extending along the central axis 65 of the hose coupling 52 is passageway 64 which carries the fluid that is to be transported . to seal the hose coupling 52 to some other fluid device such as a pump , valve or other coupling are seal grooves 66 which hold some type of sealing devices , such as an o - rings which are positioned within the seal grooves 66 . one o - ring is positioned within each groove 66 to provide a secure sealing function so that the fluid being transported does not leak outside of the hose coupling 52 . now referring to fig8 of the drawings , a perspective view of the retention spring 60 is shown . the retention spring 60 is comprised of a helical spring 74 which is made up of two helix spring coils 74 a , 74 b which are connected at their terminations by , at one end , the spring collar 72 and at the other end by a spring base 76 . the spring collar 72 has a spring chamfer 73 along its inner edge and this spring chamfer 73 contacts the hose 62 at the hose barb 68 . now referring to fig9 , a perspective view of the retention spring 60 is shown as a two lead helix spring 74 consisting of spring coils 74 a , 74 b . the spring coils 74 a and 74 b begin at the spring collar 72 and extend downwardly to the spring base 76 . the spring coils 74 a and 74 b can be any type of known spring types such as a helical spring , a round wire compression spring , a wave spring or any other type of material or configuration as long as the force characteristics required for this application are satisfied and the teachings of this application are followed . example specifications for the retention spring 60 and the hose 62 are as follows : the tubing or hose 62 is a 12 . 5 mm diameter having a 1 . 0 mm wall thickness and made out of nylon - 12 material . the spring rate of the retention spring 60 depends on the alloy used for the retention spring 60 with examples of 15 - 5 ph cres at condition 1025 or 17 - 7 ph . the specifications for the hose coupling assembly 50 call for the retention spring 60 to be first compressed and then released after the hose 62 is installed and applies a compressive force to the hose 62 at the hose nipple barb 28 . this equates to a significant compressive clamping force ( perpendicular to the axis of the coupling body 52 ). note that a separate spring compression tool is required at assembly to compress the retention spring 60 a sufficient distance to allow the hose 62 to be inserted onto the hose nipple 56 and under the retention spring 60 in its compressed state . the retention spring 60 provides a relatively constant clamping force on the tube at higher pressures since as the axial load increases on the hose coupling assembly 50 due to mechanical forces and due to pressure of the fluid by simply increasing its installed length to fill in for the reduction in wall thickness due to stretching of the hose coupling assembly 50 . now referring to fig1 , a perspective view of the alternate embodiment of the hose coupling 62 with the retention spring 60 assembled onto the coupling body 54 at the coupling collar 59 by the spring base 76 . to assemble the hose coupling assembly 50 , the retention spring 60 is compressed so that the spring collar 72 is pushed back past the nose bump 68 far enough to provide clearance for the hose 62 to be pushed onto the coupling nose 56 , over the hose bump 68 and up to the hose stop 58 . the hose 62 is pushed over the nose chamfer 70 of the hose coupling 52 and over a nose bump 68 formed on the outer surface of the coupling nose 56 . the hose 62 deforms at shown as a hose bump 63 to conform to the nose bump 68 formation . then the retention spring 60 is released and it axially moves to cover and apply a clamping force by the spring chamfer 71 in the spring collar 72 to the hose 62 at the hose bump 63 . there is a circumferential force applied to the hose 62 at the hose bump 63 and traps the hose 62 between the retention spring 60 and the nose bump 68 . there is an axial force and a radial compressive force applied to the hose 62 forcing it against the nose bump 68 to seal the hose 62 with the hose coupling 52 at the coupling nose 56 and specifically at the nose bump 68 . the present disclosure has been particularly shown and described with reference to the foregoing illustrations , which are merely illustrative of the best modes for carrying out the disclosure . it should be understood by those skilled in the art that various alternatives to the illustrations of the disclosure described herein may be employed in practicing the disclosure without departing from the spirit and scope of the disclosure as defined in the following claims . it is intended that the following claims define the scope of the disclosure and that the method and apparatus within the scope of these claims and their equivalents be covered thereby . this description of the disclosure should be understood to include all novel and non - obvious combinations of elements described herein , and claims may be presented in this or a later application to any novel and non - obvious combination of these elements . moreover , the foregoing illustrations are illustrative , and no single feature or element is essential to all possible combinations that may be claimed in this or a later application . | 5 |
referring to fig1 , there is shown a schematic view of an exemplary glass manufacturing system 100 which uses a fusion draw process to manufacture a glass sheet 102 in accordance with an embodiment of the present invention . the glass manufacturing system 100 includes a melting vessel 110 , a melting to fining tube 115 , a fining vessel 120 , a finer to stir chamber tube 125 ( with a level probe stand pipe 127 extending therefrom ), a stir chamber 130 ( e . g ., mixing vessel 130 ), a stir chamber to bowl connecting tube 135 , a bowl 140 ( e . g ., delivery vessel 140 ), a downcomer 145 , a fusion draw machine ( fdm ) 150 ( which includes an inlet 155 , a forming apparatus 160 , and a pull roll assembly 165 ), and a traveling anvil machine ( tam ) 170 . typically , the glass manufacturing vessels 115 , 120 , 125 , 127 , 130 , 135 , 140 , 145 and 155 are made from platinum or platinum - containing metals such as platinum - rhodium , platinum - iridium and combinations thereof , but they may also comprise other refractory metals such as palladium , rhenium , ruthenium , and osmium , or alloys thereof . the forming apparatus 160 ( e . g ., isopipe 160 ) is typically made from a ceramic material or glass - ceramic refractory material . the melting vessel 110 is where glass batch materials are introduced as shown by arrow 112 and melted to form molten glass 114 . the fining vessel 120 ( e . g ., finer tube 120 ) is connected to the melting vessel 110 by the melting to fining tube 115 . the fining vessel 120 has a high temperature processing area that receives the molten glass 114 ( not shown at this point ) from the melting vessel 110 and in which bubbles are removed from the molten glass 114 . the fining vessel 120 is connected to the stir chamber 130 by the finer to stir chamber connecting tube 125 . the stir chamber 130 is connected to the bowl 140 by the stir chamber to bowl connecting tube 135 . the bowl 140 delivers the molten glass 114 ( not shown ) through the downcomer 145 into the fdm 150 . the fdm 150 includes the inlet 155 , the forming vessel 160 ( e . g ., isopipe 160 ), and the pull roll assembly 165 . the inlet 155 receives the molten glass 114 ( not shown ) from the downcomer 145 and from the inlet 155 the molten glass 114 ( not shown ) then flows to the forming vessel 160 . the forming vessel 160 includes an opening 162 that receives the molten glass 114 ( not shown ) which flows into a trough 164 and then overflows and runs down two opposing sides 166 a and 166 b before fusing together at a root 168 to form a glass sheet 109 . the pull roll assembly 165 receives the glass sheet 109 and outputs a drawn glass sheet 111 . the tam 170 receives the drawn glass sheet 111 and separates the drawn glass sheet 111 into separate glass sheets 102 . in accordance with an embodiment of the present invention , one or more of the glass manufacturing vessels 115 , 120 , 125 , 127 , 130 , 135 , 140 , 145 and 155 have a configuration which enables an atmosphere of gas to pass therein which helps suppress hydrogen permeation blistering within the molten glass 114 or otherwise benefit the glass production . furthermore , the glass manufacturing system 100 includes one or more control systems 175 which supply the atmosphere to the one or more specially configured glass manufacturing vessels 115 , 120 , 125 , 127 , 130 , 135 , 140 , 145 and 155 . for instance , one control system 175 can be used to supply the atmosphere of gas to all of the specially configured glass manufacturing vessels 115 , 120 , 125 , 127 , 130 , 135 , 140 , 145 and 155 . or , one control system 175 can be used to supply the atmosphere to one or any combination of the specially configured glass manufacturing vessels 115 , 120 , 125 , 127 , 130 , 135 , 140 , 145 and 155 . a detailed description about one of the specially configured glass manufacturing vessels 115 , 120 , 125 , 127 , 130 , 135 , 140 , 145 and 155 namely the finer to stir chamber tube 125 ( with the level probe stand pipe 127 extending therefrom ) is discussed next with respect to fig2 . referring to fig2 , there is shown a cross - sectional view of an exemplary finer to stir chamber tube 125 ( with the level probe stand pipe 127 extending therefrom ) configured in accordance with an embodiment of the present invention . as shown , the finer to stir chamber tube 125 has an input 202 from which molten glass 114 is received from the fining vessel 120 ( not shown ) and an output 204 from which the molten glass 144 is provided to the stir chamber 130 ( not shown ). the finer to stir chamber tube 125 and the level probe stand pipe 127 include an external layer 206 ( e . g ., precious metal sheet 206 ), an intermediate layer 208 ( e . g ., mesh screen 208 , beads 208 , corrugated or dimpled metal sheet 208 ) and an internal layer 210 ( e . g ., precious metal sheet 210 ). the intermediate layer 208 is positioned or otherwise located between the external layer 206 and the internal layer 210 . the intermediate layer 208 has a gas permeable structure that permits an atmosphere of gas to pass therein between the external layer 206 and the internal layer 210 . the control system 175 creates and provides the atmosphere of gas through an input port 212 within the external layer 206 to the intermediate layer 208 . the atmosphere of gas maintains a positive pressure within open spaces of the intermediate layer 208 and suppresses blister formation within the molten glass 114 or otherwise benefits the glass production . the gas may exit the intermediate layer 208 from one or more outlet ports 214 ( two shown ) formed within the external layer 206 . for example , the gas output from the intermediate layer 208 may be recycled by the control system 175 , or some other recovery system , or released into the manufacturing facility . alternatively , if the finer to stir chamber tube 125 and the level probe stand pipe 127 are not totally gas tight then only the input port 212 may be used and the gas can leak out at some other place or places in the finer to stir chamber tube 125 and the level probe stand pipe 127 . it should be appreciated that the finer to stir chamber tube 125 and the level probe stand pipe 127 or any glass manufacturing vessel can have any type of shape and this particular precious metal structure 206 , 208 and 210 or a wide variety of different precious metal structures 206 , 208 and 210 in accordance with different embodiments of the present invention as will be discussed next with respect to fig3 - 5 . referring to fig3 a - 3b , there are respectively shown a cross - sectional side view and a cross - sectional end view of an exemplary glass manufacturing vessel 300 configured in accordance with an embodiment of the present invention . the glass manufacturing vessel 300 is designed to have molten glass 114 flow therein . the glass manufacturing vessel 300 is configured to have an external layer 206 ( e . g ., precious metal sheet 206 ), an intermediate layer 208 ( e . g ., mesh screen 208 , beads 208 , corrugated or dimpled metal sheet 208 ) and an internal layer 210 ( e . g ., precious metal sheet 210 ). the external layer 206 includes a first side 302 and a second side 304 and the internal layer 210 includes a first side 306 and a second side 308 . the intermediate layer 208 is positioned or otherwise formed between the second side 304 of external layer 206 and the first side 306 of the internal layer 210 . the intermediate layer 208 has a gas permeable structure that permits an atmosphere of gas to pass therein between the external layer 206 and the internal layer 210 . in this example , the internal layer &# 39 ; s second side 308 contacts the molten glass 114 . the control system 175 ( not shown ) creates and provides the atmosphere of gas through an input port 212 within the external layer 206 to the intermediate layer 208 . the atmosphere of gas maintains a positive pressure within open spaces of the intermediate layer 208 and suppresses blister formation within the molten glass 114 or otherwise benefits the glass production . the gas may exit the intermediate layer 208 from an outlet port 214 ( if used ) formed within the external layer 206 . the gas output from the intermediate layer 208 may be recycled by the control system 175 ( not shown ), some other recovery system , or released into the manufacturing facility . a discussion is provided next with respect to fig4 and 5 to explain how an existing glass manufacturing vessel can be retrofitted to be configured in accordance with an embodiment of the present invention . referring to fig4 a - 4b , there are respectively shown a cross - sectional side view and a cross - sectional end view of an exemplary glass manufacturing vessel 400 configured in accordance with an embodiment of the present invention . the glass manufacturing vessel 400 is formed by taking an existing glass manufacturing vessel 402 ( existing structure 402 ) and applying the intermediate layer 208 ( e . g ., mesh screen 208 , corrugated or dimpled metal sheet 208 ) over the existing glass manufacturing vessel 402 ( existing structure 402 ) and then applying the external layer 206 ( e . g ., precious metal sheet 206 ) over the intermediate layer 208 . in this case , the aforementioned internal layer 210 is the existing glass manufacturing vessel 402 ( existing structure 402 ). the intermediate layer 208 has a gas permeable structure that permits an atmosphere of gas to pass therein between the external layer 206 and the existing glass manufacturing vessel 402 ( existing structure 402 ). the control system 175 ( not shown ) creates and provides the atmosphere of gas through the input port 212 within the external layer 206 to the intermediate layer 208 . the atmosphere of gas maintains a positive pressure within open spaces of the intermediate layer 208 and suppresses blister formation within the molten glass 114 or otherwise benefits the glass production . the gas may exit the intermediate layer 208 from the outlet port 214 ( if used ) formed within the external layer 206 . the gas output from the intermediate layer 208 may be recycled by the control system 175 ( not shown ), some other recovery system , or released into the manufacturing facility if the system if not fully gas tight . referring to fig5 a - 5b , there are respectively shown a cross - sectional side view and a cross - sectional end view of an exemplary glass manufacturing vessel 500 configured in accordance with an embodiment of the present invention . the glass manufacturing vessel 500 is formed by taking an existing glass manufacturing vessel 502 ( existing structure 502 ) and applying the external layer 206 over the existing glass manufacturing vessel 502 ( existing structure 502 ). in this case , the external layer 206 has a corrugated or dimpled structure such that the intermediate layer 208 is formed by the open spaces that are created when the external layer 206 is positioned next to the existing glass manufacturing vessel 502 ( existing structure 502 ). in the illustrated example , the corrugated external layer 206 is positioned to be just off the existing structure 502 so the gas atmosphere can pass through all of openings created by the corrugated external layer 206 . alternatively , the corrugated external layer 206 can contact the existing structure 502 but in this case the input port 212 would be around the entire perimeter of the corrugated external layer 206 so the gas atmosphere can pass the openings created by the corrugated external layer 206 . in another example , the dimpled external layer 206 can have dimples that contact the internal layer 210 at selected points and thus create the gas permeable layer 208 so the gas atmosphere can pass in between the dimpled external layer 206 and the internal layer 210 . if desired , the glass manufacturing vessel 502 does not need to be made from existing glass manufacturing vessel 502 but could be made by taking a new structure ( e . g ., downcomer , bowl ) and then applying the external layer 206 which has the corrugated or dimpled structure over the new structure . in any case , the aforementioned internal layer 210 is the existing glass manufacturing vessel 502 ( existing structure 502 ) or the new structure . plus , the formed intermediate layer 208 permits an atmosphere of gas to pass therein between the external layer 206 and the existing glass manufacturing vessel 502 ( existing structure 502 ) or the new structure . the control system 175 ( not shown ) creates and provides the atmosphere of gas through the input port 212 within the external layer 206 to the intermediate layer 208 ( e . g ., open spaces ). the atmosphere of gas maintains a positive pressure within open spaces of the intermediate layer 208 and suppresses blister formation within the molten glass 114 or otherwise benefits the glass production . the gas may exit the intermediate layer 208 from the outlet port 214 ( if used ) formed within the external layer 206 . the gas output from the intermediate layer 208 may be recycled by the control system 175 ( not shown ), some other recovery system , or released into the manufacturing facility . in view of the foregoing , one will appreciate that in one of its simplest forms the present invention relates to the fabrication and use of a glass manufacturing vessel 300 , 400 and 500 ( which can have any physical shape ) that has an intermediate layer 208 ( e . g ., integral gas permeable membrane 208 ) located or formed between two layers of precious metal 206 and 210 . the intermediate layer 208 ( e . g ., integral gas permeable membrane 208 ) would have an atmosphere of gas passed through it to suppress hydrogen permeation blistering in the molten glass 114 or to provide an atmosphere of benefit to the glass production . in addition , one will appreciate that the glass manufacturing vessel 300 , 400 and 500 with this composite metal 206 , 208 and 210 could be used for the melting , delivery or forming of glass . the glass manufacturing vessel 300 , 400 and 500 with the intermediate layer 208 ( e . g ., integral gas permeable membrane 208 ) could be fabricated in many ways several of which are discussed below . one exemplary method of fabricating the glass manufacturing vessel 300 ( for example ) is the lamination of the intermediate layer 208 ( e . g ., woven precious metal mesh 208 ) between the external and internal layers 206 and 210 ( e . g ., two layers of platinum cladding 206 and 208 ). this can be done by roll bonding , welding or by the fabrication of concentric cylinders that are nested together . fig6 and 7 are photographs of an exemplary composite metal structure 206 , 208 and 210 that was fabricated in the lab by roll bonding . fig6 is a cross section of the precious metal mesh 208 laminated between two sheets of 0 . 010 ″ thick precious metal 206 and 210 ( see also fig8 a - 8f ). fig7 is a close - up of the cross section of the precious metal mesh 208 laminated between the two precious metal sheets 206 and 210 where the atmosphere can pass in open spaces 702 between the two precious metal sheets 206 and 210 . the control system 175 can provide the protective atmosphere which could be introduced into the intermediate layer 208 ( e . g ., woven precious metal mesh 208 ) through the ends or by one or more inlet ports 212 drilled into the external ( non - glass contact ) skin of the structure . typically , the control system 175 would only need to supply a volume of gas which is enough to maintain a positive pressure of gas inside the intermediate layer 208 . in one example , the control system 175 should be able to humidify whatever gas mixture is introduced into the intermediate layer 208 . in addition , the control system 175 should be able to mix various gases such as nitrogen and water or combustible gases and supply the atmosphere using mass flow controllers . furthermore , the control system 175 should be able to accurately control the partial pressures of the various gases to help suppress hydrogen permeation blistering in the molten glass 114 or otherwise benefit glass production . referring to fig8 a - 8f , there are photographs used to help describe a process that was used in a lab to form and use the exemplary composite metal structure 206 , 208 and 210 shown in fig6 - 7 . the first step in the fabrication of the gas permeable precious metal structure 206 , 208 and 210 is to assembly the starting materials which in this case include a 40 mesh pt - 10rh screen 208 and two 0 . 010 ″ thick pt sheets 206 and 210 ( see fig8 a - 8c ). the 40 mesh pt - 10rh screen 208 used in this demonstration was woven in structure and constructed of 0 . 008 ″ diameter wires . however , it should be appreciated that a broad range of wire diameters , mesh sizes , cladding thicknesses and metal compositions could be used for the gas permeable precious metal structure 206 , 208 and 210 . in any case , the sandwich of pt metal sheets 206 and 210 with the 40 mesh pt - 10rh screen 208 positioned in between the two pt metal sheets 206 and 210 was spot welded together in the center for ease of handling and to keep the structure together during the assembly process . then , the sandwich of pt metal sheets 206 and 210 with the 40 mesh pt - 10rh screen 208 was heated to 1200 ° c . and transferred hot to the rolling mill 802 . thereafter , the sandwich of pt metal sheets 206 and 210 with the 40 mesh pt - 10rh screen 208 was rolled together with a roll gap setting to give a 10 % reduction in thickness ( see fig8 d ). this roll cladding procedure was repeated one more time with an additional 10 % reduction in thickness , after reheating the sandwich of pt metal sheets 206 and 210 with the 40 mesh pt - 10rh screen 208 to 1200 ° c . ( see fig8 e ). the cross sections of the structure produced in this experiment are shown in fig6 - 7 where it can readily be seen that the woven structure of the 40 mesh pt - 10rh screen 208 provides areas of continuous porosity 702 where the protective atmosphere would flow between the two pt metal sheets 206 and 210 . to verify that the assembled sandwich of pt metal sheets 206 and 210 with the 40 mesh pt - 10rh screen 208 did indeed include a gas permeable membrane 208 that was an integral part of the cladding a flow test was run . for this test , the two longer sides of the laminated structure 206 , 208 and 210 were welded together to provide a gas tight seal . this left the laminated structure 206 , 208 and 208 with openings at both shorter ends . as shown in fig8 f , a plastic tube 802 was taped to one short end ( located behind thumb ) of the laminated structure 206 , 208 and 210 as an inlet for gas . then , liquid soap 806 was applied to the opposing short end 808 of the laminated structure 206 , 208 and 210 as a method to detect gas flow through the laminated structure 206 , 208 and 210 . a slight flow of gas was applied through the plastic tub 802 . as can be seen in fig8 f , the gas flow resulted in the liquid soap 806 generating bubbles at the other end 808 of the laminated structure 206 , 208 and 210 . the process described above is exemplary and by no means the only method for fabricating and utilizing the composite metal structure 206 , 208 and 210 . as an alternative , the metal external layer 206 , intermediate layer 208 ( e . g ., mesh ) and the metal internal layer 210 could be fabricated together by standard sheet metal technology of forming and welding . additionally , the intermediate layer 208 could be beads of precious metal or an inert refractory material that provide some structural support and separation for gas flow between the external layer 206 ( e . g ., precious metal sheet 206 ) and the internal layer 210 ( e . g ., precious metal sheet 210 ). in addition , the intermediate layer 208 with the porous structure could be formed by joining a corrugated or dimpled external layer 206 to a corrugated or dimpled internal layer 206 to make a laminate structure . alternatively , the intermediate layer 208 with the porous structure could be formed by joining a corrugated or dimpled external layer 206 to flat internal layer 210 or vice versa joining a flat external layer 206 to a corrugated or dimpled internal layer 210 to make a laminate structure . furthermore , it is possible to use dissimilar materials for the external layer 206 and the internal layer 210 cladding of the laminate structure . for instance , a material such as iridium that has favorable properties for glass contact yet is prone to oxidation could be used as the internal layer 210 . the iridium would provide erosion and contamination resistance , yet be protected from oxidation on its external surface by flowing a reducing environment within the intermediate layer 208 between the external layer 206 and the internal layer 210 . the external layer 206 could be made of standard precious metal for resistance to oxidation . moreover , the mesh that is used as the intermediate layer 208 could be made of some material with superior strength to the standard pt - 20rh alloy . the mesh would not necessarily have to be compatible with the molten glass 114 , since it would not come in contact with the molten glass 114 . finally , the composite metal structure 206 , 208 and 210 and in particular the intermediate layer 208 ( e . g ., gas permeable precious metal structure 208 ) should be designed from an atmosphere flow standpoint such that the intermediate layer 208 has open spaces ( e . g ., pore sizes ) that are large as possible to minimize the pressure drop and flow restriction for the atmosphere inside the gas permeable precious metal structure 206 , 208 and 210 . from a strength standpoint , the composite metal structure 206 , 208 and 210 should be designed such that the intermediate layer 208 has open spaces ( e . g ., pore sizes ) which are minimized to support the external layer 206 and the internal layer 208 on either side of the intermediate layer 208 and prevent the external layer 206 and the internal layer 210 from sagging or creeping into the open spaces ( e . g ., pores ) in the intermediate layer 208 . for instance , the bigger the open spaces ( e . g ., pore sizes ), the more likely the internal layer 210 will sag into the void area from the hydrostatic pressure of the glass head inside the glass manufacturing vessel . basically , all of these factors should at least be taken into account when designing the composite metal structure 206 , 208 and 210 for use in the glass manufacturing system . from the foregoing , one skilled in the art will appreciate that present invention relates to a method and procedure to fabricate and use an intermediate layer 208 ( e . g ., integral gas permeable structure 208 ) between the external layer 206 and internal layer 210 which can be the platinum cladding of a glass manufacturing vessel for manufacturing high quality glass . the integral gas permeable structure 208 is internal to the precious metal cladding 206 and 210 and serves as a distribution system for the protective atmosphere for hydrogen permeation blistering suppression or otherwise benefiting the glass production . in other words , the “ capsule ” intermediate layer 208 is actually part of the structure of the platinum wall of the melt , delivery and forming glass manufacturing vessels . as discussed above , there are many ways to make the composite metal structure 206 , 208 and 210 with the integral gas permeable structure 208 . one exemplary process is to laminate a precious metal sheet 206 ( e . g ., platinum sheet 206 ), a woven precious metal mesh screen 208 and another precious metal sheet 210 ( e . g ., platinum sheet 210 ). one layer of the precious metal sheet 210 would be the glass contact or inside surface of the glass manufacturing vessel 300 , 400 and 500 . the mesh screen 208 would serve to create a gas permeable gap between the two precious metal sheets 206 and 210 . the open spaces of the mesh screen 208 is where the atmosphere would flow to surround the precious metal sheet 210 that is in contact with the production molten glass 114 . the external layer 206 of platinum would serve as the external vessel to contain the protective atmosphere and prevent its leakage or dilution . the present invention would eliminate the need for an external capsule and the large environmental control unit ( ecu ) used for the generation and control of the protective atmosphere . there are many advantages that the present invention has over the current technology . for instance , some of the advantages that the present invention has over the existing capsule and enclosure technology are as follows : the laminated or internal porous structure of the present invention is an integral part of the platinum cladding of the melt , delivery or forming system and as a result there is flexibility in where and how it can be installed . the laminated or internal porous structure of the present invention can be used as a replacement for any area of current cladding in a glass manufacturing system . for instance , there may be an area of the melt , delivery or forming system where the current protective atmosphere adversely affects the life of performance of the parts of the system and the laminated or internal platinum structure of the present invention can be used in this area of the melt , delivery or forming system . the laminated or internal porous structure of the present invention can be used to improve sealing in general and to improve the ability to have better atmosphere control because leakage into and out of the protective atmosphere can be controlled . from a cost standpoint , the present invention would greatly reduce the capital cost for hydrogen permeation protection by eliminating the need for a humidity controlled enclosure on the aforementioned glass manufacturing system 100 . it would also substantially reduce the cost of the ecu for supplying the protective atmosphere , since the present invention would require only a low amount of protective atmosphere flow . there are also operational savings in both nitrogen consumption and energy usage . the present invention could be a gas tight structure and thus require much less make - up nitrogen in order to maintain a positive pressure of protective gas . additionally , the amount of protective atmosphere needed to circulate in the integral system would be a small percentage when compared to the existing humidity controlled enclosure thus requiring less energy for steam generation and the circulation of the protective atmosphere . the present invention could also allow a cost reduction in the amount of precious metal ( e . g ., platinum ) required for cladding on the glass manufacturing vessels . for example , the one concept of a laminated structure with precious metal mesh 208 between two layers of precious metal skin 206 and 210 could give equivalent structural stiffness and strength with less precious metal due to the low amount of precious metal per unit volume for a mesh / screen structure versus solid precious metal . furthermore , it should be appreciated that the glass manufacturing vessels 300 , 400 or 500 can be used in any type of glass manufacturing system that uses precious metal or any glass melted or flowing in precious metal . plus , the glass manufacturing vessels 300 , 400 or 500 can be used to manufacture , for example , optical glasses , borosilicate glasses , alumino - borosilicate glasses , and soda - lime - silicate glass . furthermore , the glass manufacturing vessels 300 , 400 or 500 can be used to produce any type of glass article such as , for example , lenses , plate glass , table ware , containers , glass tubing , glass parts for optical applications and not just a glass sheet . moreover , it should be appreciated that the inventive concept of the aforementioned integral capsule can be used to address problems in other glass manufacturing applications such as , for example , a glass tubing manufacturing application . referring to fig9 a ( prior art ), there is illustrated a portion of a traditional glass tubing manufacturing system 900 where a device 902 is located in a glass forehearth 904 and molten glass 906 which is received from a tank ( not shown ) and flows in the direction of arrows 908 around the device 902 and out of an opening 910 formed by a ring 912 at the bottom of the glass forehearth 904 to manufacture glass tubing 914 . the device 902 includes a section 916 and a bell 918 which are attached to one another . the section 916 has one end 920 a portion of which is extending above the molten glass 906 and a second end 922 which is located in the molten glass 906 and attached to the bell 918 . the bell 918 is positioned within the opening 910 formed by the ring 912 however the bell 918 does not contact the ring 912 . the bell 918 has a circular - shaped top portion 924 which is attached to the section &# 39 ; s second end 922 and a circular - shaped bottom portion 926 from which the glass tubing 914 is drawn from . the bell &# 39 ; s circular - shaped top portion 924 has a larger diameter than the section &# 39 ; s second end 922 . in addition , the bell &# 39 ; s diameter is continually reduced as one moves from the circular - shaped top portion 924 to the circular - shaped bottom portion 926 . alternatively , the bell 918 can be shaped where the lower portion 926 has a larger diameter than the top portion 924 and in this case the top portion 924 would be located below the ring 912 . in any case , the section 916 and bell 918 both have an opening 928 formed therein through which a gas 930 ( e . g ., air 930 ) travels in a direction indicated by arrows 932 . the flowing gas 930 functions to keep the glass tubing 914 that is formed from collapsing . the device 902 is held somewhere external to the glass forehearth 904 by a bell positioner ( not shown ) which can raise , lower and move the device 902 in any direction to properly position the device 902 . the traditional glass tubing manufacturing system 900 suffers from a problem where the metal ( e . g ., platinum , stainless steel , high temperature alloys ( e . g ., inconnel ), precious metal ) used to make the bell &# 39 ; s section 916 can be contaminated with carbon ( c ) ( and possibly other elements ) which forms co 2 bubbles 934 when in contact with the molten glass 906 ( see expanded view 936 ). the co 2 bubbles 934 end - up as blister defects in the glass tubing 914 . the mechanism by which this blister formation happens is the oxidation of the carbon ( c ) from the contaminated section 916 . as the carbon ( c ) is oxidized at the metal - glass interface 938 , more carbon ( c ) from the bulk metal diffuses to the surface metal . thus , the co 2 bubbles 934 form at the metal - glass interface 938 and eventually the co 2 bubbles 934 are incorporated in the molten glass 906 as defects . this reaction would continue on until the carbon ( c ) in the contaminated section 916 is exhausted which can take a long time because of the kinetics of the metal - glass interface 938 reactions . during this time defective glass tubing 914 is being made . a detailed discussion about how this problem can be solved is provided next with respect to fig9 b . referring to fig9 b , there is illustrated a portion of a glass tubing manufacturing system 900 ′ which is the same as the aforementioned glass tubing manufacturing system 900 except that it incorporates an improved device 902 ′ in accordance with an embodiment of the present invention . the improved device 902 ′ is located in the glass forehearth 904 ′ and molten glass 906 ′ which is received from a tank ( not shown ) flows in the direction of arrows 908 ′ around the improved bell device 902 ′ and out of the opening 910 ′ formed by the ring 912 ′ at the bottom of the glass forehearth 904 ′ to manufacture glass tubing 914 ′. the improved device 902 ′ is the same as the aforementioned bell device 902 in that it includes the section 916 ′ ( with the first end 920 ′, the second end 922 ′, and hole 928 ′) and the bell 918 ′ ( with the circular - shaped top portion 924 ′, the circular - shaped bottom portion 926 ′, and hole 928 ′) through both of which a gas 930 ′ ( e . g ., air ) flows in direction of arrows 932 ′ to help prevent the glass tubing 914 ′ which is being formed from collapsing . however , the improved device 902 ′ has at least a portion of the contaminated section 916 ′ wrapped with a mesh 917 ′ ( e . g ., platinum mesh 917 ′, gas permeable structure 917 ′) and then a non - contaminated cladding 919 ′ ( e . g ., platinum - rhodium cladding 919 ′, stainless steel cladding 919 ′, high temperature alloy cladding 919 ′ ( e . g ., inconnel cladding 919 ′)) is wrapped around the mesh 917 ′. the section &# 39 ; s mesh 917 ′ and cladding 919 ′ would extend above the molten glass 906 ′ and be open to an ambient atmosphere 938 ′ or a combustion atmosphere 940 ′ in the forehearth 904 ′. this atmosphere 938 ′ or 940 ′ would contain some level of oxygen . by diffusion and convection , this atmosphere 938 ′ or 940 ′ would fill the void area that the mesh 917 ′ makes between the contaminated section 916 ′ and the non - contaminated cladding 919 ′. the contact of the ambient or combusion atmosphere 938 ′ or 940 ′ with the exposed surface of the section 916 ′ would cause the oxidation of the carbon ( c ) in the section 916 ′ ( see expanded view 942 ′). this oxidation reaction would form co 2 gas 944 ′. the difference between the problematic co 2 bubbles 934 and this co 2 gas 944 ′ is that the co 2 gas 944 ′ would form in the void area of the mesh 917 ′ and harmlessly diffuse out of this area into the ambient or combusion atmosphere 938 ′ or 940 ′ rather than into the molten glass 906 ′. the co 2 gas 944 ′ formed would not cause blisters in the molten glass 906 ′. plus , the formed co 2 gas 944 ′ would not contaminate the cladding 919 ′ because for carbon ( c ) to adversely affect the metal cladding 919 ′ ( precious metal cladding 919 ′) it must be in the reduced or elemental form . if desired , the improved device 902 ′ may contain an optional input port 950 ′ and an optional output port 952 ′ both of which would extend through the cladding 919 ′. the optional input port 950 ′ would be connected to non - contaminated tubing 954 ′ through which a gas ( e . g ., air ) would flow to assist in the removal of the co 2 gas 1044 from the mesh 917 ′. the optional output port 952 ′ would be connected to non - contaminated tubing 956 ′ through which the gas ( e . g ., air ) and co 2 gas 944 ′ would flow from the mesh 917 ′. it should be appreciated that any device which contains a contaminate such as carbon and contacts molten glass 906 can be wrapped in the mesh 917 ′ and cladding 919 ′ like the improved device 902 ′ to help prevent or at least reduce the formation of co 2 bubbles 934 or other problematical gas bubbles in the molten glass 906 ′. an example of such a device is discussed below with respect to fig1 . referring to fig1 , there is illustrated a device 1000 which is configured to be partially inserted into molten glass 1006 in accordance with yet another embodiment of the present invention . the device 1000 is located in a vessel 1004 which contains molten glass 1006 . the device 1000 includes a section 1016 ( which is contaminated with for instance carbon ) and a component 1018 ( e . g ., stirrer blades 1018 , thermocouple 1018 , level probe 1018 ) which are attached to one another . the contaminated section 1016 has one end 1020 a portion of which is extending above the molten glass 1006 and a second end 1022 which is located in the molten glass 1006 and attached to the component 1018 . in this example , the contaminated section 1016 is shown having a hole 1028 formed therein which could for instance be used as a wire way . alternatively , the contaminated section 1016 could be solid . the device 1000 has at least a portion of the contaminated section 1000 wrapped with a mesh 1017 ( e . g ., platinum mesh 1017 , gas permeable structure 1017 ) and then a non - contaminated cladding 1019 ( e . g ., platinum - rhodium cladding 1019 , stainless steel cladding 1019 , high temperature alloy cladding 1019 ( e . g ., inconnel cladding 1019 )) is wrapped around the mesh 1017 . the section &# 39 ; s mesh 1017 and non - contaminated cladding 1019 would extend above the molten glass 1006 and be open to an ambient atmosphere 1038 or a combustion atmosphere 1040 in the vessel 1004 . this atmosphere 1038 or 1040 would contain some level of oxygen . by diffusion and convection , this atmosphere 1038 or 1040 would fill the void area that the mesh 1017 makes between the contaminated section 1016 and the non - contaminated cladding 1019 . the contact of the ambient or combusion atmosphere 1038 or 1040 with the exposed surface of the contaminated section 1016 would cause the oxidation of the carbon ( c ) in the contaminated section 1016 ( see expanded view 1042 ). this oxidation reaction would form co 2 gas 1044 which would harmlessly diffuse out of this area into the ambient or combusion atmosphere 1038 or 1040 rather than into the molten glass 1006 . the co 2 gas 1044 formed would not cause blisters in the molten glass 1006 . plus , the formed co 2 gas 1044 would not contaminate the cladding 1019 because for carbon ( c ) to adversely affect the metal cladding 1019 ( precious metal cladding 1019 ) it must be in the reduced or elemental form . if desired , the device 1000 may contain an optional input port 1050 and an optional output port 1052 both of which would extend through the cladding 1019 . the optional input port 1050 would be connected to non - contaminated tubing 1054 through which a gas ( e . g ., air ) would flow to assist in the removal of the co 2 gas 1044 from the mesh 1017 . the optional output port 1052 would be connected to non - contaminated tubing 1056 through which the gas ( e . g ., air ) and co 2 gas 1044 would flow from the mesh 1017 . although several embodiments of the present invention have been illustrated in the accompanying drawings and described in the foregoing detailed description , it should be understood that the invention is not limited to the disclosed embodiments , but is capable of numerous rearrangements , modifications and substitutions without departing from the invention as set forth and defined by the following claims . | 1 |
in the following the invention will be described by means of figures and embodiments . the invention will be explained by using a network comprising a mobile network without restricting the invention to such implementation . fig1 depicts a schematic of a communication path between a first party ue 1 and a server s 1 . the server is connected via a link l 11 to an ip based network ip 1 . said ip based network is connected via a link l 12 to a proxy server p 1 . said proxy server is used to connect the fixed connected domain comprising the before mentioned components with a wireless domain via a link l 13 . the wireless domain comprises the network for mobile telecommunications rn 1 and the first party ule 1 . the network for mobile telecommunications rn 1 is connected to the proxy via said link l 13 . it is further connected to the first party ue 1 via a radio link rl 1 . the proxy p 1 acts as a party towards the server s 1 and the first party ue 1 . in the following the connection radio link rl 1 , radio network rn 1 and link l 14 , between the first party ue 1 and the proxy p 1 acting as a second party is regarded . the invented method is used to determine a window size for said connection . fig2 depicts a flow chart describing the invented method . after starting 201 the method a first optional step 202 is performed . at that step the proxy p 1 , acting as a window size determining unit , categorises all mobile terminals ue 1 that currently terminate at least one active tcp ( transmission control protocol ) flow at said proxy p 1 into destinations , according to the location of the mobile terminal . instead of tcp the invented method can be executed for any window based packet transmission protocol as for example sctp or dccp ( datagram congestion control protocol ). in a step 203 , the proxy , again acting as a window size determining unit , groups all tcp flows , with the same pipe capacity into the same group . in a preferred embodiment , tcp flows with a pipe capacity that falls into the same predefined range of pipe capacities are grouped into the same group . said range is defined for example by operator settings or by a vendor of a computer program that controls the window size determining unit in a way that it executes the invented method . step 203 is run separately and independently for those active tcp flows that terminate at the same destination . if the optional step 202 has not been performed , step 203 is run separately and independently for all active tcp flows . at step 204 , for all flows with the same pipe capacity or with a pipe capacity that falls into the same predefined range of pipe capacities a window size is determined . step 204 can be performed several times until for each tcp flow a window size is determined . in an embodiment of the invention a window is one of an initial window , a loss window or a restart window . step 202 is described in more detail by means of fig3 a . after starting step 202 in the sub - step startddest , the destination of a connection is determined in the sub - step ddest . this can be performed for example by gaining information from the radio network . depending on which information from the mobile network is available to the window size determining unit and a preferred granularity , a destination can for example be one of a location area , a routing area , a cell , a service area or an area served by a radio network controller , a mobile services switching centre , a radio base station or a serving general packet radio service support node . after determining a destination for each connection the method shall be performed for , the step 202 is ended in the sub - step endddest . alternatively the sequence of steps or each of the steps 202 , 203 and 204 can be performed for a single destination , a group of destinations or all destinations . an advantage of this step 202 is that mobile terminals of the same destination share the same potential bottleneck link in the mobile network , and that different destinations have a different potential bottleneck link . thus , it can be expected that mobile terminals of the same destination with the same potential bottleneck link share some transmission characteristics . step 203 is depicted in more detail in fig3 b . when step 203 is started in sub - step startdpcap , the estimation of the round trip time of the connection rl 1 , rn 1 , l 13 between the parties p 1 , ue 1 is determined in a sub - step drtt . the round - trip - time is estimated for example based on knowledge about the network or experience collected on said network or compatible networks . in a further sub - step dbrate , the bit rate is determined of a link l 13 , rl 1 belonging to a path across which the connection between the parties is set up . the pipe capacity of a link is the minimum number of bytes a sending party needs to have in flight to fully utilize its available bandwidth . it can be calculated as the product of bit rate and round trip time in the sub - step dtcap . afterwards the step 203 ends in the sub - step enddpcap . in a preferred embodiment of the invention , the bit rate on the bottleneck link is determined for the estimation of the pipe capacity . in the depicted connection this is the radio link rl 1 . thus , the pipe capacity is simply the product of the radio bearer rl 1 bit rate and the round - trip delay between the proxy p 1 and the mobile terminal ue 1 . it is known to a person skilled in the art that the proxy p 1 can attain knowledge about the mentioned bit rate and round - trip delay associated with a specific tcp connection . for example , on request from the proxy p 1 the network for mobile telecommunications rn 1 could signal that information to the proxy p 1 , or the proxy p 1 could have access to a profile database where that information is kept . in an embodiment of the invention , connections with the same pipe capacity are grouped . in a preferred embodiment of the invention , in order to reduce the number of executions of the invented method , not only connections with exactly the same pipe capacity are treated equally , but also connections within a predefined range of pipe capacities . the fig3 c , 3 d , and 3 e are used to describe step 204 in more detail . the embodiment of step 204 as depicted in fig3 c comprises the sub - steps of starting the step startselwin , of determining an upper threshold value for a window size dupthresh , of selecting a window size , and of ending the step endselwin . the upper threshold value of a window size is determined as twice the pipe capacity of the connection the window is used for . a window size above twice the pipe capacity does not increase the performance of a connection . in the next sub - step selwin a window size is determined . said window size has a value above zero and below or equal to the upper threshold value . in a preferred embodiment of the invention , the value is higher than the pipe capacity of the connection . the higher the value , the smaller the loss of transmission capacity , but the risk of congestion or of losing packets increases . fig3 d depicts an embodiment of step 204 , with the additional sub - step store selected window size sselwin . the selected window size is stored to be reused for the same connection if a packet is lost . in an embodiment of the invention , the stored window size is stored together with an indication of the pipe capacity or the range of pipe capacities the connection belongs to and is used for another connection with the same pipe capacity or within the same predefined range of pipe capacities . in a preferred embodiment of the invention , the stored window size is stored together with an indication of the pipe capacity or the range of pipe capacities the connection belongs to and an identification of the destination for the connection , and the window size is used for another connection with the same pipe capacity or with a pipe capacity that falls into the same predefined range of pipe capacities only if it has the same destination . fig3 e depicts an embodiment of step 204 , with the additional sub - steps of receiving an indication of a packet loss recvpktloss and of selecting a new , smaller window size selswin . in the sub - step of receiving an indication of a packet loss recvpktloss , an indication is received that a packet of an initial flight was lost . an initial flight is a number of packets send in a first window after a set - up or a restart of a connection . if one of the packets sent in an initial flight is lost , congestion can be assumed . therefore , a new , smaller window size is selected in the sub - step selswin . in a preferred embodiment of the invention , the new window size is half the former window size unless the window size is already one maximum segment size . in the following the size of a window is measured in multiples of a maximum segment size to make it easier for a person skilled in the art to understand the invention . in a preferred embodiment of the invention the new selected window size is stored and used as described by fig3 d . fig3 f depicts an embodiment of the invented method with the additional steps of determining an increase of pipe capacity for a connection dipcap , selecting an increased window size for the connection seliwin , and of introducing the increased window size for the connection intseliwin . in the case that a pipe capacity of a connection is increased , for example because a radio link receives more bandwidth , an indication is sent to a window size selecting unit . the window size selecting unit selects a new window size for a congestion window in a step seliwin . a congestion window defines the number of packets that may be sent before an acknowledgement is received at the sender . the congestion window is set to the size of a loss window after a packet loss , of an initial window when a connection is set up , or of a restart window when a connection is restarted . during an active for example tcp connection , the congestion window size varies . it should be noted that the change of a window size changes the size of the first congestion window after a set - up of , restart of or packet loss on a connection . in the following embodiments however , the size of a congestion window is changed in the latter use of a connection . in a preferred embodiment the congestion window size is increased linearly until either an upper threshold value is reached or a congestion indication is received . if a congestion indication is received , the congestion window size reduced to about half its former value . at the step seliwin , the window size selecting unit determines whether there is already a window size stored for connections of the same pipe capacity or within the same range of pipe capacity as the increased pipe capacity . if so , the stored window size will be used for the congestion window size . in a preferred embodiment stored value will be used only if the identification of the stored destination for the value matches with an identification of the destination of the connection . if no stored window size is available , the new window size is selected as a value that is a multiple of the new pipe capacity . in a preferred embodiment of the invention , the new window size is in a range between the increased pipe capacity and twice the increased pipe capacity . the new window size is introduced for the use for the connection in a next step intselwin . in a first sub - step the upper threshold value for a window size is set to twice the increased pipe capacity plus or minus two maximum segment sizes . three alternative embodiments are introduced for introducing from there on in more detail . in a first and preferred embodiment of introducing the new congestion window size , the slow start threshold value of the connection is set to the selected window size value . this leads to a faster than linear increase of the congestion window size used for the connection . in a second embodiment , the congestion window used for the connection is set to the selected window size . by this , the new congestion window size is used immediately for the connection . in a third embodiment , no further action is taken which leads to a linear increase of the congestion window size . fig3 g depicts a sequence of additional steps that are implemented in an embodiment of the invented method . in a first step startmoni the sequence is started . in a next step moni connections with the same pipe capacity or with a pipe capacity that falls into the same predefined range of pipe capacities are monitored whether a congestion indication is received for an initial flight , a restart flight or a loss flight . a flight is a number of packets send within a congestion window . if the flight is the first flight sent after a set - up of a connection , it is called initial flight and the number of packets is related to the initial window size . if the flight is the first flight sent after a restart of a connection , it is called restart flight and the number of packets is related to the restart window size . if the flight is the first flight sent after a packet loss on a connection , it is called loss flight and the number of packets is related to the loss window size . the monitoring is performed for a certain predefined time interval or for a predefined number of connections set - ups or restarts . if the time for the monitoring expires or the predefined number of connection set - ups or restarts is reached , the monitoring is terminated . it is then assumed that the window sizes can be increased for future set - ups or restarts . therefore increased new window size values are determined in a next step sellwin . in a preferred embodiment of the invention , the window size is increased by a predefined constant value . the sequence of additional steps in ended in a step endmoni . fig4 depicts a window size selecting unit wssu 4 . said unit comprises an input / output unit 104 for receiving and sending data , a processing unit pu 4 for controlling and coordinating the other units , a selecting unit su 4 for selecting a window size , a store st 4 for storing window sizes , a comparing unit cu 4 for comparing stored pipe capacities and determined pipe capacities or the respective predefined ranges , and a destination determining unit ddu 4 . the units comprised in the window size selecting unit wssu 4 can be implemented as depicted in a single housing or may be distributed within a node or even among several nodes . the units may be realised by means of hardware of software or a combination of both . in an embodiment of the window size selecting unit wssu 4 a destination determining unit ddu 4 is optional . in another embodiment of the invention , the comparing unit cu 4 is adapted to compare stored destinations and determined destinations . in an embodiment of the invention , the initial window , the loss window and the restart window are of the same size . after booting of an entity that is adapted to act as a sending party , initial values are set for the initial window , the loss window and the restart window in said entity . an embodiment is to choose the pipe capacity as this initial value . a preferred embodiment is to choose the twice the pipe capacity as this initial value . | 7 |
an improved bag support for a riding mower grass collector according to this invention is generally identified as 1 . a grass directing hood 4 is attached to a framework 2 which is also the means for mounting the collector to mower 10 . framework 2 will be described later . mower 10 may be powered by an internal combustion engine or other means . the powering means drives a cutting element ( not shown ) which is enclosed within a housing 20 . the cutting element may be a conventional rigid blade or a monofilament for severing the grass . a flow of air is required for proper cutting as well as for transport of the clippings into the bag . the air flow also provides a vacuuming action which is used advantageously to vacuum up leaves and the like . typically , a rigid blade is equipped with an integral sail to generate air flow , while an auxiliary sail or fan may be used with a monofilament mower . in any case , the air flow generated conveys the clippings or leaves from within housing 20 , up a chute 22 from whence they are directed into bags 6 , normally filling from left to right . hood 4 is provided with various means for exhausting the generated air flow . in the present embodiment , a screen 24 within hood 4 prevents grass from escaping , but allows the air to escape forwardly of the bags . however , this is not claimed as a feature of the present invention . hood 4 supported on framework 2 is inclined upwardly from front to rear , corresponding generally to the angle of chute 22 , so there are a minimum of restrictions to the flow of entrained clippings from chute 22 into the bags 6 . this invention relates specifically to an inexpensive means for supporting a plurality of grass bags 6 on a grass collector , or alternately a larger leaf bag 80 , when the unit is used to vacuum up leaves . the invention also provides an easy and inexpensive means for removing and installing the bags . the bags are typically a loosely woven polyester , conforming to applicable governmental specifications , strong enough to contain sharp materials such as nails , pieces of wire , glass , etc . that may be picked up and thrown by the cutting element . grass bag 6 may be of any size or shape compatible with the collector hood 4 and frame 2 , but a generally square bag , large enough to hold a standard 30 gallon disposable plastic bag is preferred . leaf bag 80 will be described later . reusable bag 6 has a front 30 and rear 32 , a bottom 33 , two sides 36 and an open top 40 . bag 6 is constructed with front 30 shorter than the rear 32 and the top edge of sides 36 sloping upwardly to the rear as at 38 at approximately the same angle to the horizontal as the inclination of hood 4 , so that when the bag is in operative position , opening 40 will be parallel to inclined hood 4 , and bag 6 will hang vertically from framework 2 . see fig1 . a bag frame 8 has three continuous and coplanar sides 5 . the fourth side has an open space 44 at the center , bounded by a pair of parallel handles 12 extending peripendicularly outward from segments 45 of the fourth side adjacent open space 44 . segments 45 of the fourth side are at an angle of approximately three degrees from the plane of the remaining three coplanar sides 5 as best shown at 43 in fig1 . the purpose of the three degree inclination will be explained later . handles 12 are spaced so they can be grasped with one hand by an operator . frame 8 is of a slightly resilient material , preferably a steel rod , such that handles 12 can be squeezed together without undue effort , and will return to their normal position when released . bag frame 8 is formed and sized so that when two bags 6 are installed side by side on framework 2 as shown in fig1 frames 8 will fit snugly against each other and a portion of framework 2 so clippings will fall into the bags and will not leak out around the bags and onto the ground . bag 6 is preferably attached to frame 8 by folding a portion of the bag material over frame 8 and the material sewn to secure frame 8 within fold 7 . bag 6 is positioned on frame 8 so handles 12 are at the center of the long rear segment 32 of bag 6 . this orientation provides that handles 12 will be accessible at the rear of the unit and that bag 6 will hang vertically when installed . the short portion 41 of bag 6 between handles 12 is unsupported . a single tubular member is formed into a u - shaped configuration , and a front end piece 52 is welded or otherwise attached across the open end to form a rectangular framework 2 when viewed in top plan . front end 52 will be toward front of mower 10 when framework 2 is installed , with end 11 to the rear . long sides 9 are bent at an obtuse angle 23 as best shown in fig3 . the location of the bend is determined primarily by the front to rear dimension of leaf bag frame 82 as will be described later . the downwardly bent portion 19 provides means for mounting the entire collector assembly 1 to mower 10 . the remainder of framework 2 then extends rearwardly and upwardly at an angle approximating that of chute 22 . this is best shown in fig1 and 2 . the downwardly bent portion 19 is generally perpendicular to the ground when installed on mower 10 . at least two transverse support brackets 14 and 16 are attached to framework 2 at specific points to be discussed later and provide structural reinforcement to framework 2 as well as additional uses to be described below . diagonal braces 3 spanning obtuse angle 23 add strength to framework 2 . grass directing hood 4 is attached to the top of framework 2 . a first bag frame support bracket 14 is attached to tubular framework 2 transverse to the direction of travel and is coplanar with framework 2 , at a point forward of end 11 a distance substantially equal to the front - to - rear dimension of bag frame 8 . the location of bracket 14 as well as the shape of bag frame 8 ensures that bag 6 will fit snugly against tubular framework 2 to prevent grass spillage . in addition to acting as a grass bag support , bracket 14 gives structural support to framework 2 . this dual usage minimizes the structural elements required , thus contributing to a lower total weight and price of the assembly . bracket 14 is generally u - shaped , with open side 15 facing the rear for receiving bag frame 8 . open side 15 is wider than the cross sectional dimension of frame 8 so frame 8 can fit easily into opening 15 with bag 6 installed on frame 8 . bracket 14 has a notched out portion 46 at each end as shown in fig2 for a purpose to be described later . second bag frame bracket 16 is located transversely across frame 2 forward of rear end 11 at a point equal to the front - to - rear dimension of leaf bag frame 82 and in alignment with long sides 9 of framework 2 . in the preferred embodiment of this invnetion , bracket 16 is located at or very near the downward bend of framework 2 . this is best shown in fig1 and 2 . second bracket 16 is also u - shaped , with the opening 17 to the rear . opening 17 is wider than the cross - sectional dimension of leaf bag frame 82 so that frame 82 can fit easily into opening 17 with bag 80 installed on frame 82 . bracket 16 is also a structural support for framework 2 . mounting pins 50 on front end piece 52 and second bracket 16 fit through corresponding holes on mower 10 , and are secured by hairpin cotters or the like . thus , bracket 16 and front crosspiece 52 act as structural reinforcements as well as means for mounting the assembly to the mower . in addition , bracket 16 is the retainer for the front of leaf bag 82 . these multiple functions further contribute to a lightweight , inexpensive unit . a pair of handle brackets 18 is attached to end 11 . handle brackets 18 are located on end 11 in a position to receive handles 12 or 12 &# 39 ; when bags 6 or 80 are installed . each bracket 18 is mounted perpendicularly downward from end 11 and includes a narrow opening 60 leading into a slot 62 , the slot perpendicular to opening 60 . the portions of bracket 64 adjacent opening 60 are slanted inwardly toward the opening 60 as best shown in fig5 . opening 60 is wider than the width of handles 12 when they are squeezed together as shown at 66 in fig6 . slot 62 is narrower than the width of handles 12 in their normal position shown at 68 in fig5 . the lower outside corners of slot 62 have a radius 63 large enough to accept bag frame 8 . the portions of bracket 18 inside slot 62 adjacent both sides of opening 60 are slanted upwardly as at 70 toward opening 60 for a purpose to be described later . in the present embodiment of this invention , each of the two bag frame brackets 18 accommodate the pair of handles 12 of two grass bags 6 when bags 6 are installed side - by - side as shown in fig1 or each bracket accepts one handle 12 &# 39 ; of leaf bag 80 as shown in fig8 . to install grass bags 6 , the portion of bag frame 8 opposite handle 12 is inserted into open side 15 of first bag support bracket 14 , bag 6 pivoted upwardly and handles 12 squeezed together as at 66 in fig6 . handles 12 are then inserted into opening 60 , being guided by the slanted portions 64 . when handles 12 are in slot 62 , they are released as shown in fig7 . the resilience of frame 8 holds handles 12 in slot 62 since slot 62 is narrower than the normal spacing 68 of the handles . radius 63 and upward slopes 70 as well as the biasing force of bag frame 8 help nestle handles in place in slot 62 for a positive securement . as mentioned previously , bag frame 8 is configured to fit snugly against framework 2 so clippings will be deposited directly into the bags and not onto the ground . the three degree inclination 43 of segments 45 of frame 8 adjacent handles 12 requires that segments 45 must be biased against the resilience of frame 8 into coplanar alignment with the three coplanar sides , in order to allow handles 12 to be inserted into the slot 62 of bracket 18 . in effect , the edges of slot 62 act as a fulcrum , which transmits the biasing force against framework 2 when handles 12 are secured in bracket 18 . this is best illustrated in fig5 and 7 . this biasing action contributes substantially to a sealing fit of frame 8 against framework 2 . a desirable feature of this invention is that a disposable plastic bag 71 can be inserted into reusable fabric grass bag 6 as shown in fig1 , and retained without retainer cords or other fasteners . the top edge of plastic bag 71 can be merely folded over bag frame 8 . the snug fit of bag frame 8 to tubular framework 2 holds plastic bag 71 in place . when filled , plastic bag 71 can easily be removed from the regular bag , and disposed of in a conventional manner . when inserting plastic bag 71 into reusable bag 6 , handles 12 may be inserted into brackets 18 from the front so bag 6 will be supported rearwardly from framework 2 to facilitate inserting plastic bag 71 . when plastic bag 71 is inserted , bag 6 is to be returned to its operative position . the bag support structure of this invention has an additional significant advantage . a single large leaf bag 80 as illustrated in fig8 can be installed to tubular framework 2 in place of smaller grass bag 6 . leaf bag 80 would normally be used for a specialized function , such as vacuuming up leaves or the like . leaf bag 80 is constructed in much the same manner as grass bag 6 . leaf bag 80 consists of a front side 30 &# 39 ;, a rear side 32 &# 39 ; longer than front side 30 &# 39 ;, a bottom 33 &# 39 ;, two sides 36 &# 39 ; and an open top 40 &# 39 ;. sides 36 &# 39 ; are cut with the top edge 38 &# 39 ; sloping upwardly from front to rear at the same angle to the horizontal as framework 2 , so that when leaf bag 80 is installed , it will hang vertically . bag frame 82 consists of two sides 84 and front end 85 of frame 82 which are continuous and coplanar , while the rear end has an open space 86 at the center . space 86 is bounded by a pair of handles 12 &# 39 ; extending perpendicularly outward from said frame . segments 87 of rear side adjacent space 86 are inclined at an angle approximately three degrees from the plane of sides 84 and front end 85 ( similar to the angle shown at 43 in fig1 ) for a purpose to be explained later . bag frame 82 thus extends around the top edge of sides 36 &# 39 ;, front 30 &# 39 ;, and a portion of rear side 32 &# 39 ; leaving space 86 between handles 12 &# 39 ;. frame 82 conforms to the area of framework 2 bounded by sides 9 , rear end 11 , and second bracket 16 . this conformation will ensure that leaf bag will , in effect , create a seal with framework 2 when installed , so that leaves will not leak out onto the ground . frame 82 includes tubular members 88 and 88 &# 39 ; adjacent each handle to receive rod 90 which extends across space 86 between handles 12 &# 39 ;. rod 90 is inserted through tubular members 88 and 88 &# 39 ; to support the portion of bag 80 that extends across space 86 , preferably by means of a hem 91 through which rod 90 may be inserted . rod 90 extends beyond tubular member 88 an amount greater than the width of slot 62 in bracket 18 . rod 90 is secured to tubular member 88 &# 39 ; by roll pins 92 or other means of securement . rod 90 is thus free to slide in unsecured tubular member 88 , so that handles 12 &# 39 ; can be biased toward each other so they may be inserted into bag frame brackets 18 . as stated previously , handles 12 &# 39 ; are spaced wider than the outside ends of slot 62 so the resilience of frame 82 will hold handles 12 &# 39 ; firmly in slot 62 , in the pocket formed by radius 63 and inclined portions 70 . bag 80 is affixed to frame 82 by folding a portion of the material of bag 80 around frame 82 at the periphery of opening 40 &# 39 ;, and sewing a hem 89 to secure bag 80 to frame 82 . another hem 91 encloses rod 90 so bag 80 is supported around its entire open end 40 &# 39 ;. bag 80 is positioned on frame 82 so handles 12 &# 39 ; will be located at long rear side 32 &# 39 ; of bag so bag will hang vertically when installed . frame 82 is dimensioned so handles 12 &# 39 ; will be located to engage in existing bag frame brackets 18 . handle spacing 86 is slightly wider than the horizontal distance between the outer edges of the pair of brackets 18 . wider spacing 86 is required so the resilience of frame 82 can be utilized to hold handles 12 &# 39 ; in brackets 18 . leaf bag 80 is installed by placing the portion of bag frame 82 opposite handles 12 &# 39 ; into opening 17 of second support bracket 16 , with bag 80 centered so handles 12 &# 39 ; are aligned with bag frame brackets 18 , then pivoting bag 80 upwardly and biasing handles 12 &# 39 ; toward each other so they can be inserted through opening 60 and into slot 62 , one handle 12 &# 39 ; into each bracket 18 . notches 46 in first support bracket 14 are located to allow sides of bag frame 82 to pass therethrough when leaf bag 80 is installed , so that frame 82 will fit snugly against framework 2 so leaves will be deposited in bag 80 and not on the ground . radius 63 and upwardly sloped portion 70 of bracket 18 cooperate with the outward biasing action of resilient bag frame 82 to hold handles 12 &# 39 ; firmly in place on bracket 18 . inclined segments 87 of fourth frame side are forced into coplanar alignment with the sides 84 and front 85 when handles 12 &# 39 ; are placed in bracket 18 . the resilience of frame 82 applies a biasing force on handles 12 &# 39 ; in slot 62 , the edge of slot 62 acting as a fulcrum whereby said force is transferred into an upward biasing force to seal frame 82 against framework 2 . bag 80 is thus supported in a position to receive leaves or the like . to remove the bag , merely move handles 12 &# 39 ; toward each other and remove them through opening 60 and withdraw frame 82 from bracket 16 . the leaves may then be disposed of in a conventional manner . while a preferred embodiment of the present invention has been described , various modifications and alternatives will be apparent to those skilled in the art after reading the foregoing description . for example , the bags and the corresponding portions of the frame and framework may be of any corresponding shape and size . thus , it can be seen that changes may be contemplated without departing from the spirit and scope of the appended claims . | 0 |
the torque available in a self - igniting internal combustion engine for the purpose of accelerating a vehicle driven with a combustion engine is limited , especially by the permissible extent of smoke buildup in the exhaust gas . smoke development in the exhaust gases is dependent first on the fresh - air quantity delivered to the engine and second on the injected fuel quantity -- that is , on the air number λ . smoke development is furthermore dependent on the relative position of the onset of injection to top dead center . smoke - free operation of a self - igniting engine is an extremely important goal . if such an engine is now operated with an exhaust turbocharger , then when the engine is supposed to be brought from relatively low rpm to higher rpm , that is , during acceleration , the inertia of the exhaust turbocharger causes the pressure in the intake tube between the exhaust turbocharger and the engine to drop to 0 . 8 - 0 . 9 bar . however , this in turn means that there is a relatively small quantity of air available to the engine , and in order not to exceed the smoke limit only an equally limited fuel quantity can be injected into this quantity of air . the reduction of the charge precisely during acceleration has a very negative effect on the acceleration of vehicles equipped with engines of this kind . referring now to the drawings , there is shown in fig1 the interrelationship of the average combustion - chamber pressure , the air number λ , and the onset of injection . in this instance , the measurement was made at 1000 rpm and an intake tube pressure of 0 . 9 bar -- that is , the condition where the engine is to be accelerated out of an idling rpm , for instance . the solid line represents the course of the average combustion - chamber pressure over the air number λ for an injection onset at 10 ° before top dead center , while the broken line represents the course of pressure at 20 ° before top dead center . the arrows variously indicate the point at which the permissible smoke limit is exceeded , which is in the order of magnitude of a ( bosch ) blackness number ( szb ) of 3 . 5 . it can clearly be seen that at the earlier injection onset a substantially higher average combustion - chamber pressure can be attained ( with the same amount of smoke ) and that the permissible blackness number is only exceeded after a further enrichment with fuel . however , it is a disadvantage that the steeper pressure increase with an earlier onset of injection has a deleterious effect on engine noise . still , the periods during which the engine is in a state of acceleration as described above are relatively short , and so it is possible to approach the permissible threshold values much more closely than would be the case during substantially stationary operation of the engine , with the injection quantity and instant of injection being set for reliable , smokefree operation with low noise emission . the temporary adjustment of the onset of injection during acceleration phases according to the invention can be effected by means of an embodiment as shown in fig2 . this figure shows the injection onset adjustment device of an injection pump , which is not shown in detail , having an injection adjustment piston 1 displaceably disposed in a closed cylinder bore 2 and on one end enclosing a control pressure chamber 4 . on the other end , the injection adjustment piston 1 is under the influence of a restoring spring 5 disposed in a relief chamber 6 enclosed by the injection adjustment piston 1 . the injection adjustment piston 1 is connected in movable fashion with an adjuster arm 8 which actuates a supply onset device , not shown in detail , of the injection pump . in a known manner , the control pressure chamber communicates continuously via a line 10 containing a throttle 9 with a control pressure source having a pressure controlled in accordance with rpm . in many known embodiments of injection pumps , this control pressure source is the suction chamber of the injection pump . then the line 10 can be disposed in the injection adjustment piston 1 itself , for instance , and can communicate with the suction chamber via an aperture 11 which is provided between the cylinder bore 2 and the suction chamber in order to displace the adjuster arm 8 into the suction chamber 12 of the injection pump . the relief chamber 6 serves to receive the quantity of leakage fuel which is carried back to the fuel supply container 15 via a relief line 14 . from the control pressure chamber 4 , a connecting line 16 leads to a work chamber 17 of a pump device 18 . the pump device 18 has a pump piston 20 in a closed cylinder 19 , and the pump piston 20 is connected via an actuation rod 21 with the gas pedal 22 . the pump piston 20 , on one end in the cylinder 19 , encloses the work chamber 17 and on the other end encloses a pressure chamber 23 . the pressure chamber 23 communicates at all times via a pressure line 24 with the suction chamber 12 of the injection pump , that is , with the control pressure source . a first longitudinal bore 25 is provided in the pump piston 20 , connecting the work chamber 17 with the pressure chamber 23 . a first throttle 26 is located in the longitudinal bore 25 . a second longitudinal bore 27 is also provided , which in like manner connects the work chamber 17 with the pressure chamber 23 . a check valve 28 is disposed in this second longitudinal bore 27 or at one of its ends . the check valve 28 is preferably embodied as a flutter valve and it opens in the flow direction toward the work chamber 17 . when the gas pedal 22 is moved in the direction of full load -- that is , when acceleration is to be performed -- the pump piston 20 is adjusted such that the volume of the work chamber 17 is reduced . during the adjustment movement , the check valve 28 is closed for a brief instant . this valve also responds to a very slow adjustment movement of the pump piston 20 . if the fuel quantity forced out by the pump piston 20 is larger than the fuel quantity which can flow back into the pressure chamber 23 via the first throttle 26 in order to equalize pressure , then there is a pressure increase in the work chamber 17 and in the control pressure chamber 4 . this increase in pressure causes a displacement of the injection adjustment piston 1 counter to the force of the restoring spring 5 and thus causes a shift of the onset of injection by the injection pump to a larger angle before top dead center or toward &# 34 ; early &# 34 ;. because the increased control pressure after the end of the adjustment movement of the pump piston 20 can be equalized via the first throttle 26 and the throttle 9 , the injection adjustment piston 1 returns to its original position after a period of time determined either by the size of the throttles 9 and 26 , the magnitude of the restoring force , or the amount of deflection of the injection adjustment piston 1 . the process described represents a hydraulic differentiation of the speed of the change in load . at the same time , the adjustment force required for the injection adjustment piston 1 is generated by the movement of the gas pedal 22 . the adjustment time is in direct proportion to the speed and dimension of the change in load . if the gas pedal 22 is retracted , that is , set for a smaller load , then the volumetric enlargement of the work chamber 17 is compensated for instantaneously via the second longitudinal bore 27 , so that there is no influence exerted on the control pressure in the control pressure chamber 4 . the embodiment of the invention as described above very simply and reliably provides an apparatus with which the onset of injection can be shifted toward &# 34 ; early &# 34 ; during an instance of acceleration . after the expiration of the acceleration phase , the control of the injection adjustment piston 1 is effected in an unchanged , conventional manner , so that the injection onset values for normal , substantially stationary operation are not affected . the deflection of the injection adjustment piston 1 is limited by a stop 29 . this is important for the case where several repeated pumping movements are performed with the pump piston 20 . in order to avoid an impermissible increase of the pressure in the work chamber 17 and the control pressure chamber 4 , a pressure - limiting valve 30 is also provided , which relieves the system comprising control pressure chamber 4 and work chamber 17 toward the suction chamber 12 . this avoids the establishment of injection onset values located at an excessive distance before top dead center in case there is uncontrolled actuation of the gas pedal . naturally , the acceleration signal can be attained by electrical means in place of the hydraulic process described above . then the gas pedal travel distance covered is differentiated and an adjustment of the injection adjustment piston 1 effected in accordance with the acceleration signal thus obtained by electric or electronic means . this can be applied in particularly advantageous fashion if the adjustment of injection onset is already effected electrically for normal operation , such as is described in german offenlegungsschrift no . 22 10 400 . in a system of this kind , a separate control adjustment can be made with the acceleration signal . the acceleration signal naturally can be obtained at other locations in the system as well , for instance at the quantity adjustment device of the injection pump . if the acceleration signal is obtained as an electrical signal , then the duration of the adjustment toward &# 34 ; early &# 34 ; of the injection adjustment piston 1 or of the onset of injection can be determined in an advantageous manner via a timing element . with this timing element , the inertial behavior of the turbocharger can be taken into account . the first exemplary embodiment shown in fig2 was realized with a purely hydraulic injection adjuster such as that found conventionally in a majority of injection pumps . the acceleration signal itself was used as the control variable , no substantial changes in the structure of the injection pump having been necessary . a different possibility for adjusting the instant of injection is shown in fig3 . there , a modified injection adjustment piston 1 &# 39 ; is provided , which is embodied as a stepped piston . the piston section 32 having the larger diameter corresponds to the embodiment of the injection adjustment piston 1 in fig1 . as in fig1 it encloses in a corresponding cylinder bore 2 &# 39 ; a control pressure chamber 4 , which communicates at all times with the suction chamber 12 of the injection pump via a line 10 in the piston section 32 and via the aperture 11 . the adjuster arm 8 is also coupled with the piston section 32 . however , in this instance , the cylinder bore 2 &# 39 ; is embodied as a stepped cylinder bore , while the cylinder bore section 33 having the smaller diameter serves to receive the correspondingly smaller stepped piston section 34 . within the cylinder bore section 33 , this piston section 34 encloses the relief chamber 6 , which communicates via the relief line 14 with the fuel supply container 15 . as in the foregoing embodiment , the restoring spring 5 is disposed in the relief chamber 6 , here acting upon the smaller stepped piston section 34 . an annular compensation work chamber 37 is enclosed in the larger stepped bore section 35 between the end face 36 of the larger stepped piston section 32 remote from the control pressure chamber 4 and the smaller stepped piston section 34 . this compensation or relief work chamber 37 communicates at all times with the suction chamber 12 , or with the control pressure source in general , via a bore 39 containing a throttle 40 . the bore 39 may extend , for instance , in the larger stepped piston section 32 and , similarly to the line 10 , may communicate with the suction chamber 12 via the aperture 11 . from the compensation work chamber 37 , a second relief line 41 also leads to the fuel supply container 15 . a valve 42 is disposed in the second relief line 41 , being embodied here as a magnetic valve . the magnetic valve is triggered by a control device 43 , which receives as its control signal a voltage change signal obtained at the gas pedal 22 . this may be effected , for instance , via a potentiometer coupled with the gas pedal 22 . first , in a known manner , the rpm - dependent control pressure is fed into the control pressure chamber 4 via the line 10 and the injection adjustment piston 1 &# 39 ; is accordingly displaced counter to the force of the spring 5 until such time as there is a balance of forces on the piston 1 &# 39 ;. when the valve 42 is closed , the effective surface area is the area of the end face on the side toward the control pressure chamber minus the area of the end face 36 on the side toward the relief chamber 6 . the relief work chamber communicates at all times via the throttle 40 with the control pressure chamber 12 . as long as there are no abrupt changes in control pressure , the same pressure prevails in the relief work chamber as in the control pressure chamber 4 . now in order to adjust the onset of injection , the valve 42 is opened in response to an appropriate acceleration signal , so that the compensation work chamber 37 is relieved of pressure . the hydraulic force exerted upon the stepped piston section 32 is correspondingly greater , so that the injection adjustment piston 1 &# 39 ; is displaced still further counter to the force of the restoring spring 5 . thus values are attained for onset of injection which are located , for instance , at 20 ° before top dead center . in this embodiment , the acceleration signal is obtained by electrical means in an advantageous manner . the voltage picked up at the potentiometer 44 is differentiated and compared with a minimum value characterizing the load change beyond which an adjustment of injection onset is necessary . upon exceeding this set - point value , a timing device is set , over the operating time of which the magnetic valve 42 is opened . with the aid of the timing device , a minimum duration of the injection onset adjustment advantageously can also be established during accelerations of brief duration , with this duration of injection onset adjustment being in proportion to the time and inertia behavior of the turbocharger . naturally the acceleration signal also can be obtained as an analog signal with an appropriately embodied control device 43 and the valve 42 can be opened analogously to this signal . this is particularly advantageous because it makes it possible to take into account changes in load which are both rapid and large in extent . a further possibility for control intervention in adjusting the onset of injection is in varying the restoring force on the injection adjustment piston . here , the initial tension of the restoring spring 5 can be varied , for instance by electrical or electronic means . devices for varying the restoring spring are known , for instance from german offenlegungsschrift no . 27 16 307 ; however , the restoring force in that case is varied in accordance with the operating temperature of the engine . in the above exemplary embodiments , the acceleration signal was attained either electrically or hydraulically . a further possibility for obtaining the signal is to use the pressure increase before the turbine of the exhaust turbocharger in the acceleration phase as a control value . just as the pressure drops downstream of the turbocharger , so the exhaust counterpressure increases before the turbine , as a result of the sluggish behavior of the exhaust turbocharger , whenever there is an increased expulsion of gas as a result of a fuel enrichment . this behavior is shown in diagram form in fig5 with time t 1 marking the onset of acceleration . fig4 illustrates an apparatus for obtaining the acceleration signal . a pneumatic servomotor is provided , which in the illustrated embodiment is a pressure box 47 and in which an adjusting diaphragm 48 encloses a control pressure chamber 49 . the control pressure chamber 49 communicates with the exhaust pipe of the engine upstream of the turbine of the exhaust turbocharger . on the side of the diaphragm 48 remote from the control pressure chamber 49 , the diaphragm is stressed by a compression spring 51 supported on the housing 50 of the pressure box 47 . a transmission member 52 in the form of an actuation rod is firmly connected with the diaphragm 48 , being guided in a sealed manner out of the control pressure chamber and having a valve closing member 53 on its opposite end . the valve closing member 53 cooperates with a valve seat 54 , which is formed by the end of a second relief line 41 &# 39 ; discharging into a collector line 55 leading to the fuel supply container . this relief line 41 &# 39 ; corresponds to the second relief line 41 of the embodiment shown in fig3 . the valve 42 and control device 43 provided in that embodiment can be replaced by the embodiment shown in fig4 . the differentiation effect is brought about in this case by the communication of the control pressure chamber 49 , via a throttle bore 56 , with the atmosphere . the throttle bore may either be disposed in the diaphragm 48 , in which case the chamber including the compression spring 51 communicates via an aperture 57 with the atmosphere , or the throttle bore can be provided directly in the housing wall defining the control pressure chamber 49 . the throttle assures that the diaphragm 48 is deflected , beyond a certain magnitude of dynamic change of the exhaust counterpressure , and the second relief line 41 &# 39 ; is opened toward the fuel collection container . fig6 shows a further embodiment of the examples according the invention discussed at the outset . in an engine driven with an exhaust turbocharger , a full - load stop adjustable in accordance with charge pressure , also called a manifold - pressure compensator , is provided in the injection pump for the purpose of adaptation of the injection quantity . as a result of this feature , as described at the outset , the injectable fuel quantity is greatly reduced during acceleration in accordance with the low charge pressure . as a result of the above - described adjustment of the injection onset , it was possible to attain higher power outputs in the engine , with an identical fuel injection quantity . the output during acceleration can be still further increased , however , by injecting somewhat more fuel than would be predetermined by the full - load stop controlled in accordance with charge pressure . the adjustment apparatus for the full - load stop is designed such that a sufficiently great safety margin is kept to prevent smoking combustion . from fig1 it can be seen that in the case of an adjustment of the injection onset toward &# 34 ; early &# 34 ; the permissible smoke limit approaches closer to an air number λ = 1 . 0 . in this sense it is possible to supply somewhat more fuel to the aspirated air , and this can make a further contribution toward increasing power output in accordance with the invention . accordingly , in the apparatus shown in fig6 the control variable of the manifold - pressure compensator is affected simultaneously with the acceleration signal . the full - load stop here has a pneumatic servomotor 59 in the form of a pressure box , in which an adjusting diaphragm 60 encloses a pressure chamber 61 which communicates via a throttle 62 with the intake tube 63 of the engine downstream of the turbocharger . the adjusting diaphragm 60 is stressed on the side remote from the pressure chamber 61 by a restoring spring 64 and is firmly connected with an actuation member 66 , which adjusts the full - load stop of the injection pump 67 in a known manner . an adjustable stop 68 provided in the pressure chamber 61 prevents an excessive adjustment of the full - load stop or an excessive leaning down of the fuel mixture when there is no pressure in the pressure chamber . to this extent , this exemplary embodiment corresponds to the conventional embodiment of a charge - pressure - controlled full - load stop or manifold - pressure compensator . the pressure chamber 61 further communicates with the atmosphere via a discharge line 69 . a second throttle 70 is provided in the discharge line 69 , and there is a further valve 71 downstream , which is embodied by way of example as a magnetic valve . this magnetic valve , in the same manner as the magnetic valve 42 in the embodiment of fig3 receives a control signal from the control device 43 and is closed when this control signal is present . when the valve 71 is open , the adjustment characteristic of the manifold - pressure compensator is fixed with the aid of the throttles 62 and 70 and the effective diaphragm surface area of the adjusting diaphragm 60 in proportion to the force of the restoring spring 64 . an average pressure value determined by the pitch ratio of the throttles 62 and 70 , that is by the ratio of the different minimum cross sectional areas of the throttles 62 and 70 , is established in the pressure chamber 61 , which is lower than the maximum charge pressure prevailing at that time so long as the valve 71 is opened . by closing this valve 71 , the full charge pressure reaches the pressure chamber 61 , as a result of which a higher charge pressure per se is simulated , and the full - load stop is adjusted in accordance with this simulated charge pressure . as a result of this embodiment , a supplementary amount of torque is obtained by increasing the injection quantity during the acceleration phases , without great additional expense . the foregoing relates to three preferred exemplary embodiments of the invention , it being understood that other embodiments and variants thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims . | 5 |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.