text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
preferred embodiments of the present invention will be described in detail herein below with reference to the annexed drawings . in the following description , a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear . a preferred embodiment of the present invention provides a basic menu plane enabling a user to easily select menu icons , a menu extension mechanism , a menu movement method , and a menu access mode for a high - level user . [ 0024 ] fig2 is a block diagram illustrating a mobile communication terminal according to an embodiment of the present invention . referring to fig2 a control unit 100 controls the overall operation of the mobile communication . in addition , the control unit 100 forms a basic menu plane as will be described below in detail , and enables a display unit 140 to display the basic menu plane . further , the control unit 100 dynamically generates or removes a menu plane each time a predetermined number of items , for example , four menu items are added or removed , respectively . when the user moves a menu selection box along menu icons so that the menu selection box moves from a first menu plane , displayed in the display unit 140 , to a second menu plane , the control unit 100 enables the display unit 140 to display a dynamic three - dimensional image , a moving hexahedron or other polyhedron that selectively includes first , second , third , . . . , etc . menu planes . that is , as illustrated in fig3 b , as the menu selection box moves from a first menu plane to a second menu plane , the hexahedron or other polyhedron rotates to show one menu plane initially and then another menu plane . the display unit 140 displays various messages , etc ., under the control of the control unit 100 . for example , the display unit 140 is a lcd ( liquid crystal display ), or tft ( thin film transistor ) lcd . an interface unit 120 includes a plurality of number and function keys , and transmits input data , corresponding to a key selected by a user , to the control unit 100 . for example , the interface unit 120 may include up / down / left / right arrow keys for enabling movement of the menu selection box in the basic menu plane displayed on the screen of the display unit as described above . such an interface unit 120 may include a commonly used key matrix or touch screen . when the interface unit 120 is embodied with a touch screen , a plurality of number keys , function keys , and arrow keys , etc ., displayed on the touch screen , may be selected by an input instrument such as a stylus pen . [ 0026 ] fig3 a is a view illustrating a basic menu plane , and fig3 b is a view illustrating a cursor movement between menu planes displayed in the display unit . referring to fig3 a and 3b , the basic menu plane 210 has a rectangular image , equally divided into 9 parts , for example , that is displayed when the user pushes a menu key . a basic menu plane 210 includes a menu icon box 215 positioned in the center , and four user menu registration slots 212 , 214 , 216 , and 218 to which the menu selection box can move from the menu icon box 215 by selecting or pushing a key once . a menu icon is disposed in each of the user menu registration slots 212 , 214 , 216 , and 218 . the control unit 100 disposes a management menu item of mobile communication terminal in the menu icon box 215 in the center . a management menu in the menu icon box 215 includes submenus for defining functions related to a user - menu setting such as user menu registering , removing , and moving functions , changing icons , and changing of a menu item name . the management menu is referred to as a terminal management menu . in addition , the terminal management menu may further include a function of setting high / low - level user modes . a user menu may be added , for example , in a start - menu registration portion of the terminal management menu , and may be deleted in a start - menu deletion portion thereof . in addition , the user menu icons may be changed , for example , in a main - screen setting portion thereof . menu registration icon boxes in the basic menu plane 210 , which can be set by a user , comprise four user menu registration slots 212 , 214 , 216 , and 218 to which the menu selection box can move from the menu icon box 215 by selecting or pushing a key once . accordingly , as the number of menu items registered by the user exceeds 4 , a new menu plane is generated . a menu item in the center of the new menu plane also becomes the terminal management menu item . also , when a number of new menu planes are generated , the terminal management menu is always positioned in their menu registration slot in the center . further , the control unit 100 generates or removes a menu plane dynamically each time four menu items are added or removed . in addition , the control unit 100 enables the user to move the menu selection box from one menu plane to other menu plane using a direction key or a menu key . in detail , provided that the menu selection box or a curser is positioned at one of the user menu registration slots 212 , 214 , 216 and 218 shown in fig3 a , selecting or pressing a direction key from the menu slot where the cursor is positioned enables movement of the cursor to another menu plane . for example , if the up arrow key is pushed when a cursor is positioned on the user menu registration slot 212 of a menu plane 210 , then the cursor moves to the menu registration slot 228 of the menu plane 220 . if the right arrow key is pushed when the cursor is positioned on the user menu registration slot 216 of the menu plain 210 , then the cursor moves to the menu registration slot 224 of a menu plain 220 . referring to fig3 a , if a user pushes the up arrow key when a user cursor is positioned on the user menu registration slot 212 of the basic menu plain 210 , then the menu plain 220 is displayed on the screen of the display unit 140 . herein , the cursor is basically positioned on the lower menu slot 228 of the menu plain 220 in case of moving to the menu plain 220 from the user menu registration slot 212 previously positioned . if there is no registered menu in the menu slot 220 , then the cursor is positioned on the menu icon box 225 of the menu plain 220 . here , when the cursor or the menu selection box moves from one menu plane to another menu plane , an upper one 212 of four menu registration slots of said one menu plane 210 is connected to a lower one 228 of four menu registration slots of said another menu plane 220 . in addition , a lower one 218 of the four menu registration slots of said one menu plane 210 is connected to an upper one ( it is not shown in fig3 ) of the four menu registration slots of said another menu plane , and a left one 214 of the four menu registration slots of said one menu plane 210 is connected to a right one ( it is not shown in fig3 a ) of the four menu registration slots of said another menu plane . finally , a right one 216 of the four menu registration slots of said one menu plane 210 is connected to a left one 224 of the four menu registration slots of said another menu plane 220 . that is , the menu is configured as if a number of menu planes are spatially connected to each other . actually , the connection is made within the user &# 39 ; s thought , not the real space . in detail , the position of the menu planes is not specified in real space , but the position of the next or subsequent menu plane is determined according to the user &# 39 ; s thought process . further detail regarding the menu item connections will be described with reference to fig4 and 5 hereinafter . here , if there is no menu item registered in the menu registration slot in said another menu plane , connected to the menu registration slot in said one menu plane , the cursor or the menu selection box moves from the menu registration slot in said one menu plane to a terminal management menu in the center of said another menu plane . if there is no registered menu in the menu slot where the cursor is to be positioned and the previous menu plain is continued upon a cursor moving from the basic menu plain to one of other menu plains by a key input of a user according to the above - mentioned movement rule , then the cursor is positioned on the menu icon box 215 in order to reduce the unnecessary key input . in addition , in response to the inter - plane cursor movement , the control unit 100 enables the display unit 140 to display a rotating three - dimensional image , a hexahedron or other polyhedron including one menu plane and another menu plane , such that its front view is changed from said one menu plane to said another menu plane as illustrated in fig3 b . in a preferred embodiment , the maximum number of menu items in one menu plane , which can be registered by a user , is four . if the user registers an additional menu item , with four menu items previously registered by the user , the control unit 100 generates a new menu plane internally , and registers the additional menu item . here , the number of the additional menu item registered by the control unit 100 is one . however , when the user moves the cursor to the new menu plane using the direction key , the control unit 100 enables the new menu plane to inherit three menu items from said one menu plane , besides the one additional menu item . that is , when there are empty menu slots in the new menu plane , in which no menu item is registered , the control unit 100 displays the menu items in the previous menu plane corresponding to the empty menu slots in position in the empty menu slots . the menu item &# 39 ; s inheritance is to give the user a further chance to select a menu rather than keep the empty menu slots as they are , thereby reducing unnecessary movements of the cursor . according to the present invention , there is no limit on the maximum number of menu planes . however , when permitting a short key access by using number keys provided in the mobile communication for the user &# 39 ; s convenience , it may be preferable to set the maximum number of the menu planes to three . according to the present invention , in one embodiment , the control unit 100 may dispose four basic menu items as a default in the first menu plane . in addition , a user may change the default menu items to other menu items , but not delete them . this limitation on the deletion is to provide the user with at least one menu plane when the user pushes the menu key , consequently providing the user with complete gui service and basic accessibility to the menu functions . in this case , when a user adds a new menu item to the existing menu items , the control unit 100 automatically generates a new menu plane , and registers the new menu item to the new menu plane . it is to be noted that newly added menu items are registered in each menu plane in sequence of menu slots 212 → 214 → 216 → 218 , referring to fig3 a . in one embodiment , when there are three menu planes , the maximum number of menu items that may be registered is twelve , and access to each menu item may be made by using a number key corresponding to a number assigned to each menu item . [ 0036 ] fig4 illustrates where a menu item is added according to an embodiment the present invention , and fig5 illustrates where there are three menu planes according to an embodiment of the present invention . referring to fig2 to 5 , the control unit 100 enables a user to register , delete , and change a user menu in a terminal management menu positioned in the center of the menu plane . when the user registers a new menu in the terminal management menu , a new menu plane is generated internally , and the registered menu item is placed in the upper menu slot of the second menu plane . for example , when additional menu items are registered ( for example , menu 9 ) after finishing the registration up to a menu 8 on menu plane 2 220 , the control unit 100 generates a new menu plane 3 as indicated by numeral 230 in fig5 and enables its empty menu slots to inherit the corresponding ones from the menu plane 2 220 . when a menu item in any position is deleted , the control unit 100 automatically realigns the menu items of each menu plane , and removes an unnecessary menu plane by the menu plane &# 39 ; s deletion . when there is no menu item additionally registered by the user in the menu plane 1 210 , the cursor movement between menus occur in this menu plane only . in a case where a user registers an additional menu to generate the menu plane 2 220 , the user may move a cursor to the menu plane 2 220 by pushing a direction key from the menu plane 1 210 . when , upon moving from the menu plane 1 210 to the menu plane 2 220 , there is no menu item in the new position , the new position inherits the corresponding menu item from the previous menu plane as shown in fig4 and the cursor is placed in the terminal management box in the center . on the other hand , if there is a registered menu item in the new menu plane , the cursor is placed in the registered menu item . when three menu planes are formed as illustrated in fig5 when the user moves a cursor from the “ menu 2 ” to “ menu 7 ”, a cursor movement back to the previous menu plane is allowable through “ menu 7 ”. that is , when a cursor movement is made between menu planes , the cursor movement &# 39 ; s path is stored in a memory in the mobile communication terminal , so that a user may move a cursor between the menu planes along the path . in fig5 if a user pushes the left arrow key when the cursor is positioned on menu 2 of the menu plain 210 and the cursor moves to the menu plain 220 , then the cursor is to be positioned on menu 7 of the menu plain 220 . herein , the menu 7 of the menu plain 220 is a menu slot connected to the previous menu plain 210 . such a menu slot connected to other menu plain is referred to as entry point . the menu slots of the entry point are varied on the number of menu plain . if the right arrow key is pushed in menu 7 , the cursor moves to the menu plain 210 . and , in movement of the cursor by a direction key at the remaining menu slots menu 5 , menu 6 and menu 8 of the menu plain 220 , if there is a menu plain other than the menu plain 210 , the cursor moves to the menu plain . for example , in fig5 the cursor positioned on menu 5 , menu 6 and menu 8 moves to other menu plain , i . e ., the menu plain 230 . however , if there is no menu plain 230 and there is only two menu plains 210 and 220 , the cursor should move only to the menu plain 210 from the menu plain 220 . selecting any one of direction keys with the cursor placed on a menu item in the menu plane 2 220 , other than the right direction key at “ menu 7 ”, moves a cursor to a new menu plane , i . e ., a menu plane 3 230 . similarly , selecting any one of direction keys with the cursor placed on a menu item in the menu plane 3 230 , other than the right direction key at “ menu 11 ”, moves a cursor to the menu plane 1 210 . subsequent operations are performed in the same manner . when a user pushes the menu key the first time , no previous menu plane exists , and therefore all the next planes become the menu plane 2 220 . however , when the user continues to push the direction key , reentering the menu plane 1 210 through the menu plane 3 230 , the user enables a cursor to move to the menu plane 3 230 through an entry point or the menu plane 2 220 . [ 0042 ] fig6 is a view illustrating a high - level user menu mode according to the present invention . the present invention , in one embodiment , provides a high - level user menu mode in a terminal management menu . this high - level user menu mode is configured by a combination of the menu key and the direction key , which enables both a cursor movement between the planes and selection of the menu items . that is , when a mobile communication terminal has key arrays as illustrated in fig6 a user may display a menu screen by pushing a “ menu ” key in a standby state . in the high - level user mode , the “ menu ” key is used for the inter - plane cursor movements . in addition , four direction keys 1 , 2 , 3 , 4 are mapped to four menu items in the corresponding positions , respectively , and a key in the center corresponds to a terminal management menu 5 . in this case , a user may perform an inter - plane cursor movement by selecting the menu key once , and activate the menu items using the corresponding direction keys . [ 0044 ] fig7 is a flowchart illustrating a method of accessing a menu composed of multi - dimensional planes in a mobile communication terminal according to one embodiment of the present invention , for example , when a user selects a user - setting menu . when a user registers user menus that include frequently used menus from all menus in the mobile communication terminal , multi - dimensional menu planes are generated as described above , and the user may access the menu according to a control flow as shown in fig7 . referring to fig7 when a user selects a user - setting menu in a mobile communication terminal , the control unit 100 thereof waits for a key input from the user in step 302 . when the control unit 100 receives the key input from the user through an interface unit 120 in step 304 , the control unit 100 moves to step 306 . here , the interface unit 120 may be a key matrix or a touch screen as mentioned above . then , the control unit 100 checks if the key selected by the user in step 306 is , for example , one of the up / down / left / right direction keys . when the key selected by the user is the direction key , the control unit 100 moves to step 308 to determine whether the cursor movement made by the direction key is inside the menu plane . that is , the control unit 100 determines whether the user &# 39 ; s selection of the direction key moves the menu selection cursor on the menu plane out of the menu plane . when it is determined that the menu selection cursor moves to a menu item in the menu plane , the control unit 100 moves to step 310 to place the menu selection cursor at the menu item . when it is determined that the menu selection cursor moves out of the menu plane , the control unit 100 moves to step 312 to check if there is a next menu plane . when it is checked that there is no next menu plane , the control unit 100 moves to step 314 to move the menu selection cursor to a menu slot at a position opposite to its present position in the menu plane , and returns to step 302 to wait for a key input from the user . if it is determined that there is a next menu plane , the control unit 100 moves to step 316 to display the next menu plane on the display unit 140 , and moves the menu selection cursor to the next menu plane . then , in step 318 , the control unit 100 determines whether menus are registered in all menu slots in the next menu plane . if it is determined that there is an empty menu slot , to which no menu item is registered , in step 324 , the control unit 100 enables the empty menu slot , currently on display , to inherit the corresponding menu item from the previous menu plane . for example , when there are three empty menu items in the next menu plane as mentioned above , the empty menu items automatically inherit the corresponding menu items from the previous menu plane , respectively . this inheritance operation is to give the user a further chance to select a menu rather than keep the empty menu slots as they are , thereby eliminating a need to go back to the previous menu plane to access these menu items and thus reducing unnecessary key manipulations . then , in step 320 , the control unit 100 determines whether a menu item to be reached by the menu selection cursor is the inherited menu item . if it is determined that the menu item is the inherited menu item , the control unit 100 positions the menu selection at the terminal menu item on the display in step 32 and if not , positions it at the corresponding menu item . the present invention revolutionizes the common menu configuration in the prior art , and provides a diversified menu constitution and a multi - dimensional cursor movement between menu planes , and various ways of accessing the menu , consequently improving the utilization and practical use of the menu . although various embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims . | 7 |
according to this preferred embodiment of the present invention , the earth pressure balance shield machine has a rectangular construction and no disc cutter arrangement is employed . the earth pressure balance shield machine according to this preferred embodiment of the present invention is arranged for tunnel excavation in which the tunnel has a rectangular cross - section , which is shown in fig1 to fig3 of the drawings . according to the earth pressure balance shield machine of this preferred embodiment of the present invention , an electric motor is employed as a driving motor 7 and a flexible conveyor with scraper arrangement is employed as a waste conveyor 9 . according to this preferred embodiment of the present invention , the earth pressure balance shield machine comprises a cutting unit 1 , a shaft member 2 , a spiral waste collecting member 3 , an earth pressure balance cabin 4 , a transfer case 5 , a reducer 6 , a driving motor 7 , a waste conveyor 9 , a partition unit for the earth pressure balance cabin , a sliding support 25 , a telescopic cylinder 26 , a propulsion cylinder 16 , an airlock chamber 27 , a front shield unit 13 , a middle shield unit 14 , a rear shield unit 15 and a middle shield panel 32 . the front shield unit 13 comprises a cutting unit 1 at a front end of the front shield unit 13 . the cutting unit 1 comprises a cutting head 11 and a plurality of cutting teeth 12 distributed on the cutting head 11 . a shaft member 2 for the cutting head has two distal ends . each cutting head 11 is fixedly connected to the first end of the shaft member 2 while the second end of the shaft member 2 is connected to a power transmission unit . the power transmission unit is formed by the transfer case 5 , the reducer 6 and the driving motor 7 in which the transfer case 5 is connected to the reducer 6 and the driving motor 7 . the power transmission unit positioned at an upper portion and the power transmission unit positioned at a lower portion of the earth pressure balance shield machine have different connection relationship with other parts or elements of the earth pressure balance shield machine . in the power transmission unit positioned at the upper portion , a front end of the transfer case 5 is fixedly connected to the moveable partition member 30 of the partition unit for the earth pressure balance cabin while the reducer 6 and the driving motor 7 , which is connected to the transfer case 5 , is supported through a sliding arrangement . the rear end of the sliding arrangement is connected to the telescopic cylinder 26 . according to the earth pressure balance shield machine of this preferred embodiment of the present invention , the sliding arrangement comprises a sliding support 25 , a sliding member 24 and a guiding rail 23 . the reducer 6 and the driving motor 7 are fixedly positioned on the sliding support 25 . the sliding support 25 has a bottom end connected to the sliding member 24 while the sliding member 26 is engaged with the guiding rail 23 . the guiding rail 23 is fixed connected to a middle shield support frame 33 . the sliding support 25 has a rear end connected to the telescopic cylinder 26 . alternately , a slot can be provided on the guiding rail while a sliding block which is complement to the slot of the guiding rail is provided through affixing to a bottom end of a supporting leg of the sliding support 25 . in the power transmission unit positioned at the lower portion , a front end of the transfer case 5 is fixedly connected to a middle shield support panel 10 while the reducer 6 and the driving motor 7 , which is connected to the transfer case 5 , is supported by a support frame 18 . the support frame 18 has a bottom end fixedly connected to a rear end of the middle shield unit 14 . the shaft member , which is connected to the power transmission unit positioned at the lower portion , is connected to the spiral waste collecting member 3 . an inlet of the waste conveyor 9 is positioned at a rear end of the spiral waste collecting member 3 . the earth pressure balance cabin 4 is formed by the front shield unit 13 , the moveable partition member 30 , a stationary partition member 31 and the excavation surface . in order to ensure the safety of workers during changing the cutting unit , a one - way valve 29 is provided on the middle shield panel 32 . in order to reduce the fictional force during excavation process , the cutting teeth 12 form a spiral arrangement on the cutting head 11 . in a projection of a vertical cross section of the front shield unit , the cutting unit 1 has a matrix arrangement ( as shown in fig3 ), wherein in fig3 , each of the circles in solid line refer to a front projection of the cutting head 11 , each of the circles in phantom line 19 refer to a trajectory of the maximum cutting radius of the cutting teeth 12 . as shown in fig3 , a cutting trajectory of the cutting unit 1 can basically cover the entire excavation surface of a tunnel . in the power transmission unit , the transfer case 5 has a structural construction which is identical to the product of luoyang reastar transmission co . limited . the transfer case 5 and the shaft member 2 can be connected by spline connector or flange connector or connector of other types . the partition unit for the earth pressure balance cabin comprises the moveable partition member 30 and the stationary partition member 31 . the moveable partition member 30 is connected to the stationary partition member 31 and the front shield unit 13 by screw connectors . according to this preferred embodiment of the present invention , the earth pressure balance shield machine has a cylindrical construction and no disc cutter arrangement is employed . the earth pressure balance shield machine according to this preferred embodiment of the present invention is arranged for tunnel excavation in which the tunnel has a circular cross - section . fig4 refers to a left end view of the earth pressure balance shield machine of this embodiment . according to the earth pressure balance shield machine of this preferred embodiment of the present invention , a hydraulic motor is employed as a driving motor 7 and a relay - style flexible screw conveyor is employed as a waste conveyor 9 . all other structural construction and connection relationship between different parts are the same as that of embodiment 1 . in the embodiment 1 , a hydraulic motor can also be used for the driving motor 7 and a relay - style flexible screw conveyor can also be used as a waste conveyor 9 . in the embodiment 2 , an electric motor can also be used for the driving motor 7 and a flexible conveyor with scraper arrangement can also be used as a waste conveyor 9 . according to the above embodiments , the transfer case 5 has a four subdivision structure , that is , one transfer case 5 can drive rotational movement of four cutting units 1 at the same time . of course , according to the design need , one driving motor can use to drive to rotate two cutting units , three cutting units , five cutting units or other number of cutting units simultaneously . according to the earth pressure balance shield machine of the present invention , in additional to the rectangular construction in embodiment 1 and the cylindrical construction in embodiment 2 , other special forms of construction such as polygonal or oval can be employed to facilitate tunnel excavation which has a different cross - section . the number of cutting units can selectively adjusted according to the need of tunnel excavation with respect to the cross - section of the excavation surface . according to the earth pressure balance shield machine without disc cutter arrangement , the cutting units do not require a disc cutter arrangement for support , all the cutting units are driven directly by the power transmission unit and thereby independent active rotation is realized . during operation , a cutting action of the cutting unit 1 includes a rotational movement ( the major action ) and a longitudinal feed movement . the driving motor 7 drives the shaft member 2 and the cutting unit 1 to rotate through the reducer 6 and the transfer case 5 . the transfer case 5 is arranged for using a smaller number of driving motor 7 to drive a larger number of cutting unit 1 to rotate at the same time for space saving purpose such that the bulky distribution of power transmission unit in the epb shield machine is solved . as shown in fig1 and fig2 of the drawings , the longitudinal feed movement of the cutting unit 1 is realized by a reinforced concrete lining segment 17 and a propulsion cylinder 16 . when the piston of the propulsion cylinder 16 is extended outward , the reinforced concrete lining segment 17 is pressed . since the reinforced concrete lining segment 17 is affixed securely to the wall of the tunnel through slurry solidification , its support reaction is sufficient on the propulsion cylinder 16 to drive the entire shield machine ( which includes the front shield unit 13 , the middle shield unit 14 and the rear shield unit 15 ) to propel in a forward direction while at the same time driving the longitudinal feed movement of the cutting unit 1 . during the tunnel excavation process , the waste which falls into a bottom of the earth pressure balance cabin 4 is continuously moved backward to the inlet of the waste conveyor 9 to facilitate removal through the spiral waste collecting member 3 which is installed on the shaft member 2 in the power transmission unit at the lower portion . during the tunnel excavation process , the cutting unit should be replaced when the cutting unit wears excessively . when replacing the cutting unit , the waste in the earth pressure balance cabin 4 is emptied first . then the screw connectors are loosened such that the moveable partition member 30 is disconnected to the stationary partition member 31 and said front shield unit 13 . the sliding support 25 , the power transmission unit at the upper portion and the cutting unit 1 are moved backward along the guiding rail for a predetermined distance through a retraction of the telescopic cylinder 26 , then a worker can enter the earth pressure balance cabin through a gap between the moveable partition member 30 and the stationary partition member 31 to replace the cutting unit . in order to ensure the safety of the worker , based on the geological conditions of the excavation surface , 0 ˜ 3 bar compressed air is injected into the enclosed space at a front end of the middle shield panel 32 through a one - way valve 29 in order to balance the earth and water pressure of the excavation surface and prevent tunnel collapse . in order to prevent pressure - related diseases of the worker , direct movement between high pressure condition and atmospheric condition is not allowed and a transition through the airlock chamber 27 is required . after the worker enters the airlock chamber 27 , the pressure inside the airlock chamber is increased by injecting compressed air . the gate 22 can only be open when the pressure is increased to the level which is the same as that of the location at a front end of the middle shield panel 32 so that safety entrance to the location at the front end of the middle shield panel 32 is ensured . when the worker is retreated from the location at the front end of the middle shield panel 32 into the airlock chamber 27 , the worker can only retreat from the airlock chamber 27 after the pressure inside the airlock chamber 27 is decreased to atmospheric pressure . for maintenance and replacement convenience , most of the parts are connected by using screw connectors . for example , the driving motor 7 , the reducer 6 and the transfer case 5 at the upper portion of the shield machine are connected by screw connectors respectively , the front end of the transfer case 5 is affixed onto the moveable partition member 30 by screw connectors , the moveable partition member 30 is connected to the stationary partition member 31 and the front shield unit 13 by screw connectors , the reducer 6 and the driving motor 7 are connected to the sliding support 25 by screw connectors , and the rear end of the sliding support 25 is connected to the telescopic cylinder 26 by screw connectors . | 4 |
in advance , it is useful to first define some terms which will be used throughout the present application . ( hdpe ) high density polyethylene comprises pe ranging between 0 . 930 g / cm 3 and under 0 . 970 g / cm 3 . ( ldpe ) low density polyethylene comprises pe ranging between 0 . 914 g / cm 3 and under 0 . 930 g / cm 3 . low molecular weight polyethylene comprises pe wherein the majority of its short chains are slightly branched ( irregular or lineal ) and having a high melting index . high molecular weight polyethylene comprises pe the majority of its long chains are highly branched ( irregular or lineal ) and having a low melting index . melting index : amount of polymer flowing through an orifice , at a set rate , set temperature , and set weight . the greater the polymer flow , greater the melting index value and vice versa . e . s . d . corresponds to the english abbreviation for equivalent spherical diameter . it is calculated as follows : a sample maximum cut indicates that 98 % of the particles have an e . s . d . less than the maximum cut . for example , if a sample has a maximum cut of 15 μm , 98 % of the sample &# 39 ; s particles have an e . s . d . less than 15 μm . mean particle measure is the e . s . d . of the greater number of particles having a uniform size found in a sample . the components of the blend of the present invention consist of synthetic paper produced from one or more high density polyethylenes ( pe ), mixed together with magnesium silicate ( talc ) ( mg 3 h 2 ( sio 3 ) 4 ), calcium carbonate ( caco 3 ) and finally titanium dioxide . the polyethylene content must be high density , and preferably low molecular weight , having a melting index ( re astm d - 1238 ) ranging between 1 and 5 g / 10 minutes , preferably 2 g / 10 minutes . the pe is preferably found in a range between 50 % and 90 % p / p , depending on the intended paper basic weight ( grammage ). the use of low molecular weight polyethylene allows for better component homogenization and much smoother extrusion , which allows working at slightly lower temperatures , hence avoiding possible oxidations caused by excesses in temperature . magnesium silicate ( talc ) has a cut value greater than 44 μm , in a proportion ranging between 10 % and 32 % of the total amount of the mix . the tests carried out during the present invention allowed to observe that the laminar form and particle size used herein are ideal for granting the silk paper texture since the sheet edges protrude from the surface therefore giving a rough effect . said sheets make the film brittle having good creasing ( deadfold ), thereby eliminating a great portion of memory . if a greater cut particle is used , the film turns too rough and cannot be thinned . on the contrary , if a lesser cut particle is used , no effect is observed . calcium carbonate requires greater cut values ranging between 50 and 60 μm , in a proportion ranging between 1 % and 20 % of the total amount of the mix . the tests carried out during the present invention allowed to observe that when using only talc , the paper turns out too rough , making it necessary to smooth said effect without losing the previously obtained properties . this is when calcium carbonate is added to act as a talc dispersant , making its way between the sheets . the particle size must not be greater since it would greatly block the effects gained by the talc . titanium dioxide may be used in a proportion of 2 % of the total value of the mix , in order to provide adequate whiteness . one of the most important features of this invention consists in that in order to maintain excellent creasing , it was discovered that under no circumstance was low density polyethylene to be used in any of its forms ( blend , lamination , co - extrusion ), since its branched molecular structure , either amorphous or lineal , immediately destroyed the crease . synthetic paper is totally incompatible with such class of polyethylenes . the manufacture of this synthetic paper is produced by means of an extrusion process , either by a blow film system , or by a cast film system , depending on the final product to be obtained . if the papers are thin , between 20 and 50 g / m 2 , they may be manufactured in blow film . greater than 50 g / m 2 must be manufactured in cast film because if the other system is used , thickness and wrinkle formation control is lost . synthetic paper is produced ranging from 20 g / m 2 up to 120 g / m 2 and may be dyed in any color , without affecting its final properties . also it allows sticking using glues or heat . if the paper is used as packing means in automated packing machines , these machines do not need large modifications . in certain occasions , small adjustments are made on the cutting system , depending on the equipment . this paper is printed using flexography or rotogravure processes , using alcohol diluted inks . for better ink adhesion on paper , corona treatment must be done . firstly , a master batch must be prepared in order to handle calcium carbonate , magnesium silicate and titanium dioxide , substances present in powder form , whereas high density polyethylene is in pellets . therefore , we take very low molecular weight high density polyethylene , between 10 and 50 g / 10 minutes , and we ground it ; this is done in order to mix it well with the other components that are present as powders . later , it is mixed in a tumbling mixer for no less than an hour . finally , it is extruded in a double screw extruder ( specialized machine for preparing master batch since it has an excellent homogenization capacity and very necessary in this case ) and is converted into pellets . the temperature profile can be the following : first zone 120 ° c ., second zone 160 ° c ., third zone 200 ° c ., and head 200 ° c . temperatures should not exceed 200 ° c . in order to avoid oxidation of the high density polyethylene . typically , conventional techniques for preparing a master batch that will be mixed with polyethylenes , but low density , use very low molecular weight polyethylene , either irregularly branched or linearly branched . one of the key aspects of this invention was discovering precisely that this technique prevents reducing memory of the resulting films . in order to get the mix for extrusion , the master batch ( very low molecular weight high density polyethylene , talc , calcium carbonate and titanium dioxide ) and low molecular weight high density polyethylene are combined in a tumbling mixer for 45 to 75 minutes , depending on the amount to be mixed , and trying to get good distribution of all components . furthermore , the extrusion process begins . the extruder must have excellent refrigeration in its feeding zone in order to avoid initial overheating of the mixture and hence maintain uniform feeding . the extruder screw must at least have a 24 diameter length , with a homogenization zone in order to have optimal uniformity of all mix components . the temperature profile during the extrusion process through the cylinder shall be : 150 ° c . in the first zone , 180 ° c . in the second zone , 190 ° c . in the third zone , 210 ° c . in the screen carrier and 210 ° in the cast . these temperatures may vary according to the type of machine used and the melting index used . the paper tends to wrinkle a lot , since it tries to rapidly solidify upon exiting the extruder cast . in order to correct this , it is necessary that the paper arrives at the pull rolls as hot as possible ( 100 ° c .). this can be achieved bringing the pull rolls towards the cast exit , and controlling the cooling air . on one of the lead rolls which guide the paper towards the winding coil , a corona treatment is preferably applied , raising the paper &# 39 ; s surface tension to at least 40 dynes , in order to ease printing . if the paper use requires breathing , the paper is microperforated after printing and before entering the cutting phase . this process may be carried out hot or cold , but due to the paper &# 39 ; s rigidity , it is preferable cold in order to maintain a smooth surface . formulation for producing paper used in wrapping 50 g / m 2 margarine using an automatic packing process : 65 % p / p high density polyethylene , 0 . 960 g / cm 3 density , melting index 1 . 5 g / 10 minutes ; 15 % p / p high density polyethylene , 0 . 950 g / cm 3 density , melting index 20 g / 10 minutes ; 13 % p / p magnesium silicate ( talc ); 5 % p / p calcium carbonate ; and 2 % p / p titanium dioxide . formulation for producing paper for wrapping 30 g / m 2 hamburgers and fast food in general : 74 % p / p high density polyethylene , 0 . 964 g / cm 3 density , melting index 2 g / 10 minutes ; 10 % p / p high density polyethylene , 0 . 950 g / cm 3 density , melting index 20 g / 10 minutes ; 10 % p / p magnesium silicate ( talc ); 4 % p / p calcium carbonate ; and 2 % p / p titanium dioxide . 1 . an apparatus having two coils or rolls was manufactured , one made of rubber having a hardness of 60 shore and one made of metal , one on top of the other , on the ends thereof air pistons were placed putting pressure . these rolls are coupled to a gear mechanism which is driven by a motor carrying a frequency shifter for precisely controlling revolutions . 2 . for comparison purposes , 5 synthetic paper samples were taken of formulation i , 5 samples of aluminium sheet and 5 samples of polypropylene sheet , all having 75 μm thickness respectively , size 10 cm by 10 cm . aluminium sheet is used since this type of wrapping is widely used in areas where excellent creasing is needed and polypropylene sheet is used since this product is used in certain types of packaging like for example french - fries . 3 . the rolls started spinning at a speed of 60 turns per minute and subject to pressures of 10 psi , 20 psi , 30 psi , 40 psi , and 50 psi respectively . 4 . each sample was slightly folded in half and introduced through the rolls . 5 . the first test was carried out at 10 psi introducing a synthetic paper sample , later an aluminium sample and finally a polypropylene sample . likewise , the second test was carried out at 20 psi , the third at 30 psi , the fourth at 40 psi and the fifth at 50 psi . 6 . after subjecting to pressure stress , the samples were left standing for 10 minutes in order to give them an opportunity to recover memory and the opening angle formed by the two planes was measured . the result of the angle formed by the two planes was very small for synthetic paper , a 0 ° angle for aluminium , and a 180 ° angle for polypropylene ; therefore , and trying to simulate an industrial margarine wrapping machine crease , the following was done : 1 . the same samples , already folded in half , were slightly folded again in such a way that four superimposed planes measuring 5 cm by 5 cm were created and again were introduced inside the rolls , at the same speed and same pressures . 2 . the samples were left standing for ten minutes and the results are shown on the following table . in order to convert these results into percentages , we can say that a zero memory sheet is one that upon folding at a predetermined pressure , the angle formed between the two planes is zero , as in the aluminium case . hence , we can say that a sheet having much more memory is one that upon folding at a predetermined pressure , the angle formed between the two planes is 180 °, like for example a polypropylene sheet . we can conclude that a paper having maximum memory would have a 100 % value and one with zero memory 0 %. | 2 |
a flexible shoe of the type shown in fig1 is shown in cross - sectional detail in the forepart of the shoe in fig2 . the shoe is formed by an overlapped slip last construction in the forepart of the shoe in which the uppers 1 are brought under a last to simulate a lasting allowance 2 in a conventional cement constructed shoe . the lasting allowance 2 is folded inward toward a longitudinal mid - line of the shoe . this overlap slip last construction allows the upper to form to the last without wrinkles . the lasting allowance by which the upper is attached to the sole extends about one fourth to about three eights of an inch inward toward a longitudinal mid - line of the shoe whereas standard lasting allowances typically extend to about one half of an inch . in general , the extent to which the lasting allowance will extend inward toward the longitudinal mid - line of the shoe will depend on the pattern of the shoe . the reduced size of the lasting allowance of the present invention helps reduce wrinkles . it should be noted that the upper 1 can be made up of several different pieces of leather , animal hide , natural or synthetic material stitched together , or a unitary piece of leather , animal hide , natural or synthetic material . the upper 1 is then stitched to a sock lining material 3 at the position of the lasting allowance 2 . the upper 1 is inverted to allow for the stitching 14 after which it is turned again to an upright position to allow for insertion of a last . in some embodiments the sock 3 can be extended along an inner wall of the upper to form a lining . thus , in such a variation , it will be understood that the sock 3 can be adhered to or stitched along the upper in locations in addition to the location of the last allowance 2 . it should also be noted that the upper 1 itself can have an inner lining of cloth cemented to it or in a preferred embodiment pig skin is attached along an inner wall . as shown in fig3 the heel portion of the shoe is constructed according to known slip last construction in which a standard wrap 4 provides a last allowance 16 whose surface is cemented directly to the sole 5 and also surrounds an insole board 6 and foam material 7 . atop the foam material 7 is the sock material 3 which is attached at its edges 8 to the upper 1 by stitching 17 . on the outer side of the upper 1 , the wrap 4 bulges outward 9 sealing the upper - sock seam or attachment . the heel 10 may be composed of a honeycombed cell pattern 11 which imparts added cushioning . the heel 10 may have a triangular or cylindrical block to impart stability and comfort at compression points . as shown in fig2 the sole 5 in the forepart of the shoe is constructed with a cavity 12 which is filled with a flexible cushioning material 7 . a material such as a soft eva can be used or any other suitable material . this flexible material which fills the cavity 12 is cemented to the sole 5 . this construction imparts added flexibility to the sole . as shown in fig6 [ t ] the sole 5 contains a built in shank design 25 in a portion of the forepart of the sole adjacent to the heel 10 . this shank design imparts stability . the built in shank 25 extends from a mid - portion of the forepart of the sole or metatarsal region 19 to the heel . the sole and heel are further supported by additional cylindrical blocks added to the honeycomb design in the interior design of the heel . an insole board 6 as shown in fig4 is held in place by the wrap material as shown in fig3 . the insole board 6 typically has foam glued onto it . the insole board 6 has a narrow tapered forward position 18 which cooperates with the built in shank design to provide some of the functionality of a conventional shank . the design of the insole board 6 of the present invention does not extend the length of the shoe , but rather extends along the heel and over the built in shank design in a tapered or narrowed fashion as shown in fig4 . the tapering 18 of the insole board 6 allows the shoe flexibility while still imparting some rigidity . as shown in fig2 in the forepart of the shoe , the last allowance 2 of the upper 1 and sock 3 are stitched to the sole 5 . thus , the sock 3 is interposed between the upper 1 and the sole 5 . the last allowance 2 is then stitched to the sole in the forepart of the shoe . the stitch 15 traverses through the last allowance 2 of the upper and sole 5 binding them together . the stitching acts as a reinforcement for binding the upper to a sole . the stitch 15 can also traverse through the last allowance 2 of the upper 1 , the sock 3 and sole 5 binding all three elements together . the stitching is accomplished by full littleway sole stitch or other stitching to bind the stated elements together . in the heel portion of the shoe the last allowance 16 is not an integral part of the upper 1 and the last allowance 16 is cemented to the heel 10 . in the heel portion of the shoe the upper 1 is not stitched to the sole 5 as is done in the forepart of the shoe . while the heel 10 of the shoe has a conventional wrap 4 of fig1 and 3 , the forepart of the shoe has a storm welt 13 along the periphery of the upper portion of the sole 5 . the storm welt 13 forms a visually continuous shape with the wrap 4 . that is , where the wrap 4 ends at the end of the heel portion , the storm welt 13 continues around the forepart of the shoe . the storm welt 13 not only enhances the visual appearance , but performs a functional purpose as well . this purpose is that of preventing water , rain , etc . from becoming interposed between the upper 1 and the sole 5 . other welt designs can be utilized in place of storm welts . these welt designs project from the sole and form a shallow well to insert the upper to the sole . in an alternative embodiment of the present invention , the upper 1 can be stitched to a mid - sole 20 as shown in fig5 . in this embodiment , a mid - sole 20 is interposed between the upper 1 and the sole 5 . the mid - sole 20 is made of a material which has a surface which is compatible for stitching to the upper 1 and a lower surface compatible for bonding or cementing to the sole 5 . this variation using a mid - sole 20 for stitching to the upper 1 is desireable in situations where the sole 5 is too thick to allow for stitching the sole 5 to the upper 1 or where it would be difficult to stitch the upper 1 to a sole 5 because of the sole &# 39 ; s material or thickness . this variation can also be employed when it is desired not to have stitches visible on the sole 5 for aesthetic reasons . the stitching between the upper 1 and mid - sole 20 would not be visible . this shoe , by virtue of the features disclosed in this patent application , will possess some flexibility . it should also be noted that the present invention includes the use of various shoe inserts 30 which can be placed in the shoe to provide cushioning . the inserts 30 can be used to avoid contact of the foot with the last allowance where it is stitched to the sock in the forepart of the shoe . the use of the inserts can further provide comfort to the wearer of the shoe . in a preferred mode of construction , the flexible shoe of the present invention may be formed as follows : the upper 1 is first formed from one or several pieces as mentioned hereinabove . then in the heel portion of the shoe the upper 1 is stitched together with the sock 3 and wrap 4 from outside of the shoe . the upper 1 is then turned inside out with the sock 3 and wrap 4 stitched to the rear or heel of the shoe . the last allowance 2 of the upper 1 in the forepart of the shoe is then stitched to the sock 3 in such a manner that the last allowance 2 and sock 3 are in inverted positions to their positions in the heel 10 ; namely , the last allowance 2 is stitched on top of the sock 3 . the upper 1 and sock 3 combination are forced onto the last . an insole board 6 as shown in fig4 is prepared so it has a narrow tapered forward portion 18 which acts in conjunction with the built in shank design to provide some of the functionality of a conventional shank . this tapering allows the shoe flexibility while still imparting some rigidity . the wrap 4 is closed around an inserted insole board 6 in the heel portion of the shoe and secured to the insole board 6 by cementing . the forepart of the sole 5 is formed by impregnation or placing of a cushioning material such as , but not limited to , eva in a cavity 12 of the sole 5 . a shank equivalent 25 is incorporated in a portion of the forepart of the sole 5 . the sole 5 is cemented to the upper 1 by conventional methods starting at the toe . the soles 5 are conventionally heated prior to attachment and stretched as they are placed sequentially along the shoe . the sole 5 is then pressed to the upper 1 to facilitate the adherence of the sole 5 to the upper 1 . the shoe is removed from the last and the sole 5 is stitched to the upper 1 and sock 3 in the forepart of the shoe . a final reconfiguring of the shoe may be required by placing the shoe on the last in order to restore the shape of the shoe which may have been distorted in the manufacturing process . while preferred embodiments of the invention have been illustrated and described , it will be understood by those skilled in the art that changes and modifications may be restored to without departing from the spirit and scope of the invention . | 0 |
referring to fig1 and 2 , an embodiment of a container assembly 1 is provided for containing an electronic device to a computer panel 100 . the container assembly 1 includes a retainer 10 attached to the panel 100 , a cover 40 pivotably attached to the retainer 10 , a lock 60 attached to the retainer 10 , an elastic support 70 , two gear dampers 80 , and a rotating shelf 90 attached to the electronic device . in this embodiment , the electronic device includes a card reader 50 and an interface module 58 . referring to fig3 and 4 , the retainer 10 includes a substantially square bottom wall 11 , and two opposite sidewalls 12 a , 12 b and another two opposite sidewalls 12 c , 12 d extending from four side edges of the bottom wall 11 . a recessed portion 13 is defined in the bottom wall 11 adjacent to the sidewall 12 a for mounting the lock 60 therein . the recessed portion 13 defines an accommodating hole 14 , and two through holes 18 therein . a block plate 19 is bent outward from an edge of each through hole 18 . two mounting portions 20 are formed on an inner surface of the bottom wall 11 for mounting the elastic support 70 . each mounting portion 20 includes an l - shaped retaining plate 22 , two limiting plates 24 , 26 at two opposite sides of the retaining plate 22 , and a mounting plate 27 with a locking hole 272 . the mounting plate 27 is formed at the same side with the limiting plate 26 . two through slots 36 are defined in the bottom wall 11 adjacent to the sidewalls 12 c , 12 d . a pivot hole 39 is defined in each of the sidewalls 12 c , 12 d adjacent to the sidewall 12 b . referring to fig5 , the lock 60 includes a substrate 61 , and a push - push button 64 attached to the substrate 61 . the substrate 61 forms two hooks 63 corresponding to the two block plates 19 of the retainer 10 . the push - push button 64 includes two actuated retaining pieces 65 , and a trigger 66 set between the retaining pieces 65 . when the trigger 66 is triggered , the retaining pieces 65 are actuated to move to or toward each other ; when the trigger 66 is triggered again , the retaining pieces 65 are actuated to move away from each other . referring to fig6 , the elastic support 70 is made from a bent resilient steel wire . the elastic support 70 includes a substantially u - shaped pushing portion 72 , and two substantially l - shaped fixing portions 74 extending from two distal ends of the pushing portion 72 towards each other . the pushing portion 72 includes a pushing segment 722 , and two legs 724 extending from two opposite ends of the pushing segment 722 . the pushing segment 722 and the two legs 724 are coplanar . each fixing portion 74 includes a retaining segment 742 and an extending segment 744 forming the l shape . a locking segment 746 is formed from a distal end of the extending segment 744 . the retaining segment 742 , the extending segment 744 , and the locking segment 746 defining a plane which has an adjustable angle with the plane of the pushing portion 72 . referring to fig7 , each gear damper 80 includes an installing portion 81 , and a pinion gear 89 mounted to the back surface of the bottom wall 11 of the retainer 10 via the installing portion 81 . referring to fig8 , the cover 40 includes a base plate 41 , and a front plate 42 and two side plates 43 extending from three edges of the base plate 41 . an anchor 47 extends down from a bottom edge of the front plate 42 corresponding to the push - push button 64 of the lock 60 . two locking holes 46 are defined in the front plate 42 at opposite sides of the anchor 47 . a through slot 45 is defined in the front plate 42 for a memory card extending therethrough to access the card reader 50 . a through hole 48 is defined in each side plate 43 adjacent to the front plate 42 . a plurality of bent tabs 44 is formed on the base plate 41 . a pivot 49 extends out from an end of each side plate 43 which is away from the front plate 42 . referring back to fig1 and 2 , the card reader 50 defines a plurality of mounting slots 52 in the top surface thereof corresponding to the bent tabs 44 of the cover 40 , and a plurality of mounting slots 56 in the bottom surface thereof . a threaded hole 54 defined in a side surface of the card reader 50 , and a threaded hole 59 defined in a side surface of the interface module 58 , are configured to align with the through holes 48 of the cover 40 , respectively . referring to fig9 and 10 , the rotating shelf 90 includes a rectangular main board 91 , and two leg portions 95 extending from two opposite sides of the bottom surface of the main board 91 . a plurality of bent tabs 92 is formed on the top surface of the main board 91 for engaging in the mounting slots 56 of the card reader 50 . two hooks 93 extend forward from a front edge of the main board 91 for engaging in the locking holes 46 of the cover 40 . two sets of protrusions , each set having a first protrusion 911 and a second protrusion 913 , are formed on the bottom surface of the main board 91 . each set aligns in a direction perpendicular to the front edge of the main board 91 . a gap 912 is defined between the first and second protrusions 911 , 913 of each set . the second protrusions 913 are substantially triangular , forming two opposite bevels . each leg portion 95 has a convex edge forming a rack 96 thereon . referring to fig3 - 6 and 11 - 12 , in assembly , the push - push button 64 of the lock 60 is received in the accommodating hole 14 of the retainer 10 , with the hooks 63 extending through the through holes 18 and engaging with the block plates 19 . thus , the lock 60 is secured in the recessed portion 13 of the retainer 10 . the elastic support 70 is received in the retainer 10 , with the retaining segments 742 engaged in the retaining plates 22 , and the locking segment 746 inserted in the locking hole 272 . the legs 724 abut against the limiting plates 24 , and the extending segments 744 abut against the limiting plates 26 . thus , the elastic support 70 is mounted on the bottom wall 11 of the retainer 10 . referring to fig7 and 12 , the pinion gear 89 is mounted to the installing portion 81 via a fastening element 200 ( see fig2 ), and the installing portion 81 is secured to the back surface of the bottom wall 11 of the retainer 10 . part of the pinion gear 89 enters the retainer 10 through the through slot 36 . referring to fig1 - 2 , 8 - 10 , and 13 , the bent tabs 44 of the cover 40 are inserted into the mounting slots 52 of the card reader , and a screw 202 ( see fig1 ) extends through the through hole 48 of the cover 40 and engages in the threaded hole 54 of the card reader 50 . thus , the card reader 50 is secured to the cover 40 . a screw 204 ( see fig1 ) extends through another through hole 48 of the cover and engages in the threaded hole 59 of the interface module 58 . thus , the interface module 58 is secured to the cover 40 . the bent tabs 92 of the main board 91 of the rotating shelf 90 are inserted into the mounting slots 56 of the card reader 50 . the hooks 93 engage in the locking holes 46 of the cover 40 . thus , the rotating shelf 90 is attached to the card reader 50 and the cover 40 . an electromagnetic interference ( emi ) shield 97 is attached to the card reader 50 . referring to fig1 - 17 , the pivots 49 of the cover 40 are pivotably engaged in the pivot holes 39 of the retainer 10 . when the cover 40 is pressed towards the panel 100 to shield the retainer 10 , the leg portions 95 of the rotating shelf 90 extend into the through slots 36 of the retainer 10 , and the racks 96 on the leg portions 95 engage with the pinion gears 89 of the gear dampers 80 , such that the pinion gears 89 are driven by the racks 96 . the pushing segment 722 is located in the gaps 912 between the first and second protrusions 911 , 913 . when continuing to push the cover 40 towards the panel 100 , the rotating shelf 90 presses the pressing segment 722 and deforms the two legs 724 , and pushes the pressing segment 722 to slip out from the gaps 912 along the bevel of the second protrusions 913 . when the anchor 47 of the cover 40 triggers the trigger 66 , the retaining pieces 65 are closed to hold the anchor 47 . thus , the cover 40 is locked in the retainer 10 , and the emi shield 97 abuts against the bottom wall 11 of the retainer 10 . when being opened to access the card reader 50 , the cover 40 is depressed , so that the anchor 47 triggers the trigger 66 . the retaining pieces 65 release the anchor 47 , and the elastic support 70 is restored to push the card reader 50 and the cover 40 to move relative to the panel 100 . thus , the card reader 50 and the cover 40 are pivoted out from the opening 102 of the panel 100 and located slantingly ( see fig1 - 17 ). during this course , the pushing segment 722 of the elastic support 70 rides over the second protrusions 913 again , and is located in the gaps 912 . meanwhile , the damping force generated during the rotation of the pinion gear 89 will restrain the restoring force of the elastic support 70 , and gently release the spring energy of the elastic support 70 . therefore , the card reader 50 can be opened smoothly , gently , and quietly . in other embodiments , positions of the racks 96 and the pinion gears 89 can be interchanged , i . e ., the racks 96 are attached to the retainer 10 and the gear dampers 80 are attached to the cover 40 . then , each leg portion 95 has a concave end surface for the rack 96 arranged thereon . it is to be understood , however , that even though numerous characteristics and advantages of the disclosure have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . | 6 |
the material according to the independent patent claim solves this problem ; the subclaims state further preferred embodiments . the present invention provides a multilayer material sheet for purposes of packaging in which at least one layer is highly conductive with a surface resistivity of less than 1 × 10 4 ohm / sq -- preferably 1 × 10 2 to 1 × 10 3 ohm / sq -- and lays between electrostatic dissipative or derivating layers with a surface resistivity of between 1 × 10 5 ohm / sq and 1 × 10 12 ohm / sq . these electrostatic dissipative or derivating layers may also be coated or printed . this material is free of particle contamination during the handling and can be recycled with normal cardboards . it turned out to be favourable to add highly conductive fibers to the electrostatic shielding layer ; a material consisting of paper or nonwoven fabric with a loading of 2 % to 65 %, preferably 5 % to 25 %, of highly conductive fibers is especially preferable . according to a further feature of the invention , the highly conductive fibers shall consist of a conducting alloy or a metal , preferably carbon , fe , ag , cu , cr or the like . fibers of copper or a copper alloy of a diameter of not more than 100 microns , preferably 20 microns , and especially a length between about 5 and 75 mm are used in the shielding layer of a special embodiment . within the scope of this invention , shipping boxes made of the said material sheet shall be independently protected ; for preventing the wrapped packed products from damages caused by esd the material has the effect of a &# 34 ; faraday cage &# 34 ; shielding the packed products against electrostatic fields . this electrostatic shielding will attenuate the electrostatic fields to less than 100 to 50 volts . the material sheet and the thereof made shipping box respectively according to the present invention prevent the generation of a triboelectric or frictional electric charge , i . e . the static charging caused by friction between the packaging material and its content . the material used for packing according to the present invention is free of conducting , contaminating particles . the material provides also a good mechanical protection for the electronic components . further advantages , features and details according to the present invention result from the following description of preferred embodiments as well as from the drawings , in which : fig1 : is a condensed cross - sectional view through the sheet of material according to the present invention ; fig2 and fig3 : are diagonal views of different embodiments of an open shipping box made of a sheet of material according to the present invention . a sheet of material 10 for making shipping boxes 12 consists according to fig1 of a lower layer 14 being a white test - liner , topped with a highly conductive shielding paper layer 16 which , in another embodiment may be a nonwoven fabric . the paper layer / nonwowen fabric is topped by a fluted brown test - liner 18 , which is topped by a so - called craft - liner 20 . the craft - liner 20 of 120 to 150 gr / sq meter is an electrostatic dissipative material with a surface resistivity between 1 × 10 5 ohm / sq and 1 × 10 12 ohm / sq . this craft - liner may also be coated with a not shown covering and be printed . the layer 16 consists -- as mentioned -- of a highly conductive electrostatic shielding paper or nonwoven fabric with a loading of 2 % to 65 % especially 5 % to 25 %, of a highly conductive fiber . the latter is preferably made of a copper compound with a diameter of less than 20 microns and a length of 5 to 75 mm . for this shielding layer 16 other metals or metal alloys may also be used such as carbon , fe , ag , cu , cr or the like . the surface resistivity of this electrostatic shielding 16 is between 1 × 10 2 ohm / sq and 1 × 10 3 ohm / sq . the brown test - liner 18 above layer 16 is of 112 to 120 gr / sq . meter in the shape of b flute , e flute or f flute . naturally , instead of the -- preferred unbleached -- brown paper material or flute cardboard , another coloration may be used . the white test - liner 14 of approximately 150 gr / sq . meter is an electrostatic dissipative material with a surface resistivity of between 1 × 10 5 ohm / sq and less than 1 × 10 12 ohm / sq . for achieving the electrostatic shielding properties of the material sheet 10 , the position of the highly conductive electrostatic shielding layer 16 within the overall material construction is of minor importance ; the electrostatic shielding layer 16 can be placed between the craft - liner 20 and the fluted test - liner 18 or between the latter and the white test - liner 14 . also layer 16 could be embedded inside the brown test - liner 18 or the white test - liner 14 during the manufacturing of the material sheet 10 . according to fig2 a cuboid shipping box 12 made from the material sheet 10 -- consisting of a bottom 22 and a lift - up lid 24 with lateral tongues 23 linked to it -- of a length a of about 190 mm , a width b of about 130 mm and of a height h of 35 mm is lined with two antistatic soft foam inserts 26 to enhance mechanical protection for a packed product not shown for reasons of clearness . the height i of the foam inserts 26 made from the described material for shielding layer 16 is about 15 mm . the shipping box 12a of fig3 consisting of bottom 22a and removable lid 24a contains transversal inserts 28 inserted transversaly to its axis a . inside the shipping boxes 12 described in fig2 a populated printed circuit board fitted with 3 esd event detectors with trigger voltages of 50 volts , 100 volts and 150 volts respectively was inserted . the shipping box 12 was laid on a grounded plane of a diameter of about 127 mm and a metal plate of a corresponding size was laid on top of the shipping box to cover the 3 esd event detectors . an esd event simulator ( human body model ; c = 100 pf , r = 1500 ohm with variable output from 10 to 5000 volts ) was used to simulate an esd event . then voltages ranging from 100 to 5000 volts were applied to the center of the plate laid on top of the lift - up lid 24 in 500 volts increment . after each discharge the box 12 was opened to see if the esd event detectors have been triggered . it was found out that for all the testing voltages all the esd event detectors remained in their original -- untriggered -- state . this procedure simulates a real life situation where shipping box and its content may be subjected to esd in the non esd protected areas . for comparison purposes , the same test was performed with black -- carbon coated -- cardboard boxes from various sources . all the boxes had the same size as the one described in the test above , and the tests were performed under the same conditions . in all the black cardboard boxes tested the esd event detectors were triggered at voltages ranging between 1000 and 2000 volts . | 1 |
fig1 and 2 show a cross section of a segment of a conveyor system that features rails 2 in which a self - propelled trolley 4 is arranged . one such rail 2 features a base part 6 and c - shaped sides 8 , 10 , which enclose the side wheels 12 of the trolley 4 . the c - shaped sides 8 , 10 each feature a central , outwardly displaced running area 14 for the lateral guide rollers 16 of the trolley , as well as upper and lower support surfaces 18 , 20 , each inclined towards the wheel 12 . one and the same rail is thus suited for trolleys 4 that feature lateral guide rollers 16 , as shown in fig2 , and for trolleys 4 without lateral guide rollers , but on which the wheels 12 simply abut the support surfaces 18 , 20 . the wheels 12 and the guide rollers 16 are generally non - powered wheels or rollers without any drive function . drive is provided on the one hand by a frictional wheel 22 functioning in concert with a corresponding frictional surface 24 of the rail 2 , and / or a cog 26 functioning together with a cog rail 28 of the rail 2 . sliding contacts 30 , 32 , 34 function together with power rails 36 , 38 , 40 in the rail and serve to transmit current on the one hand and provide switching and control functions on the other hand . the details of the rail and its function are illustrated in greater detail in fig3 through 13 and are further described below . in the respective upper portion of the c - shaped sides 8 , 10 , the rail 2 features dovetailed assembly grooves 42 , 44 , which accommodate the clampable connection strips 46 for connecting adjoining rail segments 2 a , 2 b to one another . additional assembly grooves 48 , 50 for accommodating connection strips 46 are arranged on the bottom side of the base part 6 of the rail 2 . to provide a secure connection between adjoining rail sections 2 a , 2 b , the connection strips 46 feature clamping screws 52 for each rail section 2 a , 2 b as fig5 illustrates . to create an expansion joint 54 between segments 2 a , 2 b , the connection strips 46 are fastened to only one rail segment 2 b by means of clamping screws 52 , while the connection strip 46 is displaceably arranged in the other rail segment 2 a as fig6 shows . the power rails 36 , 38 , 40 are fastened with the aid of sliders 56 , which feature a block part 58 with molded feet 60 , 62 , which engage the dovetailed assembly grooves 64 of the rails 2 . driven dowel pins 66 between the feet 60 , 62 prevent the sliders 56 from separating from the base part 6 . in fig7 and 9 , the dowel pins 66 are shown prior to being driven into the opening 68 between the feet 60 , 62 . recesses 70 for accommodating the power rails 36 , 38 , 40 are arranged in the block part 58 . lateral to the block part 58 are snap - in pins 72 , which feature snap - in hooks 74 , 76 oriented away from one another , which function together with facing snap - in strips 78 , 80 of the hollow power rails 36 , 38 , 40 . to facilitate connection to a power supply , the heads 82 of contact screws 84 extending through the block part 58 of the slider 56 and the base part 6 of the rail 2 to the opposite side thereof are arranged in the power rails 36 , 38 , 40 . as fig1 through 3 reflect , the contact screws 84 are secured by means of a first nut 86 , while a second nut 88 serves for clamping the power supply connection 90 . arranged on the bottom side of the base part 6 is an additional dovetailed assembly groove 92 for the purpose of fastening cable clips 94 . the latter features clipping feet 96 , 98 , which engage the assembly groove 92 and between which a dowel pin 100 is arranged to prevent the feet from separating from the assembly groove 92 . the cable clips 94 arranged at specific intervals on the bottom side of the base part 6 serve to hold all types of lines such as power supply lines and control lines . the bottom side of the base part 6 can also ultimately be covered with a cover 102 that features side fastening strips 104 , 106 that engage corresponding insert grooves 108 , 110 on the bottom side of the base part . an additional dovetailed assembly groove 112 for securing the cog rail 28 is arranged on the top side of the base part 6 . a rail of this kind can be bent to form an inside curve as shown in fig1 or an outside curve as shown in fig1 . for this purpose , the rail can be bent as a whole unit in the manner shown . to form an inside or outside curve as shown in fig1 , the c - shaped sides 8 a and 10 a must be individually bent according to the desired curvature radius and then connected to one another using the base segment parts 6 a . the new rail is suited not only for mixed operation by trolleys with and without lateral guide rollers , but , thanks to the assembly grooves and the insert - and - clip connections , can be employed universally , is easy to retrofit , and can be assembled quickly and easily . rails can be removed and later reused in a simple manner . no complicated tools are required . | 1 |
the present invention is directed to a document conversion and network database system that is particularly effective in providing relevant document data to authorized clients of subscriber entities . with reference to fig1 - 6 of the drawings , a network database system 10 includes a primary computer 12 for receiving and processing data from a provider 13 , a subscriber computer 14 , and a client computer 16 , each of the computers 12 , 14 , and 16 being connectable to a distributed computer network 18 . in an exemplary implementation , the computer network 18 includes a multiplicity of communication lines 20 and a plurality of server computers 22 . one such server , designated 22 a , is a primary server that is set up in a conventional manner for directing communications on the network 18 and having additional features in accordance with the present invention that are described below . optionally , the primary server 22 a is principally associated with the primary computer 12 ( by a local telephone connection ); moreover , the primary computer 12 can be integrated with the primary server 22 a . another server , designated 22 b , communicates with the subscriber computer 14 , and a further server , designated 22 c , communicates with the client computer 16 . it will be understood that a single server may communicate with more than one of the computers 12 , 14 , and 16 . further , it is contemplated that the system includes a plurality of the subscriber computers 14 , multiple counterparts of the client computers 16 for each of the subscriber computers 14 and , possibly , a plurality of the primary computers 12 . in the exemplary implementation described herein , the communication network 18 is the internet , with at least some of the communication lines 20 being conventional telephone utility lines , each computer having a suitable modem or digital port ( not shown ) for interfacing with the telephone utility lines . as used herein , each of the servers 22 other than the primary server 22 a is considered to be a part of a composite network , designated 18 ′. a principal feature of the present invention is that the primary computer 12 is implemented for automatically customizing selected documents of the provider to identify the subscriber , and optionally the client , and reformatting the selected documents to facilitate navigation therein by the subscriber &# 39 ; s clients . the clients selectively access and navigate the documents using communications between the client computer 16 and the client server 22 c . the primary computer 12 includes a cdrom drive 24 for receiving and inputting source disks 25 that may be periodically received from the provider 13 . the computer 12 may also include a high - density disk drive 26 for writing processed counterparts of the received data on output disks 27 for delivery to the primary server 22 a . it will be understood that the cdrom drive 24 and the high - density drive 26 can be a single device , and further that the processed data can be transmitted to the primary server 22 a over the network 18 instead of being delivered on the high - density disks . a suitable primary server 22 a can be implemented with the server computer 22 running windows nt 4 . 0 , microsoft internet information server 4 . 0 , microsoft index server , microsoft site - server express , microsoft active server pages , microsoft sql server 6 . 5 , and microsoft transaction server that are commercially available programs of microsoft corp . of redmond , wash ., the uppercase terms being believed to be respective trademarks of microsoft . according to the present invention , the server 22 a is further programmed for authorizing and tracking client access as described below in connection with a subscriber and client database that can be implemented in the above - identified sql server program . the source disk 25 preferably contains the data from the provider 13 in a plurality of document files , one or more index files , and one or more map files , illustrations , the map files defining links to related documents and images . in an exemplary implementation , the various files are stored as compressed text files in american standard for information interchange ( ascii ) format . typically , certain text is delimited with special codes , such as by being enclosed in brackets , as “[ . . . ]”. preferably , the text files have imbedded tags for delimiting titles , subtitles , sections , headers , footers , etc . however , html tags are appropriately locatable for aesthetically formatting the documents and facilitating navigation thereof based on the document structure alone , without reliance on imbedded tags being in the raw ascii files . for example , titles and subtitles may be identified by having a length of only one line . as shown in fig2 , a document conversion process 50 is operable when the source disk 25 is mounted in the cd drive 24 . the process includes a conventional decompress step 52 wherein compressed file archives of the provider 13 on the disk 25 are decompressed and each of the resulting files is copied as ascii text in a suitable hard disk memory working directory 53 of the primary computer 12 . next , a suitable word processor program is entered in a start word process step 54 and a conversion macro 56 is invoked for processing the source text as described herein . suitable word processor programs include microsoft word 7 . 0 and mac word , as appropriate for suitable ibm - compatible and macintosh implementations of the primary computer 12 , each program being available from microsoft corp ., macintosh being believed to be a trademark of apple computer corp . in each of these implementations , the conversion macro 56 is appropriately coded in visual basic , also available from microsoft corp . in the conversion macro 56 , the working directory 53 as well as a target directory are determined in an initialize step 58 , and linkmap and docmap files therein are opened in an open map step 60 . in the initialize step 58 , one of several possible modules of the files is selectable according to available categories of the information . for example in the case of medical documents , exemplary categories are adult health , pediatric health , behavioral health , women &# 39 ; s health , etc . as further enumerated in the above - referenced listing of appendix a . the working directory can be a particular subdirectory having the selected category of documents . next , a file is read from the top of the directory 53 in a read first file step 62 , and a loop 63 is entered wherein a test index step 64 is performed . this test is firstly on the filename main part for bypassing signon and menu files , for example , and secondly on the extension , also bypassing “*. art ” artholder files , the test branching to a prepare index step 66 that is described below in connection with fig3 if the extension is “. idx ”. if not , control advances to test article step 68 that for normal articles and similar files such as credits and menus branches to a convert article step 70 that is described below in connection with fig4 . otherwise in each case of bypassing , the macro advances to a read next file step 72 , followed by a test done step 74 whereby the loop 63 is repeated unless there was no next file , in which the macro 56 ends , completing the process 50 . as shown in fig3 , the prepare index step 66 includes a strip step 76 for removing non - index lines from the current ( index ) file . a variable η is set to “ a ” in a set topic pointer step 78 , whereupon a loop 80 is entered in which a get section step 82 finds lines that begin with the letter η , with allowance for the absence of topics having that identification , and further allowance for the topic η having subheadings . next , in a convert links step 84 , index links are converted to html links , and the section η is replaced in an insert section step 86 . predefined top and bottom content is then added to the file in an add boilerplate step 88 , that content being next modified ( by specifying a subindex name , etc .) to be consistent with the selected module in a specialize boilerplate step 90 , after which the current index portion is saved in a save subindex step 92 . the topic letter η is then incremented in an increment pointer step 94 , and a test loop step 96 is performed for repeating the loop 88 until done , in which case control is returned to the main portion of the macro 56 . as shown in fig4 , the convert article step 70 first finds and replaces embedded tags of the current raw article file with corresponding html commented tags in a convert tags step 98 . text that is delimited with special characters is located , and corresponding html delimeters are substituted therefor in a special text step 100 . particularly , bolded text in the raw ascii files is delimited by brackets (“ . . . [ bolded text ] . . . ”), being changed by the special text step 100 to “ . . . & lt ; b & gt ; bolded text & lt ;/ b & gt ; . . . ”. a window title and a displayed article title are created in a create title step 102 that also adds top and bottom html tags to the file . unused header information is then hidden by comment codes , and delimited with appropriate tags in a hide header step 104 . typically , the raw ascii file has a footer containing a copyright notice , there being a need for improving the form and content of the notice . accordingly , the footer / copyright information is segregated with lines and italics being added in a convert footer step 106 . also , if there are sets of tags delimiting reformatted text that should not be altered ( such as lists , menus and tables ), tags delimiting such text are changed to corresponding html tags in a convert preformat step 108 . for example “& lt ;!--/ btable --& gt ; . . . table text . . . & lt ;!--/ btable --& gt ;” is changed to “& lt ; pre & gt ; . . . & lt ;/ pre & gt ;”. next , a document anchor step 110 establishes a document target name at the top of the file in html format , and extracts external target articles and artwork using the linkmap and docmap files , and imbeds corresponding html links . following the document anchor step 110 , a section links step 112 selects section headings and adds copies thereof at the top of the article , the copies being hot - linked into the article body . the section links step 112 makes use of imbedded tags ( if present ) and structural characteristics of the raw ascii file to identify the section headings . next , a paragraphs step 114 converts imbedded paragraph tags to html paragraph tags . in the case of indented paragraphs , that text is delimited by “& lt ; bodyquote & gt ; . . . indented text . . . & lt ;/ bodyquote & gt ;” tags . simple bulleted lists are then converted from reformatted text into properly formatted html lists in a make lists step 116 . more complex lists are also reformatted , if feasible ; otherwise they are left as reformatted text . finally , predefined top and bottom content is then added to the file in an add boilerplate step 118 , for providing a consistent appearance in all article files . that content is next modified in a specialized boilerplate step 120 using predefined markers having the actual module name , etc . as in the above - described specialize boilerplate step 90 of fig3 . upon completion of the conversion macro 56 , the document and index files , stored in html / asp format are transmitted by any suitable means to the primary server 22 a . as an alternative to using the high - density disk 27 as described above , the files can be uploaded by transmission over the network 18 . in the exemplary internet implementation of the system 10 , the primary server 22 a has a default web page that is addressable from the subscriber computer 14 and any of the client computers 16 . as shown in fig5 , a subscriber navigation path 130 permits a subscriber to set up a practice - specific home page using a new site selection option 132 from the default page , designated 134 . in a practitioner registration process , after appropriate information concerning the site is entered using a series of screens , a username and [ and ] password for the site is generated at the primary server 22 a , and a virtual website is created as described below . as indicated in fig5 , this information is not immediately available to the subscriber , being subsequently e - mailed ( following verification of financial arrangements if desired ), the primary server 22 a being implemented in a conventional manner for communicating the username and password to the subscriber computer 14 . alternatively , the subscriber &# 39 ; s username and password can be passed over the network 18 to be displayed on the subscriber computer 14 and saved by the subscriber . the subscriber navigation path 130 also includes a practitioner login path 136 that is password protected according to the present invention . once the subscriber has transmitted the username and password to the primary server 22 a , the server transmits corresponding codes directed to a username and password header portion of the web browser being run in the subscriber computer . thus in subsequent browser requests directed to the family of web page locations , the same username and password is automatically passed to the server 22 a as a part of the request . this is an important feature of the present invention that avoids the risks and inconvenience of the subscriber computer 14 having to accept cookies from the server 22 a , which cookies might possibly contain harmful viruses . appropriate coding for passing the username and password into the appropriate header field of the subscriber &# 39 ; s or client &# 39 ; s web browser is included in the odbc program module of the primary server 22 a , the details of such code being within the skill of the web - server programming art . following successful login , control passes to an administration page 138 from which the subscriber can generate and maintain client data / statistics using a stats window 140 , the client data being retained by the primary server 22 a in the above - identified sql server . the subscriber can also authorize new users in an authorize window 142 , or amend the previously entered site data in an information window 144 . additionally , the subscriber can access the above - described converted documents from a practitioner home page 146 , from which an index window 148 facilitates identification of sought - for information . a new and completely different virtual website is created for each practitioner of the subscriber that completes the practitioner registration process . thus another important feature of the present invention is that although the registration process of the new site path 132 process requires only five to ten minutes to complete , the resulting practice - specific website appears to have required hours of highly skilled labor to produce , just for the practitioner &# 39 ; s clients . the practitioners may efficiently promote themselves with these websites , extending the client educational materials of the converted documents to the clients with very little effort . as shown in fig6 , clients of any of the subscribers can also access the default web page 134 from a client computer 16 as described above in connection with fig5 . as shown in fig6 , a client navigation path 150 permits a client to register using a new client selection option 152 from the default page 134 . after appropriate information concerning the client is entered using a series of screens , a username and password for the client is generated at the primary server 22 a . the information required from the client can include last name , first name , middle initial , mailing address , telephone number , a personal password , and an e - mail address . of course some of this information can be omitted , particularly if it has already been provided to the sql client database , a minimal requirement being that there be sufficient information transmitted from the client to distinguish from other clients . as indicated in fig5 , the username and password information is not immediately available to the client as described above in connection with fig5 , being subsequently e - mailed ( with instructions for using the site ). it will be understood that the subscriber can communicate the subscriber &# 39 ; s username or any other predetermined designation given to the patient for permitting the client to complete the registration process , which designation can serve as temporary authorization pending granting of the patient &# 39 ; s username and password . also , the client &# 39 ; s permanent password can be either chosen by the client or generated by the server 22 a . once registered , patients have access from the default page 134 and a client login window 154 to the subscriber &# 39 ; s home page 146 and the index page 148 . most preferably , the initial client authorization is unique to each practitioner of the subscriber , each of the practitioner virtual home pages having a respective address that is terminated by the corresponding authorization term , whereby the first screen that the client sees is his practitioner &# 39 ; s virtual home page . this page then links to the document modules that the practitioner originally selected during the practitioner registration process . in a preferred form , each client education article begins as follows : “ welcome , & lt ; client &# 39 ; s first name & gt ; & lt ; client &# 39 ; s last name & gt ; to [ systemowner ]. net . this client education material has been provided to you by & lt ; practitioner &# 39 ; s practice name & gt ;.” of course , many variations of the above may be appropriate . anything that is stored in the practitioner / client database ( s ) can be displayed on the document pages , so that they can [ br ] be personalized messages . the converted documents are dynamically compiled in a process that first reads the header field “ www - authenticate ” for the username , that field reading “ www - authenticate username : password . . . ” an exemplary form of the corresponding record of the sql database reads : select “ fname ” “ mi ” “ lname ” from table where username =“ x ”. an exemplary html coding for each web - page is : welcome & lt ;% fname %& gt ; & lt ;% lname %& gt ; to ssytemowner . net this web - site has been provided by basically , the primary server 22 a looks at each page before sending it out and replaces the placeholders or variables with the corresponding information from the database table . any fields of the database can be inserted into the documents . the pre - processed pages are then sent to the client &# 39 ; s browser to complete each of the client &# 39 ; s requests . suitable program code for directing this dynamic compilation is provided in the smtp program module of the primary server 22 a , the details of such code being within the skill of the web - server programming art . although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . therefore , the spirit and scope of the appended claims should not necessarily be limited to the description of the preferred versions contained herein . | 8 |
the siliceous molecular sieves suitably employed in the practice of the invention include the microporous crystalline aluminosilicates , i . e ., the zeolitic molecular sieves as well as the so - called silica polymorphs . with respect to the latter compositions , their crystal lattices are ideally formed entirely of sio 2 tetrahedral units , but the as - synthesized forms commonly contain at least trace amounts of aluminum derived from aluminum impurities in the synthesis reagents . the aluminosilicate molecular sieves comprise the large class of well - known crystalline zeolites . these high - silica molecular sieves are either commercially available or are prepared by methods , well - known in the art , involving direct hydrothermal synthesis or involving certain types of crystal lattice dealuminations . a comprehensive review article by e . m . flanigen concerning both &# 34 ; high &# 34 ; si / al zeolites and silica molecular sieves is published in &# 34 ; proc . 5th int . conf . zeolites , naples , 1980 &# 34 ;, l . v . c . rees , ed ., heyden , london , pp . 760 - 780 . this article is incorporated herein by reference . it is a critical aspect of the present invention that the adsorptive capacity of the siliceous molecular sieve employed in less than 10 weight percent , preferably less than 6 weight percent , when measured at 25 ° c . and a water vapor pressure ( p / p o ) of 4 . 6 torr . the efficacy of the molecular sieves employed in the practice of the present invention is not dependent upon the presence of the water of hydration present in the internal cavities of the microporous structure as a result of their hydrothermal formation . in fact , at least a major proportion , usually substantially all , of this original water of hydration is removed in the process of removing any pore - blocking templating agent which may be present in the adsorbent . calcination effectively removes the organic moieties . also , water washing or washing with a caustic or dilute mineral acid solution is advantageously utilized to remove extraneous synthesis reagents from the pore system . lowering of the alkali metal content , particularly the non - zeolitic , i . e ., occluded alkali metal compounds can also be beneficial . these procedures also serve to remove the original water of hydration . it is another critical aspect that the number of alo 2 tetrahedral units of the crystal lattice , if present at all , be very small compared with the number of sio 2 tetrahedral units . it has been observed that there appears to be some correlation between the framework sio 2 / al 2 o 3 ratio and the adsorptive capacity for water , i . e ., the so - called hydrophobicity , of siliceous molecular sieves . it is known that for the successful elimination of odors generally , including ammonia , it is essential to effectively isolate the source molecules to a level beneath their detection threshold , which in almost all instances is an extremely low concentration level . since even a microgram of ammonia in a 50 cc &# 34 ; sniff &# 34 ; of atmospheric air is detectable as an odor , it is necessary to effectively sequester ammonia on the molecular sieve adsorbents employed in the present invention to an uncommon degree . this is not to be expected in the case of these so - called hydrophobic ( organophilic ) adsorbents in which the relative absence of cation sites is universally believed to favor the adsorption of non - polar hydrocarbons and to exhibit only modest adsorption affinity for polar molecular species such as water . in fact , both water and ammonia are strongly adsorbed in low - silica zeolites such as zeolite x and zeolite a . in the present invention , however , the zeolitic adsorbents show high adsorptive affinity for ammonia and low adsorptive affinity for water , for reasons which have not yet been fully explained . whatever the reason , it is found that the class of siliceous molecular sieves defined hereinabove , from which the original , as - synthesized water of hydration has preferably been substantially removed , and which have a framework sio 2 / al 2 o 3 molar ratio of at least 50 , a capacity for adsorbed water of not greater than 10 , and preferably not greater than 6 , weight percent when measured at 25 ° c . and a water vapor pressure ( p / p o ) of 4 . 6 torr , function in an extraordinary manner with respect to ammonia adsorption . many of the synthetic zeolites prepared using organic templating agents are readily prepared in a highly siliceous form -- some even from reaction mixtures which have non intentionally added aluminum . these zeolites are markedly organophilic and include zsm - 5 ( u . s . pat . no . 3 , 702 , 886 ); zsm - 11 ( u . s . pat . no . 3 , 709 , 979 ); zsm - 35 ( u . s . pat . no . 4 , 016 , 245 ); zsm - 23 ( u . s . pat . no . 4 , 076 , 842 ); and zsm - 38 ( u . s . pat . no . 4 , 046 , 859 ) to name only a few . it has been found that the silica molecular sieves known as silicalite and f - silicalite are particularly suitable for use in the present invention and are thus preferred . these materials are disclosed in u . s . pat . nos . 4 , 061 , 724 and 4 , 073 , 865 , respectively . to the extent the aforesaid siliceous sieves are synthesized to have sio 2 / al 2 o 3 ratios greater than 50 , they are frequently suitable for use in the present process without any additional treatment to increase their degree of hydrophobicity . molecular sieves which cannot be directly synthesized to have both sufficiently high si / al ratios and / or degree of hydrophobicity can be subjected to dealumination techniques , flourine treatments and the like , which result in organophilic zeolite products . high - temperature steaming procedures for treating zeolite y which result in hydrophobic product forms are reported by p . k . maher et al ., &# 34 ; molecular sieve zeolites ,&# 34 ; advan chem . ser . 101 , american chemical society , washington , d . c ., 1971 , p . 266 . a more recently reported procedure applicable to zeolite species generally , involves dealumination lattice site . this process is disclosed in u . s . pat . no . 4 , 503 , 023 issued mar . 5 , 1985 to skeels et al . halogen or halide compound treatments for zeolites to increase their hydrophobicity are disclosed in u . s . pat . nos . 4 , 569 , 833 and 4 , 297 , 335 . with respect to the foregoing adsorbents , it is important that the pore system be open so that the internal cavities of the crystals be accessible to the ammonia molecules , even in their hydrate form . in the case of the aluminosilicates or silica polymorphs produced using large organic templating ions such as tetraalkylammonium ions , it is necessary to remove charge balancing organic ions and any occluded templating material in order to permit adsorption of the ammonia molecules . in such a removal process and also in the removal of inorganic debris , the original water of hydration is also removed . upon exposure to the atmosphere a portion of the water of hydration is reacquired , but this does not affect the characteristics of the molecular sieve which are essential for the practice of the present invention , i . e ., the molecular sieve can be employed in either a hydrated or dehydrated state , but in general the dehydrated state is preferred . in the case of most of the dealumination procedures referred to above , the original water of dehydration is also removed , and can similarly be replaced , if desired , for the practice of the invention . it should be pointed out that it is the framework sio 2 / al 2 o 3 ratio which is important . this is not necessarily the same ratio as would be indicated by conventional wet chemical analysis . especially , this is the case when dealumination has been accomplished by high temperature steaming treatments wherein aluminum - containing tetrahedral units of the zeolite are destroyed , but the aluminum values remain , at least in part , in the zeolite crystals . for such zeolite products resort must be had to other analytical methods such as x - ray and nmr . one such steam - treated zeolite y composition , denominated lz - 10 , has been found to be particularly useful in the practice of the present process , especially when utilized in combination with the silica polymorph silicalite . the process for preparing lz - 10 is described in detail in u . s . pat . no . 4 , 331 , 694 and in u . s . application ser . no . 880 , 561 filed feb . 23 , 1978 , now abandoned . a benefit appears to be obtained by such a combination of molecular sieves in all proportions , but each type of adsorbent is preferably present in an amount of at least 10 percent based on the total weight of the two adsorbents ( hydrated weight basis ). the method for contacting the ammonia source with the siliceous molecular sieve adsorbent is not narrowly critical even though other adsorbable molecular species , including water vapor are present . the process is believed to be basically an adsorptive process rather than an ion - exchanged process . the siliceous molecular sieve can be present in a formulation with diluents , carriers , dispersing media and the like , even aqueous media , and applied to the odor source in that form . the formulation may be in the form of a powder , an agglomerate , an aerosol or in shaped forms , i . e . monoliths , which can be directly applied to a concentrated source of the ammonia odor of be positioned within a zone through which a gas stream containing the ammonia molecules are entrained . specific applications include the incorporation of the adsorbents in , foot powders , incontinence pads , cat litter , diapers , non - woven tissues and the like for the treatment of ammonia odors in bathrooms , kitchens , garbage compactors and cans , etc . temperature conditions at contact are not critical , but are preferable within the range of - 25 ° to 40 ° c ., i . e ., the ambient atmospheric temperature occurring in any season and in any geographical location . pressure is also not a critical factor , but is preferably at least about one atmosphere . the present process is illustrated by the examples appearing hereinafter . in the present experiments ten molecular sieves adsorbent composition were each contacted with a 1 . 0 normal aqueous ammonium hydroxide solution . the adsorbents were : ( a ) lz - 10 , a steam - treated ammonium - exchanged form of zeolite y prepared according to the procedure set forth in u . s . pat . no . 4 , 331 , 694 . the framework si / al 2 ratio was greater than 50 . ( b ) lz - 10 , prepared by essentially the same procedure as in ( a ) above with minor variations in the steaming conditions . the product had a framework si / al 2 ratio of greater than 50 . ( c ) s - 115 ( silicalite ) a silica polymorph prepared using a tetraalkylammonium templating agent in a reaction system to which no alumina was intentionally added . the framework si / al b 2 ratio was greater than 150 . the templating agent was removed from the adsorbent by calcination . ( d ) s - 115 , another silica polymorph sample prepared in essentially the same manner as in ( c ) above . the method for preparation of both ( c ) and ( d ) is set forth in u . s . pat . no . 4 , 061 , 724 . ( e ) a mixture of equal parts by weight of ( a ) and ( c ) above . ( f ) a mixture of equal parts by weight of ( b ) and ( d ) above . ( g ) lz - 105 , an aluminosilicate zeolite of the zsm - 5 type prepared in the absence of an organic templating agent . the framework si / al 2 ratio was about 37 . the sample was activated by calcination prior to use in the testing procedure . ( h ) s - 130 , a silica polymorph of the type described in detail in u . s . pat . no . 4 , 104 , 294 and known in the art as tea - silicate . the framework si / al 2 ratio was about 400 . the templating agent used in synthesis had been removed by calcination . ( i ) f - 70 , a sample of the aluminosilicate zeolite f as described in detail in u . s . pat . no . 2 , 996 , 358 . the sample had been prepared for testing as an ion - exchange medium for removing ammonia from waste water streams . the framework si / al 2 ratio about 2 . ( j ) w - 85 , a sample of the aluminosilicate zeolite w as described in detail in u . s . pat . no . 3 , 012 , 853 . the sample had been prepared for testing as an ion - exchange medium for removing ammonia from waste water . the framework si / al 2 ratio was between 4 and 5 . in the test procedure the aqueous ammonium hydroxide solution was added to the dry zeolite powder sample in incremental amounts and mixed well after each addition . after each addition and mixing , the sample was smelled to determine if any odor of ammonia could be detected . if there was no odor detection , an addition increment of the nh 4 oh solution was added . addition of nh 4 oh solution was terminated upon the first detection of ammonia odor . the amount of ammonia adsorbate contained by each sample at termination is set forth below : table i______________________________________ nh . sub . 4 oh absorbed , nh . sub . 3 adsorbed , adsorbed ( wt %) ( wt %) ______________________________________a 68 . 4 1 . 07b 57 . 1 0 . 89c 26 . 0 0 . 47d 28 . 9 0 . 52e 38 . 5 0 . 76f 51 . 2 1 . 03g 14 . 8 0 . 25h 51 . 2 0 . 87i 25 . 0 0 . 43j 12 . 6 0 . 21______________________________________ samples ( a ), ( c ), ( e ), ( g ), ( h ), ( i ) and ( j ) were permitted to stand at ambient room temperature for 24 hours and then again smelled to determine if the odor of ammonia was detectable . samples ( a ) ( e ) and ( h ) were found to have no odor . sample ( c ) gave off a very faint odor and in the case of sample ( g ), ( i ) and ( j ) a strong odor was still present . additional nh 4 oh solution was added to samples ( a ), ( e ) and ( h ) until the odor of ammonia could again be detected . for these samples the final results insofar as adsorption capacity for ammonia under odorless conditions are as follows . table ii______________________________________ nh . sub . 4 oh absorbed , nh . sub . 3 adsorbed , adsorbed ( wt %) ( wt %) ______________________________________ ( a ) 91 . 6 1 . 56 ( e ) 60 . 7 1 . 03 ( h ) 59 . 3 1 . 01______________________________________ it is apparent from the foregoing data that despite a significant ion - exchange capacity for ammonium ions , the samples of zeolite f , zeolite w and the low - silica zsm - 5 type zeolite exhibit only a modest capacity for sequestering ammonia and , more importantly , a poor capability for keeping the initially sequestered ammonia from passing to the atmosphere over the adsorbent in amounts which were readily detectable by the sense of smell . lz - 10 should particularly outstanding performance in both sequestration and odor prevention . using samples ( a ), ( c ) ( e ), and ( h ) loaded with nh 4 oh ( 24 hours ) from example 1 ( above ) were heated to determine the effects of temperature increase upon the odor - suppressing properties of these adsorbent materials . bottles containing each of the samples was placed into a water bath and heated . as the temperature of the bath reached 50 ° c ., 65 ° c ., 75 ° c . and 85 ° c . the bottles were smelled and the level of ammonia odor gauged . the results are set forth below : table iii______________________________________adsorbent temperature odor perception______________________________________ ( a ) 50 very , very faint 65 faint 75 faint 85 none to very faint ( c ) 50 medium 65 faint 75 medium 85 medium ( h ) 50 medium 65 faint 75 strong 85 strong ( e ) 50 faint 65 very , very faint 75 faint 85 faint______________________________________ the apparent preference for the adsorbents of the present invention for ammonia over less polar adsorbates can be used to advantage in such applications as the prevention of ammonia odor development in diapers . the adsorbent is first pre - loaded with a pleasant fragrance ( perfume ) before being incorporated into the diaper article . because the adsorbents are hydrophobic , the initial contact with water during use of the diaper causes only a modest release of the adsorbed fragrance , but upon the generation of ammonia by normal bacterial action , the fragrance is rapidly desorbed by the adsorbed ammonia , which signals the need for diaper change . | 8 |
fig1 - 3 show an assembled utility knife housing 100 which comprises first and second halves 102 , 104 . the first half 102 is , as shown in fig4 arranged to receive a blade carrier 106 , and an serpentine spring 108 and thumb piece 110 . it will be noted at this point that even though the spring 108 and thumb piece 110 are in fact unitarily formed as one piece in the preferred embodiment , each member will be assigned different numerals and will be referred to as separate elements for the sake of disclosure clarity . the blade carrier 106 , the construction of which is best seen in fig2 - 27 , is arranged to be slidable within the housing 100 and is arranged to travel along guide surfaces which are best seen in fig8 . the lower guide surface 112 is arranged to engage the lower minor edge 106 a of the blade carrier , while the inboard minor edges of upper and lower guide ribs 114 , 116 , are arranged to engage what shall be referred to as the rear major surface 106 b of the carrier 106 . as will be appreciated from fig4 these upper and lower guide ribs 114 , 116 are such as to engage the rear major surface 106 b of the blade carrier at locations which are proximate the upper and lower edges thereof . a detailed description of the structure provided on the front major surface of the carrier will discussed hereinlater with reference to fig2 and 26 , along with the manner in which different types of blades can be operatively and adjustably mounted thereon . the serpentine spring 108 is provided with a connection boss 108 a at one end . a through hole which is formed in this boss 108 a is adapted to receive a circular cross section pin 102 p which is , as best seen in fig8 formed on the inner wall of the first half proximate the rear end thereof . in this embodiment , the thumb piece 110 is unitarily formed at the leading end of the spring . the configuration of this spring 108 and the thumb piece 110 are shown in fig2 - 24 . it will be noted that while the top of the thumb piece is illustrated as being relatively flat throughout most of the figures , it is possible to modify the shape of this element as the need to vary the engagement with the thumb surface of the operator , occurs . merely by way of example , the surface of the thumb piece 110 can be increased in the manner illustrated in phantom in fig2 , in the event that it is required to enable the operator to be able to increase the amount of forward thrust during use . further , as shown in fig3 , the boss 108 a is formed with a slot 108 s which is sized to receive rib 117 with which pin 102 p is integrally formed ( see fig8 ). the engagement between the rib 117 and the boss 108 a prevents the relative rotation of the boss 108 a about the pin 102 p when the serpentine spring 108 is elongated via the application of manual force to the thumb piece 110 . the provision of the slotted boss 108 a is thought to prolong the working life of the spring . the lower surface of the thumb piece 110 is formed with an engagement projection 110 a . this projection 110 a is adapted to be received in one of a number ( two in this embodiment ) of engagement recesses 106 b 1 , 106 b 2 , which are formed along the upper minor edge 106 c of the blade carrier . while being normally well received in the selected one of the engagement recesses , the engagement projection 110 a is driven down into position by the force which is applied to the thumb piece 110 during the operation of the knife . the sides of the thumb piece 110 are formed with guide grooves 110 b which are arranged to receive the inwardly extending wall portions 1021 , 1041 which extend along the sides of a slot 100 s which is formed in the upper minor surface of the housing 100 and in which the thumb piece is adapted to slide . this slot 100 s extends along the middle of a shallow trench denoted by the numeral 100 t . the flat windings of the serpentine spring 108 are arranged so that the curved inflexion portions 108 b of the spring have a greater lateral thickness than the portions 108 c of the spring which extend therebetween . in fact , as seen in fig2 , in this embodiment , one side of the spring 108 is formed flat while the other side is such as to exhibit an almost 100 % change in thickness . the shoulder or inflexion portions 108 a are close to , if not about twice as thick when taken laterally , as the connecting members 108 c . a tapered section 108 d interconnects the thick and thin portions as shown . this configuration not only facilities the provision of the rigidifying guide ribs 104 a , 104 b which are formed in the second half 104 of the housing , by effectively providing a channel in which they may be received , but also increases the strength and longevity of the portions ( viz ., inflexion portions 108 b ) of the spring 108 which undergo considerable deformation / flexure during the operation of the knife . the various other modifications which are possible with the above - described spring and thumb - piece construction / arrangement will be readily self - evident to the person skilled in the art to which this invention pertains and as such no further disclosure is deemed necessary and will be accordingly omitted for brevity . the two halves 102 , 104 of the housing are interconnected using a unique connection arrangement . the forward end of the first half 102 is formed with a slot 102 a ( see fig5 ) while the corresponding forward end of the second half 104 is provided with a tang 104 c ( see fig1 ) which is adapted to slid into the recess or slot 102 a to establish a connection at the forward or leading end of the housing . the rear end of the first half 102 is formed with a rectangular push - button - like projection 102 b . the top of this projection 102 b is sized so that it may be readily pressed with a thumb or digit of an operator &# 39 ; s hand during a disconnection operation . the second half 104 , on the other hand , is formed with an opening 104 d into which the projection may enter and subsequently be received . two clasper - like tabs 104 e which are resilient , are formed on either side of the opening or aperture and are arranged to frictionally engage the sides of the projection 102 b as the projection 102 b is moved toward and into the opening . the ends of the tabs 104 e are formed with small inwardly extending ridges 104 r . these are arranged to slide on the sides of the projection 102 b until the projection 102 b is almost completely received in the opening 104 d and the two halves 102 , 104 of the housing 100 are essentially in full engagement with each other . at this time , the ridges 104 r snap into recesses 102 d ( see fig7 ) which are formed on opposite sides of the projection 102 b and produce a click - lock effect which binds the two halves 102 , 104 snugly together . when it is desired to separate the first and second halves , all that is necessary is for an operator to press on the top of the projection 102 b , which is clearly accessible from the second side of the housing as clearly illustrated in fig3 and apply a force acting in the direction shown by arrow r ( release ) in the depicted in fig2 . the application of this force r is such as to move the projection 102 b away from the second half 104 and induce the ridges 104 r to ride up out of the recesses 102 d and re - engage the sides of the projection 102 b . once this click - lock is released , the projection 102 b is able to slide with the tabs 104 e frictionally engaging its sides to permit the two halves 102 , 104 to smoothly separate from one another until such time as disengagement between the same is stably achieved . a finger guard 118 is provided on the lower minor edge of the housing . in this embodiment , the guard is formed from projections portions 118 / 2 , 118 / 4 which are formed in the respective halves and which seat side by side when the two halves 102 , 104 are connected to one another . a strengthening web 118 / 4 a is , as shown in fig1 , provided in the projection portion 118 / 4 which is formed in the second half 104 of the housing . this guard member 118 is such as to provide an abutment which prevents the index finger of the operator from slipping forward toward the blade during a cutting operation . while the finger guard 118 which is illustrated in the drawings is shown in the form of a single simply shaped projection , the invention is not so limited and it is possible , merely by way of example , to provide a more pronounced member or an arrangement wherein a pair of the projections are provided in a manner which are arranged to have the operator &# 39 ; s index finger received therebetween and thus prevented from slipping either forward or backward during use of the device . a blade storage area is provided within the housing . this area is , as indicated by the numeral 102 st in fig8 such as to be located so as to be covered by the blade carrier when the carrier is disposed in position in the manner illustrated in fig4 for example . fig2 - 27 show details of the blade carrier 106 . as mentioned above , the carrier 106 has a flat rear major surface 106 b and also has a profiled front major surface 106 d . this profiling includes shaped edge members 106 e and 106 f which are respectively formed along the upper and lower edges of the carrier 106 and which project out about the main planar portion of the front major surface . both the upper and lower edges 106 e , 106 f are provided with the previously mentioned engagement recesses or openings 106 b 1 , 106 b 2 and 106 b 3 , 106 b 4 into which the engagement projection 110 a formed on the lower surface of the thumb piece 110 , can be selectively received . the provision of the engagement recesses on both the upper and lower edges of the blade carrier 106 allows the carrier to be rotated through 180 ° so that the upper edge takes the position of the lower edge and vice versa ., and rest in the first half in this new orientation . it will be noted that in this embodiment the recesses 106 b 1 , 106 b 2 in the upper edge 106 e are located essentially opposite the recesses 106 b 3 , 106 b 4 which are formed in the lower edge . this close to mirror image arrangement is not necessary and the recesses can be arranged in different positions in accordance with the adjustment characteristics which are sought . in the illustrated orientation or position , the blade carrier 106 is arranged to receive an essentially trapezoidally - shaped cutting blade in the manner indicated by the first icon ic 1 which is imprinted into the front major surface . examples of this type of blade are given in fig2 - 33 . a will be noted , this type of blade is provided with at least one connection notch in its upper edge ( viz ., the edge opposite the cutting edge ). the blade carrier is provided with a first positioning projection 106 g which extends down from the upper edge member 106 e in a manner that enables a blade to be set on the front major surface , in the manner indicated by the first icon , with the cutting edge seated on the lower edge 106 f and with the positioning projection located in a connection notch formed in the upper edge of the blade . as will be appreciated from fig4 even if the blade is such as to have only one connection notch ( e . g . the blade shown in fig2 ), the maximum amount of blade projection can be adjusted by selecting the appropriate engagement recess ( i . e ., one of 106 b 1 and 106 b 2 ) in the edge of the blade carrier 106 which is in contact with the lower surface of the thumb piece 110 . in this embodiment , since there are only two engagement recesses formed in each of the upper and lower edges of the carrier , the amount of adjustment is limited to only two stages . however , in the event that the blade is formed with more than one connection notch ( see fig2 and 33 by way of example ), then the degree of adjustment freedom is increased and the maximum amount of blade projection can be varied to a greater degree . the formation of three or more engagement recesses in the upper and lower edges of the carrier would also increase this freedom . the blade carrier 106 is formed with a second positioning projection 106 h . this projection is , as shown in fig2 , located toward a rear edge of the carrier ( viz ., rear as seen in fig2 ) and is arranged to project up from a raised section 106 i . this projection 106 h is adapted for use with a razor blade of the nature illustrated in fig3 and 35 and is arranged to be received in the openings which are formed in the middle of the blade . it will be understood from the second icon ic 2 which is imprinted on the front major surface of the carrier , that when it is desired to use the razor type blade as different from the blades shown in fig2 - 33 , the blade carrier needs to rotated through 180 ° from the illustrated orientation and set in the first half so that the cutting edge of the razor blade will project oriented downwardly in the required manner . it will of course be self - evident that the blade carrier 106 can be readily adapted to receive and operatively support a number of different blades and is limited to the illustrated arrangements . the material from which the two halves 102 , 104 are formed can be either opaque or transparent . it is also possible that one half be made of a transparent material and the other of an opaque type . combinations of colored / patterned material is also possible . in fact , is possible to make the second half 104 transparent and make the components such the thumb piece 110 , spring 108 and blade carrier 106 different colors so as to be visible through the transparent half . this arrangement of course renders the blade which is disposed on the blade carrier 106 , visible to the operator , who immediately is aware of the type which is currently loaded and whether this is the type that is required for the job in hand . by making the spring 108 and thumb piece 110 of a brightly colored material it is possible , in combination with the use of at least one transparent half , to increase the aesthetic value of the device by making the shape and operation of the spring visible to the operator . in addition to this , the operator is immediately made aware of the type of utility knife that is being used and enables an immediate differentiation between the type wherein the blade is automatically retracted and those wherein the blade is locked in position through the provision of a detent mechanism or the like . although the present invention has been disclosed with reference to only one specific embodiment , it will be self evident to those skilled in the art to which the present invention pertains , that various changes and modifications could be made without departing from the scope of the invention which is limited only by the appended claims . that is to say , while the embodiment of the present invention is directed to the type of arrangement wherein the blade retracts automatically under the bias of a spring when the manual pressure which is used to force the blade out into a projected position , is removed , that various aspects of the invention could well be applied to the type of knife wherein the blade is locked in position using a lock or detent mechanism . by way of example , the blade carrier could be used in such an arrangement without need of modification and could be arranged , for example , so that one or more of the engagement recesses which are formed in the lower edge of the carrier , could be arranged to engage a catch or the like and thus serve a dual purpose . the spring and thumb piece could be also transferred to other types of knives without major redesign . the finger guard arrangement could also be used without any particular difficulties . the unique connection arrangement which allows the two halves to be connected / separated with ease could also be applied to any number of different hand - held devices and thus represents a valuable design arrangement . | 1 |
fig1 - 6 illustrate the head gimbal assembly 10 according to the present invention . fig1 is a top plan view of a head gimbal assembly 10 including a flex on suspension ( fos ) 12 and a gimbal 18 , wherein a dissipative polymer covercoat 34 of suitable known construction has been screened over a specified area of the transducer leads 24 and ground lead 25 . fig2 is an enlarged perspective top plan view , and fig3 a cross - sectional view , of a head gimbal assembly 10 . the dissipative covercoat 34 has been screened onto the transducer leads 24 and ground lead 25 over a window in the dissipative covercoat 34 , thereby allowing a tight tolerance on resistance as it is more robust in thickness than in area . the application of the dissipative covercoat 34 over the fos 12 , transducer leads 24 , and ground lead 25 is more easily assembled than other potential esd solutions , because its application step is similar to a conventional covercoat by using a thermal cure instead of a uv cure . charge built up by handling or testing the head gimbal assembly 10 is dissipated through the dissipative covercoat to the ground lead 25 . the ground lead 25 is connected to ground at the tail tack 22 by a conductive adhesive . the dissipative covercoat 34 is applied onto all the transducer leads 24 , which provides a discharge path from both the reader and writer leads , thus protecting the reader element against induced current from a reader or writer element discharge . the dissipative covercoat 34 should have a resistance in the range of 220 kω to 10 mω . the resistance of dissipative covercoat 34 is based on area , thickness and concentration of the dissipative covercoat 34 . alternatively , the dissipative polymer covercoat 34 is applied to the entire length of the fos 12 and transducer leads 24 and ground lead 25 , as shown in fig4 . this provides for esd protection to the entire substrate 35 and length of the transducer leads 24 and ground lead 25 by bleeding off the charge at a controlled rate . further , a dissipative substrate 37 is used on the fos to bleed charge built up on the leads 24 and 25 , as shown in fig5 . in this embodiment , a dissipative polymer substrate 37 of suitable known construction is used as a substrate for the fos 12 and is in direct contract with the transducer leads 24 and ground lead 25 . dissipative substrate 37 may be composed of , but is not limited to , polyimide . dissipative substrate 37 is beneficial in that it does not allow the fos 12 to tribocharge as well as allowing the bleed off of any charge built up on the leads . [ 0033 ] fig6 illustrates a different resistive system that would be implemented similar to fig3 . a conventional intrinsically conductive polymer 36 is screened over the transducer leads 24 and ground lead 25 , and non - conductive covercoat 33 is screened over the conductive polymer 36 . charge built up by handling or testing is dissipated through the conductive polymer 36 to the ground lead 25 . the ground lead 25 is connected to ground at the tail tack 22 by a conductive adhesive , which measures in the range of less than 1 mω . the conductive polymer 36 is applied onto all the transducer leads 24 and ground lead 25 , which provides a discharge path from both the reader and writer leads , thus protecting the reader element against induced current from a reader or writer element discharge . the conductive polymer 36 can be from any of the families of conductive polymers , such as pyrrole , thiophene and furan . the resistance of conductive polymer 36 is based on area , thickness and concentration of the conductive polymer 34 . an alternate preferred embodiment of the head gimbal assembly 10 with bleed resistors is shown in fig7 - 9 . fig7 is a top plan view of head gimbal assembly 10 of the type shown in fig1 . fig8 is an enlarged perspective view of fig7 . this embodiment further includes a fos breakaway tab 32 which is located on the end of the fos opposite the gimbal 18 , a mounting plate 14 , a load beam 16 , and a magnetoresistive head ( shown in fig1 ). the magnetoresistive head includes a slider 20 ( shown in fig1 ) and transducer 26 ( shown in fig1 and 14 ). the transducer 26 is fabricated onto a substrate , and then the substrate is attached to the slider . the fos 12 extends from an actuator ( not shown ) and attaches to a portion of the mounting plate 14 on the tail tack 22 of the fos 12 , and further extends to , and is attached onto , the load beam 16 . the gimbal 18 is attached to an end portion of the fos 12 . the gimbal 18 and an end portion of load beam 16 supports slider 20 in the vertical direction and also supplies a downward force to counteract the hydrodynamic lifting force developed by media ( not shown ) that move beneath slider 20 . fig7 also shows the transducer leads 24 , which run the entire length of the fos 12 , to the gimbal 18 and eventually to the magnetoresistive head . in this embodiment a discrete ceramic bleed resistor 38 is connected to the transducer leads 24 on the fos breakaway tab 32 . the resistor acts as a dissipative route between the transducer leads 24 and ground , and has a resistance in the range of 220 kω to 10 mω . the single resistor design provides esd protection through the pcc connect and is torn off with the tester bond pads after testing and handling , thus no additional particle contamination . an alternative derivation of this embodiment is shown in fig9 where bleed resistors 38 are connected to the fos 12 near the gimbal 18 . at least two bleed resistors 38 are electrically connected to transducer leads 24 and gold pads 39 . . conductive epoxy is applied between the gold pad 39 and load beam 16 by a is through hole 44 . the bleed resistors 38 are tied to the grounded load beam 16 via the conductive epoxy . this provides protection from esd during and after drive build , as the resistors are permanent on the fos 12 . another alternative embodiment of the head gimbal assembly 10 with esd protection is shown in fig1 and 11 . in this embodiment , the polyimide substrate 35 of fos 12 is altered by a laser source , thereby carborizing and producing a bleed resistor 38 . the desired resistance is tied to the time of laser application , power of the laser and size of the carbonized area . the resistance of bleed resistor 38 is preferably in the range of 220 kω to 10 mω . the bleed resistor 38 is in electrical contact with transducer leads 24 and acts as the dissipative route between the transducer leads 24 and ground . [ 0037 ] fig1 is an enlarged fragmentary perspective view of gimbal 18 near the end of the head gimbal assembly 10 . as illustrated in fig1 , the transducer leads 24 run along the gimbal 18 to the contact pads 28 , which are on the slider 20 . wires 30 electrically connect the transducer 26 to the bond pads 28 . the transducer leads 24 are made of an electrically conductive material such as copper . the transducer leads 24 are fabricated or deposited upon a dielectric material such as a polyimide or a polyester material such as polyethyleneterephthalate ( pet ). the bond pads 28 are also formed from an electrically conductive material , such as copper , and are fabricated upon the slider 20 . fig1 - 15 illustrate an alternative embodiment for esd protection in the magnetoresistive head of head gimbal assembly 10 . fig1 and 14 show a simplified schematic of a magnetoresistive head 28 , which includes the slider 20 and transducer 26 . the transducer 26 is fabricated into a substrate or slider ( not shown ). the transducer 26 includes a writer element 42 , a read element ( not shown ), and a magnetic shield 43 . transducer 26 further includes parasitic capacitors 48 and 49 between writer coil 42 and the magnetic shield 43 and between magnetic shield 43 and slider 20 , respectively . magnetic shield 43 , which may also serve as a pole , is provided to shield stray magnetic flux generated by writer element 42 . writer bleed resistors r 1 , r 2 and r 3 are fabricated simultaneously with reader bleed resistors , to offer minimal process content increase . reader bleed resistors are shown and described in u . s . patent application ser . no . 09 / 824 , 528 , filed apr . 2 , 2001 , by tabat et al , entitled “ magnetic transducers with integrated charge bleed resistors ,” and is incorporated by reference herein . fig1 illustrates bleed resistor r 1 electrically coupled to writer element 42 and slider 20 . bleed resistor r 1 provides a discharge path from the writer element 42 , which will reduce or balance any charge build - up . similarly , bleed resistor r 3 provides a discharge path between shield 43 and the slider 20 . [ 0039 ] fig1 illustrates bleed resistors r 1 and r 2 coupled onto either side of the writer element 42 and to the slider 20 . bleed resistors r 1 and r 2 couple to the same physical location on the slider 20 , such that they are effectively coupled together and provide a discharge path across the writer element 42 . the use of r 2 in addition to r 1 allows for reduced write signal degradation owing to these resistors . similarly , a bleed resistor r 3 provides a discharge path between shield 43 and the slider 20 . via 58 provides an electrical connection between the bleed resistors ( r 1 , r 2 , and r 3 ) and slider 20 , which is more fully illustrated in fig1 . a nominal value in the range of 10 kω to 1 gω is targeted for the writer bleed resistors r 1 , r 2 and r 3 . [ 0041 ] fig1 is a top plan view of transducer 26 showing connect coil contacts 52 , which provide electrical connection to the writer element 42 as shown in fig1 . in fig1 the read element has not yet been deposited . the bleed resistor terminals , at the ends of the resistors , themselves can be fabricated using the bottom shield seed layer material . the bleed resistors are buried under an insulating layer such as alumna , used for back fill during the fabrication process and chemical - mechanical - planaraization ( cmp ) of the substrate prior to fabrication of read element . bleed resistors r 1 , r 2 and r 3 are shown as wire leads deposited on the substrate of slider 20 , which provide electrical connections in accordance with the present invention between coil contacts 52 and a via 58 and between shield 43 and a via 58 . via 58 provides an electrical connection from a top surface of transducer 26 and slider 20 . slider 20 is connected to load beam 16 and load beam 16 is connected to ground . the presence of the writer bleed resistors r 1 , r 2 and r 3 should offer improvements in wafer manufacturing process in various ways , as charge can be bled from the wafer to the chuck mechanism in process tools . in plasma process tools , such bleeding of charge is known to reduce esd risk . also , in plasma processing , the presence of unbalanced charge drives variation during pattern transfer . in plating tools , the presence of an extra electrical contact to the substrate can provide greater uniformity . following wafer processing , the writer bleed resistors will offer additional protection beyond what reader bleed resistors may offer . the additional protection will occur during bar , slider , head gimbal assembly , head stack assembly , drive production and drive operation . the expected improvement during processing should be in yield . because esd damaged parts may not be suitably screened for , improvements in performance may also be possible . any additional electrical elements integrated into the head , such as bleed resistors , need to be confirmed to not adversely affect drive performance , however no significant adverse effects have been seen experimentally or have been predicted in models . it is to be understood that even though numerous characteristics and advantages of various embodiments of the present invention have been set forth in the foregoing description , together with details of the structure and function of various embodiments of the invention , this disclosure is illustrative only , and changes may be made in detail , especially in matters of structure and arrangement of parts within the principles of the present invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . | 6 |
a method in accordance with one embodiment of the invention includes using a support 10 . support 10 comprises an element having a first major surface 12 and a second major surface 14 facing oppositely from the first major surface 12 . recesses 16 are formed in the first major surface 12 of the support 10 . the support has surface portions 11 surrounding each recess 16 and projecting upwardly from the bottom surface of the recess . in this embodiment , each surface portion 11 is in the form of a substantially continuous wall extending along one side of a recess or forming a division between two adjacent recesses . each surface portion or wall 11 has outwardly - sloping surfaces extending from the top of the wall to the bottom surface of each adjacent recess , so that each wall widens toward the bottom of the recess whereas each recess widens toward the top or open side of the recess . each surface portion or wall 11 has a set of spaced apart support protrusions or bumps 13 disposed along the length of the wall . bumps 13 project upwardly from the top surface of the wall . each support protrusion or bump 13 may have the shape of a pyramid , a cone , an elongate protruding element , or any other shape . the recesses 16 and other features of the support 10 may be formed by machining , by casting , by molding , or by providing a sheet and etching the first major surface 12 of the sheet to form the features discussed above . the support may comprise a metal or a polymer , and may be rigid or flexible . a conductive element 20 having depressions 22 is provided on the support 10 , as shown in fig2 , most preferably by forming the conductive element as a layer of conductive material overlying the top surface of the support so that the shape of conductive element 20 conforms to the shape of the support top surface 12 . thus , the conductive element 20 has depressions 22 corresponding to the recesses in the support surface , each such depression having a bottom wall 57 and side walls 59 projecting upwardly from the bottom wall around the periphery of each depression . the side walls 59 correspond to walls 11 ( fig1 ) of the support , and form borders between adjacent depressions 22 . the side walls 59 have sloping wall portions 55 . each side wall 59 has spaced - apart protruding portions or bumps 21 projecting upwardly from the top of the side wall . bumps 21 correspond to the support protrusions or bumps 13 . the conductive element 20 may be formed on the support 10 by depositing a layer of conductive material on the first major surface 12 of the support . for example , metal may be deposited on the first major surface 12 until a layer of metal having depressions 22 is formed on the support 10 . where the support is formed from an electrically conductive material , the metal can be electroplated directly on the support . alternatively , where the support is formed from a nonconductive material , a thin conductive layer may be deposited on the support by sputtering , electroplating , evaporation or chemical vapor deposition , whereupon additional metal can be deposited on the conductive layer by electroplating . the conductive element 20 may also be formed by placing a metal sheet over the first major surface 12 and pressing the metal sheet against the recesses 16 so as to form the depressions 22 in the , recesses 16 of the support 10 . for example , the support 10 and metal sheet may be placed in a press having a compliant pad , such as a rubber sheet , on one side with the support 10 on the other side , and the metal sheet can be squeezed between the support 10 and the compliant pad . in another example , the metal sheet can be squeezed in a press between the support and a mating female die , i . e ., a die having a shape substantially complementary to the shape of support top surface 12 . desirably , the depressions 22 closely conform to the recesses 16 in the support 10 so that the support 10 can be engaged and moved and the conductive element 20 will be carried on the support 10 . although the support 10 , recesses 16 , conductive element 20 , support protrusions 13 , protruding portions 21 , and depressions 22 have rectangular shapes in fig1 - 7 , these features may have any regular or irregular shape . the designations “ top ” and “ bottom ” are used for convenience and do not refer to any gravitational frame of reference . preferably , the support 10 comprises a material , at least at the first major surface 12 , that does not adhere to the conductive element 20 formed on the support . in a preferred embodiment , the support comprises a metal , such as molybdenum , steel , or brass and has a coating of chromium . in embodiments including a coating on the support , the coating is preferably applied after the recesses and other features of the support surface 12 are formed . a plurality of microelectronic packages 24 is provided . each of the packages 24 shown in fig3 and 4 comprises a microelectronic element 26 , such as a semiconductor chip and a region 33 of a dielectric layer 27 . as used herein , the term “ microelectronic element ” comprises a semiconductor chip , a printed circuit board , a wafer or stacked assembly incorporating a plurality of semiconductor chips , or any other microelectronic element . in the embodiment shown in fig3 , the dielectric layer regions 33 associated with numerous packages 24 are provided as parts of a unitary strip 27 of dielectric material . the strip 27 has a region 33 corresponding to each microelectronic element . each region 33 has a plurality of leads 32 arranged with apertures 30 , also referred to herein as bond windows . the bond windows 30 provide access to the leads 32 so that they can be bonded to contacts 34 on the microelectronic element 26 . terminal structures 36 on each region 33 of the strip 27 , as shown in fig4 , are connected to the leads 32 . the terminal structures are exposed at an outer surface of the dielectric layer or strip 27 , i . e ., the surface facing away from microelectronic elements 26 . the terminal structures may be flush with the outer surface , recessed relative to the outer surface , or project from the outer surface . in the particular embodiment depicted in the drawings , terminal structures 36 lie on the inner surface of the dielectric layer ( the surface facing toward microelectronic elements 26 ) and are exposed at the outer surface through holes in the dielectric layer aligned with the terminal structures . as further discussed below , the terminal structures will be used to provide connections to external circuitry , such as a printed circuit board or other microelectronic element . in the particular embodiment depicted , each package 24 includes a compliant layer 38 between the strip 27 and the microelectronic element 26 and the leads 32 are disposed between the strip and the compliant layer 38 . the compliant layer 38 is best seen in fig4 - 6 . during manufacture of the packages 24 , the leads and terminal structures on the dielectric elements shown in fig3 - 6 may be connected to microelectronic elements 26 using a lead - bonding process according to certain embodiments of international patent publication wo 94 / 03036 , the disclosure of which is hereby incorporated by reference herein . in other embodiments , the terminal structures on the dielectric elements may be connected to microelectric elements 26 by wire - bonding . the strip 27 shown in fig3 - 6 also has a central hole 46 as shown in fig6 , in each region 33 and a thermally conductive plane as , for example , a metallic plane 48 is accessible through the central hole 46 . the strip 27 preferably includes holes 31 separating each region 33 , in between the individual packages 24 . the holes 31 are arranged in a pattern corresponding to the pattern of protruding portions or bumps 21 on conductive element 20 . preferably , the holes 31 have a shape for engaging the protruding portions 21 . in the assembly method , the support 10 and conductive element 20 are juxtaposed with the plurality of microelectronic packages 24 so that the conductive element faces the packages 24 and each package 24 is aligned with a depression 22 in the conductive element 20 . the inner side of the dielectric layer , bearing the microelectronic elements faces toward conductive element 20 . the support 10 and packages 24 are moved in relation to one another so that a surface of each package 24 touches a surface of the conductive element 20 within a depression 22 and so that the protruding portions or bumps 21 of the conductive element are received in the holes 31 in the strip . in the embodiment shown , a rear surface of the microelectronic element or chip 26 is brought into contact with the bottom wall 57 . the holes 31 aid in registration of the plurality of packages with the conductive element . moreover , the support 10 reinforces the conductive element during the assembly process so that the conductive element does not bend or otherwise distort during this step . this further aids in registration of the conductive element with the packages . the packages 24 may be oriented so that the rear surface of the microelectronic element 26 faces upwardly and the support 10 may be oriented so that the conductive element 20 faces downwardly toward the packages 24 , as shown in fig5 . however , the orientation of the support 10 and microelectronic element 26 relative to gravity is in no way essential to the invention . the packages may be assembled with the conductive element utilizing robotic equipment , computer controllers , optical systems , and any other equipment used in the microelectronic arts . as best appreciated with reference to fig2 , the conductive element 20 defines several rows 23 and columns 25 of depressions 22 . a strip 27 having a corresponding number of rows and columns of packages 24 is desirably used with the support 10 and conductive element 20 . in other embodiments , a plurality of strips 27 , may be assembled with the conductive element 20 so that a strip 27 corresponds to a row 23 of depressions 22 . in other embodiments , the conductive element 20 may comprise a single row of depressions 22 for assembly with a single strip 27 . in other embodiments , the strip may comprise a sheet incorporating packages 24 arranged in a two - dimensional array other than the specific array shown in fig3 . after assembly of the packages with the conductive element , a flowable material 40 is introduced into the space between the conductive element 20 and the dielectric component 27 , so that the leads 32 and the microelectronic element 26 are surrounded by the flowable material 40 . the flowable material may be inserted into depressions 22 via any open area of depression 22 not covered by strip 27 . for example , the bond windows 30 can be used for this purpose . in an alternate embodiment not shown , strip 27 may be provided with apertures remote from the bond windows for permitting introduction of flowable material 40 into depression 22 . the flowable material may be introduced into the various depressions 22 of conductive element 20 either simultaneously or sequentially . merely by way of example , the flowable material may be introduced by conventional dispensing equipment using a needle ( not shown ) aligned with an opening in the strip at each depression . the flowable material also adheres the microelectronic element 26 to the conductive element 20 . in a further variant , a layer of a thermally - conductive material such as a grease , gel or curable adhesive composition loaded with a thermally - conductive filler may be provided between the rear surfaces of each microelectronic element and the bottom surface 57 of each depression . for example , the thermally - conductive material may be applied to the rear surfaces of the microelectronic elements or to the bottom surfaces of the depressions before assembling the packages with the conductive element . the support 10 is removed after the packages 24 are adhered to the conductive element 20 . the conductive element 20 releases from the support 10 , as the conductive element 20 is not adhered thereto . the fit of the conductive element 20 in the recesses 16 is overcome by the adhesion between the packages 24 and the conductive element 20 . the cured flowable material desirably contributes to the adhesion between the packages and the conductive element . the sloping wall portions 55 of the conductive element 20 may be arranged to facilitate the release of the conductive element 20 from the support 10 . conductive features such as masses of an electrically conductive bonding material as , for example , a solder , may be added to the dielectric layer , in contact with the terminal structures , so that the packages 24 can be interconnected with external circuitry . as shown in fig6 , first conductive features 42 are added on the terminal structures 36 . second conductive features 43 are placed in the central holes 46 in contact with the conductive planes 48 . third conductive features 47 are disposed on the bumps or protruding portions 21 of the conductive element 20 . the packages 24 are diced into individual assemblies 50 by severing the conductive element 20 and strip 27 , at the middle of each wall 59 between adjacent depressions 22 , so that the strip and conductive element are severed along lines 35 shown in fig3 . after dicing , each assembly 50 includes a package 24 , with the microelectronic element 26 and with a portion 33 of the dielectric layer , together with an individual element 52 formed from a portion of the conductive element 20 . thus , the conductive element 20 and strip 27 are severed along lines 35 a cutting through rows of packages , and along lines 35 b cutting through columns of packages , as best seen in fig3 . in this arrangement , the conductive element 20 is severed through the protruding portions or bumps 21 . thus , each wall 59 provided in the original conductive element 20 is severed to leave one sloping wall portion 55 of the conductive element as a side wall along one side of the assembly , and each bump 21 of the conductive element is severed to form a tab 51 at an edge of such side wall or sloping wall portion 57 . preferably , the process of placing the third conductive features 47 on the bumps and the severing process are conducted so that after the severing process , the third conductive features 47 remain on all of the bumps . for example , pairs of conductive features 47 may be added to each bump 21 and the each bump 21 may be severed between the conductive features 47 of the pair . alternatively , the third conductive features may be provided as masses of solder covering the entire exposed surface of each bump 21 , and these masses may be severed into smaller masses when the conductive element is severed . in a further alternative , the conductive features may be added after the severing operation . the dicing or severing operating may be performed by utilizing a blade or a laser or any other means of cutting through the conductive element 20 and strip 27 . preferably , the dicing or severing operation is performed after the support 10 has been removed . in an alternative , the support can be severed along with the conductive element and strip , so that a portion of the support remains in place on each assembly after the severing step . these portions of the support can be removed after severing . the step of adding the conductive features can be performed before or after the severing step , and before or after removing the support . each finished assembly includes an individual element or electrically conductive shield 52 formed by a portion of the conductive element 20 having one depression 22 . the wall 57 which originally constituted the bottom wall of the depression forms a wall of the shield whereas sloping side walls 55 form walls of the shield projecting from wall 57 to the vicinity of the dielectric element 33 . each wall 57 has a tabs 51 at its edge remote from wall 57 . in use , the finished assembly can be bonded to a circuit board . the first conductive elements or bonding material 42 serves to connect terminal structures 36 to contact pads of the circuit board . the third conductive element or bonding material 47 can connect tabs 51 , and hence the conductive shell , to a mating conductive feature on the circuit board . this connection can be used to carry a voltage such as ground potential to the shell , to conduct heat from the shell to the circuit board , or both . thus , the individual element 52 comprises a heat spreader , or an electromagnetic shield for the package 24 . the second conductive element 43 can connect the metallic plate 48 to a mating metallic or other thermally conductive feature on the circuit board , and may also form an electrical ground or other electrical connection . these features of the finished assembly and its use with a circuit board may be in accordance with copending , commonly assigned u . s . patent application ser . no . 10 / 210 , 160 and copending , commonly assigned pct international application u . s . ser . no . 02 / 27 , 509 , the disclosures of which are hereby incorporated by reference herein . in other embodiments , an adhesive 41 may be disposed on the surface of the conductive element 20 in the depressions 22 , on the package 24 , or both , before the microelectronic element 26 is brought into contact with the conductive element 20 . the adhesive may be thermally conductive , electrically conductive or both . in other preferred embodiments , the conductive element 20 is attached to another part of the microelectronic package 24 , such as the upper surface of the microelectronic element 26 or the dielectric layer 27 . the flowable material may comprise a curable dielectric material . in addition , certain embodiments of u . s . pat . nos . 6 , 329 , 224 , 6 , 359 , 335 , 6 , 232 , 152 , and 5 , 776 , 796 , the disclosures of which are hereby incorporated by reference herein , may be used . desirably , the conductive element 20 comprises a recession or hole that communicates between depressions . such recession or hole is desirably arranged so that the flowable material can flow between adjacent depressions . an example of such a recession of hole is used in the method shown in fig6 a and 6b . in this method , support 10 ′ is provided with rows of projecting posts 79 projecting upwardly from a generally planar bottom surface 77 . here again , the conductive element 20 ′ is provided as a layer of conductive material such as a metal closely overlying and conforming to support 10 ′, preferably by forming the conductive element on the support by the methods discussed above . thus , the conductive element will include rows of spaced - apart protrusions or pillars 65 extending outwardly from a bottom wall 75 , each such pillar being hollow and substantially surrounding one post 79 of the support . the pillars are separated from one another by gaps or recessions 63 . thus , the conductive element includes depressions 22 ′ surrounded by rows of projecting pillars 65 , each such depression having a bottom wall constituted by a portion of bottom wall 75 . the gaps or recessions 63 act as a bridge between adjacent depressions 22 ′ or a depression 22 ′ and the exterior of the assembly . in the assembly method , packages 24 ′ are assembled with the conductive element in substantially the same manner as discussed above . the pillars 65 desirably project through holes 31 ′ in the dielectric element in much the same manner as the bumps discussed above . the dielectric element includes conductive features similar to those discussed above , such as terminal structures 36 ′ exposed at an outer surface 68 of the dielectric layer ( the surface facing away from support 10 ′ in fig6 a ). in this method as well , a flowable material 40 ′ is introduced into depressions 22 ′ after assembling the packages to the conductive element , and desirably before removing support 10 ′. before introducing flowable material 40 ′, a solder mask or coverlay 66 may be attached to outer surface 68 as taught in commonly - assigned u . s . pat . no . 6 , 359 , 335 , which is hereby incorporated by reference herein . coverlay 66 seals the bond windows 30 ′ in the dielectric strip . the coverlay desirably also extends over the tips of pillars 65 , and seals the holes 30 in the dielectric layer which receive the pillars . in this condition , the various depressions 22 ′ communicate with one another through the gaps 63 between the pillars , but do not communicate with the outer surface of the dielectric element . a flowable material 40 ′ may be introduced between the dielectric strip 27 ′ and the conductive element 20 ′ as , for example , by injecting the dielectric material into the gaps between pillars at an edge of the assembly . the dielectric material can flow through all of the depressions 22 ′ and disperse through the entire assembly when it is introduced . however , the flowable material will not contaminate the conductive features exposed at the outer surface of the dielectric element . in this process , the flowable material 40 ′ will fill all of the depressions and will also fill the gaps 63 between the pillars . in an alternate embodiment , coverlay 66 may be provided with apertures remote from the terminal structures 36 ′, and flowable material may be introduced into one or more of the depressions 22 ′ through these apertures . here again , the flowable material will pass from one depression to another via gaps or recessions 63 . as shown in fig6 b , the pillars 65 are spaced so that gaps or recessions 63 have a dimension d large enough to permit flowable material 40 ′ to permeate through , from one depression 24 ′ to another . however , dimension d is small enough not to permit electromagnetic radiation wavelengths at an operating frequency associated with the microelectronic elements 26 ′ from passing between adjacent pillars 65 during operation of the finished assemblies . stated another way , the pillars are close enough to one another to form a faraday shield effective to block electromagnetic radiation at an operating frequency used by the microelectronic element . to act as a faraday shield , the dimension d of the gaps , and hence the distance between adjacent pillars , should be less than the wavelength of radiation at the operating frequency . where the microelectronic element is a radio frequency power amplifier , the operating frequency may be taken as the carrier frequency of the signals which are to be amplified . where the microelectronic element is a digital element such as a conventional digital semiconductor chip , the operating frequency may be taken as the clock frequency of the chip . here again , after injection and curing of the flowable material , and desirably after removing the conductive element and strip from support 10 , the conductive element and dielectric strip are severed along severance planes extending between adjacent depressions 22 ′ to yield individual assemblies 50 ′ ( fig6 c ). as shown in fig6 c , each assembly 50 ′ includes a conductive shell or shield including a bottom wall 57 ′ formed from a portion of the original bottom wall 75 of the conductive element , and side walls 55 ′ projecting upwardly from the bottom wall 57 ′. each side wall 55 ′ is formed by a plurality of conductive pillar portions 74 , formed from the conductive pillars 65 of the original conductive element . regions of cured flowable material 72 are also present at the exterior surfaces of the sidewalls 55 ′, in the portions of the sidewalls corresponding to the gaps 63 between the posts in the original conductive element . in another embodiment of the invention , as shown in fig6 d , the conductive element 20 ″ is formed with raised portions or walls 59 ″ having substantially continuous side walls 55 ″ and having bumps or protrusions 21 ″ similar to the side walls and bumps of the conductive element discussed with reference to fig2 - 6 . however , at least one passageway 80 extends through each wall 59 ″ connecting adjacent depressions 22 ″. as seen in fig6 d , each passageway 80 includes a portion extending through one side wall 55 ″ of a hollow wall 59 ″ defining a wall space 81 open toward the rear surface of the conductive element , i . e ., toward the top of the drawing in fig6 d . each passageway 80 also includes a further portion extending through the opposite side wall of the same hollow wall 59 ″, so that the depressions 22 ″ communicate with one another through the wall space 81 within the wall . according to this embodiment , the support is removed before flowable material 40 ″ is introduced . coverlay 66 ″ is applied to both the front surface 68 of the structure ( the outer surface of the dielectric layer ) and rear surface 69 of the structure ( defined by the outwardly facing surfaces of the depression bottom walls 57 ″). flowable material 40 ″ may be introduced into the structure either by apertures 82 in conductive element 20 or through pathways 80 in walls 59 ″ on the edges of the structure . in a further embodiment , flowable material 40 ″ may be introduced into the structure at more than one location simultaneously . pathways 80 , similar to recessions 63 discussed above with reference to fig6 a - 6b , enable flowable material 40 ″ to permeate from one depression 22 ″ to another . as previously mentioned coverlay 66 ″ on front surface 68 seals the bond windows and other openings in the dielectric layer . additionally the coverlay 66 ″ on rear surface 69 of assembly 50 prevents flowable material passing through the wall spaces within the hollow walls 59 ″ from leaking onto the rear surface of the structure . the rear or outwardly - facing surfaces of depression bottom walls 57 ″ remain substantially free of the flowable material . in use of the completed assemblies , this surface may be connected to a heat sink or thermal spreader without an insulative material impeding the dissipation of heat from the chip . preferably , pathways 80 are sized so as to permit flowable material 40 ″ to pass through the structure but are also sized so as not to permit wavelengths of electromagnetic radiation at an operating frequency to pass . in another embodiment of the invention , as shown in fig7 , a plurality of stacks 124 of microelectronic elements are assembled in the depressions 122 of a conductive element . the stack 124 may be assembled with a compliant layer 155 , or another pad of dielectric material and a dielectric layer 129 . the dielectric layer 129 may comprise a strip , as discussed above or may be provided in other forms . contacts of the microelectronic elements 126 a and 126 b are connected to terminal structures 136 on the dielectric layer 129 . the dielectric layer 129 and conductive element are severed to form individual assemblies 150 , each having one or more stacks 124 disposed in a depression 122 . in another embodiment , the packages 224 each comprise a semiconductor chip with contacts that face away from the dielectric layer , as shown in fig8 . the conductive element 220 is assembled with the plurality of packages 224 so that the conductive element 220 overlies the surface of the chip having the contacts 234 . the contacts 234 may be attached to terminal structures 236 on the dielectric layer 229 using wire bonds 237 . the conductive element 220 is placed over the upper surface of the microelectronic element with enough clearance so as to avoid interfering with the wire bonds 237 . for example , the depression 222 in the conductive element 220 has a depth “ x ” greater than the height of the package 224 and wire bonds . in other embodiments , standoff is provided using a pad 255 , disposed on the microelectronic element and the conductive element 220 is attached to the pad . the dielectric layer 229 and conductive element 220 are severed to form individual assemblies 250 in substantially the same manner as discussed above . in another embodiment , a plurality of stacks 324 are disposed in depressions 422 of a conductive element , as shown in fig9 . the conductive element is assembled with the stack 324 so that contacts on a face of one of the microelectronic elements 326 faces the bottom 357 of the depression 322 . a pad 355 may be disposed between the microelectronic element 326 a and the bottom 357 . contacts on the microelectronic element 326 a and microelectronic element 326 b are connected to terminal structures 336 on a dielectric layer 329 . more than one device may be assembled in each depression of the conductive element . for example , the conductive element may be assembled with a strip carrying pairs of chips or devices so that the pair of chips or devices are both disposed in a depression . in another example , one or more devices are placed in each depression . individual devices or packages may be placed in the depression using , for example , a pick and place machine . in a further embodiment of the invention , as shown in fig1 and 11 , the conductive element is severed at some but not all of the protruding portions . thus , each individual assembly resulting from the severing step includes two depressions and the devices disposed in those depressions . in this embodiment , the conductive element acts as a shield to prevent electromagnetic fields from one device from propagating to the adjacent die in the same assembly . a conductive element 420 is assembled with a plurality of packages 424 , as discussed above . the conductive element 420 and packages 424 may be assembled so that a single chip or other microelectronic element is disposed in a depression , or a plurality of microelectronic elements is disposed in each depression . in the embodiment shown , a pair of packages 424 are disposed in each depression 422 . a flowable material is introduced around the microelectronic elements . the conductive element 420 is severed along the walls 459 so that individual assemblies 450 having a pair of depressions 422 are formed . in other embodiments , more than a pair of depressions 422 are incorporated in the individual assemblies by selecting protruding portions 421 to sever . in other words , walls 459 a along a selected dicing plane 435 ( fig1 ) are severed and walls 459 b are not severed . in another embodiment of the present invention , the support and conductive element disclosed herein is used to form assemblies disclosed in certain embodiments of u . s . provisional application no . 60 / 315 , 408 , filed aug . 28 , 2001 , the disclosure of which is hereby incorporated by reference herein . these and other variations and combinations of the features discussed above can be utilized without departing from the invention . for example , a plurality of microelectronic elements may be directly assembled with a conductive element , without being packaged with a dielectric layer . the conductive element may be assembled with other types of packages , having configurations other than the packages discussed above . a microelectronic element in a flip - chip arrangement may be used . the packages may be assembled with the conductive element by placing packages into the depressions using robotic or pick and place equipment . devices other than microelectronic elements may be assembled with the conductive element . active dies , passive dies , elements of a circuit other than dies , may be assembled with the conductive element . thus , the foregoing description of the preferred embodiments should be taken by way of illustration rather than by way of limitation of the invention as defined by the claims . | 7 |
preferred embodiments of the invention are wherein m is 1 or 2 ; preferred embodiments of the invention are r 2 is trifluoromethyl , or c 1 - 6 - alkyl ; preferred embodiments of the invention are wherein r 3 is selected from the group consisting of halogen , c 1 - 6 - alkoxy , c 1 - 6 - sulfanyl , c 1 - 6 - alkyl , hydroxy or trifluoromethyl ; particularly preferred embodiments of the invention are wherein the compound of the invention is any of the following : 1 -[ 2 -( 2 - trifluoromethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 4 - bromophenylsulfanyl ) phenyl ] piperazine , 1 -{ 2 -[ 4 -( methylsulfanyl ) phenylsulfanyl ] phenyl } piperazine , 1 -[ 2 -( 4 - hydroxyphenylsulfanyl ] phenyl } piperazine , 1 -[ 2 -( 2 , 4 - dimethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 3 , 5 - dimethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 2 , 6 - dimethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 2 , 5 - dimethylphenylsulfanyl ) phenyl ] piperazine , 1 -[ 2 -( 2 - trifluoromethylphenylsulfanyl ) phenyl ][ 1 , 4 ] diazepane , 1 -[ 2 -( 3 - methylphenylsulfanyl ) phenyl ]-[ 1 , 4 ]- diazepane , 1 -[ 2 -( 4 - butylphenoxy ) phenyl ] piperazine , 1 -[ 2 -( 4 - methoxyphenoxy ) phenyl ] piperazine , 2 -( 4 - methylphenylsulfanyl ) phenyl - 1 - piperazine , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- piperazine , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - chlorophenyl ] piperazine , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - methylphenyl ] piperazine , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - methylphenyl ] piperazine , 1 -[ 2 -( 4 - fluorophenylsulfanyl )- 5 - methylphenyl ] piperazine , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - trifluoromethylphenyl ] piperazine , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- 3 - methylpiperazine , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- 3 , 5 - dimethylpiperazine , 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ]- 3 , 6 - dihydro - 2h - pyridine , 4 -[ 2 -( 4 - methoxyphenylsulfanyl ) phenyl ]- 3 , 6 - dihydro - 2h - pyridine or 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ] piperidine the expression c 1 - 6 - alk ( en / yn ) yl means a c 1 - 6 - alkyl , c 2 - 6 - alkenyl or a c 2 - 6 - alkynyl group . the expression c 3 - 8 - cycloalk ( en ) yl means a c 3 - 8 - cycloalkyl - or cycloalkenyl group . the term c 1 - 6 alkyl refers to a branched or unbranched alkyl group having from one to six carbon atoms inclusive , including but not limited to methyl , ethyl , 1 - propyl , 2 - propyl , 1 - butyl , 2 - butyl , 2 - methyl - 2 - propyl and 2 - methyl - 1 - propyl . similarly , c 2 - 6 alkenyl and c 2 - 6 alkynyl , respectively , designate such groups having from two to six carbon atoms , including one double bond and one triple bond respectively , including but not limited to ethenyl , propenyl , butenyl , ethynyl , propynyl and butynyl . the term c 3 - 8 cycloalkyl designates a monocyclic or bicyclic carbocycle having three to eight c - atoms , including but not limited to cyclopropyl , cyclopentyl , cyclohexyl , etc . the term c 3 - 8 cycloalkenyl designates a monocyclic or bicyclic carbocycle having three to eight c - atoms and including one double bond . in the term c 3 - 8 - cycloalk ( en ) yl - c 1 - 6 - alk ( en / yn ) yl , c 3 - 8 - cycloalk ( en ) yl and c 1 - 6 - alk ( en / yn ) yl are as defined above . the terms c 1 - 6 - alk ( en / yn ) yloxy , c 1 - 6 alk ( en / yn ) ylsulfanyl , hydroxy - c 1 - 6 - alk ( en / yn ) yl , halo - c 1 - 6 - alk ( en / yn ) yl , halo - c 1 - 6 - alk ( en / yn ) yloxy , c 1 - 6 - alk ( en / yn ) ylsulfonyl etc . designate such groups in which the c 1 - 6 - alk ( en / yn ) yl are as defined above . as used herein , the term c 1 - 6 - alk ( en / yn ) yloxycarbonyl refers to groups of the formula c 1 - 6 - alk ( en / yn ) yl - o — co —, wherein c 1 - 6 - alk ( en / yn ) yl are as defined above . as used herein , the term acyl refers to formyl , c 1 - 6 - alk ( en / yn ) ylcarbonyl , arylcarbonyl , aryl - c 1 - 6 - alk ( en / yn ) ylcarbonyl , c 3 - 8 - cycloalk ( en ) ylcarbonyl or a c 3 - 8 - cycloalk ( en ) yl - c 1 - 6 - alk ( en / yn ) yl - carbonyl group . the term 3 – 7 - membered ring optionally containing one further heteroatom as used herein refers to ring systems such as 1 - morpholinyl , 1 - piperidinyl , 1 - azepinyl , 1 - piperazinyl , 1 - homopiperazinyl , 1 - imidazolyl , 1 - pyrrolyl or pyrazolyl , all of which may be further substituted with c 1 - 6 - alkyl . the heterocycles formed by two adjacent r 3 substituents and fused to the parent ring may together form rings such as 5 - membered monocyclic rings such as 3h - 1 , 2 , 3 - oxathiazole , 1 , 3 , 2 - oxathiazole , 1 , 3 , 2 - dioxazole , 3h - 1 , 2 , 3 - dithiazole , 1 , 3 , 2 - dithiazole , 1 , 2 , 3 - oxadiazole , 1 , 2 , 3 - thiadiazole , 1h - 1 , 2 , 3 - triazole , isoxazole , oxazole , isothiazole , thiazole , 1h - imidazole , 1h - pyrazole , 1h - pyrrole , furan or thiophene and 6 - membered monocyclic rings such as 1 , 2 , 3 - oxathiazine , 1 , 2 , 4 - oxathiazine , 1 , 2 , 5 - oxathiazine , 1 , 4 , 2 - oxathiazine , 1 , 4 , 3 - oxathiazine , 1 , 2 , 3 - dioxazine , 1 , 2 , 4 - dioxazine , 4h - 1 , 3 , 2 - dioxazine , 1 , 4 , 2 - dioxazine , 2h - 1 , 5 , 2 - dioxazine , 1 , 2 , 3 - dithiazine , 1 , 2 , 4 - dithiazine , 4h - 1 , 3 , 2 - dithiazine , 1 , 4 , 2 - dithiazine , 2h - 1 , 5 , 2 - dithiazine , 2h - 1 , 2 , 3 - oxadiazine , 2h - 1 , 2 , 4 - oxadiazine , 2h - 1 , 2 , 5 - oxadiazine , 2h - 1 , 2 , 6 - oxadiazine , 2h - 1 , 3 , 4 - oxadiazine , 2h - 1 , 2 , 3 - thiadiazine , 2h - 1 , 2 , 4 - thiadiazine , 2h - 1 , 2 , 5 - thiadiazine , 2h - 1 , 2 , 6 - thiadiazine , 2h - 1 , 3 , 4 - thiadiazine , 1 , 2 , 3 - triazine , 1 , 2 , 4 - triazine , 2h - 1 , 2 - oxazine , 2h - 1 , 3 - oxazine , 2h - 1 , 4 - oxazine , 2h - 1 , 2 - thiazine , 2h - 1 , 3 - thiazine , 2h - 1 , 4 - thiazine , pyrazine , pyridazine , pyrimidine , 4h - 1 , 3 - oxathiin , 1 , 4 - oxathiin , 4h - 1 , 3 - dioxin , 1 , 4 - dioxin , 4h - 1 , 3 - dithiin , 1 , 4 - dithiin , pyridine , 2h - pyran or 2h - thiin . the term aryl refers to carbocyclic , aromatic systems such as phenyl and naphtyl . the acid addition salts of the invention are preferably pharmaceutically acceptable salts of the compounds of the invention formed with non - toxic acids . exemplary of such organic salts are those with maleic , fumaric , benzoic , ascorbic , succinic , oxalic , bis - methylenesalicylic , methanesulfonic , ethanedisulfonic , acetic , propionic , tartaric , salicylic , citric , gluconic , lactic , malic , mandelic , cinnamic , citraconic , aspartic , stearic , palmitic , itaconic , glycolic , p - aminobenzoic , glutamic , benzenesulfonic and theophylline acetic acids , as well as the 8 - halotheophyllines , for example 8 - bromotheophylline . exemplary of such inorganic salts are those with hydrochloric , hydrobromic , sulfuric , sulfamic , phosphoric and nitric acids . further , the compounds of this invention may exist in unsolvated as well as in solvated forms with pharmaceutically acceptable solvents such as water , ethanol and the like . in general , the solvated forms are considered equivalent to the unsolvated forms for the purposes of this invention . some of the compounds of the present invention contain chiral centres and such compounds exist in the form of isomers ( i . e . enantiomers ). the invention includes all such isomers and any mixtures thereof including racemic mixtures . racemic forms can be resolved into the optical antipodes by known methods , for example , by separation of diastereomeric salts thereof with an optically active acid , and liberating the optically active amine compound by treatment with a base . another method for resolving racemates into the optical antipodes is based upon chromatography on an optically active matrix . racemic compounds of the present invention can also be resolved into their optical antipodes , e . g . by fractional crystallization of d - or l -( tartrates , mandelates or camphorsulphonate ) salts . the compounds of the present invention may also be resolved by the formation of diastereomeric derivatives . additional methods for the resolution of optical isomers , known to those skilled in the art , may be used . such methods include those discussed by j . jaques , a . collet and s . wilen in “ enantiomers , racemates , and resolutions ”, john wiley and sons , new york ( 1981 ). optically active compounds can also be prepared from optically active starting materials . the pharmaceutical formulations of the invention may be prepared by conventional methods in the art . for example : tablets may be prepared by mixing the active ingredient with ordinary adjuvants and / or diluents and subsequently compressing the mixture in a conventional tabletting machine . examples of adjuvants or diluents comprise : corn starch , potato starch , talcum , magnesium stearate , gelatine , lactose , gums , and the like . any other adjuvants or additives usually used for such purposes such as colourings , flavourings , preservatives etc . may be used provided that they are compatible with the active ingredients . solutions for injections may be prepared by dissolving the active ingredient and possible additives in a part of the solvent for injection , preferably sterile water , adjusting the solution to desired volume , sterilising the solution and filling it in suitable ampules or vials . any suitable additive conventionally used in the art may be added , such as tonicity agents , preservatives , antioxidants , etc . the pharmaceutical compositions of this invention or those which are manufactured in accordance with this invention may be administered by any suitable route , for example orally in the form of tablets , capsules , powders , syrups , etc ., or parenterally in the form of solutions for injection . for preparing such compositions , methods well known in the art may be used , and any pharmaceutically acceptable carriers , diluents , excipients or other additives normally used in the art may be used . conveniently , the compounds of the invention are administered in unit dosage form containing said compounds in an amount of about 0 . 01 to 100 mg . the total daily dose is usually in the range of about 0 . 05 – 500 mg , and most preferably about 0 . 1 to 50 mg of the active compound of the invention . the compounds of the invention are prepared by the following general methods : a ) deprotection or cleavage from a polymer support of a compound with formula ii and r 1 , r 2 , r 3 , m , p , q , s , x , y and the dotted line are as described above , and r ′″ is a tert - butyl , methyl , ethyl , allyl or benzyl group or r ′″ oco 2 is a solid supported carbamate group , such as the wang resin - based carbamate linker . wherein r 1 , r 2 , m , p , q , y and the dotted line are as described above , to the corresponding diazonium compound , and subsequently reacting with a compound hxz , wherein x and z are as defined above . wherein r 2 , r 3 , x , s and q are as described above with an alkylating agent of formula ( cl —( ch 2 ) m + 1 ) nh ( ch 2 ) 2 cl or ( br —( ch 2 ) m + 1 ) nh ( ch 2 ) 2 br wherein m are as defined above . wherein r 2 , r 3 , x , s and q are as described above and g is a bromine or iodine atom with a compound of formula vi wherein r 1 , m and p are as defined above . e ) dehydrating and optionally simultaneously deprotecting a compound of formula vii wherein r 1 , r 2 , r 3 , x , m , p , q and s are as described above and r is either a hydrogen atom or a boc group . f ) hydrogenate the double bond in a compound of formula viii wherein r 1 , r 2 , r 3 , x , m , p , q and s are as described above . the deprotection according to method a ) was performed by standard techniques , known to the persons skilled in the art and detailed in the textbook protective groups in organic synthesis t . w . greene and p . g . m . wuts , wiley interscience , ( 1991 ) isbn 0471623016 . starting materials of formula ii wherein r ′″= tert - bu were prepared according to the procedure as outlined below . fluoronitrobenzene derivatives were reacted with phenols or thiophenols according to the procedure of sawyer et al . j . org . chem . 1998 , 63 , 6338 followed by reduction using standard procedures known to the persons skilled in the art . this includes reduction to the corresponding aniline using a metal hydride salt such as sodium borohydride in conjunction with palladium on carbon catalyst in an alcoholic solvent or reduction using a metal chloride salt such as zinc chloride or tin chloride . the resulting aniline was then converted to a properly substituted 3 , 5 - diketopiperazine in a modification of the procedure of kruse et al . recl . trav . chim . pays - bas 1998 , 107 , 303 using n - butyloxycarbonyliminodiacetic acid . the 3 , 5 - diketopiperazine derivative was then reduced with for example borane to the corresponding boc protected piperazine , which was then deprotected to the piperazine in situ . the compounds shown in formula ii , wherein y ═ ch and the optional double bond is reduced , were prepared from their tertiary alcohol precursors vii wherein r is a boc group , by a modified barton reduction in a similar manner as described in hansen et al . synthesis 1999 , 1925 – 1930 . the intermediate tertiary alcohols were prepared from the corresponding properly substituted 1 - bromo - phenylsulfanylbenzenes or their corresponding ethers by metal - halogen exchange followed by addition of an appropriate electrophile of the formula ix in a similar manner as described in palmer et al . j . med . chem . 1997 , 40 , 1982 – 1989 . the properly substituted 1 - bromo - phenylsulfanylbenzenes were prepared in a similar manner as described in the literature by reaction of properly substituted thiophenols with properly substituted aryliodides according to schopfer and schlapbach tetrahedron 2001 , 57 , 3069 – 3073 bates et al ., org . lett . 2002 , 4 , 2803 – 2806 and kwong et al . org . lett . 2002 , 4 , ( in press ). the corresponding substituted 1 - bromo - phenoxybenzenes may be prepared as described by buck et al . org . lett . 2002 , 4 , 1623 – 1626 . the cleavage from a polymer support , such as from the wang resin based carbamate linker , according to method a ) was performed according to literature known procedures ( zaragoza tetrahedron lett . 1995 , 36 , 8677 – 8678 and conti et al . tetrahedron lett . 1997 , 38 , 2915 – 2918 ). the starting material of formula ii may also be prepared according to the methods described in patent application wo 01 / 49681 . the diamines were either commercially available or synthesised by methods known to chemists skilled in the art . iron - complexes , like η 6 - 1 , 2 - dichlorobenzene - η 5 - cyclopentadienyliron ( ii ) hexafluorophosphate and substituted analogues were synthesised according to literature known procedures ( pearson et al . j . org . chem . 1996 , 61 , 1297 – 1305 ) or synthesised by methods known to chemists skilled in the art . the diazotation followed by reaction with a compound hxz according to the method b ) was performed by addition of the diazonium salt of the corresponding aniline to a solution of sodium salt of a thiophenol or a phenol in an aqueous suspension of copper . the starting material of formula iii was prepared as outlined in the following . a fluoronitrobenzene derivative was reacted with a piperazine derivative in a solvent such as dmf , nmp or other dipolar aprotic solvent containing an organic base such as triethylamine to afford the orthonitophenylpiperazine derivative . the intermediate orthonitrophenylpiperazine was subsequently reduced using standard procedures as stated above to give the starting material of formula iii . the reaction of a compound of formula iv with an alkylating agent of formula ( cl —( ch 2 ) m + 1 ) nh ( ch 2 ) 2 cl or ( br —( ch 2 ) m + 1 ) nh ( ch 2 ) 2 br as its hydrobromide or hydrochloride salt , wherein m is as defined above was performed in a similar manner as described in sircar et al . j . med . chem . 1992 , 35 , 4442 – 4449 . starting materials of formula iv were prepared as described above for starting materials of formula ii . the reaction of a compound of formula v with a diamine of formula vi in method d ) was performed in a similar manner as described in nishiyama et al . tetrahedron lett . 1998 , 39 , 617 – 620 . the starting material of formula v was prepared in a similar manner as described in schopfer et al . tetrahedron 2001 , 57 , 3069 – 3073 . the dehydration reaction and optional simultaneous deprotection of a compound of formula vii in method e ) was performed in a similar manner as described in palmer et al j . med . chem . 1997 , 40 , 1982 – 1989 . the starting material of formula vii wherein r ═ h was prepared from a compound of formula vii wherein r is a boc group ( see above ) by deprotection with hydrochloric acid in methanol . compounds of formula vii wherein r = boc , may be prepared as described in palmer et al . j . med . chem . 1997 , 40 , 1982 – 1989 . the reduction of the double bond according to method f ) was generally performed by catalytic hydrogenation at low pressure (& lt ; 3 atm .) in a parr apparatus , or by using reducing agents such as diborane or hydroboric derivatives as produced in situ from nabh 4 in trifluoroacetic acid in inert solvents such as tetrahydrofuran ( thf ), dioxane , or diethyl ether . the starting material of formula viii was prepared from ii as described in method a ). analytical lc - ms data were obtained on a pe sciex api 150ex instrument equipped with ionspray source and shimadzu lc - 8a / slc - 10a lc system . column : 30 × 4 . 6 mm waters symmmetry c18 column with 3 . 5 μm particle size ; solvent system : a = water / trifluoroacetic acid ( 100 : 0 . 05 ) and b = water / acetonitrile / trifluoroacetic acid ( 5 : 95 : 0 . 03 ); method : linear gradient elution with 90 % a to 100 % b in 4 min and with a flow rate of 2 ml / min . purity was determined by integration of the uv ( 254 nm ) and elsd trace . the retention times ( rt ) are expressed in minutes . preparative lc - ms - purification was performed on the same instrument . column : 50 × 20 mm ymc ods - a with 5 μm particle size ; method : linear gradient elution with 80 % a to 100 % b in 7 min and with a flow rate of 22 . 7 ml / min . fraction collection was performed by split - flow ms detection . 1 h nmr spectra were recorded at 500 . 13 mhz on a bruker avance drx500 instrument or at 250 . 13 mhz on a bruker ac 250 instrument . deuterated methylenchloride ( 99 . 8 % d ), chloroform ( 99 . 8 % d ) or dimethyl sulfoxide ( 99 . 8 % d ) were used as solvents . tms was used as internal reference standard . chemical shift values are expressed in ppm - values . the following abbreviations are used for multiplicity of nmr signals : s = singlet , d = doublet , t = triplet , q = quartet , qui = quintet , h = heptet , dd = double doublet , dt = double triplet , dq = double quartet , tt = triplet of triplets , m = multiplet and b = broad singlet . for ion - exchange chromatography , the following material was used : scx - columns ( 1 g ) from varian mega bond elut ®, chrompack cat . no . 220776 . prior to use , the scx - columns were pre - conditioned with 10 % solution of acetic acid in methanol ( 3 ml ). for de - complexation by irradiation , a ultaviolet light source ( 300 w ) from philipps was used . as starting polymer supports for solid phase synthesis , wang - resin ( 1 . 03 mmol / g , rapp - polymere , tuebingen , germany ) was used . ferrocene ( 167 g ), anhydrous aluminium trichloride ( 238 g ) and powdered aluminium ( 24 g ) were suspended in 1 , 2 - dichlorobenzene ( 500 ml ) and heated to 90 ° c . in a nitrogen atmosphere for 5 h with intensive stirring . the mixture was cooled to room temperature and water ( 1000 ml ) was added carefully in small portions while cooling on an ice bath . heptane ( 500 ml ) and diethylether ( 500 ml ) were added , and the mixture was stirred at room temperature for 30 minutes . the mixture was extracted with diethylether ( 3 × 300 ml ). the aqueous phase was filtered , and aqueous ammonium hexafluorophosphate ( 60 g in 50 ml water ) was added in small portions under stirring . the product was allowed to precipitate at room temperature . after 3 hours the precipitate was filtered off , washed intensively with water and dried in vacuo ( 50 ° c .) to give 81 g ( 21 %) of the title compound as a light yellow powder . 1 h nmr ( d 6 - dmso ): 5 . 29 ( s , 5h ); 6 . 48 ( m , 2h ); 7 . 07 ( m , 2h ). 4 -[( 4 - nitrophenoxy ) carbonyloxymethyl ] phenoxymethyl polystyrene ( 267 g , 235 mmol ) was suspended in dry n , n - dimethylformamide ( 2 l ). n - methylmorpholine ( 238 . 0 g , 2 . 35 mol ) and piperazine ( 102 . 0 g , 1 . 17 mol ) were added and the mixture was stirred at room temperature for 16 h . the resin was filtered off and washed with n , n - dimethylformamide ( 2 × 1 l ), tetrahydrofuran ( 2 × 1 l ), water ( 1 × 500 ml ), methanol ( 2 × 1 l ), tetrahydrofuran ( 2 × 1 l ) and methanol ( 1 × 1 l ). finally , the resin was washed with dichloromethane ( 3 × 500 ml ) and dried in vacuo ( 25 ° c ., 36 h ) to yield an almost colourless resin ( 240 . 0 g ). 4 -({ 4 -[ η 6 -( 2 - chlorophenyl )- η 5 - cyclopentadienyliron ( ii )] piperazin - 1 - yl } carbonyloxymethyl ) phenoxymethyl polystyrene hexafluorophosphate ( intermediate for 1a – 1h and 1k – 1l ) 4 -[( piperazin - 1 - yl ) carbonyloxymethyl ] phenoxymethyl polystyrene ( 115 . 1 g , 92 mmol ) was suspended in dry tetrahydrofuran ( 1 . 6 l ), and η 6 - 1 , 2 - dichlorobenzene - η 5 - cyclopentadienyliron ( ii ) hexafluorophosphate ( 76 . 0 g , 184 mmol ) was added followed by potassium carbonate ( 50 . 9 g , 368 mmol ). the reaction mixture was stirred at 60 ° c . for 16 h . after cooling to room temperature , the resin was filtered off and washed with tetrahydrofuran ( 2 × 500 ml ), water ( 2 × 250 ml ), tetrahydrofuran ( 2 × 500 ml ), water ( 2 × 250 ml ), methanol ( 2 × 250 ml ), dichloromethane ( 2 × 250 ml ) and methanol ( 2 × 250 ml ). finally , the resin was washed with dichloromethane ( 3 × 500 ml ) and dried in vacuo ( 25 ° c ., 36 h ) to yield a dark orange resin ( 142 g ). 4 -({ 4 -[ η 6 -( 2 - chloro - phenyl )- η 5 - cyclopentadienyliron ( ii )]-[ 1 , 4 ]- diazepan - 1 - yl } carbonyloxymethyl ) phenoxymethyl polystyrene hexafluorophosphate ( intermediate for 1i and 1j ) a solution of buli ( 2 . 5 m in hexane , 12 . 0 ml , 30 mmol ) was slowly added to a stirred solution of 1 - bromo - 2 -( 4 - methylphenylsulfanyl ) benzene ( 30 mmol ) in dry thf ( 75 ml ) under argon at − 78 ° c . the solution was stirred for 10 min before 4 - oxo - piperidine - 1 - carboxylic acid tert - butyl ester ( 5 . 98 g , 30 mmol ) was added in one portion . the solution was allowed to warm up to room temperature and then stirred for 3 h . saturated aqueous nh 4 cl ( 150 ml ) was added and the solution was extracted with ethylacetate ( 150 ml ). the organic phase was washed with brine , dried ( mgso 4 ) and the solvent was evaporated in vacuo . crude 1 was purified by flash chromatography on silica gel ( eluent : ethylacetate / heptane 20 : 80 ) to produce the target compound as a white foam . lc / ms ( m / z ) 399 . 3 ( mh + ); rt = 3 . 82 ; purity ( uv , elsd ): 98 %, 100 %; yield : 5 . 02 g ( 42 %). 2 -( 4 - methylphenylsulfanyl ) aniline ( 2 . 9 g , 13 . 5 mmol ) was dissolved in dry thf ( 200 ml ) and placed under a nitrogen atmosphere . n -( tert - butylocycarbonyl ) iminodiacetic acid ( 4 . 7 g , 20 . 2 mmol ) and carbonyl diimidazole ( 4 . 2 g , 40 . 4 mmol ) were added to the solution and the reaction was refluxed for 60 hours . the reaction mixture was cooled to room temperature and ethyl acetate ( 500 ml ) was added . the resulting solution was then washed with 2 n nahco 3 ( 2 × 200 ml ), 2 n hcl ( 2 × 200 ml ) and saturated sodium chloride solution ( 100 ml ) and the solvents evaporated in vacuo . yield 6 . 0 g , 107 %, 1 h nmr ( cdcl 3 ) 1 . 5 ( s , 9h ); 2 . 32 ( s , 3h ); 4 . 4 – 4 . 6 ( m , 4h ); 7 . 02 – 7 . 18 ( m , 3h ); 7 . 2 – 7 . 45 ( m , 5h ). the following 3 , 5 diketopiperazine derivatives were prepared in an analogous fashion : 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2b ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - chlorophenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2c ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - methylphenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2d ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - methylphenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2e ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - fluorophenylsulfanyl )- 5 - methylphenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2f ) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - trifluoromethylphenyl ]- 3 , 5 - dioxopiperazine ( intermediate for 2g ) fluoronitrobenzene ( 7 . 1 g , 50 mmol ) was dissolved in dmf ( 100 ml ) containing triethylamine ( 10 g , 100 mmol ) and placed under a nitrogen atmosphere . to the solution was added 2 - methyl - piperazine ( 5 . 5 g , 55 mmol ). the reaction was heated to 80 ° c . for 16 hours . the reaction was allowed to cool to room temperature before the solvent was reduced to half volume in vacuo . ethyl acetate ( 200 ml ) and ice - water ( 250 ml ) were added to the solution and the product was extracted with diethyether ( 2 × 200 ml ). the aqueous phase was saturated with sodium chloride and extracted with ethyl acetate ( 2 × 200 ml ). the organic phases were combined , washed with saturated brine , dried over magnesium sulfate , filtered and the filtrate was concentrated in vacuo . the product ( 10 . 5 g ) was dissolved in ethanol ( 250 ml ). palladium on charcoal catalyst ( 10 % w / w , 2 . 2 g ) was added to the solution and the solution was hydrogenated in a parr apparatus at 3 bar for 3 hours . the solution was filtered and the solvents evaporated in vacuo to give the aniline product . yield ( 8 . 0 g , 83 %) to a solution of 2 - trifluoromethylthiophenol ( 1 . 75 g , 9 . 8 mmol ) in a 1 : 1 mixture of tetrahydrofuran / dimethylformamide ( 30 ml ), sodium hydride ( 7 . 4 mmol , 60 % in mineral oil ) was carefully added at room temperature ( caution : generation of hydrogen ). the mixture was stirred for an additional 30 min after the generation of hydrogen had ceased . subsequently , 4 -({ 4 -[ η 6 -( 2 - chloro - phenyl )- η 5 - cyclopentadienyliron ( ii )] piperazin - 1 - yl } carbonyloxymethyl ) phenoxymethyl polystyrene hexafluorophosphate ( 3 . 5 g , 2 . 45 mmol ) was added and the mixture was stirred at 55 ° c . for 12 h . after cooling to room temperature , the resin was filtered off and washed with tetrahydrofuran ( 2 × 50 ml ), tetrahydrofuran / water ( 1 : 1 ) ( 2 × 50 ml ), n , n - dimethylformamide ( 2 × 50 ml ), water ( 2 × 50 ml ), methanol ( 3 × 50 ml ), tetrahydrofuran ( 3 × 50 ml ), and subsequently with methanol and tetrahydrofuran ( each 50 ml , 5 cycles ). finally , the resin was washed with dichloromethane ( 3 × 50 ml ) and dried in vacuo ( 25 ° c ., 12 h ) to yield a dark orange resin . the thus obtained resin and a 0 . 5 m solution of 1 , 10 - phenanthroline in 3 : 1 mixture of pyridine / water ( 20 ml ) was placed in light - transparent reactor tube . the suspension was agitated by rotation under irradiation with visible light for 12 h . the resin was filtered and washed with methanol ( 2 × 25 ml ), water ( 2 × 25 ml ) and tetrahydrofuran ( 3 × 25 ml ) until the washing solutions were colourless ( approx . 5 cycles ) and the irradiation procedure was repeated until decomplexation was complete ( approx . 5 cycles ). after the decomplexation was completed , the resin was washed with dichlormethane ( 3 × 25 ml ) and dried in vacuo ( 25 ° c ., 12 h ) to obtain a light brown resin . 100 mg ( 77 μmol ) of the thus obtained resin were suspended in a 1 : 1 mixture of trifluoroacetic acid and dichlormethane ( 2 ml ) and stirred at room temperature for 2 h . the resin was filtered off and washed with methanol ( 1 × 0 . 5 ml ) and dichloromethane ( 1 × 0 . 5 ml ). the filtrates were collected and the volatile solvents evaporated in vacuo . the crude product was purified by preparative lc - ms and subsequently by ion - exchange chromatography . lc / ms ( m / z ) 339 ( mh + ); rt = 2 . 39 ; purity ( uv , elsd ): 92 %, 100 %; overall yield : 1 mg ( 4 %). 1b , 1 -[ 2 -( 4 - bromophenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 350 ( mh + ); rt = 2 . 46 ; purity ( uv , elsd ): 75 %, 92 %; yield : 2 mg ( 7 %). 1c , 1 -{ 2 -[ 4 -( methylsulfanyl ) phenylsulfanyl ] phenyl } piperazine : lc / ms ( m / z ) 317 ( mh + ); rt = 2 . 39 ; purity ( uv , elsd ): 91 %, 100 %; yield : 2 mg ( 8 %). 1d , 1 -[ 2 -( 4 - hydroxyphenylsulfanyl ] phenyl } piperazine : lc / ms ( m / z ) 287 ( mh + ); rt = 1 . 83 ; purity ( uv , elsd ): 84 %, 100 %; yield : 3 mg ( 13 %). 1e , 1 -[ 2 -( 2 , 4 - dimethylphenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 48 ; purity ( uv , elsd ): 95 %, 100 %; yield : 4 mg ( 17 %). 1f , 1 -[ 2 -( 3 , 5 - dimethylphenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 51 ; purity ( uv , elsd ): 96 %, 100 %; yield : 5 mg ( 21 %). 1g , 1 -[ 2 -( 2 , 6 - dimethylphenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 42 ; purity ( uv , elsd ): 97 %, 100 %; yield : 4 mg ( 17 %). 1h , 1 -[ 2 -( 2 , 5 - dimethylphenylsulfanyl ) phenyl ] piperazine : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 46 ; purity ( uv , elsd ): 97 %, 100 %; yield : 1 mg ( 4 %). 1i , 1 -[ 2 -( 2 - trifluoromethylphenylsulfanyl ) phenyl ]-[ 1 , 4 ]- diazepane : lc / ms ( m / z ) 353 ( mh + ); rt = 2 . 46 ; purity ( uv , elsd ): 70 %, 96 %; yield : 1 mg ( 4 %). 1j , 1 -[ 2 -( 3 - methylphenylsulfanyl ) phenyl ]-[ 1 , 4 ]- diazepane : lc / ms ( m / z ) 299 ( mh + ); rt = 2 . 44 ; purity ( uv , elsd ): 76 %, 93 %; yield : 1 mg ( 4 %). 1k , 1 -[ 2 -( 4 - butylphenoxy ) phenyl ] piperazine : lc / ms ( m / z ) 311 ( mh + ); rt = 2 . 77 ; purity ( uv , elsd ): 91 %, 100 %; yield : 4 mg ( 17 %). 1l , 1 -[ 2 -( 4 - methoxyphenoxy ) phenyl ] piperazine : lc / ms ( m / z ) 285 ( mh + ); rt = 2 . 08 ; purity ( uv , elsd ): 93 %, 100 %; yield : 4 mg ( 18 %) 1 - tert - butyloxycarbonyl - 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ]- 3 , 5 - dioxo - piperazine ( 5 . 5 g , 13 mmol ) was dissolved in dry thf ( 50 ml ) and placed under a nitrogen atmosphere . borane tetrahydrofuran complex ( 50 mmol , 1 . 0 m ) in tetrahydrofuran was added and the reaction was refluxed for ten minutes . excess borane was quenched by the addition of an excess of ethyl acetate and the reaction was refluxed for a further 20 minutes . the reaction was allowed to cool to room temperature before hydrogen chloride dissolved in methanol ( 50 ml , 4 m ) was added and the reaction was refluxed for 4 . 5 hours . the reaction was allowed to cool to room temperature and the reaction was concentrated in vacuo . the compound was crystallised from the gum residue by the addition of ether / methanol solution . the crystalline solid was filtered and washed with ether / methanol ( 1 : 1 ) to give a white crystalline solid . yield ( 2 . 0 g , 47 %) 1 h nmr ( d 6 - dmso ) 2 . 35 ( s , 3h ); 3 . 18 ( br s , 8h ); 6 . 68 ( d , 2h ); 7 . 02 ( m , 1h ); 7 . 18 ( m , 1h ); 7 . 3 – 7 . 5 ( m , 4h ); ms ( mh + ) 285 . 2b , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ] piperazine lc - ms ( m / z ) 305 . 1 ( mh + ) rt = 2 . 46 purity ( uv , elsd ) 71 %, 91 % yield 0 . 096 g , 100 % 2c , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - chlorophenyl ] piperazine lc - ms ( m / z ) ( mh + ) 335 . 2 rt = 2 . 38 purity ( uv , elsd ) 98 %, 100 % yield 0 . 22 g , 62 % 2d , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 4 - methylphenyl ] piperazine lc - ms ( m / z ) ( mh + ) 315 . 1 rt = 2 . 33 purity ( uv , elsd ) 97 %, 100 % yield 0 . 21 g , 56 % 2e , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - methylphenyl ] piperazine lc - ms ( m / z ) ( mh + ) 315 . 2 rt = 2 . 38 ( uv , elsd ) 98 %, 100 % yield 2 . 3 g , 58 % 2f , 1 -[ 2 -( 4 - fluorophenylsulfanyl )- 5 - methylphenyl ] piperazine lc - ms ( m / z ) ( mh + ) 303 . 2 rt = 2 . 46 ( uv ) 98 % yield 2 . 1 g , 62 % 2g , 1 -[ 2 -( 4 - methoxyphenylsulfanyl )- 5 - trifluoromethylphenyl ] piperazine lc - ms ( m / z ) ( mh + ) 369 rt = 2 . 50 ( uv , elsd ) 96 %, 100 % yield 0 . 54 g , 31 % 2 -( 3 - methylpiperazin - 1 - yl ) phenylamine ( 0 . 96 g , 5 mmol ) was dissolved in 30 ml water containing sulfuric acid ( 0 . 28 ml , 5 . 2 mmol ) and the solution was cooled to 0 ° c . and sodium nitrite ( 0 . 36 g , 5 . 2 mmol ) was added . the reaction was stirred for 30 minutes before the ph of the reaction was adjusted to ph 7 with sodium acetate . the diazonium salt solution was then added dropwise to a solution of 4 - chlorothiophenol in a suspension of copper ( 0 . 3 g , 5 mmol ) in 2 m naoh ( 4 ml ). after addition , the reaction mixture was heated to 60 ° c . for 30 minutes before being allowed to cool to room temperature and ethyl acetate ( 10 ml ) was added . the reaction mixture was filtered and the layers were separated . the aqueous layer was extracted with ethyl acetate ( 2 × 10 ml ). the combined organic phases were dried ( mgso 4 ) and volatile solvents evaporated in vacuo . the crude product was purified by flash chromatography using silica gel , eluting with ethyl acetate / methanol / ammonia 96 : 3 : 1 . the pure product was isolated as a colourless oil . yield ( 0 . 18 g , 11 %) 1 h nmr ( cdcl 3 , 500 mhz ) 1 . 12 ( d , 3h ); 2 . 6 – 2 . 72 ( br m , 2h ); 3 . 0 – 3 . 15 ( m , 5h ); 6 . 9 ( m , 2h ); 7 . 08 ( d , 1h ); 7 . 15 ( m , 1h ); 7 . 25 – 7 . 35 ( m , 4h ); ms ( mh + ) 319 . 1 . 3b , 1 -[ 2 -( 4 - chlorophenylsulfanyl ) phenyl ]- 3 , 5 - dimethylpiperazine lc - ms ( m / z ) ( mh + )+ 333 . 1 rt = 2 . 29 ( uv , elsd ) 83 %, 100 % yield 0 . 54 g , 31 %. concentrated aq hydrochloric acid ( 10 ml ) was added to a stirred solution of 1 - tert - butoxycarbonyl - 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ] piperidin - 4 - ol ( 0 . 84 g , 2 . 1 mmol ) in acetic acid ( 30 ml ). the solution was boiled under reflux overnight , cooled to room temperature and then stirred in an ice bath . an aqueous solution of naoh ( 9 . 1 m , 40 ml ) was slowly added and the unclear solution was extracted with ethyl acetate ( 2 × 40 ml ). the combined organic phases were dried ( mgso 4 ) and the solvents evaporated in vacuo . the crude material ( 0 . 48 g ) was dissolved in ethyl acetate ( 3 . 2 ml ) at 50 ° c . and a solution of oxalic acid ( 0 . 11 g ) in etoh ( 3 . 2 ml ) was slowly added . the target compound was collected as a white oxalic salt . 1 h ( dmso - d 6 ) δ 7 . 3 – 7 . 2 ( m , 7h ); 7 . 15 ( m , 1h ); 7 . 00 ( m , 1h ); 5 . 6 ( d , 1h ); 3 . 7 ( d , 2h ); 3 . 25 ( t , 2h ); 2 . 6 ( m , 2h ); 2 . 3 ( s , 3h ). lc / ms ( m / z ) 282 . 2 ( mh + ); rt = 2 . 24 ; purity ( uv , elsd ): 99 %, 100 %; yield : 0 . 31 g ( 40 %). 4b , 4 -[ 2 -( 4 - methoxyphenylsulfanyl ) phenyl ]- 3 , 6 - dihydro - 2h - pyridine lc / ms ( m / z ) 298 ( mh + ); rt = 2 . 00 ; purity ( uv , elsd ): 97 %, 100 %; yield : 0 . 28 g ( 30 %). methyl chloro - oxo - acetate ( 1 . 37 g , 11 . 25 mmol ) was added to a stirred solution of 1 - tert - butoxycarbonyl - 4 -[ 2 -( 4 - methylphenylsulfanyl ) phenyl ] piperidin - 4 - ol ( 3 . 00 g , 7 . 5 mmol ) and 4 -( dimethylamino ) pyridine ( 1 . 65 g , 13 . 5 mmol ) in a mixture of dry ch 3 cn ( 24 ml ) and chcl 3 ( 12 ml ) at 0 ° c . under argon . the reaction mixture was allowed to reach room temperature and then stirred 2 h . ethyl acetate ( 140 ml ) was added and some salts were removed by filtration through celite . the organic phase was washed with sat . nahco 3 ( 140 ml ), brine ( 140 ml ) and dried ( mgso 4 ). the solvents were evaporated in vacuo and the crude material was dried in vacuo . this material was dissolved in dry toluene ( 48 ml ) under argon . bu 3 snh ( 3 . 27 g , 11 . 25 mmol ) and aibn ( 0 . 31 g , 1 . 88 mmol ) were added . the solution was stirred under argon at 90 ° c . for 2 . 5 h . the solvent was evaporated in vacuo , and the crude material was purified by flash chromatography on silica gel ( eluent : a stepwise gradient of ethylacetate in heptane from 10 : 90 to 20 : 80 ) to produce 4 -( 2 -( 4 - methylphenylsulfanyl ) phenyl )- piperidine - 1 - carboxylic acid tert - butyl ester as a clear oil ( 1 . 94 g , 67 %). this oil was dissolved in meoh ( 9 . 2 ml ) and hcl in diethylether ( 2 . 0 m ) was added at 0 ° c . the reaction mixture was allowed to warm to room temperature and stirred overnight . the target compound was collected as its hydrochloride . m . p 229 – 231 ° c . calculated for c 18 h 21 ns . hcl : c , 67 . 58 ; h , 6 . 63 ; n , 4 . 38 . found : c , 67 . 33 ; h , 6 . 97 ; n , 4 . 31 . lc / ms ( m / z ) 284 ( mh + ); rt = 2 . 12 ; purity ( uv , elsd ): 96 %, 100 %; yield : 0 . 26 g ( 46 %). inhibition of the uptake of [ 3 h ] serotonin into whole rat brain synaptosomes the compounds were tested with respect to their 5 - ht reuptake inhibiting effect by measuring their ability to inhibit the uptake of [ 3 h ] serotonin into whole rat brain synaptosomes in vitro . the assay was performed as described by hyttel psychopharmacology 1978 , 60 , 13 . the compounds were tested with respect to their efficacy on 5 - ht 2c receptor - expressing cho cells ( euroscreen ) as determined by fluorometric imaging plate reader ( flipr ) analysis . this assay was carried out according to molecular devices inc . instructions for their flipr calcium assay kit and as modified from porter et al . british journal of pharmacology 1999 , 128 , 13 . preferred compounds of the present invention exhibit serotonin reuptake inhibition below 200 nm ( ic 50 ) in the assay above . more preferred are the compounds which exhibit inhibition below 100 nm and most preferably below 50 nm . compounds of particular interest exhibit serotonin reuptake inhibition below 10 nm ; | 2 |
the compositions of the invention are derived by incorporating the appropriate amount of the compound ( i ), or a mixture of two or more compounds of formula ( i ), in the polyisocyanate of which it is to enhance the reactivity . the mixing of the components can be achieved by any of the mixing processes conventional in the art . since the polyisocyanate is normally a fairly mobile liquid and most of the compounds of formula ( i ) are also liquid , the admixing is accomplished readily by adding the required amount of compound ( i ) to the polyisocyanate with appropriate agitation . the admixing can be carried out at ambient temperature ( circa 20 ° c .) or at elevated temperatures up to about 80 ° c ., if desired . in certain instances it is found that , when the mixing of the two components is carried out at elevated temperatures , the degree of enhancement of reactivity of the polyisocyanate which is thereby achieved is greater than the enhancement achieved using the same proportion of compound of formula ( i ) to polyisocyanate but carrying out the mixing at lower temperatures in the above range . the admixture of the two components is preferably carried out under conditions which exclude the presence of moisture and of oxygen , e . g ., in the presence of an atmosphere of dry inert gas such as nitrogen . the polyisocyanates which are treated in accordance with the invention are mixtures of polymethylene polyphenyl polyisocyanates containing from about 20 to about 90 percent by weight of methylenebis ( phenyl isocyanate ), the remainder of the mixture being comprised of oligomeric polyisocyanates of higher molecular weight and functionality . these polymethylene polyphenyl polyisocyanates are well - known in the art and are prepared commercially by phosgenation of mixtures of the corresponding methylene - bridged polyphenyl polyamines . the latter , in turn , are obtained by interaction of formaldehyde , hydrochloric acid and aniline using procedures well - known in the art ; see , for example , u . s . pat . nos . 2 , 683 , 730 ; 2 , 950 , 263 ; 3 , 012 , 088 ; 3 , 344 , 162 and 3 , 362 , 979 . included in the polyisocyanates which can be treated in accordance with the invention are modified polymethylene polyphenyl polyisocyanates such as those which have been heat treated in order to increase their viscosity and also those which have been reacted with minor amounts ( up to about 0 . 5 equivalents per equivalent of polyisocyanate ) of a polyol to form prepolymers . the polyols employed in the preparation of said prepolymers can be any of the polyether polyols or polyester polyols known in the art for the preparation of prepolymers of this type . advantageously , the polyols have an average equivalent weight of about 30 to about 1500 and contain from 2 to 6 hydroxyl groups per molecule . illustrative of polyols which can be used to prepare prepolymers in accordance with procedures known in the art are those listed in u . s . pat . no . 3 , 644 , 168 ( col . 12 , line 17 to col . 13 , line 8 ). the prepolymers which can be treated in accordance with the present invention are inclusive of those prepolymers of certain polymethylene polyphenyl polyisocyanates and polyethylene glycols of molecular weight from 200 to 600 which prepolymers are described in u . s . pat . no . 4 , 055 , 548 . illustrative of compounds of the formula ( i ) are alkyl n -( aryl ) imidates such as methyl n - phenylformimidate , ethyl n - phenylformimidate , ethyl n - tolylformimidate , ethyl n - phenylacetimidate , ethyl n - phenylpropionimidate , methyl n - phenylbutyrimidate , ethyl n -( p - tert .- butylphenyl )- formimidate and the like ; oxazolines such as 2 - methyl -, 2 - ethyl -, 2 , 4 , 4 - trimethyl -, 2 - benzyl -, 2 - hexyl -, 2 - octyl -, 2 - ethyl - 4 - methyl -, and 2 - propyl - 4 , 4 - dimethyloxazolines and the like ; and oxazines such as 2 - benzyl - 5 , 6 - dihydro - 4 , 4 , 6 - trimethyl -, 6 - butyl - 5 , 6 - dihydro - 2 - methyl -, 5 , 6 - dihydro - 2 , 6 - dimethyl -, 5 , 6 - dihydro - 6 , 6 - dimethyl -, and 5 , 6 - dihydro - 2 , 5 , 5 , 6 , 6 - pentamethyl - 4h - 1 , 3 - oxazine , and the like . all the above compounds and classes of compounds are known in the art and can be prepared by methods well - described in the art . a preferred group of compounds of formula ( i ) are the alkyl substituted oxazolines and a particularly preferred species within this group is 2 - ethyloxazoline . as set forth above , the amount of compound ( i ), or the amount of a mixture of two or more compounds of formula ( i ), which is incorporated in any given polymethylene polyphenyl polyisocyanate is related to the acid value of the latter . the &# 34 ; acidity &# 34 ; or &# 34 ; acid value ,&# 34 ; sometimes referred to as the &# 34 ; hot - acidity ,&# 34 ; of a polyisocyanate is a term well recognized in the art . the acidity is determined by potassium hydroxide titration of the free acid ( hydrochloric acid ) generated upon subjecting a measured quantity of polyisocyanate to a brief period of heating in methanol ; the exact procedure employed is that set forth in u . s . pat . no . 3 , 793 , 362 in column 7 beginning at line 27 . the amount of compound of formula ( i ), or of a mixture of two or more such compounds , which is incorporated into the polyisocyanate in accordance with the invention is advantageously of the order of 0 . 2 to 2 . 0 moles per equivalent of acid present in said polyisocyanate as determined by the acid value of the latter . preferably the amount of compound of formula ( i ), or mixture of two or more such compounds , is in the range of 0 . 4 to 1 . 2 moles per equivalent of acid present in the polyisocyanate . the compositions prepared in accordance with the invention possess enhanced reactivity as compared with the corresponding untreated polyisocyanate . further , the compositons of the invention retain this enhanced level of activity upon storage over prolonged periods of time prior to use in the formation of cellular and non - cellular polyurethanes and like polymers which are prepared therefrom . the presence of the compound ( i ) in the polyisocyanates prepared in accordance with the invention does not have any deleterious effect on the properties of such products prepared therefrom . on the contrary , it is found that , in many instances , the structural strength and related properties of polymers prepared from the polyisocyanates of the invention are superior to those of corresponding polymers prepared from the untreated polyisocyanates . that the compound ( i ) is actually increasing the reactivity of the polyisocyanate and not merely acting as a catalyst in the reaction between the polyisocyanate and active - hydrogen containing material is apparent from the following finding . under identical conditions two polyurethane - forming reactions were carried out . in the one case the polyisocyanate was pretreated with a compound ( i ) in accordance with the invention before being reacted with the polyol , while in the other case the polyisocyanate was untreated but the compound ( i ), in the same amount as that used to treat the polyisocyanate , was added to the polyol before reaction with the polyisocyanate . it was found that the cream and tack free times exhibited in the reaction between the polyol and the polyisocyanate which had been treated in accordance with the invention were over 20 times shorter than in the case of the untreated polyisocyanate . the following examples describe the manner and process of making and using the invention and set forth the best mode contemplated by the inventors of carrying out the invention but are not to be construed as limiting . a series of compositions were prepared using as starting material a batch of polymethylene polyphenyl polyisocyanate containing approximately 50 percent by weight of methylenebis ( phenyl isocyanate ) and having an equivalent weight of 133 and an acid value of 0 . 05 . a portion of the batch was retained as untreated control . composition a was prepared by admixing 100 g . of the starting isocyanate with 0 . 06 g . ( representing 0 . 44 mole per equivalent of acid based on acid value ) of 2 - ethyloxazoline . composition b was made in the same way as composition a but increasing the amount of 2 - ethyloxazoline to 0 . 12 g . ( representing 0 . 88 mole per equivalent of acid based on acid value ). composition c was made in the same way as composition a but increasing the amount of 2 - ethyloxazoline to 0 . 18 g . ( representing 1 . 32 mole per equivalent of acid ). each of the compositions a - c and the control sample were divided into equal portions and one portion of each was stored at 25 ° c . under an atmosphere of dry nitrogen for 75 days . the other portion of each sample was stored at 45 ° c . under an atmosphere of dry nitrogen for the same period . at the end of the storage period , each sample was submitted to a test for reactivity based on the exothermic temperature generated in a polyurethane forming reaction under standard conditions . the test was carried out as follows : 100 grams of the isocyanate to be tested was added to 100 grams of a proprietary polyol catalyst mixture that does not contain a blowing agent . the combined materials were immediately mixed for 10 seconds at 2000 rpm with a mixing blade ( 2 inch split conn type ). the material was poured , after mixing , into a 32 ounce paper cup that had been prepared by insertion of thermocouple through its side ( 3 / 4 inch from bottom with 3 inch immersion ). the thermocouple was connected to a temperature recorder to plot temperature versus time . a timer and recorder were started at the beginning of mixing . the slope and amount of exotherm are a measure of the reactivity of the isocyanate . the results obtained in the test are summarized in table i below . table i______________________________________ reaction temperature ( after 15 mins . ) sample after storage at 25 ° c . after storage at 45 ° c . ______________________________________control 46 ° c . 38 ° c . compositiona 85 ° c . 54 ° c . compositionb 109 ° c . 95 ° c . compositionc 118 ° c . 115 ° c . ______________________________________ it will be seen from the above results that all of compositions a , b and c retained markedly greater reactivity ( as measured by the exotherm 15 minutes after mixing of the reactants ) after storage for 75 days at both 25 ° c . and 45 ° c . than did the control samples . the procedure described in example 1 was repeated exactly as described using a different sample of polymethylene polyphenyl polyisocyanate containing approximately 50 percent by weight of methylenebis ( phenyl isocyanate ). the isocyanate had an equivalent weight of 132 . 4 and an acid value of 0 . 06 . compositions a &# 39 ;, b &# 39 ; and c &# 39 ; were prepared by admixing 100 g . of the isocyanate and 0 . 06 g ., 0 . 12 g ., and 0 . 18 g ., respectively of 2 - ethyloxazoline corresponding to 0 . 37 , 0 . 74 and 1 . 11 moles , respectively , per equivalent of acid in the isocyanate . the samples were divided into two portions , one of which was stored at 25 ° c . and the other at 45 ° c . for 75 days as before . at the end of the storage period the samples were all subjected to the reactivity test described in example 1 and the results are recorded in table 2 . table 2______________________________________ reaction temperature ( 15 mins . ) sample after storage at 25 ° c . after storage at 45 ° c . ______________________________________control 33 ° c . 30 ° c . compositiona &# 39 ; 49 ° c . 44 ° c . compositionb &# 39 ; 73 ° c . 68 ° c . compositionc &# 39 ; 103 ° c . 94 ° c . ______________________________________ again , it will be seen from the above results that all of compositions a &# 39 ;, b &# 39 ; and c &# 39 ; retained markedly greater reactivity after storage at both temperatures than did the control samples . the polyisocyanate used as starting material in preparing the compositions described in this example was a polymethylene polyphenyl polyisocyanate containing approximately 70 percent by weight of methylenebis ( phenyl isocyanate ) and having an equivalent weight of 131 and an acid value of 0 . 05 percent . five compositions were made by adding the following amounts of 2 - ethyloxazoline to 827 g . aliquots of the above isocyanate , the admixture being carried out at room temperature ( circa 20 ° c .). ______________________________________compo - weight moles of 2 - ethyloxazolinesition 2 - ethyloxaxoline ratio : equivs . hcl in isocyanate______________________________________d 0 . 337 g . 0 . 25e 0 . 674 g . 0 . 5f 1 . 01 g . 0 . 75g 1 . 34 g . 1 . 0h 1 . 68 g . 1 . 25______________________________________ the reactivity of the above compositions and of the untreated polyisocyanate was studied over a period of four months using the following technique . each isocyanate composition was divided into eight equal amounts and the individual portions were placed in 8 oz . stoppered bottles under nitrogen and stored at room temperature ( circa 20 ° c .) until ready for test . starting 1 week from initial time of preparation and continuing at weekly intervals for 1 month , then at monthly intervals for four months , one of the bottles in each of the series was checked for reactivity by reacting 100 parts by weight of the polyisocyanate with 133 . 3 parts by weight of a mixture containing the following ingredients in the specified proportions . ______________________________________polyether triol : mw = 4500 100 parts by wt . ethylene glycol 19 parts by wt . dibutyl tin mercaptide 0 . 12 parts by wt . dibutyl tin diacetate 0 . 03 parts by wt . organosilicone surfactant 1 . 0 parts by wt . ______________________________________ the polyisocyanate to be tested and the polyolcatalyst mixture were brought together in a quart paper cup at ambient temperature ( circa 20 ° c .) with high speed mechanical stirring for 10 seconds . the blended material was allowed to react and foam ( trapped air introduced in the mechanical mixing causes the foaming ) and the cream time , gel time , firm time and tack free time was recorded for each sample . &# 34 ; cream time &# 34 ; is that time ( in seconds ), after initial admixture of the polyol and polyisocyanate , at which gas formation of bubble nucleation appears in the mixture . this point in time is usually marked by a pronounced change in color from dark brown to tan . &# 34 ; gel time &# 34 ; is that time ( in seconds ) after initial admixture of the polyol and polyisocyanate at which the mixture changes from a strictly fluid to a gel state . &# 34 ; firm time &# 34 ; is that time ( in seconds ) after initial admixture of the polyol and polyisocyanate at which the mixture becomes firm to the touch , i . e ., surface of the foam is not depressed by applying thumb pressure . &# 34 ; tack free time &# 34 ; is that time ( in seconds ) after initial admixture of the polyol and polyisocyanate at which the foam is no longer sticky to the touch . the determination of the above characteristics of a foam prepared from a polyisocyanate under standard conditions gives a clear indication of the order of reactivity of the polyisocyanate . observations taken over a period of time on the same polyisocyanate give a measure of the stability of the reactivity upon storage . the results of such testing for compositions d - h and for the untreated polyisocyanate are shown in table 3 . table 3__________________________________________________________________________ storage timecomposition initial 1 wk . 2 wks . 3 wks . 4 wks . 2 months 3 months 4 months__________________________________________________________________________controlcream time ( secs ) ca 180 ca 180 ca 240 ca 180 ca 240 ca 240 ca 200 ca 180gel time ( secs ) -- -- -- -- -- -- -- -- tack free time ( secs ) -- -- -- -- -- -- -- -- firm time ( secs ) -- -- -- -- -- -- -- -- cream time ( secs ) 17 - 19 19 19 19 17 18 23 23gel time ( secs ) none 30 none none none none none nonetack free time ( secs ) 45 47 63 67 55 75 93 60firm time ( secs ) 120 120 145 125 125 145 140 150ecream time ( secs ) 16 16 18 18 16 17 16 16gel time ( secs ) 19 19 21 none 19 18 19 19tack free time ( secs ) 32 21 24 33 25 21 23 24firm time ( secs ) 67 57 67 87 57 60 60 85fcream time ( secs ) 16 16 18 18 15 16 15 16gel time ( secs ) 22 18 19 20 17 18 16 17tack free time ( secs ) 30 20 22 24 19 20 18 18firm time ( secs ) 50 37 47 53 37 40 30 25gcream time ( secs ) 15 15 17 17 16 15 15 16gel time ( secs ) 20 19 23 21 19 16 16 17tack free time ( secs ) 25 21 26 25 20 17 19 18firm time ( secs ) 45 37 53 53 37 25 25 25hcream time ( secs ) 15 15 16 14 15 15 14 -- gel time ( secs ) 20 18 17 15 17 17 15 -- tack free time ( secs ) 33 20 18 16 18 18 16 -- firm time ( secs ) 45 37 37 30 27 25 19 -- __________________________________________________________________________ it will be seen from the above results that the reactivity of the untreated polyisocyanate was extremely poor , whereas that of the treated polyisocyanates d - h was good and was maintained at the initial level over a prolonged period of storage . the same polymethylene polyphenyl polyisocyanate as that used as starting material in example 3 was employed . an aliquot of 827 g . of the polyisocyanate was heated to 70 ° c . and admixed with stirring at this temperature with 1 . 01 g . ( representing 0 . 75 mole per equivalent of acid in the polyisocyanate ) of 2 - ethyloxazoline . the mixture was then cooled to room temperature ( 20 ° c .) and divided into 9 equal portions which were placed in 8 oz . stoppered bottles under a nitrogen atmosphere and stored at room temperature . the reactivity of the samples was then checked at intervals over a period of 6 months using the test described in example 3 . the results obtained are shown in table 4 . table 4__________________________________________________________________________ storage time 2 3 4 5 6 initial 1 wk . 2 wks . 3 wks . 4 wks . months months months months months__________________________________________________________________________cream time 19 17 16 16 16 16 15 15 17 13 ( secs ) gel time 29 19 18 none 17 19 16 16 18 15 ( secs ) tack free time 37 25 21 24 19 20 17 17 20 18 ( secs ) firm time 55 45 45 47 45 30 27 30 35 45 ( secs ) __________________________________________________________________________ it will be seen that the treated polyisocyanate had a high degree of reactivity as compared with the untreated isocyanate ( see control ; example 3 ) and this level of reactivity was maintained on storage over a period of three months . it was also observed that the polyurethane foam prepared from the various samples during the storage period showed significantly less tendency to crack after demolding than did corresponding foams prepared from the various samples of compositions d - h of example 3 . the polyisocyanate employed as starting material was a prepolymer prepared by reacting 100 parts by weight of a polymethylene polyphenyl polyisocyanate [ containing approximately 70 percent by weight of methylenebis ( phenyl isocyanate ) and having an equivalent weight of 131 ] with 12 . 7 parts by weight of a polyoxyethylene glycol having a molecular weight of 400 . the prepolymer had an equivalent weight of 161 and an acid value of 0 . 04 percent . five compositions ( i - m ) were made by adding the following amounts of 2 - ethyloxazoline to 827 g . aliquots of the above prepolymer , the admixture being carried out at room temperature ( ca 20 ° c .). ______________________________________compo - wt . moles 2 - ethyloxazolinesition 2 - ethoxazoline ratio : equivs . hcl in isocyanate______________________________________i 0 . 112 g . 0 . 25j 0 . 224 g . 0 . 50k 0 . 336 g . 0 . 75l 0 . 45 g . 1 . 0m 0 . 56 g . 1 . 25______________________________________ each of the above compositions was then divided into eight equal portions which were placed individually under dry nitrogen in 8 oz . stoppered bottles and stored at room temperature until ready for test . the reactivity of the various samples and the untreated prepolymer was checked at intervals over a period of 4 months using the test described in example 3 . the results are shown in table 5 . table 5__________________________________________________________________________ storage timecomposition initial 1 wk . 2 wks . 3 wks . 4 wks . 2 months 3 months 4 months__________________________________________________________________________controlcream time ( secs ) & gt ; 360 & gt ; 360 & gt ; 360 & gt ; 360 & gt ; 360 & gt ; 360 & gt ; 360 & gt ; 360gel time ( secs ) -- -- -- -- -- -- -- -- tack free time ( secs ) -- -- -- -- -- -- -- -- firm time ( secs ) -- -- -- -- -- -- -- -- cream time ( secs ) 120 83 163 105 87 137 & gt ; 95 & gt ; 120gel time ( secs ) & gt ; 360 none none none none none none -- tack free time ( secs ) -- ca 360 -- & gt ; 360 & gt ; 360 & gt ; 360 & gt ; 360 -- firm time ( secs ) -- -- -- -- -- -- -- -- jcream time ( secs ) 27 33 30 37 33 53 33 35gel time ( secs ) 43 43 57 -- 47 115 43 nonetack free time ( secs ) 83 87 97 125 57 185 77 100firm time ( secs ) 210 210 227 245 235 315 185 215kcream time ( secs ) 20 23 27 33 20 25 24 22gel time ( secs ) 25 30 32 47 24 30 26 25tack free time ( secs ) 35 40 50 95 28 43 32 30firm time ( secs ) 75 180 187 245 53 85 80 65lcream time ( secs ) 18 18 15 20 20 20 23 22gel time ( secs ) 23 20 21 22 22 25 25 24tack free time ( secs ) 28 22 24 28 25 35 30 28firm time ( secs ) 40 30 30 57 37 85 95 57mcream time ( secs ) 17 16 15 16 16 18 19 16gel time ( secs ) 18 18 18 17 17 19 23 17tack free time ( secs ) 20 20 22 18 18 20 26 18firm time ( secs ) 35 30 33 33 33 27 20 35__________________________________________________________________________ it will be seen that all of compositions i - m possessed superior reactivity to that of the untreated prepolymer and that the excellent level of reactivity of compositions j - m was maintained on storage for periods up to 4 months . this example shows that the reactivity of an isocyanate terminated prepolymer can be enhanced in accordance with the invention by treating the initial polyisocyanate with 2 - ethyloxazoline prior to formation of the prepolymer or by treating the already formed prepolymer with 2 - ethyloxazoline . two isocyanate compositions were prepared as follows using as starting material the same batch of polymethylene polyphenyl polyisocyanate as that used in example 3 . to a portion of 2000 g . of the polyisocyanate , preheated to 70 ° c ., was added with vigorous stirring 3 . 25 g . of 2 - ethyloxazoline ( representing 1 mole per equivalent of acid in the polyisocyanate ). the mixture was maintained at 70 ° c . overnight before being cooled to room temperature ( ca 20 ° c .). a portion ( 1787 g .) of the product was heated to 70 ° c . and stirred while a total of 155 g . of polyethylene glycol ( mw = 400 ) was added . after the addition was complete , the mixture was stirred and heated at 75 ° c . for 1 hour before being cooled to room temperature . a second portion of 2000 g . of the same polyisocyanate was heated to 70 ° c . with stirring in a nitrogen atmosphere and a total of 170 g . of polyethylene glycol ( mw = 400 ) was added slowly . when the addition was complete , the mixture was stirred for a further hour at 75 ° c . and then 3 . 65 g . ( corresponding to 1 mole per equivalent of acid in the starting isocyanate ) of 2 - ethyloxazoline was added with stirring . the resulting mixture was stirred at 75 ° c . for a further 30 minutes before being cooled to room temperature . each of the compositions n and o so obtained was divided into 8 equal portions which were placed in individual 8 oz . stoppered bottles under nitrogen and stored at room temperature . the reactivity of the samples was checked at intervals using the test procedure described in example 3 . the results are recorded in table 6 . table 6__________________________________________________________________________ storage timecomposition initial 1 wk . 2 wks . 3 wks . 4 wks . 2 months 3 months__________________________________________________________________________cream time ( secs ) 14 15 15 17 16 17 16gel time ( secs ) 16 16 17 18 17 18 17tack free time ( secs ) 18 17 18 19 18 19 17firm time ( secs ) 20 19 19 20 20 20 18ocream time ( secs ) 16 15 15 17 18 18 16gel time ( secs ) 17 16 17 18 19 19 16tack free time ( secs ) 18 17 18 19 21 20 17firm time ( secs ) 19 18 18 20 23 20 19__________________________________________________________________________ it will be seen that both of compositions n and o showed markedly superior reactivity as compared with the untreated polyisocyanate and the high level of activity was maintained substantially unchanged over a storage period of 3 months . | 2 |
to understand how we can improve the refrigeration cycle we must first analyze the components of a conventional air - conditioning system and understand where the inefficiencies exist . fig1 depicts the conventional air - conditioning circuit 10 . the circuit of fig1 consists of the following elements : a compressor 12 , condenser 14 , expansion valve 16 , and evaporator 18 with temperature sensor 20 coupled controllably to the expansion valve , connected in series by conduits 13 , 15 , 17 to form a closed loop system . shading indicates that the refrigerant within the condenser passes through three separate states as it is converted back to a liquid form : superheated vapor 22 , condensing vapor 24 and subcooled liquid 26 . similarly , shading in the evaporator indicates that the refrigerant contained therein is in two states : vaporizing refrigerant 28 and superheated vapor 30 . pressures and temperatures are indicated at various points in the refrigeration cycle by the variables p1 , t1 , p2 , t2 , etc . in the evaporator , only the refrigerant changing from a liquid state 28 ( p4 , t3 ) to a vapor state 30 ( p4 , t4 , assuming dp small ) provides refrigerating effect . the more liquid refrigerant ( state 28 ) in the evaporator , the higher its cooling capacity and efficiency . the ratio of liquid to vapor refrigerant can vary . the determining factors are the performance of the expansion valve , the proportion of &# 34 ; flash gas &# 34 ; entering the evaporator through the valve , and the temperature t3 and pressure p4 of the entering liquid refrigerant . as can be seen in fig1 only superheated vapor ( state 30 ) enters the compressor 12 . the term &# 34 ; superheat &# 34 ; refers to the amount of heat in excess of the latent heat of the vaporized refrigerant , that is , heat which increases its volume and / or pressure . high superheat at the compressor inlet can add considerably to the work that must be performed by other components in the system . ideally , the vapor entering the compressor would be at saturation , containing no superheat and no liquid refrigerant . in most systems using a reciprocating compressor 12 this is not practical . we can , however , make significant improvements . the discharge heat of the vapor exiting from the compressor includes the superheat of the vapor entering the compressor plus the heat of compression , friction and the motor added by the compressor . at the entrance of the condenser , all of the refrigerant consists of superheated vapors at pressure p1 and temperature t1 . the portion of the condenser needed to desuperheat the refrigerant ( state 22 ) is directly related to the temperature t1 of the entering superheat vapors . only after the superheat is removed can the vapors start to condense ( state 24 ). the superheated vapors 22 are subject to the gas laws of boyle and charles . at a higher temperature t1 , they will tend to either expand ( consuming more condenser area ) or increase the pressures p1 and p2 in the condenser , or a combination of both . the rejection of heat at this point is vapor - to - vapor , the least effective means of heat transfer . as the vapors enter the condensing portion of the condenser they are at saturation ( state 24 ) and at a pressure p2 and temperature t2 which are not greater than p1 and t1 , respectively . at this stage , further removal of latent heat will convert the vapors into the liquid state 26 . the pressure p2 will not further change during this stage of the process . as the refrigerant starts to condense , the condensation will take place along the walls of the condenser . at this point , heat transfer is from liquid - to - vapor , and produces a more efficient rejection of unwanted heat . the condensing pressures are influenced by the condensing area ( total condenser area minus the area used for desuperheating and the area used for subcooling ). the effect of superheat can be observed as both a reduction in condensing area ( state 24 ) and an increase in the overall pressure ( both p1 and p2 ). in an effort to suppress the formation of flash gas entering the expansion valve , many manufacturers use part of the condenser to further cool or subcool the liquid refrigerant to a lower temperature t3 ( state 26 ). if we consider only the subcooling of the liquid without regard to decreased condensing surface , then we can expect a gain of 1 / 2 % refrigeration capacity per degree ( f .) of subcooling . if we consider the reduction in condensing surface , however , then there is a net loss of capacity and efficiency due to increased condensing temperature t2 and higher head pressure p1 . analysis of the refrigeration cycle shows that several factors that can be improved . combining these factors , as described with reference to fig4 can dramatically improve the overall capacity and efficiency of performance . fig2 illustrates , in an air - conditioning system , the effects of liquid pumping as taught in my prior u . s . pat . no . 4 , 599 , 873 , incorporated herein by reference . the system is largely the same as that of fig1 so like reference numerals are used on like parts . the various states are indicated by like reference numerals followed by the letter &# 34 ; a .&# 34 ; temperatures and pressures are also indicated in like manner with the understanding that the quantities symbolized by the variables differ substantially in each system . the principal structural difference is that a liquid refrigerant centrifugal pump 32 is installed between the outlet of the condenser 14 ( on systems that do not have a receiver ) and the expansion valve 16 . the pump 32 increases the pressure p2 of the liquid refrigerant flowing from the condenser outlet by a dp of 8 to 15 p . s . i . to an incrementally increased pressure p3 . this is referred to as the liquid pressure amplification process . the pressure added to the liquid refrigerant will transfer the refrigerant to the subcooled region of the enthalpy ( i . e ., p3 & gt ; p2 , t3 same , and will not allow the refrigerant to flash prematurely , regardless of head pressure . by eliminating the need to maintain the standard head pressure , minimum head pressure p1 can be lowered to 30 p . s . i . above evaporator pressure p4 in air - conditioning and refrigeration systems . condensing temperature t1 can float rather than being set to a fixed minimum temperature in a conventional system , e . g ., 105 ° f . in r - 22 air - conditioning systems . if ambient temperature is 65 ° f ., using a pump 32 in an r - 22 air - conditioning system lowers condensing temperature t1 to about 86 ° f . at full load . additionally , head pressure p1 is lowered , as next explained . for the evaporator 18 to operate at peak efficiency it must operate with as high a liquid - to - vapor ratio as possible . to accomplish this , the expansion valve 16 must allow refrigerant to enter the evaporator at the same rate that it evaporates . overfeeding or underfeeding of the expansion valve will dramatically affect the efficiency of the evaporator . using pump 32 assures an adequate feed of liquid refrigerant to valve 16 so that the exhaust refrigerant at the intake of compressor 12 is at a temperature t4 and pressure p4 closer to saturation . fig3 graphs the flow rate of refrigerant through the expansion valve 16 in laboratory tests with and without the liquid pump 32 running . the upper trace indicates incremental pressure added by pump 32 and the lower trace graphs the flow rate of refrigerant through the expansion valve . the test begins with the system running in steady state with centrifugal pump 32 on . at 131 min . the pump was turned off . the flow rate of refrigerant entering the evaporator 18 through the expansion valve 16 ( txv ) shows a decided decrease in flow compared to the flow when the pump is running . an increase in head pressure only partially restores refrigerant flows . the reduced flow of refrigerant to the evaporator has several detrimental effects , as shown in fig1 . note the reduced effective evaporator area 28 as compared to area 28a in fig2 . at 150 min ., the liquid pump 32 is turned on . with the pump 32 again running , the flow rate is consistently higher , with an even modulation of the expansion valve , because of the absence of flash gas . it can be seen that running the pump increases the amount of refrigerant in the evaporator yet the superheat setting of the valve controls the modulation of the expansion valve at a consistent flow rate . the net result is a greater utilization of the evaporator 18 as shown in fig2 ( note state 28a ). the efficiency of the compressor 12 is related to a number of factors , most of which can be improved when the liquid pumping system is applied . the efficiencies can be improved by reducing the temperature in the cylinders of the compressor , by increasing the pressure p4 of the entering vapor , and by reducing the pressure p1 of the exiting vapor . with the vapor entering the compressor at a higher pressure , the compressor capacity will increase . with cooler gas ( t4 ) entering the cylinders , the heat retained in the compressor walls will be less , thereby reducing the expansion , due to heat absorption , of the entering vapor . with these improvements on the suction side of the compressor , the condensing temperature t1 can float with the ambient to a lower condensing temperature in the system of fig2 . this reduces the lift , or work , of the compressor by reducing the difference between p4 and p1 . the increased capacity or power reduction , due to the lower condensing temperatures , will be approximately 1 . 3 % for each degree f . that the condensing temperature is lowered . as explained earlier , the liquid pump &# 39 ; s added pressure dp maintains all liquid leaving the pump 32 in the subcooled region of the enthalpy diagram . for this reason , it is no longer necessary to flood the bottom part of the condenser ( see 26 in fig1 ) to subcool the refrigerant . this portion of the condenser can now be used to condense vapor ( compare state 24a of fig2 with state 24 in fig1 ). this increased condensing surface can further lower the condensing temperature t2 and pressure p2 . the temperature t3 of the refrigerant leaving the condenser will be approximately the same as if subcooled , but with little or no subcooling ( state 26a ). with the application of the pump 32 , the evaporator discharge or superheat temperature t4 and compressor intake pressure p4 have been reduced considerably from the corresponding parameters in the system of fig1 . the best results are obtained when such a system is operated with the condenser at moderate ambient temperatures , usually under 80 ° f . as ambient temperatures rise above the minimum condensing temperature , the advantages gradually decrease . at a typical ambient temperature of around 75 ° f ., a typical improvement in efficiency of the system of fig2 over that of fig1 is 7 %- 10 %, declining to negligible at 100 ° f . ambient temperature . i have discovered , however , that , by using the present invention , next described , an additional 6 % to 8 % savings can be achieved under typical ambient conditions . moreover , we can obtain very substantial improvements of efficiency and effectiveness at ambient temperatures over 100 ° f . fig4 shows an air - conditioning system 100 in accordance with the present invention . the general configuration of the system resembles that of system 10a in fig2 . in accordance with the invention , however , a conduit or line 34 is connected at one end to the outlet of pump 32 and at the opposite end to an injection coupling 36 at the entrance to the condenser . this circuitry enables a portion of the condensed liquid refrigerant to be injected at temperature t3 from the pump outlet into the entrance of condenser . as this liquid refrigerant enters the desuperheating portion of the condenser , it will immediately reduce the temperature of , and thereby suppress , the superheated vapors entering the condenser at pressure p1 and temperature t1 . the amount of refrigerant injected at coupling 36 should be sufficient to dissipate the superheated vapors and preferably reduce the incoming temperature t1 to a temperature close ( within 10 ° f .- 15 ° f .) to the saturation temperature t2 of the refrigerant . in a 10 ton , 120 , 000 btu air - conditioning system , line 15 has an inside diameter of 1 / 2 inch and line 34 has an inside diameter of 1 / 8 inch , for a cross - sectional ratio of line 34 to line 15 of 1 : 16 or about 6 %. due to flow rate differences and variations ( e . g ., due to modulation of valve 16 by sensor 20 ) the flow ratio is less than about 5 %, probably 2 %- 3 %, in a typical application . ( 1 ) by reducing the superheat temperature t1 , the pressure p1 and volume of the superheat vapors will both be reduced . ( 2 ) the vapor will be very close to or at saturation point ( t2 , p2 ). ( 4 ) heat transfer will be higher because of liquid - to - vapor heat transfer over a greater area of the condenser ( compare state 24b with state 24a ). the injection of liquid refrigerant into the condenser 14 is accomplished using the same pump 32 that is installed for the liquid pressure amplification process . by reducing the work required to desuperheat the refrigerant vapor , the pump can perform a substantial portion of the work required to recirculate the liquid through the condenser . although some gain can be seen at low ambient temperature , with this process of superheat suppression , the best gains will be realized at higher ambient temperature . this is just the opposite of the benefits noted with liquid refrigerant amplification alone . for example , at over 100 ° f ., the system of fig2 gives little if any increase in efficiency and capacity over the system of fig1 . tests have shown that the system of fig4 on the other hand , will provide efficiency increases of 10 %- 12 % at 100 ° f . and as much as 20 % at 113 ° f ., and add capacity to allow air conditioning to be run effectively in the desert . fig5 is a graph of actual results achieved in a test of a 60 ton trane air - conditioning system comparing operation of system 100 of fig4 with operation of systems 10 and 10a of respective fig1 and 2 . all readings were taken at 86 ° f . ambient temperature . the readings are : a . standard system without modification ( fig1 ), b . same system adding the pump 32 only ( fig2 ), and c . the same system modified in accordance with the present invention to include both pump 32 and superheat suppression circuitry 34 , 36 ( fig4 ). for each parameter -- head pressure p1 ( p . s . i . ), condensing temperature t1 (° f .) and liquid temperature t3 (° f .) entering the evaporator -- configuration c , the present invention , demonstrated lower readings . such performance characteristics enable a system 100 according to the present invention to provide a greater cooling capacity as well as greater efficiency . these advantages continue to higher ambient temperatures , including temperatures at which configurations a and b would no longer be effective . fig6 shows an alternative embodiment including bypass conduits 50 , 52 connected around liquid amplification pump 32 , and valve 54 to control refrigerant flow through bypass conduits 50 and 52 . i have discovered that the high refrigerant flow rates of large refrigeration or air conditioning systems necessitate multiple liquid pressure amplification pumps in parallel or a larger single liquid pressure amplification pump . the use of a larger single pump is often preferred for simplicity of design . in such systems the large electrically - driven compressors typically operate on a separate electrical circuit from the liquid pressure amplification pump motor . should the power circuit to the liquid amplification pump motor be turned off or disconnected while the compressor motor circuit is still operable , the compressor will work to drive refrigerant through the pump . in order to preserve all available cooling capacity of the partially disabled system under those circumstances , unnecessary refrigerant pressure drops in the system should be minimized where possible . unfortunately , it is not possible to entirely eliminate the pressure drop through the idle liquid pressure amplification pump . in the case of an idle centrifugal pump , the convoluted flow path through the idle pump , along with the throttling of the pump outlet required to minimize cavitation , together cause a pressure drop through the idle pump which cannot be eliminated . in the case of an idle positive displacement pump , refrigerant flow is likely be blocked entirely , other than seepage of fluid through clearances within the pump . i have solved this problem by providing bypass conduits 50 and 52 around pump 32 , which is preferably a centrifugal pump but which could alternatively be a positive displacement pump . refrigerant flow through bypass conduit 50 and 52 is controlled by valve 54 ( fig6 ). in one embodiment , valve 54 is a check valve of standard design , such a swing check valve , a lift check valve , or a tilting - disk check valve , which remains closed during normal system operation to prevent backflow of refrigerant around pump 32 . in an alternate embodiment , valve 54 can be an electrically operable valve , such as a solenoid - actuated valve which is spring - biased to a normally open position to permit flow through the bypass conduit , and electrically biased to a closed position , from the pump motor circuit . whenever power is removed from the pump motor , the power to the solenoid is turned off , allowing the valve to move to its normally open position to open the bypass line . in yet another embodiment , valve 54 can be a solenoid - actuated valve in which the power is turned off to open the valve responsive to a loss of pressure downstream of pump 32 . in each of the foregoing instances , if pump 32 is idled while the compressor continues to operate , valve 54 opens permitting refrigerant to bypass pump 32 in a forward , i . e . downstream , direction and limits the pressure drop to less than about 5 psi , and preferably to 1 / 2 to 1 psi . when pump 32 is restarted and downstream pressure increases , valve 54 closes again to prevent backflow . having described and illustrated the principles of the invention in a preferred embodiment thereof , it should be apparent that the invention can be modified in arrangement and detail without departing from such principles . i claim all modifications and variation coming within the spirit and scope of the following claims . | 5 |
the techniques of the invention are used to replicate transactional data with full integrity . the invention is applicable to relational databases and other types of databases and data sources as long as the data source application program interface supports certain operations , which are described below . fig1 illustrates a network 100 configured in accordance with an embodiment of the invention . the network 100 includes a first computer 102 connected to a second computer 104 via any wired or wireless transmission channel 106 . the first computer 102 includes standard components , such as a central processing unit 110 and a network connection circuit 112 linked by a bus 114 . also connected to the bus 114 is a memory 116 . the memory 116 stores a first database or data source 118 , which may be any known database or data source . a batch processor 120 includes executable instructions to process the data in the database 118 in accordance with operations discussed below . these operations are used to migrate the data to a different location in the network 100 , such as computer 104 . the second computer 104 also includes standard components , such as a network connection circuit 130 and a central processing unit 132 linked by a bus 134 . a memory 136 is connected to the bus 134 . the memory stores a second database or data source 138 . the memory 136 also stores a batch processor 120 , which may include the same executable instructions of those of the batch processor 120 of the first computer 102 . the batch processor 120 of the second computer 104 facilitates the processing of the data in the database 138 in accordance with embodiments of the invention . the batch processor 120 of the first computer facilitates the transport of data from the first database 118 to the second database 138 . similarly , the batch processor 120 of the second computer 104 facilitates the transport of data from the second database 138 to the first database 118 . the batch processor 120 includes executable instructions to implement various operations of the invention , as discussed below . consider an example with the following tables in a database : order_master table ( columns are order id , customer name , key is order id ) customer order id name row 1 1 smith row 2 2 jones row 3 3 adams order_detail table ( columns are order id , part id , quantity , key is order id , part id ) order id part id quantity row 1 1 car 4 row 2 1 boat 2 row 3 2 car 2 row 4 3 truck 1 row 5 3 car 2 invoice table ( columns are order id and amount , key is order id ) a “ unique key ” ( uk ) in each table is a set of columns within the table used to uniquely identify each row within the table . for example , in the order_master table , order id is a unique key because it never repeats in the table . in the order_detail table , order id is not unique because it repeats ( the value 1 appears twice ). however , a combination of order id and part id is unique ( there are no repetitions in ( 1 , car ), ( 1 , boat ), ( 2 , car ), ( 3 , truck ), ( 3 , car )). note that it is possible for a table to have more than one unique key . also note that a unique key that is not strictly defined by the database may be specified as a logical concept by a user performing replication ( i . e ., it is possible for a table not to have a pre - defined unique key ). operations which alter the contents of any table are known generically as database change operations . these are inserts , updates or deletes . an insert results in a new row in a table ; an update is a change to an existing row in a table ( for example , changing the quantity in the order_detail table from 4 to 5 where order id is 1 and part id is car ); and a delete is the removal of a row in a table . one or more database operations are typically grouped into a database transaction . the application defines all of the operations which constitute a given transaction . one property of a database transaction in this context is that each database change in the transaction is applied or none are applied . for example , if an application were to submit an insert for rows 1 and 2 of order_detail , along with row 1 of order_master , but the insert on order_master failed , an inconsistency in the database would be apparent — there would be order_detail rows without a corresponding order_master record . for this reason , if any of the database operations fails , they all “ roll back ” and no trace of the transaction is present in any trails . transaction capabilities are a way to guarantee consistency in the database by providing “ all or nothing ” features . referential integrity is another tool used by databases and applications to enforce consistency . referential integrity is a feature provided by relational database management systems that prevents users or applications from entering inconsistent data . most relational database management systems have various referential integrity rules that are applied when creating a relationship between two tables . for example , the invoice table references an order from the order_master table ; without a corresponding order in the order_master table , the entry in the invoice table makes no sense and should not be allowed . this is referential integrity . the following terms apply in the context of referential integrity . invoice rows with order ids of 1 are said to be the child rows of order_master rows with order ids of 1 ; conversely , the order_master row is the parent of the corresponding invoice row . a key field that identifies records in a different table is called a foreign key . so , for example , the order id in invoice is said to be the foreign key in the relationship between order_master and invoice . note that referential integrity is different from transactional integrity , because invoices may be submitted at a different time — in a different transaction — than the transaction which originally created the order . also , referential integrity rules may be strictly defined in the database or may be enforced by application code . databases may enforce referential constraints in different ways . one way is a deferrable constraint , which means that the check to ensure consistency is deferred until all operations have been posted for a transaction . the other way is a non - deferrable constraint , which specifies that constraints are checked as operations are posted . the pattern of activity in most transactional applications is that many transactions are in different states of progress during periods of activity , which is known as interleaved transactions . for example : time transaction table operation type key t0 100 order_master insert 4 t1 200 order_master update 2 t2 100 order_detail insert 4 , ’ car ’ t3 200 n / a commit n / a t4 300 invoice insert 2 t5 100 n / a commit n / a transactions on the database occur in parallel and don &# 39 ; t necessarily commit in the order they are initiated . these events are recorded , typically , in a database transaction log , an event log , or an application log ( known more generically here as a transaction log ). note that until a commit operation is submitted , all rows touched in a transaction are locked from access by any other transaction . no changes are permanent to the database until and unless a commit is encountered for a given transaction . transaction replication is a method by which database operations occurring in the source database s can be applied to a target database t while retaining transaction integrity rules at t . transaction replication has two essential steps : capture and apply ( many other features may be implemented , such as data translation , filtering , mapping , routing , etc .). capture describes a process by which the transaction replication system retrieves the changes recorded in the transaction logs . apply describes a process by which transaction operations retrieved by capture are applied , via a database api , to the target system . note that capture and apply may be the same processes or different processes , may exchange data directly over an inter - process channel or may exchange data asynchronously via file queues , database queues or equivalent methods . a capture process may deliver transaction data to the apply ( via any of the methods above ), in either an interleaved form or in a transaction sorted form . the sorted form defers the outputting of each transaction until its corresponding commit operation is seen . at that point , it outputs each operation in the transaction consecutively , rather than in an interleaved manner . for example , the sorted version of the above interleaved transaction set would be : time transaction table operation type key t1 200 order_master update 2 t3 200 n / a commit n / a t0 100 order_master insert 4 t2 100 order_detail insert 4 , ’ car ’ t5 100 n / a commit n / a in this scenario , the data has been reordered into commit order . note also that the record from transaction 300 is not output until a commit is seen ( if a rollback operation is seen , the transaction operations are discarded ). even though operations may technically come out of order , they will never come out of order for a given unique key on a table . that is because , when a transaction changes a specific row , that row is locked for the duration of the transaction ; this prevents a “ parallel ” transaction from updating that row ( until the first transaction commits and unlocks the row ). the commit for the locking transaction is guaranteed to occur before the commit to the second transaction . when performing transaction replication against a sorted transaction stream , it is possible to group transactions in the apply process . this means that transactions 200 and 100 can be grouped together into a single transaction without violating transaction integrity rules . but now , for transaction 200 to be committed , the group transaction logic also requires all operations in transaction 100 to be successfully applied , or the grouped transaction is rolled back . in this sense , additional transaction rules are applied at the target that didn &# 39 ; t exist on the source database . therefore , there can be a many to one relationship between transactions at s , and transactions at t . but no transaction in s will be split across multiple transactions in t . note that this also has significant performance implications , because commit operations typically cause significant database overhead , and fewer commits for the same operations means increased efficiency . note also that if a grouped transaction fails , transaction replication can also fall back to a mode of applying the original transactions one at a time . replication is said to be active - active or multi - master if transactions can originate on any database . for example , in a two database scenario , database 1 would function as both the originator of transactions which are replicated to database 2 , and database 2 would also function as the originator of transactions which are replicated to database 1 . in these types of scenarios , conflicts can arise , when database 1 and database 2 update the same row at nearly the same time . for example , imagine that database 1 is adding $ 200 to the invoice amount for order 1 , making it $ 300 ; database 2 , at nearly the same time , adds $ 400 to the invoice amount for order 1 , making it $ 500 in database 2 . but when the transactions are replicated , the last change is incorrectly overwritten at each database , and database 2 receives the update from database 1 to make the amount $ 300 , while database 1 receives the update from database 2 , making it $ 500 . one conflict detection mechanism that identifies this problem is to compare non - key values — in this case , the prior value of amount — before applying the update . for example , when applying the update from database 1 to database 2 , the sql would be : this statement would fail , because database 2 would have the new amount of $ 500 . this would indicate a conflict . conflicts can be resolved using any number of prior art techniques . an access method provides a way for changing data within tables of a database . one type of access method is to use a programming interface , known generically as an application program interface or api . in most sql databases , prepared statements can be used to increase the efficiency of applying changes programmatically to a database . a prepared statement has both standard sql syntax and placeholders ( parameters ) for the actual data values that will be supplied each time the statement is executed . one advantage of a prepared statement is that the statement only needs to be parsed by the database one time ( overhead is incurred each time parsing occurs ); each time that statement needs to be executed again , with different values , the already parsed statement is submitted with different parameter values . for example , the following are distinct statements with parameters : two statements are considered equivalent statements if all of the following are true : the tables are the same the operations are the same ( insert , update or delete ) the columns being “ set ” by the statement are the same the columns being specified in the “ where ” clause are the same the first and third statements are the same , because the operation , table , set list of columns , and where list of columns are equivalent . to execute the first update , the first statement above with parameters is parsed . then the prepared statement (# 1 ) is submitted with parameters partid = 55 , orderid = 22 . to execute the second update , the second statement above with parameters is parsed . then the prepared statement (# 2 ) is submitted with parameters partid = 321 , quantity = 561 . orderid = 22 . to execute the third update , prepared statement # 1 is reused ( saving an extra parsing step ), because the parameters are the same as in the first statement . prepared statement # 1 is submitted with parameters partid = 7823 , orderid = 33 . another efficiency booster offered by many databases is the submission of multiple rows to the database api in a single call . this saves roundtrips between the client program and the database server , and can reduce and eliminate much of the other overhead associated with processing a single operation . these features are known as multi - row or array operations . multi - row operations generally require that the statements to be executed are equivalent statements ( as described above ). using the above example , the first and third statements could be sent in a single api call , because they are equivalent statements . in this case , an array of parameter values is passed to the api for a given parameter , one per row being updated ( when a single row is updated , a single value is supplied , rather than an array ). different databases also provide ways to distribute a transaction &# 39 ; s work load across multiple processing threads , processes or even systems . if the transaction is large , the work can be distributed to multiple processing resources , and later committed or rolled back as a unit . this is known as a distributed transaction . one way in which this occurs is known as two - phase commit . in the first phase , the participating threads all perform their own segment of work on the transaction and ensure that the work is persisted ( e . g ., via a prepare transaction operation ). in the second phase , once an acknowledgement is received that all participating threads have persisted their portion of the work , a second phase commit operation ensures that the transaction is complete . if any of the threads fail or the master processing thread quits prematurely , all threads are rolled back . in replication , changes that are captured from the source database can be selectively applied to the target database . this is done by interpreting the captured data , and interfacing with the appropriate api to execute database changes at the target . historically , in replication systems , apply operations have been submitted to apis one row at a time . this is due to the fact that the workload is highly varied — different statements from different transactions are interleaved in the source environment . it is unlikely that consecutive statements will be equivalent statements in any large numbers . replication systems have traditionally operated in a single threaded fashion as well , at least on a per transaction basis . in interleaved transaction replication , a thread may be created for each individual transaction that is active at any given time , but this does not account for the ability to split workload across multiple threads . usually , this isn &# 39 ; t productive , because transactions are small , and coordinating between multiple transaction threads has some overhead in the database . in replication systems which supply a transaction sorted operation stream to apply , multi - threading is also difficult , because 1 ) the original ordering of updates on a specific row must be maintained ; and 2 ) any referential integrity constraints must also be considered . because thread execution does not always occur in the same order as submission of workload , a coordination mechanism must be developed to enable multi - threaded execution in this environment . an embodiment of the invention combines the following concepts : transaction sorted streams of captured operations ; combining small transactions on the source database into bigger transactions on the target database ; submission of multiple equivalent statements in each transaction in a single database api call ; and distribution of workload in a large transaction to multiple processes or processing threads . as mentioned above , transaction sorted streams enable the combining of smaller transactions on the source database into larger transactions during the apply to the target database while preserving transaction integrity rules . one solution is to apply these operations as they are encountered by the apply process , and simply “ bracket ” the transaction around larger numbers of operations than in the source ( in the transaction sorted example above , the operations in transaction 200 and transaction 100 would be combined into a single transaction on the target ). another alternative is to gather operations across a larger number of transactions into groups of equivalent statements . consider this example ( in transaction sorted order ): op transaction operation 1 50 update order_detail set quantity = 3 where orderid = 5 and partid = “ truck ” 2 50 insert into order_detail ( orderid , partid , quantity ) values ( 5 ,” boat ”, 1 ) 3 100 insert into order_master ( orderid , customername ) values ( 1 , “ smith ”) 4 100 insert into order_detail ( orderid , partid , quantity ) values ( 1 ,” car ”, 4 ) 5 100 insert into order_detail ( orderid , partid , quantity ) values ( 1 ,” boat ”, 2 ) 6 200 insert into order_master ( orderid , customername ) values ( 2 , “ jones ”) 7 200 insert into order_detail ( orderid , partid , quantity ) values ( 2 ,” car ”, 2 ) 8 225 update order_detail set quantity = 4 where orderid = 1 and partid = “ car ” 9 225 update order_detail set quantity = 3 , partid =” car ” where orderid = 1 and partid =” boat ” there are two statement types in this example : an insert of all columns into order_master and an insert of all columns into order_detail . in this example , an embodiment of the invention sorts the operations into the following statement buckets or submission groups : bucket op key operation 1 1 od , 5 ,” truck ” update order_detail set quantity = 3 where orderid = 5 and partid = “ truck ” 1 8 od , 1 ,” car ” update order_detail set quantity = 4 where orderid = 1 and partid = “ car ” 2 2 od , 5 ,” boat ” insert into order_detail ( orderid , partid , quantity ) values ( 5 ,” boat ”, 1 ) 2 4 od , 1 ,” car ” insert into order_detail ( orderid , partid , quantity ) values ( 1 ,” car ”, 4 ) 2 5 od , 1 ,” boat ” insert into order_detail ( orderid , partid , quantity ) values ( 1 ,” boat ”, 2 ) 2 7 od , 2 ,” car ” insert into order_detail ( orderid , partid , quantity ) values ( 2 ,” car ”, 2 ) 3 3 om , 1 insert into order_master ( orderid , customername ) values ( 1 , “ smith ”) 3 6 om , 2 insert into order_master ( orderid , customername ) values ( 2 , “ jones ”) 4 9 od , 1 ,” boat ” update order_detail set quantity = 3 , partid =” car ” where orderid = 1 and partid =” boat ” in theory , each bucket can be submitted to the database api as a unit , for a total of four calls to the database to apply a total of nine operations . however , the order in which these operations is applied is crucial or operations will fail . for example : bucket # 1 includes an update to order where orderid = 1 ( op 8 ), but the insert of the row was performed in bucket # 3 ( op 3 )— therefore , if bucket # 1 is applied before bucket # 3 , the database will return a “ not found ” error if bucket # 2 is submitted before bucket # 3 , the order_detail rows for orders 1 and 2 will precede the insertion of the corresponding order_master rows , violating referential integrity rules note that if the row from the source database has another unique identifier , it is not necessary to use the row &# 39 ; s primary key column values as the chief tracking mechanism . for example , in an oracle database a unique rowid is specified by the oracle database for each row . an embodiment of the invention is configured to gather many operations , and usually many small transactions , from the source into a larger group transaction on the target . the techniques described above are used to sort operations into buckets . 1 ) operations to the same row occurring more than once must be executed in the correct ( original ) sequence ( in the above example , operation 4 in bucket # 2 must precede operation 8 in bucket # 1 , otherwise , an update is applied to a non - existent record ) 2 ) operations that update unique keys must be sequenced properly 3 ) operations that require referential integrity to be preserved must be executed in the correct order ( operation 3 in bucket # 3 must precede operations 4 and 5 in bucket # 2 ) the first rule to ensure proper sequential order is maintained across different buckets that contain operations on the same row is to execute the bucket which contains the first operation prior to the bucket which contains the second operation on that row , the second before the third , and so on . however , consider the following scenario : op bucket operation key 1 1 insert a 2 1 insert b 3 2 delete x 4 2 delete b 5 1 insert c 6 1 insert b 7 1 insert e in this example , the delete in operation 4 must come after insert in operation 2 , but before the insert in operation 6 . if all of bucket 1 were to be applied first , a duplicate row error would occur when applying operation 6 , because the bucket already inserted the row in operation 2 . conversely , if bucket 2 is applied first , then the delete in operation 4 would fail , because the row hasn &# 39 ; t been inserted yet ( operation 2 in bucket 1 ). as a consequence , the rule for applying buckets must be modified . buckets may be split across multiple rounds . in the above example , application of operations into particular rounds could be executed as follows while preserving key order : op bucket operation key round 1 1 insert a 1 2 1 insert b 1 3 2 delete x 2 4 2 delete b 2 5 1 insert c 3 6 1 insert b 3 7 1 insert e 3 even though operations 1 , 2 5 , 6 and 7 are in the same bucket , operation 2 in bucket # 1 must be executed before operation 4 in bucket # 2 , which must be executed before operation 6 in bucket # 1 . this means that the execution must be split into three rounds . an embodiment of the invention enforces this rule to track all row keys as buckets are constructed . if an operation has the same key as a prior operation ( on the same table ), then the prior operation &# 39 ; s bucket is marked for immediate execution ( described below ). consider the following example with the following state when operation 4 is reached . op bucket operation key round 1 1 insert a 2 1 insert b 3 2 delete x 4 2 delete b when examining operation 4 , it can be observed that a row with the same key was seen in a prior operation ( key b , operation 2 ). as a result , the operations ( 1 and 2 ) in bucket 1 are executed ( subject to execution of “ dependent buckets ” as described below ), as shown by marks in the round column below . op bucket operation key round 1 1 insert a 1 2 1 insert b 1 3 2 delete x 4 2 delete b op bucket operation key round 1 1 insert a 1 2 1 insert b 1 3 2 delete x 2 4 2 delete b 2 5 1 insert c 6 1 insert b in operation 6 , key b is encountered . because there is a key b in operation 4 , bucket 2 ( operations 3 , 4 ) are executed . finally , when the end of available operations is observed , the remainder of bucket 1 ( operations 5 , 6 , 7 ) is executed in round 3 . op bucket operation key round 1 1 insert a 1 2 1 insert b 1 3 2 delete x 2 4 2 delete b 2 5 1 insert c 3 6 1 insert b 3 7 1 insert e 3 this is like tracking the same rows . when attempting to detect whether an operation modifies the same row as a prior operation , it is necessary to examine , in update operations , the before image value of that key and compare it with keys encountered so far . if the before image key value is the same as a prior after image key value of a row , then the update is to that row . those operations can then be linked in the proper order ( op 1 after key = a , op 2 before key = b , after = c , op 3 before key = c , after = d , op 4 before key = d , after key = d − all operations are on the same row ). in the instance where an update operation occurs in the same bucket to the same key , the execution of the bucket can be deferred . for example : op bucket operation key round 1 1 update a 1 2 1 update b 1 3 1 update a 1 4 2 delete a 2 note that when encountering operation 3 , even though key a was already seen in operation 1 , one can defer execution of the bucket until operation 4 ( where key a is encountered in a different bucket ). the reason is that key order is maintained within bucket 1 , and since there are no intervening changes to the row with key a between operations 1 and 3 , all operations in bucket 1 can be executed together . this method is advantageous in applications where operations update the same row repeatedly , using the same sql ( i . e ., the same list of columns in the update ). rather than triggering execution based on observing the same row twice , rows which appear more than once can be deferred for a different execution round than rows that do not . in this scenario , the only successor row key is b and successor row operations are 4 and 6 . therefore , the operations ( in all buckets ) that do not have row ordering dependencies ( rounds 1 and 2 above ) are executed , leaving the following : op bucket operation key round predecessor row op 4 2 delete b 3 6 1 insert b 4 next , the same logic is used to select bucket 2 operation 4 for execution , leaving : op bucket operation key round predecessor row op 6 1 insert b 4 an embodiment of the invention allows further deferral of execution . consider the following example . round prior round updated method ( new op bucket operation key cols ( forced by op ) method ) 1 1 insert a c1 , c2 , c3 1 ( 2 ) 1 2 2 update a c2 2 ( 3 ) 2 3 3 update a c2 , c3 3 ( 6 ) 3 4 3 update a c2 , c3 3 ( 6 ) 3 5 1 insert b c1 , c2 , c3 5 ( none ) 1 6 2 update a c2 4 (( 8 ) 2 7 1 insert c c1 , c2 , c3 5 ( none ) 1 8 4 delete a 6 ( none ) 4 note that in the prior method , operation 2 would force bucket 1 to execute with just one operation outstanding ( op 1 ). however , as long as the buckets execute in the proper order , the entire contents of each bucket can be submitted in each round — this reduces the total number of rounds from 6 to 4 . if bucket 2 executes before bucket 3 , the operations on key b would be ordered insert ( op 2 ), delete ( op 5 ), update ( op 4 ). this would result in an error on the update ( record not found ), since the record was already deleted . therefore , the challenge is recognizing the proper situations in which this method can be applied . attention now turns to ensuring proper unique key order . any changes to unique keys that are not the primary key must also be properly sequenced . for example : if executed using one of the above methods , all of bucket 1 would be executed in the first round , and bucket 2 would be executed in the second round , because the primary keys do not conflict . however , were this to occur , operation 3 would execute before operation 2 . in this case , the row where key = b has a unique key value of y when operation 3 attempts to execute , resulting in duplicate index error condition , since operation 3 is attempting to update the unique key value to y . y must change to z before x can change to y , since at most one row can hold any given value at a point in time . as a result , the same rules that are applied using primary keys must also be applied to any additional unique keys in a table : if when encountering a row , a prior operation is seen for a unique key in any row , the bucket to which that prior operation belongs should be executed the exception to the above are when the unique key value didn &# 39 ; t change from one operation to the next , the bucket execution can be deferred when updates on the same unique key occur in the same bucket , they can be deferred until an operation with the same unique key value occurs in a different bucket a more crude general rule could be applied to always execute changes to tables with unique keys immediately ( exempt them from multi - row operations ). since in many applications a majority of transaction activity does not affect unique keys ( other than primary keys ), operations on the minority of tables that do have unique keys can be executed immediately without a significant decrease in overall performance . ensuring that non - deferrable referential integrity constraints are preserved is another aspect of the invention . note that when referential integrity constraints are deferrable to the end of a transaction , no additional features are necessary — any constraints must only be true at the end of the transaction and the order of operations within the transaction is therefore irrelevant ( as long as rules for primary keys and unique keys are obeyed , as described above ). for the purposes of this example , assume a relationship between a parent table parts ( partid , desc columns ) and order_detail ( which contains a partid column ). in this relationship , when an order_detail row is created or changed , a corresponding row must exist in the parts table , where a corresponding parent key parts . partid exists for the child key order_detail . part id . op transaction bucket operation 1 50 1 insert into order_detail ( orderid , partid , quantity ) values ( 5 ,” boat ”, 1 ) 2 100 2 insert into parts ( partid , desc ) values (“ car ”, “ 4 wheels ”) 3 100 1 insert into order_detail ( orderid , partid , quantity ) values ( 1 ,” car ”, 4 ) in the original transaction 100 , the parts parent row was properly inserted into the source database . however , at the end of the grouped transactions ( 50 and 100 ) at the target , without any modifications to the earlier rules , the bucket of inserts to order_detail would be executed prior to the bucket containing the insert to parts . this would violate the referential integrity constraint that a parts record precedes any related order_detail records . the following table describes the rules for ensuring referential integrity across buckets where there is a relationship between a parent and child . parent child operation operation execution comments insert insert parent if child key precedes the parent key , could violate first referential integrity rules . for example , if parts . partid = “ car ” does not exist , and order_detail . partid = “ car ” is inserted , the constraint is violated . insert update parent possible new value for parent key must precede the first possible creation of a new child key ( via an update from an old child key ). for example , parts . partid = “ plane ” could be inserted , followed by an update to the order_detail . where partid = “ car ” setting partid = “ plane ”. were these operations reversed , the new value of the order_detail row would have a child key value that did not have a corresponding parent key . insert delete doesn &# 39 ; t constraint on parent goes away . matter update insert parent possible new value in parent key must precede new first instance of child key . for example , parts . partid could be changed to “ jet ” before order_detail . partid is inserted with value of “ jet ”. but if the reverse order were applied , the part would not exist when the detail row was inserted . update update doesn &# 39 ; t the relationship where child . partid = parent . partid matter could be violated regardless of order . this scenario would therefore not be possible assuming the same constraints on the source database . for example , if parts . partid were updated from “ car ” to “ boat ” and the corresponding order_detail row is then updated from “ car ” to “ boat ”, this would not have been possible in the original database , regardless of which operation were applied first . in the instance where parts was updated first , this would cause the order_detail row to have no corresponding entry in parts for “ car ”; but in the opposite case , if order_detail of “ boat ” was changed to “ car ” first , there would be no corresponding entry in parts . partid ( yet ) were the value was “ car ”. therefore , if the source database has the same referential integrity constraints as the target , then an update to both tables is not possible where a parent key / child key relationship exists . update delete child first if parent key x changes to y before child key x is deleted , violates the constraint . when child key x is deleted , parent key x is free to change to y . delete insert doesn &# 39 ; t if a new value is inserted for the child key , the matter corresponding the parent key must already exist . if a row was deleted from the parent table , it must not contain a row that is needed by the child row . delete update child first if child changes from x to y , then parent key value x cannot be deleted until child changes . delete delete child first if parent x is deleted before child x , the child is incorrectly orphaned . the relationship between two buckets that have to be executed in a specific order is described as follows : the predecessor bucket is the bucket that must be executed first ; the successor bucket is the bucket that must be executed last . alternate embodiments of the invention use different mechanisms for tracking referential integrity . one technique is to track the actual child and parent key relationships in a way similar to tracking primary and unique keys described earlier . consider this example . op bucket operation parent key entry round 1 1 insert into order_detail parts . partid , “ boat ” 1 ( orderid , partid , quantity ) values ( 5 ,” boat ”, 1 ) 2 2 insert into parts parts . partid , “ car ” 1 ( partid , desc ) values (“ car ”, “ 4 wheels ”) 3 3 update order_detail set parts . partid , “ car ” 2 partid = “ car ” where orderid = ( successor to op 2 ) 1 and partid = “ boat ” 4 1 insert into order_detail parts . partid , “ car ” 2 ( orderid , partid , quantity ) values ( 6 ,” car ”, 2 ) ( successor to op 2 ) in this example , operation 1 can be executed immediately , since there are no parts rows anywhere with the same value for partid in the queue . however , not all of bucket 1 can be executed immediately , because the insertion of parts . partid value of “ car ” in operation 2 must precede operation 3 . the general technique is to track parent / child key relationships . a separate memory table ( e . g ., a hash table ), is used to link the same instance of each key in memory . when an existing key is found , the operation is marked as a successor operation and is linked to its predecessor operation . when deciding which operations to execute in which round , all operations that are not successor operations are executed first . this results in the execution sequence noted above . the main limitation with this method is that it requires the entire parent / child key to be present in all operations , even when the key values did not change . this is frequently not the case in update statements , in which only the primary key , plus any columns that changed , are always available to the system . the invention uses various techniques to combine rules into a proper execution sequence . multi - row operations must be sequenced properly to ensure both referential integrity rules and that any row changed more than once in the transaction ends up with the correct values . this may be accomplished in the following manner . the buckets created during the gathering of transaction operations are referred to collectively as queued buckets . the goal is to apply all queued operations held in the queued buckets . the basic method for applying all queued operations is to make a number of passes through the queued buckets to see what can be executed in each pass . if a given queued bucket has a predecessor bucket , it is not an immediate candidate for execution ( the predecessor bucket must be executed first ). all queued buckets without predecessor buckets are marked for execution . once a bucket is marked for execution , each operation is analyzed to see if any of its operations are successor row operations . if so , such operations are deferred until later , but the remainder of the bucket can be executed . once all buckets are analyzed , eligible buckets are submitted for execution . operations in eligible buckets that were not successor rows are executed via multi - row operations on the database . after operations complete , dependencies are analyzed again to see what remains . this can update both predecessor / successor bucket relationships , as well as predecessor / successor row relationships — if the predecessor is removed , the successor can be executed . these passes continue until all operations have been executed . it is also possible that predecessor / successor relationships cannot always be smoothly resolved . since the relationships are generalized here , circular relationships are possible . therefore , in the event that a given pass does not uncover any new operations for execution , a pass is made in which the oldest outstanding operation is executed , along with any subsequent operations in the same bucket that are older than the oldest operation in any predecessor buckets . for example : op bucket operation comments 1 1 insert into order_detail ( orderid , predecessor is partid , quantity ) values ( 1 ,” car ”, 4 ) bucket # 2 2 1 insert into order_detail ( orderid , predecessor is partid , quantity ) values ( 2 ,” blimp ”, 1 ) bucket # 2 3 2 update parts set partid = “ bike ” predecessor is where partid = “ scooter ” bucket # 3 4 3 delete from order_detail no predecessors where orderid = 1 according to the above rules , in the first round of execution , the eligible bucket is the bucket with no predecessors , bucket # 3 . however , bucket # 3 cannot be executed , because the only operation within it , operation # 3 , must be executed after operation # 1 ( otherwise , a record not found error will occur ). but if bucket # 3 is not executed , neither of the other buckets can be executed , and no progress can be made . when it is determine that no progress can be made , the system cycles through the buckets in order , starting with the one with the oldest outstanding operation first ( in this case , bucket 1 ). it then executes those operations in bucket 1 that precede all other operations ( operations 1 and 2 ), leaving the following : op bucket operation comments 3 2 update parts set partid = “ bike ” predecessor is where partid = “ scooter ” bucket # 3 4 3 delete from order_detail no predecessors where orderid = 1 at this point , the system falls back to the original mode of operation , selecting the bucket with no predecessors , # 3 . it applies # 3 , then applies # 1 , completing the queue . thus , the invention identifies dependencies between buckets or submission groups and designates priority buckets or submission groups for execution in the order specified by the designated priority . the multi - row operational techniques of the invention can be applied together with multi - threading techniques to achieve greater throughput . this is done by “ sharing ” a transaction across two or more threads , and then committing those threads under the same transaction umbrella . this enables apply operations in a transaction to execute in parallel with each other . one technique for doing this in many databases is supplied by the two phase commit capability . work in a transaction ( whether single row or multi - row ) is divided across threads by analyzing the dependencies in the transaction . successor rows and buckets cannot be submitted until predecessor rows and buckets have been submitted to each thread and are subsequently confirmed as complete . until a predecessor bucket ( referential integrity rule ) or row ( primary and unique key ordering rule ) has actually completed , the submission of corresponding successors is not guaranteed to be in proper order . at that point , the entire transaction can be committed . one example of how this can be accomplished is in the two phase commit protocol supported by many databases . in phase i , the individual threads perform their portion of database activity and subsequently perform a phase 1 commit ( also known as prepare ). once the master thread has detected successful prepares by each participating thread , it then issues a phase 2 commit ( also known as a final commit ). if an error is encountered on any row being changed in a multi - row operation , the replication system may perform custom error handling . one method is to rollback the entire transaction ( including changes performed by other buckets ) and replay individual operations in a single row at a time . this also enables those transactions in the larger group that had no inherent issues to be successfully submitted to the database and any problems to be isolated to the actual offending transaction . some operations cannot be submitted in multi - row or cannot be feasibly submitted ( such as inserting lobs into the database ). in these situations , the system can fallback to a row at a time mode and : perform all existing operations in the queue preceding the current operation , using the methods described above fallback to single operation at a time mode for the current operation resume the prior methods for subsequent operations when two databases are being replicated to each other , depending on database and application design , it is possible for conflicts to arise . for example , assume that a customer record exists in systems s and t , and that the current balance is $ 500 . subsequently , the customer withdraws $ 100 , leaving a balance of $ 400 on system s . nearly simultaneously , before the transaction from s is replicated to t , the customer withdraws an additional $ 100 , this time from system t ( this can occur for many reasons , such as adjacent terminals are connected to different systems ). the balance before any replication on each system is $ 400 , but after replication it is also $ 400 incorrectly — the updates applied by replication reflected an ending balance of $ 400 in each case . this is one common form of conflict . as a result , many replication systems employ conflict rules , such as the following : carry both the before value ($ 500 ) and the after value ($ 400 ) of balance to the target system lookup the row to which an update is being applied , and make sure that the before value from the original system matches the before value of the target system if the values don &# 39 ; t match , as in the example , declare a conflict and don &# 39 ; t replicate the data as is ( conflict resolution may involve a variety of prior art mechanisms ) in these cases , to maintain efficiency it may be necessary to employ multi - row operations and multi - threading for row operations that may be in conflict . in order to do so , the replication system includes any conflict detection columns in its update statement ; for example , if the statement without conflict detection is : note that the second statement would result in a “ record not found ” error in the above example , and reveal a possible conflict . operations executed in a single source database transaction may reach into the millions . at a point well before that it becomes inefficient and very memory intensive to queue rows , track key relationships and perform the other functions listed above . when a large transaction is encountered , it can be broken up into multiple queues . for example , if a transaction includes 2500 operations , the first 1000 operations might be submitted in queue # 1 , the second 1000 operations in queue # 2 , and the final 500 operations in queue # 3 . the techniques of the invention can be applied to target databases even when the source database is different ( e . g . oracle to sybase ), has a differing schema ( different table names and layouts ), only contains some of the rows and columns from the source ( overlapping data ), and / or may have performed transformation on the changing data stream . as with other logical replication systems , the invention requires that the source provide changes to the same row in their original order , and that row changes are presented in the correct order so that referential integrity constraints are not violated . those skilled in the art will appreciate that the invention can be used to build a low cost disaster recover grid . due to the relative efficiency of multi - row operations over single - row operations , the processing of the invention can be used to build lower cost backup systems . this is due to the database operation patterns of the source system , compared with the target . on many source transaction databases , the dominant activity is single - row operations executed by multiple cpus . when the transaction volumes are v and the number of single row operations supported by a single cpu is sr , then the number of cpus required by the system hosting the source database , excluding other requirements , is v / sr . the number of multi - row operations on the target system is known as mr . the processing requirement on the target system is therefore v / mr . as an example , if the number of single - row operations supported by a database configuration for a particular application is 2000 , and the number of multi - row operations supported by the same database configuration is 8000 , then theoretically , the target database requires only 25 % of the processing required by the source database ( mr / sr ). so at a minimum , data backup can be provided at a fraction of the cost using multi - row methods than can be achieved using single - row operations . however , this has limited usefulness , since after a switchover to the backup , the backup system will need all of the processing power that was available to the source system , because it is falling back to a single row operation mode . however , computer blade / grid technology combined with multi - row capabilities enables cost savings , as in the following example : the source databases can be located in the same or different locations the 10 target databases are hosted by a common grid of cpus ( same location ) assume that multi - row operations are 4 times more efficient than single - row operations , and that each source database requires 8 cpus to operate effectively the minimal number of target cpus therefore required are therefore 8 / 4 = 2 the total number of source cpus is 10 * 8 = 80 ( scpus ), the minimal number of target cpus is 10 * 2 = 20 ( tcpus ) an additional number of cpus is “ reserved ” for switchover to the backup ; per backup system brought online , the additional number of required cpus to support the backup application is 8 ( 10 on originating − 2 already allocated at the backup ) these 8 cpus are dynamically provisioned from the grid / blade cpu pool by the backup for dedicated use at the time of switchover when processing switches back to the primary system , the cpus are returned to the reserve pool therefore , if the goal of the backup grid is to protect all data , and support at most one switchover from primary to backup , this can be done at a total cost of 20 + 8 on the backup system , which is only 28 / 80 = 35 % of the cost of the source system this system becomes more efficient as the number of source databases grows , the requirement for simultaneously active backup databases is reduced , and the ratio of mr to sr increases . offloading processing , specifically reporting and similar query functions , to a secondary database can help : enable users to more freely access production data reduce the impact to production system users , improving response time enable the production system to support greater numbers of transactions ( due to the offloading of query tasks ) the mechanism for doing so often involves data replication , sometimes between heterogeneous databases and possibly involving data transformation . in this context , replication systems apply database operations that apply on the source to the target in close to real time . the reporting system must support two activities ( and incur two costs ), however : change replication of the source data into the target ( cost is r ) query activity by the users ( cost is q ) the total cost of such a system is q + r . assume that q requires 2 cpus , and single - row apply processing also requires 4 cpus , for a total cost of 6 cpus . however , if the efficiency of multi - row apply processing is 4 times that of single - row processing , the cost of r becomes 1 ( 4 / 4 ), and the total cost changes to 3 ( 2 + 1 ). an embodiment of the present invention relates to a computer storage product with a computer - readable medium having computer code thereon for performing various computer - implemented operations . the media and computer code may be those specially designed and constructed for the purposes of the present invention , or they may be of the kind well known and available to those having skill in the computer software arts . examples of computer - readable media include , but are not limited to : magnetic media such as hard disks , floppy disks , and magnetic tape ; optical media such as cd - roms and holographic devices ; magneto - optical media such as floptical disks ; and hardware devices that are specially configured to store and execute program code , such as application - specific integrated circuits (“ asics ”), programmable logic devices (“ plds ”) and rom and ram devices . examples of computer code include machine code , such as produced by a compiler , and files containing higher - level code that are executed by a computer using an interpreter . for example , an embodiment of the invention may be implemented using java , c ++, or other object - oriented programming language and development tools . another embodiment of the invention may be implemented in hardwired circuitry in place of , or in combination with , machine - executable software instructions . the foregoing description , for purposes of explanation , used specific nomenclature to provide a thorough understanding of the invention . however , it will be apparent to one skilled in the art that specific details are not required in order to practice the invention . thus , the foregoing descriptions of specific embodiments of the invention are presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed ; obviously , many modifications and variations are possible in view of the above teachings . the embodiments were chosen and described in order to best explain the principles of the invention and its practical applications , they thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . it is intended that the following claims and their equivalents define the scope of the invention . | 6 |
fig1 to 5 and 17 show a first embodiment of a passenger cabin 10 of an aircraft , such as , in particular , an airplane 12 , with a first embodiment of a seat arrangement 14 , which is formed by the seat assemblies 16 . the passenger cabin 10 has curved side walls 18 ( in this case with windows 20 ) and a side wall storage space 22 , which is housed in a side wall storage space delimitation 24 , which extends along the side wall 18 beneath the window 20 . in the example shown , the seat arrangement 14 has four seat rows , as shown , in particular , in fig1 , i . e ., a left outer row 26 ( window row ), a left center row 27 , a right center row 28 , as well as a right outer row 29 ( window row ). between the respective outer rows 26 , 29 and the center rows 27 , 28 , an aisle 30 , 31 is formed in each case . shown is a business class region of the passenger cabin 10 with business class seats that are intended for long distances . in order to form the individual seats 32 , there are seat assemblies 16 , which are formed in such a way that each seat 32 has its own access 34 from the closest aisle 30 , 31 . the construction of the respective seat assemblies 16 is described in more detail below . the seat assembly 16 has a seat structure 36 , in order to form the actual seat 32 , and a passenger space partition 38 , in order to spatially separate the passenger space 40 for the personal use of the passenger using the respective seat 32 . the seat structure 36 comprises a seat backrest 42 , on which is formed a backrest surface 44 , and a seat cushion element 46 having an upper side that forms the seat surface 48 . in each of the embodiments shown , the seat structure 36 has , in addition , a leg support element 50 , on which a leg support surface 52 is formed . in the embodiments shown , a head support 54 is also mounted on the seat backrest 42 ; furthermore , armrests 56 are provided . the seat structure 36 can be adjusted in at least three positions : i . e ., an access position 58 , a comfort position 60 , and a reclining position 62 . in order to move from the comfort position 60 into the access position 48 , the seat cushion element 46 is moved with its rearward portion under the seat backrest 42 . as a result , the useable seat surface 48 is variable . in the comfort position 60 a seat surface 48 that is lower than in the access position 58 by approximately 3 inches to 10 inches is provided . fig1 and 17 show the seat structures 36 in the comfort position 60 , whereas the access position 58 is shown with a dashed line . as can be seen , the access position 58 makes easy access possible , even if the access path 112 is narrow and is limited by the adjacent seat structures 36 . in the following reference is made once again to the fig1 to 15 and 17 , in order to explain in more detail the construction and the function of the seat assemblies . in the reclining position 62 the seat cushion element 46 is pushed even further forwards ; the leg support 50 is swung up ; and the seat backrest 42 is swung down into the space , which is made available by pushing away the seat cushion element 46 , underneath the seat backrest 42 , which is located in the access position 58 , so that a flat sleeping surface 64 having a diagonally measured length of approximately 195 cm is formed inside the passenger space 40 , which is separated from the passenger space partition 38 . the passenger space partition 38 completely surrounds the seat structure 36 on its back side 66 as well as on a side region 68 and on a frontal front end 72 , which forms a foot region 70 in the reclining position , and leaves open a wide access 76 on the other side region 74 . as can be seen , in particular , in fig1 to 5 , the front end 72 of the seat assemblies 16 in the outer rows 26 , 29 overlaps the side wall storage space 22 , where in this case a foot support element 78 , which rests on the side wall storage space delimitation 24 , is provided with a foot support surface 80 . when the seat structure 36 has been moved into the reclining position 62 , a region of the side wall storage space delimitation 24 , which projects into the outer contour of the passenger space partition 38 , is used as the underlay for the leg support element 50 . as can be seen , in particular , from fig1 , the seat assemblies 16 in the outer rows 26 , 29 are arranged so as to be tilted with their front end 72 towards the side walls 18 relative to the longitudinal direction 82 (= direction of flight ) of the passenger cabin 10 , in order to form an angle of 10 deg . to 40 deg ., in particular , approximately 28 . 4 deg . the outer contour 83 ( which can be seen in fig5 to 8 , 16 and 17 ) of the seat cover , which forms the passenger space partition 38 , has more or less the form of a parallelogram , which resemble the shape of a tear . the side region 68 without access ( base line of the parallelogram shape ) is formed , when seen in the plan view , more or less rectilinear and terminates at the front end 72 in a front projection 86 , which is arranged so as to be offset towards the side without access relative to the longitudinal center plane by means of the seat assembly 16 . from this front projection 86 the seat cover 84 extends in its outer contour with a bevel or an arch - shaped shoulder 88 downwards to the wide access 76 . this measure allows the foot end region 70 to be designed narrower than a rear end region 90 , which envelops the seat structure 36 in the access position 58 and the comfort position 60 . at the rear end region 90 the seat cover 84 extends then from the wide access 76 , which extends up to the armrests 56 , towards a bevel or taper more or less downwards as far as to a downwards pointing projection , which forms the rearward end 94 of the seat assembly 16 . this projection 92 is also arranged so as to be offset towards the side relative to the longitudinal center plane by means of the seat assembly 16 , but towards the side region 74 with access . from the rear projection 92 the seat cover 84 extends around the seat backrest 62 ( in the access position 58 or the comfort position 60 ) with a bevel 96 , which is tilted forwards and towards the side region 68 without access , or with a shoulder , which at a corner region terminates in turn in the side region 68 , which has no access and extends more or less in the frontal direction . as can be seen from fig1 to 5 and 17 , each of the front seat assemblies extends with this corner region 98 and with the rearward region of the side region 68 without access into the wide access 76 of the side region 74 of the respective adjacent rear seat assembly 16 . in this case the wider access 76 of the respective seat assembly 16 is restricted by the front seat assembly 16 to a narrow access 100 , which is defined by the rearward end of the wider access 76 , on the one hand , and the rear bevel 96 of the respective front seat assembly 16 . in the case of the seat structure 36 , which is in the access position 48 , the full width of this narrower access 100 can be used , because the seat cushion element 46 is moved out of the way of the narrower access 100 ( see , for example , fig1 ). if the seat structure 36 is in the comfort position 60 , then the seat cushion element 46 projects far into the narrow access 100 . the narrow access 100 can also be completely blocked by the seat cushion element 46 , which is in the comfort position , because a passenger can adjust the seat structure 36 into the access position 58 , in order to enter into the passenger space 40 and in order to leave the passenger space . fig6 to 12 show , in addition , a second embodiment of the seat assembly , which corresponds , except for the embodiment of the foot end region 70 , to the first embodiment explained above . as shown in fig6 to 12 , a personal storage space 102 is formed in the foot end region inside the seat cover 34 . a foot support element 78 with the foot support surface 80 is located under a storage space delimitation 104 , which is formed in the foot end region 70 . otherwise , the second embodiment of the seat structure corresponds to the first embodiment of the seat structure 16 that was explained above . fig1 to 16 show a second embodiment of a seat arrangement 106 , wherein in the embodiment shown in fig1 a total of eight rows of seat assemblies 16 are arranged side by side . in the adjacent seat rows the individual seat assemblies are arranged so as to be offset from each other in the longitudinal direction . here , too , the two aisles 30 , 31 are formed . a seat row 108 , which is formed close to the aisle , is provided in each case next to the aisles 30 , 31 ; and a seat row 110 , which is formed away from the aisle , is provided further away from the respective aisle 30 , 31 . the seat row 110 , which is formed away from the aisle , can be , for example , an outer row or a window row . one or two center rows can also be provided in the center region . in the embodiment of the seat arrangement 106 that is shown , the seat assemblies 16 of the seat rows 110 , which are formed away from the aisle , are formed , according to the first embodiment , whereas the seat assemblies 16 in the seat rows 108 , which are formed close to the aisle , are formed , according to the second embodiment , as shown , for example , in fig1 . as can be seen the best in fig1 , the seat assemblies 16 of the window rows are arranged tilted at about 5 deg . to 10 deg . with the foot end region 70 towards the respective side wall 18 . the seat assemblies 16 , which are located between the side wall 18 and the respective aisle 30 , 31 , in the seat rows 108 , which are formed close to the aisle , are tilted with their rearward ends 94 towards the respective wide access 76 of the adjacent seat assembly 16 at a smaller angle , for example 2 deg . to 5 deg . relative to the longitudinal direction 82 of the passenger cabin 10 ( corresponds to the direction of flight ). the seat assemblies 16 of at least the seat row 108 , which is formed close to the aisle , are arranged one behind the other in such a way that between the back side of the respective front seat assembly and the front side of the respective rear seat assembly an access path 112 is formed to the respective adjacent seat of the seat row 110 , which is formed away from the aisle . this access path 112 is defined by the rear bevel 96 of the front seat assembly 16 and the front shoulder 88 of the rear seat assembly 16 . in this case , too , the access path 112 for the passenger is cleared of obstructions by moving the seat cushion element 46 out of the comfort position 60 into the access position 46 . the seat arrangements 14 , 106 allow better utilization of the space in the passenger cabin 10 , so that , on the whole , more business class seats 32 can be obtained without loss of comfort for the respective passengers . in the case of the tilted arrangements of the seat assemblies 60 that are shown , it can be provided that the seat structures 36 inside the passenger space 40 , for example , for takeoff and landing , can be aligned so as to face in the direction of flight , i . e ., in the longitudinal direction 82 . this applies , in particular , to the seat structures 36 , which are moved into the access position 58 . one possible mechanism for adjusting the seat structure 36 is explained below with reference to fig1 to 21 . as can be seen from fig1 to 21 , the seat cushion element 46 can be hinged in a moveable manner in a longitudinal rail 114 , in order to move between the access position 58 and the comfort position 60 . the longitudinal rail 114 can be housed in the seat cover 84 of the passenger space partition 38 . in addition , a roller carriage 116 can be arranged in such a way that it can be moved towards the front and the rear . in the course of moving the seat structure 36 from the comfort position 60 into the reclining position 62 , the roller carriage can be moved forwards , in order to support the seat backrest 42 and / or the seat cushion element 46 and / or the leg support element 50 in the reclining position 62 . other mechanisms , instead of a roller carriage 160 , are also conceivable . it should be understood that this description is not intended to limit the invention . on the contrary , the exemplary embodiments are intended to cover alternatives , modifications and equivalents , which are included in the spirit and scope of the invention as defined by the appended claims . further , in the detailed description of the exemplary embodiments , numerous specific details are set forth in order to provide a comprehensive understanding of the claimed invention . however , one skilled in the art would understand that various embodiments may be practiced without such specific details . although the features and elements of the present exemplary embodiments are described in the embodiments in particular combinations , each feature or element can be used alone without the other features and elements of the embodiments or in various combinations with or without other features and elements disclosed herein . this written description uses examples of the subject matter disclosed to enable any person skilled in the art to practice the same , including making and using any devices or systems and performing any incorporated methods . the patentable scope of the subject matter is defined by the claims , and may include other examples that occur to those skilled in the art . such other examples are intended to be within the scope of the claims . 108 seat row formed close to the aisle ( aisle row ) 110 seat row formed away from the aisle ( for example , the window row or center row ) | 1 |
poly ( aryl ether ketones ) were prepared according to the route shown below : the first step in preparing these poly ( aryl ether ketones ) involves synthesis of an alkylated diphenol . any methyl ketone with at least eleven total carbon atoms could be condensed with phenol to yield the desired monomer . addition of anhydrous hydrogen bromide and a sulfur - containing catalyst , such as mercaptoacetic acid , along with anhydrous hydrogen chloride could be used to produce the desired bisphenol . the modified bisphenol is shown below : the next step is to prepare the activated bisfluorophenyl monomer , as shown below : this compound , 6hdca , and its fluorinated analog , 6fdca , were reacted with thionyl chloride with dmf as a catalyst to produce the corresponding chloroformylphenyl compounds in good yields . in the naming of the polymers , the c11 and c17 refer to the length of the carbon chain attached between the ether linkages , and the 6f refers to the hexafluoroisopropylidene group located between the ketone linkages . the polymers designated with an af in the name indicate a random terpolymer made from bis - af and the alkylated bisphenol present in a one to one ratio ( i . e . af : c11 ( 1 : 1 )). all the peks synthesized were soluble in common organic solvents such as chloroform and tetrahydrofuran as well as polar aprotic solvents , such as n , n - dimethylformamide , n , n - dimethylacetamide and dimethyl sulfoxide . the inherent viscosities for the polymer series ranged from 0 . 56 - 1 . 04 dl / g , and all were measured at a concentration of 0 . 25 g / dl at 25 ° c . in chloroform . all polymers precipitated as white fibrous materials . yields for the polymers ranged from 80 - 93 % with the lowest being for af : c17 - pek . all elemental analyses were within 0 . 6 % of theoretical . clear , colorless , tough , creasable films were cast from chloroform ( 15 % w / v ). these films were use to determine dielectric constants as well as infrared spectra . all the peks were subjected to thermogravimetric analysis ( tga ) in both air and nitrogen . thermal stabilities , taken at a 10 % weight loss with a heating rate of 20 ° c ./ min ., ranged from 402 ° c .- 479 ° c . in air and 450 ° c .- 494 ° c . in nitrogen . char yield (%) were determined in nitrogen at 800 ° c . and ranged from 30 - 50 percent . all the peks were also analyzed by differential scanning calorimetry ( dsc ) in nitrogen . glass transition temperatures ( tg ) were taken as the midpoint of the step transition during the second heating and ranged from 78 ° c . for 6fc17 to 143 ° c . for af : c11 ( 1 : 1 ). in a 100 - ml , three - neck , round - bottom flask , equipped with a magnetic stirrer , condenser , rubber stopper with a glass tube and an argon outlet connected to a hcl trap , was placed a mixture of the ketone ( 5 . 0000 g ( 0 . 0252 mol of 2 - tridecanone , 0 . 0177 mol of 2 - nonadecanone )), a ten molar excess of phenol and one milliliter of mercaptoacetic acid . the mixture was then heated to 40 ° c . to induce melting ; then a mixture of hcl : hbr ( 2 : 1 ) gas was bubbled through the solution using argon as a carrier gas . the hcl and hbr gases were produced in a separate flask , equipped with a magnetic stir bar , by dropwise addition of concentrated sulfuric acid onto a mixture of nacl and kbr , 4 g each . after heating at 40 ° c . for a period of time , three hours for bis - c17 and 24 hours for bis c - 11 , the bisphenol precipitated out of solution . the resulting bisphenol was washed with water until the excess phenol had been removed . the bisphenol was collected , dried over p 2 o 5 for 12 hours and then recrystallized from hexane to a constant melting point , 75 - 77 ° c . for bis - c11 and 83 . 5 - 85 ° c . for bis - c17 . a one - liter , round - bottom flask was charged with 200 grams ( 0 . 512 mol ) of 2 , 2 - bis ( 4 - carboxyphenyl ) hexafluoropropane , 400 ml of thionyl chloride and five drops of dmf as a reaction catalyst . the reaction mixture was heated at reflux for two hours at which time a clear , yellow solution was formed . excess thionyl chloride was vacuum - distilled from the reaction mixture . the solid residue was dissolved in 200 ml of dry hexane at reflux . the hot solution was suction - filtered to yield a clear , colorless filtrate that was allowed to cool to complete crystallization . a second recrystallization from dry hexane yielded 210 g ( 95 %) of 2 , 2 - bis ( 4 - chloroformylphenyl ) hexafluoropropane ( 6 fdac ) as clear , colorless crystals , m . p . 96 - 97 ° c . a three - liter , three - neck , round - bottom flask was fitted with a reflux condenser , hcl gas trap and argon purge . to the flask was added 210 g of 2 , 2 - bis ( 4 - chloroformylphenyl ) hexafluoropropane and 900 ml of fluorobenzene . to the solution was added 160 g ( 1 . 20 mol ) of anhydrous aluminum chloride in small portions . the reaction was heated at 50 ° c . to 60 ° c . until hcl gas evolution ceased . the solution was allowed to cool , separated into two halves , and each half was poured into 3 . 5 l of 1m hcl . the organic layers were collected , combined and concentrated to an oily residue . one liter of absolute alcohol was added to the residue with stirring to give a crystalline solid . the solid was collected and recrystallized twice from isopropyl alcohol and then treated with charcoal in chloroform at reflux . the mixture was filtered while hot , and the filtrate was poured into ice - cold hexane ( three times the volume of chloroform used ) to precipitate the 6fbfp . the solid was collected , dried and treated with charcoal in acetone . the mixture was filtered hot , and the 6fbfp was recrystallized from acetone that was taken to a water cloud point to give approximately 160 g ( 0 . 292 mol ) of 2 , 2 - bis [ 4 -( 4 - fluorobenzoyl ) phenyl ] hexafluoropropane as white needle crystals with a melting point of 142 - 143 ° c . a 250 - ml , round - bottom flask was purged with argon and filled with 15 . 8653 g ( 0 . 0494 mol ) of 2 , 2 - bis -( 4 - chloroformylphenyl ) propane ( 6hdac ) and 100 ml of fluorobenzene . to this solution was added with stirring 18 . 5 grams of anhydrous aluminum chloride in small portions over a 5 - minute period . a small amount of heat was given off as evidenced by a slight rise in the temperature of the solution . the yellow reaction mixture was heated to 50 - 60 ° c . for 1 . 5 hours . the reaction progress was monitored by observing the hcl gas adsorption in a water trap . the reaction mixture was allowed to cool and then poured slowly into 700 ml of stirred , ice - cold 1m hcl . the lower organic layer was collected and concentrated to a light - red solid under reduced pressure . the solid was digested in 100 ml of ethanol for 12 hours and the resulting white solid was collected by filtration . recrystallization from isopropyl alcohol yielded 15 . 8 g ( 73 %) of 2 , 2 - bis -[ 4 -( 4 - fluorobenzoyl ) phenyl ] propane ( 6hbfp ), m . p . 167 - 168 ° c . a 100 - ml , three - neck , round - bottom flask was equipped with a dean - stark trap , a reflux condenser , a mineral oil bubbler , a magnetic stir bar and an argon source . to the flask was added bisphenol , anhydrous potassium carbonate ( 7 . 30 mmol ), 45 ml of toluene and 15 ml of n , n - dimethylacetamide ( dmac ). the atmospheric oxygen was removed under vacuum , and the flask was then purged with argon . this was done three times . after removal of the oxygen , the reaction mixture was heated at reflux to allow filling of the dean - stark trap to overflow in order to observe water from the reaction azeotroping into the trap with toluene . after three hours the dean - stark trap was drained , and excess toluene was allowed to distill over . the reaction flask was allowed to cool to 90 ° c . and then the activated bisfluoro monomer was added in crystalline form . the sides of the reaction flask were rinsed with solution from the flask . the polymerization was continued at reflux for 16 hours and then the heat source was removed . upon cooling , the polymer solution was diluted with 30 ml of dmac and filtered through a coarse - fritted - glass funnel to remove reaction salts . the clear polymer solution was precipitated by pouring the polymer solution slowly down the side of a beaker into 500 ml of stirred water . the precipitate was collected , washed with methanol and dried in vacuo at 50 ° c . for 12 hours . each of the polymerizations described in examples 5 - 9 followed this general procedure with specific amounts of reactants , yields and analytical results noted . 0 . 3360 g ( 0 . 911 mmol ) of bis - c11 , 0 . 3065 g ( 0 . 911 mmol ) of bis - af and 1 . 0000 g ( 1 . 823 mmol ) of 6fbfp ; af - c17 ( 1 : 1 )- poly ( aryl ether ketone ): polymerization of 2 , 2 - bis -( 4 - hydroxyphenyl ) hexafluoropropane ( bis - af ), bis - c17 and 6fbfp 0 . 4125 g ( 0 . 911 mmol ) of bis - c17 , 0 . 3063 g ( 0 . 911 mmol ) of bis - af and 1 . 0000 g ( 1 . 823 mmol ) of 6fbfp ; the foregoing examples are given to illustrate the principle of the invention and are not intended to serve as limitations thereof . there are many variations and modifications of the invention that will be readily apparent to those skilled in the art in light of the above teachings . it is therefore understood that , within the scope of the pending claims , the invention may be practiced other than as specifically described herein . | 2 |
an industrial control network , such as a can , usually comprises a physical network comprising a number of nodes with one central control unit , for example , a number of sensors , a number of actuators and a number of pid controllers , which jointly control a production process or the climate in a building , for example . the sensors can for example measure the temperature , the pressure , the light intensity , the position , the chemical composition and the like of a process . the actuators , which are capable of influencing process parameters , may for example comprise heating elements , valves , cocks , servomotors and the like . the pid controllers thereby determine the degree to which and the manner in which the actuators respond to the signals from the sensors . in a conventional control system , all signals are passed through the central control unit , which thus controls the entire data traffic in the network . in the case of complex control networks , a high degree of expertise on the part of the operator is required for controlling such a process , tracing and remedying trouble and making changes in the network configuration . the can network that is described herein has a decentralized control , wherein the tasks of the central control unit have been minimized . the invention even makes it possible for a network to function without making use of a central control unit . one feature of the objects in the present network is that each object has its own intelligence , that is , hardware and software , to carry out particular tasks independently , so that the load on the control unit is reduced , less data traffic on the network is required , the control process becomes more transparent and a possibility is created to exchange objects in the network for objects of a different type without adjustments in the central control being required . the intelligence of the objects is contained in standard interface modules , to which the ( conventional ) objects are linked . the format of the information that is exchanged between the various objects is standardized thereby , so that it is not necessary to take the peculiarities of the various types of objects into account . one aspect of said decentralized control is that the sensors are so arranged that each time they detect a relevant change , they send a message comprising the new value they have measured on the network on their own accord , or send such a message at regular intervals . the actuators in the network are arranged to filter from said messages those messages that contain information that is relevant to their functioning . this process does not require any interference from a central processing unit , therefore . what is required , however , is that a setting be made , only once or each time a change occurs , if necessary , which messages an object is to send at which point in time , and which objects must listen to those messages . said setting can take place on the interface modules of the objects themselves , but it can also be done by sending messages to said objects . in particular it can take place by setting the various connections graphically by means of connecting lines between the outputs and the inputs of objects in a graphic representation on a display screen of the system to be controlled , which is done on a computer that is connected to the network , after which the control unit sends the required messages with instructions to the various objects on the basis of said graphic representation . furthermore , the control method described herein provides a possibility of sending messages to objects without stating an explicit address in the form of a node id . also this reduces the load on the central control unit as well as the amount of data traffic on the network , because it is also possible to send a message to a particular group of objects in one go . to that end , the storage means of each object include a record comprising a number of fields , which contain object attributes . object attributes comprise both functional attributes and location attributes , as well as status information of the object . such a record may look as follows , for example : this record shows that the object is a lighting object , which belongs to the group of “ emergency provisions ” and which is located in the area “ second floor ” at location “ room 2 ”. the object has a variable called “ status ”, which currently has value “ on ”. an object may have more than one variable for that matter . in actual practice , the values of the fields will for example be represented by a character which takes up 1 byte , for example , in order to minimize the data traffic in the network . in this example , however , complete and meaningful indications are used for the sake of clarity . when another object in the network wants to know the status of , for example , all emergency provisions on the second floor , it will send a message containing the following query on the network : in response thereto , each object that meets these criteria will send a message containing its current record to the querying object , so that the following result could be obtained : when the emergency lighting in room 3 on the second floor must be turned off , for example , this can be done by sending a message with the following contents over the network : in this example , the first three fields “ area ”, “ location ”, and “ type of object ” jointly form a unique key , and thus a unique address for the object in question . in principle the need to allocate unique id &# 39 ; s to the objects is obviated when this method is used . the number of fields can be extended as required for that matter , so as to increase the selection possibilities or extend the number of objects in the network . generally , the message will be accepted by several objects when one or more of the fields of a message contain the wild card “ all ”. in this manner it is for example possible within a control network to regulate the temperature in various ovens , the velocity of various conveyor belts or the rotational speed of several drive shafts by means of one message , whereby the object that sends the message does not need to know how many and which ovens , conveyor belts or drive shafts form part of the network . furthermore this makes it possible to add or remove objects during operation , that is , without interrupting the process , without this having consequences for the control . furthermore it is simple to change or extend the can network that is described herein , or to couple two such networks ( think for example of trains , truck / trailer combinations ), because node id &# 39 ; s are set automatically so that this does not need to be done manually . this takes place in the following manner . when a node , which may be an object , must be given a new id , for example because it is newly introduced into the network , or because two networks have been coupled and conflicting id &# 39 ; s occur , the interface module of the node will generate an id , which is derived from , for example , the last digits of its serial number , so as to prevent as much as possible different nodes generating the same id . the node will then send an id request comprising said id on the network , which id request is addressed to all nodes in the network . in can terms , such a message is an “ rtr message ”, that is , a short message which , in the main , only consists of said id and an rtr bit . in this case the rtr bit indicates that this is an id request . the advantage of rtr messages is that several nodes are capable of sending send such messages simultaneously , and are allowed to do so . in response to said id request , a node which already has the aforesaid id will send a message with an id ban for the id in question to the requesting node , whereupon the requesting node will generate a new id and make a new attempt . when no id ban has been received after a predetermined period of time , the node will send an id confirmation message containing a device identification ( for example its serial number ) on the network , it will adopt the id as its own unique id and store said id in its permanent storage . the id may be stored in a volatile storage , but in that case the method described herein must be repeated every time the system is started . an id ban and an id confirmation message have the same format for that matter ( at least comprising the id and the device identification ), and they are indistinguishable from each other . preferably , the waiting period until the id confirmation message is sent varies with each node , because otherwise there would be a risk of two nodes trying to send the same id confirmation message simultaneously . this can be realised , for example , by making said waiting period dependent on at least part of the device identification ( the serial number ) of the object in question , or to use a random waiting period . since different waiting periods are used , one of the two nodes will obtain the id by being the first to send an id ban ( in the form of an id confirmation message ), as a result of which the other node will be forced to make a new attempt . when two nodes , in spite of the above - described procedure , simultaneously try to send an id confirmation message containing the same id ( but with a different device identification , of course ), the can network protocol will not allow this ( can only allows short rtr messages to be sent simultaneously ). the two nodes will then continue to present the message , albeit without any result . according to the invention , this process is stopped after a number of failed attempts , for example after five attempts , after which the two nodes will assume that the id is not available , whereupon they will send a new id request containing a new id . as an additional safeguard , a first node , upon detecting an id confirmation message containing its own id but a different device identification , will assume that its id is no longer valid and send a new id request . the second node , from which the id confirmation message originated , will do the same in response to the id confirmation message from the first node , so that neither one of the two nodes will retain the id in question . other nodes , for example the central control unit , can keep a list of the nodes that are present in the network and their id &# 39 ; s on the basis of the confirmation messages . although the present invention has been described herein by means of an exemplary embodiment , several variations thereto are possible , and consequently the present description must not be construed to be limitative in any way as regards the scope of the rights being applied for . | 6 |
in describing the preferred embodiment of the present invention , reference will be made herein to fig3 - 8 of the drawings in which like numerals refer to like features of the invention . to improve contrast in an image during exposure of the resist layer in a lithographic process when using a high numerical aperture imaging tool , the present invention employs reflective interference of transverse magnetic ( tm ) waves that have z components which are oppositely oriented to those of the incoming image waves , and selection of a resist layer thickness and photosensitivity location that are appropriately matched to the z interference pattern , above a layer reflective to the radiation employed in the imaging tool . in fig3 , there is shown the passage of high incident angle light waves through resist layer 50 . incident waves 46 a and 46 ′ a enter the resist layer at opposite angles θ , and are refracted as waves 46 c , 46 ′ c , respectively . the tm polarized electric field vectors from these incident light rays are shown by arrows 46 b . and 46 ′ b . during half the optical cycle , electric fields 46 d and 46 ′ d on the refracted waves are oriented at an angle with a partially downward direction within the resist layer , i . e . a downward pointing component along the z axis . in accordance with the present invention , fig3 shows a configuration that provides between resist layer 50 and wafer substrate 42 a layer 60 which is reflective to the light utilized in the imaging system . it should be noted that fig3 does not show a preferred rendering of the preferred embodiment of the invention even though it includes reflective layer 60 , since resist layer 50 is of conventional form . typically , for radiation of wavelength of about 157 nm to 365 nm , the invention employs a reflective system of layers that may comprise an aluminum film of about 100 nm thickness . each light ray 46 c , 46 ′ c . is reflected off of reflective film 60 , producing reflected waves 46 e and 46 ′ e , respectively . these reflected rays have tm vectors 46 f and 46 ′ f , respectively , which are oriented at an angle in a generally upward direction during the half of the optical cycle in which fields 46 d and 46 ′ d are oriented generally downward . at the z position shown , the vector sum of the 4 vectors 46 d , 46 ′ d , 46 f , and 46 ′ f is almost zero , because of the geometrical orientation of these fields and the high reflectivity of the reflective layer . in other words , destructive interference is almost complete at the z position shown , because the z components of the reflected waves 46 e and 46 ′ e that have been produced by the reflective layer are oppositely oriented to the z components of the incident image waves 46 c and 46 ′ c , and have almost equal magnitude . more generally , as a result of the interference of tm rays 46 d , 46 ′ d with 46 f , 46 ′ f , an interference pattern is formed in the z - direction , i . e ., through the thickness of resist layer 50 . while a nearly complete destructive interference can in principle be achieved , perfect constructive interference is not achieved in all four tm waves shown . in this configuration , vector interference reduces peak dose in tm polarization compared to te polarization , but within certain planes does not reduce tm contrast . however , even though , as in the prior art , constructive interference is incomplete , the new configuration usually causes overall tm dose to increase within the planes of high tm contrast , since the resist is now exposed by both incident and reflected waves . a dose variation in the z - direction occurs in both te and tm polarizations . planes of maximum tm dose are also planes of maximum tm contrast . fig4 shows the interference pattern created by such high incident angle tm waves through the thickness of resist layer 50 , as a result of reflection from reflective film 60 . the z - direction is through the thickness of the resist layer ( shown having a thickness of 250 nm ) and the x - and y - direction is in the plane of the resist layer . in this figure , nominally dark line 52 is formed at x - position of approximately 0 , and bright space 54 is formed at x - position of approximately − 80 nm . the interference patterns are also shown for additional dark lines ( not identified ) at x - positions of approximately + 160 nm and − 160 nm , and for a bright space ( not identified ) at x - position of approximately + 80 nm . the dark lines and bright spaces continue to repeat outside the boundaries of the figure . along dark line 52 , the lighter regions 80 that are spaced apart in the z - direction are regions of less contrast ( where the line would be seen to be less dark ), separated by spaced - apart regions where the contrast is at a maximum ( where the line would be seen to be darker ). for example dark line 52 has less contrast regions 80 at z - positions of approximately 13 nm , 88 nm , 163 nm and 238 nm , and has regions of maximum contrast at heights of approximately 50 nm , 125 nm , and 200 nm . for bright line 54 , the high intensity regions 90 with higher intensity centers 92 , spaced apart in the z - direction , are seen as corresponding to the high contrast regions of dark line 52 . fig5 shows the interference patterns for both tm and te polarized waves produced in a resist layer 50 of conventional thickness c by a reflective layer . as will now be explained , fig5 can also be understood as including a rendition of the invention that has been annotated with other features to help explain the functioning of the invention . the resist layer of conventional thickness 50 has tm interference pattern 101 with low contrast region 80 along with high intensity region 90 and region 92 of even higher intensity , and te interference pattern 111 with comparable high intensity regions 90 ′ and 92 ′, but with uniformly high contrast . to exploit the complete destructive interference obtained with underlying reflective layer 60 , in accordance with the present invention the portion of the resist that would have the highest tm contrast in the z - direction thickness is utilized for the resist layer to be employed on the wafer . in other words , a resist layer of less than conventional thickness is positioned at a desired location above reflective layer 60 , and with a suitable thickness , so that it includes the interference pattern portions having higher contrast , and excludes at least some , preferably most , of those interference pattern portions that would have a lower contrast . in general , one matches the location and thickness of the resist photosensitivity region or regions with the high contrast regions of the interference pattern along z . a preferred resist layer selection is shown in fig5 , in which a thin imaging layer photosensitive portion 50 ′ having thickness a at a distance b above reflective layer 60 is selected as the resist layer thickness and location to be utilized . photosensitive resist layer 50 ′ is seen as including the tm interference portion 102 having the highest contrast from tm interference pattern 101 , and excludes those portions of the interference pattern that have lesser tm contrast . while the thickness a of photosensitive resist layer 50 ′ is shown encompassing only a single region of high tm contrast in the z - direction , multiple regions of high tm contrast in the z - direction may be used if the upper and lower adjacent regions of lesser contrast are excluded . to ensure the proper location of the photosensitive resist layer 50 ′ with respect to reflective layer 60 , a spacer layer 70 of thickness b may be employed . the z - direction thickness of photosensitive resist layer 50 ′ is typically thinner than normally used , to confine the resist exposure to only a single region of unreversed tm contrast within what would normally be the full interference pattern in a thicker resist layer 50 . the selected tm interference pattern 102 is shifted vertically relative to the te interference pattern portion 112 in photosensitive resist layer 50 ′, due to differential te / tm phase shift from the reflective layer on the substrate in the presence of the spacer medium 70 . the photosensitive resist layer 50 ′ may also be selected by its location to exclude part of the te bright fringe ( which is actually brighter than the tm intensity , but plotted here with an independent brightness scale ), in order to approximately match the collected te dose with the tm dose . since the system then provides substantially equal doses in te and tm polarization as well as substantially equal contrasts , it may be used with unpolarized light , and is not vulnerable to the polarization sensitivities described above . together , the spacer layer and reflective film comprise a reflective layer system . other highly reflective layer combinations can be used , so long as the reflective layer system is thin enough to remain substantially within the folded depth of focus of the imaging system , where the tm phase shift positions the photosensitive resist portion near a plane of high tm contrast , and where preferably the te / tm differential phase shift approximately balances the te and tm doses within the photosensitive region . usually the last of these design objectives is less important than the other two . the te and tm interference patterns of fig5 are only schematic in such embodiments , but a qualitatively very similar analysis applies in general as far as the interfering waves within the photosensitive regions are concerned . a quantitative analysis can be carried out using the equations provided by rosenbluth et al . in “ fast calculation of images for high numerical aperture lithography ,” spie v . 5377 - optical microlithography xvii , ( 2004 ): p . 615 . using eq . 11 or eq . 19 of that reference , one can show that with the proper spacer thickness the tm contrast ratio ( cr ) is given by here θ ″ is the angle of propagation inside the resist film , and r is defined as r is essentially the reflectivity of the reflective film stack when placed within the wafer film stack . v p and u p are the amplitudes of the up - traveling and down - traveling tm waves , respectively , per unit incident wave amplitude . v p and u p may be calculated using standard thin film methods , as explained in rosenbluth et al . the value r is particularly easy to calculate when the resist layer can be approximated as a dielectric ; in that case one can simply ignore all films above the resist layer , and treat the incident medium as a semi - infinite film of index equal to the resist index . cr in these equations is defined as : where i max is the intensity of a bright space , and i min the intensity of a dark line , under standard lithographic conditions for producing two - beam line / space images . when the spacer thickness is not optimal the phase of r changes , and cr may be calculated from : in conventional resist systems r is fairly small , and thus cr ≈ 1 − 2 * sin 2 θ ″ conventionally ; clearly cr can be degraded quite substantially when the propagation angle inside the resist is large . on the other hand , if | r |≈ 1 , cr ≈ 1 when φ = 0 . moreover , the difference between the 2 | r | factor appearing in the denominator of the above cr equation and the 1 +| r | 2 expression in the numerator will decrease quadratically as | r | approaches 1 , which means that very substantial contrast improvement is possible even when | r | is only moderately large . the photosensitive resist layer used in accordance with the present invention preferably has a thickness less than about where k 1 is the half - pitch k 1 - factor of the process , and n is the refractive index of the resist . more preferably , the photosensitive resist layer thickness is less than about half this amount , in the range of about 15 to 30 nm . for clarity the components of the invention in the fig5 embodiment are shown in isolation in fig6 , with the te and tm interference patterns removed . in a preferred embodiment , the photosensitive resist layer has as high an index of refraction as possible , where n is preferably greater than 1 . 85 , and has hardmask properties for etch resistance when used in a thin layer in accordance with the present invention . suitable materials showing sufficient etch resistance may be chosen from photoresist systems containing inorganic moities . typical examples of resist systems suitable for 193 nm lithography where the inorganic moiety is silicon are described in u . s . pat . nos . 6 , 770 , 419 , 6 , 653 , 048 and 6 , 444 , 408 . additional examples of resist systems where the inorganic moiety is ferrocene ( iron ), hafnium based , or titanium based , are described in u . s . pat . no . 6 , 171 , 757 . the disclosures of these patents are hereby incorporated by reference . although the inorganic moieties used in this invention may exhibit high absorbance at 193 nm lithography a combination between silicon and inorganic moities such as titanium , hafnium or ferrocene maybe used to achieve the appropriate index as well as transparency suitable for the thin photosensitive layers employed in this invention . the preferred spacer used in the present invention is an organic copolymer , such as an acrylate or polystyrene , with a refractive index of about 1 . 7 . when the resist film has a high index , such as above 1 . 85 . for very high index resist , and spacer indices of about 1 . 7 , the optimum thickness of the spacer can be about 64 nm , and can preferably be chosen in the range of about 64 ± 5 nm . in general , the appropriate spacer thickness for a given set of film indices can be determined either by simulation , using for example one of the commercially available lithography simulation programs , or experimentally , by spinning a spacer with a graded thickness onto a test wafer , and then determining the optimal thickness by comparing the performance in different regions of the test wafer , in particular by finding the region and associated spacer thickness that minimizes the difference between te and tm doses . a resist layer may be photosensitive in its top portion , and it may be formed or treated in such a way that its remaining portion can be etched through after the exposed areas in the photosensitive portion have been developed away , supposing first that the resist is a positive - tone resist . this is also possible for negative - tone resists , except that with negative - tone resists it is the unexposed portions of the photosensitive portion that are developed away . alternatively , a different underlayer film may be etched through after developing an image in an upper photosensitive resist layer . the developed region and the etched region can then serve as a stencil to transfer the pattern into a constituent film of the integrated circuit that is undergoing fabrication . in this context , the photosensitive region includes only those portions of the resist that both respond to the exposing image , and that respond to the post - exposure developer , since it is only the developed regions whose pattern is transferred into the integrated circuit . in many cases the resist layer is heated after being exposed but before being developed . when the thickness of the photosensitive region is in the range of 15 nm to 30 nm , this heating step smoothes the exposing profile across this thickness , rendering it reasonably uniform over the z range . resist refractive indices of about 1 . 7 can be achieved when the inorganic moiety is silicon , and this chemistry is very well developed . a suitable spacer index for such a resist is n = 1 . 6 , and the thickness of the spacer can be about 77 ± 5 nm . fig7 shows graphical representations of a test of this configuration of the invention made by simulating the exposure of a wafer to a line / space pattern of 90 nm pitch produced by an alternating phase shifting mask using a conventional light source with poles of radius 0 . 1 positioned such that the +/− 1 st orders are centered at a pupil coordinate of 0 . 89 ( expressed as a fraction of the pupil radius ), a wavelength of 193 nm , an na of 1 . 2 , and a coupling index of refraction of 1 . 43 . this corresponds to a k 1 factor of 0 . 28 for the half - pitch . the wafer substrate has a reflective layer of aluminum of 100 nm thickness , a spacer layer of 77 nm thickness and refractive index of 1 . 6 , and a resist layer of 20nm thickness and refractive index of 1 . 7 . the plotted exposure profile is the average over the 20 nm z range . when compared to a conventional resist layer of 160 nm thickness and refractive index of 1 . 7 , without the reflective layer and spacer , the present invention is seen to produce much higher tm contrast than the conventional resist and wafer combination , and to substantially match te and tm doses . focus for the conventional system has been set according to a criterion of maximizing tm contrast , but nonetheless the tm contrast achieved by the conventional system is very poor . the conventional system could instead be adjusted for a better te depth of focus , but in that case the tm contrast would be even worse . at the relatively steep propagation angles entailed by k 1 = 0 . 28 imaging , the invention achieves a tm phase shift from the reflective layer system that provides high tm contrast in the resist layer , and a differential te / tm phase shift that substantially balances the te and tm doses . as is standard practice in the lithography art , the source parameters are optimized around the most aggressive k 1 features present , in this case the k 1 = 0 . 28 features . this optimization improves depth of focus , a requirement that the invention eases in one respect , due to the thin resist layer used , but makes more stringent in another respect , since the reflected waves must remain reasonably well focused . fig7 shows that , overall , the invention provides a depth of focus that is acceptable for such an aggressive k 1 factor , and in particular a better depth of focus than the conventional system under conditions where non - negligible tm contrast is required . all of these imaging requirements tend to be more easily achieved at the smaller propagation angles that are associated with larger k 1 factors . however , one must also verify that process parameters optimized for the most aggressive k 1 features will perform adequately for any features with larger k 1 factor that may be present , even though these parameters are not optimized for the larger k 1 features . fig8 illustrates that the invention achieves this , using an example where the invention is applied to a so - called “ dfm design ”, in which moderate - pitch features are present at twice the pitch of the most aggressive k 1 features . thus , the present invention provides improved contrast of the image of a feature projected onto the resist layer in a lithographic process when using a high numerical aperture imaging tool . the present invention restores transverse magnetic wave contrast in lithographic processing by providing a film stack that reflects additional interfering waves into the image in order to enable full destructive interference , and that achieves better uniformity with respect to other polarization dependencies such as te versus tm dose , and permits the use of unpolarized light . if stray light increases from the reflective layer system , the effect may be ameliorated by adding an absorbing topcoat , because the image will only be attenuated by the transmission of this topcoat , while reflected stray light will be reduced by the square of the topcoat transmission . alternatively , the effect of stray light may be corrected using other known flare correction methods that have recently been developed , for example those described in us20050091634a1 , us20050091631a1 , and us20050091014a1 . while the present invention has been particularly described , in conjunction with a specific preferred embodiment , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the foregoing description . it is therefore contemplated that the appended claims will embrace any such alternatives , modifications and variations as falling within the true scope and spirit of the present invention . | 6 |
public water supplies as well as private water supplies , for example , water from wells , contain trace levels of various heavy metal ion impurities , including , for example , fe +++ , mn +++ and cu ++ . iron and copper pipe present in homes and commercial buildings also places heavy metal ions into the water supply . over time the presence of such ions causes staining of reservoirs in the home and in commercial buildings , especially porcelain reservoirs such as toilet bowls , urinals , bathtubs , sinks , basins and the like . typically , from about 0 . 5 to about 500 ppm of these heavy metal ions in the water supply is sufficient to cause staining . in one type of cleaner for such reservoirs , an aqueous solution of an active cleaning constituent or mixture of such constituents , typically anionic or nonionic surfactants , is employed . these constituents clean the subject reservoir by solubilizing soil deposits . by and large , this type of cleaning solution is not effective in preventing staining by the offending heavy metal ions . another type of cleaning composition incorporates acids , e . g ., hydrochloric acid , which ionize in solution , and which are effective in removing and / or preventing staining . disadvantageously , most surfactants are not compatible with such acid constituent , and the stain - removing benefit of the acid cannot be combined with the cleaning power of the surfactant . it has been found that certain polyester compounds are useful in retarding staining , when used in cleaning compositions of the first mentioned type , containing a surfactant or blend of surfactants . the polyester polymer of the present invention are water - dissipatible , meltable polyesters of the type disclosed in u . s . pat . nos . 3 , 779 , 993 and 3 , 734 , 874 each to kibler et al ; 4 , 335 , 220 to coney ; 4 , 223 , 196 to sublett , and 4 , 304 , 900 and 4 , 304 , 901 each to o &# 39 ; neill , all of these patents being incorporated herein by reference thereto . accordingly , the reaction product of polymers suitable for use with the present invention may be the reaction product of ( a ) a difunctional dicarboxylic acid , ( b ) a difunctional sulfomonomer , and ( c ) a glycol or a mixture of glycol and diamine , the polymer having an inherent viscosity ( as defined in u . s . pat . no . 4 , 335 , 220 to coney ) of at least 0 . 1 , preferably about 0 . 3 , the term &# 34 ; inherent viscosity &# 34 ; referring to viscosity determinations made at 25 ° c . using 0 . 25 grams of polymer per 100 ml . of a solvent composed of 60 % by weight phenol and 40 % by weight tetrachlorethane . the difunctional dicarboxylic acid reactant ( a ) can be aliphatic , alicyclic , and aromatic dicarboxylic acids , for example , succinic , glutaric , adipic , fumaric , maleic , 1 , 4 - cyclohexanedicarboxylic , terephthalic , and phthalic acids . mixtures of two or more acids can be used . the corresponding anhydrides , esters and acid chlorides of the above acids are also suitable . the difunctional sulfomonomer reactant ( b ) can be a dicarboxylic acid or ester containing a metal sulfonate group or a hydroxy acid containing a metal sulfonate group . preferably , the metal ion is an alkali metal . the difunctional sulfomonomer ( b ) include sulfophthalic , sulfoterephthatic , sulfoisophthalic , and 4 - sulfonaphthalene - 2 , 7 - dicarboxylic acids , and their corresponding esters . also suitable are metallosulfoaryl sulfonates , e . g ., 5 - sodiosulfoisophthalic acid . aliphatic , alicyclic and alkylaryl glycols are suitable as reactant ( c ) herein , and include ethylene glycol , propylene glycol , p - ethylenediol , 1 , 3 - cyclohexanedimethanol and the like . two or more glycols can be used in the synthesis of the polyesters suitable herein . diethylene glycol is preferred . the polyester polymers suitable in the compositions of the present invention have a molecular weight of from about 10 , 000 to about 25 , 000 . an example of the aforementioned polyester is the &# 34 ; aq &# 34 ; polyester series , manufactured by eastman chemical products , inc ., especially aq 55d , wherein the suffix &# 34 ; d &# 34 ; denotes a dispersion of the polymer . the aq polymers are available as solid pellets or as aqueous dispersions . the dispersions typically comprise 20 - 35 % solids , and have viscosities in the range of 10 - 50 cps at 100 rpm . also suitable for use herein are the aq29 and aq38 polymers . it has been found that the polyester polymers herein recited may be included within a surfactant containing composition used in the cleaning of reservoirs , especially toilet bowls , to lessen the tendency of di - and trivalent metal ions as may be present in the water supplied to the reservoirs from staining the surfaces thereof , especially porcelain surfaces . it is critical , however , that the cleaning composition in which the polyester is included not contain significant levels of ionizable species , for example , ionizable acids , as the polymers are destabilized at higher ionic strengths . preferably , the ionic strength of the cleaning composition should be less than 0 . 5 mol / liter . when destabilized , the polymer precipitates , making it ineffective for its intended activity but also possibly preventing proper operation of the automatic dispenser preferably used to deliver the composition to the reservoir . the aqueous cleaning composition of the present invention comprises on a weight basis from about 1 to about 15 %, preferably from about 2 to about 8 %, of a nonionic or anionic surfactant and mixtures thereof ; from about 0 . 05 % to about 10 % ( active basis ), preferably from 0 . 1 to about 3 %, of the polyester polymer , and water . while optional , it is quite preferable to include perfume , typically less than about 2 %, more specifically between 0 . 05 to 1 . 0 % by weight , of an oil based perfume , and a dye , typically less than 5 %, more specifically between 0 . 25 and 2 % by weight . the polymer is provided as a dispersion in the cleaning composition . it has been further found that perfumes included in the cleaning composition are sequestered by the polyester . this is demonstrated by the low intensity fragrance exhibited by perfume containing compositions of the present invention , prior to dilution in the reservoir . advantageously , when the cleaning composition is diluted , as by use in a water containing reservoir , there is a release or &# 34 ; bloom &# 34 ; of the perfume . while the mechanism is not fully understood , it is believed that the polymer , when present in aqueous solutions at quite dilute levels , either unravels to release the perfume or releases the perfume to preferentially capture the heavy metal ion . preferably , the concentration of the polymer in aqueous solution in the reservoir suitable to obtain release of the perfume is from about 40 parts per billion to about 100 parts per million , most preferably from about 1 to about 50 ppm . importantly , it has been found that dilution of the polymer as described above does not prevent capture of the offending heavy metal ions . any anionic , nonionic , cationic , amphoteric , or zwitterionic surfactant is suitable in the composition of the present invention , provided that ionization is insufficient in the case of the ionizable surfactants to interfere with the intended function of the polymer . generally , however , the ionizable surfactants have a low degree of dissociation and , accordingly , do not jeopardize the activity of the polymer . anionic and non - ionic surfactants are especially preferred . broadly , the anionic surfactants are water - soluble alkyl or alkylaryl compounds , the alkyl having from about 8 to about 22 carbons , including a sulfate or sulfonate substituent group that has been base - neutralized , typically to provide an alkali metal , e . g ., sodium or potassium , or an ammonium anion , including , for example : ( 1 ) alkyl and alkylaryl sulfates and sulfonates having preferably 10 to 18 carbons in the alkyl group , which may be straight or branched chain , e . g ., sodium lauryl sulfate and sodium dodecylbenzene sulfonate ; ( 2 ) alpha - olefin aryl sulfonates preferably having from about 10 to 18 carbons in the olefin , e . g ., sodium c 14 - 16 olefin sulfonate , which is a mixture of long - chain sulfonate salts prepared by sulfonation of c 14 - 16 alpha - olefins and chiefly comprising sodium alkene sulfonates and sodium hydroxyalkane sulfonates ; ( 3 ) sulfated and sulfonated monoglycerides , especially those derived from coconut oil fatty acids ; ( 4 ) sulfate esters of ethoxylated fatty alcohols having 1 - 10 mols ethylene oxide , e . g ., sodium polyoxyethylene ( 7 mol eo ) lauryl ether sulfate , and of ethoxylated alkyl phenols having 10 mols ethylene oxide and 8 to 12 carbons in the alkyl , e . g ., ammonium polyoxyethylene ( 4 mol eo ) nonyl phenyl ether sulfate ; ( 5 ) base - neutralized esters of fatty acids and isethionic acid , e . g ., sodium lauroyl isethionate ; ( 6 ) fatty acid amides of a methyl tauride , e . g ., sodium methyl cocoyl taurate , ( 7 ) beta - acetoxy - or beta - acetamido - alkane sulfonates where the alkane has from 8 to 22 carbons , and ( 8 ) acyl sarcosinates having from 8 to 18 carbons in the acyl , e . g ., sodium lauroyl sarcosinate . the nonionics include ( 1 ) fatty alcohol alkoxylates , especially the ethoxylates , wherein the alkyl group has from 8 to 22 , preferably 12 to 18 , carbons , and typically 6 to 15 mol alkoxide per molecule , e . g ., coconut alcohol condensed with about nine mols ethylene oxide ; ( 2 ) fatty acid alkoxylates having from about 6 to about 15 mols alkoxylate , especially the ethoxylate ; ( 3 ) alkylphenoxy alkoxylates , especially the ethoxylates , containing 6 to 12 carbons , preferably octyl or nonyl , in the alkyl , and having about 5 to 25 , preferably 5 to 15 mols alkylene oxide per molecule , e . g ., nonyl phenol ethoxylated with about 9 . 5 mols ethylene oxide ( igepal co - 630 ); ( 4 ) condensates of ethylene oxide with a hydrophobic base formed by condensation of propylene oxide with propylene glycol , e . g ., nonionic surfactants of the pluronic series manufactured by basf wyandotte , ( 5 ) condensates of ethylene oxide with an amine or amide ; ( 6 ) fatty amine oxides , e . g ., stearyl dimethyl amine oxide , and ( 7 ) alkylolamides . preferred anionics are the alkyl and alkylauryl sulfates and the alpha - olefin aryl sulfonates , while preferred nonionics are the fatty alcohol ethoxylates and the alkyl phenoxy ethoxylates preferred dyes are fd & amp ; c blue no . 1 ( colour index no . 42 , 090 ), fd & amp ; c green no . 3 ( colour index no . 42 , 053 ), acid blue 249 ( colour index no . 74220 ), and colour index no . 52 , 015 . typically , the perfume preferably incorporated in the composition of the present invention is a mixture of organic compounds admixed so that the comined odors of the individual components produce a pleasant or desired fragrance . while perfumes are generally mixtures of various materials , individual compounds may also be used as the perfume ingredient . the perfume compositions generally contain a main note or the &# 34 ; bouquet &# 34 ; of the perfume composition , modifiers which round off and accompany the main note , fixatives including odorous substances that lend a particular note to the perfume throughout each of the stages of evaporation , substances which retard evaporation , and top notes which are usually low - boiling , fresh - smelling materials . perfumery raw materials may be divided into three main groups : ( 1 ) the essential oils and products isolated from these oils ; ( 2 ) products of animal origin ; and ( 3 ) synthetic chemicals . the essential oils consist of complex mixtures of volatile liquid and solid chemicals found in various parts of plants . mention may be made of oils found in flowers , e . g ., jasmine , rose , mimosa , and orange blossom ; flowers and leaves , e . g ., lavender and rosemary ; leaves and stems , e . g ., geranium , patchouli , and petitgrain ; barks , e . g ., cinnamon ; woods , e . g ., sandalwood and rosewood ; roots , e . g ., angelica ; rhizomes , e . g ., ginger ; fruits , e . g ., orange , lemon , and gergamot ; seeds , e . g ., aniseed and nutmeg ; and resinous exudations , e . g ., myrrh . these essential oils consist of a complex mixture of chemicals , the major portion thereof being terpenes , including hydrocarbons of the formula ( c 5 h 8 ) n and their oxygenated derivatives . hydrocarbons such as these give rise to a large number of oxygenated derivatives , e . g ., alcohols and their esters , aldehydes and ketones . some of the more important of these are geraniol , citronellol and terpineol , citral and citronellal , and camphor . other constituents include aliphatic aldehydes and also aromatic compounds including phenols such as eugenol . in some instances , specific compounds may be isolated from the essential oils , usually by distillation in a commercially pure state , for example , geraniol and citronellal from citronella oil ; citral from lemon - grass oil ; eugenol from clove oil ; linalool from rosewood oil ; and safrole from sassafras oil . the natural isolates may also be chemically modified as in the case of citronellal to hydroxy citronellal , citral to ionone , eugenol to vanillin , linalool to linalyl acetate , and safrol to heliotropin . animal products used in perfumes include musk , ambergris , civet and castoreum , and are generally provided as alcoholic tinctures . the synthetic chemicals include not only the synthetically made , also naturally occurring isolates mentioned above , but also include their derivatives and compounds unknown in nature , e . g ., isoamylsalicylate , amylcinnamic aldehyde , cyclamen aldehyde , heliotropin , ionone , phenylethyl alcohol , terpineol , undecalactone , and gamma nonyl lactone . perfume compositions as received from the perfumery house may be provided as an aqueous or organically solvated composition , and may include as a hydrotrope or emulsifier a surface - active agent , typically an anionic or nonionic surfactant , in minor amount . the perfume compositions are quite usually proprietary blends of many different fragrance compounds . however , one of ordinary skill in the art , by routine experimentation , may easily determine whether such a proprietary perfume blend is suitably sequestered by the polyester in the compositions of the present invention . the polyester polymer herein described are dispersible , not soluble , in water . the polymers are not easily dissipated in cold water , although in some instances cold water is preferred , depending on the particular reactants employed . typically , dispersions of the polymer are made by adding solid polymer to water heated to about 175 ° to about 190 ° f ., accompanied by stirring . the aforementioned coney , kibler , et al ., and sublett patents describe in greater detail preparation of these polymer dispersions . a perfume - complexed polyester may be made by subsequently adding the perfume or a perfume solution to the cooled dispersion under conditions of shear . it is preferred to admix an aqueous premix of the surfactant to the cooled polymer dispersion or the perfume - complexed polymer dispersion , under conditions of stirring . when used as a toilet cleaning product , the composition of the present invention is preferably dispensed into the toilet tank on the occasion of a flush , the volume of water in the tank being sufficient to achieve adequate dilution to the concentration levels at which the polymer releases the perfume , for a perfume - complexed polymer . suitable for use in combination with the subject composition is the dispenser described in u . s . pat . no . 3 , 698 , 021 to mack . also suitable is the dispenser disclosed in u . s . pat . no . 4 , 660 , 231 to m . mcelfresh , which is an example of a downstroke dispenser and discharges composition as the tank water level drops as a result of a flush . the mack device is an upstroke dispenser that discharges composition as the tank water level rises during refilling of the tank , in which case the tank is the primary reservoir and the entire tank water volume is treated as to remove the offending ions . | 8 |
embodiments of the invention may utilize structure and / or concepts described in commonly owned u . s . pat . no . 6 , 865 , 944 , which is herein incorporated by reference in its entirety . fig1 illustrates a plan view of a micro - electromechanical system ( mems ) device 10 , for example , a gyroscope . mems device 10 is formed on a substrate ( not shown ) and includes at least one proof mass 12 , a plurality of suspensions 14 for supporting proof masses 12 , and at least one cross beam 16 connected to suspensions 14 . in an alternative configuration , suspensions 14 are individually and directly connected to the substrate . mems device 10 also includes motor drive combs 18 , motor pickoff combs 20 , and sense plates 22 , which correspond to individual proof masses 12 . proof masses 12 are fabricated from any mass suitable for use in a mems device . in one embodiment , proof mass 12 is a plate of silicon . other materials compatible with micro - machining techniques may also be utilized . while fig1 shows two proof masses 12 , mems devices utilizing fewer or greater than two proof masses may also be utilized . proof masses 12 are located substantially between motor drive comb 18 and motor pickoff comb 20 . proof masses 12 include a plurality of comb - like electrodes 26 . a portion of electrodes 26 extends towards motor drive comb 18 and a portion of electrodes 26 extends towards motor pickoff comb 20 . while , in the illustrated embodiment , proof masses 12 have thirty - four electrodes 26 , it is known to utilize proof masses incorporating different numbers of electrodes . in other embodiments of mem devices ( not shown ), motor drive comb and motor pickoff comb may be located next to one another . proof masses 12 , in the embodiment shown , are supported above a respective sense plate 22 by suspensions 14 . while four suspensions 14 are depicted for suspending each proof mass 12 , any number of suspensions 14 which properly support proof masses 12 may be utilized . suspensions 14 are , in one embodiment , beams micro - machined from a silicon wafer . suspensions 14 also act as springs allowing proof masses 12 to move within a drive plane ( x - axis ) and a sense plane ( y - axis ), as shown in fig1 . motor drive combs 18 include a plurality of comb - like electrodes 28 extending towards a respective proof mass 12 . while motor drive combs 18 are shown as having eighteen electrodes 28 , the number of electrodes 28 on motor drive combs 18 typically is determined by the number of electrodes 26 on the respective proof mass 12 . motor drive combs are typically connected to drive electronics ( not shown in fig1 ). electrodes 26 and electrodes 28 are interdigitated as they extend from respective proof masses 12 and motor drive combs 18 and form capacitors which are utilized to generate motion in the drive plane ( x - axis ). motor pickoff combs 20 also include a plurality of comb - like electrodes 30 extending towards a respective proof mass 12 . while motor pickoff combs 20 are depicted as having eighteen electrodes 30 , the number of electrodes 30 extending from motor pickoff combs 20 is typically determined by the number of electrodes 26 on a respective proof mass 12 . motor pickoff combs 20 are sometimes referred to as sense combs . electrodes 26 and electrodes 30 are interdigitated as they extend from respective proof masses 12 and motor pickoff combs 20 and form capacitors which are utilized to sense motion in the drive plane ( x - axis ). sense plates 22 are parallel with their respective proof mass 12 and form a capacitor . if an angular rate ( i . e . an aircraft turning ) is applied to mems device 10 operating as a gyroscope along an input vector ( z - axis ) while the at least one proof mass 12 is oscillating along the drive plane ( x - axis ), a coriolis acceleration is detected in the sense plane ( y - axis ). the capacitance is used to sense motion in the sense plane ( y - axis ). an output of mems device 10 typically is a signal proportional to the change in capacitance caused by the motion . sense plates 22 are typically connected to sense electronics , not shown in fig1 . sense electronics detect changes in capacitance as proof masses 12 move toward and / or away from their respective sense plates 22 and the respective motor drive combs 18 and motor pickoff combs 20 . motor pickoff combs 20 are typically connected to a bias voltage ( not shown ) used in sensing motion of proof masses 12 . motor drive combs 18 are typically connected to drive electronics ( not shown ). the drive electronics cause the respective proof mass 12 to oscillate at substantially a tuning fork frequency along the drive plane ( x - axis ) by using the capacitors formed by the plurality of interdigitated comb - like electrodes 26 , 28 of proof mass 12 and motor drive comb 18 . mems device 10 has two closely spaced modes of oscillation . one of the modes , sometimes referred to as a motor mode , is driven by an electrostatic force , at a resonant frequency of device 10 to produce a relatively large amplitude of oscillation . when a rotational force is applied to device 10 , a coriolis force is produced which is proportional to the velocity of proof mass 12 in the motor mode . the coriolis force drives proof masse 12 in a sense mode direction at a frequency of the motor mode . one or more electrodes are provided to detect oscillations in the sense mode , as described below , utilizing capacitance . a dc and / or an ac bias voltage is applied to sense electrodes , so that a motion of proof masses 12 in the sense mode produces an output current . in certain operating environments , mems devices , for example , gyroscopes are subjected to extreme shock and vibration exposure , but also have to be mechanically sensitive enough to measure minute angular velocities and linear accelerations . such forces may cause extensions 26 of proof masses 12 to forcefully come into contact with one or more of motor drive comb 18 , its extensions 28 , motor pickoff comb 20 , and its extensions 30 . in addition to a possibility that one or more of extensions 26 , 28 , and 30 could be broken off or otherwise damaged , electrostatic forces might cause proof mass 12 to remain in physical contact with the component of device 10 the proof mass 12 has contacted . other forces may cause the main body of proof mass 12 to come into contact with sense plate 22 . again , the electrostatic forces may cause proof mass 12 to remain in contact with sense plate 22 . mems device 10 is also configured with a plurality of deceleration stops 50 which reduce or alleviate the above described operational problems caused by excessive external mechanical forces . device 10 utilizes deceleration stops 50 to provide the external force protection . proof masses 12 are further identified as a left proof mass 54 and a right proof mass 56 . the terms “ left ” and “ right ” as used herein are for illustrative purposes with respect to the figures only to describe operation of deceleration stops 50 , and do not imply any type of structural limitations of mems device 10 . left proof mass 54 and right proof mass 56 are supported above the substrate , as described above , by suspensions 14 . while suspensions 14 suspend proof masses 54 and 56 above a substrate ( not shown ) onto which a sense plate ( not shown ) is typically mounted , suspensions 14 also allow proof masses 54 and 56 to vibrate upon application of a bias voltage . as proof masses 54 and 56 vibrate , extensions 26 move back and forth between extensions 28 of motor drive combs 18 and extensions 30 of motor pickoff combs 20 , causing capacitance changes which can be quantified . fig2 is an illustration that details a deceleration stop 50 , which operates to prevent left proof mass 54 from contacting motor drive comb 18 and motor sense comb 20 . while a single deceleration stop 50 is illustrated and described with respect to left proof mass 54 , it is to be understood that the description applies to deceleration stops utilized in conjunction with any proof mass ( including right proof mass 56 ) and that multiple deceleration stops 50 can be associated with any individual proof mass ( as shown in fig1 ). deceleration stop 50 includes a body 60 which , in one embodiment , is located between cross beam 16 and proof mass 54 , and is attached to crossbeam 16 through an anchoring extension 62 . in one embodiment , body 60 is attached to the substrate and provides an anchoring function for the mems device . as illustrated in fig2 , and in an embodiment , the suspensions 14 may have a convoluted or serpentine configuration so as to provide the suspensions a spring - like functionality . in addition , a plurality of deceleration beams 64 extend from body 60 towards proof mass 54 . as illustrated in fig2 , and in an embodiment , one or more of the beams 64 may include a plurality of tines 70 , 72 of uniform or varying width and separated from one another by respective gaps 74 . at least one deceleration extension 66 located in between deceleration beams 64 extends from proof mass 54 . as illustrated in fig2 , and in an embodiment , the extension 66 may include a plurality of tines 76 , 78 , 80 of uniform or varying width and separated from one another by respective gaps similar to gap 74 . as further illustrated in fig2 , and in an embodiment , an additional plurality of deceleration beams 82 extend from the body 60 , and an additional deceleration extension 84 extends from the crossbeam 16 . the beams 82 and extension 84 may be tined in the manner described above with reference to deceleration beams 64 and deceleration extension 66 . deceleration beams 64 , 82 , deceleration extensions 66 , 84 , and serpentine suspensions 14 allow proof mass 54 to move freely under normal motion conditions , but serve to decelerate proof mass 54 when the motion of proof mass 54 exceeds a certain limit . in one embodiment , deceleration beams 64 , 82 are positioned closer to extensions 66 , 84 than proof mass 54 is to combs 28 and 30 . as shown in fig1 and 2 , deceleration beams 64 , 82 and deceleration extensions 66 , 84 , in one embodiment , are elongated rectangular structures . specifically , when a motion of proof mass 54 causes one or more of deceleration extensions 66 , 84 to engage one or more of deceleration beams 64 , 82 , due to an external force , one or more of deceleration beams 64 , 82 and deceleration extensions 66 , 84 bend , decelerating proof mass 54 such that when proof mass 54 contacts a fixed stop , an impact is significantly reduced or eliminated . the deceleration of proof mass 54 due to deceleration stops 50 prevents damage to the interdigitating members of proof mass 54 , motor drive comb 18 , and motor pickoff comb 20 . moreover , the tined configuration of the beams 64 , 82 and / or extensions 66 , 84 enable deceleration of the proof mass 54 to occur in successive stages . that is , for example , upon sudden movement of the proof mass 54 to the right in fig2 , tine 80 and tine 70 may engage one another and bend prior to tine 78 and tine 72 bending and , perhaps , obviate the need for tine 78 and tine 72 to bend . while a preferred embodiment of the invention has been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . accordingly , the scope of the invention is not limited by the disclosure of the preferred embodiment . instead , the invention should be determined entirely by reference to the claims that follow . | 6 |
fig1 is a block diagram of a spray performance analysis system 100 in accordance with an exemplary embodiment of the present invention . as shown in fig1 , analysis system 100 includes a wc image capture unit 102 , a calibration image analysis unit 104 , a wc image analysis unit 105 , a calibration unit 106 and a statistics unit 108 . wc image capture unit 102 captures witness card images that are submitted to either unit 104 or unit 105 depending on the type of image being processed . wc images of calibration witness cards are submitted to unit 104 . wc images of as - sprayed witness cards are submitted to unit 105 . the image analysis units 104 and 105 preferably include the same core image preprocessing control parameters , but are configured to perform different functions . the calibration image analysis unit 104 generates stain area information from calibrated drops of one or several stains as directed by the user . the wc image analysis unit 105 automatically identifies as many as all of the stains within a witness card image and may determine stain areas for each identified stain and physical attributes of the stain image space . calibration unit 106 , receives calibration witness card stain dimension data from calibration image analysis unit 104 and known droplet volume information to generate a calibration curve equation , or set of linear and / or non - linear equations , capable of accurately estimating a droplet dimension ( e . g ., droplet diameter or mmd ) as a function of a determined stain dimension ( e . g ., stain diameter ) for an identified fluid at an identified temperature upon an identified paper stock . statistics unit 108 receives and stores one or more calibration equations generated by calibration unit 106 . upon receiving as - sprayed witness card stain dimension data from wc image analysis unit 105 , statistics unit 108 may select a stored calibration equation , or set of equations , based upon the fluid , fluid temperature and type of witness card used to produce the as - sprayed stains . statistics unit 108 then uses the selected calibration equation ( s ) to estimate spray droplet diameters ( i . e ., mmd values ) and spray density for each as - sprayed witness card . in addition , based upon the number of droplets , spray density , and mmd values determined for each as - sprayed witness card retrieved from a known location within a sprayed target area , statistics unit 108 is capable of generating statistical data that characterizes spray performance within any or all portions of the sprayed target area . fig2 a depicts an exemplary embodiment of the present invention in which a spray performance analysis system 200 is implemented in a stand - alone configuration . as shown in fig2 a , such an embodiment may include a scanner 202 ( or more generally , a wc image capture unit 102 including a digital camera 640 as will be discussed more fully in connection with fig6 ), and a conventional computer processing unit 204 with conventional user input / output devices such as a display 206 , keyboard 208 and mouse 210 . the computer system may use any of the major platforms such as windows , linux , macintosh , unix or os2 . further , computer processing unit 204 includes components ( e . g . processor , disk storage or hard drive , etc .) having sufficient processing and storage capabilities to effectively execute spray performance analysis system processes . in such an embodiment , a user interfaces with the spray performance analysis system executing upon computer processing unit 204 via a command line or graphical user interface to process witness cards in accordance with the present invention . wc image capturing , image analysis , generation of calibration equations , and the generation of as - sprayed statistics may , accordingly , be performed from a single location . fig2 b presents an alternate exemplary embodiment of the present invention in which spray performance analysis system functions are performed in a distributed networked environment . as shown in fig2 b , a scanner 212 ( or , again , any wc image capture mechanism , e . g ., camera 640 ), computer processing unit 214 and storage device 216 are connected by communication network 218 . in such an environment , scanner 212 ( or , e . g ., a camera ) is typically used to generate images of calibration witness cards and / or as - sprayed witness cards and to store the images to networked storage device 216 . in this manner , images can be generated , stored and later retrieved by processing unit 214 in order to develop calibration equations and / or generate as - sprayed analysis statistics . as described in u . s . pat . no . 7 , 277 , 570 , paper stock may be used as witness cards . such paper stock is preferably selected to avoid paper speckle ( i . e ., single or small clusters of pixels within a witness card image caused by the grain and / or structure of the paper stock ) and to avoid paper imperfections ( i . e ., larger groups of image pixels caused by paper stock local area imperfections or lack of homogeneity in the grain structure of the paper ). although paper stock may be used in connection with the instant witness card analysis methodology , it has been determined that other forms of witness cards and related witness card image capturing techniques may be more suitable or desirable in certain situations . referring now to fig5 a , one other type of witness card in accordance with the present invention that may be employed is a semiopaque wc 500 . such a wc 500 may include a transparent or semiopaque sheet or substrate 510 that is covered by a coating 520 that may be designed to chemically react or be altered upon contact / interaction with a sprayed simulant or other substance . such a wc 500 may be made from , e . g ., a material known as flexible tlc plates available from whatman plc ( united kingdom ). these plates are available in 20 cm × 20 cm sheets and can be cut with scissors ( or with any other appropriate cutting tool ) to desired dimensions . a particular variety of these plates suitable for wc analysis in accordance with the present invention is known as tlc pe sil g / uv , which contains , as a coating , 60 å of silica gel . fig5 b shows an alternative witness card 501 in which a chemical reactant or marker is actually integrally formed or mixed with the material that forms the sheet 525 itself . that is , as a result of the card manufacturing process , the “ coating ” is indistinguishable from what might be considered a carrier sheet or substrate . depending on the type of coating 520 ( including , e . g ., the coating on the tlc pe sil g / uv sheets ) or chemical reactant / marker , a droplet of simulant ( and particularly an un - dyed stimulant ) may not be immediately visible to a human eye or electronic imaging device such as a scanner or digital camera . accordingly , to facilitate detection or viewing of stains on semiopaque wc 500 , an image enhancing apparatus 600 may be provided , as shown in fig6 . such an apparatus may comprise a light table 610 having a light source 625 that is preferably capable of emitting light in an evenly distributed manner so as to avoid , to the extent possible , uneven lighting of a wc 500 . the light source may comprise any suitable form of illumination at any suitable wavelength and is not restricted to white light or light in the visible waveband . light table 610 preferably has a semiopaque or semi - transparent platform 630 through which light from light source 625 passes . platform 630 may comprise glass , crystalline and / or plastic structures that help to evenly distribute light . in accordance with an embodiment of the instant invention , wc 500 is placed on platform 630 in view of , for example , a camera 640 . camera 640 may be a conventional film camera , but is preferably an electronic digital camera that can quickly generate digital wc image data 650 . light source 625 illuminates wc 500 in such a way as to make the stains or droplets thereon visible to , e . g ., camera 640 . the resulting captured wc image data 650 is the data that , as shown in fig1 , may be supplied to either calibration image analysis unit 104 or witness card image analysis unit 105 . further , it should be appreciated by those skilled in the art that the light table 610 and camera 640 arrangement described herein is merely an example of one approach to practicing the instant invention and that other implementations of a wc image capture unit 102 are possible and still within the scope of the invention . with the wc data 650 in hand , either by way of a scanner or the light table 610 and camera 640 arrangement of fig6 , analysis of the witness card data can proceed as explained in detail in u . s . pat . no . 7 , 277 , 570 and as outlined next . fig3 depicts a process flow diagram for the development of calibration equations used to calibrate a spray performance analysis system in accordance with an exemplary embodiment of the present invention . as shown in fig3 , a spray fluid and witness card type is selected ( e . g ., paper stock , transparent / coated / semiopaque ) at step 302 , and calibration witness card sample stains are produced at step 304 , upon the selected wc with known volumes of the selected fluid . next , at step 306 , the calibration witness card is scanned or digitally imaged by wc image capture unit 102 ( see fig1 ) to produce an electronic image containing images of the calibration witness card stains . image processing of the respective stain images is performed , at step 308 , by image analysis unit 104 to determine stain area and / or dimension measurements of the sample stains . examples of such dimension measurements may include a diameter of an identified stain , a radius of an identified stain , and a circumference of an identified stain . stain area and / or dimension measurement information and droplet volume information is passed to calibration unit 106 to develop , at step 310 , a calibration equation , or set of linear and / or non - linear equations , using conventional techniques capable of approximating droplet volume as a function of droplet stain area and / or dimension measurements . the generated calibration equation is validated , at step 312 , by calculating stain volume approximations for each of the calibration droplets based upon the measured calibration stain measurements . if the approximated volumes are determined , at step 314 , to be within a predetermined percentage error of the known droplet volumes , the generated calibration equation information is stored , at step 316 , for later access by the spray performance analysis system statistics unit 108 . if the approximated volumes are determined , at step 314 , to not be within the predetermined percentage error of the known droplet volumes , the calibration process described above is iterated or repeated until a set of validated calibration equations is achieved . still additional detail regarding the calibration process of depicted in fig3 may be found in u . s . pat . no . 7 , 277 , 570 . fig4 is a process flow diagram depicting use of the spray performance analysis system of fig1 to generate as - sprayed performance statistics in accordance with an exemplary embodiment of the present invention . as shown in fig4 , a spray fluid and witness card type is selected at step 402 , witness cards are positioned at step 404 throughout an area to be sprayed , and as - sprayed witness card stains are produced at step 406 as a result of spraying the test area with a spray device in a prescribed manner using the selected fluid or simulant . for example , the manner of spraying is typically representative of a proposed agricultural , military , industrial or other use , as described above . next , at step 408 , an electronic image of each as - sprayed witness card is produced using wc image capture unit 102 ( e . g ., scanner or digital camera ) and stored . image processing of the respective stain images is performed , at step 410 , by wc image analysis unit 105 to identify stains within the as - sprayed witness card image that exceed a pre - determined threshold and to determine an approximate area and / or dimension of each detected stain . examples of such dimension measurements may include a diameter of an identified stain , a radius of an identified stain , and a circumference of an identified stain . preferably , such as - sprayed witness card stain area and / or dimension information is stored in a manner that associates the witness card with a unique test ( e . g ., a unique test identifier , etc .). at step , 412 , statistics unit 108 , retrieves as - sprayed witness card stain area measurement and / or dimension information associated with a common test from storage and further retrieves a set of calibration equations for use in approximating the mass of the droplet that produced each identified as - sprayed witness card stain . next , at step 414 , statistics unit 108 generates and stores spray density and droplet mass data for an as - sprayed witness card associated with the selected test . if the statistics unit 108 determines , at step 416 , that additional as - sprayed witness card stain area and / or dimension information remains to be processed , step 414 is repeated , otherwise , statistics unit 108 proceeds to generate , at step 418 , statistics data that summarizes as - sprayed performance based upon the spray density and droplet mass data generated , at step 414 , for each of the respective as - sprayed witness cards . additional detail related to steps identified in fig4 may be found in u . s . pat . no . 7 , 277 , 570 . in positioning , at step 404 , witness cards within a target spray area , care should be taken to place the witness cards in positions that may capture appropriate spray information . for example , witness cards may be placed at strategically selected and / or evenly spaced locations from a stationary spray distribution point , or a ground zero detonation point , to form one or more representative grids and / or cross - sections of the target area . if the spray device is mobile , witness cards may be placed at strategically selected locations and / or evenly spaced intervals along the spray path . for example , to sample spray performance of a spray device moving along a spray path , a set of witness cards may be positioned along a perpendicular cross - section of the spray path . such cross - sectional sampling may be established at various points along the spray path to obtain information related to performance of the spray device over time . in producing as - sprayed witness cards , at step 406 , care should be taken to monitor the as - sprayed operational conditions and any deviations from the operational conditions under which the calibration witness card was created should be duly noted . such notable changes may include , as - sprayed fluid temperature , as sprayed viscosity , color intensity , wind conditions , ambient temperature / humidity , etc . preferably , the as - sprayed operational conditions can be matched at step 412 with a set of calibration equations based upon calibration witness card data produced under the same operational conditions . this matching may be conveniently done post - spraying as noted above . the systems and methods described herein may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the foregoing embodiments are therefore to be considered in all respects illustrative and not meant to be limiting . | 0 |
while the specification concludes with claims particularly pointing out and distinctly claiming the subject matter regarded as forming the present invention , it is believed that the invention will be better understood from the following detailed description taken in conjunction with the accompanying drawings in which briefly : fig1 is a bar graph which shows : assay of analog toxicity . the toxicity of 16 compounds , identified only by code number was assessed relative to 11 - oxatetradecanoic acid ( 0 - 11 ) and ethanol ( e ) controls . each bar shows the mean and standard deviation of quadruplicate assays . all compounds were tested at 10 μm . the 0 . 1 % ethanol in control e , corresponding to the final concentration of solvent present in other assays , had no effect on growth . brackets on the right of the graph indicate the efficacy group designations for this test . as described in methods herein below , 11 - oxatetradecanoic acid and ethanol controls are defined as the middle value of groups 1 and 3 , respectively . compound codes corresponded to the following structures : 21 , ch 3 --( ch 2 ) 3 -- co --( ch 2 ) 8 -- cooh ; 22 , ch 3 --( ch 2 ) 7 -- nh -- co --( ch 2 ) 3 -- cooh ; 23 ch 3 --( ch 2 ) 5 -- cooh ; 24 , ethanol ; 25 , ch 3 --( ch 2 ) 4 -- co --( ch 2 ) 7 -- cooh ; 26 , ch 3 --( ch 2 ) 10 -- co -- ch 2 -- cooh ; 27 , -- ch 3 ( ch 2 ) 2 -- o --( ch 2 ) 9 cooh ( 11 - oxatetradecanoic acid ); 28 , ch 3 --( ch 2 ) 8 -- co --( ch 2 ) 3 -- cooh ; 29 , ch 3 --( ch 2 ) 6 -- nh -- co --( ch 2 ) 4 -- cooh ; 30 , ch 3 -- ch 2 -- co --( ch 2 ) 10 -- cooh ; 31 , ch 3 --( ch 2 ) 5 -- co --( ch 2 ) 6 -- cooh ; 32 , ch 3 --( ch 2 ) 9 -- co --( ch 2 ) 2 -- cooh ; 33 , ch 3 --( ch 2 ) 2 -- co --( ch 2 ) 9 -- cooh ; 34 , ch 3 --( ch 2 ) 8 -- nh -- co --( ch 2 ) 2 -- cooh ; 35 , ch 3 -- co --( ch 2 ) 11 -- cooh ; 36 , ch 3 --( ch 2 ) 7 -- co --( ch 2 ) 4 -- cooh . fig2 a and 2b show the chemical structures of the 20 myristate analogs most toxic to trypanosomes arranged into structural groups . most of the myristic acid analogs used in the method of the present invention are well - known compounds which have been previously described as useful antiviral agents . see , e . g ., bryant et al ., proc . natl . acad . sci . usa 86 , 8655 - 8659 ( 1989 ), and bryant et al ., ibid . 88 , 2055 - 2059 ( 1991 ). in their activity as antiparasitic agents in the present invention , these myristic analogs function in a different manner than as antiviral agents . in their antiviral activity , these compounds serve as substrates of myristoyl coa : protein n - myristoyltransferase , an enzyme which transfers myristate from myristoyl coa to the amino terminal glycine residue of eukaryotic cellular and viral protein . in their antiparasitic activity , these compounds are incorporated into the gpi anchor of the parasite . however , the antiparasitic activity may also be mediated , in part , by alteration of n - myristoylated proteins , or by some change in membrane structure caused by incorporation of the myristic acid analog into phospholipids . the syntheses of the myristic acid analogs used in the method of the present invention also are well - known . thus , the synthesis of sulfur - containing myristic acid analogs is described , e . g ., by heuckeroth et al ., j . biol . chem . 263 , 2127 - 2133 ( 1988 ), heuckeroth et al ., proc . natl . acad . sci . usa 85 , 8795 - 8799 ( 1988 ), and in u . s . pat . nos . 5 , 073 , 571 and 5 , 082 , 967 . double bond - and triple bond - containing myristic acid analogs are also described in said patents , in heuckeroth et al ., proc . natl . acad . sci . usa 85 , 8795 - 8799 ( 1988 ), and in rudnick et al ., proc . natl . acad . sci . usa 89 , 10507 - 10511 ( 1992 ). synthesis of azido - substituted myristic acid analogs is described in ep 480 , 901 . the preparation of many of these and other such myristic acid analogs containing oxygen , sulfur , double bond , triple bond and aromatic residues is described in kishore et al ., j . biol . chem . 266 , 8835 - 8855 ( 1991 ). synthesis of myristic acid analogs containing carbonyl groups , nitrogen heteroatoms and nitrogen heterocycles is described in devadas et al ., j . biol . chem . 267 , 7224 - 7239 ( 1992 ). the synthesis of still other such triple bond - and aromatic moiety - containing analogs of myristic acid is described by gokel et al ., israel j . chem . 32 , 127 - 133 ( 1992 ). examples 1 - 43 , below , illustrate the synthesis of 40 additional test compounds . in order to illustrate the invention in greater detail , a total of 247 different myristic acid analogs ( listed in table 2 , below ) were tested for toxicity to trypanosomes in culture in accordance with a state - of - the - art assay . for comparison the testing included five oxy - myristic acid analogs ( oxatetradecanoic acids ) described in u . s . pat . no . 5 , 151 , 445 , the disclosure of which is incorporated herein by reference . based on the test results , these 247 compounds were divided into three efficacy groups in which groups 2 and 3 consisted of the 60 active compounds whereas the 177 compounds of group 1 were inactive . of the active compounds , the 20 compounds in group 3 were the most active . although specific examples of the invention are thus illustrated herein , it will be understood that the invention is not limited to these specific examples or the details described therein . references to show the state - of - the - art are indicated in parentheses and appended at the end . fetal calf serum , hypoxanthine , mem &# 34 ; alpha &# 34 ; medium ( 320 - 2561 aj ), penicillin , pyruvate , streptomycin and thymidine were obtained from gibco / brl . other reagents , where not specified , were from sigma chemical co . the methods used for synthesizing 203 of the 247 fatty acids shown in table 1 are described in published reports ( rapaport and newman , 1947 ; kishore et al ., 1991 ; devadas et ale , 1992 ; gokel et al ., 1992 ; rudnick et al ., 1992 ; footnote 3 ). the methods used to synthesize 40 additional fatty acids included in the panel are described below . melting points were measured on a laboratory devices mel - temp apparatus in open capillaries and are uncorrected . 1 h - nmr spectra were recorded on a hitachi perkin - elmer r - 600 high resolution nmr spectrometer and on a varian vxr 400 superconducting nmr spectra were obtained in cdcl 3 and are reported in ppm ( δ ) downfield from internal me 4 si . ir spectra were recorded on a perkin - elmer model 298 or 599 infrared spectrophotometer . tlc analyses were performed of silica gel 60f - 254 plates ( thickness = 0 . 20 mm ; merck ). column chromatography was carried out with merck kieselgel 60 ( 70 - 230 mesh ). combustion analyses were conducted by atlantic microlab inc ., atlanta , ga . high resolution mass spectrometry was conducted at the southern california mass spectrometer facility , department of chemistry , university of california , riverside . the ci / nh 3 experiments did not typically show mh + ions so high resolution mass spectrometry was done on mnh 4 + ions . phosphonium bromide was treated with potassium t - butoxide in tetrahydrofuran ( thf ) under nitrogen with stirring for 30 min . the solution was cooled with ice . aldehyde in thf was added dropwise , and the mixture was stirred for 12 h . the mixture was poured into water ( 150 ml ), washed with et 2 o ( 50 ml ), acidified ( ph = 1 , 2n hcl ) and extracted ( hexanes , 4 × 50 ml ), dried over mgso 4 , and the solvent was removed in vacuo . chromatography ( silica gel , 1 : 1 hexanes - ethyl acetate ) and crystallization or kugelrohr distillation yielded the product . a nitrile or ester containing compound , sodium hydroxide h 2 o ( 20 ml ), and etoh ( 20 ml ) were mixed and refluxed for 16 h . the mixture was cooled to room temperature , acidified ( ph = 1 , 2n hcl ), and extracted with ethyl acetate ( 4 × 50 ml ). the organic solution was washed with water ( 2 × 50 ml ), dried over mgso 4 and evaporated . the residue was crystallized or distilled to afford the product . an unsaturated compound , 5 % pd / c or pd / baso 4 and anhydrous etoh ( 50 ml ) were shaken under 15 psi h 2 for 1 . 0 - 4 . 0 h . the catalyst was filtered and washed with etoh ( 2 × 15 ml ). the solvent was evaporated in vacuo . the residue was crystallized or kugelrohr distilled to afford the product . this compound was synthesized from 7 - carboxyheptyltriphenylphosphonium bromide ( 9 . 71 g , 20 mmol ) and 2 - trans - hexenal ( 1 . 96 g , 20 mmol ) in 10 % hexamethylphosphoric triamide ( hmpa )- thf ( 100 ml ) by a wittig reaction . kugelrohr distillation yielded the product ( 1 . 97 g , 44 %) as a yellow oil ( bp 123 °- 126 ° c ./ 0 . 01 torr ). ir : 3450 - 2500 , 1720 cm - 1 ; 1 h - nmr : 0 . 95 ( t , 3h ), 1 . 35 ( m , 8h ), 1 . 62 m , 2h ), 2 . 05 ( m , 4h ), 2 . 32 ( t , 2h ), 5 . 23 ( m , 1h ), 5 . 60 ( m , 1h ), 5 . 90 ( m , 1h ), 6 . 05 ( m , 1h ), 10 . 50 ( bs , 1h ). anal . calcd . for c 14 h 24 o 2 : c , 74 . 95 , h , 10 . 78 %; found : c , 75 . 01 , h , 10 . 80 %. this compound was synthesized from 5 - carboxypentyltriphenylphosphonium bromide ( 9 . 50 g , 20 mmol ) and 2 - trans - octenal ( 2 . 52 g , 20 mmol ) in 10 % hmpa - thf ( 100 ml ) by wittig reaction . kugelrohr distillation yielded the product ( 1 . 91 g , 43 %) as a pale yellow oil ( bp 122 °- 125 ° c ./ 0 . 01 torr ). ir : 3500 - 2500 , 1730 cm - 1 ; 1 h - nmr : 0 . 95 ( t , 3h ), 1 . 40 ( m , 10h ), 2 . 30 ( m , 6h ), 6 . 00 ( m , 4h ), 11 . 30 ( bs , 1h ). anal . calcd . for c 14 h 24 o 2 : c , 74 . 95 , h , 10 . 78 %; found : c , 75 . 04 , h , 10 . 80 %. this compound was synthesized from 4 - carboxybutyltriphenylphosphonium bromide ( 8 . 87 g , 20 mmol ) and 2 - trans - nonenal ( 2 . 80 g , 20 mmol ) in 10 % hmpa - thf ( 100 ml ) by a wittig reaction . kugelrohr distillation afforded the product ( 1 . 96 g , 44 %) as a pale yellow oil ( bp 116 °- 119 ° c ./ 0 . 01 torr ). ir : 3500 - 2500 , 1730 cm - 1 ; 1 h - nmr : 0 . 90 ( t , 3h ), 1 . 35 ( m , 10h ), 2 . 30 ( m , 6h ), 5 . 90 ( m , 4h ), 10 . 05 ( bs , 1h ). anal . calcd . for c 14 h 24 o 2 : c , 74 . 95 , h , 10 . 78 %; found : c , 74 . 87 , h , 10 . 79 %. phenol ( 1 . 88 g , 20 mmol ) was mixed with naoh ( 0 . 80 g , 20 mmol ) in etoh ( 50 ml ). 8 - bromooctanoic acid ( 2 . 23 g , 10 mmol ) was then added to the mixture and refluxed for 12 h . after cooling to room temperature , water ( 100 ml ) was added and the mixture was acidified with 2n hcl ( ph = 2 ). the solid was filtered and washed with water ( 2 × 50 ml ), and recrystallized from hexane - ethyl acetate ( 5 : 1 ) to give the product as white brick - like crystals ( 1 . 79 g , 76 %), mp 67 °- 68 ° c . ; 1 h - nmr : 1 . 42 ( m , 6h ), 1 . 65 ( m , 2h ), 1 . 80 ( m , 2h ), 2 . 37 ( t , 2h ), 3 . 97 ( t , 2h ), 6 . 93 ( m , 3h ), 7 . 30 ( t , 2h ), 10 . 05 ( bs , 1h ). anal . calcd . for c 14 h 20 o 3 : c , 71 . 16 , h , 8 . 53 %; found : c , 71 . 09 , h , 8 . 54 %. this compound was synthesized from 6 - cyanohexyltriphenylphosphonium bromide ( 9 . 05 g , 20 mmol ) and p - anisaldehyde ( 2 . 72 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . kugelrohr distillation afforded the products ( 3 . 26 g , 71 %) as a colorless liquid ( bp : 143 °- 146 ° c ./ 0 . 05 torr ). ir : 2285 cm - 1 ; 1 h - nmr : 1 . 50 ( m , 6h ), 2 . 30 ( m , 4h ), 3 . 80 ( s , 3h ), 5 . 50 ( m , 1h ), 6 . 30 ( d , 1h ), 7 . 05 ( q , 4h ). this compound was synthesized from 8 -( p - methoxyphenyl )- 7 - octennitrile ( 3 . 34 g , 15 mmol ) by a hydrolysis reaction . crystallization ( hexanes - ethyl acetate ) yielded the product ( 3 . 29 g , 88 %) as white crystals ( mp 42 °- 43 ° c .). ir : 3400 - 2500 , 1730 cm - 1 ; 1 h - nmr : 1 . 50 ( m , 6h ), 2 . 35 ( m , 4h ), 3 . 82 ( s , 3h ), 5 . 55 ( m , 1h ), 6 . 35 ( d , 1h ), 7 . 05 ( q , 4h ), 11 . 20 ( bs , 1h ). anal . calcd . for c 15 h 20 o 2 : c , 72 . 55 , h , 8 , 12 % found : c , 72 . 41 , h , 8 . 07 %, z : e = 67 : 33 . this compound was synthesized from 8 -( p - methoxyphenyl )- 7 - octenoic acid ( 1 . 24 g , 5 mmol ) and pd / baso 4 ( 125 mg ) by hydrogenation . crystallization ( petroleum ether ) afforded the product ( 1 . 20 g , 96 %) as white crystals ( mp 42 °- 43 ° c .). ir : 3400 - 2500 , 1705 cm - 1 ; 1 h - nmr : 1 . 40 ( m , 10h ), 2 . 40 ( m , 4h ), 3 . 80 ( s , 3h ), 6 . 95 ( q , 4h ), 10 . 10 ( bs , 1h ). anal . calcd . for c 15 h 22 o 2 : c , 71 . 97 , h , 8 . 86 %; found : c , 72 . 07 , h , 8 . 88 %. this compound was synthesized from 5 - carboxypentyltriphenylphosphonium bromide ( 9 . 50 g , 20 mmol ) and p - ethoxybenzaldehyde ( 3 . 00 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . crystallization ( hexanes - ethyl acetate ) afforded the product ( 3 . 18 g , 64 %) as white crystals ( mp 62 °- 63 ° c . ), ir : 3450 - 2500 , 1720 cm - 1 ; 1 h - nmr : 1 . 40 ( t , 3h ), 1 . 50 ( m , 2h ), 1 . 70 ( m , 2h ), 2 . 38 ( m , 4h ), 4 . 00 ( q , 2h ), 5 . 72 + 6 . 05 ( m , 1h ), 6 . 32 ( t , 1h ), 7 . 05 ( q , 4h ), 10 . 10 ( bs , 1h ). anal . calcd . for c 15 h 20 o 3 : c , 72 . 55 , h , 8 . 12 % found : c , 72 . 53 , h , 8 . 15 %. z : e = 45 : 55 . this compound was synthesized from 7 -( p - ethoxyphenyl )- 6 - heptenoic acid ( 1 . 24 g , 5 mmol ) and pd / c ( 125 mg ) by a hydrogenation reaction . crystallization ( petroleum ether ) afforded the product ( 1 . 21 g , 97 %) as white crystals ( mp 65 °- 66 ° c .). ir : 3400 - 2500 , 1715 cm - 1 ; 1 h - nmr : 1 . 32 ( m , 7h ), 1 . 55 ( m , 5h ), 2 . 30 ( t , 2h ), 2 . 50 ( t , 2h ), 3 . 95 ( q , 2h ), 6 . 90 ( q , 2h ), 10 . 20 ( bs , 1h ). anal . calcd . for c 15 h 22 o 3 : c , 71 . 97 , h , 8 . 86 %; found : c , 71 . 91 , h , 8 . 87 %. this compound was synthesized from 4 - carboxybutyltriphenylphosphonium bromide ( 8 . 87 g , 20 mmol ) and p - propoxybenzaldehyde ( 3 . 28 g , 20 mmol , synthesized from p - hydroxybenzaldehyde and 1 - iodopropane ) in thf ( 100 ml ) by a wittig reaction . crystallization ( petroleum ether ) afforded the product ( 3 . 75 g , 76 %) as white crystals ( mp , 49 °- 50 ° c .). ir : 3400 - 2500 , 1725 cm - 1 ; 1 h - nmr : 1 . 00 ( t , 3h ), 1 . 75 ( m , 4h ), 2 . 35 ( m , 4h ), 3 . 90 ( t , 2h ), 5 . 55 ( m , 1h ), 6 . 35 ( m , 1h ), 7 . 00 ( g , 4h ), 11 . 30 ( bs , 1h ). anal . calcd . for c 15 h 20 o 3 : c , 72 . 55 , h , 8 . 12 %; found : c , 72 . 45 , h , 8 . 13 %. z : e = 35 : 65 . this compound was synthesized from 6 -( p - propoxyphenyl )- 5 - hexenoic acid ( 1 . 49 g , 6 mmol ) and pd / baso 4 ( 150 mg ) by a hydrogenation reaction . crystallization ( petroleum ether ) yielded the product ( 1 . 38 g , 92 %) as white crystals ( mp 42 °- 43 ° c . ), ir : 3400 - 2500 , 1715 cm - 1 ; 1 h - nmr : 1 . 00 ( t , 3h ), 1 . 55 ( m , 8h ), 2 . 40 ( m , 4h ), 3 . 90 ( t , 2h ), 6 . 95 ( q , 4h ), 7 . 90 ( bs , 1h ). anal . calcd . for c 15 h 22 o 3 : c , 71 . 97 , h , 8 . 86 %; found : c , 72 . 04 , h , 8 . 88 %. phenol ( 3 . 10 g , 33 mmol ), 1 , 7 - dibromoheptane ( 7 . 74 g , 30 mmol ) and naoh ( 1 . 34 g , 33 mmol ) were refluxed in etoh ( 40 ml ) for 30 h . after cooling to room temperature , water ( 150 ml ) was added and the mixture was extracted with ethyl acetate ( 4 × 50 ml ). the organic phase was washed with water ( 50 ml ) and brine ( 50 ml ), and the mixture was dried over na 2 so 4 . after evaporation of solvent , the residue was purified by kugelrohr distillation to give 7 - phenoxyheptyl bromide ( 2 . 46 g , 30 %), bp 126 °- 130 ° c ./ 0 . 10 torr , 1 h - nmr : 1 . 2 - 1 . 9 ( m , 10h ), 3 . 36 ( t , 2h ), 3 . 91 ( t , 2h ), 6 . 7 - 7 . 2 ( m , 5h ). sodium ( 0 . 22 g , 9 . 6 mmol ) was dissolved in etoh ( 20 ml ). diethyl malonate ( 1 . 53 g , 9 . 6 mmol ) in etoh ( 5 ml ) and 7 - phenoxyheptyl bromide ( 2 . 36 g , 8 . 7 mmol ) in etoh ( 5 ml ) were subsequently added at room temperature . the reaction mixture was refluxed for 8 h . after evaporation of the solvent , the residue was taken up in ethyl acetate ( 150 ml ). the organic phase was washed with water ( 2 × 50 ml ), and brine ( 50 ml ), and dried over na 2 so 4 . the crude product was purified by kugelrohr distillation to give ethyl 2 - ethoxycarbonyl - 9 - phenoxynonanoate ( 1 . 92 g , 63 %), bp 150 °- 154 ° c ./ 0 . 1 torr , 1 h - nmr : 1 . 24 ( t , 6h ), 1 . 1 - 1 . 8 ( m , 12h ), 3 . 30 ( t , 1h ), 3 . 91 ( t , 2h ), 4 . 18 ( q , 4h ), 6 . 7 - 7 . 2 ( m , 5h ). a solution of ethyl 2 - ethoxycarbonyl - 9 - phenoxynonanoate ( 1 . 84 g , 5 . 3 mmol ) in 20 % naoh ( 20 ml ) was refluxed for 10 h . the solution was acidified with hcl ( ph = 2 ) and extracted with ethyl acetate ( 3 × 50 ml ). the organic phase was washed with water ( 2 × 30 ml ), and brine ( 30 ml ), and dried over na 2 so 4 . after removal of the solvent in vacuo , the residue was heated on an oil bath at 180 °- 200 ° c . for 10 min . the crude product was distilled ( kugelrohr ) followed by crystallization ( hexane ) to give the product ( 1 . 14 g , 85 %), mp 66 . 5 °- 67 . 5 ° c . ( lit . 3 68 °- 69 ° c .). ir : 3450 - 2550 , 1720 cm - 1 ; 1 h - nmr : 1 . 26 - 1 . 39 ( m , 8h ), 1 . 61 ( q , 2h ), 1 . 75 ( q , 2h ), 2 . 34 ( t , 2h ), 3 . 93 ( t , 2h ), 6 . 83 - 6 . 96 ( m , 3h ), 7 . 28 ( t , 2h ), 10 . 8 ( bs , 1h ). a . 7 - phenylthioheptyl bromide was prepared from thiophenol ( 4 . 40 g , 40 mmol ) and 1 , 7 - dibromoheptane ( 10 . 32 g , 40 mmol ) as described above for 7 - phenoxyheptyl bromide . yield : 46 % bp ; 132 °- 136 ° c ./ 0 . 05 torr ; 1 h - nmr : 1 . 30 - 1 . 85 ( m , 10h ), 2 . 90 ( t , 2h ), 3 . 35 ( t , 2h ), 7 . 25 ( s , 5h ). b . ethyl 2 - ethoxycarbonyl - 9 - phenylthiononanoate was prepared from 7 - phenylthioheptyl bromide ( 4 . 31 g , 15 mmol ) and diethyl malonate ( 3 . 20 g , 20 mmol ) according to the procedure given above . yield : 68 %, bp : 174 °- 178 ° c ./ 0 . 05 torr ; 1 h - nmr : 1 . 15 - 1 . 90 ( m , 18h ), 2 . 90 ( t , 2h ), 3 . 30 ( t , 1h ), 4 . 20 ( q , 4h ), 7 . 25 ( s , 5h ). c . 9 - phenylthiononanoic acid was obtained from ethyl 2 - ethoxycarbonyl - 9 - phenylthiononanoate ( 3 . 66 g , 10 mmol ) by basic hydrolysis as described above . yield : 82 %, mp 67 °- 68 ° c . ; ir : 3450 - 2550 , 1695 cm - 1 ; 1 h - nmr : 1 . 20 - 1 . 80 ( m , 12h ), 2 . 35 ( t , 2h ), 2 . 85 ( t , 2h ), 7 . 20 ( s , 5h ), 10 . 50 ( bs , 1h ). anal . calcd . for c 15 h 22 o 2 s : c , 67 . 63 ; h , 8 . 32 ; s , 12 . 03 %. found : c , 67 . 54 ; h , 8 . 31 ; s , 12 . 09 %. a . 6 - benzyloxyhexyl bromide was prepared from benzyl alcohol ( 4 . 75 g , 44 mmol ) and 1 , 6 - dibromohexane ( 9 . 76 g , 40 mmol ) using the general procedure given above . yield : 36 %, bp 100 °- 105 ° c ./ torr : 1 h - nmr : 1 . 2 - 1 . 9 ( m , 8h ), 3 . 37 ( t , 4h ), 4 . 46 ( s , 2h ), 7 . 28 ( m , 5h ). b . ethyl 2 - ethoxycarbonyl - 8 - benzyloxyoctanoate was prepared from 6 - benzyloxyhexyl bromide ( 3 . 52 g , 13 mmol ) and diethyl malonate ( 2 . 29 g , 14 mmol ) according to the general procedure given above . yield 60 %, bp 152 °- 158 ° c ./ 0 . 15 torr . 1 h - nmr : 1 . 24 ( t , 6h ), 1 . 2 - 1 . 9 ( m , 10h ), 3 . 43 ( t , 2h ), 4 . 18 ( q , 4h ), 4 . 45 ( s , 2h ), 7 . 27 ( m , 5h ). c . 8 - benzyloxyoctanoic acid was prepared from ethyl 2 - ethoxycarbonyl - 8 - benzyloxyoctanoate ( 2 . 6 g , 7 . 4 mmol ) by basic hydrolysis as described above . yield : 83 %, bp 158 °- 162 ° c ./ 0 . 15 torr ; ir : 3450 - 2550 , 1710 cm - 1 ; 1 h - nmr : 1 . 24 - 1 . 43 ( m , 6h ), 1 . 54 - 1 . 69 ( m , 4h ), 2 . 31 ( t , 2h ), 3 . 46 ( t , 2h ), 4 . 51 ( s , 2h ), 7 . 23 - 7 . 38 ( m , 5h ), 9 . 55 ( bs , 1h ). anal . calcd . for c 15 h 22 o 3 : c , 71 . 97 ; h , 8 . 86 %. found : c , 71 . 83 ; h , 8 . 90 %. nah ( 0 . 63 g , 16 mmol ) was washed with hexane and then suspended in dry thf ( 60 ml ). benzylmercaptan ( 1 . 86 g , 15 mmol ) in thf ( 20 ml ) was added and the mixture stirred for 30 min . at room temperature . ethyl 8 - iodooctanoate ( 4 . 47 g , 15 mmol ) in thf ( 20 ml ) was added and the mixture was refluxed for 12 h . after evaporation of the solvent , the residue was dissolved in ethyl acetate ( 150 ml ). the organic phase was washed with water ( 2 × 50 ml ), and brine ( 50 ml ) and dried over na 2 so 4 . the crude product was purified by column chromatography on silica gel with ethyl acetate : hexane ( 1 : 5 ) and subsequent kugelrohr distillation to give ethyl 8 - benzylthiooctanoate ( 3 . 7 g , 84 %), bp 134 °- 138 ° c ./ 0 . 15 torr . 1 h - nmr : 1 . 21 ( t , 3h ), 1 . 2 - 1 . 8 ( m , 10h ), 2 . 27 ( t , 4h ), 3 . 68 ( s , 2h ), 4 . 09 ( q , 2h ), 7 . 24 ( m , 5h ). a solution of ethyl 6 - benzylthiooctanoate ( 2 . 94 g , 10 mmol ) and 1m naoh ( 60 ml , 60 mmol ) in meoh ( 30 ml ) was heated at 70 ° c . for 6 h . the reaction mixture was acidified with hcl ( ph = 1 ) and extracted with ethyl acetate ( 150 ml ). the organic phase was washed with water ( 2 × 50 ml ), and brine ( 50 ml ), and dried over na 2 so 4 . the crude product was purified by crystallization from hexane to afford the product ( 2 . 45 g , 92 %), mp 37 °- 37 . 5 ° c . ; ir : 3400 - 2500 , 1700 cm - ; 1 h - nmr : 1 . 18 - 1 . 43 ( m , 6h ), 1 . 52 ( q , 2h ), 1 . 61 ( q , 2h ), 2 . 33 ( t , 2h ), 2 . 39 ( t , 2h ), 3 . 69 ( s , 2h ), 7 . 12 - 7 . 38 ( m , 5h ), 9 . 45 ( bs , 1h ). anal . calcd . for c 15 h 22 so 2 : c , 67 . 63 , h , 8 . 32 %; found : c , 67 . 74 , h , 8 . 35 %. this compound was synthesized from 6 - cyanohexyltriphenylphosphonium bromide ( 9 . 05 g , 20 mmol ) and p - propylbenzaldehyde ( 2 . 96 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . kugelrohr distillation afforded the product ( 3 . 25 g , 67 %) as a colorless liquid ( bp 144 °- 148 ° c ./ 0 . 05 torr ). ir 2290 cm - 1 ; 1 h - nmr : 0 . 95 ( t , 3h ), 1 . 55 ( m , 8h ), 2 . 40 ( m , 6h ), 5 . 60 ( m , 1h ), 6 . 40 ( d , 1h ), 7 . 10 ( s , 4h ). this compound was synthesized from 8 -( p - propylphenyl )- 7 - octenenitrile ( 2 . 41 g , 10 mmol ) by a hydrolysis reaction . kugelrohr distillation afforded the product ( 2 . 36 g , 90 %) as a colorless oil ( bp 148 °- 152 ° c ./ 0 . 05 torr ). ir : 3400 - 2500 , 1720 cm - 1 ; 1 h - nmr : 0 . 95 ( t , 3h ), 1 . 45 ( m , 8h ), 2 . 45 ( m , 6h ), 5 . 65 ( m , 1h ), 6 . 40 ( d , 1h ), 7 . 15 ( s , 4h ), 11 . 30 ( bs , 1h ). anal . calcd . for c 17 h 24 o 2 : c , 78 . 42 , h , 9 . 29 %; found : c , 78 . 43 , h , 9 . 30 %. z : e = 88 : 12 . this compound was synthesized from 8 -( p - propylphenyl )- 7 - octenoic acid ( 1 . 30 g , 5 mmol ) and pd / baso 4 ( 130 mg ) by a hydrogenation reaction . crystallization ( petroleum ether ) afforded the product ( 1 . 25 g , 95 %) as white crystals ( mp 42 °- 43 ° c .). ir : 3400 - 2500 , 1705 cm - 1 ; 1 h - nmr : 0 . 95 ( t , 3h ), 1 . 45 ( m , 12h ), 2 . 50 ( m , 6h ), 7 . 05 ( s , 4h ), 11 . 40 ( bs , 1h ). anal . calcd . for c 17 h 26 o 2 : c , 77 . 82 , h , 9 . 99 %; found : c , 77 . 75 , h , 10 . 04 %. this compound was synthesized from 5 - carboxypentyltriphenylphosphonium bromide ( 9 . 50 g , 20 mmol ) and p - butylbenzaldehyde ( 3 . 24 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . kugelrohr distillation yielded the product ( 2 . 67 g , 51 %) as a colorless oil ( bp 154 °- 157 ° c ./ 0 . 05 torr ). ir : 3400 - 2500 , 1720 cm - 1 , 1 h - nmr : 0 . 92 ( t , 3h ), 1 . 50 ( m , 8h ), 2 . 30 ( m , 4h ), 2 . 58 ( m , 2h ), 5 . 58 + 6 . 15 ( m , 1h ), 6 . 38 ( t , 1h ), 7 . 18 ( m , 4h ), 0 . 30 ( bs , 1h ). anal . calcd . for c 17 h 24 o 2 : c , 78 . 42 , h , 9 . 29 %; found : c , 78 . 38 , h , 9 . 29 %. z : e = 62 : 38 . this compound was synthesized from 7 -( p - butylphenyl )- 6 - heptenoic acid ( 1 . 30 g , 5 mmol ) by a hydrogenation reaction using pd / c ( 130 mg ). crystallization ( petroleum ether ) afforded the product ( 1 . 19 g , 97 %) as white crystals ( mp 32 °- 33 ° c .). ir : 3400 - 2500 , 1718 cm - 1 ; 1 h - nmr : 0 . 92 ( t , 3h ), 1 . 35 ( m , 6h ), 1 . 60 ( m , 6h ), 2 . 32 ( t , 2h ), 2 . 55 ( m , 4h ), 7 . 02 ( s , 4h ), 9 . 70 ( bs , 1h ). anal . calcd . for c 17 h 26 o 2 : c , 77 . 82 , h , 9 . 99 %; found : c , 77 . 73 , h , 10 . 01 %. this compound was synthesized from p - pentylbenzaldehyde ( 3 . 52 g , 20 mmol , prepared from p - pentylbenzoyl chloride and lithium tri ( t - butoxy ) aluminum hydride ) and 4 - carboxybutyltriphenylphosphonium bromide ( 8 . 86 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . kugelrohr distillation ( bp 147 °- 151 ° c ./ 0 . 05 torr ) afforded the product ( 2 . 49 g , 48 %). ir : 3400 - 2500 , 1725 cm - 1 ; 1 h - nmr : 0 . 90 ( t , 3h ), 1 . 28 ( m , 6h ), 1 . 82 ( m , 2h ), 1 . 37 ( m , 4h ), 2 . 57 ( t , 2h ), 5 . 55 + 6 . 10 ( m , 1h ), 6 . 38 ( m , 1h ), 7 . 10 ( m , 4h ), 10 . 50 ( bs , 1h ). anal . calcd . for c 17 h 24 o 2 : c , 78 . 42 , h , 9 . 29 %; found : c , 78 . 22 , h , 9 . 27 %. z : e = 35 : 65 . this compound was synthesized from 6 -( p - pentylphenyl )- 5 - hexenoic acid ( 1 . 30 g , 5 mmol ) by hydrogenation reaction using pd / c ( 130 mg ). crystallization ( petroleum ether ) afforded the product ( 1 . 13 g , 87 %) as white crystals ( mp 29 °- 30 ° c . ), ir : 3400 - 2500 , 1730 cm - 1 ; 1 h - nmr : 0 . 89 ( t , 3h ), 1 . 32 ( m , 6h ), 1 . 60 ( m , 6h ), 2 . 35 ( t , 2h ), 2 . 58 ( m , 4h ), 7 . 07 ( s , 1h ), 10 . 30 ( bs , 1h ). anal . calcd . for c 17 h 26 o 2 : c , 77 . 82 , h , 9 . 99 %; found : c , 77 . 56 , h , 9 . 90 %. this compound was synthesized from p - propoxybenzaldehyde ( 3 . 26 g , 20 mmol , prepared from 1 - bromopropane and 4 - hydroxybenzaldehyde ) and 5 - carboxypentyltriphenylphosphonium bromide ( 9 . 50 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . crystallization ( petroleum ether ) afforded the product ( 3 . 15 g , 60 %) as white crystals ( mp : 52 °- 53 ° c .). ir : 3450 - 2500 , 1730 cm - 1 ; 1 h - nmr : 1 . 00 ( t , 3h ), 1 . 48 ( m , 2h ), 1 . 67 ( m , 2h ), 1 . 82 ( m , 2h ), 2 . 35 ( m , 4h ), 3 . 92 ( t , 2h ), 5 . 72 + 6 . 05 ( m , 1h ), 6 . 35 ( d , 1h ), 7 . 05 ( q , 4h ), 10 . 40 ( bs , 1h ). anal . calcd . for c 16 h 22 o 3 : c , 73 . 25 , h , 8 . 45 %. found : c , 73 . 15 , h , 8 . 45 %. z : e = 30 : 70 . this compound was synthesized from 7 -( p - propoxyphenyl )- 6 - heptenoic acid ( 1 . 31 g , 5 mmol ) by hydrogenation reaction using pd / c ( 130 mg ). crystallization ( petroleum ether ) afforded the product ( 1 . 23 g , 93 %) as white crystals ( mp : 49 °- 50 ° c .). ir : 3450 - 2550 , 1725 cm - 1 ; 1 h - nmr : 1 . 00 ( t , 3h ), 1 . 37 ( m , 4h ), 1 . 60 ( m , 4h ), 1 . 79 ( m , 2h ), 2 . 36 ( t , 2h ), 2 . 53 ( t , 2h ), 3 . 87 ( t , 2h ), 6 . 95 ( q , 4h ), 9 . 80 ( bs , 1h ). anal . calcd . for c 16 h 24 o 3 : c , 72 . 69 , h , 9 . 15 %; found : c , 72 . 79 , h , 9 . 16 %. this compound was synthesized from 4 - carboxybutyltriphenylphosphonium bromide ( 8 . 86 g , 20 mmol ) and p - butoxybenzaldehyde ( 3 . 56 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . crystallization ( petroleum ether ) afforded the product ( 3 . 82 g , 73 %) as white crystals ( mp : 56 °- 57 ° c .). ir : 3350 - 2500 , 1700 cm - 1 ; 1 h - nmr : 1 . 00 ( t , 3h ), 1 . 50 ( m , 2h ), 1 . 80 ( m , 4h ), 2 . 40 ( m , 4h ), 3 . 90 ( t , 2h ), 5 . 50 + 6 . 00 ( m , 1h ), 6 . 38 ( q , 1h ), 7 . 05 ( q , 4h ), 11 . 00 ( bs , 1h ). anal . calcd . for c 16 h 22 o 3 : c , 73 . 25 , h , 8 . 45 %; found : c , 73 . 32 , h , 8 . 46 %. z : e = 37 : 63 . this compound was synthesized from 6 -( p - butoxyphenyl )- 5 - hexenoic acid ( 2 . 62 g , 10 mmol ) by a hydrogenation reaction using pd / c ( 260 mg ). crystallization ( petroleum ether ) afforded the product ( 2 . 49 g , 94 %) as white crystals ( mp 39 °- 40 ° c .). ir : 3400 = 2500 , 1705 cm - 1 ; 1 h - nmr : 0 . 96 ( t , 3h ), 1 . 35 ( m , 2h ), 1 . 50 ( m , 2h ), 1 . 62 ( m , 4h ), 1 . 75 ( m , 2h ), 2 . 35 ( t , 2h ), 2 . 52 ( t , 2h ), 3 . 92 ( t , 2h ), 6 . 95 ( q , 4h ), 10 . 30 ( bs , 1h ). anal . calcd . for c 16 h 24 o 3 : c , 72 . 69 , h , 9 . 15 %; found : c , 72 . 78 , h , 9 . 18 %. nah ( 0 . 25 g , 11 mmol ) was washed with hexane and then suspended in dry thf ( 50 ml ). 4 - ethylphenol ( 1 . 22 g , 10 mmol ) in thf ( 20 ml ) was added and stirred for 30 min at room temperature . ethyl 8 - iodooctanoate ( 2 . 98 g , 10 mmol ) in thf ( 20 ml ) was added and the mixture was refluxed for 12 h . after evaporation of the solvent , the residue was dissolved in ethyl acetate ( 150 ml ), and the organic phase was washed with water ( 2 × 50 ml ), and brine ( 50 ml ) and dried over na 2 so 4 . the crude product as purified by column chromatography on silica gel ( ethyl acetate : hexane = 1 : 5 ) and subsequent kugelrohr distillation to give the product ( 0 . 85 g , 24 %), bp 122 °- 126 ° c ./ 0 . 1 torr . ir : 1740 cm - 1 ; 1 h - nmr : 1 . 19 ( t , 3h ), 1 . 25 ( t , 3h ), 1 . 30 - 1 . 80 ( m , 10h ), 2 . 28 ( t , 2h ), 2 . 57 ( q , 2h ), 3 . 90 ( t , 2h ), 4 . 12 ( q , 2h ), 6 . 86 ( d , 2h ), 7 . 08 ( d , 2h ). this compound was synthesized from ethyl 8 -( 4 - ethyl ) phenoxyoctanoate ( 1 . 76 g , 5 mmol ) by a hydrolysis reaction . crystallization from hexane gave white crystals ( 1 . 40 g , 87 %), mp 77 °- 78 ° c . ; ir : 3450 - 2950 , 1720 cm - 1 ; 1 h - nmr : 1 . 17 ( t , 3h ), 1 . 29 - 1 . 49 ( m , 6h ), 1 . 63 ( q , 2h ), 1 . 74 ( q , 2h ), 2 . 31 ( t , 2h ), 2 . 56 ( q , 2h ), 3 . 88 ( t , 2h ), 6 . 77 ( d , 2h ), 7 . 06 ( d , 2h ), 10 . 2 ( bs , 1h ). anal . calcd . for c 16 h 24 o 3 : c , 72 . 69 , h , 9 . 15 %; found : c , 72 . 53 , h , 9 . 19 %. this compound was synthesized from 10 - carboxydecyltriphenylphosphonium bromide ( 10 . 55 g , 20 mmol ) and benzaldehyde ( 2 . 12 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . kugelrohr distillation ( bp 152 °- 155 ° c ./ 0 . 03 torr ) and crystallization afforded the product ( 2 . 43 g , 44 %) as white crystals ( mp 27 °- 27 . 5 ° c .). ir : 3400 - 2500 , 1720 , 700 cm - 1 ; 1 h - nmr : 1 . 30 ( m , 10h ), 1 . 40 ( m , 2h ), 1 . 62 ( m , 2h ), 2 . 35 ( m , 4h ), 5 . 65 ( m , 1h ), 6 . 40 ( m , 1h ), 7 . 25 ( m , 5h ), 10 . 40 ( bs , 1h ). anal . calcd . for c 18 h 26 o 2 : c , 78 . 79 , h , 9 . 55 %; found : c , 78 . 66 , h , 9 . 60 %. z : e = 93 : 7 . this compound was synthesized from 12 - phenyl - 10 - dodecenoic acid ( 1 . 92 g , 7 mmol ) by a hydrogenation reaction using pd / c ( 190 mg ). crystallization ( petroleum ether ) afforded the product ( 1 . 88 g , 97 %) as white crystals ( mp 47 °- 48 ° c .). ir : 3400 - 2500 , 1700 cm - 1 ; 1 h - nmr : 1 . 30 ( m , 14h ), 1 . 60 ( m , 4h ), 2 . 32 ( t , 2h ), 2 . 57 ( t , 2h ), 7 . 20 ( m , 5h ), 10 . 20 ( bs , 1h ). anal . calcd . for c 18 h 28 o 2 : c , 78 . 21 , h , 10 . 21 %; found : c , 78 . 29 , h , 10 . 25 %. this compound was synthesized from 7 - carboxyheptyltriphenylphosphonium bromide ( 9 . 71 g , 20 mmol ) and 2 - furaldehyde ( 1 . 92 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . kugelrohr distillation yielded the product ( 2 . 69 g , 61 %) as a pale yellow oil ( bp 136 °- 139 ° c ./ 0 . 05 torr ). ir : 3500 - 2500 , 1730 , 710 cm - 1 ; 1 h - nmr : 1 . 40 ( m , 8h ), 2 . 35 ( m , 4h ), 5 . 55 ( m , 1h ), 6 . 30 ( m , 3h ), 7 . 35 ( s , 1h ), 11 . 40 ( bs , 1h ). anal . calcd . for c 13 h 18 o 3 : c , 70 . 25 , h , 8 . 16 %; found : c , 69 . 98 , h , 8 . 26 %. z : e = 79 : 21 . this compound was synthesized from 9 -( 2 - furyl )- 8 - nonenoic acid ( 0 . 89 g , 4 mmol ) by a hydrogenation reaction using pd / baso 4 ( 90 mg ). crystallization ( petroleum ether ) afforded the product ( 0 . 84 g , 93 %) as white crystals ( mp 31 °- 32 ° c . ); ir : 3450 - 2500 , 1720 cm - 1 ; 1 h - nmr : 1 . 30 ( m , 8h ), 1 . 63 ( m , 4h ), 2 . 35 ( t , 2h ), 2 . 60 ( t , 2h ), 5 . 95 ( s , 1h ), 6 . 27 ( s , 1h ), 7 . 28 ( s , 1h ), 9 . 85 ( bs , 1h ). anal . calcd . for c 13 h 20 o 3 : c , 69 . 61 , h , 8 . 99 %; found : c , 69 . 42 , h , 9 . 04 %. this compound was synthesized from 5 - methylfurfural ( 2 . 20 g , 20 mmol ) and 7 - carboxyheptyltriphenylphosphonium bromide ( 9 . 71 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . kugelrohr distillation afforded the product ( 2 . 35 g , 50 %) as a yellow oil ( bp 140 °- 143 ° c ./ 0 . 05 torr ). ir : 3400 - 2500 , 1720 cm - 1 ; 1 h - nmr : 1 . 36 ( m , 4h ), 1 . 45 ( m , 2h ), 1 . 65 ( m , 2h ), 2 . 28 ( s , 3h ), 2 . 37 ( t , 2h ), 2 . 41 ( m , 2h ), 5 . 45 ( m , 1h ), 5 . 95 ( d , 1h ), 6 . 12 ( s , 1h ), 10 . 00 ( bs , 1h ). anal . calcd . for c 14 h 20 o 3 : c , 71 . 16 , h , 8 . 53 %; found : c , 70 . 85 , h , 8 . 63 %. z : e = 9 : 91 . this compound was synthesized from 9 -( 2 -( 5 - methyl ) furyl )- 8 - nonenoic acid ( 0 . 94 g , 4 mmol ) by a hydrogenation reaction using pd / baso 4 ( 94 mg ). crystallization ( petroleum ether ) afforded the product ( 0 . 87 g , 92 %) as white crystals ( mp 49 °- 50 ° c . ); ir : 3400 - 2500 , 1710 cm - 1 ; 1 h - nmr : 1 . 30 ( m , 8h ), 1 . 60 ( m , 4h ), 2 . 23 ( s , 3h ), 2 . 32 ( t , 2h ), 2 . 55 ( t , 2h ), 5 . 81 ( s , 2h ), 8 . 95 ( bs , 1h ). anal . calcd . for c 14 h 22 o 3 : c , 70 . 56 , h , 9 . 30 %; found : c , 70 . 39 , h , 9 . 33 %. this compound was synthesized from 2 - furaldehyde ( 1 . 92 g , 20 mmol ) and 9 - carboxynonyltriphenylphosphonium bromide ( 10 . 27 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . crystallization ( petroleum ether ) afforded the product ( 2 . 95 g , 59 %) as white crystals ( mp 45 °- 46 ° c . ); ir : 3450 - 2500 cm - 1 ; 1 h - nmr : 1 . 33 ( m , 8h ), 1 . 46 ( m , 2h ), 1 . 65 ( m , 2h ), 2 . 34 ( t , 2h ), 2 . 45 ( m , 2h ), 5 . 55 ( m , 1h ), 6 . 18 ( d , 1h ), 6 . 25 ( d , 1h ), 6 . 38 ( d , 1h ), 7 . 38 ( s , 1h ), 9 . 80 ( bs , 1h ). anal . calcd . for c 15 h 22 o 3 : c , 71 . 97 , h , 8 . 86 %; found : c , 71 . 93 , h , 8 . 87 %. z : e = 43 : 57 . this compound was synthesized from 11 -( 2 - furyl )- 10 - undecenoic acid ( 1 . 25 g , 5 mmol ) by a hydrogenation reaction using pd / baso 4 ( 125 mg ). crystallization ( petroleum ether ) afforded the product ( 1 . 13 g , 90 %) as white crystals ( mp 40 °- 41 ° c . ); ir : 3450 - 2500 , 1720 cm - 1 ; 1 h - nmr : 1 . 30 ( m , 12h ), 1 . 65 ( m , 4h ), 2 . 34 ( t , 2h ), 2 . 60 ( t , 2h ), 5 . 95 ( d , 1h ), 6 . 28 ( d , 1h ), 7 . 30 ( s , 1h ), 10 . 10 ( bs , 1h ). anal . calcd . for c 15 h 24 o 3 : c , 71 . 39 , h , 9 . 58 %; found : c , 71 . 21 , h , 9 . 63 %. this compound was synthesized from 10 - carboxydecyltriphenylphosphonium bromide ( 10 . 50 g , 20 mmol ) and furfural ( 1 . 92 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . crystallization afforded the product ( 2 . 38 g , 45 %) as pale yellow crystals ( mp 38 °- 39 ° c . ); ir : 3450 - 2500 , 1715 , 695 cm - 1 ; 1 h - nmr : 1 . 35 ( m , 14h ), 2 . 35 ( t , 4h ), 5 . 60 ( m , 1h ), 6 . 30 ( m , 3h ), 7 . 35 ( s , 1h ), 9 . 40 ( bs , 1h ). anal . calcd . for c 16 h 24 o 3 : c , 72 . 69 , h , 9 . 15 ; found : c , 72 . 44 , h , 9 . 06 %. z : e = 43 : 57 . this compound was synthesized from 7 - carboxyheptyltriphenylphosphonium bromide ( 9 . 71 g , 20 mmol ) and 2 - thiophenecarboxaldehyde ( 2 . 24 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . crystallization afforded the product ( 2 . 79 g , 59 %) as white crystals ( mp 45 °- 46 ° c .). ir : 3400 - 2500 , 1720 , 710 cm - 1 ; 1 h - nmr : 1 . 45 ( m , 8h ), 2 . 35 ( m , 4h ), 5 . 55 ( m , 1h ), 6 . 50 ( d , 1h ), 7 . 00 ( m , 3h ), 11 . 00 ( bs , 1h ). anal . calcd . for c 13 h 18 so 2 : c , 65 . 51 , h , 7 . 61 %; found : c , 65 . 58 , h , 7 . 63 %. z : e = 75 : 25 . this compound was synthesized from 9 -( 2 - thienyl )- 8 - nonenoic acid ( 1 . 19 g , 5 mmol ) by a hydrogenation reaction using pd / c ( 120 mg ). crystallization afforded the product ( 1 . 05 g , 88 %) as white crystals ( mp 32 °- 33 ° c . ); ir : 3400 - 2500 , 1715 , 705 cm - 1 ; 1 h - nmr : 1 . 35 ( m , 12h ), 2 . 35 ( t , 2h ), 2 . 85 ( t , 2h ), 6 . 95 ( m , 3h ), 10 . 35 ( bs , 1h ). anal . calcd . for c 13 h 20 so 2 : c , 64 . 96 , h , 8 . 39 %; found : c , 64 . 81 , h , 8 . 43 %. this compound was synthesized from 7 - carboxyheptylphenylphosphonium bromide ( 7 . 28 g , 15 mmol ) and 2 -( 5 - methyl ) thiophenecarboxaldehyde ( 1 . 92 g , 15 mmol ) in thf ( 100 ml ) by a wittig reaction . kugelrohr distillation ( bp 155 °- 159 ° c ./ 0 . 05 torr ) and crystallization ( petroleum ether ) afforded the product ( 2 . 43 g , 48 %) as pale yellow crystals ( mp 38 °- 39 ° c .). ir : 3400 - 2500 , 1715 cm - 1 ; 1 h - nmr : 1 . 40 ( m , 6h ), 1 . 65 ( m , 2h ), 2 . 37 ( m , 4h ), 2 . 45 ( s , 3h ), 5 . 45 + 5 . 90 ( m , 1h ), 6 . 41 ( t , 1h ), 6 . 65 ( m , 1h ), 6 . 75 ( d , 1h ), 10 . 05 ( bs , 1h ). anal . calcd . for c 14 h 20 o 2 s : c , 66 . 63 , h , 7 . 99 %; found : c , 66 . 54 , h , 8 . 02 %. z : e = 72 : 28 . this compound was synthesized from 9 -( 2 -( 5 - methyl ) thienyl )- 8 - nonenoic acid ( 1 . 01 g , 4 mmol ) by a hydrogenation reaction using pd / c ( 200 mg ). crystallization ( petroleum ether ) afforded the product ( 0 . 91 g , 89 %) as white crystals ( mp 39 °- 40 ° c .). ir : 3400 - 2500 , 1720 cm - 1 ; 1 h - nmr : 1 . 32 ( m , 8h ), 1 . 63 ( m , 4h ), 2 . 32 ( t , 2h ), 2 . 45 ( s , 3h ), 2 . 71 ( t , 2h ), 6 . 54 ( s , 2h ), 9 . 50 ( bs , 1h ). anal . calcd . for c 14 h 22 o 2 s : c , 66 . 10 , h , 8 . 72 %; found : c , 65 . 97 , h , 8 . 72 %. this compound was synthesized from 2 - thiophenecarboxaldehyde ( 2 . 24 g , 20 mmol ) and 9 - carboxynonyltriphenylphosphonium bromide ( 10 . 27 g , 20 mmol ) in thf ( 100 ml ) by a wittig reaction . crystallization ( hexanes - ethyl acetate ) afforded the product ( 2 . 45 g , 46 %) as white crystals ( mp 61 °- 62 ° c . ); ir : 3450 - 2500 , 1715 cm - 1 ; 1 h - nmr : 1 . 31 ( m , 8h ), 1 . 45 ( m , 2h ), 1 . 65 ( m , 2h ), 2 . 34 ( t , 2h ), 2 . 38 ( t , 2h ), 5 . 55 ( m , 1h ), 6 . 50 ( d , 1h ), 6 . 95 ( m , 2h ), 7 . 23 ( d , 2h ), 10 . 05 ( bs , 1h ). anal . calcd . for c 15 h 22 o 2 s : c , 67 . 63 , h , 8 . 32 %; found : c , 67 . 60 , h , 8 . 34 %. z : e = 19 : 81 . this compound was synthesized from 11 -( 2 - thienyl )- 10 - undecenoic acid ( 800 mg , 3 mmol ) by a hydrogenation reaction using pd / c ( 80 mg ). crystallization ( petroleum ether ) afforded the product ( 0 . 73 g , 91 %) as white crystals ( mp 41 °- 42 ° c . ): ir : 3450 - 2500 , 1715 cm - 1 ; 1 h - nmr : 1 . 30 ( m , 12h ), 1 . 63 ( m , 4h ), 2 . 32 ( t , 2h ), 2 . 80 ( t , 2h ), 6 . 78 ( d , 1h ), 6 . 90 ( t , 1h ), 7 . 10 ( d , 1h ), 9 . 80 ( bs , 1h ). anal . calcd . for c 15 h 24 o 2 s : c , 67 . 12 , h , 9 . 01 %; found : c , 67 . 55 , h , 8 . 89 %. the biological activity of a panel of fatty acid analogs that had been tested previously as substrates for purified e . coli - derived s . cerevisiae myristoylcoa : protein n - myristoyltransferase ( nmt ) were tested for toxicity against trypanosomes as potential candidates for anti - trypanosomal drugs . for purposes of comparison , several oxatetradecanoic acids described in u . s . pat . no . 5 , 151 , 445 as inhibitors of the growth and viability of bloodstream trypanosome parasites were included in the test panel . for convenience , this panel of fatty acid analogs was subdivided based on chemical differences in their secondary functional group . these functional groups vary with respect to their polarity , steric bulk , conformations , and to a limited degree , overall chain length . the 247 compounds thus tested are organized in table 2 , below , into 20 families . several of these functional groups should have complex effects on both conformation and stereoelectronic properties ( e . g . analogs with ester ) whereas others will predominantly affect only one of these properties ( e . g . conformation but not polarity in the case of olefins ; polarity but not conformation in the case of oxatetradecanoic acids ). in many of these families , the effects of the functional group have been assessed at every possible position from c3 through c13 in tetradecanoic acid ( e . g . see the thia - and oxotetradecanoic acids listed in table 2 ). to perform the large scale testing , a reproducible and rapid assay was employed . the method exploits the fact that growing trypanosomes secrete large amounts of pyruvic acid , an end product of glucose catabolism ( operdoes , 1987 ). the pyruvic acid causes a change in color of the phenol red indicator present in the culture medium , providing a quantitative measure of cell growth . a similar assay has been published previously ( zinsstag et al ., 1991 ). the detailed assay procedures used herein are as follows : trypanosomes were grown in the presence of analogs or positive and negative controls ( 11 - oxatetradecanoic acid and the ethanol solvent , respectively ). to avoid bias in data interpretation analog solutions were identified only by a code number . to evaluate reliability and reproducibility of the assay , several analogs were coded twice . all coded analogs were tested in quadruplicate on at least two separate occasions . after a standard growth period , the absorbance of the culture was determined at 550 nm and 405 nm and an efficacy value calculated from the ratio of these absorbances . results from a representative test are shown in fig1 . this set of coded compounds included samples of ethanol and 11 - oxatetradecanoic acid as both coded and uncoded samples ( compounds e and 24 and o11 and 27 respectively ). the excellent agreement between these samples and the controls attests to the reproducibility of this assay . quadruplicate samples were generally each within 5 % of the mean , and the ratio of the absorbance at 550 nm and 405 nm obtained for 11 - oxatetradecanoic acid averaged 1 . 12 with a standard error of 0 . 04 for over 100 determinations during a 6 month period . the analogs were grouped in terms of efficacy , defining 10 μm 11 - oxatetradecanoic acid as the center of group 3 and the ethanol controls as the center of group 1 ( fig1 ). the range of values were calculated defining each group independently for each test based on the 11 - oxatetradecanoic acid and ethanol values in that trial . this controlled for any differences in medium or cell growth . all compounds classified as group 3 were tested at least twice . after screening and categorizing all analogs in this manner , the code was broken and the structures of the compounds were matched with their efficacy . note that 11 - oxa -, 13 - oxa -, and 6 - oxatetradecanoic acids fall in groups 3 , 2 , and 1 , respectively . these values correlate well with their effects on trypanosome growth assessed by cell counts using a hemocytometer ( doering et al ., 1991 ). fig2 shows the structures of the 20 most active compounds which collectively define group 3 . they are presented in decreasing order of potency in table 1 , above , and as structural groups in fig2 . nine of the compounds are either thiatetradecanoic or oxatetradecanoic acids . the ether functional group is also present in conjunction with an aromatic residue in three other compounds . an additional four analogs contain oxygen , either in the form of a ketocarbonyl or an ester group . the remaining structures include 13 - nitrotridecanoic acid and three unsaturated , fourteen carbon carboxylic acids . 9 - tetradecynoic acid was the most potent anti - trypanosomal agent identified among the 247 compounds screened . for toxicity assays , cloned t . brucei ( strain 427 ) of variant antigen type 221 ( obtained from g . a . m . cross , rockefeller university ) were harvested from cd - 1 mice at a parasitemia of 2 - 5 × 10 8 trypanosomes / ml . after centrifugation of the infected blood ( 430 × g ; 8 min ; 4 ° c . ), the upper portion of the buffy coat was retained , with care taken to avoid contamination with erythrocytes . this material , consisting predominantly of trypanosomes , was then resuspended in bbs containing 1 mg / ml fatty acid free bovine serum albumin . the suspension was centrifuged ( 3 , 000 × g ; 8 min ; 4 ° c . ), and the cell pellet resuspended in culture medium to a final density of 1 . 5 × 10 7 cells / ml . ( the composition of this culture medium was as described above except that 40 μm monothioglycerol was added ; duszenko et al ., 1985 ; doering et al ., 1990 ; hamm et al ., 1990 .) the doubling time of trypanosomes under these culture conditions is approximately 6 h at 37 ° c . this rapid assay , which can accommodate multiple samples , depends on measurement of the color change produced in the medium &# 39 ; s phenol red indicator dye due to acidification by growing trypanosomes . stocks of analogs ( 10 mm in absolute ethanol , identified only by a code number ) were diluted in culture medium to twice the concentration to be tested . aliquots of 100 μl were dispensed into 96 - well microtiter plates and warmed to 37 ° c . in a 5 % co 2 incubator before the addition of an equal volume of cell suspension ( 1 . 5 × 10 7 / ml , see above ). all assays were performed in quadruplicate in each plate . control wells included appropriately diluted ethanol ( which had no effect on cell growth ) and 10 μm 11 - oxatetradecanoic acid . the plate was incubated for 36 h at 37 ° c . and then stored at 4 ° c . for 12 h to allow equilibration of co 2 in the medium with that in air . the absorbance of each sample , at 550 nm and 405 nm ( values chosen based on the absorption spectra of fresh and acidified media ), was then read in a uv max kinetic microplate reader ( molecular devices ). to control for any variation in sample volume , the ratio of absorbance at 550 nm to absorbance at 405 nm for each well was calculated . this ratio was then averaged for each quadruplicate set and normalized to the average obtained in the set of control wells containing 10 μm 11 - oxatetradecanoic acid , yielding an &# 34 ; efficacy value &# 34 ;. table 2__________________________________________________________________________screening fatty acid analogs for toxicity against t . brucei type 221structure reference efficacy group . sup . 1__________________________________________________________________________saturated fatty acids . sup . 2ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- cooh 1ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- cooh 1ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- cooh 1ch . sub . 3 --( ch . sub . 2 ). sub . 11 -- cooh 1ch . sub . 3 --( ch . sub . 2 ). sub . 12 -- cooh 1ch . sub . 3 --( ch . sub . 2 ). sub . 13 -- cooh 1ch . sub . 3 --( ch . sub . 2 ). sub . 14 -- cooh 1ch . sub . 3 --( ch . sub . 2 ). sub . 16 -- cooh 1ch . sub . 3 --( ch . sub . 2 ). sub . 18 -- cooh 1oxatetradecanoic acidsch . sub . 3 -- o --( ch . sub . 2 ). sub . 11 -- cooh kishore et al ., 1991 2ch . sub . 3 -- ch . sub . 2 -- o --( ch . sub . 2 ). sub . 10 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- o --( ch . sub . 2 ). sub . 9 -- cooh kishore et al ., 1991 3 *. sup . 3ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- o --( ch . sub . 2 ). sub . 8 -- cooh kishore et al ., 1991 3 * ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- o --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 3bch . sub . 3 --( ch . sub . 2 ). sub . 6 -- o --( ch . sub . 2 ). sub . 5 -- cooh kishore et al ., 1991 3 **. sup . 4ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- o --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- o --( ch . sub . 2 ). sub . 3 -- cooh kishore et al ., 1991 3 * ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- o --( ch . sub . 2 ). sub . 2 -- cooh kishore et al ., 1991 2ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- o -- ch . sub . 2 -- cooh kishore et al ., 1991 1thiatetradecanoic acidsch . sub . 3 -- s --( ch . sub . 2 ). sub . 11 -- cooh kishore et al ., 1991 3 * ch . sub . 3 -- ch . sub . 2 -- s --( ch . sub . 2 ). sub . 10 -- cooh kishore et al ., 1991 2ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- s --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 2ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- s --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 3b * ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- s --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 2ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- s --( ch . sub . 2 ). sub . 5 -- cooh kishore et al ., 1991 3 ** ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- s --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 2ach . sub . 3 --( ch . sub . 2 ). sub . 8 -- s --( ch . sub . 2 ). sub . 3 -- cooh kishore et al ., 1991 3 ** ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- s --( ch . sub . 2 ). sub . 2 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- s -- ch . sub . 2 -- cooh kishore et al ., 1991 1myristic acid analogs containing sulfur and / or oxygen substituentsch . sub . 3 -- ch . sub . 2 -- s --( ch . sub . 2 ). sub . 5 -- s --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch . sub . 2 -- s --( ch . sub . 2 ). sub . 2 -- o --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 2ch . sub . 3 -- ch . sub . 2 -- o --( ch . sub . 2 ). sub . 2 -- s --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch . sub . 2 -- o --( ch . sub . 2 ). sub . 5 -- s --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 1ch . sub . 3 -- o --( ch . sub . 2 ). sub . 2 -- o --( ch . sub . 2 ). sub . 2 -- o --( ch . sub . 2 ). sub . 5 -- cooh kishore et al ., 1991 1oxotetradecaoic acidsch . sub . 3 -- co --( ch . sub . 2 ). sub . 11 -- cooh devadas et al ., 1992 2ch . sub . 3 -- ch . sub . 2 -- co --( ch . sub . 2 ). sub . 10 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- co --( ch . sub . 2 ). sub . 9 -- cooh devadas et al ., 1992 2a * ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- co --( ch . sub . 2 ). sub . 8 -- cooh devadas et al ., 1992 2bch . sub . 3 --( ch . sub . 2 ). sub . 4 -- co --( ch . sub . 2 ). sub . 7 -- cooh devadas et al ., 1992 2a * ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- co --( ch . sub . 2 ). sub . 6 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- co --( ch . sub . 2 ). sub . 5 -- cooh devadas et al ., 1992 3 ** ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- co --( ch . sub . 2 ). sub . 4 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- co --( ch . sub . 2 ). sub . 3 -- cooh devadas et al ., 1992 3b * ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- co --( ch . sub . 2 ). sub . 2 -- cooh devadas et al ., 1992 2ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- co -- ch . sub . 2 -- cooh devadas et al ., 1992 1myristic acid analogs containing ester groupsch . sub . 3 -- o -- co --( ch . sub . 2 ). sub . 10 -- cooh devadas et al ., 1992 2ch . sub . 3 -- ch . sub . 2 -- o -- co --( ch . sub . 2 ). sub . 9 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- o -- co --( ch . sub . 2 ). sub . 8 -- cooh devadas et al ., 1992 2ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- o -- co --( ch . sub . 2 ). sub . 7 -- cooh devadas et al ., 1992 2ach . sub . 3 --( ch . sub . 2 ). sub . 4 -- o -- co --( ch . sub . 2 ). sub . 6 -- cooh devadas et al ., 1992 1ach . sub . 3 --( ch . sub . 2 ). sub . 5 -- o -- co --( ch . sub . 2 ). sub . 5 -- cooh devadas et al ., 1992 2bch . sub . 3 --( ch . sub . 2 ). sub . 6 -- o -- co --( ch . sub . 2 ). sub . 4 -- cooh devadas et al ., 1992 2ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- o -- co --( ch . sub . 2 ). sub . 3 -- cooh devadas et al ., 1992 3ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- o -- co --( ch . sub . 2 ). sub . 2 -- cooh devadas et al ., 1992 3b * ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- o -- co -- ch . sub . 2 -- cooh devadas et al ., 1992 1ch . sub . 3 -- ch . sub . 2 -- o -- co --( ch . sub . 2 ). sub . 10 -- cooh devadas et al ., 1992 1myristic acid analogs containing amide groupsch . sub . 3 -- nh -- co --( ch . sub . 2 ). sub . 10 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- nh -- co --( ch . sub . 2 ). sub . 8 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- nh -- co --( ch . sub . 2 ). sub . 7 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- nh -- co --( ch . sub . 2 ). sub . 6 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- nh -- co --( ch . sub . 2 ). sub . 5 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- nh -- co --( ch . sub . 2 ). sub . 4 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- nh -- co --( ch . sub . 2 ). sub . 3 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- nh -- co --( ch . sub . 2 ). sub . 2 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- nh -- co -- ch . sub . 2 -- cooh devadas et al ., 1992 1myristic acid analogs containing acylamino amide groupsch . sub . 3 -- co -- nh --( ch . sub . 2 ). sub . 10 -- cooh devadas et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- co -- nh --( ch . sub . 2 ). sub . 7 -- cooh devadas et al ., 1992 1ch . sub . 2 --( ch . sub . 2 ). sub . 4 -- co -- nh --( ch . sub . 2 ). sub . 6 -- cooh devadas et al ., 1992 1ch . sub . 2 --( ch . sub . 2 ). sub . 5 -- co -- nh --( ch . sub . 2 ). sub . 5 -- cooh devadas et al ., 1992 1ch . sub . 2 --( ch . sub . 2 ). sub . 6 -- co -- nh --( ch . sub . 2 ). sub . 4 -- cooh devadas et al ., 1992 1ch . sub . 2 --( ch . sub . 2 ). sub . 7 -- co -- nh --( ch . sub . 2 ). sub . 3 -- cooh devadas et al ., 1992 1ch . sub . 2 --( ch . sub . 2 ). sub . 8 -- co -- nh --( ch . sub . 2 ). sub . 2 -- cooh devadas et al ., 1992 1ch . sub . 2 --( ch . sub . 2 ). sub . 9 -- co -- nh -- ch . sub . 2 -- cooh devadas et al ., 1992 1anitroalkylcarboxylic acidso . sub . 2 n --( ch . sub . 2 ). sub . 9 -- cooh lu et al ., 1994 . sup . 5 1o . sub . 2 n --( ch . sub . 2 ). sub . 10 -- cooh lu et al ., 1994 2ao . sub . 2 n --( ch . sub . 2 ). sub . 12 -- cooh lu et al ., 1994 3halogenated analogsbr --( ch . sub . 2 ). sub . 12 -- cooh lu et al ., 1994 2br --( ch . sub . 2 ). sub . 13 -- cooh lu et al ., 1994 2f . sub . 3 c --( ch . sub . 2 ). sub . 12 -- cooh lu et al ., 1994 1f . sub . 3 c -- ch ═ ch --( ch . sub . 2 ). sub . 10 -- cooh lu et al ., 1994 1tetradecenoic acidsch . sub . 2 ═ ch --( ch . sub . 2 ). sub . 11 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch ═ ch --( ch . sub . 2 ). sub . 10 -- cooh kishore et al ., 1991 z12 . sup . 6 1ch . sub . 3 -- ch . sub . 2 -- ch ═ ch --( ch . sub . 2 ). sub . 9 -- cooh kishore et al ., 1991 z11 2bch . sub . 3 --( ch . sub . 2 ). sub . 2 -- ch ═ ch --( ch . sub . 2 ). sub . 8 -- cooh kishore et al ., 1991 z10 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 z8 1ach . sub . 3 --( ch . sub . 2 ). sub . 5 -- ch ═ ch --( ch . sub . 2 ). sub . 5 -- cooh kishore et al ., 1991 z7 2bch . sub . 3 --( ch . sub . 2 ). sub . 5 -- ch ═ ch --( ch . sub . 2 ). sub . 5 -- cooh kishore et al ., 1991 z7 . sup . 7 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 e6 2bch . sub . 3 --( ch . sub . 2 ). sub . 6 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 z6 1isomer mixture : 15 % e6 , 85 % z6 kishore et al ., 1991 e : z6 1ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh kishore et al ., 1991 e5 1ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh kishore et al ., 1991 z5 1ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- ch ═ ch --( ch . sub . 2 ). sub . 2 -- cooh kishore et al ., 1991 z4 1ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- ch ═ ch --( ch . sub . 2 ). sub . 2 -- cooh kishore et al ., 1991 e4 1ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- ch ═ ch -- ch . sub . 2 -- cooh kishore et al ., 1991 z3 1ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- ch ═ ch -- cooh kishore et al ., 1991 e2 1ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- ch ═ ch -- cooh kishore et al ., 1991 z2 1ch . sub . 3 -- ch . sub . 2 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c8 : z5 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c10 : z5 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c12 : z5 1ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- ch ═ ch --( ch . sub . 2 ). sub . 2 -- cooh rudnick et al ., 1992 c16 : z4 1ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c16 : z5 1ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh rudnick et al ., 1992 c16 : z6 1ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c17 : z5 1ch . sub . 3 --( ch . sub . 2 ). sub . 11 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c18 : z5 1tetradecadienoic acidsch . sub . 3 --( ch . sub . 2 ). sub . 2 -- ch ═ ch -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- ch ═ ch -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh see examples 2bch . sub . 3 --( ch . sub . 2 ). sub . 5 -- ch ═ ch -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh see examples 3tetradecynoic acidshc . tbd . c --( ch . sub . 2 ). sub . 11 -- cooh kishore et al ., 1991 2bch . sub . 3 -- c . tbd . c -- c --( ch . sub . 2 ). sub . 10 -- cooh kishore et al ., 1991 1ch . sub . 3 ch . sub . 2 -- c . tbd . c --( ch . sub . 2 ). sub . 9 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- c . tbd . c --( ch . sub . 2 ). sub . 8 -- cooh kishore et al ., 1991 2ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- c . tbd . c --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 3ach . sub . 3 --( ch . sub . 2 ). sub . 4 -- c . tbd . c --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 3ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- c . tbd . c --( ch . sub . 2 ). sub . 5 -- cooh kishore et al ., 1991 2ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- c . tbd . c --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 2ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- c . tbd . c --( ch . sub . 2 ). sub . 3 -- cooh kishore et al ., 1991 2ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- c . tbd . c --( ch . sub . 2 ). sub . 2 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- c . tbd . c -- ch . sub . 2 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- c . tbd . c -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- c . tbd . c --( ch . sub . 2 ). sub . 2 -- cooh rudnick et al ., 1992 c13 : y4 . sup . 8 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- c . tbd . c --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c13 : y5 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- c . tbd . c --( ch . sub . 2 ). sub . 4 -- cooh rudnick et al ., 1992 c13 : y6 2bch . sub . 3 --( ch . sub . 2 ). sub . 9 -- c . tbd . c --( ch . sub . 2 ). sub . 2 -- cooh rudnick et al ., 1992 c15 : y4 1ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- c . tbd . c --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c15 : y5 1ch . sub . 3 --( ch . sub . 2 ). sub . 7 -- c . tbd . c --( ch . sub . 2 ). sub . 4 -- cooh rudnick et al ., 1992 c15 : y6 1ch . sub . 3 --( ch . sub . 2 ). sub . 10 -- c . tbd . c --( ch . sub . 2 ). sub . 2 -- cooh rudnick et al ., 1992 c16 : y4 1ch . sub . 3 --( ch . sub . 2 ). sub . 9 -- c . tbd . c --( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 c16 : y5 1ch . sub . 3 --( ch . sub . 2 ). sub . 8 -- c . tbd . c --( ch . sub . 2 ). sub . 4 -- cooh rudnick et al ., 1992 c16 : y6 1aromatic analogs11 carbon equivalent length . sup . 9c . sub . 6 h . sub . 5 --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 2bc . sub . 6 h . sub . 5 --( ch . sub . 2 ). sub . 2 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh kishore et al ., 1991 112 carbon equivalent lengthc . sub . 6 h . sub . 5 --( ch . sub . 2 ). sub . 8 -- cooh kishore et al 1991 1c . sub . 6 h . sub . 5 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 1ac . sub . 6 h . sub . 5 --( ch . sub . 2 ). sub . 2 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 1c . sub . 6 h . sub . 5 -- o --( ch . sub . 2 ). sub . 7 -- cooh see examples 113 carbon equivalent lengthc . sub . 6 h . sub . 5 --( ch . sub . 2 ). sub . 9 -- cooh kishore et al ., 1991 2bch . sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch . sub . 2 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 991 2bch . sub . 3 --( ch . sub . 2 ). sub . 2 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 5 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 4 -- cooh gokel et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 3 -- cooh gokel et al ., 1992 1ach . sub . 3 --( ch . sub . 2 ). sub . 6 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 2 -- cooh gokel et al ., 1992 1c . sub . 6 h . sub . 5 -- ch . sub . 2 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 1ch . sub . 3 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch . sub . 2 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 5 ---- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 3 ). sub . 3 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 2 -- cooh gokel et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- c . sub . 6 h . sub . 4 -- ch ═ ch -- ch . sub . 2 -- cooh gokel et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- c . sub . 6 h . sub . 4 -- ch ═ ch -- cooh gokel et al ., 1992 1ch . sub . 3 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 7 -- cooh see examples 1ch . sub . 3 -- ch . sub . 2 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 6 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 5 -- cooh see examples 1ch . sub . 3 --( ch . sub . 3 ). sub . 3 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 4 -- cooh gokel et al ., 1992 3ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 3 -- cooh gokel et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 2 -- cooh gokel et al ., 1992 1ch . sub . 3 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 5 -- cooh see examples 1ch . sub . 3 -- ch . sub . 2 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 2 -- cooh gokel et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch -- ch . sub . 2 -- cooh gokel et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch -- cooh gokel et al ., 1992 1c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 8 -- cooh see examples 1c . sub . 6 h . sub . 5 -- s --( ch . sub . 2 ). sub . 8 -- cooh see examples 1c . sub . 6 h . sub . 5 -- ch . sub . 2 -- o --( ch . sub . 2 ). sub . 7 -- cooh see examples 1c . sub . 6 h . sub . 5 -- ch . sub . 2 -- s --( ch . sub . 2 ). sub . 7 -- cooh see examples 114 carbon equivalent lengthc . sub . 6 h . sub . 5 --( ch . sub . 2 ). sub . 10 -- cooh heuckeroth et al ., 1990 2bch . sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 9 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch . sub . 2 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh kishore et al ., 1991 1ach . sub . 3 --( ch . sub . 2 ). sub . 2 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 7 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 6 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 5 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 4 -- cooh gokel et al ., 1992 1ch . sub . 3 --) ch . sub . 2 ). sub . 6 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 3 -- cooh gokel et al ., 1992 1c . sub . 6 h . sub . 5 --( ch . sub . 2 ). sub . 2 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh heuckeroth et al ., 1990 1ch . sub . 3 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch . sub . 2 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 1ch . sub . 3 --( ch . sub . 2 ). sub . 2 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 5 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 2 -- cooh gokel et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- c . sub . 6 h . sub . 4 -- ch ═ ch -- ch . sub . 2 -- cooh gokel et al ., 1992 1ch . sub . 3 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 1ach . sub . 3 1 &# 39 ; ch . sub . 2 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 7 -- cooh kishore et al ., 1991 1ach . sub . 3 --( ch . sub . 2 ). sub . 2 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 6 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 5 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 4 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 4 -- cooh gokel et al ., 1992 3ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 3 -- cooh gokel et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- o -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 2 -- cooh gokel et al ., 1992 1ch . sub . 3 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch . sub . 2 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 5 -- cooh kishore et al ., 1991 1ach . sub . 3 --( ch . sub . 2 ). sub . 2 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh see examples 1ch . sub . 3 --( ch . sub . 2 ). sub . 3 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 3 -- cooh see examples 2ach . sub . 3 --( ch . sub . 2 ). sub . 4 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 2 -- cooh gokel et al ., 1992 2ch . sub . 3 --( ch . sub . 2 ). sub . 5 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch -- ch . sub . 2 -- cooh gokel et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 -- o -- c . sub . 6 h . sub . 4 -- ch ═ ch -- cooh gokel et al ., 1992 1c . sub . 6 h . sub . 5 -- o --( ch . sub . 2 ). sub . 9 -- cooh kishore et al ., 1991 1c . sub . 6 h . sub . 5 -- s --( ch . sub . 2 ). sub . 9 -- cooh kishore et al ., 1991 1ch . sub . 3 -- c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 8 -- cooh kishore et al ., 1991 1ch . sub . 3 -- c . sub . 6 h . sub . 4 -- s --( ch . sub . 2 ). sub . 8 -- cooh kishore et al ., 1991 1ch . sub . 3 -- s -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh kishore et al ., 1991 1ch . sub . 3 -- s -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh kishore et al ., 1991 1ch . sub . 3 -- ch . sub . 2 -- c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 7 -- cooh see examples 115 carbon equivalent lengthc . sub . 6 h . sub . 5 --( ch . sub . 2 ). sub . 11 -- cooh rapoport and newman , 1947 1c . sub . 6 h . sub . 5 -- ch ═ ch --( ch . sub . 2 ). sub . 9 -- cooh see examples 1c . sub . 6 h . sub . 5 -- o --( ch . sub . 2 ). sub . 10 -- cooh see examples 1azido - aromatic analogsp - n . sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 . sup . 5 1p - n . sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 7 -- cooh lu et al ., 1994 1bp - n . sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh lu et al ., 1994 1m - n . sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh lu et al ., 1994 1m - n . sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 10 -- cooh lu et al ., 1994 1bp - n . sub . 3 -- c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 5 -- cooh lu et al ., 1994 1bm - n . sub . 3 -- c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 5 -- cooh lu et al ., 1994 1p - n . sub . 3 -- c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1bm - n . sub . 3 -- c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1p - n . sub . 3 -- c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 7 -- cooh lu et al ., 1994 1m - n . sub . 3 -- c . sub . 6 h . sub . 4 -- o --( ch . sub . 2 ). sub . 7 -- cooh lu et al ., 1994 1nitro - aromatic analogso . sub . 2 n -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1o . sub . 2 n -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 5 -- cooh lu et al ., 1994 1ao . sub . 2 n -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 4 -- cooh lu et al ., 1994 1h . sub . 2 n -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1h . sub . 2 n -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 7 -- cooh lu et al ., 1994 1halo - aromatic analogso - f -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh lu et al ., 1994 1m - f -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 7 -- cooh lu et al ., 1994 1p - f -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh lu et al ., 1994 1ap - cl -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh lu et al ., 1994 1p - br -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh lu et al ., 1994 1ap - cf . sub . 3 -- c . sub . 6 h . sub . 4 --( ch . sub . 2 ). sub . 8 -- cooh lu et al ., 1994 1o - f -- c . sub . 6 h . sub . 4 -- ch ═ c --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1m - f -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1p - f -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1ap - cl -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1p - br -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1p - cf . sub . 3 -- c . sub . 6 h . sub . 4 -- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh lu et al ., 1994 1hetero - aromatic analogsch . sub . 3 --( ch . sub . 2 ). sub . 7 - furyl -( ch . sub . 2 ). sub . 2 -- cooh rudnick et al ., 1992 1ch . sub . 3 --( ch . sub . 2 ). sub . 6 - furyl -( ch . sub . 2 ). sub . 3 -- cooh rudnick et al ., 1992 2ch . sub . 3 --( ch . sub . 2 ). sub . 5 - furyl -( ch . sub . 2 ). sub . 4 -- cooh rudnick et al ., 1992 3ch . sub . 3 --( ch . sub . 2 ). sub . 4 - furyl -( ch . sub . 2 ). sub . 5 -- cooh rudnick et al ., 1992 2b2 - furyl -( ch . sub . 2 ). sub . 8 -- cooh see examples 1 2 -( 5 - ch . sub . 3 - furyl )!-( ch . sub . 2 ). sub . 8 -- cooh see examples 12 - furyl -( ch . sub . 2 ). sub . 10 -- cooh see examples 2b2 - furyl -( ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh see examples 1 2 -( 5 - ch . sub . 3 - furyl )!- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh see examples 12 - furyl - ch ═ ch --( ch . sub . 2 ). sub . 8 -- cooh see examples 12 - furyl - ch ═ ch --( ch . sub . 2 ). sub . 9 -- cooh see examples 12 - thienyl -( ch . sub . 2 ). sub . 8 -- cooh see examples 1a2 - thienyl -( ch . sub . 2 ). sub . 9 -- cooyh kishore et al ., 1991 1 2 -( 5 - ch . sub . 3 - thienyl )!-( ch . sub . 2 ). sub . 8 -- cooh see examples 12 - thienyl -( ch . sub . 2 ). sub . 10 -- cooh see examples 2b2 - thienyl - ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh see examples 1 2 -( 5 - ch . sub . 3 - thienyl )!- ch ═ ch --( ch . sub . 2 ). sub . 6 -- cooh see examples 12 - thienyl - ch ═ ch --( ch . sub . 2 ). sub . 8 -- cooh see examples 1__________________________________________________________________________ . sup . 1 efficacy groups were assigned as described in methods and the text subgroup &# 34 ; a &# 34 ; indicates compounds near the upper boundary of an efficacy group ; subgroup &# 34 ; b &# 34 ; indicates compounds at the lower boundary . the 20 mos toxic compounds ( group 3 ) are highlighted in bold type . . sup . 2 purchased from nu chek prep , inc . ( elysian , mn ) . sup . 3 * indicates compounds that were categorized as group 2 when tested at 2 μm . . sup . 4 ** indicates compounds that remained in group 3 when testged at 2 μm . . sup . 5 t . lu , q . li , a . katoh , j . hernandez , k . duffin , e . jacksonmachelski , l . j . knoll , g . w . gokel , and j . i . gordon , j . biol . chem ., 269 , 5346 - 5357 ( 1994 ). . sup . 6 z , designates cis double bond geometry . sup . 7 e , designates trans double bond geometry . sup . 8 y , indicates triple bond . sup . 9 examination of cpk space filling atomic models indicates that the width of an aromatic ring is equivalent to three methylenes . the antiparasitic agents described herein can be used for administration to mammalian hosts infected with trypanosomes and the like by conventional means , preferably in formulations with pharmaceutically acceptable diluents and carriers . the amount of the active agent to be administered must be an effective amount , that is , an amount which is medically beneficial but does not present toxic effects which overweigh the advantages which accompany its use . it would be expected that the adult human dosage would normally range upward from about one milligram of the active compound . a suitable route of administration is orally in the form of capsules , tablets , syrups , elixirs and the like , although parenteral administration also can be used . appropriate formulations of the active compound in pharmaceutically acceptable diluents and carriers in therapeutic dosage form can be prepared by reference to general texts in the field such as , for example , remington &# 39 ; s pharmaceutical sciences , ed . arthur osol , 16th ed ., 1980 , mack publishing co ., easton , pa . various other examples will be apparent to the person skilled in the art after reading the present disclosure without departing from the spirit and scope of the invention . all such other examples are intended to be included within the scope of the appended claims . bryant , m . l ., heuckeroth , r . o ., kimata , j . t ., ratner , l ., and gordon , j . i . ( 1989 ) proc . natl . acad . sci . u . s . a . 86 , 8655 - 8659 bryant , m . l ., ratner , l ., duronio , r . j ., kishore , n . s ., adams , s . p ., and gordon , j . i . ( 1991 ) proc . natl . acad . sci . u . s . a . 88 , 2055 - 2059 . devadas , b ., adams , s . p ., and gordon , j . i . ( 1991 ) j . lab . comp . radiopharm . 29 , 157 - 164 . devadas , b ., lu , t ., katoh , a ., kishore , n . s ., wade , a . c ., mehta , p . p ., rudnick , d . a ., bryant , m . l ., adams , s . p ., li , q ., gokel , g . w ., and gordon , j . i . ( 1992 ) j . biol . chem . 267 , 7224 - 7239 . doering , t . l ., raper , j ., buxbaum , l . u ., hart , g . w ., and englund , p . t . ( 1990 ) methods 1 , 288 - 296 . doering , t . l ., raper , j ., buxbaum , l . u ., adams , s . p ., gordon , j . i ., hart , g . w ., and englund , p . t . ( 1991 ) science 252 , 1851 - 1854 . doering , t . l ., pessin , m . s ., hoff , e . f ., hart , g . w ., raben , d . m ., and englund , p . t . ( 1993 ) j . biol . chem . 268 , 9215 - 9222 . duszenko , m ., ferguson , m . a . j ., lamont , g . s ., rifkin , m . r ., and cross , g . a . m . ( 1985 ) j . exp . med . 162 , 1256 - 1263 . gokel , g . w ., lu , t ., rudnick , d . a ., jackson - machelski , e ., and gordon , j . i . ( 1992 ) israel j . chem . 32 , 127 - 133 . hamm , b ., schindler , a ., mecke , d ., and duszenko , m . ( 1990 ) mol . biochem . parasitol . 40 ( 1 ), 13 - 22 . heuckeroth , r . o ., glaser , l ., and gordon , j . i . ( 1988 ) proc . natl . acad . sci . u . s . a . 85 , 8795 - 8799 . heuckeroth , r . o ., and gordon , j . i . ( 1989 ) proc . natl . acad . sci . u . s . a . 86 , 5262 - 5266 . heuckeroth , r . o ., jackson - machelski , e ., adams , s . p ., kishore , n . s ., huhn , m ., katoh , a ., lu , t ., gokel , g . w ., and gordon , j . i . ( 1990 ) j . lipid res . 31 , 1121 - 1129 . johnson , d . r ., cox , a . d ., solski , p . a ., devadas , b ., adams , s . p ., leimgruber , r . m ., heuckeroth , r . o ., buss , j . e ., and gordon , j . i . ( 1990 ) proc . natl . acad . sci . u . s . a . 87 , 8511 - 8515 . kishore , n . s ., lu , t ., knoll , l . j ., katoh , a ., rudnick , d . a ., mehta , p . p ., devadas , b ., huhn , m ., atwood , j . l ., adams , s . p ., gokel , g . w ., and gordon , j . i . ( 1991 ) j . biol chem . 266 , 8835 - 8855 . kishore , n . s ., wood , d . c ., mehta , p . p ., wade , a . c ., lu , t ., gokel , g . w ., and gordon , j . i . ( 1993 ) j . biol . chem . 268 , 4889 - 4902 . rapoport , l . and neuman , m . s . ( 1947 ) j . am . chem . soc . 69 , 471 - 472 . rudnick , d . a ., lu , t ., jackson - machelski , e ., hernandez , j . c ., li , q ., gokel , g . w ., and gordon , j . i . ( 1992 ) proc . natl . acad . sci . u . s . a . 89 , 10507 - 10511 . rudnick , d . a . mcwherter , c . a ., gokel , g . w ., and gordon , j . i . ( 1993 ) adv . enzymol . 67 , 375 - 430 . zinsstag , j ., brun , r ., and gessler , m . ( 1991 ) parasitol . res . 77 , 33 - 38 . | 2 |
referring to the drawing figures , fig1 a and 1 b are rear and front views , respectively , of an exemplary digital camera 10 in accordance with the principles of the present invention . as is shown in fig1 a and 1 b , the exemplary digital camera 10 comprises a handgrip section 20 and a body section 30 . the handgrip section 20 includes a power button 21 or switch 21 having a lock latch 22 , a record button 23 , a strap connection 24 , and a battery compartment 26 for housing batteries 27 . the batteries may be inserted into the battery compartment 26 through an opening adjacent a bottom surface 47 of the digital camera 10 . as is shown in fig1 a , a rear surface 31 of the body section 30 comprises a liquid crystal display ( lcd ) 32 or viewfinder 45 , a rear microphone 33 , a joystick pad 34 , a zoom control dial 35 , a plurality of buttons 36 for setting functions of the camera 10 and an output port 37 for downloading images to a computer , for example . as is shown in fig1 b , a zoom lens 41 extends from a front surface 42 of the digital camera 10 . a metering element 43 and front microphone 44 are disposed on the front surface 42 of the digital camera 10 . a pop - up flash unit 45 is disposed adjacent a top surface 46 of the digital camera 10 . an image sensor 11 is coupled to processing circuitry 12 ( illustrated using dashed lines ) are housed within the body section 30 , for example . an exemplary embodiment of the processing circuitry 12 comprises a microcontroller ( μc ) 12 or central processing unit ( cpu ) 12 . the cpu 12 is coupled to a nonvolatile ( nv ) storage device 14 , and a high speed ( volatile ) storage device 15 , such as synchronous dynamic random access memory ( sdram ) 15 . in the digital camera 10 , the processing circuitry 12 ( microcontroller ( μc ) 12 or cpu 12 ) embodies a processing algorithm 13 that comprises an edge detection algorithm 13 in accordance with the principles of the present invention to provide image alignment feedback for panorama ( composite ) images . this will be discussed in more detail with reference to fig2 . an exemplary edge detection algorithm 13 is disclosed in “ a simplified approach to image processing ” by randy crane , isbn : 0 - 13 - 226416 - 1 . this laplacian convolution provides a fast and efficient method for identifying edges within an image . fig2 is a flow diagram that illustrates an exemplary method 60 in accordance with the principles of the present invention . the exemplary method 60 comprises the following steps . a user captures 61 ( stores 61 ) an image that is to be used as part of a panorama image sequence . the captured image is processed 62 using the edge detection filter 13 . the camera applies 63 the edge detection filter to that portion of the captured image that will overlap with the next image of the panorama sequence . for instance , if the user is taking a sequence of pictures for a panorama composite , traversing from left to right , the camera can apply the edge detection filter to the right half of each image , since the right half of an image will overlap with the left half of the next image . once the camera has applied the edge detection filter , it computes 64 a histogram of the resultant values in order to identify a threshold value . the threshold value is selected 65 such that a small portion of the total number of image pixels are considered “ edges ”. for instance , 10 - 15 % of the total pixels may be designated edges . by using the histogramming function , the camera 10 can accommodate either very busy images ( those with many edges ) or very bland images ( those with few edges ) without cluttering the liveview image . once the edges are identified and the threshold has been applied , the camera extracts 66 the image information ( pixels ) near the edges from the previously taken image , and superimposes 67 only those pixels over the liveview image . the definition of “ near ” in this case is dependent on display size , but a radius of 2 - 3 pixels is considered reasonable . by applying the method of identifying edge features and superimposing only those elements of the previous image that are near those edges over the current liveview image , the user is provided a full - screen display that is minimally obscured with prior image information . only those elements of the previous image that are important for alignment obscure the liveview image . this approach eliminates the disadvantage of using a reduced - size image as found in canon digital cameras , for example . furthermore , it eliminates the disadvantage of overlaying a large portion of the previous image ( as much as 50 % of it ) over a full - screen liveview , interfering with the composition of the current image . this approach also allows a number of adjustments to be made , by either changing 68 the percentage of pixels that will be identified as “ edges ”, or by changing 69 the radius ( or extent ) around the edges that are sampled to display on the liveview image . by altering the threshold value 65 , the user of this technique can alter the number of edges that the user of the camera will see superimposed on the liveview image . a higher threshold value increases the likelihood of the user seeing false edges , while a lower threshold value decreases the number of edges displayed . the false edges that can be detected with a higher threshold may provide more alignment features , but it also obscures more of the current liveview image . fewer edges decrease the clutter obscuring the current liveview image , allowing for better composition of the current image , but provides fewer features for alignment . altering the radius of pixels that are sampled around edges likewise alters the level of obscuration of the liveview image . a larger radius includes more features around the edges to use for alignment , but it also obscures more of the liveview image . conversely , a smaller radius reduces the visibility of alignment features . this method is easily identifiable in application , since it essentially overlays only edge features from the previous image over the current liveview image . by obscuring the current liveview as little as possible , the camera 10 provides the user the best possible solution to the problem of aligning adjacent images during a panorama sequence . thus , digital cameras and methods that use edge detection for providing image alignment feedback for panorama ( composite ) images have been disclosed . it is to be understood that the above - described embodiments are merely illustrative of some of the many specific embodiments that represent applications of the principles of the present invention . clearly , numerous and other arrangements can be readily devised by those skilled in the art without departing from the scope of the invention . | 7 |
the present invention embodies a device or system of devices which , when installed in or on a large vehicle , such as a class a motorhome , having a interior floor in the driver &# 39 ; s area which is a considerable distance , often three to four feet , above ground level , will greatly reduce the level of athletic ability required to enter or exit the subject vehicle through a driver &# 39 ; s side door . due to the width of such a subject vehicle , it is desirable and necessary for any device or devices such as those in the present invention to be retracted proximately within the limits of the subject vehicle body for travel on the highway . in the present invention , this retraction and extension of the device or devices used is accomplished by means of a rotary motion or motions . in all of the several preferred embodiments , this rotary motion is controlled automatically in response to opening and closing of the driver &# 39 ; s side door . in all of the several embodiments , the location and orientation of the step surfaces when in the open or extended position allows the person using them to step onto , and bring their whole weight directly and completely above , the subject step surface in the manner in which they normally ascend or descend stairways . the upper two views in fig1 a and 1b illustrate the problem which the present invention addresses . due to the necessity to keep any fixed stepping surface provisions such as stirrups or recessed step pockets , as illustrated here , proximately within the width limits of the subject large vehicle 1 , a person entering or exiting the subject vehicle through the driver &# 39 ; s side door 2 cannot place full weight directly above the supporting step surface . it is , therefore , necessary for the person to support some of their weight by using arms and hands holding onto whatever handhold , handle or object is available when entering or exiting the subject vehicle 1 through the driver &# 39 ; s side door 2 . the lower two views , fig1 c and 1d , illustrate the present invention in its simplest embodiment . as can be seen in both the side view and the rear view , the person has opened the driver &# 39 ; s side door 2 of the subject vehicle 1 causing a step 3 to rotate out into the extended or open position . the person has stepped up onto the step 3 ( which can be called a base step ) and is able to stand comfortably with weight fully and directly above the step 3 without need to use arms to help support the person &# 39 ; s weight ; that is , the person stands with his center of gravity over the step . fig1 c and 1d show that the vehicle 1 , a motorhome , has vehicle side panels p extending down alongside the front wheel , which may be essentially down to the center hub of the wheel , at both fore and aft of the wheel . the step 3 swings out from below the panel p , and does not amount to a structure that replaces a panel portion rear of the wheel , as in some truck step structures of the prior art . fig2 further illustrates the present invention in its simplest embodiment showing a top view of the rotation of the step 3 from a retracted position into an extended position . fig3 - 6 further illustrate the invention and its use in a two - step embodiment , to be described further below . fig7 further illustrates the present invention in its simplest embodiment showing a view from inside looking outward and toward the side of the subject vehicle . the first preferred mechanism of the simplest embodiment is shown . the step 3 is shown extended , although seen in edge view . the step 3 is shown mounted onto a rotary shaft 7 by means of a commercially available clamp 12 . the shaft 7 is supported rotationally and axially by a lower bearing 8 , mounted on a base plate 10 which is in turn mounted to and supported by a support frame member 11 . the upper end of the shaft 7 is inserted into a commercially available pneumatic rotary actuator 15 which supports it rotationally and serves as a means of rotating the shaft 7 through an arc of 90 degrees , shown in fig2 as direction of rotation 5 , to move the step 3 from the retracted position to the extended position . this action occurs automatically in response to the opening the driver &# 39 ; s side door 2 as illustrated in fig2 . in the preferred embodiment of the present invention , the opening the driver &# 39 ; s side door 2 as illustrated in fig2 actuates an electrical switch , preferably of the commercially available “ proximity ” or “ limit ” type , which closes an electrical circuit powered by the vehicle &# 39 ; s electrical system and connected to the solenoid of a commercially available pneumatic valve 14 . in the preferred embodiment the pneumatic valve 14 is of the solenoid actuated , spring return “ four way valve ” type . the valve 14 is piped to the rotary actuator 15 in an arrangement that causes the rotary actuator 15 to return the step 3 to the retracted position when the pneumatic valve 14 is in the spring return position . this ensures that in case of a loss of electrical power , the valve 14 will be set to the “ retract ” position . the electrical wiring to create the electrical circuit is readily achievable by anyone skilled in the art . both the rotary actuator 15 and the pneumatic valve 14 are mounted on the base plate 10 . compressed air is delivered to the pneumatic valve 14 through an air pipe 13 . the compressed air source can be any state of the art system , but the air pressure delivered to the pneumatic valve 14 must be regulated to provide enough driving torque to allow the rotary actuator 15 to rotate the shaft 7 and the step 3 . however , for safety reasons , air pressure should not be so high as potentially to cause injury to a person in the path of the rotational motion of the step 3 as it moves from the retracted position to the extended position and vice versa . good practice demonstrates that the pressure should be at or below the level that will cause the step 3 to exert a force of approximately five pounds or less at its outermost end . also for reasons of safety , the preferred embodiment of the present invention includes the use of commercially available air flow rate controllers 17 on the exhaust ports of the pneumatic valve 15 . these flow rate controllers 17 restrict the rate at which the compressed air exits the pneumatic valve 15 . this in turn controls the rate of rotation of the shaft 7 and the step 3 caused by rotary actuator 15 as the step rotates from retracted to extended positions and vice versa . good practice demonstrates that said rate of rotation should be at or below the rate that will cause the step 3 to take approximately 1 . 5 to 2 seconds to complete a 90 degree rotation . the limitation of compressed air pressure resulting in limited rotational torque applied to the step 3 necessitates that a means be provided to securely hold the step 3 in the extended position to avoid unsafe movement of the step 3 when stepped upon . such a means to hold the step 3 is provided in the preferred embodiment by a latching plunger 18 illustrated in fig7 , 8 and 9 . the plunger 18 is mounted on the lower end of a pair of rods which run vertically through a mounting unit 20 which contains a pair of commercially available low friction linear bearings . the upper ends of the rods to which plunger 18 is mounted are in turn attached by a bracket to the cylinder rod of a commercially available spring return air cylinder 19 . the air cylinder 19 is attached to the mounting unit 20 . the spring return action of the air cylinder 19 applies a downward force to the plunger 18 when the air pressure is released when the valve 14 is in the extended position as shown in fig7 . the plunger 18 mounts a free turning roller on its lower end . the roller , on a horizontal axis , rolls on top of the step 3 while the step 3 rotates into the fully extended position . the plunger 18 rolls over the edge of the step 3 as the step 3 reaches its fully extended position and drops to the limit of its travel , pushed downward by the spring return action of air cylinder 19 . in this fully extended position , the plunger 18 prevents any backward rotational movement in the retracting direction . when the valve 14 moves to the retract position in response to the driver &# 39 ; s side door opening , compressed air is sent to the air cylinder 19 which exerts a force to raise the plunger 18 . when the plunger 18 is raised so that the roller on its lower end clears the top of the step 3 , the step is free to back into its retracted position as shown in fig8 . another preferred mechanism of the simplest embodiment of the present invention is shown in fig9 . this embodiment is identical the embodiment shown in fig7 and fig8 with the exception of the substitution of a commercially available air cylinder 16 connected to a lever mounted to the shaft 7 and the addition of a commercially available bearing 9 supporting the upper end of shaft 7 . the bearing 9 and the air cylinder 16 are suitably mounted to the back plate 10 . the full extension of the cylinder 16 causes the shaft 7 to rotate 90 degrees causing the step 3 to go from the extended position to the retracted position . a second preferred embodiment of the present invention is shown in fig3 a - 3d in which a second or upper step 4 is added to the single lower step 3 of the simplest preferred embodiment shown in fig1 c and 1d . this upper step 4 seen in fig3 , 4 and 5 unfolds with motion 6 seen in fig6 a and 6b from the step 3 referred to in the first embodiment when the first step 3 reaches its fully extended or open position as shown in fig4 . in its open or extended position , the second step 4 provides a step surface which preferably is approximately mid way between the first step 3 and the subject vehicle floor level and extending laterally well beyond the vehicle body 1 in similar fashion to the first step 3 as shown in fig5 . thus , the person can stand on this step without being off balance as shown in fig1 a and 1b . the second step 4 folds back down into or onto the first step 3 before the first step 3 returns to the retracted position . in the preferred form of this second embodiment of the present invention the second step 4 and its support mechanism is in the form of a parallelogram as seen from the side in fig1 with pivoting means at all four intersectional points of the parallelogram . a spring preferably of the torsion type located at the lower pivot points of one or more of the pivotal members 22 provides the means to rotate the subject second step 4 into the extended or open position in the manner 6 shown in fig6 a . an air cylinder 24 located in the first step 3 assembly provides the means to rotate the second step 4 from the extended or open position back to the retracted position . compressed air is supplied from the valve 14 to the air cylinder 24 through the shaft 7 which is bored and tapped for this purpose as shown in fig1 . in the preferred form of the subject second embodiment , when the extension of the subject steps is initiated by the opening of the driver &# 39 ; s side door 2 as shown fig4 , the second step 4 is prevented from opening into the extended position by one or more free turning rollers 28 , shown in fig1 , positioned and fixedly mounted to hold the subject second step 4 down until the first step 3 has reached its fully extended and latched position . at this point , having passed clear of the subject rollers 28 , the second step 4 is free to swing up into its extended position in response to the pressure of the spring action exerted on members 22 seen in fig1 ( springs not shown ). also at this point the latching plunger 18 , which secures the first step 3 in its extended position is itself prevented form retracting by a secondary latch 25 as shown in fig1 . when closure of the driver &# 39 ; s door 2 triggers the retraction sequence , full retraction of the second step 4 , as shown in fig1 , releases this subject secondary latch 25 via a catch 25 a secured to the second step 4 as seen in fig1 and 12 . this in turn allows the latching plunger 18 to retract which further allows the first step 3 to return to the retracted position . also in the preferred form of the subject second embodiment of the present invention , when the second step 4 reaches full extension in the extended mode ( fig1 ), one or more pairs of pivotally mounted and joined longitudinal members 23 and 27 are propelled into an over - center position in relation to each other by a means such as a torsion spring ( not shown ) at the joining of the subject members 23 and 27 . the distal ends of the subject members are pivotally attached to diagonally opposed corners of the parallelogram formed by the second step 4 , its support members 22 and the first step 3 . thereby the subject members 23 and 27 rigidly lock the second step 4 in position so long as they remain in the over - center relation each to the other . when the retract action is initiated by the driver &# 39 ; s door closure , the air cylinder 24 mounted in the step assembly , which retracts the second step 4 , moves the subject over - center members 23 and 27 out of the over - center position by its initial movement before continuing to retract the second step 4 with the remainder of its stroke as can be seen from fig1 another preferred part of both embodiments of the present invention is a mounting means which does not require any drilling , welding , or other modifications to the subject vehicle . fig1 shows schematically one preferred mounting means consisting of a structural member 11 bolted to the backing plate 10 and a main structural member 29 on its other end . the main structural member 29 is rigidly clamped to the vehicle frame f by clamping plates 30 . additional stability and rigidity is provided by a lower brace member 31 which is also clamped to the subject vehicle frame f using clamping plates 30 . fig1 also illustrates a sheet metal dust cover 32 provided to keep road dirt thrown up by the vehicle wheels from getting into the mechanism . it should be understood that the step mechanism can be mounted in other ways to the vehicle , such as by bolting to the vehicle frame , if desired . in other embodiments of the present invention , although for obvious reasons the step surfaces on which the person entering or exiting the subject vehicle steps should be approximately horizontal , the axis of rotation or shaft 7 need not be approximately vertical . in fact , in some applications of the present invention , the axis of rotation will need to be inclined at a suitable angle to the vertical and may not even be a physical shaft . the axis of rotation can be virtual in nature formed by two or more bearings so located and mounted as to form the desired axis of rotation around which the subject base step 3 or step assembly 3 and 4 is rotated from the retracted position to the extended position and back to the retracted position . fig1 shows yet another embodiment of the invention with modified step latching . the function of the latching plunger 18 and the secondary latch 25 shown in fig1 , which is to prevent retraction of the first step 3 before the second step 21 is fully retracted , is replaced by a spring actuated stop 33 pivotally mounted in the first or base step 3 . when the first step 3 reaches the fully extended position in response to the opening of the driver &# 39 ; s side door , the second step 21 is clear of the rollers 28 and begins to rise into its vertically extended position . this action of the second step 21 releases the spring actuated stop 33 to rise in response to its spring force to the position shown in fig1 directly in line with and in contact with the roller 28 . this action holds the first step 3 firmly in its fully extended position until the spring actuated stop 33 is pushed back down into its retracted position by the full retraction of the second step 21 . this occurs , as explained above , in response to the closing of the driver &# 39 ; s side door 2 or in response to cancellation of the opening action or other loss of electrical power to the driver &# 39 ; s side step system . the above described preferred embodiments are intended to illustrate the principles of the invention , but not to limit its scope . other embodiments and variations to these preferred embodiments will be apparent to those skilled in the art and may be made without departing from the spirit and scope of the invention as defined in the following claims . | 1 |
the present invention is an apparatus and method . the apparatus portion includes a wall frame 40 having the dimensions such as seen in fig1 . the wall frame is made of 4 sections , namely a top section 43 , a bottom section 44 , a left section 42 and a right section 41 . as seen in the first figure , the top section has over a 16 inch distance length . the wall frame is placed over wall studs and mounting brackets 47 are provided with screw openings so that a user can drive a screw into the wall to attach the wall frame to the wall . on the left panel , or left section , the left panel includes a tool magnet 48 for holding tools such as a screwdriver or drywall knife . on the right panel , a hose opening allows connection to a hose . the bottom panel is shown with a hepa filter . an opening for the filter allows mounting of the filter in the opening . the top panel has a spring hinged flap access allow passage of tools downward to the tool magnet . the flap is sealed normally and is held closed by a spring and optionally a latch . the latch can be opened to allow passage of a tool to the wall frame . four supports can provide additional structure for the wall frame . in an alternate embodiment , the elements can be placed in different orientations , such as if the filter were placed on the left side opposite the hose on the right side . in the primary embodiment , the air flow passes upward from the filter and flows out through the hose opening . in fig2 , the magnet is shown as a strip running the width of the left panel . although the panels can be made of wood , they can also be formed as plastic members . the four supports can provide for interlocking plastic members . during transportation of the wall frame , the panel members are preferably carried in a bag stacked together . when assembled , the wall frame is preferably airtight . a hoop system can be formed as a rectangular inner ring that fits with a rectangular outer ring . in fig3 , the inner ring and outer ring are shown as rectangular frames sandwiching and outer edge of a glove bag . the glove bag is preferably airtight against the inner ring and the outer ring . the pair of rings can be connected together by interference fit , magnetic , or by adhesive means . the inner ring and outer ring can be connected to the wall frame by interference fit , by magnetic means or by adhesive means . the wall frame may have a slot formed in the top member in the side members to provide an insertion from the top of the pair of rings including the inner ring and outer ring . the wall frame and the pair of rings is preferably square shaped to allow sideways or upside down mounting . the bag shown in fig4 provides a glove bag having a pair of gloves attached to a bag and then having a lower area to carry debris . the wall frame 40 generally has a right section 41 and a left section 42 . the right section 41 or left section 42 preferably has a suction opening 53 disposed in it . the right section or left section preferably has a tool magnet 48 mounted to it as well . the left or right section , also called the side sections are supported by the tape as well as the top mounting brackets 47 and the bottom mounting brackets 49 . the side sections when formed as planks are preferably connected to the top section 43 with top corner supports 46 . the side sections when formed as planks are also preferably connected to the bottom section 44 by bottom corner supports 45 . the bottom corner supports 45 can be formed as wooden elongated members . alternatively , the top mounting brackets 47 can be secured to the top section and the bottom mounting brackets 49 can be secured to the bottom section . the top section 43 preferably has a top opening 51 with a top opening hinge 54 that opens inward and is spring - loaded so that it closes the top opening flap with an air tight seal . the top section can also have a top opening flap that opens outward , but this is not preferred . the bottom section can have a bottom opening 52 . the bottom opening 52 includes a filter for filtering air so that air is moving upward . in an improved version of the present invention , the filter assembly is a side filter 88 mounted on a left or right side of the wall frame 40 . as seen in fig7 , four small circular filters can be used . additionally , in vacuum 89 such as an integrated vacuum can be mounted to the side of the wall frame 40 , opposite the side filters 88 . in the improved version of the present invention , the airflow flows from the side filters side of the apparatus to the vacuum site of the apparatus . the vacuum may have a variable control on it . the suction opening 53 optionally includes an air filter for filtering air leaving the unit . it is preferred that the side filters 80 are mounted on a side filter openings disposed in a side of the wall frame 40 . with an integrated vacuum , the housing of the vacuum can be mounted directly to the wall frame 40 , or can be connected to the suction opening 53 by a hose . it is preferred that the tape 90 is color contrasting to the side of the wall frame 40 . the glove assembly 20 has a hand 21 . the hand portion of the glove assembly includes at least a thumb 27 , a forefinger 28 and a middle finger 29 . the hand 21 is preferably heat laminated to the forearm 22 . the forearm and hand can be made of a rubber or plastic . it is preferred that the forearm and hand are made of a rubbery plastic material commonly used for gloves . the forearm may optionally extend to an elbow section 23 that is heat laminated to the forearm . the glove assembly 20 is laminated to the glove bag at a thermal lamination 25 . the glove fringe 24 extends from the thermal lamination 25 and may have an edge forming a glove opening 26 . optionally , the glove fringe 24 has elastic for changing in size . the glove assembly 20 is airtight when connected at the thermal lamination 25 to the glove bag 30 . a pair of gloves allows a user to use both hands . the glove bag 30 has a glove bag bottom 32 that may have a fold at the bottom . preferably , a seam does not run across the bottom . the glove bag is connected to the outside ring 37 and the inside ring 38 by being sandwiched at a glove bag fold 36 . the glove bag fold 36 is pushed into the ring groove 39 that is disposed on either the outside ring 37 or on the inside ring 38 . the outside ring and the inside ring can be made to snap together or come together by magnetic attachment . the outside ring and the inside ring form a retainer ring . the retainer ring 91 fits inside a retainer ring slot 92 formed on the left and right sections of the wall frame 40 . the retainer ring slot 92 begins at a retainer slot opening 93 formed on the top section of the wall frame 40 . a portion of the glove bag 30 is folded over to form a glove bag fold over 31 . the edge of the glove bag fold over is the glove bag opening 35 . the glove bag first seam 33 and the glove bag second seam 34 can be formed at corners of the glove bag , or on a left and right side of the glove bag . a glove bag bottom 32 can be made flat . the first embodiment of the pocket containment method 60 is a simplified version and may have a number of different steps in addition to the ones listed . the first step 61 is to detect the access area . the second step 62 is to find studs and then measure and mark them . the third step 63 is to assemble a wall mount with tools in place and also taped the outer connection points . the fourth step 64 is to attach a wall apparatus with four screws and making sure they are mounted to bay studs . a fifth step 65 is to tape all areas with industry duct tape around the wall mount and walls . a sixth step 66 is to attach a hepa vacuum with retainer ring to the suction opening 53 . a retainer ring clips to the outside of the suction opening 53 . the seventh step 67 is to attach a 6 mil bagging system such as glove bag 30 . the eighth step 68 is too wet in the area by missing with a small spray bottle having a wetting agent . the ninth step 69 is to turn on the hepa vacuum and then insert hands into the bagging system . the 10 th step is to cut a hole with the recommended drywall hand saw . the 11 th step 71 is to remove the drywall and place it in the glove bag 30 . the drywall will generally rest of the floor toward the bottom of the glove bag 30 . the 12 th step 72 is to drop in the vacuum attachment and clean the bay area of all debris and dust . the 13 th step 73 is to seal the top and bottom of the bay with poly strips and industry tape . the 14 th step 74 is to mist the area making sure that debris and the bag is adequately wet but not pooling at the bottom . the 15 th step 75 is to wipe the area and tools and to remove all of the tools except for the screwdriver . the 16 th step 76 is to wet wipe the screwdriver and to reclean the area . the 17 th step 77 is to temporarily seal the bag with industry duct tape . the 18 th step 78 is to encapsulate the cut area with a lock down encapsulate spray . the 19 th step 79 is to let the area dry for 15 minutes . the 20 th step 80 is to vacuum out air inside the glove bag , then twist the bag and minimum of five turns and applied industry tape to close the bag . the bagging system is then detached and the bag is goose necked which means to be folded over again . the bag is twisted a minimum of five turns during closing . it is preferred to apply tape and the place the glove bag 30 into another 6 mil clear bag which is then also taped in the same manner . the 21 st step 81 is to fill out a label and attach the label to the bag . the label should have the details of : homeowner , date , contents , address and a notation of cad981400518 epa residential not commercial . the 22 nd step 82 is to cut or remove tape around the wall mount . the 23 rd step 83 is to remove and disassemble the wall mount . the 24 th step 84 is to make any necessary repairs . the 25 th step is to cover the hole was a poly sheet of plastic and tape in place . the 26 th step is to have materials tested before for the removal or debris is discarded and to leave always on - site until testing results are completed . a card such as a hotline number can be provided by a plumber . a second embodiment of the pocket containment method 160 is the best mode of the present invention . the pocket containment method 160 has a number of steps , and may have other steps not included in the listed steps . the first step 161 is to detect the access area . the second step 162 is find the wall studs and measure and mark for cutting the area . the third step 163 is to isolate the area with critical carriers such as poly plastic sheet over doors and air vents and other air openings . the fourth step 164 is to assemble the wall mount with tools in place and to tape the outer connection points . the fifth step 165 is to attach the wall apparatus with all four screws making sure that they are mounted to the bay studs . the sixth step 166 is to tape all four edges with industry duct tape all around the wall mount and walls inside and out . the seventh step 167 is to attach the recommended hepa vacuum hose and duct tape around both nozzles . the eighth step 168 is to wet the area by missing it with a small spray bottle of a wetting agent such as alcohol or water . the ninth step 169 is to attach a 6 mil bagging system with a glove bag attached between the outside mounting ring and the inside mounting ring . the 10 th step 170 is to tape with teal colored duct tape inside , along the bottom and all along the bagging system edge and wall mount . the 11 th step 171 is to turn on the hepa vacuum and adjusts the flow with a dampener so that the bag doesn &# 39 ; t collapse too much . the 12 th step 172 is to use a respirator before opening the wall . the 13 th step 173 is to insert hands into the bagging system . the 14 th step 174 is to cut a hole with a drywall hand saw . the 15 th step is to remove the drywall and place it in a bag . the 16 th step 176 is to drop in the vacuum attachment and clean the bay of all debris and dust and remove the bottom strip of tape that was put on the bottom of the bagging system . the bay area is cleaned . the 17th step 177 is to mist the area making sure that the debris of the bag is adequately wet but not pooling at the bottom hollow of the bag . the 18th step 178 is to wet wipe around the area and tools and remove the tools except for the screwdriver . the 19th step 179 is to remove the bottom strip of tape that was put on bottom of bagging system and discard . the 20th step 180 is to vacuum out air inside the bagging system , then twist the bag a minimum of five turns and apply industrial tape . after that , wet wipe the inside area of the bay . the 21st step 181 is to detach the inner vacuum hose and tape both ends and then what wipe and remove the vacuum hose . the 22nd step 182 is to encapsulate the area all around the drywall edges and inside the top and bottom of the bay with fiber knock down spray so that fibers do not become airborne . it is suggested to use one can to ensure all material is knocked down . the 23rd step 183 is to detach the bagging system which includes the glove bag . the glove bag is then goose necked in the taped again and then placed in a second 6 mil clear bag which is in turn taped using the same gooseneck method . the 24th step 184 is to detach and the hose with the vacuum still on and dampener wide - open . the vacuum is held on or beneath the screws , to capture dust as the user unscrews the screws on the wall unit . when the remove all the wall mount screws is complete , and while the vacuum is on , the user tapes the end of the hose with the duct tape and then turns the vacuum off . the user does not detach the hose until outside in open air and wearing a respirator . also , the hose can remain taped . the 25th step 185 is to cut the tape around the wall mount . the 26 th step 186 is to remove the wall mount from the wall . the 27th step 187 is to fill out a label and attach it to the bag . the label may include information such as : homeowner , date , contents , address , the notation cad981400518 epa residential not commercial . the 28th step 188 is to let the area dry for 20 minutes . the 29th step 189 is to make necessary repairs to plumbing . the 30th step 190 is to cover the hole with poly sheet of plastic and tape in place after a repair is made . the 31st step 191 is to remove the critical barriers , unless mold is present , in which case the barriers should remain . the 32 nd step 192 is to have materials tested before the debris is discarded . it is preferred to leave the waste on site until testing results are complete . a hotline number can be provided to the user and imprinted on the label or tag such as , 855 - lab - togo for waste assistance . | 1 |
other features and advantages of the invention will become apparent from a consideration of the following detailed description and the accompanying drawings . the device embodying the present invention combines the functions of a wheelchair , a walker , and a sitting chair . in the interest of brevity , the combined wheelchair , walker , and sitting chair will be referred to herein as a device . as shown in the figures , the invention is embodied in a device 10 . the device 10 comprises a frame 12 , which includes a first front leg 14 , which extends vertically upward in a use orientation shown in fig1 , and has a first end 16 and a second end 18 , with the first end 16 of the first front leg 14 of the frame 12 being located beneath the second end 18 of the first front leg 14 of the frame 12 in the use orientation . the frame 12 further includes a second front leg 20 , which extends vertically upward in the use orientation , and has a first end 22 and a second end 24 , with the first end 22 of the second front leg 20 of the frame 12 being located beneath the second end 24 of the second front leg 20 of the frame 12 in the use orientation . the frame 12 further includes a first rear leg 26 , which extends upward at an oblique angle in the use orientation , and has a first end 28 and a second end 30 , with the first end 28 of the first rear leg 26 of the frame 12 being located beneath the second end 30 of the first rear leg 26 of the frame 12 in the use orientation . the frame 12 further includes a second rear leg 32 , which extends upward at an oblique angle in the use orientation , and has a first end 34 and a second end 36 , with the first end 34 of the second rear leg 32 of the frame 12 being located beneath the second end 36 of the second rear leg 32 of the frame 12 in the use orientation . the frame 12 further includes a first arm rest 40 , which connects the second end 18 of the first front leg 14 of the frame 12 to the second end 30 of the first rear leg 26 of the frame 12 . the first arm rest 40 of the frame 12 has a first end 42 connected to the second end 18 of the first front leg 14 of the frame 12 , and a second end 44 spaced - apart from the second end 30 of the first rear leg 26 of the frame 12 , with the second end 30 of the first rear leg 26 of the frame 12 being connected to the first arm rest 40 of the frame 12 , at a location between the first end 42 of the first arm rest 40 of the frame 12 and the second end 44 of the first arm rest 40 of the frame 12 . the frame 12 further includes a second arm rest 46 , which connects the second end 24 of the second front leg 20 of the frame 12 to the second end 36 of the second rear leg 32 of the frame 12 . the second arm rest 46 of the frame 12 has a first end 48 connected to the second end 24 of the second front leg 20 of the frame 12 , and a second end 50 spaced - apart from the second end 36 of the second rear leg 32 of the frame 12 , with the second end 30 of the first rear leg 26 of the frame 12 being connected to the second arm rest 46 of the frame 12 , at a location between the first end 48 of the second arm rest 46 of the frame 12 and the second end 50 of the second arm rest 46 of the frame 12 . the frame 12 further includes a first cross arm 60 , which connects the first front leg 14 of the frame 12 to the first rear leg 26 of the frame 12 . the first cross arm 60 of the frame 12 has a first end 62 connected to the first front leg 14 of the frame 12 , at a location between the first end 16 of the first front leg 14 of the frame 12 , and the second end 18 of the first front leg 14 of the frame 12 , and a second end 64 connected to the first rear leg 26 of the frame 12 , at a location between the first end 28 of the first rear leg 26 of the frame 12 and the second end 30 of the first rear leg 26 of the frame 12 . the first cross arm 60 extends parallel to the first arm 40 . the frame 12 further includes a second cross arm 66 , which connects the second front leg 20 of the frame 12 to the second rear leg 32 of the frame 12 . the second cross arm 66 of the frame 12 has a first end 68 connected to the second front leg 20 of the frame 12 , at a location between the first end 22 of the second front leg 20 of the frame 12 and the second end 24 of the second front leg 20 of the frame 12 , and a second end 70 connected to the second rear leg 32 of the frame 12 , at a location between the first end 34 of the second rear leg 32 of the frame 12 and the second end 36 of the second rear leg 32 of the frame 12 . the first cross arm 60 of the frame 12 extends parallel to the second arm 46 of the frame 12 . the frame 12 further includes a first back rest element 74 , which has a first end 76 connected to the first rear leg 26 , adjacent to the second end 64 of the first cross arm 60 of the frame 12 , and extends vertically upward therefrom in the use orientation . the first back rest element 74 of the frame 12 has a second end 78 located above the first end 76 of the first back rest element 74 of the frame 12 in the use orientation . the frame 12 further includes a second back rest element 80 , which has a first end 82 connected to the second rear leg 32 of the frame 12 , adjacent to the second end 70 of the second cross arm 66 of the frame 12 , and extends vertically upward therefrom in the use orientation . the second back rest element 80 of the frame 12 has a second end 84 located above the first end 82 of the second back rest element 80 of the frame 12 in the use orientation . the frame 12 further includes a first rear cross brace 96 , which has a first end 98 connected to the first rear leg 26 of the frame 12 , adjacent to the second end 64 of the first cross arm 60 of the frame 12 , and a second end 100 connected to the second rear leg 32 of the frame 12 . the first rear cross brace 96 of the frame 12 , the first cross arm 60 of the frame 12 , and the second cross arm 66 of the frame 12 are coplanar . the frame 12 further includes a second rear cross brace 102 , which has a first end 104 connected to the second end 78 of the first back rest element 74 of the frame 12 , and a second end 106 connected to the second end 84 of the second back rest element 80 of the frame 12 . the second rear cross brace 102 of the frame 12 is parallel to the first rear cross brace 96 of the frame 12 . the frame 12 further includes a first top brace 110 , which has a first end 112 connected to the second end 78 of the first back rest element 74 of the frame 12 , and a second end 114 . the first top brace 110 of the frame 12 extends parallel to the first arm rest 40 of the frame 12 . the frame 12 further includes a second top brace 116 , which has a first end 118 connected to the second end 84 of the second back rest element 80 of the frame 12 , and a second end 120 . the second top brace 116 of the frame 12 extends parallel to the second arm rest 46 of the frame 12 . the frame 12 further includes a first support brace 130 , which has a first end 132 connected to the second end 114 of the first top brace 110 of the frame 12 , and a second end 134 connected to the first arm rest 40 of the frame 12 , at a location between the second end 30 of the first rear leg 26 of the frame 12 and the first end 42 of the first arm rest 40 of the frame 12 . the first support brace 130 of the frame 12 extends vertically upward from the second end 134 of the first support brace 130 of the frame 12 to the first end 132 of the first support brace 130 of the frame 12 in the use orientation , as shown in fig1 . the frame 12 further includes a second support brace 136 , which has a first end 138 connected to the second end 120 of the second top brace 116 of the frame 12 , and a second end 140 connected to the second arm rest 46 of the frame 12 , at a location between the second end 36 of the second rear leg 32 of the frame 12 and the first end 48 of the second arm rest 46 of the frame 12 . the second support brace 136 of the frame 12 extends vertically upward from the second end 140 of the second support brace 136 of the frame 12 to the first end 138 of the second support brace 136 of the frame 12 in the use orientation . the device 10 further comprises a seat 150 , which is mounted on the first rear cross brace 96 of the frame 12 , the first cross arm 60 of the frame 12 , and the second cross arm 66 of the frame 12 . the device 10 further comprises a back support 152 , which has a first end 154 connected to the first back rest element 74 of the frame 12 , at a location adjacent to the first arm rest 40 of the frame 12 , and a second end 156 connected to the second back rest element 80 of the frame 12 , at a location adjacent to the second arm rest 46 of the frame 12 . the device 10 further comprises a first arm rest cover 160 , which is mounted on the first arm rest 40 of the frame 12 , between the second end 134 of the first support brace 130 of the frame 12 and the first end 42 of the first arm rest 40 of the frame 12 , and a second arm rest cover 162 , which is mounted on the second arm rest 46 of the frame 12 , between the second end 140 of the second support brace 136 of the frame 12 and the first end 48 of the second arm rest 46 of the frame 12 . the device 10 further comprises a first tray mounting element 166 , which is mounted on the first arm rest 40 of the frame 12 , and a second tray mounting element 168 , which is mounted on the second arm rest 46 of the frame 12 . the device 10 further comprises a tray 170 , which is mounted on the first and second tray mounting elements 166 , 168 to support food , work , or the like , for a person sitting in the device 10 . the device 10 further comprises a first hand grip pivot mount 172 , which is located on the first top brace 110 of the frame 12 , and a second hand grip pivot mount 174 , which is located on the second top brace 116 of the frame 12 . the device 10 further comprises a first hand grip 180 , which has a proximal end 182 pivotally mounted in the first hand grip pivot mount 172 , and a distal end 184 spaced - apart from the proximal end 182 of the first hand grip 180 . the first hand grip 180 is pivotally movable between a use position , shown in fig1 , having the first back rest element 74 of the frame 12 located between the distal end 184 of the first hand grip 180 and the proximal end 182 of the first hand grip 180 , and a stored position , shown in fig2 , having the first support brace 130 of the frame 12 located between the distal end 184 of the first hand grip 180 and the proximal end 182 of the first hand grip 180 . the device 10 further comprises a second hand grip 190 , which has a proximal end 192 pivotally mounted in the second hand grip pivot mount 174 , and a distal end 194 spaced - apart from the proximal end 192 of the second hand grip 190 . the second hand grip 190 is pivotally movable between a use position , shown in fig1 , having the second back rest element 80 of the frame 12 located between the distal end 194 of the second hand grip 190 and the proximal end 192 of the second hand grip 190 , and a stored position , shown in fig2 , having the second support brace 136 of the frame 12 located between the distal end 194 of the second hand grip 190 and the proximal end 192 of the second hand grip 190 . the device 10 further comprises a first sleeve 200 , which is telescopingly connectable to the first front leg 14 of the frame 12 . the first sleeve 200 has a first end 202 , a second end 204 , and a cap 206 on the second end 204 of the first sleeve 200 . the device 10 further comprises a first lock 208 , which releasably connects the first sleeve 200 to the first front leg 14 of the frame 12 , and has a plurality of holes , such as holes 210 , defined through the first sleeve 200 , with the holes 210 being spaced - apart from each other , from adjacent to the first end 202 of the first sleeve 200 , toward the second end 204 of the first sleeve 200 . the device 10 further comprises a button 212 on the first front leg 14 of the frame 12 , which is received in one of the plurality of holes 210 of the first sleeve 200 when the first sleeve 200 is connected to the first front leg 14 of the frame 12 . the device 10 further comprises a second sleeve 220 , which is telescopingly connectable to the second front leg 20 of the frame 12 , and has a first end 222 , a second end 224 , and a cap 226 on the second end 224 of the second sleeve 220 . the device 10 further comprises a second lock 230 , which releasably connects the second sleeve 220 to the second front leg 20 of the frame 12 , and has a plurality of holes , such as holes 234 defined through the second sleeve 220 , with the holes 234 being spaced - apart from each other , from adjacent to the first end 222 of the second sleeve 220 , toward the second end 224 of the second sleeve 220 . the device 10 further comprises a button 236 on the second front leg 20 of the frame 12 . the button 236 is received in one of the plurality of holes 234 of the second sleeve 220 when the second sleeve 220 is connected to the second front leg 20 of the frame 12 . one form of the device 10 further comprises a third sleeve telescopingly connectable to the first front leg 14 of the frame 12 . the third sleeve has a first end and a second end . this form also comprises a third lock releasably connecting the third sleeve to the first front leg 14 of the frame 12 . the third lock has a plurality of holes defined through the third sleeve , with the holes being spaced - apart from each other , from adjacent to the first end of the third sleeve , toward the second end of the third sleeve . the button on the first front leg 14 of the frame 12 is received in one of the plurality of holes of the third sleeve when the third sleeve is connected to the first front leg 14 of the frame 12 . this form further comprises a fourth sleeve telescopingly connectable to the second front leg 20 of the frame 12 . the fourth sleeve has a first end and a second end . this form still further comprises a fourth lock , which releasably connects the fourth sleeve to the second front leg 20 of the frame 12 . the fourth lock has a plurality of holes defined through the fourth sleeve , with the holes being spaced - apart from each other , from adjacent to the first end of the fourth sleeve , toward the second end of the fourth sleeve . the button on the second front leg 20 of the frame 12 is received in one of the plurality of holes of the fourth sleeve when the fourth sleeve is connected to the second front leg 20 of the frame 12 . the device 10 further comprises wheel units , such as a first wheel unit 250 and a second wheel unit 252 , which can be connected to either the first and second sleeves 200 , 220 or to the third and fourth sleeves , as desired . the device 10 further comprises a first set of rear wheels 260 , which is mounted on the first end 28 of the first rear leg 26 of the frame 12 , and a second set of rear wheels 262 , which is mounted on the first end 34 of the second rear leg 32 of the frame 12 . the device 10 further comprises a brake unit , which includes a first brake handle 270 on the first hand grip 180 , and a second brake handle 272 on the second hand grip 190 . the device 10 further comprises a first brake shoe 274 , which is on the first set of rear wheels 260 , and a second brake shoe 276 , which is on the second set of rear wheels 262 . the device 10 further comprises first connection mechanism 280 , which operably connects the first brake handle 270 to the first brake shoe 274 , and a second connection mechanism 282 , which operably connects the second brake handle 272 to the second brake shoe 276 . the brake connection mechanisms 280 , 282 may include cables , joints , and the like , such as might be used to connect the hand brake of a bicycle to the brake shoes of the bicycle , as will be understood by those skilled in the art . thus , the exact structure of the brake mechanisms will not be discussed in detail . brakes can also be operated by a person sitting in the device 10 using straps or the like , as is known to those skilled in the art . the strap brakes can be used to provide further stability to the device 10 while the person is moving into or out of the device 10 . the first rear cross brace 96 of the frame 12 , the first cross arm 60 of the frame 12 , and the second cross arm 66 of the frame 12 are all located beneath the second ends 134 , 140 of the first and second support braces 130 , 136 of the frame 12 , at a distance sufficient to locate a center of gravity of the frame 12 beneath the second ends 134 , 140 of the first and second support braces 130 , 136 of the frame 12 . the device 10 further comprises a weight , such as a weight 288 , which can be included to further control the location of the center of gravity of the device 10 and thus increase the stability thereof . another form of the device 10 comprises a back support cushion 290 having straps , such as strap 292 , which releasably engage the back support 152 when the back support cushion 290 is in place , as shown in fig2 . the back support cushion 290 assists in maintaining proper posture . the device 10 may also comprise first and second foot rests 294 and 296 , as shown in fig5 , mounted on the frame 12 . yet another form of the device 10 , shown in fig6 , comprises a lower cross brace 300 and a foot pedal 302 on the lower rear cross brace 300 . the lower cross brace 300 and the foot pedal 302 provide further control of the device 10 for a person pushing the device 10 . it is understood that while certain forms of the present invention have been illustrated and described herein , it is not to be limited to the specific forms or arrangements of parts described and shown . | 0 |
this invention is directed to compounds of the formula ## str1 ## wherein r and r 1 are independently hydrogen , c 1 - c 6 alkyl , phenyl , benzyl , naphthyl , pyridyl or substituted phenyl having 1 , 2 , or 3 substituents selected from the group consisting of c 1 - c 6 alkyl , c 1 - c 6 alkoxy , c 1 - c 6 alkylthio , halo , trifluoromethyl , phenyl , phenoxy , phenyl ( c 1 - c 4 alkyl ), phenyl ( c 1 - c 4 alkoxy ), phenylacetyl , c 1 - c 6 alkanoyl , cyano , carbamyl , nitro , c 1 - c 6 alkoxycarbonyl , methylenedioxy , c 3 - c 6 alkylene , amino , -- nh ( c 1 - c 4 alkyl or benzyl ), and n ( c 1 - c 4 alkyl ) 2 ; r 2 is hydrogen , c 1 - c 6 alkyl , carboxymethyl , c 1 - c 4 alkoxycarbonylmethyl or a group of the formula ## str2 ## wherein t is 1 or 0 ; a is -- ch 2 --, -- o --, -- nh -- or -- n ( c 1 - c 6 alkyl )--; and y is phenyl or substituted phenyl as defined above ; r 4 is c 1 - c 6 alkyl , carboxymethyl , or c 1 - c 4 alkoxycarbonylmethyl ; r 3 is hydrogen or a group of the formula ## str3 ## wherein b is o or s ; x is selected from the phenyl substituents defined above ; m is 0 , 1 or 2 ; n is 0 or 1 ; q is -- nh --, -- n ( c 1 - c 6 alkyl )--, -- s --, or -- o --; and r 5 is a group of the formula --[ ch ( r 6 )] q -( ch 2 ) r - r 7 wherein r 6 is hydrogen or c 1 - c 6 alkyl ; q is 0 or 1 ; r is 0 , 1 or 2 ; and r 7 is hydrogen , c 1 - c 8 alkyl , c 3 - c 8 cycloalkyl , pentafluorophenyl , pyridyl , tetrahydro - naphthyl , indolyl , quinolinyl , phenyl , naphthyl , or phenyl or naphthyl substituted with 1 , 2 , or 3 substituents as defined above for phenyl ; or the group --( q ) n r 5 is 2 - tetrahydroisoquinolinyl ; and the pharmaceutically acceptable salts thereof ; provided that at least one of the groups r or r 1 is other than hydrogen or c 1 - c 6 alkyl , and r or r 1 is hydrogen only when the other of r and r 1 is substituted phenyl in which the substituent is phenyl ; and provided further that at least one of the groups r 2 and r 3 is other than hydrogen , and when r 3 is a group of the formula ## str4 ## r 2 is other than a group of the formula ## str5 ## in the compounds of formula i or ii , the groups r and r 1 can be in either the cis or trans configuration relative to the plane of the pyrazolidinone ring . the trans configuration , preferred in accordance with the present invention , is indicated to be the thermodynamically favored form . as used herein &# 34 ; halo &# 34 ; refers to fluoro , chloro , or bromo . the term &# 34 ; c 1 - c 6 alkyl &# 34 ; includes both straight and branched chain alkyl and cycloalkyl and includes methyl , ethyl , propyl , cyclopropyl , isopropyl , butyl , methylcyclopropyl , cyclobutyl , isobutyl , t - butyl , pentyl , cyclopentyl , neopentyl , hexyl , cyclohexyl , 2 - methylpentyl and the like . in the &# 34 ; c 1 - c 6 alkoxy &# 34 ; and &# 34 ; c 1 - c 6 alkylthio &# 34 ; substituents , the alkyl portion is c 1 - c 6 alkyl as defined above . the term &# 34 ; c 1 - c 6 alkanoyl &# 34 ; includes formyl , acetyl , propionyl , butyryl , pentanoyl , hexanoyl , and the like . the term &# 34 ; pharmaceutically acceptable salts &# 34 ; encompasses those salts that form by standard acid - base reactions with basic groups ( such as amino groups ) and acidic groups , particularly carboxylic acid groups , on the compounds of formula i or ii . thus , the pharmaceutically acceptable salts of the present invention can be prepared by conventional chemical methods from the compounds of formula i or ii which contain a basic or acidic moiety . generally , the salts are prepared by reacting the free base or acid with a stoichiometric amount or with an excess of the desired salt - forming acid or base in a suitable solvent or combination of solvents . suitable salt - forming acids include inorganic acids such as hydrochloric , hydrobromic , sulfuric , sulfamic , phosphoric , nitric , and the like ; organic acids such as acetic , propionic , succinic , glycolic , stearic , lactic , citric , malic , tartaric , ascorbic , pamoic , maleic , hydroxymaleic , phenylacetic , glutamic , benzoic , salicylic , sulfanilic , 2 - acetoxybenzoic , fumaric , toluenesulfonic , methanesulfonic , ethanedisulfonic , oxalic , benzenesulfonic , picric , cinnamic , and like acids . bases which find use for preparation of salts of compounds of formula i or ii having an acidic moiety include alkali or alkaline earth metal hydroxides such as sodium , potassium , lithium , calcium , or magnesium hydroxides , ammonia , or organic bases such as benzylamine , dibenzylamine , dibenzylethylenediamine , triethylamine , trimethylamine , piperidine , pyrrolidine , 2 - hydroxyethylamine , bis ( 2 - hydroxyethyl ) amine , phenylethylbenzylamine , and like organic amines . the compounds of this invention bind to cck and gastrin receptors in the brain and / or peripheral sites such as the pancreas , gall bladder , stomach , and ileum . their ability to antagonize cck and gastrin makes these compounds useful as pharmaceutical agents for the treatment and prevention of disease states wherein cck or gastrin may be involved , for example , gastrointestinal disorders such as irritable bowel syndrome , ulcers , excess pancreatic or gastric secretion , acute pancreatitis , motility disorders , neoplasms of gastrointestinal origin , central nervous system disorders involving cck &# 39 ; s interaction with dopamine , such as neuroleptic disorders , tardive dyskinesia , parkinson &# 39 ; s disease , psychosis or gilles de la tourette syndrome , other cns disorders where cck is believed to be a causative factor , such as panic attacks and other forms of anxiety , and in modulating appetite regulatory systems . preferred cck and gastrin receptor binding compounds of this invention are the pyrazolidinones of formula i , particularly those wherein r and r 1 are in the trans configuration relative to the plane of the pyrazolidinone ring . preferably , r and r 1 are phenyl or substituted phenyl . a preferred group of compounds of formula i are those wherein r 2 is hydrogen and r 3 is a group of the formula ## str6 ## one series of such preferred compounds of this invention are those wherein b is sulfur , n is 1 , q is -- nh --, and r 5 is phenyl or substituted phenyl . another preferred group of compounds exhibiting a consistent pattern of significant binding to cck and gastrin receptors are those compounds of formula i wherein r 2 is hydrogen and r 3 is a moiety defined by the group -- conh --[ ch ( r 6 )] q -( ch 2 ) r - r 7 . especially preferred of those compounds are those wherein q and r are 0 and r 7 is phenyl , substituted phenyl , 2 - naphthyl or 3 - quinolinyl and r and r 1 are phenyl , naphthyl , or substituted phenyl in the trans configuration relative to the plane of the pyrazolidinone ring . when r 7 is substituted phenyl , preferred substituents are halo , more particularly , chloro , bromo or iodo ; trifluoromethyl ; c 1 - c 4 alkyl ; c 3 - c 4 alkylene ; benzyloxy ; and methylthio . the compounds of this invention are readily prepared from the corresponding compounds of the formula ## str7 ## the intermediate 3 - pyrazolidinones are readily prepared by reacting hydrazine with the corresponding α , β - unsaturated esters of the formula r 1 -- ch ═ c ( r )-- coor &# 39 ; wherein r and r 1 are as defined above and r &# 39 ; is an ester forming group , typically c 1 - c 6 alkyl . the present compounds are prepared generally by acylating or alkylating the 3 - pyrazolidinones of formula iii under neutral or basic conditions with acylating or alkylating agents selected to give the targeted compound of this invention . in another embodiment of this invention there is provided pharmaceutical formulations comprising as an active ingredient an effective amount of a compound of formula i or ii and a pharmaceutically acceptable carrier , excipient or diluent therefor . such formulations can be prepared for oral or parenteral administration for the treatment and prevention of disorders of the gastrointestinal , central nervous and appetite regulatory systems of warm - blooded vertebrates , especially a man . for oral use of an antagonist of cck or gastrin of this invention , the selected compound can be administered , for example , in the form of tablets or capsules , or as an aqueous solution or suspension . in the case of tablets , common excipients include binding agents , for example , syrup , acacia , gelatin , sorbitol , tragacanth , polyvinylpyrrolidine ( povidone ), methylcellulose , ethylcellulose , sodium carboxymethylcellulose , hydroxypropylmethylcellulose , sucrose and starch ; fillers and carriers , for example , corn starch , gelatin , lactose , sucrose , microcrystalline cellulose , kaolin , mannitol , dicalcium phosphate , sodium chloride and alginic acid ; lubricants such as magnesium stearate ; disintegrants such as croscarmellose , microcrystalline cellulose , corn starch , sodium starch glycolate and alginic acid ; and suitable wetting agents such as lauryl sulfate . for oral administration in capsule form , useful diluents include lactose and dried corn starch . when aqueous suspensions are desirable for oral use , the active ingredient can be combined with emulsifying and suspending agents , for example , sorbitol , methylcellulose , glucose / sugar syrup , gelatin , hydroxyethylcellulose , carboxymethylcellulose , aluminum stearate gel or hydrogenated edible oils , for example , almond oil , fractionated coconut oil , oily esters , propylene glycol or ethyl alcohol ; flavoring agents such as pepperment , oil of wintergreen , cherry flavoring or the like ; and preservatives such as methyl or propyl p - hydroxybenzoates or ascorbic acid . the pharmaceutical formulations in accordance with this invention can also be prepared for parenteral use . such formulations typically take the form of sterile isotonic solutions of the active ingredient according to standard pharmaceutical practice . the appropriate dose of the compound of the present invention for its use as an antagonist of cck or gastrin in humans will vary according to the age , weight and response of the individual patient , as well as the severity of the patient symptoms and the nature of the condition being treated . thus , the preferred daily dose will normally be determined by the prescribing physician . however , in most instances , effective daily doses of the compounds of this invention will range from about 0 . 05 mg to about 50 mg / kg and preferably about 0 . 5 mg to about 20 mg / kg in a single or divided doses . the following examples are provided to describe further the compounds of this invention and methods for their preparation . tetrahydrofuran ( thf ) was dried by distillation from sodium / benzophenone . reactions and workup steps were conducted at room temperature unless otherwise noted . solvents were removed using a rotary evaporator at reduced pressure . chromatography was performed on normal - phase silica columns except as noted . titrations were performed in 2 : 1 dmf : h 2 o as solvent . 4 , 5 - diphenyl - 3 - pyrazolidinone ( 3 . 00 g , 12 . 6 mmol ) was dissolved in 40 ml thf under nitrogen , then a solution of 4 - chloro - 3 - trifluoromethylphenylisocyanate ( 2 . 87 g , 13 . 0 mmol , 1 . 03 eq .) in 10 ml thf added over 2 min . after 2 . 3 hr , solvent was removed in vacuo , and the residue triturated with 25 ml toluene . the resulting solid was pulverized , washed twice with toluene , and dried in vacuo at 65 ° c . to give 4 . 94 g ( 85 %) white solid . 1 h nmr ( d 6 - dmso ) δ 3 . 81 ( br s , 1h ), 5 . 56 ( br s , 1h ), 7 . 26 - 7 . 50 ( m , 10h ), 7 . 62 ( d , j = 9 hz , 1h ), 7 . 89 ( dd , j = 3 , 9 hz , 1h ), 8 . 13 ( br s , 1h ), 9 . 64 ( br s , 1h ), 10 . 90 ( br s , 1h ); mass spectra ( ms ) 460 ( m + 1 + ); analysis for c 23 h 17 clf 3 n 3 o 2 : 4 -- n , n - dimethylaminoaniline ( 2 . 00 g , 14 . 68 mmol ) and triethylamine ( 3 . 63 g , 35 . 87 mmol , 2 . 44 eq .) were dissolved in 50 ml toluene under nitrogen , then triphosgene ( 1 . 45 g , 4 . 89 mmol , 0 . 333 eq .) added in one batch as a neat solid . the mixture was heated to reflux for 2 . 5 hr , cooled , then quickly filtered , the collected solid washed twice with toluene , and the combined filtrates evaporated in vacuo to give crude 4 -- n , n - dimethylaminophenylisocyanate as 2 . 57 g brown oil . this was redissolved in 50 ml thf and a solution of 4 , 5 - diphenyl - 3 - pyrazolidinone ( 3 . 50 g , 14 . 69 mmol , 1 . 00 eq .) in 50 ml thf added over 3 min . after 20 . 7 hr , solvent was removed in vacuo and the product isolated by chromatography ( preparative hplc ; 0 - 50 % etoac : toluene gradient ) as 1 . 73 g yellow oil which slowly crystallized . recrystallization from toluene gave 744 mg ( 13 %) white crystalline solid : 1 h nmr ( d 6 - dmso ) δ 2 . 84 ( s , 6h ), 3 . 71 ( s , 1h ), 5 . 55 ( s , 1h ), 6 . 67 ( d , j = 8 hz , 2h ), 7 . 12 - 7 . 52 ( m , 12h ), 8 . 86 ( br s , 1h ), 10 . 70 ( br s , 1h ); ms 400 ( m + ); titration pk a &# 39 ; s 4 . 0 , 7 . 9 . analysis for c 24 h 24 n 4 o 2 : 4 - benzyloxybenzoic acid ( 2 . 0 g , 8 . 8 mmol ) was suspended in 50 ml toluene with oxalyl chloride ( 5 ml ) and heated to reflux for 15 min . solvent was removed in vacuo , the residue redissolved in 30 ml acetone , and an aqueous solution of nan 3 ( 1 . 16 g , 17 . 6 mmol , 2 . 0 eq . in 10 ml h 2 o ) added dropwise with external cooling by a water bath . the mixture was stirred for 1 hour , diluted with h 2 o , extracted twice with toluene , then the combined extracts washed with water and brine , and dried over na 2 so 4 . this solution of acyl azide was treated with 4 , 5 - diphenyl - 3 - pyrazolidinone ( 1 . 6 g , 6 . 8 mmol , 0 . 76 eq . ), warmed until bubbles evolved , and heating maintained for 30 min . after stirring overnight at room temperature , the solvent was removed in vacuo , and the product isolated by chromatography ( 0 - 30 % etoac : hexane gradient ) as 1 . 6 g ( 52 %) white solid : mp 127 °- 30 ° c . ; 1 h nmr ( cdcl 3 ) δ 3 . 95 ( d , j = 6 hz , 1h ), 5 . 0 ( s , 2h ), 5 . 55 ( d , j = 6 hz , 1h ), 6 . 8 ( d , j = 10 hz , 2h ), 6 . 86 - 7 . 46 ( m , 16h ), 7 . 05 ( d , j = 10 hz , 2h ), 8 . 95 ( s , 1h ); ms 463 ( m + ); titration pk a 7 . 7 . analysis for c 29 h 25 n 3 o 3 : 1 , 2 , 3 , 4 - tetrahydro - 2 - naphthoic acid ( 639 mg , 3 . 63 mmol ) was dissolved in 80 ml benzene under nitrogen , azeotropically dried by distilling a small portion of the solvent , then diphenylphosphorylazide ( 1 . 12 g , 4 . 08 mmol , 1 . 1 eq .) and et 3 n ( 0 . 41 g , 4 . 02 mmol , 1 . 1 eq .) added and the mixture heated to reflux for 1 hour . solvent was removed in vacuo , the residue dissolved in dry thf under nitrogen , and 4 , 5 - diphenyl - 3 - pyrazolidinone ( 784 mg , 3 . 29 mmol , 0 . 91 eq .) added and the mixture stirred overnight . the solvent was removed in vacuo and the product isolated by chromatography ( 25 - 50 % etoac : hexane gradient ) as 0 . 92 g ( 68 %) white foam . recrystallization of a 120 mg sample from i - pr 2 o : i - proh gave 94 mg white solid , containing a 1 : 1 mixture of two diastereomers by nmr : mp 82 °- 95 ° c . ; 1 h nmr ( cdcl 3 ) δ 1 . 46 - 1 . 66 ( m , 1h ), 1 . 79 - 1 . 97 ( m , 1h ), 2 . 30 - 2 . 84 ( m , 2h ), 2 . 95 ( apparent t of d , j = 6 , 16 hz , 1h ), 3 . 87 ( apparent d , j = 6 hz , 1h ), 4 . 09 ( m , 1h ), 5 . 12 ( m , 1h ), 5 . 34 ( apparent d of d , j = 6 , 14 hz , 1h ), 6 . 86 - 7 . 40 ( m , 14 h ), c . 9 . 0 ( v br s , 1h ); ms 411 ( m + ). a solution of 4 , 5 - diphenyl - 3 - pyrazolidinone ( 2 . 0 g , 8 . 4 mmol ) in 50 ml ch 2 cl 2 and 5 ml pyridine was treated dropwise with a solution of 3 - trifluoromethylbenzoylchloride ( 1 . 4 g , 8 . 4 mmol ) in 25 ml ch 2 cl 2 and stirred overnight . the mixture was washed with 1n hcl , dried over na 2 so 4 , evaporated , and the product isolated by chromatography ( preparative hplc ) as 840 mg ( 24 %) purple foam : 1 h nmr ( cdcl 3 ) δ 3 . 83 ( s , 1h ), 5 . 16 ( s , 1h ), 7 . 2 - 7 . 64 ( m , 15h ); ms 410 ( m + ); titration pk a 7 . 15 . analysis for c 23 h 17 f 3 n 2 o 2 : a solution of 4 , 5 - diphenyl - 3 - pyrazolidinone ( 1 . 25 g , 5 . 26 mmol ) in 50 ml chcl 3 was treated with a solution of 4 - chlorophenylchloroformate ( 1 . 0 g , 5 . 26 mmol ) in 10 ml chcl 3 and stirred overnight . the solvent was removed in vacuo and the residue recrystallized from etoac : hexane to give 1 . 6 g ( 58 %) white solid : mp 175 °- 7 ° c . 1 h nmr ( cdcl 3 ) δ 3 . 98 ( d , j = 6 hz , 1h ), 5 . 62 ( d , j = 6 hz , 1h ), 6 . 8 - 7 . 5 ( m , 15h ); ms 392 ( m + ); titration pk a 7 . 8 . analysis for c 22 h 17 cln 2 o 3 : a solution of 1 -[( 4 - nitrophenyl ) oxycarbonyl ]- 4 , 5 - diphenyl - 3 - pyrazolidinone ( 1 . 00 g , 2 . 48 mmol ) and 3 , 4 - dichlorobenzylamine ( 5 ml ) in 50 ml abs . etoh was heated to reflux for 8 hours . solvent was removed in vacuo , the residue taken up in ch 2 cl 2 , washed twice with 1n hcl and once with ph 7 buffer , and dried over na 2 so 4 . after removal of solvent in vacuo , the product was purified by chromatography ( 0 - 35 % etoac : hexane gradient ) to give 250 mg ( 23 %) solid : 1 h nmr ( cdcl 3 ) δ 3 . 93 ( d , j = 6 hz , 1h ), 4 . 28 ( dabq , j = 7 , 15 ( jab ) hz , δυ = 48 hz , 2h ), 5 . 50 ( d , j = 6 hz , 1h ), 5 . 56 ( br t , j = 7 hz , 1h ), 6 . 92 - 7 . 44 ( m , 13h ), 8 . 73 ( br s , 1h ); ms 439 ( m + ); titration pk a 8 . 4 . analysis for c 23 h 19 cl 2 n 3 o 2 : 1 -[( 4 - chloro - 3 - trifluoromethylphenyl ) aminocarbonyl ]- 4 , 5 - diphenyl - 3 - pyrazolidinone ( 2 . 00 g , 4 . 35 mmol ) in 100 ml toluene was heated at reflux for 24 hours . after removal of solvent in vacuo , the rearranged product was isolated by chromatography ( ch 2 cl 2 ), then recrystallized from i - pr 2 o : hexane , to give 300 mg ( 15 %) white solid : mp 72 °- 4 ° c . 1 h nmr ( cdcl 3 ) δ 4 . 22 ( d , j = 12 hz , 1h ), 4 . 82 ( dd , j = 9 , 12 hz , 1h ), 5 . 44 ( d , j = 9 hz , 1h ), 7 . 20 ( m , 2h ), 7 . 32 - 7 . 42 ( m , 8h ), 7 . 46 ( d , j = 9 hz , 1h ), 7 . 72 ( dd , j = 3 , 9 hz , 1h ), 7 . 87 ( d , j = 3 hz , 1h ), 10 . 56 ( br s , 1h ); ms 459 ( m + ). analysis for c 23 h 17 clf 3 n 3 o 2 : the reaction was conducted under a dry nitrogen atmosphere . a suspension of 4 , 5 - diphenyl - 3 - pyrazolidinone ( 1 . 19 g , 5 . 00 mmol ) in 35 ml toluene was treated with 0 . 40 g nah ( 60 % in mineral oil ; hydride content 0 . 24 g , 10 . 0 mmol , 2 . 00 eq . ), and the mixture stirred at 45 ° c . for 2 hours . 2 , 6 - dichlorobenzothiazole ( 1 . 02 g , 5 . 00 mmol , 1 . 00 eq .) was added and stirring continued at 80 ° c . for 20 hours . after cooling , the reaction mixture was poured onto 30 ml ice - cooled 0 . 5n hcl , extracted with etoac , and the separated organic phase washed twice with brine , dried over na 2 so 4 , and the solvent evaporated in vacuo . the residue was recrystallized from et 2 o : hexane to provide 1 . 46 g ( 72 %) light tan crystals : mp 170 . 5 °- 2 . 5 ° c . 1 h nmr ( cdcl 3 ) δ 4 . 07 ( br d , j = 6 hz , 1h ), 5 . 24 ( br d , j = 6 hz , 1h ), 7 . 16 - 7 . 58 ( m , 14h ); ms 405 ( m + ); titration pk a 6 . 6 . 1 -[( 4 -- nitrophenyl ) aminocarbonyl ]- 4 , 5 - diphenyl - 3 - pyrazolidinone ( 500 mg , 1 . 24 mmol ) was dissolved in 50 ml etoh and hydrogenated with 5 % pd / c ( 500 mg ) under 60 p . s . i . h 2 , overnight at room temperature . the mixture was filtered to remove catalyst , solvent removed in vacuo , and the product isolated by chromatography ( 0 - 50 % etoac : hexane gradient ) as 125 mg ( 27 %) solid . 1 h nmr ( cdcl 3 ) δ 3 . 97 ( d , j = 6 hz , 1h ), 5 . 50 ( d , j = 6 hz , 1h ), 6 . 58 ( d , j = 10 hz , 2h ), 6 . 96 ( d , j = 10 hz , 2h ), 7 . 2 - 7 . 5 ( m , 10h ); ms 372 ( m + ); titration pk a 4 . 5 , 8 . 1 . analysis for c 22 h 20 n 4 o 2 : to a suspension of 1 -[( 4 - bromophenyl ) aminocarbonyl ]- 4 , 5 - diphenyl - 3 - pyrazolidinone ( 2 . 0 g , mmol ) in 30 ml abs . etoh were added a solution of koh ( 1 . 1 eq .) in abs . etoh and t - butyl bromoacetate ( 5 ml ). after stirring for 3 days a precipitate of kbr had appeared . the mixture was diluted with h 2 o , extracted with et 2 o , then the et 2 o layer washed with h 2 o and brine , dried over na 2 so 4 , and evaporated in vacuo . an inseparable mixture of two products was isolated by chromatography ( 0 - 25 % etoac : hexane gradient ) as 1 . 3 g ( 52 %) foam , containing a 3 : 2 ratio of n - alkylated to o - alkylated products [ first and second title products , respectively ] by nmr : 1 h nmr ( cdcl 3 ) n - alkylated : δ 1 . 53 ( s , 9h ), 3 . 96 ( d , j = 19 hz , 1h ), 4 . 06 ( s , 1h ), 4 . 65 ( d , j = 19 hz , 1h ), 5 . 95 ( s , 1h ), 7 . 23 - 7 . 46 ( m , 14h ), 9 . 70 ( s , 1h ); o - alkylated : δ 1 . 53 ( s , 9h ), 4 . 18 ( d , j = 7 hz , 1h ), 4 . 67 ( s , 2h ), 5 . 40 ( d , j = 7 hz , 1h ), 7 . 23 - 7 . 46 ( m , 14h ), 7 . 74 ( s , 1h ); ms 549 , 551 ( m + &# 39 ; s for br isotopes ). analysis for c 28 h 28 brn 3 o 4 : the regioisomeric mixture of t - butyl esters from example 11 [ c . 3 : 2 mixture of n - to o - alkylated ] ( 500 mg , 0 . 91 mmol ) was dissolved in 30 ml ch 2 cl 2 and 5 ml trifluoroacetic acid . after 4 hours tlc ( ch 2 cl 2 ) indicated disappearance of starting materials . solvent was removed in vacuo and a mixture of two products isolated by chromatography ( 0 - 100 % etoac : hexane gradient ) as 180 mg ( 40 %) foam , comprised of a 4 : 3 ratio of n - alkylated to o - alkylated compounds [ first and second title products , respectively ] by nmr . 1 h nmr ( cdcl 3 ) n - alkylated : δ 4 . 09 ( d , j = 2 hz , 1h ), 4 . 10 ( d , j = 19 hz , 1h ), 4 . 68 ( d , j = 19 hz , 1h ), 5 . 83 ( d , j = 2 hz , 1h ), 7 . 20 - 7 . 50 ( m , 14h ), 9 . 08 ( s , 1h ); o - alkylated : δ 4 . 19 ( d , j = 5 hz , 1h ), 4 . 83 ( abq , j = 16 hz , δυ = 30 hz , 2h ), 5 . 46 ( d , j = 5 hz , 1h ), 7 . 20 - 7 . 50 ( m , 14h ), 7 . 75 ( s , 1h ); ms 493 , 495 ( m + s for br isotopes ); titration pk a 4 . 8 . analysis for c 24 h 20 brn 3 o 4 : the n - and o - alkylated products were separated by chromatography on a waters c 18 reverse - phase column , using 30 - 40 % ch 3 cn : h 2 o buffered with 0 . 3 - 0 . 5 % nh 4 oac . the leading fractions from the first pass were evaporated , lyophilized , then taken up in ch 2 cl 2 , washed twice with 1n hcl , and the solvent removed in vacuo to provide 28 mg o - alkylated product : 1 h nmr ( cdcl 3 δ 4 . 19 ( d , j = 7 hz , 1h ), 4 . 84 ( abq , j = 17 hz , δυ = 25 hz , 2h ), 5 . 45 ( d , j = 7 hz , 1h ), 6 . 39 ( br s , 1h ), 7 . 20 - 7 . 40 ( m , 14h ), 7 . 70 ( s , 1h ). the later fractions were rechromatographed twice more , then similarly processed to give 8 mg n - alkylated product : 1 h nmr ( cdcl 3 ) δ cdcl 3 4 . 05 ( s , 1h ), 4 . 08 ( br d , j = 18 hz , 1h ), 4 . 70 ( br d , j = 18 hz , 1h ), 5 . 82 ( s , 1h ), 7 . 21 - 7 . 50 ( m , 14h ), 9 . 0 ( br s , 1h ). a solution of 1 -[( 4 - trifluoromethylphenyl )- aminocarbonyl ]- 4 , 5 - diphenyl - 3 - pyrazolidinone ( 740 mg , 1 . 74 mmol ) and koh ( 122 mg of 88 % pure , 1 . 1 eq .) in 30 ml abs . etoh was treated with iodomethane ( 5 ml ) and stirred overnight . the mixture was diluted with h 2 o , extracted twice with ch 2 cl 2 , and the combined extracts washed with h 2 o , dried over na 2 so 4 , and evaporated in vacuo . the product was isolated by chromatography ( 0 - 15 % etoac : hexane gradient ) as 61 mg ( 8 %) solid . 1 h nmr ( cdcl 3 ) δ 4 . 0 ( s , 3h ), 4 . 11 ( d , j = 6 hz , 1h ), 5 . 48 ( d , j = 6 hz , 1h ), 7 . 2 - 7 . 74 ( m , 14h ), 8 . 09 ( s , 1h ); ms 439 ( m + ). also isolated was 1 -[( 4 - trifluoromethylphenyl )- aminocarbonyl ]- 2 - methyl - 4 , 5 - diphenyl - 3 - pyrazolidinone , corresponding to a product prepared , according to the method of example 1 , from 2 - methyl - 4 , 5 - diphenyl - 3 - pyrazolidinone and 4 - trifluoromethylphenylisocyanate . indole - 2 - carboxylic acid ( 1 . 35 g , 8 . 38 mmol ), oxalyl chloride ( 4 ml ), and dmf ( 3 drops ) were added in order to 50 ml toluene , and stirred until gas evolution subsided and a homogeneous solution was obtained ( c . 20 min ). solvent was removed in vacuo , the residue taken up in ch 2 cl 2 , and added to a solution of 4 , 5 - diphenyl - 3 - pyrazolidinone ( 2 . 0 g , 8 . 40 mmol , 1 . 00 eq .) in 50 ml ch 2 cl 2 and 5 ml pyridine . after stirring overnight , the solution was washed with 1n hc 1 , dried over na 2 so 4 , and solvent removed in vacuo . the residual solid was stirred with ch 2 cl 2 , filtered , and recrystallized from dmf : h 2 o to give 1 . 42 g ( 44 %) white solid : mp 248 °- 50 ° c . 1 h nmr ( d 6 - dmso ) δ 3 . 82 ( s , 1h ), 5 . 86 ( s , 1h ), 6 . 95 - 7 . 6 ( m , 16h ), 11 . 84 ( br s , 1h ); ms 381 ( m + ); titration pk a 6 . 75 . analysis for c 24 h 19 n 3 o 2 : examples 15 - 135 are summarized below in table i . the compound of each example is identified by reference to the structural formula preceeding each group of examples . the method for preparing each compound is indicated by reference to the methods a - o , corresponding to the procedures identified in the foregoing examples 1 - 9 . example 133a , and examples 137 - 138 in table ii follow the same format . examples 136 , 139a / 139b , 140 - 143 are illustrated separately to show physical chemistry data as well as the individual methods of preparation of these compounds . the phenyl groups on the pyrazolidinone ring of the compounds of examples 1 - 67 , 74 - 109 , and 136 - 143 are in the trans position . table i - physical chemistry data on cck / gastrin antagonists ## str8 ## a nalysis , % method solvent yield , mp . theory / found ex . r of prep . of cryst .. sup . a % ° c . ms 1hnmr formula c h n 15 h a etoac : 2 . 20 g 168 - 70 357 ( m +) dmso 3 . 75 ( s , 1h ), 5 . 58 ( s , 1h ), c22h19n3o2 73 . 93 5 . 36 11 . 78hexane 73 % 6 . 96 - 7 . 53 ( m , 15h ), 9 . 16 ( s , 1h ), 73 . 84 5 . 42 11 . 75 10 . 8 ( s , 1h ) 16 4 - cf3 a ( thf ) phme 2 . 32 g 426 ( m + 1 ) dmso 3 . 80 ( br s , 1h ), 5 . 58 ( br s , c23h18f3n3o2 64 . 94 4 . 26 9 . 88 43 . 3 % 1h ), 7 . 30 - 7 . 80 ( m , 14h ), 9 . 54 ( br s , 64 . 67 4 . 09 9 . 75 1h ), 10 . 90 ( br s , 1h ) 17 4 - f a etoac : 1 . 76 g 189 - 91 375 ( m +) cdcl3 3 . 99 ( d , j = 6 hz , 1h ), 5 . 53 c22h18fn3o2 70 . 37 4 . 83 11 . 17hexane 65 % ( d , j = 6hz , 1h ), 6 . 85 - 7 . 5 ( m , 14h ), 70 . 24 4 . 85 11 . 09 8 . 95 ( br s , 1h ) 18 4 - cl a etoac : 2 . 44 g 173 - 5 391 ( m +) dmso 3 . 78 ( s , 1h ), 5 . 56 ( s , 1h ), c22h18cln3o2 67 . 43 4 . 63 10 . 72hexane 48 % 7 . 24 - 7 . 6 ( m , 14h ), 9 . 32 ( s , 1h ), 67 . 30 4 . 79 10 . 67 10 . 81 ( s , 1h ) 19 4 - cl b chrom 60 mg 405 ( m +) cdcl3 3 . 18 ( s , 3h ), 3 . 53 ( d , j = 3 c23h2ocln3o2 ( nme ) ( prep 40 % hz , 1h ), 4 . 86 ( d , j = 3 hz , 1h ), 6 . 9 - plates ) 7 . 42 ( m , 15h ) 20 4 - br a ( thf ) phme ( to 2 . 64 g 174 - 6 . sup . b 435 , 437 dmso 3 . 77 ( br s , 1h ), 5 . 57 ( br s , c22h18brn3o2 . 63 . 49 4 . 60 8 . 71give 58 % ( m +&# 39 ; s for br 1h ), 7 . 12 - 7 . 55 ( m , 14h ), 9 . 31 ( br s , 1 / 2 ( c7h8 ) 63 . 15 4 . 60 8 . 81phme isotopes ) 1h ), 10 . 81 ( br s , 1h ) hemi - solvate ) 21 4 - i c etoac : 90 mg 177 - 9 483 ( m +) cdcl3 4 . 0 ( d , j = 6hz , 1h ), 5 . 54 ( d , c22h181in3o2 54 . 67 3 . 75 8 . 69hexane 2 % j = 6hz , 1h ), 6 . 9 - 7 . 5 ( m , 14h ) 54 . 46 3 . 70 8 . 51 22 4 - co2et a chrom 480 mg 430 ( m + 1 ) cdcl3 1 . 36 ( t , j = 8hz , 3h ), 4 . 02 c25h23n3o4 11 % ( d , j = 6hz , 1h ), 4 . 34 ( q , j = 8hz , 2h ), 5 . 56 ( d , j = 6hz , 1h ), 7 . 18 - 7 . 95 ( m , 14h ) 23 4 - come a chrom 31 mg 399 ( m +) cdcl3 2 . 52 ( s , 3h ), 4 . 03 ( d , j = 6 c24h21n3o3 1 . 2 % hz , 1h ), 5 . 55 ( d , j = 6hz , 1h ), 7 . 31 ( d , j = 12 hz , 2h ), 7 . 2 - 7 . 5 ( m , 11 hz ), 7 . 83 ( d , j = 12hz , 2h ), 9 . 18 ( br s , 1h ) 24 4 - no2 a etoac : 1 . 8 g 168 - 70 402 ( m +) dmso 3 . 83 ( s , 1h ), 5 . 58 ( s , 1h ), c22h18n4o4 65 . 67 4 . 51 13 . 92hexane 71 % 7 . 25 - 7 . 5 ( m , 10h ), 7 . 82 ( d , j = 14 65 . 43 4 . 56 13 . 70 hz , 2h ), 8 . 2 ( d , j = 14hz , 2h ), 9 . 77 ( s , 1h ), 11 . 03 ( br s , 1h ) 25 4 - me a phme 1 . 72 g 371 ( m +) dmso 2 . 25 ( s , 3h ), 3 . 75 ( s , 1h ), c23h21n3o2 74 . 37 5 . 70 11 . 31 44 % 5 . 57 ( br s , 1h ), 7 . 08 ( d , j = 8hz , 74 . 52 5 . 50 11 . 10 2h ), 7 . 3 - 7 . 5 ( m , 12h ), 9 . 03 ( br s , 1h ), 10 . 74 ( br s , 1h ) 26 4 - et a triturated 3 . 74 g 385 ( m +) dmso 1 . 16 ( 1 , j = 8hz , 3h ), 2 . 55 c24h23n3o2 74 . 78 6 . 01 10 . 90with phme 92 % ( q , j = 8hz , 2h ), 3 . 74 ( br s , 1h ), 75 . 00 6 . 13 10 . 71 5 . 57 ( br s , 1h ), 7 . 12 ( d , j = 9 hz , 2h ), 7 . 14 - 7 . 54 ( m , 12h ), 9 . 06 ( br s , 1h ), 10 . 76 ( br s , 1h ) 27 4 - n - pr c etoac : 230 mg 169 - 71 400 ( m + 1 ) cdcl3 0 . 9 ( t , j = 10 hz , 3h ), 1 . 58 c25h25n3o2 75 . 16 6 . 31 10 . 52hexane 6 % ( m , 2h ), 2 . 5 ( t , j = 10hz , 2h ), 4 . 0 75 . 07 6 . 23 10 . 50 ( d , j = 6hz , 1h ), 5 . 54 ( d , j = 6hz , 1h ), 6 . 82 ( s , 1h ), 7 . 03 ( d , j = 12hz , 2h ), 7 . 1 ( d , j = 12hz , 2h ), 7 . 23 - 7 . 5 ( m , 10h ), 8 . 62 ( br s , 1h ) 28 4 - n - bu a etoac : 1 . 22 g 165 - 7 413 ( m +) cdcl3 0 . 95 ( t , j = 10hz , 3h ), 1 . 3 c26h27n3o2 75 . 52 6 . 58 10 . 16hexane 47 % ( m , 2h ), 1 . 5 ( m , 2h ), 2 . 56 ( t . j = 10 75 . 23 6 . 35 9 . 97 hz , 2h ), 3 . 96 ( d , j = 6hz , 1h ), 5 . 54 ( d , j = 6hz , 1h ), 6 . 93 ( s , 1h ), 7 . 03 ( d , j = 12hz , 2h ), 7 . 1 ( d , j = 12hz , 2h ), 7 , 23 - 7 . 46 ( m , 10h ), 9 . 04 ( s , 1h ) 29 4 - i - pr a thf : 1 . 0 g 191 - 3 399 ( m +) cdcl3 1 . 21 ( d , j = 10hz , 6h ), 2 . 83 c25h25n3o2 75 . 16 6 . 31 10 . 52etoac 40 % ( m , j = 10hz , 1h ), 4 . 0 ( d , j = 6hz , 75 . 37 6 . 42 10 . 46 1h ), 5 . 53 ( d , j = 6hz , 1h ), 6 . 83 ( s , 1h ), 7 . 1 - 7 . 5 ( m , 14h ), 8 . 65 ( s , 1h ) 30 4 - t - bu c etoac 790 mg 204 - 7 413 ( m +) cdcl3 1 . 26 ( s , 9h ), 4 . 0 ( d , j = 6hz , c26h27n3o2 75 . 52 6 . 58 10 . 16 30 % 1h ), 5 . 50 ( d , j = 6hz , 1h ), 6 . 83 ( s , 75 . 74 6 . 78 10 . 18 1h ), 7 . 12 ( d . j = 12hz , 2h ), 7 . 35 ( d , j = 12hz , 2h ), 7 . 2 - 7 . 44 ( m , 10h ), 8 . 6 ( s , 1h ) 31 4 - c - hexyl b chrom , 104 mg 200 - 3 439 ( m +) dmso 1 . 15 - 1 . 85 ( m , 10h ), 2 . 22 c28h29n3o2 76 . 51 6 . 65 9 . 56then 3 % ( m , 1h ), 3 . 74 ( s , 1h ), 5 . 58 ( s , 1h ), 76 . 29 6 . 81 9 . 38 etoac , 7 . 13 ( d , j = 12hz , 1h ), 7 . 46 ( d , then j = 12hz , 1h ), 7 . 3 - 7 . 43 ( m , 10h ), chrom 9 . 08 ( s , 1h ), 10 . 76 ( s , 1h ) 32 4 - ph c chrom , 312 mg 180 - 2 433 ( m +) cdcl3 4 . 02 ( d , j = 6hz , 1h ), 5 . 60 c28h23n3o2 76 . 94 5 . 50 9 . 97then , 17 % ( d , j = 6hz , 1h ), 7 . 2 - 7 . 56 ( m , 20h ), 76 . 86 5 . 39 9 . 96 etoac : 9 . 4 ( br s , 1h ) hexane 33 4 - ome a etoac : 1 . 9 g 154 - 7 387 ( m +) cdcl3 3 . 74 ( s , 3h ), 3 . 96 ( d , j = 6 c23h21n3o3 71 . 30 5 . 46 10 . 85hexane 79 % hz , 1h ), 5 . 53 ( d , j = 6hz , 1h ), 6 . 74 70 . 71 5 . 67 10 . 71 ( d , j = 12hz , 2h ), 7 . 15 ( d , j = 12hz , 2h ), 6 . 9 - 7 . 43 ( m , 11h ), 9 . 0 ( br s , 1h ) 34 4 - oet a triturated 2 . 93 g 401 ( m +) dmso 1 . 31 ( t , j = 7hz , 3h ), 3 . 73 c24h23n3o3 71 . 80 5 . 77 10 . 47with phme 87 % ( s , 1h ), 3 . 97 ( q , j = 7hz , 2h ), 5 . 55 72 . 05 5 . 89 10 . 21 ( br s , 1h ), 6 . 84 ( d , j = 8hz , 2h ), 7 . 3 - 7 . 53 ( m , 12h ), 8 . 99 ( br s , 1h ), 10 . 72 ( br s , 1h ) 35 4 - o - i - pr b triturated 1 . 34 g 178 - 80 415 ( m +) cdcl3 1 . 27 ( d , j = 8hz , 6h ), 3 . 93 c25h25n3o3 72 . 27 6 . 06 10 . 11with et2o 74 % ( d , j = 5 hz , 1h ), 4 . 42 ( septet , j = 6 72 . 25 6 . 04 10 . 06 hz , 1h ), 5 . 54 ( d , j = 5hz , 1h ), 6 . 72 ( d , j = 9hz , 2h ), 6 . 95 ( s , 1h ), 7 . 05 ( d , j = 9hz , 2h ), 7 . 13 - 7 . 39 ( m , 11h ) 36 4 - och2ch2ph b chrom 324 mg 477 ( m +) dmso 3 . 01 ( t , j = 7hz , 2h ), 3 . 73 c30h27n3o3 75 . 45 5 . 70 8 . 80 ( etoac : 31 % ( s , 1h ), 4 . 14 ( t , j = 7hz , 2h ), 5 . 55 75 . 71 5 . 78 8 . 67 hexane ), ( br s , 1h ), 6 . 86 ( d , j = 9hz , 2h ), then 7 . 18 - 7 . 52 ( m , 17h ), 9 . 01 ( br s , 1h ), triturated 10 . 72 ( br s , 1h ) with phme 37 4 - oph a etoac : 2 . 9 g 188 - 90 450 ( m + 1 ) dmso 3 . 75 ( s , 1h ), 5 . 59 ( s , 1h ), c28h23n3o3 74 . 82 5 . 16 9 . 35ch3oh 68 % 6 . 95 - 7 . 56 ( m , 19h ), 9 . 21 ( s , 1h ), 74 . 58 5 . 22 9 . 34 10 . 8 ( s , 1h ) 38 4 - sme a etoac : 1 . 6 g 160 - 2 403 ( m +) cdcl3 2 . 42 ( s , 3h ), 4 . 0 ( d , j = 6hz , c23h21n3o2s 68 . 46 5 . 25 10 . 41hexane 65 % 1h ), 5 . 54 ( d , 4 = 6hz , 1h ), 6 . 95 - 68 . 28 5 . 28 10 . 25 7 . 44 ( m , 15h ), 8 . 98 ( br s , 1h ) 39 4 - cf3 a etoac : 3 . 0 g 165 - 7 425 ( m +) dmso 3 . 8 ( s , 1h ), 5 . 58 ( s , 1h ), c23h18f3n3o2 64 . 94 4 . 27 9 . 88hexane 83 % 7 . 3 - 7 . 56 ( m , 12h ), 7 . 82 ( d , 1h ), 65 . 07 4 . 19 9 . 77 7 . 98 ( s , 1h ), 9 . 54 ( s , 1h ), 10 . 88 ( s , 1h ) 40 3 - no2 a etoac : 2 . 11 g 164 - 6 ( no m +) cdcl3 4 . 03 ( d , j = 6hz , 1h ), 5 . 62 c22h18n4o4 65 . 57 4 . 51 13 . 92hexane 84 % ( d , j = 6hz , 1h ), 7 . 2 - 8 . 1 ( m , 14h ) 65 . 53 4 . 25 13 . 67 41 3 - me a ch3oh 1 . 05 g 188 - 90 371 ( m +) dmso 3 . 3 ( s , 3h ), 3 . 74 ( s , 1h ), c23h21n3o2 74 . 37 5 . 70 11 . 31 46 % 5 . 57 ( s , 1h ), 6 . 8 - 7 . 54 ( m , 12h ), 74 . 17 5 . 63 11 . 04 9 . 04 ( s , 1h ), 10 . 86 ( s , 1h ) 42 3 - ome a etoac : 2 . 1 g 163 - 5 387 ( m +) cdcl3 3 . 7 ( s , 3h ), 3 . 98 ( d , j = 6hz , c23h21n3o3 71 . 30 5 . 46 10 . 85hexane 51 % 1h ), 5 . 54 ( d , j = 6hz , 1h ), 6 . 56 - 71 . 29 5 . 72 10 . 59 7 . 48 ( m , 16h ) 43 3 - o - i - pr b c6h6 : 450 mg 80 - 85 415 ( m +) cdcl3 12 . 6 ( d , j = 6hz , 6h ), 3 . 96 c25h25n3o3 72 . 27 6 . 06 10 . 11hexane 22 % ( d , j = 5hz , 1h ), 4 . 45 ( septet , j = 6 71 . 99 6 . 18 9 . 94 hz , 1h ), 5 . 51 ( d , j = 5hz , 1h ), 6 . 54 - 6 . 62 ( m , 2h ), 6 . 91 - 7 . 08 ( m , 3h ), 7 . 21 - 7 . 50 ( m , 11h ) 44 3 - och2ph b triturated 1 . 64 g 143 - 463 ( m +) cdcl3 3 . 99 ( d , j = 5hz , 1h ), 4 . 97 c29h25n3o3 75 . 14 5 . 44 9 . 07with et2o 85 % 44 . 5 ( s , 2h ), 5 . 54 ( d , j = 5hz , 1h ), 6 . 66 - 75 . 01 5 . 49 8 . 84 6 . 68 ( m , 2h ), 7 . 06 ( s , 1h ), 7 . 09 - 7 . 12 ( m , 2h ), 7 . 23 - 7 . 44 ( m , 16h ) 45 3 - cf3 , 4 - br b chrom 120 mg 503 , 505 cdcl3 4 . 03 ( d , j = 6hz , 1h ), 5 . 58 c23h17brf3n3o2 54 . 78 3 . 40 8 . 33 12 % ( m +&# 39 ; s for br ( d , j = hz , 1h ), 7 . 2 - 7 . 56 ( m , 15h ) 55 . 05 3 . 51 8 . 07 isotopes 46 3 , 4 - dicl a etoac : 2 . 2 g 169 - 71 425 ( m +) cdcl3 4 . 04 ( d , j = 6hz , 1h ), 5 . 57 c22h17cl2n3o2 61 . 99 4 . 02 9 . 86hexane 49 % ( d , j = 6hz , 1h ), 6 . 97 - 7 . 5 ( m , 15h ) 62 . 22 4 . 11 9 . 75 47 3 - cl , 4 - f a etoac : 2 . 0 g 174 - 6 409 ( m +) cdcl3 4 . 0 ( d , j = 6hz , 1h ), 5 . 56 ( d , c22h17clfn3o2 64 . 47 4 . 18 10 . 25hexane 84 % j = 6hz ), 1h ), 6 . 95 - 7 . 5 ( m , 15h ) 64 . 03 4 . 76 9 . 53 48 3 - no2 , 4 - cl a etoac : 910 mg 149 - 51 436 ( m +) cdcl3 4 . 03 ( d . j = 6hz , 1h ), 5 . 58 c22hl7cin404 60 . 49 3 . 92 12 . 83hexane 41 % ( d , j = 6hz , 1h ), 7 . 2 - 7 . 82 ( m , 14h ), 60 . 23 4 . 03 12 . 79 9 . 3 ( s , 1h ) 49 3 , 4 -( ch2 ) 3 b etoac : 380 mg 179 - 81 397 ( m +) dmso 1 . 97 ( m , 2h ), 2 . 8 ( m , 4h ), c25h23n3o2 75 . 55 5 . 83 10 . 57hexane , 12 % 3 . 7 ( s , 1h ), 5 . 58 ( s , 1h ), 7 . 12 - 7 . 5 75 . 67 5 . 95 10 . 46 then ( m , 13h ), 9 . 0 ( s , 1h ), 10 . 75 ( s , 1h ) chrom ( etoac : hexane ), thenetoac 50 3 , 4 -( ch2 ) 4 d chrom 354 mg 177 - 411 ( m +) cdcl3 1 . 74 ( t , j = 3hz , 4h ), 2 . 66 c26h25n3o2 75 . 89 6 . 12 10 . 21 ( etoac : 20 % 8 . 5 ( d , j = 7hz , 4h ), 3 . 97 ( d , j = 5hz , 76 . 08 6 . 33 10 . 05 ch2cl2 ), 1h ), 5 . 55 ( d , j = 5hz , 1h ), 6 . 83 - then 6 . 92 ( m , 3h ), 6 . 98 ( s , 1h ), 7 . 24 - et2o : 7 . 44 ( m , 10h ), 9 . 06 ( br s , 1h ) ch2cl2 51 3 , 4 - diome b chrom 640 mg 418 ( m + 1 ) cdcl3 3 . 74 ( s , 3h ), 3 . 82 ( s , 3h ), c24h23n3o4 69 . 05 5 . 55 10 . 07 11 % 3 . 97 ( d , j = 6hz , 1h ), 5 . 58 ( d , j = 6 68 . 92 5 . 54 10 . 12 hz , 1h ), 6 . 53 - 7 . 5 ( m , 14h ), 8 . 7 ( s , 1h ) 52 3 , 4 - och2o b etoac 390 mg 179 - 81 401 ( m +) dmso 3 . 73 ( s , 1h ), 5 . 55 ( s , 1h ), c23h19n3o4 68 . 82 4 . 77 10 . 47 7 % 5 . 97 ( s , 2h ), 6 . 8 - 7 . 6 ( m , 13h ), 68 . 98 4 . 76 10 . 29 9 . 05 ( s , 1h ), 10 . 75 ( s , 1h ) 53 2 - cf3 a etoac 3 . 46 g 143 - 5 425 ( m +) dmso 3 . 8 ( s , 1h ), 5 . 6 ( s , 1h ), 7 . 2 - c23h18f3n3o2 64 . 94 4 . 26 9 . 88 77 % 7 . 75 ( m , 14h ), 8 . 68 ( s , 1h ), 10 . 95 65 . 15 4 . 19 9 . 60 ( s , 1h ) 54 2 , 3 - dicl a thf : 3 . 9 g 191 - 3 425 ( m +) dmso 3 . 78 ( s , 1h ), 5 . 54 ( s , 1h ), c22h17cl2n3o2 61 . 93 4 . 02 9 . 86hexane 70 % 7 . 3 - 7 . 6 ( m , 13h ), 8 . 88 ( s , 1h ), 62 . 00 3 . 96 9 . 94 11 . 05 ( s , 1h ) 55 2 , 4 - dicl a etoac : 1 . 7 g 150 - 3 425 ( m +) cdcl3 4 . 02 ( d , j = 6hz , 1h ), 5 . 38 c22h17cl2n3o2 61 . 98 4 . 02 9 . 86hexane 63 % ( d , j = 6hz , 1h ), 7 . 15 - 7 . 5 ( m , 13h ), 62 . 16 4 . 28 9 . 96 8 . 1 ( d , j = 10hz , 1h ), 8 . 95 ( s , 1h ) 56 2 , 4 - dif a chrom 800 mg 393 ( m +) cdcl3 4 . 03 ( d , j = 6hz , 1h ), 5 . 43 c22h17f2n3o2 32 % ( d , j = 6hz , 1h ), 6 . 8 ( m , 2h ), 6 . 91 ( s , 1h ), 7 . 2 - 7 . 5 ( m , 9h ), 7 . 93 ( m , 1h ), 8 . 8 ( br s , 1h ) 57 2 - cl , 5 - cf3 a etoac : 1 . 38 g 130 - 2 459 ( m +) cdcl3 4 . 05 ( d , j = 6hz , 1h ), 5 . 41 c23h17clf3n3o2 60 . 07 3 . 73 9 . 14hexane 29 % ( d , j = 6hz , 1h ), 7 . 2 - 7 . 5 ( m , 14h ), 60 . 37 3 . 95 9 . 03 8 . 53 ( s , 1h ) 58 3 , 5 - dicf3 a chrom 3 . 6 g 493 ( m +) cdcl3 4 . 03 ( d , j = 6hz , 1h ), 5 . 62 c24h17f6n3o2 58 . 42 3 . 47 8 . 52 69 % ( d , j = 6hz , 1h ), 7 . 2 - 7 . 58 ( m , 13h ), 58 . 59 3 . 75 8 . 69 7 . 75 ( s , 2h ) 59 3 , 5 - dicl a etoac : 800 mg 166 - 8 425 ( m +) dmso 3 . 82 ( s , 1h ), 5 , 54 ( s , 1h ), c22h17cl2n3o2 61 . 99 4 . 02 9 . 86hexane 30 % 7 . 2 ( s , 1h ), 7 . 15 - 7 . 5 ( m , 10h ), 7 . 71 61 . 75 3 . 94 9 . 65 ( s , 2h ), 9 . 5 ( s , 1h ), 10 . 95 ( s , 1h ) ## str9 ## a nalysis , % method solvent yield , mp . theory / found ex . r of prep . of cryst .. sup . a % ° c . ms 1hnmr formula c h n 60 h a ( thf ) phme : hexane , 117 mg 69 - 79 373 ( m +) cdcl3 4 . 03 ( d , 1h ), 5 . 77 ( d , 1h ), c22h19n3os . 69 . 77 6 . 53 9 . 39then et2o : 5 % 7 . 10 - 754 ( m , 16h ), 9 . 6 ( br s , 1h ) c4h10o 69 . 72 6 . 38 9 . 37hexane ( to give [ plus for et2o : 1 . 20 ( t , 6h ), 3 . 48et2o solvate ) ( q , 4h )] 61 3 - cf3 a chrom 1 . 5 g 442 ( m + 1 ) cdcl3 4 . 07 ( d , j = 6hz , 1h ), 5 . 82 c23h18f3n3os 62 . 58 4 . 11 9 . 52 33 % ( d , j = 6hz , 1h ), 7 . 12 - 7 . 63 ( m , 62 . 87 4 . 22 9 . 34 16h ) 62 4 - cf3 a phme 800 mg 87 - 90 441 ( m +), cdcl3 4 . 09 ( d , j = 6hz , 1h ), 5 . 77 c23h18f3n3os 62 . 51 4 . 11 9 ., 52 29 % 442 ( m + 1 ) ( d , j = 6hz , 1h ), 7 . 16 ( d , j = 9hz , 62 . 51 4 . 15 9 . 46 1h ), 7 . 2 - 7 . 28 ( m , 3h ), 7 . 3 - 7 . 44 ( m , 7h ), 7 . 44 - 7 . 64 ( m , 5h ) 63 3 - cf3 , 4 - cl a chrom , then 200 mg 80 - 2 475 ( m +), cdcl3 4 . 09 ( d , j = 6hz , 1h ), 5 . 83 c23h17clf3n3o 58 . 05 3 . 60 8 . 83triturated with 10 % 476 ( m + 1 ) ( d , j = 6hz , 1h ), 7 . 06 - 7 . 6 ( m , s 58 . 15 3 . 62 8 . 55hexane 15h ) 64 2 , 3 - dicl a etoac : hexane 2 . 5 g 154 - 6 441 ( m +), dmso 3 . 95 ( s , 1h ), 6 . 16 ( s , 1h ), c22h17cl2n3os 59 . 73 3 . 87 9 . 50 67 % 442 , 444 7 . 2 - 7 . 6 ( m , 13h ), 9 . 5 ( br s , 1h ), 59 . 92 4 . 11 9 . 73 ( m + 1 &# 39 ; s for cl 11 . 5 ( br s , 1h ) isotopes ) 65 pentaf a chrom 600 mg 463 ( m +) cdcl3 4 . 04 ( d , j = 5hz , 1h ), 5 . 82 c22h14f5n3os 21 % ( s , 1h ), 6 . 94 ( s , 1h ), 7 . 2 - 7 . 55 ( m , 11h ) ## str10 ## a nalysis , % method solvent yield , theory / found ex . r r &# 39 ; of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n 66 2 , 3 - dicl me a etoac : 670 mg 172 - 4 439 ( m +) dmso 3 . 35 ( s , 3h ), 3 . 88 ( s , 1h ), 5 . 50 c23h19cl2n3o2 62 . 74 4 . 35 9 . 54 hexane 76 % ( s , 1h ), 7 . 16 - 7 . 56 ( m , 13h ), 9 . 26 ( s , 62 . 55 4 . 26 9 . 37 1h ) 67 4 - cf3 me a chrom 210 mg 439 ( m +) cdcl3 3 . 36 ( s , 3h ), 3 . 93 ( d , j = 3hz , c24h20f3n3o2 65 . 60 4 . 59 9 . 56 40 % 1h ), 5 . 54 ( d , j = 3hz , 1h ), 6 . 92 ( s , 65 . 35 4 . 51 9 . 30 1h ), 7 . 15 - 7 . 6 ( m , 14h ) ## str11 ## a nalysis , % method solvent yield , theory / found ex . r r &# 39 ; of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n 68 2 , 3 - dicl ph a etoac 170 mg 172 - 3 425 ( m +) dmso 2 . 5 ( m 1h ), 3 . 53 ( m , 1h ), 5 . 72 c22h17cl2n3o2 61 . 96 4 . 02 9 . 86 63 % ( s , 1h ), 7 . 3 - 7 . 76 ( m , 11h ), 7 . 95 ( s , 1h ), 62 . 20 4 . 04 9 . 94 8 . 58 ( s , 1h ), 10 . 6 ( br s , 1h ) ## str12 ## a nalysis , % method solvent yield , theory / found ex . r r &# 39 ; of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n 69 4 - br n - bu a chrom 670 mg 415 , 417 dmso 0 . 84 ( t , j = 12hz , 3h ), 1 . 30 ( m , c20h22brn3o2 56 % ( m +&# 39 ; s for br 2h ), 1 . 46 ( m , 2h ), 1 . 65 ( m , 2h ), 3 . 29 ( s , isotopes ) 1h ), 5 . 38 ( s , 1h ), 7 . 2 - 7 . 6 ( m , 9h ), 9 . 17 ( s , 1h ), 10 . 34 ( s , 1h ) ## str13 ## a nalysis , % method solvent yield , theory / found ex . r r &# 39 ; of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n 70 3 - cf3 n - bu a chrom 290 mg 405 ( m +) cdcl3 0 . 93 ( t , j = 12hz , 3h ), 1 . 42 ( m , c21h22f3n3o2 62 . 21 5 . 47 10 . 36 21 % 2h ), 1 . 5 ( m , 2h ), 1 . 73 ( m , 1h ), 1 . 83 ( m , 62 . 40 5 . 66 10 . 26 1h ), 3 . 79 ( s , 1h ), 4 . 83 ( m , 1h ) 7 . 2 - 7 . 6 ( m , 9h ), 7 . 74 ( s , 1h ), 7 . 83 ( s , 1h ) 71 4 - cf3 n - bu a chrom 136 mg 152 - 5 405 ( m +) cdcl3 0 . 95 ( t , j = 8hz , 3h ), 1 . 42 ( m , c21h22f3n3o2 62 . 21 5 . 47 10 . 36 15 % 2h ), 1 . 51 ( m , 2h ), 1 . 72 ( m , 1h ), 1 . 88 61 . 97 5 . 56 10 . 22 ( m , 1h ), 3 . 53 ( s , 1h ), 4 . 82 ( t , j = 8hz , 1h ), 7 . 18 - 7 . 35 ( m , 5h ), 7 . 44 ( abq , j = 8 hz , δν = 18hz , 4h ), 7 . 65 ( s , 1h ), 8 . 55 ( νbr s , 1h ) 72 4 - br ch2ph a etoac : 248 mg 449 , 451 dmso 2 . 97 - 3 . 15 ( m , 2h ), 3 . 47 ( br s , c23h20brn3o2 61 . 34 4 . 48 9 . 33 hexane 51 % ( m +&# 39 ; s for br 1h ), 4 . 70 ( br s , 1h ), 7 . 01 ( d , j = 8hz , 61 . 16 4 . 73 9 . 12 isotopes ) 2h ), 7 . 15 - 7 . 42 ( m , 12h ), 9 . 05 ( br s , 1h ), 10 . 47 ( br s , 1h ) 73 4 - br i - pr a chrom 45 mg 401 , 403 , cdcl3 1 . 12 ( d , j = 6hz , 6h ), 2 . 05 ( m , c19h20brn3o2 ( etoac : 42 % ( m +&# 39 ; s for br j = 7hz , 1h ), 3 . 64 ( s , 1h ), 4 . 56 ( d , j = 8 hexane ) isotopes ) hz , 1h ), 7 . 20 - 7 . 51 ( m , 9h ), 8 . 28 ( br s , 1h ) ## str14 ## a nalysis , % method solvent yield , theory / found ex . r x of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n 74 4 - cf3 -- e ( et3n ) c 100 mg 72 - 5 410 ( m +) cdcl3 3 . 89 ( d , j = 4 hr , 1h ), 5 . 16 ( br s , c23h17f3n2o2 67 . 31 4 . 18 6 . 83 6 % 1h ), 7 . 18 - 7 . 26 ( m , 5h ), 7 . 26 - 7 . 50 ( m , 67 . 57 4 . 45 6 . 64 8h ), 7 . 50 - 7 . 57 ( m , 2h ) 75 3 , 4 - dicl -- e ( no c 508 mg 68 - 70 410 , 412 cdcl3 3 . 89 ( d , j = 4 hz , 1h ), 5 . 18 ( br s , c22h16c12n2o2 64 . 25 3 . 92 6 . 81base ) 29 % ( m +&# 39 ; s for cl 1h ), 7 . 14 - 7 . 48 ( m , 14h ) 64 . 21 3 . 99 6 . 60 isotopes ) 76 3 - cf3 ch2 e chrom 600 mg 424 ( m +) cdcl3 3 . 47 ( s , 2h ), 3 . 94 ( s , 1h ), 5 . 30 c24h19f3n2o2 67 . 92 4 . 51 6 . 60 17 % ( s , 1h ), 7 . 0 - 7 . 8 ( m , 14h ) 67 . 76 4 . 56 6 . 79 77 4 - cf3 ch2 e ( no c 101 mg 66 - 68 424 ( m +) cdcl3 3 . 48 ( br s , 2h ), 3 . 91 ( d , j = 4hz , c24h19f3n2o2 67 . 92 4 . 51 6 . 60base ) 6 % 1h ), 5 . 28 ( br s , 1h ), 7 . 04 - 7 . 5 ( m , 15h ) 67 . 78 4 . 56 6 . 45 78 3 , 4 - dicl ch2 e ( et3n ) et2o : 1 . 0 g 70 - 72 426 ( m +) cdcl3 3 . 36 ( br s , 2h ), 3 93 ( d . j = 5hz , c23h18cl2n2o2 64 . 95 4 . 27 6 . 58 hexane 17 % 1h ), 5 . 27 ( br s , 1h ), 6 . 84 ( br s , 1h ), 7 . 0 64 . 93 4 . 67 6 . 60 ( br s , 1h ), 7 . 08 - 7 . 5 ( m , 12h ) 79 h o f etoac : 980 mg 164 - 6 358 ( m +) cdcl3 3 . 97 ( d , j = 6hz , 1h ), 5 . 54 ( d , c22h18n2o3 73 . 73 5 . 06 7 . 82 hexane 43 % j = 6hz , 1h ), 6 . 9 - 7 . 5 ( m , 16h ) 73 . 94 5 . 29 7 . 88 80 4 - no2 o f etoac 13 g 175 - 7 403 ( m +) cdcl3 4 . 02 ( d , j = 6hz , 1h ), 5 . 52 ( d , c22h17n3o5 65 . 51 4 . 25 10 . 42 32 % j = 6hz , 1h ), 7 . 1 - 7 . 5 ( m , 12h ), 8 . 19 ( d , 65 . 49 4 . 31 10 . 34 j = 15hz , 2h ), 9 . 25 ( br s , 1h ) 81 4 - br s b etoac : 610 mg 156 - 7 452 , 454 cdcl3 3 . 97 ( d , j = 4hz , 1h ), 5 . 58 ( d c22h17brn2o2s 58 . 29 3 . 78 6 . 18 hexane 13 % ( m +&# 39 ; s for br j = 4hz , 1h ), 7 . 25 - 7 . 55 ( m , 14h ), 9 . 15 58 . 04 3 . 79 6 . 07 isotopes ) ( br s , 1h ) ## str15 ## a nalysis , % method solvent yield , theory / found ex . r x of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n 82 3 - cf3 nh n chrom 1 . 72 g 425 ( m +) cdcl3 4 . 22 ( d , j = 12hz , 1h ), 4 . 82 c23h18f3n3o2 ( ch2cl2 ) 48 % ( dd , j = 9hz , 12hz , 1h ), 5 . 46 ( d , j = 9 hz , 1h ), 7 . 18 - 7 . 75 ( m , 13h ), 7 . 84 ( s , 1h ), 10 , 35 ( s , 1h ) 83 4 - cf3 nh n chrom 530 mg 74 - 6 425 ( m +) cdcl3 4 . 23 ( d , j = 12hz , 1h ), 4 , 82 c24h18f3n3o2 64 . 94 4 . 27 9 . 88 ( ch2cl2 ), 30 % dd , j = 9 , 12hz , 1h ), 5 . 44 ( d , j = 9hz , 65 . 11 4 . 41 9 . 65 then 1h ), 7 . 18 - 7 . 24 ( m , 2h ), 7 . 3 - 7 . 42 ( m , triturated 8h ), 7 . 56 - 7 . 7 ( m , 4h ), 10 . 4 ( br s , 1h ) with hexane ## str16 ## a nalysis , % method solvent yield , theory / found ex . r x of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n 84 h s o ( c6h6 ) et2o 233 mg 186 - 8 371 ( m +) cdcl3 4 . 05 ( d , 1h ), 5 . 23 ( d , 1h ), 7 . 15 - c22h17n3os 71 . 14 4 . 61 11 . 31 42 % 7 . 68 ( m , 15h ) 71 . 38 4 . 89 11 . 11 85 6 - br s o ( phme ) et2o : 1 . 67 g 180 - 6 449 , 451 cdcl3 4 . 06 ( d , j = 7hz , 1h ), 5 . 24 ( d , c22h16brn3os 58 . 67 3 . 58 9 . 33 hexane 57 % ( m +&# 39 ; s for br j = 7hz , 1h ), 7 . 16 - 7 . 52 ( m , 13h ), 7 . 64 58 . 87 3 . 83 9 . 08 isotopes ) ( d . j = 1hz , 1h ) 86 4 , 5 - dicl s o ( phme ) et2o : 1 . 10 g 200 - 4 440 ( m + 1 for cdcl3 4 . 13 ( d , j = 8hz , 1h ), 5 . 19 ( d , c22h15cl2n3os 60 . 01 3 . 43 9 . 54 hexane 83 % cl isotopes ) j = 8hz , 1h ), 7 . 18 - 7 . 45 ( m , 13h ) 60 . 30 3 . 70 9 . 62 87 h o o ( phme ) et2o 660 mg 174 - 355 ( m +) cdcl3 4 . 04 ( d , j = 4 . 5hz , 1h ), 5 . 60 ( d , c22h17n3o2 74 . 35 4 . 82 11 . 82 82 % 5 . 5 j = 4 . 5 hz , 1h ), 7 . 14 - 7 . 54 ( m , 15h ) 74 . 56 4 . 98 11 . 67 ## str17 ## a nalysis , % method solvent yield , mp . theory / found ex . r of prep . of cryst .. sup . a % ° c . ms 1hnmr formula c h n 88 3 - pyridyl c precipi - 3 . 5 g 208 - 10 358 ( m +) dmso 3 . 8 ( s , 1h ), 5 . 54 ( s , 1h ), 7 . 27 - c21h18n4o2 70 . 38 5 . 06 15 . 63tated from 73 % 7 . 5 ( m , 11h ), 7 . 94 ( m , 1h ), 8 . 23 ( m , 70 . 34 5 . 16 15 . 35reaction 1h ), 8 . 7 ( m , 1h ), 9 . 38 ( brs , 1h ), mixture 10 . 94 ( br s , 1h ) 89 4 - pyridyl c chrom 183 mg 356 ( m +) cdcl3 3 . 93 ( d , j = 6hz , 1h ), 5 . 46 ( d , c21h18n4o2 28 % j = 6hz , 1h ), 7 . 18 - 7 . 35 ( m , 10h ), 7 . 62 ( d , j = 10hz , 2h ), 7 . 95 ( d , j = 10hz 2h ) 90 1 - naphthyl a etoac : 790 mg 145 - 7 407 ( m +) cdcl3 4 . 03 ( d , j = 6hz , 1h ), 5 . 51 ( d , c26h21n3o2 76 . 64 5 . 19 10 . 31hexane 33 % j = 6hz , 1h ), 6 . 8 - 7 . 8 ( m , 18h ), 9 . 0 ( br 76 . 41 5 . 33 10 . 12 s , 1h ) 91 2 - naphthyl a etoac : 1 . 13 g 172 - 4 407 ( m +) cdcl3 4 . 02 ( d , j = 6hz , 1h ), 5 . 60 ( d , c26h21n3o2 76 . 64 5 . 19 10 . 31hexane 44 % j = 6hz , 1h ), 7 . 1 - 7 . 9 ( m , 18h ), 9 . 38 76 . 83 5 . 27 10 . 26 ( br s , 1h ) 92 3 - quinollnyl d thf : 157 mg 244 - 409 ( m +) dmso 3 . 81 ( s , 1h ), 5 . 57 ( s , 1h ), c25h20n4o2 73 . 51 4 . 93 13 . 71phme 12 % 6 . 5 7 . 29 - 7 . 62 ( m , 12h ), 7 . 85 ( d , j = 8hz , 73 . 48 4 . 74 13 . 55 ( came out 1h ), 7 . 91 ( d , j = 8hz , 1h ), 8 . 44 ( d , of j = 2hz , 1h ), 8 . 97 ( d , j = 2hz , 1h ), reaction 9 . 62 ( br s , 1h ), 11 . 00 ( br s , 1h ) mixture ) 93 6 - quinollnyl d ch3cn : 224 mg 222 - 5 408 ( m +) dmso 3 . 79 ( s , 1h ), 5 . 58 ( s , 1h ), c25h20n4o2 73 . 51 4 . 94 13 . 72phme 32 % 7 . 25 - 7 . 49 ( m , 11h ), 7 . 85 - 7 . 93 ( m , 73 . 68 5 . 09 13 . 57 2h ), 8 . 14 ( d , j = 1 . 4hz , 1h ), 8 . 20 ( d , j = 8hz , 1h ), 8 . 74 ( dd , j = 1 . 4 , 4 . 3hz , 1h ), 9 . 45 ( br s , 1h ), 10 . 95 ( br s , 1h ) 94 n - bu a chrom 2 . 68 g 337 ( m +) dmso 0 . 86 ( t , j = 10hz , 3h ), 1 . 15 ( m , c20h23n3o2 71 . 19 6 . 87 12 . 45 76 % 2h ), 1 . 38 ( m , 2h ), 3 . 08 ( m , 2h ), 3 . 62 71 . 33 6 . 71 12 . 27 ( s , 1h ), 5 , 47 ( s , 1h ), 7 . 18 ( s , 1h ), 7 . 3 - 7 . 46 ( m , 10h ), 10 . 52 ( s , 1h ) 95 c - hexyl a etoac : 1 . 9 g 152 - 4 363 ( m +) cdcl3 0 . 8 - 1 . 84 ( m , 10h ), 3 . 6 ( m , 1h ), c22h25n3o2 72 . 70 6 . 93 11 . 56hexane 83 % 3 . 89 ( d , j = 6hz , 1h ), 4 . 98 ( d , j = 12 72 . 59 7 . 03 11 . 30 hz , 1h ), 5 . 42 ( d , j = 6hz , 1h ) 7 . 2 - 7 . 45 ( m , 10h ), 8 . 66 ( s , 1h ) 96 ch2ph a chrom 2 . 6 g 371 ( m +) cdcl3 3 . 86 ( d , j = 6hz , 1h ), 4 . 31 c2323h21n3o2 74 . 37 5 . 70 11 . 31 67 % ( dabq , j = 8hz , jab = 20hz , δν = 36 74 . 11 5 . 77 11 . 12 hz , 2h ), 5 . 50 ( m , 1h ), 5 . 51 ( d , j = 6 hz , 1h ), 7 . 07 - 7 . 43 ( m , 16h ) 97 ch2ph ( nme ) m chrom 380 mg 385 ( m +) cdcl3 2 . 65 ( s , 3h ), 3 . 66 ( d , j = 2hz , c24h23n3o2 ( etoac : 39 % 1h ), 4 . 38 ( abq , j = 20hz , δν = 72hz , hexane ) 2h ), 4 . 94 ( d , j = 2hz , 1h ), 6 . 9 ( m , 2h ), 7 . 15 - 7 . 46 ( m , 13h ), 7 . 9 ( br s , 1h ) 98 ch2ph - 2 - cl m chrom 149 mg 405 ( m +) cdcl3 3 . 92 ( d , j = 7hz , 1h ), 4 . 4 ( m , c23h20cln3o2 68 . 06 4 . 97 10 . 35 15 % 2h ), 5 . 39 ( d , j = 7hz , 1h ), 5 . 55 ( t , j = 6 68 . 30 5 . 13 10 . 01 hz , 1h ), 7 . 15 - 7 . 43 ( m , 14h ), 8 . 48 ( br s , 1h ) 99 ch2ph - 3 - cl c etoac : 750 mg 133 - 6 405 ( m +) cdcl3 3 . 88 ( d , j = 6hz , 1h ), 4 . 26 c23h20cln3o2 68 . 08 4 . 97 10 . 35hexane 29 % ( dabq , j = 7hz , jab = 17hz , δν = 48 67 . 78 5 . 07 10 . 46 hz , 2h ), 5 . 48 ( d , j = 6hz , 1h ), 5 . 57 ( t , j = 7hz , 1h ), 6 . 94 - 7 . 43 ( m , 14h ), 8 . 9 ( br , 1h ) 100 ch2ph - 4 - cl a etoac : 182 mg 124 - 7 405 ( m +) cdcl3 3 . 89 ( d , j = 5hz , 1h ), 4 . 27 c23h20cln3o2 68 . 06 4 . 97 10 . 35hexane 30 % ( dabq , j = 6hz , jab = 12hz , δν = 42 68 . 22 5 . 09 10 . 15 hz , 2h ), 5 . 48 ( t , j = 6hz , 1h ), 5 . 50 ( d , j = 5 hz , 1h ), 6 . 98 - 7 . 44 ( m , 14h ), 8 . 52 ( br s , 1h ) 101 ch ( me ) ph ( s ) a chrom 900 mg 385 ( m +) cdcl3 . sup . e 1 . 32 ( q , j = 9hz , 3h ), 3 . 90 c24h23n3o2 74 . 78 6 . 01 10 . 90 ( 1 : 1 mixture of 34 % ( dd , j = 5hz , 9hz , 1h ), 4 . 90 ( q , j = 8 75 . 04 6 . 10 10 . 94 diastereomers - each hz , 1h ), 5 . 37 ( dd , j = 9hz , 36hz , 1h ), optically active ). sup . d 5 . 45 ( t , j = 5hz , 1h ), 7 . 0 - 7 . 44 ( m , 15h ), 8 . 53 ( br s , 1h ) 102 ch ( me ) ph ( r ) a chrom 172 mg 385 ( m +) dmso . sup . e 1 . 20 ( t , j = 6hz , 3h ), 3 , 60 ( s , c24h23n3o2 ( 1 : 1 mixture of 7 % 1 / 2h ), 3 . 66 ( s , 1 / 2h ), 4 . 83 ( m , 1h ), diastereomers - each 5 . 43 ( s , 1 / 2h ), 5 . 52 ( s , 1 / 2h ), 7 . 2 - optically active ). sup . f 7 . 55 ( m , 15h ), 10 . 58 ( s , 1h ) 103 ch ( me ) ph - 4 - br (+/-) a etoac : 670 mg 145 - 7 463 , 465 dmso 1 . 41 ( d , j . 8hz , 3h ), 3 . 62 ( s , c24h22brn3o2 62 . 08 4 . 78 9 . 05 ( single diasteromer hexane 33 % ( m +&# 39 ; s for 1h ), 4 . 76 ( m , 1h ), 5 . 42 ( s , 1h ), 7 . 2 - 62 . 27 4 . 75 8 . 95 obtained in br 7 . 62 ( m , 15h ), 10 . 56 ( s 1h ) crystallization ). sup . g isotopes ) 104 ch ( me )- 1 - a chrom 137 mg 435 ( m +) cdcl3 ( peaks for major isomer visble c28h25n3o2 naphthyl ( r ) 12 % in plot ) 1 . 5 ( d , j = 9hz , 3h ), 3 . 86 ( d , ( c . 3 : 1 mixture of j = 6hz , 1h ), 5 , 48 ( d , j = 6hz , 1h ), diastereomers - each 5 . 74 ( m , 1h ), 7 . 06 - 8 . 19 ( m , 19h ) optically active ). sup . h 105 ch2ch2ph a chrom 720 mg 385 ( m +) cdcl3 2 . 68 ( m , 2h ), 3 . 42 ( m , 2h ), c24h23n3o2 74 . 78 6 . 01 10 . 90 30 % 3 . 86 ( d , j = 6hz , 1h ), 4 . 94 ( 1 , j = 5hz , 74 . 49 6 . 15 10 . 74 1h ), 5 . 27 ( d , j = 6hz , 1h ), 6 . 95 - 7 . 44 ( m , 15h ) 106 ch2ch2ph - 2 - cl c chrom 2 . 2 g 419 ( m +) cdcl3 2 . 82 ( m , 2h ), 3 . 45 ( m , 2h ), c24h22cln3o2 68 . 65 5 . 28 10 . 01 63 % 3 . 85 ( d , j = 7hz , 1h ), 5 . 02 ( t , j = 6hz , 68 . 86 5 . 36 10 . 01 1h ), 5 . 25 ( d , j = 7hz . 1h ), 6 . 95 - 7 . 4 ( m , 14h ), 8 . 58 ( br s , 1h ) 107 ch2ch2ph - 4 - cl c chrom 1 . 5 g 419 ( m +) cdcl3 2 . 63 ( m , 2h ), 3 . 40 ( m , 2h ), c24h22cln3o2 68 . 65 5 . 28 10 . 01 66 % 3 . 86 ( d , j = 8hz , 1h ), 4 . 83 ( t , j = 6 hz , 68 . 84 5 . 36 9 . 76 1h ), 5 . 22 ( d , j = 8hz , 1h ), 6 . 88 - 7 . 42 ( m , 14h ), 8 . 45 ( br s , 1h ) 108 ch2ch2ch2ph d chrom 239 mg 399 ( m +) cdcl3 1 . 70 ( pentet , j = 7hz , 2h ), 2 . 48 c25h25n3o2 75 . 16 6 . 31 10 . 52 ( etoac : 48 % ( t , j = 7hz , 2h ), 3 . 18 ( m , 2h ), 3 . 89 ( d , 74 . 89 6 . 28 10 . 27hexane ) j = 6hz , 1h ), 4 . 92 ( br t , j = 6hz , 1h ), 5 . 35 ( d , j = 6hz , 1h ), 7 . 02 - 7 . 46 ( m , 15h ), 8 . 25 ( br s , 1h ) ## str18 ## a nalysis , % method solvent yield , theory / found example of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n 109 b chrom 75 mg 160 - 6 397 ( m +) cdcl3 2 . 58 - 2 . 82 ( m , 2h ), 3 . 37 - 3 . 48 ( m , 1h ), 3 . 54 - 3 . 62 ( m , c25h23n3o24 % 1h ), 3 . 64 ( d , j = 2 , 1h ), 4 . 37 ( d , j = 3 . 5 , 2h ), 4 . 95 ( d , j = 2 , 1h ), 6 . 78 ( m , 1h ), 7 . 02 - 7 . 46 ( m , 13h ), 8 . 18 ( br s , 1h ) ## str19 ## a nalysis , % meth . solvent yield , mp , theory / found ex . r1 r2 r3 prep . of cryst .. sup . a % ° c . ms 1hnmr formula c h n 110 4 - cf3 2 - cl h a etoac 185 mg 459 ( m +) dmso 3 . 57 ( br s , 1h ), 5 . 72 ( br c23h17clf3n3o2 60 . 07 3 . 73 9 . 14 19 % s , 1h ), 7 . 14 - 7 . 82 ( m , 13h ), 59 . 85 3 . 80 8 . 82 9 . 72 ( br s , 1h ), 11 . 01 ( br s , 1h ) 111 4 - cf3 3 - cn h a triturated 1 . 80 g 450 ( m +) dmso 3 . 90 ( br s , 1h ), 5 . 67 ( br c24h17f3n4o2 64 , 00 3 . 80 12 . 44 with phme 88 % s , 1h ), 7 . 12 - 7 . 98 ( m , 13h ), 64 . 09 3 . 98 12 . 26 9 . 63 ( br s , 1h ), 10 . 83 ( br s , 1h ) 112 4 - cf3 3 - ome h a chrom ( 2 × 160 mg 455 ( m +) cdcl3 3 . 82 ( s , 3h ), 4 . 03 ( d , c24h20f3n3o3 63 . 29 4 . 43 9 . 23 with 9 % j = 7hz , 1h ), 5 . 51 ( d , j = 7hz , 63 . 00 4 . 36 9 . 03 etoac : 1h ), 6 . 92 - 7 . 00 ( m , 3h ), 7 . 14 - hexane ), 7 . 50 ( m , 10h ), ˜ 8 . 8 ( br s , 1h ) then triturated with phme hexane 113 4 - cf3 4 - n ( me ) 2 h a etoac : 95 mg 468 ( m +) dmso 2 . 90 ( s , 6h ), 3 . 73 ( br s , c25h23f3n4o2 64 . 10 4 . 95 11 . 96 hexane 32 % 1h ), 5 . 46 ( br s , 1h ), 6 . 77 ( d , 64 . 26 5 . 18 11 . 71 j = 8hz , 2h ), 7 . 23 - 7 . 40 ( m , 7h ), 7 . 62 ( d , j = 8hz , 2h ), 7 . 76 ( d , j = 8hz , 2h ), 9 . 42 ( br s , 1h ), 10 . 81 ( br s , 1h ) 114 4 - br 2 - cl h a phme , 47 mg 469 , 471 dmso 3 . 53 ( br s , 1h ), 5 . 72 ( br c22h17brcln3o2 56 . 13 3 . 64 8 . 94 then 10 % ( m +&# 39 ; s for s , 1h ), 7 . 12 - 7 . 60 ( m , 13h ), 56 . 24 3 . 62 8 . 82 etoac : br 9 . 49 ( br s , 1h ), 10 . 93 ( br s , 1h ) hexane isotopes ) 115 4 - br 2 - ome h a etoac : 52 mg 465 , 467 cdcl3 3 . 72 ( s , 1h ), 3 . 78 ( s , c23h20brn3o3 59 . 24 4 . 32 9 . 01 hexane 17 % ( m +&# 39 ; s for 3h ), 5 . 50 ( br s , 1h ), 6 . 87 - 7 . 04 59 . 46 4 . 23 8 . 90 br ( m , 3h ), 7 . 27 - 7 . 52 ( m , 10h ), isotopes ) 9 . 29 ( br s , 1h ) 116 4 - br 2 , 3 - dicl h a triturated 1 , 89 g 503 , 505 dmso 3 . 58 ( s , 1h ), 5 . 65 ( s , c22h16brcl2n3o2 49 . 35 3 . 13 7 . 67 ( trans ) with 69 % ( m +&# 39 ; s ), 1h ), 5 . 70 ( s , 2h for 1 / 2 . 1 / 2ch2cl2 49 . 60 3 . 25 7 . 78 et2o , 506 , 508 ch2cl2 ), 7 . 28 - 7 . 46 ( m , 12h ), then ( m + 1 &# 39 ; s for 9 . 43 ( br s , 1h ), 10 . 91 ( br s , 1h ) ch2cl2 : cl , br hexane isotopoes ) ( to give ch2cl2 hemi - solvate ) 117 4 - br 2 , 3 - dicl h a ch2cl2 76 mg 198 - 503 , 505 , dmso 5 . 04 ( d , j = 10hz , 1h ), c22h16brcl2n3o2 52 . 31 3 . 19 8 . 32 ( cis ) ( 2 ×) 54 % 205 507 ( m +&# 39 ; s 6 . 30 ( m , 1h ), 6 . 72 ( d , j = 7hz , 52 . 59 3 . 27 8 . 35 for cl , br 2h ), 7 . 00 - 7 . 12 ( m , 3h ), 7 . 30 - isotopes ) 7 . 60 ( m , 7h ), 9 . 31 ( br s , 1h ), 10 . 70 ( br s , 1h ) 118 4 - br 3 - conh2 h a ch3cn 237 mg 210 - 479 , 481 dmso 3 . 78 ( s , 1h ), 5 . 55 ( s , c23h19brn4o3 57 . 63 4 . 00 11 . 69 45 % 3 ( m + 1 &# 39 ; s for 1h ), 7 . 25 - 7 . 59 ( m , 12h ), 7 . 80 57 . 57 3 . 96 11 . 66 br ( d , j = 8hz , 1h ), 7 . 94 ( d , j = 24 isotopes ) hz , 2h ), 9 . 28 ( s , 1h ), 10 . 78 ( br s , 1h ) 119 4 - br 4 - no2 h a etoac : 343 mg 480 , dmso 3 . 88 ( br s , 1h ), 5 . 69 ( br c22h17brn4o4 54 . 90 3 . 56 11 . 64 phme 60 % 482 ( m +&# 39 ; s s , 1h ), 7 . 30 - 7 . 53 ( m , 9h ), 55 . 15 3 . 64 11 . 55 for br 7 . 76 ( br d , j = 7hz , 2h ), 8 . 31 isotopes ) ( d , j = 8hz , 2h ), 9 . 39 ( br s , 1h ), 10 . 93 ( br s , 1h ) 120 3 - cf3 , 2 - cl h a etoac 604 mg 493 dmso 3 . 58 ( br s , 1h ), 5 . 72 ( br c23h16cl2f3n3o2 55 . 89 3 . 26 8 . 50 4 - cl hexane 44 % 495 ( m +&# 39 ; s s , 1h ), 7 . 30 - 7 . 50 ( m , 7h ), 55 . 85 3 . 21 8 . 43 for br 7 . 58 - 7 . 67 ( m , 3h ), 7 . 93 ( d , j = 9 isotopes ) hz , 1h ), 8 . 15 ( br s , 1h ), 9 . 83 ( br s , 1h ), 11 . 04 ( br s , 1h ) 121 4 - i - pr 2 - cl h a etoac : 514 mg 434 ( m + 1 ) dmso 1 . 18 ( d , j = 7hz , 6h ), c25h24cln3o2 69 . 20 5 . 58 9 . 68 hexane 43 % 2 . 84 ( m , j = 7hz , 1h ), 3 . 51 ( br 69 . 00 5 . 55 9 . 73 s , 1h ), 5 . 74 ( br s , 1h ), 7 . 14 - 7 . 64 ( m , 13h ), 9 . 27 ( br s , 1h ), 10 . 88 ( br s , 1h ) 122 4 - br h 2 - cl a etoac 750 mg 182 - 470 ( m + 1 ) dmso 4 . 16 ( br s , 1h ), 5 . 66 ( br c22h17brcln3o2 56 . 13 3 . 64 8 . 93 43 % 2 . 5 s , 1h ), 7 . 48 - 7 . 88 ( m , 13h ), 56 . 35 3 . 62 8 . 92 9 . 56 ( br s , 1h ), 11 . 26 ( br s , 1h ) 123 4 - br h 3 - ome a etoac : 520 mg 154 - 467 ( m +) cdcl3 3 . 72 ( s , 3h ), 4 . 94 ( d , c23h20brn3o3 59 . 24 4 . 32 9 . 01 hexane 30 % 5 j = 6hz , 1h ), 5 . 57 ( d , j = 6hz , 59 . 44 4 . 39 9 . 06 1h ), 6 . 74 - 6 . 88 ( m , 3h ), 7 . 04 - 7 . 32 ( m , 7h ), 7 . 42 ( br s , 4h ), 9 . 2 ( br s , 1h ) 124 4 - br h 3 - o - i - a et2o : 2 . 24 g 148 - 493 , 495 cdcl3 1 . 22 ( t , j = 6hz , 6h ), c25h24brn3o3 60 . 74 4 . 89 8 . 50pr hexane 91 % 51 ( m +&# 39 ; s for 3 . 90 ( d , j = 4 . 5hz , 1h ), 4 . 43 60 . 53 4 . 94 8 . 70 br ( septet , j = 6hz , 1h ), 5 . 58 ( d , isotopes ) j = 4 . 5hz , 1h ), 6 . 74 - 6 . 82 ( m , 3h ), 7 . 08 ( dd , j = 2 , 9hz , 2h ), 7 . 19 - 7 . 29 ( m , 5h ), 7 . 36 - 7 . 42 ( m , 5h ) 125 4 - br h 3 - no2 a ch2cl2 : 1 . 32 g 150 - 480 , 482 dmso 4 . 05 ( s , 1h ), 5 . 61 ( s , c22h17brn4o4 54 . 90 3 . 56 11 . 64 hexane 48 % 1 . 5 ( m +&# 39 ; s for 1h ), 7 . 27 - 7 . 52 ( m , 9h ), 7 . 66 ( t , 54 . 63 3 . 67 11 . 74 br j = 8hz , 1h ), 7 . 82 ( d , j = 8hz , isotopes ) 1h ), 8 . 16 ( d , j = 8 , 1h ), 8 . 22 ( s , 1h ), 9 . 34 ( br s , 1h ), 10 . 95 ( br s , 1h ) 126 4 - br h 3 - cl a etoac : 232 mg 142 - 470 ( m + 1 ) cdcl3 4 . 0 ( d , j = 6hz , 1h ), c22h17brcln3o2 56 . 13 3 . 64 8 . 93 hexane 27 % 3 5 . 46 ( d , j = 6hz , 1h ), 6 . 87 ( br 56 . 21 3 . 76 8 . 84 s , 1h ), 7 . 0 - 7 . 12 ( m , 3 h ), 7 . 22 - 7 . 54 ( m , 10h ), 8 . 78 ( br s , 1h ) 127 4 - br h 3 - br a chrom , 128 mg 515 , 517 cdcl3 3 . 94 ( br d , j = 4hz , c22h17br2n3o2 51 . 29 3 . 33 8 . 16 then 17 % ( m +&# 39 ; s ), 1h ), 5 . 46 ( br d , j = 4hz , 1h ), 51 . 66 3 . 60 7 . 88 triturated 516 ( m + 1 7 . 04 - 7 . 44 ( m , 15h ) with for br et2o : isotopes ) hexane 128 4 - br h 4 - ome a chrom 296 mg 467 ( m +) cdcl3 3 . 78 ( s , 3 h ), 3 . 95 ( d , c23h20brn3o3 59 . 24 4 . 32 9 . 01 ( etoac ), 34 % j = 6hz , 1h ), 5 . 49 ( d , j = 6hz , 59 . 30 4 . 53 8 . 78 then 1h ), 6 . 85 ( d , j = 12hz , 2h ), triturated 7 . 0 - 7 . 18 ( m , 5h ), 7 . 24 - 7 . 5 ( m , with 7h ), 9 . 1 ( br s , 1h ) hexane 129 4 - br h 4 - cl a triturated 1 . 92 g 172 - 469 , 471 , dmso 3 . 78 ( s , 1h ), 5 . 49 ( s , c22h17clbrn3o2 56 . 13 3 . 64 8 . 93 with et2o 82 % 4 . 5 473 1h ), 7 . 28 - 7 . 50 ( m , 13h ), 9 . 22 56 . 03 3 . 57 9 . 02 ( m +&# 39 ; s ), ( br s , 1h ), 10 . 84 ( br s , 1h ) 470 ( m + 1 for cl , br isotopes ) 130 4 - cf3 h 2 - cl a triturated 260 mg 178 - 459 ( m +) cdcl3 4 . 4 ( d , j = 6hz , 1h ), c23h17clf3n3o2 60 . 07 3 . 73 9 . 14 with 38 % 9 5 . 58 ( d , j = 6hz , 1h ), 7 . 2 - 7 . 54 60 . 07 3 . 77 9 . 18 etoac : ( m , 13h ), 7 . 64 ( br s , 1h ), 9 . 48 hexane ( br s , 1h ) 131 3 - cf3 , h 2 - cl a triturated 250 mg 109 - 493 ( m +) cdcl3 4 . 38 ( d , j = 6hz , 1h ), c23h16cl2f3n3o2 55 . 89 3 . 26 8 . 50 4 - cl with 34 % 10 5 . 6 ( d , j = 6hz , 1h ), 7 . 16 - 7 . 66 55 . 60 3 . 24 8 . 45 etoac : ( m , 12h ), 7 . 86 ( br s , 1h ), 9 . 58 hexane ( br s , 1h ) 132 4 - i - pr h 2 - cl a etoac : 200 mg 226 - 433 ( m +) dmso 1 . 16 ( d , j = 7hz , 6h ), c25h24cln3o2 69 . 20 5 . 57 9 . 68 hexane 31 % 7 2 . 82 ( m , 1h ), 3 . 92 ( br s , 1h ), 69 . 45 5 . 60 9 . 68 5 . 48 ( br s , 1h ), 7 . 12 ( d , j = 12 hz , 2h ), 7 . 28 - 7 . 64 ( m , 11h ), 9 . 14 ( brs , 1h ), 10 . 98 ( br s , 1h ) 133 4 - br 2 - cl 2 - cl a etoac : 4 . 32 g , 505 ( m +) dmso 4 . 02 ( br s , 1h ), 5 . 75 ( br c22h16brcl2n3o2 52 . 30 3 . 19 8 . 32 ( trans ) hexane 88 % s , 1h ), 7 . 28 - 7 . 58 ( m , 12h ), 52 . 07 3 . 27 8 . 09 9 . 41 ( br s , 1h ), 11 . 06 ( br s , 1h ) 133a 4 - br 2 - cl 2 - cl a etoac : 113 mg 505 ( m +) dmso 5 . 26 ( d , j = 8hz , 1h ), c22h16brcl2n3o2 52 . 31 3 . 19 8 . 32 ( cis ) ( thf ) hexane 48 % 6 . 20 ( br s , 1h ), 6 . 36 ( d , j = 9 52 . 23 3 . 32 8 . 47 hz , 1h ), 6 . 85 ( t , j = 9hz , 1h ), 7 . 06 - 7 . 70 ( m , 10h ), 9 . 34 ( br s , 1h ), 10 . 74 ( br s , 1h ) ## str20 ## a nalysis , % meth . solvent yield , mp , theory / found ex . r ar1 ar2 prep . of cryst .. sup . a % ° c . ms 1hnmr formula c h n 134 4 - br ph 1 - naphthyl a et2o 1 . 48 g 187 - 9 486 , 488 cdcl3 4 . 70 ( d , j = 6hz , 1h ), 5 . 59 c26h20brn3o2 64 . 21 4 . 15 8 . 64 hexane 61 % ( m + 1 &# 39 ; s ( d , j = 6hz , 1h ), 6 . 97 ( d , j = 9hz , 64 . 02 4 . 20 8 . 61 for br 2h ), 7 . 15 - 7 . 52 ( m , 12h ), 7 . 70 - isotopes ) 7 . 88 ( m , 3h ), 9 . 10 ( br s , 1h ) 135 4 - br 3 - pyridyl ph a etoac 848 mg 184 - 437 , 439 dmso 3 . 84 ( s , 1h ), 5 . 56 ( s , 1h ), c21h17brn4o2 57 . 68 3 . 92 12 . 81 ( 2 ×), then 24 % 87 . 5 ( m + 1 &# 39 ; s 7 . 23 - 7 . 46 ( m , 10h ), 7 . 83 ( d , j = 8 57 . 74 3 . 99 13 . 07 chrom , for br hz , 1h ), 8 . 53 ( dd , j = 1 . 1 , 4 . 5hz , then isotopes ) 1h ), 8 . 65 ( d , j = 1 . 7hz , 1h ), 9 . 28 etoac ( s , 1h ), 10 . 86 ( br s , 1h ) . sup . a includes other methods of purification such as chromatography ( chrom ), trituration , and precipitation , as indicated . if only solvents are given , compound was purified by recrystallization from those solvents for other methods of purification , solvents used follow in parentheses . . sup . b after recrystallization from etoac : hexane . . sup . c purified by extraction into 1n naoh , followed by acidification wit 1n hcl and extraction into organic solvent ( et2o or etoac ). evaporation o solvent gave material homogeneous by tlc and of satisfactory purity . . sup . d prepared using s (-)- α - methylbenzylisocyante . . sup . e all splitting patterns reported are those apparent upon visual inspection of plot , and reflect a combination of true protonproton magnetic couplings , and multiplicity due to presence of a mixture of two diasteromers . . sup . f prepared using r (+)- α - methylbenzylisocyanate . . sup . g prepared using (±) 4 - bromo - α - methylbenzylisocyanate . . sup . h prepared using ( r )(-)- 1 -( 1 - naphthyl ) ethyllsocyanate . 2 - ammonaphthalene ( 2 . 95 g , 20 . 6 mmol ) was dissolved in 230 ml chcl 3 under nitrogen . triethylamine ( 11 . 5 ml , 8 . 35 g , 82 . 5 mmol , 4 . 00 eq ) was added and the mixture was cooled in an ice bath . thiophosgene ( 3 . 30 ml , 43 . 3 mmol , 2 . 0 eq ), dissolved in 90 ml chcl 3 , was added slowly over 1 hr . stirring was continued for 2 hr at room temperature , then the mixture was partitioned between h 2 o and chcl 3 . the organic phase was separated , washed with h 2 o and two times with 1 . 0n hcl , then dripped through na 2 so4 to remove water and evaporated in vacuo to yield 4 . 29 g (& gt ; 100 %) of a brown oil which solidified . nmr indicated the desired 2 - naphthylisothiocyanate and contaminants : 1 h nmr ( cdcl 3 ) 7 . 30 - 7 . 85 ( m , 7h ). 4 , 5 - diphenyl - 3 - pyrazolidinone ( 1 . 00 g , 4 . 20 mmol was dissolved in 10 ml thf under nitrogen and a solution of crude 2 - naphthylisothiocyanate ( obtained above ; 0 . 93 g , c . 5 . 0 mmol , c . 1 . 2 eq ) in 10 ml thf was added . after stirring overnight , tlc indicated the presence of unreacted pyrazolidinone , so more 2 - naphthylisothiocyanate ( 0 . 39 g , c . 0 . 50 eq ) was added in thf . after stirring an additional 1 hr , tlc still indicated some pyrazolidinone . after removal of solvent in vacuo , the residue was partially purified on two sequential silica columns ( etoac : hexane with 0 . 5 % hoac ). the material so obtained was dissolved in chcl 3 and extracted three times with ph 10 buffer . the combined aqueous extracts were acidified with 1 . 0n hcl and then extracted three times with et 2 o . the organic extracts were combined , dripped through na 2 so 4 to remove water , and evaporated in vacuo to obtain 0 . 60 g of material , which tlc indicated still contained impurities . the entire extractive procedure was then repeated ( using ch 2 cl 2 as the organic phase throughout ), to afford 311 mg ( 17 %) of a pale yellow foam : 1 h nmr ( cdcl 3 ) δ 4 . 11 ( d , j = 5 hz , 1h ), 5 . 73 ( d , j = 5 hz , 1h ), 7 . 26 - 7 . 56 ( m , 13h ), 7 . 67 - 7 . 82 ( m , 4h ); ms 423 ( m +); titration pk a 5 . 8 . analysis for c 26 h 21 n 3 os : calculated c 73 . 73 , h 5 . 00 , n 9 . 92 ; found c 73 . 75 , h 5 . 13 , n 9 . 97 . table ii__________________________________________________________________________physcial chemistry data on cck / gastrin antagonists ## str21 ## analysis , % method solvent yield , theory / foundex . r of prep . of cryst .. sup . a % mp . ° c . ms 1hnmr formula c h n__________________________________________________________________________137 3 - qulnolinyl g triturated 1 . 23 g 424 , dmso 3 . 99 ( s , 1h ), c25h20n4os 70 . 73 4 . 75 13 . 20 with phme 69 % 425 6 . 18 ( br s , 1h ), 70 . 52 4 . 86 12 . 98 ( m +, 7 . 12 - 7 . 52 ( m , 10h ), m + 7 . 51 ( td , j = 15 . 2hz , 1 ) 1h ), 7 . 60 ( td , j = 15 , 2hz , 1h ), 7 . 98 ( t , j = 15hz , 2h ), 8 . 44 ( s , 1h ) 8 . 98 ( d , j = 3hz , 1h ), 10 . 22 ( br s , 1h ), 11 . 96 ( br s , 1h ) 138 ch2ph - 3 , 4 - dicl g chrom 1 . 38 g 456 , cdcl3 4 . 00 ( d , j = c23h19cl2n3o 60 . 53 4 . 20 9 . 21 ( etoac : 69 % 458 5hz , 1h ), 4 . 48 ( dd , s 60 . 30 4 . 33 8 . 95 hexane + ( m +&# 39 ; s j = 5 , 17hz , 1h ), hoac ) for br 4 . 76 ( dd , j = 7 , 17hz , iso - 1h ), 5 . 65 ( d , j = 5hz , topes ) 1h ), 6 . 05 ( br s , 1h ), 6 . 87 ( dd , j = 2 . 9 hz , 1h ), 7 . 07 - 74 . 6 ( m , 12h ), 9 . 45 ( br s , 1h ) __________________________________________________________________________ . sup . a includes other methods of purification such as chromatography ( chrom ), trituration , and precipitation , as indicated . if only solvents are given , compound was purified by recrystallization from those solvents for other methods of purification , solvents used follow in parentheses . ( r )- α - methylbenzyl alcohol ( 4 . 34 g , 35 . 5 mmol ) was dissolved in 120 ml ch 2 cl 2 under nitrogen and pyridine ( 4 . 31 ml , 1 . 5 eq ) was added . the mixture was cooled in an ice bath and a solution of phenyl chloroformate in 30 ml ch 2 cl 2 slowly added . after addition , the ice bath was removed and stirring continued overnight at room temperature . the mixture was partitioned between ch 2 cl 2 and 1 . 0n hcl , then the organic layer separated , dripped through na 2 so 4 to remove water , and the solvent evaporated in vacuo to obtain 8 . 34 g of an oil , which was used without further purification ( 97 % crude yield ): 1 h nmr ( cdcl 3 ) δ 1 . 69 ( d , j = 7 hz , 3h ), 5 . 83 ( q , j = 7 hz , 1h ), 7 . 14 - 7 . 46 ( m , 10h ); ms 242 ( m +); [ α ] d =+ 119 . 6 °, [ α ] 365 =+ 428 . 8 ° ( c = 1 . 02 , meoh ). analysis for c 15 h 14 o 3 : calculated c 74 . 36 , h 5 . 82 ; found c 74 . 06 , h 5 . 98 . (+)- trans - 4 , 5 - diphenyl - 3 - pyrazolidinone ( 8 . 13 g , 34 . 2 mmol ) was dissolved in 150 ml thf under nitrogen , cooled in an ice bath , and 1 . 43 g nah ( 60 % in mineral oil ; hydride content 0 . 86 g , 35 . 7 mmol , 1 . 05 eq ) was added . the mixture was stirred for 15 min at ice bath temperature and 30 min at room temperature . a solution of ( r )- α - methylbenzylphenylcarbonate [ from preparation 1 ] ( 8 . 25 g , 34 . 1 mmol , 1 . 00 eq ) in thf was then added over 10 min and the mixture stirred a further 40 min . after partitioning between et20 and 1 . 0n hcl , the organic phase was separated , and the aqueous phase extracted a second time with et 2 o , the organic extracts were combined , dripped through na 2 so 4 to remove water , and evaporated to provide 17 . 45 g of a crude mixture of the title products . preliminary purification ( without separation of diastereomers ) was achieved on two sequential silica columns ( etoac : hexane ). final purification and separation of diastereomers a and b was accomplished via hplc ( waters rcm 1 . 2 . 3 system ; 3 piggybacked nova c18 columns , each 40 × 100 mm , 6 μm particles ; flow rate = 45 ml / min ( c . 1100 psi ); uv detection at 245 nm / 1 . 0 aufs ; eluent 64 % meoh : h 2 o with 2 . 5 % hoac ; loading c . 50 - 60 mg / injection ). three fractions were collected : the first was highly enriched in diastereomer a , the second contained a mixture of a and b ( which was recycled ), and the third was highly enriched in diastereomer b . the first fractions from various runs were combined , evaporated , and the residue lyophilized to yield diastereomer a . processing of the third fractions from various runs in a similar fashion yielded diastereomer b . the diastereomeric purity of a and b were determined on analytical hplc ( nova c 18 column : eluent 70 % meoh : h 2 o with 1 % hoac at 1500 psi ; uv detection at 254 nm ), and were typically in the range 95 - 100 %. diastereomer a : 1 h nmr ( cdcl 3 ) δ 1 . 48 ( d , j = 8 hz . 3h ), 3 . 88 ( d , j = 6 hz , 1h ), 5 . 34 ( d , j = 6 hz . 1h ), 5 . 81 ( q , j = 8 hz , 1h ), 7 . 03 ( m , 1h ), 7 . 15 - 7 . 42 ( m , 14h ), 8 . 08 ( br s , 1h ); ms 386 ( m +); titration pk a 8 . 7 ; [ α ] d =- 23 . 1 °, [ α ] 365 =- 71 . 0 ° ( c = 0 . 99 , meoh ). analysis for c 24 h 22 n 2 o 3 : calculated c 74 . 59 , h 5 . 74 , n 7 . 25 ; found c 74 . 52 , h 5 . 97 , n 7 . 24 . diastereomer b : 1 h nmr ( cdcl 3 ) δ 1 . 42 ( d , j = 7 hz , 3h ), 3 . 88 ( d , j = 5 hz , 1h ), 5 . 34 ( s , 1h ), 5 . 80 ( q , j = 7 hz , 1h ), 7 . 14 - 7 . 43 ( m , 15h ), 8 . 30 ( br s , 1h ); ms 386 ( m +) ; titration pk a 8 . 6 ; [ α ] d =- 18 . 7 °, [ α ] 365 =- 122 . 2 ° ( c = 1 . 01 , meoh ). analysis for c 24 h 22 n 2 o 3 : calculated c 74 . 59 , h 5 . 74 , n 7 . 25 ; found c 74 . 79 , h 5 . 84 , n 7 . 22 . a thick - walled glass hydrogenation tube was charged with diastereomer b of 1 -[(( r )- α - methylbenzyl ) oxycarbonyl ]- trans - 4 , 5 - diphenyl - 3 - pyrazolidinone [ from example 139a / 139b ] ( 226 mg , 0 . 586 mmol ), 15 . 0 ml thf and 5 % pd / c catalyst ( 112 mg ) and was shaken on a parr apparatus under an atmosphere of hydrogen at c . 50 psi pressure for 15 . 5 hr . the catalyst was filtered off using celite and washed with thf . the tiltrate was evaporated in vacuo to obtain 134 mg ( 96 %) of a white foam : 1 h nmr ( cdcl 3 ) δ 3 . 99 ( d , j = l 1 hz , 1h ), 4 . 66 ( br s , 1h ), 4 . 74 ( d , j = 11 hz , 1h ), 7 . 20 - 7 . 39 ( m , 1 oh ), 8 . 63 ( br s , 1h ). diastereomer a of 1 -[(( r )- α - methylbenzyl ) oxycarbonyl ]- trans - 4 , 5 - diphenyl - 3 - pyrazolidinone [ from example 139a / 139b ] ( 261 mg , 0 . 677 mmol ) was subjected to hydrogenolysis ( 17 ml thf , 128 mg 5 % pd / c ) and workup as described in preparation 2 to obtain 154 mg ( 96 %) of a white foam : 1 h nmr ( cdcl 3 ) δ 4 . 01 ( d , j = l 1 hz , 1h ), 4 . 38 ( br s , 1h ), 5 . 81 ( br s , 1h ), 7 . 18 - 7 . 41 ( m , 10h ); [ α ] d =- 76 °, [ α ] 365 =- 278 ° ( c = 1 . 08 , chcl 3 ). (+)- trans - 4 , 5 - diphenyl - 3 - pyrazolidinone [ from preparation 2 ] ( 70 . 7 mg , 0 . 297 mmol ) was dissolved in 1 . 0 ml thf under an argon atmosphere and treated with a solution of 4 - bromophenylisocyanate ( 67 . 9 mg , 0 . 343 mmol , 1 . 15 eq ) in 1 . 0 ml thf . the mixture was stirred for 45 min , then the solvents removed in vacuo . the product was initially purified by chromatography ( etoac : toluene ) to provide 90 . 4 mg of material , in which impurities were still apparent by nmr . this was dissolved in toluene and hexane added until a precipitate appeared . solvents were carefully removed by pipette and the remaining solid dried on a vacuum pump , giving 77 . 3 mg ( 60 %) of a white solid : 1 h nmr ( cdcl 3 ) δ 4 . 01 ( d , j = 7 hz , 1 h ), 5 . 52 ( d , j = 7 hz , 1h ), 6 . 90 - 7 . 50 ( m , 15h ), 8 . 60 ( br s , 1h ); ms 435 , 437 ( m +&# 39 ; s for br isotopes ); [ α ] d =- 39 °, [ α ] 365 =- 293 ° ( c = 1 . 26 , chcl 3 ). analysis for c 22 h 18 brn 3 o 2 : calculated c 60 . 56 , h 4 . 16 , n 9 . 63 ; found c 61 . 43 , h 4 . 29 , n 9 . 58 . enantiomeric excess ( ee ) 95 . 1 %, based on hplc assay of diastereomeric purity of precursor diastereomer b from example 139a / 139b . (-)- trans - 4 , 5 - diphenyl - 3 - pyrazolidinone [ from preparation 3 ] ( 82 . 9 mg , 0 . 348 mmol ) was dissolved in 1 . 0 ml thf under an argon atmosphere and treated with a solution of 4 - bromophenylisocyanate ( 76 . 8 mg , 0 . 388 mmol , 1 . 11 eq ) in 1 . 0 ml thf . the mixture was stirred for 30 min , then the solvents removed in vacuo . the product was initially purified by chromatography ( 33 ≧ 66 % etoac : toluene gradient ) to provide 51 . 6 mg of material , in which impurities were still apparent by nmr . this was triturated with hexane , then the resulting solid recrystallized from ch 2 cl 2 : toluene : hexane . careful removal of solvents via pipette and drying on a vacuum pump yielded 20 . 8 mg ( 14 %) of a white solid : 1 h nmr ( cdcl 3 ) δ 4 . 02 ( d , j = 7 hz , 1h ), 5 . 52 ( d , j = 7 hz , 1h ), 6 . 90 - 7 . 50 ( m , 15h ), 8 . 60 ( br s , 1h ); ms 435 , 437 ( m +&# 39 ; s for br isotopes ); [ α ] d =+ 40 °, [ α ] 365 =+ 299 ° ( c = 0 . 88 , chcl 3 ). analysis for c 22 h 18 brn 3 o 2 : calculated c 60 . 56 , h 4 . 16 , n 963 ; found c 61 . 93 , h 4 . 43 , n 9 . 37 . enantiomeric excess ( ee ) 100 %, based on hplc assay of diastereomeric purity of precursor diastereomer a from example 139a / 139b . (+)- trans - 4 , 5 - diphenyl - 3 - pyrazolidinone [ from preparation 2 ] ( 134 mg , 0 . 561 mmol ) was dissolved in 8 . 0 ml thf under nitrogen and a solution of 4 - chloro - 3 - triftuoromethylphenylisothiocyanate ( 137 mg , 0 . 578 mmol , 1 . 03 eq ) in 2 ml thf was added . the mixture was stirred for 12 hr and then the solvent removed in vacuo . the residue was first purified on two sequential silica columns ( etoac : hexane with 0 . 5 % hoac ). the partially purified material so obtained ( 155 mg ) was dissolved in ch 2 cl 2 and extracted three times with ph 10 buffer . the aqueous extracts were combined , acidified with 1 . 0n hcl , and extracted three times with ch 2 cl 2 . the organic extracts were combined , dripped through na 2 so 4 to remove water , and evaporated in vacuo to give 93 . 5 mg ( 35 %) of the product as a pale yellow foam : 1 h nmr ( cdcl 3 ) δ 4 . 10 ( d , j = 5 hz , 1h ), 5 . 74 ( d , j = 5 hz , 1h ), 7 . 35 - 7 . 60 ( m , 15h ); ms 475 ( m +); [ α ] d =+ 32 °, [ α ] 365 =- 116 ° ( c = 1 . 06 , chcl 3 ). analysis for c 23 h 17 clf 3 n 3 os : calculated c 58 . 05 , h 3 . 60 , n 8 . 83 ; found c 57 . 86 , h 3 . 79 , n 8 . 69 . enantiomeric excess ( ee ) 98 . 6 %, based on hplc assay of diastereomeric purity of precursor diastereomer b from example 139n139b . (-)- trans - 4 , 5 - diphenyl - 3 - pyrazolidinone [ from preparation 3 ] ( 147 mg , 0 . 617 mmol ) was dissolved in 8 . 0 ml thf under nitrogen and treated with a solution of 4 - chloro - 3 - trifiuoromethylphenylisothiocyanate ( 160 mg , 0 . 673 mmol , 1 . 09 eq ) in 3 ml thf . the mixture was stirred for 1 . 5 hr and the solvent then removed in vacuo . the product was purified as for example 142 , except that the initial chromatographic steps were omitted , and the entire extractive procedure was repeated a second time , to yield 145 mg ( 49 %) of a pale yellow foam : 1 h nmr ( cdcl 3 ) δ 4 . 14 ( d , j = 5 hz , 1h ), 5 . 74 ( d , j = 5 hz , 1h ), 7 . 35 - 7 . 60 ( m , 15h ); ms 475 ( m +); [ α ] d =- 28 °, [ α ] 365 =+ 128 ° ( c = 1 . 1 5 , chcl 3 ). analysis for c 23 h 17 clf 3 n 3 os : calculated c 58 . 05 , h 3 . 60 , n 8 . 83 ; found c 57 . 77 , h 3 . 67 , n 8 . 64 . enantiomeric excess ( ee ) 97 . 2 %, based on hplc assay of diastereomeric purity of precursor diastereomer a from example 139a / 139b . test procedures for cck and gastrin receptor binding ( ic 50 ) brain cck receptor binding was performed using mouse brain membranes according to the method of chang and lotti ( proc . natl . acad . sci . 83 : 4923 - 4926 , 1986 ). male cf - 1 mice , 23 - 25 g were sacrificed by cervical dislocation , the forebrain removed and placed in ice cold 50 mm tris buffer , ph 7 . 4 . the tissue was homogenized in 100 volumes of the tris buffer with a brinkman polytron or tekmar tissumizer and then centrifuged at 40 , 000 g for 10 min . pellets were resuspended in tris buffer , centrifuged as above and then resuspended in 100 volumes of assay buffer , ph 6 . 5 ( 20 mm n - 2 - hydroxyethyl - piperazine - n &# 39 ;- 2 - ethane sulfonic acid ( hepes ), 1 mm ethylene glycol bis ( 2 - aminoethyl ether - n , n , n &# 39 ;, n &# 39 ;- tetraacetic acid ) ( egta ), 5 mm mgcl 2 , 130 mm nacl , and 0 . 25 mg / ml bacitracin ). the binding assay consisted of 50 μl of compound ( or buffer for total binding ), 50 μl of 125 i - cck - 8 sulfate ( 20 pm ) ( amersham im - 159 ), 200 μl of assay buffer and 200 μl of homogenate ( 80 - 120 μg protein ). the samples were incubated at room temperature ( 25 °) for 2 hours , and they were then filtered through gf / b glass fiber filters ( soaked in wash buffer for 2 hours before use ) using a 48 well brandel cell harvester designed for receptor binding . the filters were washed twice with 3 ml of 50 mm tris buffer , ph 7 . 4 , containing 0 . 01 % bsa and then counted for radioactivity in plastic tubes with a micromedic 10 / 600 automatic gamma counter . compounds were dissolved in dimethyl sulfoxide ( dmso ) at a concentration of 10 mm and then further diluted with assay buffer . the concentration of dmso in the incubation was 0 . 1 % or less and had no effect on the assay at that level . ic - 50 values of displacement curves were determined using 7 concentrations of compound and were calculated using the allfit computer program of delean , munson and rodbard ( am . j . physiol . 235 : e97 - e102 , 1978 ). non - specific binding was determined as the displacement of the radioligand by 100 nm cck - 8 sulfate . binding to peripheral type cck receptors in rat pancreas was done according to the method of chang et al . ( mol . pharmacol . 30 : 212 - 217 , 1986 ) using 3 h - l364 , 718 . pancreas was obtained from male sprague - dawley rats , 150 - 200 g , after decapitation , and dissected free from adipose and connective tissue . the tissue was homogenized in 30 volumes of 50 mm tris buffer , ph 7 . 4 and centrifuged at 40 , 000 g for 10 min . the tissue pellet was washed by resuspension and centrifugation as described above . the final pellet was suspended in 500 volumes of assay buffer ( 50 mm tris buffer , ph 7 . 4 , 5 mm mgcl 2 , 0 . 14 mg / ml bacitracin , and 5 mm dithiothreitol ) to give a protein concentration of 30 - 60 μg / 200 μl . reagent volumes for the assay were the same as those used for cck binding to brain membranes . tritium labeled l - 364 , 718 ( dupont nen , net - 971 ) was used as the ligand at a concentration of 0 . 4 - 0 . 6 nm . the samples were incubated 1 hour at room temperature and then filtered as described for the cck - brain receptor . scintillation cocktail was added to the filters which were counted for radioactivity using a micromedic taurus automatic liquid scintillation counter . compound samples were prepared and ic - 50 values were determined as described for the cck - brain experiments . non - specific binding was that amount left bound to the filters after adding 100 nm l - 364 , 718 . the method used for gastrin binding to guinea pig stomach mucosal membranes was similar to that described by takeuchi , speir and johnson ( am . j . physiol . 237 ( 3 ): e284 - e294 , 1979 ). guinea pig stomach fundus was obtained from male hartley guinea pigs , 300 - 350 g , and the mucosa was scraped off with a glass slide . the mucosa was homogenized in 50 mm tris buffer , ph 7 . 4 , containing 1 mm phenylmethanesulfonyl fluoride using a dounce glass homogenizer , and the suspension was centrifuged at 40 , 000 g for 10 min . the resulting pellet was resuspended and centrifuged once more , the final pellet was then suspended in 100 ml assay buffer per 1 guinea pig stomach to give a protein concentration of 200 - 300 μg / 200 μl . the assay buffer consisted of 50 mm tris buffer , ph 7 . 4 , 5 mm mgcl 2 , 0 . 14 mg / ml bacitracin , and 1 μg / ml each of leupeptin , chymostatin , aprotinin and pepstatin . reagent volumes for the assay were the same as those used for cck binding to brain membranes . the radioactive ligand was 20 pm 125 i - gastrin i , from dupont nen ( nex - 176 ). the samples were incubated 3 hours at room temperature and filtered and counted as described for cck binding to brain membranes . compound samples were prepared and ic - 50 values were determined as described for the cck - brain receptor binding . non - specific binding was determined using 100 nm gastrin i ( human synthetic from sigma chemical co .). table iii below summarizes representative cck and gastrin - binding tests results for exemplified compounds in accordance with this invention . table iii______________________________________cck and gastrin receptor binding data ic . sub . 50 , μm , or percent inhibition ( at 1 or 10 μm ) brain pancreas gastrin______________________________________compound ofexample no . 1 0 . 022 0 . 19 0 . 15 2 0 . 29 14 ( 10 ) 3 0 . 054 34 ( 10 ) 1 . 1 4 0 . 39 78 ( 10 ) 5 77 ( 10 ) 18 ( 10 ) 6 4 . 4 15 ( 10 ) 7 1 . 1 81 ( 10 ) 8 34 ( 10 ) 2 ( 10 ) 9 3 . 7 33 ( 10 ) 10 57 ( 10 ) 4 ( 10 ) 11 67 ( 10 ) 12 0 . 34 64 ( 10 ) ( o -) 1 . 0 55 ( 10 ) ( n -) 13 67 ( 10 ) 14 2 . 6 60 ( 10 ) 15 69 ( 10 ) 10 ( 10 ) 16 0 . 044 62 ( 10 ) 0 . 42 17 0 . 52 6 ( 10 ) 18 0 . 093 22 ( 10 ) 19 68 ( 10 ) 36 ( 10 ) 20 0 . 031 11 . 6 0 . 49 21 0 . 057 77 ( 10 ) 22 42 ( 1 ) 27 ( 10 ) 23 0 . 49 23 ( 10 ) 24 0 . 15 45 ( 10 ) 25 0 . 21 14 ( 10 ) 26 0 . 075 47 ( 10 ) 27 0 . 23 60 ( 10 ) 28 0 . 44 55 ( 10 ) 29 0 . 025 47 ( 10 ) 0 . 26 30 0 . 031 49 ( 10 ) 0 . 35 31 54 ( 1 ) 71 ( 10 ) 32 42 ( 1 ) 69 ( 10 ) 33 0 . 34 20 ( 10 ) 34 1 . 5 12 ( 10 ) 35 0 . 39 48 ( 10 ) 36 0 . 45 33 ( 10 ) 37 82 ( 1 ) 75 ( 10 ) 38 0 . 056 53 ( 10 ) 0 . 24 39 0 . 33 52 ( 10 ) 40 0 . 75 38 ( 10 ) 41 57 ( 10 ) 21 ( 10 ) 42 0 . 78 37 ( 10 ) 43 0 . 23 24 ( 10 ) 44 0 . 26 67 ( 10 ) 45 0 . 022 0 . 16 46 0 . 042 1 . 2 0 . 21 47 0 . 39 51 ( 10 ) 48 0 . 080 98 ( 10 ) 49 0 . 043 40 ( 10 ) 0 . 25 50 0 . 013 87 ( 10 ) 0 . 081 51 18 ( 1 ) 25 ( 10 ) 52 60 ( 1 ) 21 ( 10 ) 53 1 . 2 17 ( 10 ) 54 1 . 15 53 ( 10 ) 55 0 . 60 47 ( 10 ) 56 25 ( 1 ) 15 ( 10 ) 57 1 . 0 45 ( 10 ) 58 10 ( 1 ) 85 ( 10 ) 59 44 ( 1 ) 75 ( 10 ) 60 34 ( 10 ) 37 ( 10 ) 61 56 ( 10 ) 78 ( 10 ) 62 2 . 2 37 ( 10 ) 63 0 . 51 0 . 075 64 5 . 3 34 ( 1 ) 65 50 ( 10 ) 37 ( 10 ) 66 40 ( 10 ) 23 ( 10 ) 67 46 ( 10 ) 68 4 . 3 70 ( 10 ) 69 0 . 5 12 ( 10 ) 70 13 ( 1 ) 36 ( 10 ) 71 1 . 2 39 ( 10 ) 72 88 ( 10 ) 22 ( 10 ) 73 16 ( 10 ) 20 ( 10 ) 74 23 ( 10 ) 15 ( 10 ) 75 60 ( 10 ) 40 ( 10 ) 76 55 ( 10 ) 4 ( 10 ) 77 56 ( 10 ) 4 ( 10 ) 78 1 . 8 49 ( 10 ) 79 43 ( 10 ) 9 ( 10 ) 80 5 . 2 9 ( 10 ) 81 95 ( 10 ) 59 ( 10 ) 82 23 ( 10 ) 83 37 ( 1 ) 12 ( 10 ) 84 70 ( 10 ) 26 ( 10 ) 85 78 ( 10 ) 19 ( 10 ) 86 1 . 1 58 ( 10 ) 87 47 ( 10 ) 23 ( 10 ) 88 40 ( 10 ) 37 ( 10 ) 89 34 ( 10 ) 21 ( 10 ) 90 45 ( 1 ) 63 ( 10 ) 91 0 . 010 94 ( 10 ) 0 . 062 92 0 . 064 88 ( 10 ) 0 . 16 93 0 . 29 75 ( 10 ) 0 . 66 94 50 ( 10 ) 95 55 ( 10 ) 18 ( 10 ) 96 42 ( 10 ) 13 ( 10 ) 97 42 ( 10 ) 98 74 ( 10 ) 33 ( 10 ) 99 3 . 3 86 ( 10 ) 100 2 . 2 78 ( 10 ) 101 1 . 3 7 ( 10 ) 102 4 . 7 11 ( 10 ) 103 0 . 87 78 ( 10 ) 104 0 . 9 47 ( 10 ) 105 0 . 49 43 ( 10 ) 106 0 . 19 78 ( 10 ) 0 . 87107 86 ( 10 ) 61 ( 10 ) 108 1 . 3 87 ( 10 ) 109 6 . 0 11 ( 10 ) 110 0 . 007 47 ( 10 ) 0 . 13111 0 . 020 35 ( 10 ) 0 . 61112 0 . 072 42 ( 10 ) 1 . 4113 25 ( 1 ) 21 ( 10 ) 114 0 . 020 38 ( 10 ) 0 . 36115 0 . 15 53 ( 10 ) 0 . 32116 0 . 031 80 ( 10 ) 0 . 23117 0 . 40 64 ( 10 ) 1 . 0118 0 . 36 41 ( 10 ) 5 . 2119 1 . 2 64 ( 10 ) 120 0 . 016 87 ( 10 ) 0 . 12121 0 . 014 26 ( 10 ) 0 . 12122 0 . 015 8 . 6 0 . 22123 0 . 068 23 ( 10 ) 0 . 69124 0 . 15 36 ( 10 ) 0 . 73125 0 . 10 42 ( 10 ) 0 . 59126 0 . 011 59 ( 10 ) 0 . 21127 0 . 032 73 ( 10 ) 0 . 21128 0 . 49 39 ( 10 ) 129 0 . 16 69 ( 10 ) 0 . 86130 0 . 012 42 ( 10 ) 0 . 10131 0 . 012 61 ( 10 ) 0 . 062132 0 . 008 48 ( 10 ) 0 . 070133 0 . 006 7 . 9 0 . 025133a 0 . 36 55 ( 10 ) 1 . 5134 0 . 033 75 ( 10 ) 0 . 093135 0 . 14 18 ( 10 ) 1 . 7example136 0 . 16137 0 . 032138 0 . 069140 0 . 37141 0 . 016142 0 . 017143 0 . 81______________________________________ | 2 |
fig1 shows a side view of an exemplary screening machine 1 for the drainage of sand . the screening machine 1 comprises a machine body 14 which is inclined to the horizontal by a given angle such as e . g . 3 ° to 5 °. the machine body 14 is driven by a drive 7 which in the example shown comprises two electric motors and which generates a shaking and / or swinging motion in the direction of arrow a . the direction of the shaking and / or swinging motion is in an angle of approx . 45 ° to the horizontal . the exemplary screening machine 1 shown has a feed side 2 where the feedstock such as e . g . sand is introduced into the machine body 14 . driven by the shaking motion , the feedstock on the bottom of the machine body 14 moves towards the top in the direction of the outlet or discharge 3 . during transport of the bulk material in the direction of the outlet or discharge 3 , it loses water and thus becomes drier . the partially dried bulk material is then discharged at the outlet . the screening machine shown in fig1 is supported on air bellows 4 in four points in total . but more or fewer bearings 4 , 5 could be provided . in the embodiment shown , two bearings 4 , 5 are located on each longitudinal side of the machine body 14 with one bearing each being arranged on the feed side 2 and one bearing on the outlet or discharge 3 . the bearings 4 , 5 are preferably symmetric with respect to a central longitudinal sectional plane . on the feed side 2 and the outlet or discharge 3 , the bearings 4 , 5 have different dimensions . since the weight of the bulk material on the outlet or discharge 3 is greater than on the feed side 2 , the bearings 4 , 5 are here larger than on the feed side 2 . each bearing 4 , 5 comprises at least one air bellows 4 , which dampens the forces occurring during operation of the screening machine 1 , as well as a spring carrier 5 on which the air bellows 4 are placed . one double air bellows 4 each is provided on the feed side 2 on both longitudinal sides of the machine body 14 . on the outlet or discharge 3 , however , two adjacent double air bellows are located on each longitudinal side of the machine body 14 . moreover , a lateral guide 6 is provided on each bearing 4 , 5 which is shown still more clearly in fig2 a . the lateral guide 6 substantially comprises a guide part formed on the machine body 14 , which guide part is guided alongside a lateral stop provided on the spring carrier 5 , and which stop limits oscillation of the screening machine 1 in lateral direction . in the event of an air leak in one of the air bellows 4 , the screening machine 1 bears on a spring carrier 5 . fig2 b shows a cross - sectional view of another part of the screening machine 1 with the drive 7 and a bearing 4 , 5 with one double air bellows 4 . in that case , the drive 7 comprises two electric motors driving the machine body 14 , thus creating a linear movement in the direction of the arrow a ( see fig1 ). fig3 is a schematic view of a management or control device for adjusting the air pressure in the air bellows 4 a , 4 b . the device comprises an air pressure source 9 , such as for example a compressor , which can be connected via valves 10 to one or several of the air bellows 4 a , 4 b . in the embodiment shown , the air bellows 4 a , 4 b are firmly connected to the air pressure source 9 . alternatively they could also be connected to an air pressure source 9 only if required . after mounting of the air bellows , these are inflated up to a required working height by means of compressed air . the working height can be different on the feed side 2 compared with the outlet or discharge 3 of the screening machine 1 . by selection of the air pressure , on the one hand the working height and on the other hand also inclination of the screening machine 1 can be varied . the exemplary device shown in fig3 comprises a control unit 11 with a management or control software by means of which the pressure existing in the air bellows 4 a , 4 b can be automatically varied during operation of the machine 1 . thus , e . g . it is possible to automatically increase , decrease or keep constant the damping of at least one air bellows 4 during operation , to adjust or keep constant the working height of the screening machine 1 or to vary and / or keep constant the inclination of the screening machine 1 . hence , e . g . the working height of the screening machine 1 could be kept constant in at least one support point even if the weight in this point increases or decreases during operation . in order to fill the air bellows 4 a , 4 b , the valves 10 are opened accordingly by the control unit and closed again when a target pressure is reached . for this purpose , the valves 10 can be controlled by the control unit 11 via control lines . the pressure existing in the air bellows 4 a , 4 b is measured by means of a manometer 12 the measured data of which are evaluated by the control unit 11 . if necessary , air can also be removed again from the air bellows 4 a , 4 b . for this purpose , exhaust valves 13 are provided which can be controlled accordingly by the control unit 11 . thus , with the exemplary device shown in fig3 it is possible to automatically adjust the air pressure in the individual air bellows 4 a , 4 b during operation of the screening machine . according to the embodiment , the air bellows can be put under pressure individually or in groups or pressure can be reduced . the air bellows on one side ( e . g . the feed side 2 or the outlet or discharge 3 ) are preferably connected to a common compressed air circuit and are inflated to the same air pressure . but alternatively each air bellows 4 could be individually put under pressure . in that case each air bellows 4 would require e . g . an own shut - off valve 10 or , if necessary , also an own air pressure source 9 . the foregoing embodiments have been shown for illustrative purposes only and are not intended to limit the scope of the invention which is defined by the claims . | 1 |
fig5 shows a device with an interference grating for measuring displacement according to a first embodiment of the present invention , similar to the prior art measuring device device shown in fig4 . the measuring device according to this embodiment includes , for example , a circular aperture 60 provided near the transmitting side of a collimator lens 34 to limit the diameter of a light beam incident on a scale 10 . in this measuring device , incident positions 10 a and 10 b of two light beams on the scale 10 are determined so as to be spaced sufficiently farther away from each other than the diameter of the light beam that is defined by the size of the aperture 60 . furthermore , a polarizing beam splitter 62 is used instead of the half mirror 40 to change the polarization of the two light beams incident on the scale 10 . near the transmitting side of the scale 10 , there are also provided polarizing plates 64 a and 64 b which are oriented so as to cut the zeroth - order polarized light beam and transmit the first - order polarized light beam . as illustrated , there are provided lenses 66 a and 66 b and light - receiving elements 68 a and 68 b which are intended to acquire reference signals from the light beams passing through the half mirrors 44 a and 44 b , for example , to provide feedback control to the quantity of light of the ld 32 , respectively . there is also provided a non - polarizing beam splitter ( half mirror ) 70 . there are also provided a polarizing plate 74 a , a lens 76 a , and a light - receiving element 78 a to acquire an a - phase signal from the light passing through the half mirror 70 . there are also provided a quarter - wave plate 72 b , a polarizing plate 74 b , a lens 76 b , and a light - receiving element 78 b to acquire from the light passing through the half mirror 70 a b - phase signal shifted in phase by 90 degrees with respect to the a - phase signal . in this embodiment , the light beam emitted from the ld 32 is collimated through the collimator lens 34 , limited in light beam diameter by the aperture 60 , and then halved by the polarizing beam splitter 62 into two orthogonal linearly polarized light beams . the light beams are reflected on the mirrors 42 a and 42 b disposed laterally at diametrically opposed positions , respectively , and then incident at an angle θ upon two points 10 a and 10 b spaced farther from each other than the diameter of the light beams on the scale 10 . the ± first - order ( diffracted ) light beams through the scale 10 are transmitted at an angle of diffraction φ that is equal or generally equal to the angle of incidence θ . the following equation is given here to the relationship among the wavelength λ of the light source , the grating pitch p of the scale being of the same order as the wavelength λ of the light source , for example , 1 μm or less , the angle of incidence θ , and the angle of diffraction φ . that is , when the scale 10 is displaced laterally in the drawing by a displacement d , the phases of the diffracted light beams are each shifted by d / p in the opposite directions . the displacement of the scale converted into the phase difference between the light beams is observed as an interference light intensity shifted by a d / 2p cycle through the interference between the two light fluxes . the diffracted light beams pass through the polarizing plates 64 a and 64 b that are oriented to allow their respective linearly polarized light components to transmit therethrough . on the other hand , although a transmitting light beam ( the zeroth - order light beam ) or a noise component is also transmitted from the scale at the same angle as the angle of incidence θ , the light fluxes of the ± first - order light beams and the zeroth - order light beam do not overlap each other because the light beams are diffracted at the two points spaced farther from each other than the light beam diameter as described above . additionally , since the polarizing plates 64 a and 64 b are positioned so as to intercept the zeroth - order light beam , most of the light beam does not transmit therethrough . the light beam cannot be completely intercepted here because the light beam incident upon the polarizing plates 64 a and 64 b has not been subjected to a perfect linear polarization due to the degree of polarization of the light source 32 and the polarization function of the polarizing beam splitter 62 . the diffracted light beams having passed through the polarizing plates 64 a and 64 b are each reflected on the half mirrors 44 a and 44 b that are laterally disposed at diametrically opposed positions , and then incident upon the non - polarizing beam splitter 70 disposed at the center . at this stage , the light beams having passed through the half mirrors 44 a and 44 b are incident upon the light - receiving elements 68 a and 68 b via the lenses 66 a and 66 b to be a reference signal . like the prior art example shown in fig1 or fig4 , it is also possible to eliminate any one of the light - receiving elements 68 a and 68 b to employ only the other one . the two linearly polarized light beams incident upon the non - polarizing beam splitter 70 are each halved to be transmitted therethrough and reflected thereon and then directed toward the light - receiving elements 78 a and 78 b through the same optical paths , respectively . in one optical path ( the right optical path in the drawing ), the polarizing plate 74 a is disposed at an orientation of 45 degrees to interfere the two light beams with each other , thereby allowing the light - receiving element 78 a to convert the position of the scale into an electrical signal strength for output . in the other optical path ( the left optical path in the drawing ), the quarter - wave plate 72 b is further placed to cause only one of the linearly polarized light beams to lag in phase by 90 degrees and also pass through the polarizing plate 74 b for interference , thereby being converted into an electrical signal having a phase difference of 90 degrees . the two signals having a phase difference of 90 degrees that have been obtained at the light - receiving elements 78 a and 78 b are processed , thereby making it possible to determine the direction of displacement of the scale . at this time , the transmitted light beams ( the zeroth - order light beam ) from the scale that have not been cut by the polarizing plates 64 a and 64 b are also directed toward the light - receiving elements . however , since these light beams deviate from the optical paths by the diameter of the light beams or more , the light beams would not interfere with the valid light beams , causing no degradation of output signals . this allows for yielding perfect interference between two light fluxes and thereby delivering a substantially ideal sinusoidal signal . the light beams transmitted from the right and left half mirrors 44 a and 44 b are each used to monitor the intensity of the diffracted light beams and thereby control the quantity of light of the ld 32 to provide a constant intensity . fig6 shows the measured values of the signal strength against the pitch angle of the scale according to this embodiment . it can be seen that the drop in strength of the output signal against the pitch angle is reduced when compared with that of fig3 . the angle of incidence θ is made equal or substantially equal to the angle of diffraction φ as described above . this hardly causes a difference in angle of incidence of the light beams , having passed through the right and left optical paths , on the light - receiving elements even in the presence of a variation in pitch angle . this is because of the following reason . that is , the angles θ and φ are inversely proportional to each other from equation ( 1 ) expressing the relationship between the angle of incidences θ and the angle of diffraction φ . when the angles θ and φ are generally equal to each other , the sum of the angles θ and φ is generally constant . this hardly causes a difference in angle between the light beams having passed through the right and left optical paths , thereby making the signal almost free from a degradation in its strength . since this embodiment is provided with the circular aperture 60 , the diameter of an incident light beam can be reduced , thereby reducing the amount of separation between the incident positions of the light beams on the scale 10 . the aperture 60 is not limited in shape to a circular one , and can even be eliminated when the diameter of an incident light beam is originally small or the device has an allowable size . furthermore , in this embodiment , the light beams incident on the scale are differently polarized and the polarizing plates 64 a and 64 b are provided near the transmitting side of the scale to intercept the zeroth - order light beams , thereby making it possible to positively reduce the effects of noise . depending on the condition , it is also possible to employ a half mirror instead of the polarizing beam splitter 62 , and eliminate the polarizing plates 64 a and 64 b . now , referring to fig7 , a second embodiment of the present invention will be explained below in detail . this embodiment provides a device with an interference grating for measuring displacement , in which a scale grating 12 b is formed on a glass substrate 12 a , and a scale 12 coated with glass 12 c is further provided on the scale grating 12 b . the measuring device employs prisms 80 and 82 instead of the polarizing beam splitter 62 and the non - polarizing beam splitter 70 of the first embodiment . with this arrangement , light beams are incident at a point on a surface 12 s of the scale 12 ( i . e ., the surface of the glass 12 c ) but are separated farther than the diameter of the light beams after having traveled a thickness t of the glass 12 c to be incident on the scale grating 12 b . the other features of this embodiment are the same as those of the first embodiment , and the same components are designated with the same reference symbols and will not be further detailed . according to this embodiment , a plurality of light beams are incident at one point on the surface of the glass 12 c , thereby hardly causing errors due to undulations of the surface of the glass ( on the side of incidence ). although certain preferred embodiments have been shown and described , it should be understood that many changes and modifications may be made therein without departing from the scope of the appended claims . | 6 |
according to various embodiments , in a method for determining the fuel quality in an auto - igniting internal combustion engine , a defined fuel quantity which differs by a specific amount from the fuel quantity required for the operating state is injected at defined crankshaft angles during a deceleration fuel cutoff phase of the internal combustion engine , the crankshaft torque contribution effected thereby is recorded , and an absolute or relative measure for the fuel quality is calculated therefrom . according to another embodiment , a device for an auto - igniting internal combustion engine may perform the aforesaid method . according to various embodiments , the effect that a fuel injection has on the crankshaft torque is greatly dependent on the fuel quality . if a favorable operating point at which the operating parameters of the internal combustion engine are otherwise constant is thus chosen it is possible to determine the fuel quality by injecting fuel and converting the difference in the crankshaft torque from the crankshaft torque that would result in the case of a standard fuel into a deviation from the standard fuel quality or by absolutely calculating directly from the crankshaft torque an absolute measure for the fuel quality . determining the torque contribution of an injection is known in the prior art and is now used for determining the fuel quality . just a single sample injection can suffice to record a metric for the fuel quality . for improved measurement accuracy it is to be preferred to repeat the method while the operating parameters remain unchanged within defined limits and to perform an averaging or a suitable statistical evaluation for the crankshaft torques or fuel quality measured values then recorded . if it transpires that at the selected , defined crankshaft angle the generated crankshaft torque or the determined measure for the fuel quality leads to possibly erroneous or implausible values , it is to be preferred to repeat the method at a changed defined crankshaft angle which may be less or greater than the angle previously used . this will be done in particular in the case of significant deviations from the standard fuel quality or in the case of a measure for the fuel quality which indicates an unusually poor - or good - quality fuel . by means of the crankshaft torques then obtained for different crankshaft angles or measured values for the fuel quality it is then possible to use a linear regression in order to obtain an improved value for the fuel quality . fig1 is a block diagram schematically illustrating a method for determining the fuel quality in an auto - igniting internal combustion engine . after the method is started at a step s 0 it is first queried at a step s 1 whether the internal combustion engine is in a deceleration fuel cutoff mode of operation or in another mode of operation in which the injected fuel mass is constant within defined limits . if no such operating state is present ( n branch ), the method is terminated at a step s 2 . determining the fuel quality only takes place ( y branch ) if such an operating state is present . then , at a step s 3 , a defined fuel quantity is injected at a defined crankshaft angle . said fuel quantity is different from the quantity otherwise provided for the operating state ( zero in the case of the deceleration fuel cutoff operating mode ). the difference in quantity leads to a specific change in the crankshaft torque which is recorded at a step s 4 . from said torque difference according to step s 4 , either an absolute measure for the fuel quality is determined or a relative measure is calculated taking into account the deviation from a standard value that would result in the case of a standard fuel . the method is then terminated ( step s 2 ). if the method is operating in a deceleration fuel cutoff phase , the change in torque is an absolute torque contribution due to the injection of the defined fuel quantity . in order to improve the measure for the fuel quality said method can be modified in a way such as is shown in fig2 . fig2 shows the extract part of the method according to fig1 from steps s 3 to s 5 . in this case a counter is incremented ( step s 6 ) so that a statistical evaluation can be carried out by way of the determination of the torque or the torque difference . step s 6 is in this case arranged in the representation scheme of fig2 between steps s 2 and s 4 , though it can also be placed before step s 3 or after step s 4 . the main thing is that it precedes a step s 7 which is in turn arranged after the determination of the torque or the torque difference . a check is made at step s 7 to determine whether the counter has reached a specific maximum value . if this is not the case , a sliding averaging , for example , is performed at a step s 8 over the recorded change in crankshaft torque or its deviation from standard fuel conditions . the concluding step s 5 in the determination of the measured value for the fuel quality , which step is not reached until the averaging includes a defined number of loop iterations , then makes use of the averaged value for the torque or , as the case may be , the torque difference . in this way a more accurate determination of the fuel quality is reached . in the embodiment variant shown in fig2 the averaging can , of course , also include a statistical evaluation . an averaging / statistical evaluation can also be performed on the basis of the measure for the fuel quality , instead of on the basis of the crankshaft torque or the crankshaft torque difference . in that case step s 5 will then come before step s 7 and the statistical evaluation or averaging at step s 8 will make use of the measure for the fuel quality . a further embodiment of the method is shown in fig3 . this serves to vary the defined fuel quantity and / or the crankshaft angle at which said fuel quantity is injected . this is based on the knowledge that there are specific time instants ( referred to the crankshaft angle ) at which the fuel quality has a particularly strong impact on the torque contribution of an individual injection . steps of the method according to fig3 which correspond to those of the method described with reference to fig1 are labeled with the same reference signs and , to the extent that it is not necessary , are not explained again . moreover , fig3 represents only an extract of the method , which extract starts only at step s 3 , which is , of course , in turn preceded by steps s 0 and s 1 as well as s 2 . characteristic of the method according to fig3 is a query step s 9 arranged after steps s 3 and s 4 ( and , depending on embodiment , also s 5 ) to determine whether the determined change in torque or , as the case may be , torque difference ( or the measure for the fuel quality , if step s 5 is also executed ) lies within a certain tolerance range around standard values . if this is the case , the measure for the fuel quality is determined at step s 10 , analogously to step s 5 , or alternatively step s 10 contains no further steps if step s 5 preceded step s 9 ( dashed variant of fig3 ). if , however , a deviation from standard values is present which points to a particularly unusual fuel quality — because e . g . the determined torque difference or , as the case may be , torque change indicates a similar situation or ( if step s 5 was executed ) the measure for the torque or , as the case may be , torque difference points thereto , a modified specification for the defined crankshaft angle and / or change in fuel quantity which is used at step s 3 is set at a step s 11 . at the same time the value obtained at step s 4 ( or step s 5 ) is assigned to the previously used defined value for the crankshaft angle and stored . subsequently steps s 3 and s 4 ( and , where applicable , s 5 ) are executed once more and the query at step s 9 is then skipped . based on the two defined crankshaft angles or changes in fuel quantity present as well as on the assigned values from step s 4 ( and , where applicable , s 5 ), step s 10 then performs a linear regression in which model data is used which expresses a relationship between fuel quality and torque contribution of an injection as a function of the crankshaft angle . by this means an improved indication of the fuel quality can be obtained . it is , of course , possible to perform not just two iterations of the loop of steps s 3 and s 4 with two different crankshaft angles / fuel quantities , but also a higher number , which then improves the linear regression . | 8 |
the present invention is a novel pump and pump system for use in the removal of liquids from wells , especially , but not limited to , wells that have insufficient bottom hole pressure to lift the well liquids out of the well bore and to the surface . referring to fig1 and 2 , a first preferred embodiment of the present invention shall be described . fig1 and fig2 illustrate a section of a typical hydrocarbon well completion , which includes a casing string 100 with perforations 102 adjacent the hydrocarbon - producing formation and a production tubing string 104 with perforations 106 . the production tubing 104 is installed with a down hole standing valve or check valve 120 in the cased hole or well bore . preferably , the check valve / standing valve 120 is threaded onto the bottom of the production tubing 104 , just above a perforated tubing sub 122 . this configuration allows for the pump 10 and 1 ″ tubing 110 to be removed without exposing the formation to any produced fluids and / or material that are captured inside of the annulus 108 between the production tubing 104 and the 1 ″ tubing 110 . in the event that a need was presented requiring the release of this fluid , the bottom of the standing valve ( ball and seat ) 120 could be knocked off and a “ slickline ” tool could be used to remove the standing valve . additionally , the operator would have the option of removing the liquids out of the tubing by means of forced air or any other type of pressure through the annulus that would make the tubing void of any fluids or material prior to removing the standing valve 120 . the pump of the present invention , generally 10 , is disposed within the production tubing string 104 at a depth adjacent perforations 102 in casing 100 . production tubing string 104 and casing 100 are conduits whose use , construction and implementation are well known in the oil and gas production field . pump 10 includes an engine end 12 and a pump end 14 , both encased in barrel 16 . the pump , as shown in the embodiment of fig1 and 2 , is designed to fit within the well &# 39 ; s production tubing and its size is determined by a number of factors , down hole temperatures , such as production tubing size , casing size and the amount of liquids and / or particulates ( e . g ., sand and coal fines ) to be removed . in a preferred embodiment on the invention shown in fig1 and fig2 , pump 10 is attached at the end of a 1 - inch diameter ( outer diameter ) tubing string 110 . preferably , the pump is threaded onto the bottom of the 1 - inch tubing and inserted into the production tubing 104 , setting the pump into a standard api seating nipple 130 and hanging the top of the 1 - inch diameter tubing 110 in a set of tubing slips that are part of the wellhead on the surface . as shown , tubing string 110 and pump 10 are disposed within the production tubing string 104 , which is disposed within casing 100 . for the purposes of this invention , pump 10 need not be disposed entirely within production tubing string and may extend below the lower end of the production tubing string in the embodiment shown . although shown as one inch tubing , the tubing string 110 that supports pump 10 is not limited to one inch tubing and is preferably sized to meet the particular needs of the well . for example , tubing string 110 may comprise larger diameter tubing if large amounts of liquid are produced and must be lifted from the well . in sizing the tubing string 110 , there are several factors to be taken into consideration , including the required feeding pressure / gas volume required to operate the engine end of the pump , the tensile strength of the tubing that the operator desires in the wellbore , the size of the production tubing , the size of the well casing , and the amount of fluids that are calculated to be removed from the wellbore . alternatively , instead of attachment to the end of a 1 - inch tubing string disposed within a production tubing string , pump 10 can be attached ( threaded attachment ) to the end of the production tubing string 104 or the tubing string nearest the face rock ( see fig3 ). in this alternative embodiment , a seal assembly would be disposed at the top of pump 10 into which a tubing string or pipe can be inserted to supply appropriate gas pressure to the engine end of the pump . referring to fig1 and fig2 , the pump 10 and pump system shall be described . the components of pump 10 are encased in a cylindrical steel housing ( pump barrel ) 16 much like conventional , well - known rod pumps . the pump and its components can be constructed of any suitable material , such as stainless steel , which will enable it to be utilized in harsh or corrosive conditions . external seating cups 132 are disposed on the pump barrel , to isolate the engine end gas from the produced hydrocarbons , when utilized in the smaller diameter tubing . the seating cups 132 rest upon a seating nipple 130 installed in the production tubing 104 . as stated previously , the pump includes an engine end 12 and a pump end 14 disposed within the housing 16 ( fig1 ). the engine end and the pump end may be separated by a permanent packed bearing , maintenance free needle or metal to metal type bearing 40 ( preferably high temperature ) and are operably connected by a common rod or shaft 42 that extends into the engine and pump ends of the pump 10 . additionally , both ends of the pump preferably include stabilizer permanent packed or maintenance free bearings 44 and 46 ( preferably high temperature ) with ports 45 and 47 for fluid and / or gas entry . this arrangement allows the pump to operate in a vertical or any angle , including all the way to a horizontal position without a loss of efficiency or unnecessary pump wear . attached to the shaft 42 in the engine end 12 of the pump are blades 50 that are pitched to move fluids ( especially gas ) away from the ported bearing 44 in the engine end . although blades 50 are shown as impeller blades , in a preferred embodiment blades 50 are not impeller - type blades , but instead is a turbine type blade design such as that disclosed in u . s . pat . no . 4 , 931 , 026 ( see reference numeral 14 ), which is hereby incorporated by reference . still referring to fig1 and 2 , exhaust ports 60 are provided in the engine end of the pump above bearing 40 to allow the driving gas to exhaust from the engine end of the pump . these exhaust ports are provided with a ball check valve 62 that opens under pressure from the driving fluids and closes to prevent fluid from entering the engine end through the exhaust ports when the pump is idle ( see fig3 , reference numerals 60 , 62 , 64 and 66 for ball check valve configuration ). attached to the shaft in the pump end 14 of the pump are blades 52 ( axial impeller blades ) that are pitched to move fluids upward toward exhaust ports 64 in the pump end 14 . exhaust ports 64 are provided with a ball check valve 66 that opens when fluids are being lifted by the moving blades 52 in the pump end and closes to prevent fluid from entering the pump end through the exhaust ports 64 when the pump is idle . as shown ( fig1 - 3 ), the axial turbine / turbines in the engine end are driven by pressurized ( gas ) to create the correct amount of torque and / or revolutions per minute ( rpm ) of the shaft to create substantially reduced pressures at the pump inlet ports via the axial impellers in the pump end . in a preferred embodiment of the invention , pump 10 would be driven by the natural gas produced from the well . generally , natural gas from the producing formation and / or formations will flow up the production tubing or the annulus 109 between the production tubing and the casing 100 to a separator 200 at the surface , which then feeds a surface compressor 210 . preferably , the surface compressor / compressors 210 would be designed to have sufficient engine horsepower ( hp ), engine and gas water cooling , and compressor design , to exceed the highest pressure required to move the static column of fluid that will exist if the pump were to become idle . additionally , the compressor preferably would be versatile enough to adapt to a wide range of inlet and discharge pressures without rod loading the compressor or having the engine die due to not enough hp . this versatility would allow the operator to adjust the discharge pressure or gas volume that feeds the pump engine . this would further allow the operator to adjust the surface pressure feeding the compressor 210 from the surface separator 200 , thereby allowing the operator to achieve optimum well bore protection and gas / oil flow . in the arrangement shown ( see fig2 ), the pressure relieved off of the producing formation can be controlled utilizing the inlet control valve 202 on the surface separator which may prevent damage to producing sands / shale &# 39 ; s . at the discharge line of the compressor 210 a pipe “ tee ” 212 would be installed with a line 214 being laid back to the well bore to connect to the 1 ″ diameter ( or larger ) tubing ( the “ drive line ”) to which the pump 10 is connected and a second line 216 extends from the tee joint to a sales line . at this stage , any chemicals required to produce the well such as paraffin , methanol for hydrates prevention , and corrosion can be injected into the 1 ″ tubing 110 , and swept down to the engine end 12 of the pump 10 . a standard type of continuous injection chemical pump ( e . g ., natural gas or electric ), and either a threaded or welded ½ ″ collar installed on the pipe for the injection point are suitable for this purpose . this will allow the chemicals to have contact with produced fluids to perform their functions while providing maximum protection for the producing horizon / horizons from coming in contact with these chemicals . continuing with the description of the preferred process / method of operation , a portion of the pressurized gas from the compressor 210 is discharged through the tee joint 212 into the 1 inch drive line 110 , with the remainder of the pressurized gas being discharged into the sales line 216 to continue on to sales . the amount of gas needed to be directed to drive the pump 10 is adjustable by operation of an adjustable valve 218 . for example , the adjustment of the amount of gas can be achieved utilizing a manual choke that can be locked at different settings or with a motor valve that can be operated either with a pneumatic pressure controller alone or utilizing remote communications technology . the amount of gas needed to operate the pump 10 will be dependent upon the pitch of the blades , length of the “ axial turbine ” in the pump barrel , and the pressure required to lift the annular fluids , as well as other factors . as illustrated in fig1 and 2 ( gas path indicated by arrows ), the drive gas discharged into the tubing string 110 enters the pump through the ported bearing 44 at the engine end 12 . the pressurized gas entering the engine end then acts upon the blades 50 causing the blades and shaft 42 to rotate . then , the pressured driving gas ( fluid ) is exhausted from the engine through the exhaust ports 60 located just above the isolation bearing 40 and into the annulus 108 between the one - inch tubing string and the production tubing . with the common shaft rotating , the blades 52 in the pump end 14 rotate as well , causing a vacuum ( or suction ) effect which draws fluid from the well through the ported bearing 46 at the pump end . the well fluids drawn into the pump end 14 are then forced toward and through the exhaust ports 64 located just below the isolation bearing 40 and into the annular space 108 between the 1 - inch tubing 110 and the production tubing 104 . the well fluids then combine with the driving fluids in this annular space and flow toward the surface and to the separator 200 . the mixture of the produced liquids and the natural gas utilized for power , will create a lighter gravity fluid in the annular space 108 between the production tubing and the 1 - inch tubing allowing for less force ( pressure ) to be required to lift both to the surface for separation . fig2 illustrates the flow of gas ( arrows indicating flow ) in a preferred embodiment of the pump system . as is evident from the description above , the preferred process is repetitive , thus keeping the well bore clear of produced liquids and sand while allowing less back pressure on the face rock . by producing up the casing annulus without the back pressure or friction losses generally created by free liquids , the face rock or producing horizon will yield additional amounts of gas and / or oil . this will extend the life of the well , thus enabling the operator to recover potential incremental reserves that may be otherwise uneconomic to produce utilizing existing conventional artificial lift methods . further , although the ball check valves used at the exhaust ports in both the engine and pump ends of the pump have the primary purpose of preventing / reducing back flow of fluids into the pump , they also provide a secondary benefit of allowing pressure testing of the production tubing from the surface to check for any mechanical failures . this may be done utilizing a pump truck that fills the annulus between the 1 - inch and the production tubing with a neutral fluid , usually produced or salt water , and then pressures up to a calculated pressure . significant pressure leak - off may indicate that a mechanical failure of the 1 - inch tubing has occurred . this can be determined by an increase in pressure in the 1 - inch tubing as the annulus pressure depletes . the ball checks prevent the test fluids ( and any debris or other foreign material ) from entering the pump . should the 1 inch tubing not show a mechanical failure then the operator can evaluate if a rig is required to remove or unseat the pump and again apply pressure to the production tubing to see if leak off occurs . this would determine if the mechanical failure is in the production tubing . the check valve 120 installed at the bottom of the production tubing 104 would allow for this test procedure . additional benefits can be derived from the system described herein . for example , the system described above provides a means to increase liquid removal from produced gasses . simultaneously acting with the process above will be an effective method of liquid removal from the compressor discharge gas prior to sales or custody transfer of the gas . this will occur due to the reduction of gas pressure utilized for driving the pump engine to the existing sales line pressure . the hot gas from the discharge of the compressor that is not utilized for operation of the pump will cool when it is controlled or experiences a pressure drop caused by the separator inlet controller . this will cause some of the entrained water and / or oil condensate to separate out of the sales gas stream and be recovered , utilizing the surface equipment on location . thus , in the preferred embodiment of the invention , the primary ( three - phase ) separator 200 would remove all free liquids that are initially removed from the wellbore prior to feeding the pressure to the inlet of the compressor 210 . then all produced liquids and any excess gas that is not utilized in the process of operating the pump and will be controlled or choked back down to the sales - line pressure utilizing an inlet control valve 222 installed on a second ( two - phase ) separator 230 that removes produced liquids and liquids that have fallen out of the gas stream due to pressure drop , allowing less saturated “ cleaner ” gas to continue on to the sale line 216 at line pressure and temperature . referring to fig3 , there is shown an alternative embodiment of the pump and pump system of the present invention . the same reference numerals used above and shown in fig1 and 2 are used in fig3 for like components and processes . fig3 depicts an alternative configuration where the pump 10 is attached directly to the production string 104 rather than a one - inch tubing string . as shown , in this alternative embodiment , the pump is not set in a seating nipple . further , in this embodiment , it is preferred that production tubing 104 is held in place with a packer 300 . in this embodiment , the process and system functions are the same as those described above ; however , the pump 10 lifts fluids through the annulus 109 between the production tubing 104 and casing 100 . these fluids are lifted and then processed at the surface as described in connection with fig1 and 2 . in another alternative embodiment of the pump system , a central compressor with a distribution piping system ( holding a set pressure ) can be used . this alternative configuration would give the same effect as having a wellhead compressor and is akin to a gas lift system where the power natural gas would be delivered to the well from one central site to cover several wells ( e . g ., 100 - 200 wells ). in this alternative embodiment , the gas flow would be the same as that shown in fig2 and described above in connection with fig1 and 2 , with the exception that only one surface separator would be needed . reference is made to fig4 for another alternative embodiment of the present invention . the same reference numerals used above and shown in fig1 - 3 are used in fig4 for like components and processes . accordingly , the above descriptions made in conjunction with fig1 - 3 apply with respect to the alternative embodiment depicted in fig4 and will not be repeated . like fig1 and 2 , fig4 depicts a configuration designed to produce well fluids between the annulus 108 formed between tubing string 110 and the larger diameter production tubing string 104 . fig4 illustrates a section of a hydrocarbon well completion , which includes a casing string 100 with perforations 102 adjacent the hydrocarbon - producing formation and a production tubing string 104 with perforations 106 . the production tubing is installed in the cased hole or well bore . in the embodiment of fig4 , check valve / standing valve 120 is a removable standing valve or vertical check valve that is installed into the seating nipple or “ o - ring ” assembly 130 of the tubing string 104 . the seating nipple 130 is located at the bottom of the production string or one ( 1 ) joint of pipe up from the bottom such that it is disposed below . this configuration allows for the pump 10 and 1 ″ tubing 110 to be removed without exposing the formation to any produced fluids and / or material that are captured inside of the annulus 108 between the production tubing 104 and the 1 ″ tubing 110 . in the event that a need was presented requiring the release of this fluid , the standing valve 120 would be removed utilizing a “ slickline ” tool . additionally , the operator would have the option of removing the liquids out of the tubing by means of forced air or any other type of pressure forced down the annulus that would make the tubing void of any fluids or material prior to removing the standing valve 120 . still referring to fig4 , turbine blades or turbine means 50 are schematically depicted in the engine portion of the pump 10 . for a more detailed description and depiction of suitable pump engine turbine means reference is made to u . s . pat . no . 4 , 931 , 026 ( see generally reference numeral 14 ), which has been incorporated by reference . because of the high rotational speed created by the turbine configuration ( e . g . 20 , 000 - 30 , 000 rpm ), it is preferred that a vertical stabilizer bearing 140 be used as shown . reference is made to fig5 for another alternative embodiment of the present invention . the same reference numerals used above and shown in fig1 - 4 are used in fig5 for like components and processes . accordingly , the above descriptions made in conjunction with fig1 - 4 ( including the design of pump 10 ) apply with respect to the alternative embodiment depicted in fig5 and will not be repeated . as shown in fig5 , a larger diameter pump 10 is threaded onto a larger tubing string 110 ( e . g ., 2⅜ inch od tubing ) than that depicted in fig1 and 4 ( 1 inch tubing ). in this alternative configuration , the pump 10 is located above the perforations 102 formed in larger diameter casing 100 , such as a liner top . in a preferred aspect of this embodiment of the invention , pump 10 is housed within a housing or barrel 16 having an outer diameter of at least 3 . 25 inches . as shown in fig5 , pump 10 is disposed within a section of 3 . 25 inch ( od ) tubing which is threaded to a 2⅜ inch tubing section 110 above the pump 10 . as shown , pump 10 is fixed within a 4½ inch production tubing section 104 by a seating nipple or a seating cup 132 which holds the pump in place and isolates the engine end 12 from the pump end 14 of the pump . the 3 . 25 inch tubing section 104 is threaded below pump 10 to 2⅜ inch tubing ( tail pipe ) 114 . in a preferred aspect of this embodiment of the invention , a packer is set below the pump instead of a down hole standing valve . further , as shown in fig5 , preferably a string of “ tail pipe ” 114 or several joints of tubing extend below the pump 10 , with the tail pipe set or landed at the optimum place in the perforations . in a most preferred configuration , the tail pipe is smaller in diameter ( e . g . 1½ inch ) than the tubing string 110 feeding the engine of pump ( e . g ., 2⅜ inch ). this preferred configuration would increase velocity of fluids entering the tail pipe and would produce increased torque pressures for setting and releasing the packer . further , this configuration will allow more gas volume and less friction loss to the engine end , and increase velocities in the smaller diameter tubing installed inside the larger casing . the various embodiments of this invention have been described herein to enable one skilled in the art to practice and use the invention . its is understood that one skilled in the art will have the knowledge and experience to select suitable components and materials to implement the invention . for example , those skilled in the art will understand that components such as bearings , seals and valves referenced herein will be selected to effectively withstand and operate in the harsh pressure and temperature environments encountered in an oilk or gas well . although the present invention has been described with respect to preferred embodiments , various changes , substitutions and modifications of this invention may be suggested to one skilled in the art , and it is intended that the present invention encompass such changes , substitutions and modifications . | 5 |
drilling jars are used to free stuck drill strings or to recover stuck drill string components during drilling or workover operations . the jars provide an impact blow either in the up or down directions . the driller can control the jarring direction , impact intensity and jarring times from the rig floor . the magnitude and direction of the load used to initiate the impact blow ( jar ) achieve this control . examples of hydraulic jars are disclosed in u . s . pat . nos . 5 , 431 , 221 , 5 , 174 , 393 , 5 , 595 , 244 , 5 , 447 , 196 , 5 , 503 , 228 , 5 , 595 , 253 and such patents are hereby incorporated by reference herein . fig1 shows a cross section through a lower detent area 11 of prior art jar 10 . downward force arrow 13 is shown and represents the force applied to mandrel 12 of jar 10 . this force applied to mandrel 12 is transmitted to outer cylindrical housing 14 via detent piston 19 and results in an increase in pressure in the hydraulic fluid that is contained in lower chamber 16 between outer cylindrical housing 14 and mandrel 12 . the magnitude of the pressure in lower chamber 16 is directly proportional to the magnitude of the force applied to mandrel 12 . this high - pressure fluid is allowed to flow through orifice ( not shown ) to an upper chamber 20 . the result of this fluid flow is a relative axial movement between outer housing 14 and mandrel 12 . when this relative axial movement is sufficient to place the orifice in juxtaposition to relief area 17 of outer housing 14 , a sudden release of high pressure fluid occurs which results in an impact blow being delivered to the “ knocker ” part of the jar ( not shown ). the “ knocker ” is usually located at the upper most end portion of the drilling jar . as explained above , during the removal of one or more jars from a wellbore , they are stored on the derrick floor in the open position with two or more drill collars above it . the weight of the drill collars and the jar itself may close the jar causing accidental firing / unintentional impact blows of the jar . unintentional impact blows result in safety concerns for rig operators . safety clamps are typically used to prevent this occurrence , but they present a significant falling hazard as they can be 30 to 90 ft above the floor . referring to fig2 and 3 , a schematic representation of a jar connected to a ball stop assembly according to one or more embodiments of the present disclosure is shown . as illustrated in fig2 , jar 100 is connected to a ball stop assembly 105 , which is connected to a lower sub 110 . fig2 illustrates jar 100 fully compressed without the kelly mandrel shaft exposed . fig3 also illustrates jar 100 connected to a ball stop assembly 105 , which is connected to a lower sub 110 . however , in fig3 , jar 100 is extended with an exposed portion of kelly mandrel shaft 115 exposed . ball stop assembly 105 prevents unintentional impact blows , as ball stop assembly 105 acts as an internal stop that prevents axial movement of jar 100 . the ball stop assembly 105 will be described in detail below . referring to fig4 , a break - away schematic illustration of a ball stop assembly according to one or more embodiments of the present disclosure is shown . as illustrated , a lower jar assembly 120 , having a lower mandrel 125 is disposed below a ball stop housing 130 . when the tool is assembled , ball stop housing 130 slides over lower mandrel 125 into contact with lower jar assembly 120 . in this embodiment , ball stop housing 130 contacts lower jar assembly 120 at a lower jar assembly shoulder 135 . depending on the specific design , ball stop housing 130 may be coupled to lower jar assembly 120 through a screw - type connection , or alternatively with bolts , rivets , or through other connections known in the art . during assembly , a ball stop assembly 105 is disposed in ball stop housing 130 . lower sub 110 may then be coupled to ball stop housing 130 through a screw - type connection , or alternatively with bolts , rivets , or through other connections known in the art . when ball stop housing 130 is made - up with lower sub 110 , a top extension 140 of lower sub 110 may contact a ball retainer 145 of ball stop assembly 105 . thus , when assembled , lower jar assembly 120 is coupled to ball stop housing 130 , which is coupled to lower sub 110 , such that lower mandrel 125 may communicate axially through ball stop housing 130 and ball stop assembly 105 . referring to fig5 , a break - away schematic illustration of ball stop assembly 105 according to one or more embodiments of the present disclosure is shown . in this embodiment , ball stop assembly 105 includes a spring slide 150 having yoke pins 155 extending from a lower axial portion thereof . ball stop assembly 105 further includes a ball retainer 145 having a plurality of pivot pins 160 extending internally therein . pivot pins 160 are configured to hold a ball stop 165 , while allowing the ball stop 165 to rotate when motion applied by slide assembly 150 axially translates yoke pins 155 . the axial movement of spring slide 150 , and thus yoke pins 160 may thereby cause ball stop 165 to rotate about pivot pins 160 . ball stop 165 , as illustrated is hollow through the center , so as to allow the lower mandrel ( not shown ) to move axially therethrough when the ball stop 165 is rotated into an open position . the positions of ball stop 165 will be explained in detail below . a spring 170 is disposed around spring slide 150 and held in place with a seal 175 . seal 175 is fixed relative to spring slide 150 . when assembled , the ball stop assembly 105 is disposed in the ball stop housing 130 ( fig4 ), such that an area between spring slide shoulder 180 and seal 175 ( and between spring slide 150 and ball stop housing 130 ) is a sealed chamber filled with air . referring to fig6 a - 6e , schematic representations of ball stop assembly 105 during actuation according to one or more embodiments of the present disclosure are shown . as illustrated , fig6 a is representative of ball stop assembly 105 in a closed , non - actuated position , while fig6 e is representative of ball stop assembly 105 in an open , actuated position . all of fig6 a - 6e show ball stop assembly 105 having a slide assembly 150 with a spring 170 disposed therearound , and sealed to form an air chamber ( as disclosed above ) via seal 175 . ball stop 165 is held in ball retainer 145 with pivot pins 160 and ball stop 165 is connected to yoke pins 155 . spring 170 is biased such that ball stop assembly 105 is in a closed position ( as illustrated in fig6 a ). in the closed position , ball stop 165 is oriented so that there is no internal passage through ball stop assembly 105 to allow the lower mandrel 125 ( fig4 ) of the jar to translate therethrough . however , when ball stop 165 is oriented in an open position ( as illustrated in fig6 e ), the lower mandrel 125 of the jar can freely move axially through a passage ( not shown ) in ball stop 165 . the ball stop 165 is rotated by converting axial movement of slide assembly 150 to rotate ball stop 165 . as illustrated herein , actuation occurs as a result of a pressure differential created by the difference between the pressure of the drilling fluid and the sealed chamber of air , which is created by sealing the spring 170 via seal 175 . as internal drilling fluid pressure increases , the spring assembly 150 translates axially and rotates ball stop 165 into the open position . this process is illustrated through the progression of fig6 a to 6e . when drilling fluid pressure decreases , the spring 170 acts on slide assembly 150 , moving slide assembly 150 in the opposite direction to rotate ball stop 165 into a closed position . this process is illustrated through the progression of fig6 e to 6a . thus , by varying the drilling fluid pressure , the ball stop assembly 105 may be rotated into open and closed positions through the drilling / jarring process . when drilling fluid pressure is ultimately decreased as the jar is removed from the wellbore , the ball stop assembly 105 will be in a closed position , such that lower mandrel ( not shown ) cannot pass through ball stop 165 . because lower mandrel ( not shown ) cannot pass through ball stop 165 , the jar cannot unintentionally fire , thereby preventing safety hazards at the drilling rig . referring now to fig7 a and 7b , a cross - sectional illustration of an embodiment of the present disclosure is shown . as illustrated in fig7 a and 7b , in the event of a failure of seal 175 or another component of ball stop assembly 105 , fluid may still pass through ball stop assembly 105 , thereby allowing drilling to continue . as illustrated in fig7 a , while in the closed position , lower mandrel 125 is in contact with ball stop 165 , however , as the opening through ball stop 165 is smaller than the external diameter of lower mandrel 125 , lower mandrel 125 cannot translate therethrough . however , because ball stop 165 includes a narrow fluid passage 180 , fluid may still pass from lower mandrel 125 to lower sub 110 and on to other components of the drilling tool assembly , such as a drill bit ( not shown ). as illustrated in fig7 b , while in an open position , lower mandrel 125 translates through ball stop 165 , thereby allowing fluid communication therethrough . thus , in the event the ball stop assembly 165 fails , fluid communication through ball stop assembly 105 is provided so as to not interfere with the drilling operation . during operation of the jar , as explained above , the pressure generated by mud pumps allows the jar to remain in an open position due to the hydrostatic head . thus , the tool may be operated substantially automatically , as the tool will modulate between open and closed positions as a result of the pressure generated by the mud pumps . in an alternate embodiment , modulation of the tool between open and closed positions may occur through manual actuation of a ball stop . referring to fig8 a - 8c , a manual drilling jar locking assembly according to embodiments of the present disclosure is shown . referring specifically to fig8 a , an external side view of a jar according to embodiments of the present disclosure is shown . in this embodiment , an operating stem 190 is shown extending externally from the jar 195 . in order to modulate jar between a closed and open position , an operator may manually manipulate operating stem 190 to turn an internal component of jar 195 . referring to fig8 b and 8c , a cross - sectional view of fig8 a and a close perspective of section 200 of fig8 b , respectively , are shown . as illustrated , operating stem 190 is connected to a ball stop 165 , such that rotation of operating stem 190 rotates ball stop 165 between an open and closed position , similar to the rotation of ball stop 165 discussed above . in this embodiment , operating stem 190 may include , for example , a screw that when turned imparts rotation to ball stop 165 , thereby changing the orientation of ball stop 165 within jar 195 . those of ordinary skill in the art will appreciate that the jar may thus be modulated between open and closed positions as the jar is placed in or removed from the wellbore . thus , the jar may be stored in a closed position , such and accidental firing cannot occur and be modulated into an open position before the jar is disposed in the wellbore . referring to fig9 a and 9b , a partial cross - section of a safety bypass for a drilling jar according to one or more embodiments of the present disclosure is shown . specifically , fig9 a illustrates a jar in a closed or firing condition , while fig9 b illustrates the jar in an open or non - firing condition . in this embodiment , a detent section 300 ( as explained above with respect to fig1 ) of a drilling jar is shown . detent section 300 includes a high pressure chamber 305 and a low pressure chamber 310 . a fluid passage 315 provides fluid communication between high pressure chamber 305 and low pressure chamber 310 . fluid communication is provided through a first port 320 in low pressure chamber 310 and a second port 322 in high pressure chamber 305 . detent section 300 further includes a needle valve 323 disposed in fluid passage 315 and configured to translate axially within fluid passage 315 . as a drilling jar having detent section 300 is run into a wellbore , annular pressure acts on needle valve 323 , causing needle valve 323 to translate axially downwardly . the axial translation of needle valve 323 within fluid passage 315 blocks second port 322 , thereby preventing fluid from flowing from high pressure chamber 305 to low pressure chamber 310 . because fluid is prevented from flowing between high pressure chamber 305 and low pressure chamber 310 , pressure is allowed to build within high pressure chamber 305 by the downward force of the mandrel 12 ( fig1 ) via detent piston 319 , thereby allowing the jar to fire . as the jar is removed from the wellbore , the annulus pressure decreases , thereby causing needle valve 323 to translate axially upwardly , as the spring 325 of needle valve biases the needle valve into an open condition . in an open condition , fluid is allowed to flow from high pressure chamber 305 through second port 322 , into fluid passage 315 , through first port 320 , and into low pressure chamber 310 . when the jar is in an open condition , and fluid is allowed to flow between high pressure chamber 305 and low pressure chamber 310 , pressure cannot build in high pressure chamber 305 , thereby preventing the jar from firing . those of ordinary skill in the art will appreciate that as the jar is stored in the derrick , the jar is at ambient pressure and needle valve will be biased in an open condition , thereby preventing pressure from building in high pressure chamber 305 . thus , as long as the jar remains in the derrick and stored , the jar will not unintentionally fire . as such , this embodiment of the present disclosure provides a pressure sensing device that diverts the flow of hydraulic fluid away from the pressure building detent system , thereby serving as a secondary safety mechanism when a jar is returned to the surface and placed in the derrick . referring to fig1 a and 10b , a partial cross - section of an alternative safety bypass for a drilling jar according to embodiments of the present disclosure is shown . specifically , fig1 a illustrates a jar in a closed or firing condition , while fig1 b illustrates the jar in an open or non - firing condition . in this embodiment a detent section 300 of a drilling jar is shown . detent section 300 includes a high pressure chamber 305 and a low pressure chamber 310 . a fluid passage 315 provides fluid communication between high pressure chamber 305 and low pressure chamber 310 . fluid communication is provided through a first port 320 in low pressure chamber 310 and a second port 322 in high pressure chamber 305 . in this embodiment , a plunger 330 is disposed in fluid passage 315 and a seal rod 335 is disposed in fluid passage 315 below plunger 330 proximate second port 322 . as the jar is run into the wellbore , annulus pressure acts on plunger 330 , compressing a spring 325 , preventing seal rod 335 from moving axially . as temperature increases , seal rod 335 thermally expands , thereby sealing second port 322 and preventing the flow of fluid from high pressure chamber 305 through fluid passage 315 into low pressure chamber 310 . because fluid cannot flow from high pressure chamber 305 into low pressure chamber 310 , pressure builds within high pressure chamber 305 by the downward force of the mandrel 12 ( fig1 ) via detent piston 319 , thereby allowing the jar to fire . when the jar is removed from the wellbore , annulus pressure decreases and a spring 325 allows plunger 330 to retract into a biased , open position . as the temperature decreases from the downhole temperatures , the seal rod 335 contracts and allows fluid to bypass from high pressure chamber 305 through fluid passage 315 and into low pressure chamber . because fluid is allowed to flow from high pressure chamber 305 and low pressure chamber 310 , pressure cannot build in high pressure chamber 305 , thereby preventing the jar from unintentionally firing while the jar is stored in the derrick . in certain embodiments , seal rod 335 may be mechanically held within fluid passage 315 , thereby not requiring plunger 330 . in such an embodiment , the temperature increase as the jar is run into the wellbore causes seal rod 335 to thermally expand , thereby blocking second port 322 , allowing pressure to build within high pressure chamber 305 , and allowing jar to fire . referring to fig1 a and 11b a partial cross - section of an alternate safety bypass for a drilling jar according to one or more embodiments of the present disclosure is shown . specifically , fig1 a shows a jar in an open position , allowing free flow of fluids between chambers , while fig1 b shows a jar in a closed position , thereby not allowing the free flow of fluid between chambers . turning specifically , to fig1 a , a jar 400 is shown having an outer housing 401 , a mandrel 402 , pressure chamber 405 and a pressure chamber 410 . a separator 415 is disposed therebetween , the separator 415 having a plurality of valves . a first valve 420 , a pressure activated valve , allows fluid to flow from the pressure chamber 410 to the pressure chamber 405 , while a second valve 425 , a reverse free flow valve , allows fluid to only flow from pressure chamber 405 to pressure chamber 410 . jar 400 may further include a plurality of seals 403 configured to seal between separator 415 and outer housing 401 . as illustrated , first valve 420 is in the open position , thereby allowing fluid to flow freely from pressure chamber 410 to pressure chamber 405 . this condition occurs as the jar 400 is run into the wellbore as a result of annulus pressure acting on first valve 420 . due to the annulus pressure , the first valve 420 is forced open , thereby allowing the free flow of fluid from pressure chamber 410 to pressure chamber 405 . because fluid may flow therebetween , mandrel 402 can move down with respect to outer housing 401 allowing the tool to go from open position ( on surface ) to firing position ( downhole ). referring to fig1 b , as the jar 400 is removed from the wellbore , there is no annulus pressure to keep first valve 420 open , thereby resulting in first valve 420 closing , preventing fluid from flowing from pressure chamber 410 to pressure chamber 405 . as first valve 420 closes , the outer diameter of the separator is sealed , thereby preventing axial movement of jar 400 and effectively locking jar 400 . because jar 400 is locked , the jar cannot unintentionally fire . those of ordinary skill in the art will appreciate that a plurality of first and / or second valves 420 / 425 may be used to further increase the flow rate of fluids between pressure chamber 405 and pressure chamber 410 . referring to fig1 a and 12b , a partial cross - section of an alternative safety bypass for a drilling jar according to one or more embodiments of the present disclosure is shown . in this embodiment , a separator 500 prevents fluid from flowing in / out of a jar 505 . jar 505 includes an outer housing 506 and a mandrel 507 . a plurality of seals 508 may seal between separator 500 and outer housing 506 and between separator 500 and mandrel 507 . specifically , fig1 a illustrates jar 505 in an open condition , wherein fluid is allowed to flow into jar 505 , thereby allowing jar 505 to be fired . fig1 b illustrates jar 505 in a closed condition , wherein fluid is not allowed to flow into jar 505 , and as such , jar 505 cannot fire . referring specifically to fig1 a , as jar 505 is run into a wellbore , pump pressure pushes separator 500 axially downward , compressing spring 510 . the compressing of spring 510 and associated axial translation of separator 500 downward opens annulus pressure communication port 515 , and allows annulus pressure to keep separator 500 down , in an open position . when separator 500 is in an open condition , fluid may freely flow into and out of jar 505 as jar 505 is stroked , which is required in order for jar 505 to operate . referring now to fig1 b , as jar 505 is removed from the wellbore , annulus pressure decreases and returns to atmospheric pressure , at which point the spring 510 biases separator 500 in a closed position . as separator 500 is in a closed position , fluid cannot flow into jar 505 . because fluid cannot flow into jar 505 , jar 505 is effectively hydraulically locked , thereby preventing axial movement and preventing unintentional firing . because jar 505 is stored at atmospheric pressure in the derrick , jar 505 stored in derrick between uses cannot unintentionally fire . embodiments of the present disclosure may provide primary and secondary safety mechanisms for drilling jars . in certain embodiments , primary safety mechanisms may prevent axial translation of a mandrel within a jar , thereby preventing the jar from accidentally firing . in other embodiments , secondary safety mechanisms may prevent pressure from building within the detent , thereby passively preventing a jar from firing unless the jar is in the wellbore . such primary and secondary safety mechanisms may allow drilling jars to be stored in a derrick with less risk of accidentally firing , as the jar may not be capable of building hydraulic pressure or axially translating a lower mandrel . multiple primary and secondary safety mechanisms may be used on a single jar , thereby further increasing the safety of the jar . for example , in certain embodiments , a primary safety mechanism preventing axial movement of the lower mandrel may be used in the same jar as a secondary safety mechanism , such as a mechanism that prevent hydraulic pressure from building in the detent . additionally , in certain embodiments , both active and passive safety systems may be used . for example , in certain embodiments an operator may be required to manually actuate an operating stem in addition to the jar having a secondary passive safety system , such as a system to prevent hydraulic pressure from building in the detent system . those of ordinary skill in the art will appreciate that various combinations of the safety systems disclosed herein may be combined without departing from the scope of the present disclosure . although only a few example embodiments have been described in detail above , those skilled in the art will readily appreciate that many modifications are possible in the example embodiments without materially departing from pressure lock for jars accordingly , all such modifications are intended to be included within the scope of this disclosure . in the claims , means - plus - function clauses are intended to cover the structures described herein as performing the recited function and not only structural equivalents , but also equivalent structures . thus , although a nail and a screw may not be structural equivalents in that a nail employs a cylindrical surface to secure wooden parts together , whereas a screw employs a helical surface , in the environment of fastening wooden parts , a nail and a screw may be equivalent structures . it is the express intention of the applicant not to invoke 35 u . s . c . § 112 , paragraph 6 for any limitations of any of the claims herein , except for those in which the claim expressly uses the words ‘ means for ’ together with an associated function . | 4 |
fig1 a illustrates a portion of an exemplary leadframe strip 101 with molded semiconductor devices 110 after the strip has been removed from the mold press , in which the encapsulation process by molding had been completed . a leadframe strip is preferably etched or stamped from a thin sheet of base metal such as copper , copper alloy , iron - nickel alloy , aluminum , kovar ™, and others , in a typical thickness range from 120 to 250 μm . the technology trend is towards thinner leadframes . as used herein , the term base metal has the connotation of starting material and does not imply a chemical characteristic . a leadframe provides a stable support pad for firmly positioning the semiconductor chip . further , a leadframe offers a multitude of conductive leads to bring various electrical conductors into close proximity of the chip . any remaining gap between the tip of the leads and the chip terminals is typically bridged by thin bonding wires ; alternatively , in flip - chip technology the chip terminals may be connected to the leads by metal bumps . for the leadframe , the desired shape of pad , leads , and other geometrical features are etched or stamped from the original metal sheet . when required by leadframe functionality and within certain limits , the thinness of the base metal and the fine features of the leads allow a forming process by an external force acting on those leads with the goal of creating leadframe portions in a plane offset from the plane of the starting sheet . an outside force , applied along the length of a lead , can stretch the lead in the direction of the length , while the dimension of the width is only slightly reduced , so that the new shape appears elongated . for elongations small compared to the length , and up to a limit called the elastic limit given by the metal characteristics , the amount of elongation is linearly proportional to the force . as pointed out below , the possibility of affecting leadframe features by external forces may have an undesirable side effect , whereby yield - reducing deformations of leadframe portions can be created unintentionally in zones 120 between encapsulated devices . it is an irrevocable leadframe characteristic to facilitate reliable adhesion to the attached chip and to encapsulation compounds . besides chemical affinity between the molding compound and the metal finish of the leadframe , reliable adhesion necessitates leadframe surface roughness , especially in view of the technical trend of shrinking package dimensions , which offers ever less surface area for adhesion . in addition , the requirement to use lead - free solders pushes the reflow temperature range into the neighborhood of about 260 ° c ., making it more difficult to maintain mold compound adhesion to the leadframes at elevated temperatures . in order to keep fabrication cost low , the preferred method of roughening the leadframe surface is flood roughening included in the plating process of layers such as nickel . the roughening is preferably applied on both leadframe surfaces . a leadframe strip with roughened surface is then used to attach the semiconductor chip onto the pad , to connect the chip terminals to the respective leadframe leads by wire - bonding or flip - chip assembly , and finally to place the assembled strip in a steel mold press for encapsulating the assembled devices . the bottom and top halves of the steel mold are designed to form individual cavities for each device of the leadframe strip . each cavity has a precision entry gate through which the molding compound will be pressed to fill the respective cavity in a controlled fashion . the compound , in turn , is supplied to the gates in runners engraved in the mold steel . during the molding process , the compound in the runners contacts the roughened leadframe surface on its way to each gate . after filling the cavities with compound and polymerizing ( hardening ) the compound , the top mold half is lifted so that the leadframe strip with the encapsulated devices can be removed from the press . at this stage , the hardened compound in the runners remains on the strip , since the compound adheres to the roughened leadframe surface . in the following process step of degating , the compound of the runners is broken off each gate and the attached length of the leadframe . the compound of the runners exerts resistance against the force needed in this removal step , since the compound adheres to the roughened leadframe surface . as a consequence , the leadframe metal is bent and distorted along the paths of the runners . fig1 a indicates the leadframe metal distortion 102 along the runner paths to each gate , as observable by a change of the optical light reflection of the plated metal . the top view photographs of fig1 b and 1c illustrate more complete lengths 103 and 104 of distorted leadframe metal along the complete runner lengths . a more detailed analysis of the extension of the distorted metal along the runner paths , as indicated for an example by the enlarged perspective photograph of fig2 , reveals the bending of the leadframe metal by the enhanced reflection of microscope light . it is noted how clearly the metal , distorted by the forceful removal of the adhering molding compound , follows the bend ( arrows 201 and 202 ) in the path of the runner in front of the gate to the device cavity . the strong adhesion of the molding compound to the leadframe metal is explained by the amount of surface roughness of the plated metal layer on the leadframe . the atomic force microscope ( afm ) pictures of fig3 and 4 illustrate a quantitative comparison of the un - roughened nickel surface roughness o the starting base copper leadframes and the roughened surface of the plated layer of nickel . fig3 depicts a sample with the smooth ( non - rough ) plated surface , and fig4 depicts a sample of the rough surface of the plated layer . the parameter most conveniently indicating the amount of roughness is the so - called surface area ratio s . ratio s is defined as the surface area shown ( three - dimensional ) relative to a geometrically flat surface area ( two - dimensional ). the quantitative parameter values are based on a detailed analysis of the surface contours . the sample in fig3 shows a surface area ratio of s = 1 . 07 , while the sample of fig4 reveals a much larger surface area ratio of s = 1 . 52 . fig3 indicates an average surface roughness of r a = 37 ± 20 nm , while fig4 shows a much large surface average roughness of r a = 80 ± 20 nm . the root mean square of the sample in fig3 is r ms = 47 nm , while the root mean square of the sample in fig4 is r ms = 99 nm . in order to selectively eliminate or at least reduce the adhesion to molding compound in zones of the plated leadframe surface , a stamping or punching tool suitable for planishing action can be constructed so that it is an additional feature of the already installed manufacturing machines for leadframe offsetting and cutting . ( in the offset action , chip pads of the leadframe are depressed relative to the plane of the starting sheet , and in the cutting action , the leadframe sheet is cut into strips .) the planishing tool is preferably made of a hard , abrasion - resistant material such as stainless steel . its surface involved in the stamping action is preferably flat . the contours of the stamping surface are designed to either affect the general leadframe area affected by unwanted adhesion to molding compound runners , as generally marked in fig5 , or to affect specifically selected leadframe areas , as indicated , for example , by the distortions observed in fig2 . the stamping force of the tool applied during its impact on the rough leadframe surface , can be varied and computer controlled . due to the ability to set the stamping force to the desired level , the degree of smoothing a rough leadframe surface can be varied from just reducing rough peaks to almost complete flattening . accordingly , a step between the un - planished area and the planished area will mark the borderline of the planishing action , the height of the step depending on the planishing force . in the exemplary leadframe strip shown in fig5 and generally designated 500 , a plurality of sites 510 are designed to assemble semiconductor chips . sites 510 alternate with zones 520 for connecting the leadframe to the runners delivering the molding compound to the cavities in the steel mold . sites 510 have a mechanically rough and optically matte surface ; some of these surfaces are designated 511 and 512 in fig5 . preferably , both sides of the leadframe have rough surface . in contrast , zones 510 have at least portions with mechanically flattened and optically shiny surfaces , approximately outlined as areas 521 and 522 in fig5 . these flattened and shiny areas of zones 520 are created by planishing actions to smoothen and flatten surface roughness for reducing and preventing unwanted adhesion to polymeric encapsulation compounds after the packaging process . a specific planishing tool should be designed so that the planishing action of the tool captures the layout of the runners for the polymeric compound and especially includes those leadframe surfaces , which are in close proximity to the device gates . preferably the planishing tool should be designed so that the planishing action on the leadframe captures even a distance of about 10 to 20 pm inside the gate , i . e . 15 ± 5 μm inside the perimeter of the package - to - be - created . as an example , a planishing tool shaped approximately like the imprint depicted in fig2 would be capable of planishing a leadframe area contacted by the molding compound in the runner crossing the leadframe surface in order to reach the gate ; such tool is capable of reducing the surface roughness just in the area where strong metal adhesion to the molding compound is causing the detrimental deformation illustrated in fig2 . as mentioned , when the planishing tool impacts the rough leadframe surface , the impact force may create a step between the planished ( smoothened ) and un - planished ( still rough ) surface areas . the magnified microscopic photographs of fig6 and 7 illustrate examples of the effect of planishing action on a nickel - plated layer deposited on the surface of a copper leadframe . at a magnification of 5000 ×, the top view of fig6 shows a rough - plated section at the right hand side of the figure , approximately up to the arrows , and a planished section at the left hand side . the force used in the planishing action was relatively light , but clearly resulted in a partial flattening of the steep peaks dominant in the un - planished section . at a magnification of 8000 ×, the slightly perspective view of fig7 shows the step between a planished ( bottom section ) and a non - planished ( top section ) surface . the force in the planishing action was relatively light so that the step is only about 1 . 5 μm high . using a considerably stronger force for the impact , the planishing action may result in a thickness reduction of the plated metal between about 5 and 15 %. at a 10 % reduction of the leadframe thickness of 150 μm , the thickness reduction and thus the step may amount to about 15 μm . experiments have shown that the flatness of the surface corresponding to a thickness reduction of about 5 to 10 % will diminish the adhesion to the leadframe metal of the molding compound along the path of the runner to such degree that it has practically vanished . while plated metal with rough surfaces has a matte optical appearance , a planished surface looks more reflective and shiny . it is , therefore , easy to identify the extent of a planishing action by a simple optical inspection . in order to maximize adhesion between polymeric compounds and metal leadframes , it is advantageous to have rough and thus matte surfaces on both sides of a leadframe . the planishing action , on the other hand , is advantageous only on the leadframe side where the mold runners are positioned . it would , therefore , be sufficient to use the planishing tool only on one side of the leadframe . from a practical fabrication standpoint , however , counterbalancing the impact force of the planishing tool is most easily achieved by planishing corresponding areas on both sides of a leadframe . a surface step of the order of 10 μm is clearly visible in an unaided - eye inspection of a leadframe surface , especially when accompanied by a change in optical reflectivity . the application of a planishing tool by a leadframe supplier is thus easily detectable in the proximity of mold gates . since the step of trimming the leadframe for singulating the finished package after completing the encapsulation step will likely remove the planished leadframe portions , only about 10 to 20 μm inside the gate of the finished package will continue to show marks of the planishing action . another embodiment of the invention is a method for fabricating a leadframe strip for use in plastic encapsulated semiconductor devices . certain steps of the process flow are shown in the block diagram of fig8 . in step 801 , the geometrical form of a leadframe is etched or stamped from a starting sheet of a base metal . as stated above , preferred base metals include copper , copper alloy , iron - nickel alloy , aluminum , and kovar ™, and preferred starting sheets are in the thickness range from 120 to 250 μm ; thicknesses under 100 μm are becoming more common . the term base metal has the connotation of starting material and does not imply a chemical characteristic . in the next step 802 , the leadframe is plated to promote bondability and solderability and to enhance adhesion to polymeric encapsulation compounds . preferred metals for plating include nickel , palladium , gold , and combinations and alloys thereof . for some devices , another option includes tin . for strengthening adhesion without additional cost , it is preferred to employ a flood roughening technique involving the entire leadframe surface , preferably on both sides of the leadframe . a preferred roughness is in the range of 90 ± 20 nm , which results in a surface area ratio of about 150 to 160 square - units for a square area measuring 10 by 10 units side - length ( instead of a surface area ratio of 100 square - units for a flat surface ). the 50 to 60 % increase in active surface originates the enhanced adhesion . it has been described above that the strong adhesion has the unwelcome side - effect of leadframe deformation in the degating and deflashing process steps . to prevent these side effects , the next process step includes the feature of adding a light coining step for reducing or removing the rough texture in selected leadframe zones , especially in the neighborhood of the mold gate areas . in step 803 , the standard machine for off - setting ( depressing chip pads from the sheet plane ) and cutting ( creating leadframe strips ) is enriched by an additional station for planishing . by adding the planishing tool to an existing machine , no extra process step is needed and the planishing step remains low cost . in the planishing process step , the computer - controlled machine positions the leadframe sheet precisely under the planishing tool , which is shaped to impact selected areas of the leadframe on both sides of the sheet . controlled by the computer , the planishing tool impacts the selected area with pre - determined force . process control can verify the planishing result by visual inspection , since the impact changes the optical reflection of the leadframe surface to shiny from matte . the computer - controlled machine for process step 803 may execute the functions of offsetting , planishing , and cutting simultaneously or consecutively . after leadframe strips have been cut from the sheet in step 803 in the next station of the machine , the strips are shipped in step 804 to the next process stations for assembling and packaging semiconductor chips . while this invention has been described in reference to illustrative embodiments , this description is not intended to be construed in a limiting sense . various modifications and combinations of the illustrative embodiments , as well as other embodiments of the invention , will be apparent to persons skilled in the art upon reference to the description . as an example , the invention applies to products using any type of semiconductor chip , discrete or integrated circuit , and the material of the semiconductor chip may comprise silicon , silicon germanium , gallium arsenide , or any other semiconductor or compound material used in integrated circuit manufacturing . as another example , the invention applies to all leadframe - based semiconductor packages . as yet another example , the invention applies to any shape of the planishing tool and to any degree of planishing effect . it is therefore intended that the appended claims encompass any such modifications or embodiment . | 7 |
this example concerns the preparation of six new n - substituted acrylamidines . the method of preparation has been described by fuks in the previously noted article . it consists , firstly , of a synthesis of a complex constituted by tetrachloroferrate of n - isopropylacrylonitrilium referred to hereafter as the &# 34 ; complex ,&# 34 ; according to the probable reaction ## str13 ## in a dry reactor and under nitrogen there is introduced 0 . 4 mole of ferric chloride and 380 cm 3 of chloro - 2 - propane . the mixture is cooled to 0 ° c . under agitation . there is then added dropwise 0 . 4 mole of acrylonitrile in solution in 20 cm 3 of chloro - 2 - propane . the mixture is maintained at 0 ° c . for 30 minutes then it is raised to ambient temperature . a crystallized yellow - green product constituted by the &# 34 ; complex &# 34 ; begins to appear . the chloro - 2 - propane which has not undergone reaction is removed by evaporation under vacuum or by filtration and drying . after this step of synthesis of the &# 34 ; complex &# 34 ; it is subjected to aminolysis according to the probable reaction : ## str14 ## there is added to the &# 34 ; complex &# 34 ; 220 cm 3 of methylene chloride . the mixture is raised to the amination temperature under an inert atmosphere . there is added dropwise 0 . 4 mole of amine in solution in 20 cm 3 of methylene chloride . the mixture is maintained for 1 hour under agitation , the temperature being slightly raised . the solvent is then evaporated under vacuum . the salt of the acrylamidine which is formed is cooled to - 10 ° c . and 1 . 68 mole of a 30 % aqueous solution of sodium hydroxide is added . after agitation , the acrylamidine is extracted by ethylether , heptane or methylene chloride according to the product prepared . the different conditions of preparation and the yields in weight are given hereafter in table 1 . table 1______________________________________ temperature at the beginning of temperature atprepared acryl amination the end of ami - yield in per - amidine ° c . nation ° c . cent by weight______________________________________n , n &# 39 ; isopropyldiethylacryl - - 10 10 67amidinen , n &# 39 ; isopropyl - dibutylacryl - - 10 10 43 . 3amidinen , n &# 39 ; isopropyl - dipentylacryl - 0 20 35amidinen , n &# 39 ; isopropyl - dioctylacryl - 20 30 9 . 4amidinen , n &# 39 ; isopropyl - propyl acryl - - 10 10 32amidinen , n &# 39 ; isopropyl - dioctadecyl - 20 40 0 . 6acrylamidine______________________________________ for n , n &# 39 ; isopropyldioctadecylacrylamidine , the conditions of preparation are slightly different as the starting amine is not soluble in methylene chloride . 0 . 057 moles of dioctadecyl amine in suspension in 150 cm 3 of methylene chloride is added at 20 ° c . to 0 . 05 mole of &# 34 ; complex &# 34 ; dissolved in 50 cm 3 of methylene chloride . the mixture is held at reflux temmperature ( 40 ° c .) for 2 hours then the methylene chloride is evaporated under vacuum . 0 . 024 mole of a 30 % aqueous solution of sodium hydroxide is then added . the acrylamidine is extracted by ethyl ether then purified by recrystallization in acetone . the n - substituted acrylamidines have been characterized by nuclear magnetic resonance and infrared spectrometry . this example concerns the preparation of copolymers of acrylamidines and esters of acrylic and / or methacrylic acids according to the invention . there is introduced in a reactor provided with a system of agitation and cooling , the solvent , the monomers and the initiator . the reactor , maintained under nitrogen atmosphere , is placed in a thermostatic bath . when the selected reaction temperature has been reached , the copolymers are separated from the reaction medium by precipitation in a non - solvent . there is summarized hereafter in table 2 the different parameters of the tests which have been run and in table 3 there is given the properties of the prepared products , namely , the number average molecular weight mn and the percentage by weight of nitrogen . table 2__________________________________________________________________________ concentration in the re - composition action medium in moles of the per liter of tempera - non - solvent third third ture time utilized for mono - acryla - mono - in in the precipi - tests solvent ester acrylamidine mer ester midine mer aibn ° c . hours tation__________________________________________________________________________a methyl n , n &# 39 ; diiso - 3 . 37 0 . 33 0 0 . 0104 60 1 30 volumes propylacry - ofb acrylate lamidine 3 . 87 0 . 05 0 0 . 0103 60 3 . 5 cyclohexanec benzene n , n &# 39 ; triiso - 2 . 12 0 . 10 0 0 . 0062 70 7 for propylacry - volumed methyl lamidine 1 . 43 0 . 31 0 0 . 0062 70 7 of methacry - benzenee late 1 . 83 0 . 13 0 0 . 0062 70 7 solutionf n , n &# 39 ; dii - 1 . 82 0 . 27 0 0 . 0077 80 3 lauryl sopropyl - g toluene methacry - acrylami - 1 . 23 0 . 10 0 0 . 0950 80 1 late dineh 2 . 00 1 . 02 0 0 . 0078 80 3i 1 . 85 0 . 17 0 0 . 0030 80 3 methanol 200j neutral 1 . 34 0 . 22 0 0 . 0085 80 5 base oil n - vi - nylk pyrro - 1 . 82 0 . 14 0 . 14 0 . 0077 80 3 lidone n , n &# 39 ; isopro - l pylphenyl - 1 . 98 1 . 02 0 0 . 0078 80 3m toluene acrylamidine 1 . 82 0 . 27 0 0 . 0150 80 3 n , n &# 39 ; diiso - n toluene mixture 1 propylacryl - ** 0 . 20 0 0 . 0094 80 3 methanol ** amidine n , n &# 39 ; isopro - o pyldiethyl - *** 0 . 16 0 0 . 0074 80 3 mixture 2 acrylamidine *** n , n &# 39 ; isopro - p pylpropyl - *** 0 . 16 0 0 . 0074 80 3 acrylamidine__________________________________________________________________________ ** the mixture 1 has the following composition ( concentration in the reaction medium in moles per liter ): butyl methacrylate 0 . 043 hexyl methacrylate 0 . 073 ethylhexyl methacrylate 0 . 140 lauryl methacrylate 0 . 270 stearyl methacrylate 0 . 540 ethylhexyl methacrylate 0 . 067 *** the mixture 2 has the following composition ( concentration in the reaction medium in moles per liter ): lauryl methacrylate 1 . 030 stearyl methacrylate 0 . 650 stearyl acrylate 0 . 040 table 3______________________________________ properties of the copolymeryield in % by weight of % nitrogentest copolymer mn by weight______________________________________a 16 . 0 105000 1 . 06b 57 . 3 258000 0 . 19c 59 . 0 43000 0 . 26d 32 26000 0 . 22e 48 . 5 42000 0 . 54f 71 . 5 53000 0 . 64g 63 71000 0 . 34h 77 78000 2 . 40i 67 127000 0 . 42j 74 68000 0 . 58k 72 . 5 85000 0 . 41l 35 . 5 170000 1 . 12m 87 . 1 41000 0 . 90n 81 44000 0 . 77o 78 . 6 76000 0 . 06p 86 . 8 75000 0 . 23______________________________________ * 0 . 33 % n comes from acrylamide 0 . 08 % n comes from nvinylpyrrolidone this example concerns tests of viscosity which were effected , on the one hand , on a base oil not containing an additive and , on the other hand , on the same oil to which there has been added a copolymer according to the invention . a 7 . 7 % by weight of the copolymer g prepared in the previous example in added to a 200 neutral base oil . the viscosities at 210 ° f . ( 99 ° c .) and at 100 ° f . ( 37 . 8 ° c .) of the base oil and of the modified oil were measured and their indices of viscosities have been calculated . table 4______________________________________ viscosity at 210 ° f . in at 100 ° f . in index of centistokes centistiokes viscosity______________________________________200 neutraloil 6 , 3 44 100200 neutraloil withadditive g 14 , 95 104 , 65 161______________________________________ this example illustrates the beneficial effect of the copolymers according to the invention as additives in improving the viscosity of the oils . this example concerns a test effected on the base oil 200 n containing 6 . 1 % by weight of copolymer f prepared in example 2 . this oil is subjected to a mechanical shear test on an orbahn injector according to the standard din 50 - 382 . the viscosity of this oil is measured at 210 ° f . before and after testing : the percentage of the drop of the initial viscosity is only 4 . 5 % which is a very good result and shows the stability of the copolymer to the mechanical shear . this example concerns a test intended to show the dispersing and detergent property of the copolymers according to the invention when they are used as additives for lubricating oils . it consists in the determination of the papok index which permits , by means of laboratory test , to evaluate the action at elevated temperatures of these additives in relation to the products of degradation of the base oil and of zinc dithiophosphate base additives . one containing 2 . 5 % by weight of the additive to be tested in a 350 neutral base oil ( the additive is constituted by a solution in the base oil of about 50 % by weight of copolymer ); the other containing 2 . 5 % by weight of zinc dithiophosphate in a 350 neutral base oil . the two solutions are mixed and the limit concentration of zinc dithiophosphate is determined for which there will be no deposit at 210 ° c ., at the end of 30 minutes . the greater the papok index , the greater the dispersant and detergent action of the additive , as the limit concentration of zinc dithiophosphate for which there is no longer a deposit is greater . ( a ) for a commercial control additive t1 , non - dispersing and nondetergent , constituted by polyisobuylene of number average molecular weight equal to 65 . 10 3 and a nitrogen percentage (% n ) equal to 0 ; ( b ) for a commercial control additive t2 , which is dispersing and a detergent , constituted by a copolymer of alkyl methacrylate , alkyl acrylate and a nitrogen monomer for which mn = 67 . 10 3 and % n = 0 . 62 ; ( c ) for the copolymer g prepared in example 2 , for which mn = 71 . 10 3 and % n = 0 . 34 . the papok index i . p ., measured for these three additives is the following : the copolymers according to the invention , therefore have a good dispersing property . this example concerns a motor test adapted to show the stability at high temperature of a lubricating oil to which there has been added , as a multifunctional viscosity additive , the copolymer g according to the invention prepared in example 2 . the same test has been also undertaken by way of comparison with two other commercial additives , t3 and t4 , for improving the viscosity and taken from the family of copolymers of methacrylate and alkyl acrylate . t3 is a non - dispersing additive and t4 is a dispersing and detergent additive . the motor test was effected according to the standard cec l - 02 - a - 69 on a petter w 1 l motor which is a test motor having controlled ignition . a lubricating oil was prepared from an oil to which the same detergents and the same inhibitors were added in the same percentages . this oil was separated into three samples and to these samples were respectively added 7 % by weight of g , 7 % by weight of t3 and 6 . 5 % by weight of t4 . the obtained oils had the same properties at high and low temperature ( category sae 20w50 ), and had the same percentage of drop of initial viscosity ( 6 . 5 %) when they were subjected to the mechanical shear test on the orbahn injector according to the standard din 51 - 382 ( 30 cycles ). the results obtained from the motor tests cec l - 20 - a - 69 are given in table v hereafter : ______________________________________ additiveresults g t3 t4______________________________________freedom of the rings * 10 10 10varnish of the piston lands * 8 . 1 7 . 0 7 . 4piston undercrown 9 . 4 8 . 8 8 . 0total loss in weightof the two half - bearings 31 40 41in mgincrease of viscosityat 100 ° f . in % 25 62 82______________________________________ * the maximum result is equal to 10 this table shows that the performance of the oil to which the copolymer g has been added is excellent and superior to the oil to which t3 and t4 have been added . | 2 |
with reference to fig1 , an exemplary embodiment of a medical ventilator 2 is shown . the medical ventilator 2 has a pneumatic unit 4 for the preparation of a breathing gas . in this present case the pneumatic unit 4 has two gas inlets 6 a , 6 b for the coupling in of two gases , for example oxygen and air . the prepared breathing gas is carried toward a patient 8 via an inspiration line 10 during inspiration and away from the patient 8 via an expiration line 12 during expiration . the medical ventilator 2 further has a control unit 14 for regulation and control of the pneumatic unit 4 and a user interface 16 according to the invention , through which an operator can enter suitable target values for the treatment of the patient 8 . the user interface 16 in this embodiment has an interactive screen 18 . to increase safety against unwanted changes or settings a function switch 20 may be included . interactive measures between the operator and screen 18 then are permitted only after activation of the function switch 20 . in fig2 the interactive screen 18 is shown more clearly . a memory unit 22 connected to the screen 18 is also shown . the memory unit 22 is also connected to the control unit 14 in fig1 ( not shown in the fig2 ). the function parameters for the ventilation mode which shall be applied to the patient 8 are stored in the memory unit 22 . these include , among other things , ventilation mode , target values for one or more of the parameters : pressure , flow , tidal volume , inspiration time and expiration time , etc . other parameters may also be found , such as composition of the breathing gas , etc . the interactive screen 18 of the foregoing exemplary embodiment can be modified by means of a pointer device 24 . the pointer device 24 is not essential but does allow a more precise revision of the screen contents than does the use of a finger . a coordinate system 26 is drawn on the screen 18 as a graphic representation of the actual ventilation mode ( corresponding target values in memory unit 22 ). the x - axis represents pressure and the y - axis represents volume . a curve 28 is displayed in the coordinate system 26 . the curve 28 represents a breathing cycle ( inspiration 30 and expiration 32 ). when programming a ventilator mode , the pointer device 24 ( or a finger ) may select one mode from a mode list 34 on the screen . other ways of selecting a mode are also feasible , for instance by pointing at the relevant axis ( pressure or volume ) to select a mode having the relevant parameter as control parameter — for instance , pointing at the pressure axis may be used to select one of pressure control ( pc ), pressure support ( ps ), volume support ( vs ), pressure regulated volume control ( prvc ), continuous positive airway pressure ( cpap ) and pointing at the volume axis may be used to select one of volume control ( vc ), synchronized intermittent mandatory ventilation ( simv ), etc . the axes can be highlighted in different colors to indicate which mode that presently is set . a selected mode may be verified via an accept button or key 36 on the screen . other ways of accepting inputs can also be utilized . once the mode is selected , parameters have to be set or determined , for instance positive end expiratory pressure ( peep ), peak inspiratory pressure ( pip ), maximum allowed overpressure , etc . the parameters that can be set can be highlighted as lines 38 in the graph 26 with default values set in the memory 22 for each ventilator mode . these lines can be displayed with different colors . the user ( physician or other permissible user ) may then adapt the settings for the present patient by moving the line 38 for each parameter ( using the pointer device 24 or a finger ). actual values can easily be read from a numeric information field 40 . pressing accept button 36 again sets the altered values for the parameters and stores these in the memory unit 22 as target values . the screen 18 will also display actual measured values during the treatment with the selected ventilation mode . by overwriting the previous curve in a different color or lighting , the physician can easily follow any short term trend or change in the respiratory pattern . by successively dimming two or three previous breaths , the physician will get a better control over minute changes than any time based separate display of pressure and volume . a trend curve can also be displayed on the screen . the trend curve could be displayed in a different color as a background curve and can comprise the average of a certain number of preceding breaths or over a specific time , e . g . one minute . should the measured values move outside target values , the set outer limits can successively be highlighted ( possibly simultaneously with the sounding of audible alarms ). the physician may then quickly spot which parameter is out of order and quickly take control over the situation . some possible functions that can be implemented in the user interface according to the invention are displayed in fig3 to 5 and described below . the essence of the invention , however , resides in the basic use of the volume - pressure graph as a tool for displaying respiratory curves and inputting target values or other programming . thus , in fig3 , entering trigger levels for breaths is indicated . numerals for the graph 26 and accept knob 36 are maintained as they can be identical to the above . a respiration curve 42 is displayed . in order to allow a patient to initiate inspiration phases , trigger values are set . in this case the triggering is based on both pressure and flow . pressure value for triggering can be set via a first flag 44 and flow value via a second flag 46 ( here , “ flag ” indicates the combination of a line and numeric information field ). instead of flow , a trigger volume could be set . fig4 shows an example of display for a volume control mode . a curve 48 is displayed in the graph 26 . the aim in volume control is to achieve a constant tidal volume for each breath ( provided with a constant flow of respiratory gas ). the main settings here are the tidal volume as represented by tidal volume flag 50 and peep as represented by peep flag 52 . further , a maximum pressure can also be set , here represented by overpressure flag 54 . as mentioned above , parameters related to the mode itself can be displayed in a different color . in this case , tidal volume flag 50 and peep flag 52 would be displayed in different colors than overpressure flag 54 ( which relates to safety rather that regulation of the set mode ). once all parameters are set in accordance with the physician &# 39 ; s wishes , accept button 36 can be used to store the set mode ( alternately , the user interface can be made such that each set value must be verified before entering the next parameter value ). fig5 shows an example of a display when pressure control is set . respiration curve 56 represents pressure control . here , peep is set via peep flag 52 , peak pressure is set via a pip flag 58 and maximum allowed pressure is set via overpressure flag 54 . a minimum value for tidal volume ( or minute volume ) can be set on the volume axis via minimum tidal volume flag 60 . actual measured values could be displayed in information fields in the area of the graph that displays the curve 56 ( whereas all information fields for set parameters are placed on the other side of respective axis ). in this case , actual tidal volume ( and / or minute volume ) is displayed by information flag 62 ( similar information can be used for pressures as well , as indicated in the figure by dashed lines ). other features not explicitly mentioned above are well known and can be included or can replace certain nonessential features . for instance , numeric display on the volume axis can display current flow value or a small flow curve can be displayed instead . all breathing apparatus for medical use are included in the context of medical ventilator used in the present application . accordingly , respirators or ventilators for intensive care , anesthetic apparatus , respirators or ventilators for sub - acute , respirators or ventilators for home care , etc ., are all included . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art . | 0 |
the presently disclosed subject matter now will be described more fully hereinafter with reference to the accompanying drawings , in which some , but not all embodiments are shown . indeed , this invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will satisfy applicable legal requirements . like numbers refer to like elements throughout . a device for use with a drain is illustrated in fig1 through 4 and is generally designated 10 . the device 10 is configured for being received within a floor drain 1 . the device includes a basket assembly 12 containing a treatment material 14 therein . as used herein , basket assembly may refer to any assembly , device , or structure capable of carrying or containing a treatment material the treatment material 14 may be a generally solid or liquid material additionally , the treatment material 14 may be a liquid - soluble material configured to release aromatic treatment when dissolved or dissipated with liquid . as used herein , liquid - soluble includes any material in which the passage - by or pass - through of liquid causes some material change or reaction to occur . for example , liquid - soluble may refer to a material that is at least liquid - dispersible . furthermore , liquid - soluble may also describe the condition in which the liquid that passes by or through the aromatic material carries the dissolved liquid - soluble material the treatment material 14 may contain anti - bacterial or other sanitizing characteristics . the treatment material 14 may be a bacterial or enzyme treatment that is configured for destroying odor - causing microorganisms and the like that may be found in drains . the treatment material 14 may include a bioactive agent that produces enzymes that digest collected grease and oil . the treatment material 14 may include materials that are insecticidal in nature and repel and kill insects . in other embodiments , the basket assembly 12 may contain some medium that may or may not be liquid - soluble , including , for example , a sponge soaked in an appropriate chemical . in other embodiments , the treatment material 14 may be a liquid - soluble treatment material configured to emit a desired aroma when liquid flows about the material . the basket assembly 12 may include a plurality of openings 13 , such as , for example the slots shown throughout the drawings . the basket assembly 12 may be generally concentric with the drain opening 3 when installed thereon . the treatment material 14 is configured such that when liquid , which may be liquid waste - water , grease , oil , or any other liquid that is poured down a drain , passes into the openings 13 and through the treatment material 14 , the treatment material 14 releases an aroma to mask any odor emanating from the drain 1 . the device 10 includes a drain cover skirt 16 . the drain cover skirt 16 may define an opening 20 that receives and carries the basket assembly 12 . in this manner , the drain cover skirt 16 and basket assembly 12 may be integrally formed . the drain cover skirt 16 may further define a plurality of openings 18 that allow flow of liquid therethrough . a basket assembly lid 22 is provided for engaging with the opening 20 . the basket assembly lid 22 defines at least one aperture 24 for allowing flow of liquid into the basket assembly 12 . the basket assembly 12 may include a flange 26 for cooperatively engaging a recess 30 that is defined in the drain cover skirt 16 to thereby engage the lid 22 with the drain cover skirt 16 . the basket assembly lid 22 may be further configured for engagement with the drain cover skirt 16 by other appropriate manners . for example , a hook 32 carried by the drain cover skirt 16 may be further configured for engaging the flange 26 and extending into a recess 33 defined in the lid 22 . the hook 32 may be configured for rotatable movement or pivotable movement about the drain cover skirt 16 such that the hook 32 can be selectively engaged therewith . the hook 32 may be rotated or pivoted out ofthe way by inserting an elongate object such as a screwdriver or blade into the gap defined between the hook 32 and basket lid 22 and pressing the hook 32 into an unobstructed position . installation of the device 10 is accomplished by fastening the drain cover skirt 16 to a supporting floor surface 2 . the drain 1 should be aligned with the opening 20 ofthe drain cover skirt 16 such that the basket assembly 12 may be received within the drain 1 . the drain cover skirt 16 may be fastened to the supporting floor surface 2 by the use of a threaded fastener , such as a screw , though in other embodiments , any appropriate fastener may be used . the treatment material 14 is then placed into the basket assembly 12 . the treatment material 14 may occupy substantially all or only a portion of the basket assembly 12 when installed . the lid 22 is then engaged with the drain cover skirt 16 . in the one or more embodiments illustrated in fig1 , this is accomplished by engaging the flange 26 with the recess 30 . in the one or more embodiments of fig4 , this may include rotating or pivoting the hook 32 until the flange 26 is in engagement therewith . to replace a spent treatment material 14 , the lid 22 is disengaged from the drain cover skirt 16 , the treatment material 14 is replaced , and the lid 22 is then re - engaged with the drain cover skirt 16 . a device according to one or more embodiments is illustrated in fig5 through 8 and is generally designated 110 . the device 110 is similar in many respects to the device 10 illustrated in fig1 through 4 and shares many of the same aspects . the device is configured for being received within a floor drain 1 . the device 110 also includes a drain cover skirt 116 . the drain cover skirt 116 may define an opening 120 that receives a basket assembly 112 . the drain cover skirt 116 may further define a plurality of openings 118 that allow flow of liquid therethrough . the basket assembly 112 may contain treatment material 14 therein . alternatively , any desired material may be placed in the basket assembly 112 . the basket assembly 112 may include a plurality of openings 113 , such as , for example , the slots shown throughout the drawings . the plurality of openings 113 allow liquid to , flow there - through and into the drain 1 . a basket assembly lid 122 is provided for engaging with the opening 120 and is carried by the basket assembly 112 . the basket assembly lid 122 may define at least one aperture 124 for allowing flow of liquid into the basket assembly 112 . the basket assembly 112 may include a flange 126 for cooperatively engaging a recess 130 that is defined in the drain cover skirt 116 to thereby engage the lid 122 and the basket assembly 112 with the drain cover skirt 116 . the one or more embodiments illustrated in fig5 through 8 may differ from the one or more embodiments illustrated in fig1 through 4 in that the basket assembly 112 may be replaced when the treatment material or other material contained therein needs replacing . the basket assembly 122 may be further configured for engagement with the drain cover skirt 116 by other appropriate manners . for example , a hook 132 carried by the drain cover skirt 116 may be further configured for engaging the flange 126 and extending into a recess 133 defined in the lid 122 . the hook 132 may be configured for rotatable movement or pivotable movement about the drain cover skirt 116 such that the hook 132 can be selectively engaged . the hook 132 may be rotated or pivoted out of the way by inserting an elongate object such as a screwdriver or blade into the gap defined between the hook 132 and basket lid 122 and pressing the hook 132 into an unobstructed position . installation of the device 110 is accomplished by fastening the drain cover skirt 116 to a supporting floor surface 2 as illustrated in fig5 . the drain 1 should be aligned with the opening 120 of the drain cover skirt 116 such that the basket assembly 112 may be received within the drain 1 . the drain cover skirt 116 may be fastened to the supporting floor surface 2 by the use of a threaded fastener , such as a screw , though in other embodiments , any appropriate fastener may be used . the treatment material may occupy substantially all or only a portion of the basket assembly 112 when installed . the basket assembly 112 is then lowered into the drain 1 until the lid 122 is in general alignment with the drain cover skirt 116 . the lid 122 is then engaged with the drain cover skirt 116 by engaging the flange 126 of the lid 122 with the recess 130 of the cover skirt 116 thereby securing the basket assembly 112 into the drain 1 . this may be accomplished by bending or flexing of the basket 122 until the flange 126 can be engaged in the recess 1230 . in the one or more embodiments illustrated in fig8 , this may include rotating or pivoting the hook 132 until the flange 126 is in engagement therewith . the basket assemblies 12 and 112 are shown as having a generally cylindrical or frusto - conical shape , though in one or more embodiments , may have a specially configured shape . in this manner , only similarly shaped treatment material could be placed in the basket assemblies 12 and 112 . for example , the basket assemblies 12 and 112 could have an “ a ” or “ v ” shape . in this example , the treatment material would need to have a corresponding “ a ” or “ v ” shape in order to be placed into the basket assemblies 12 and 112 . this may be important to ensure that proper and authorized treatment materials are utilized with the devices disclosed herein . one or more embodiments sharing many features and elements as the one or more embodiments illustrated in fig1 through 8 are illustrated in fig9 through 15 . as illustrated in fig9 , the device 210 may include an assembly 212 containing a first material 214 and a second material 215 that is adhered thereto . in one or more embodiments , the first material 214 may be an aromatic material and the second material 215 may be a pesticide material . in one or more embodiments , one of the first material 214 and the second material 215 may also include a degreaser for aiding in preventing drain clogs . the portion of the assembly 212 may include a plurality of catches 217 that are configured for aiding in adhering the first material 214 and the second material 215 thereto . the assembly 212 is configured for being received within an opening 220 of a drain cover skirt 216 . the drain cover skirt 216 may include one or more apertures 218 that allow flow - through of liquid into the drain assembly 1 . the drain assembly 1 may include a tab 4 that is configured for receiving a threaded fastener for securing the drain cover skirt 216 thereto . the assembly 212 may include a snap arm assembly 213 that is configured for allowing placement of the assembly 213 into the opening 220 and engaging a slot 233 formed in the drain cover skirt 216 . removal of the assembly 212 is effectuated by pressing the snap assemblies 213 inward so that that the assemblies 213 are no longer in interference with the drain cover skirt 216 . subsequent pulling upward on the assembly 212 until assembly 212 is no longer in engagement with the drain cover skirt 216 completes removal . as illustrated in fig1 , a device 310 may include an assembly 312 containing a first material 314 and a second material 315 that is adhered to a portion of the assembly 312 . each ofthe first material 314 and second material 315 may be one o f any desired material , including an aromatic material , a pesticide , a degreasing material , an enzyme material , and the like . one or more catches 317 may be provided for engaging with the first material 314 and second material 315 . the assembly 312 is configured for being received within an opening 320 of a drain cover skirt 316 . the drain cover skirt 316 may include one or more apertures 318 that allow flow - through of liquid into the drain assembly 1 . the assembly 312 may include a snap arm assembly 313 that is configured for allowing placement of the assembly 312 into the opening 320 and engaging a slot 333 formed in the drain cover skirt 316 . removal of the assembly 312 is effectuated by pressing the snap assemblies 313 inward so that that are no longer in interference with the drain cover skirt 316 and pulling upward on the assembly 312 until the assembly 312 is no longer in engagement with the drain cover skirt 316 . as illustrated in fig1 , a device 410 for use with a drain 1 is provided . the device 410 may include an assembly 412 containing a first treatment material 414 and a second treatment material 415 that is adhered to a portion ofthe assembly 412 . each of the first material 414 and second material 415 may be one of any desired material , including an aromatic material , a pesticide , a degreasing material , an enzyme material , and the like . the assembly 412 is configured for being received within an opening 420 ofthe drain cover skirt 416 . the drain cover skirt 416 may include one or more apertures 418 that allow flow - through of liquid into the drain assembly 1 . the assembly 412 may include a shoulder assembly 421 that is configured for being received within a slot 422 defined by a panel 423 hingedly connected to the drain cover skirt 416 . in this manner , removal of the shoulder assembly 421 , first material 414 , and second material 415 is carried out by rotating the panel 423 away from the drain cover skirt 416 , and sliding the shoulder assembly 421 away from the slot 422 . installation and replacement of a spent first material 414 and second material 415 is accomplished by replacing the shoulder assembly 421 having an unspent first material 414 and second material 415 carried thereby with an unspent shoulder assembly . as illustrated in fig1 , a device 510 for use with a drain 1 is provided . the device 510 may include an assembly 512 containing a first material 514 and a second material 515 that is adhered to a portion ofthe assembly 512 . each of the first material 515 and second material 515 may be one of any desired material , including an aromatic material , a pesticide , a degreasing material , enzyme material , and the like . the assembly 512 is configured for being received within an opening 520 of the drain cover skirt 516 . the drain cover skirt 516 may include one or more apertures 518 that allow flow - through of liquid into the drain assembly 1 . the assembly 512 may include a shoulder assembly 521 that is configured for being received within a slot 522 carried by a panel 523 hingedly connected to the drain cover skirt 516 . in this manner , removalo f the shoulder assembly 521 , first material 515 , and second material 515 is carried out by rotating the pane 1523 away from the drain cover skirt 516 , and sliding the shoulder assembly 521 away from the slot 522 . installation and replacement of a spent first material 515 and second material 515 is accomplished by replacing the shoulder assembly 521 with a shoulder assembly 521 having unspent first material 515 and second material 515 . the panel 523 may be configured to close against and engage the cover skirt 516 by any appropriate manner , including fasteners , detents , and the like . as illustrated in fig1 , a device 610 for use with a floor drain 1 is provided . the device 610 may include a basket assembly 612 containing a material therein . the material 614 may be one of an aromatic material , pesticide material , degreaser material , enzyme material , and the like . the basket assembly 612 is configured for being received within an opening 620 ofthe drain cover skirt 616 . the drain cover skirt 616 may include one or more apertures 618 that allow flow - through of liquid into the drain assembly 1 . the basket assembly 612 may include a snap arm assembly 613 that is configured for allowing placement of the basket assembly 612 into the opening 620 and engaging a slot 633 formed in the drain cover skirt 616 . removal of the basket assembly 612 is effectuated by pressing the snap assemblies 613 inward so that that are no longer in interference with the drain cover skirt 616 and pulling upward on the basket assembly 612 until no longer in engagement with the drain cover skirt 616 . as illustrated in fig1 , a device 710 for use with a floor drain 1 is provided . the device 710 may include a basket assembly 712 containing a material therein . the material 714 may be one of an aromatic material , pesticide material , degreaser material , enzyme material , and the like . the basket assembly 712 is configured for being received within an opening 720 ofthe drain cover skirt 716 . the drain cover skirt 716 may include one or more apertures 718 that allow flow - through of liquid into the drain assembly 1 . the basket assembly 712 may include a snap arm assembly 713 that is configured for allowing placement of the basket assembly 712 into the opening 720 and engaging a slot 733 formed in the drain cover skirt 716 . removal of the basket assembly 712 is effectuated by pressing the snap assemblies 713 inward so that that are no longer in interference with the drain cover skirt 717 and pulling upward on the basket assembly 712 until no longer in engagement with the drain cover skirt 716 . as illustrated in fig1 , a device 810 for use with a floor drain 1 is provided . in fig1 , the device 810 is shown in a cross - sectional view . the device 810 may include a basket assembly 812 that includes a first vessel 840 and a second vessel 842 . each ofthe first vessel 840 and second vessel 842 may contain a material therein , and may include the same or different materials . the material may be one of an aromatic material , pesticide material , degreaser material , enzyme material , and the like . the basket assembly 812 is configured for being received within an opening 820 of the drain cover skirt 816 . the drain cover skirt 816 may include one or more apertures 818 that allow flow - through of liquid into the drain assembly 1 . the basket assembly 812 may include a snap arm assembly 813 that is configured for allowing placement of the basket assembly 812 into the opening 820 and engaging a slot 833 formed in the drain cover skirt 816 . removal of the basket assembly 812 is effectuated by pressing the snap assemblies 813 inward so that that are no longer in interference with the drain cover skirt 816 and pulling upward on the basket assembly 812 until no longer in engagement with the drain cover skirt 816 . a support 844 may be provided that spans across the drain cover opening 820 for providing support to the drain cover skirt 816 . in this manner , the support 844 may be provided such that the portion of the basket assembly 812 defined about the intersection of the first vessel 840 and the second vessel 842 rests thereon when the basket 812 is installed within the drain cover skirt 816 . in one or more embodiments , the one or more devices disclosed herein may provide for a lid or base portion ofthe basket assembly that may be selectively removable such that the treatment material may be replaced . alternatively , the basket assembly may be integrally formed such that only by replacing the basket assembly that has new treatment material therein can the basket be “ refilled .” in one or more embodiments , the basket assembly may also take on a two - part assembly such that the basket assembly may be selectively disassembled at about any of a medial portion thereof . additionally , in one or more embodiments , the one or more basket assemblies disclosed herein have been illustrated with a fastener extending therefrom . in one or more embodiments , the skirt cover may define a fastener for engaging with the one or more basket assemblies . as illustrated in fig1 a , 16 b , and 16 c , a tool 50 may be provided for engaging with any of the basket assemblies and snap arm assemblies disclosed herein . for purposes of illustration only , the tool 50 is shown interacting with basket assembly 812 and snap arm assembly 813 . the tool 50 is configured for moving the snap arm assembly 813 from a first position in which the arm assembly 813 is in engagement with the drain cover skirt 818 and a second position in which the arm assembly 813 is free of the drain cover skirt 818 . the tool 50 may include one or more openings 52 that may be provided for receiving an operator &# 39 ; s fingers . additionally , the tool 50 may include shoulders 54 that are configured for extending into the drain cover assembly 818 through openings 824 and engaging the snap arm assembly 813 to move the assembly from the first position in which the snap arm assembly 813 is in engagement with the drain cover skirt 818 and a second position in which the snap arm assembly 813 is free of the drain cover skirt 818 . one or more hooks 56 may also be provided for extending into and engaging the basket assembly 812 . in this manner , the hooks 56 will pull upward on the basket assembly 812 when the operator pulls the tool 50 upwards away from the drain . the tool 50 may be sufficiently resilient such that any bending , flexing , or other resiliency necessary for the tool to operate is provided . the tool may define planar nesting surface 58 that is configured for nesting with a top portion of the basket assembly 812 . the tool 50 may be provided with the one or more devices disclosed herein as a kit . one or more embodiments of a device for use with a floor drain are illustrated in fig1 in which an apparatus 60 is provided for engagement with the one or more basket assemblies disclosed herein . for purposes of illustration only , the basket assembly is illustrated as basket assembly 112 . the apparatus 60 includes a fluid spraying device 62 , such as a mister . a housing 64 may define a chamber for holding appropriate fluid to be sprayed , such as an aromatic material . a fan 66 may be provided extending from the housing for providing air movement of the fluid being sprayed . a battery or other energy storage may be additionally provided for powering the fan 66 . one or more alternate embodiments of a device for use with a floor drain are illustrated in fig1 in which an adaptor cover skirt 70 having a first skirt material is provided for use with the one or more basket assemblies disclosed herein . for purposes of illustration only , the basket assembly is illustrated as basket assembly 612 . the adaptor skirt 70 is provided for using square shaped drain assemblies as illustrated in fig1 with the one or more basket assemblies disclosed herein . the adaptor skirt 70 defines a void or cutout 72 , which may be a square as illustrated in fig1 . the void 72 is configured for receiving a skirt cover plate 74 that defines a second skirt material . the skirt cover plate 74 defines an opening therein for receiving the basket assembly 612 . the skirt cover plate 74 is configured , along with adaptor skirt 70 , to have varying sizes in order to accommodate drains of varying sizes , shapes , and configurations . one or more devices are illustrated in fig1 a , fig1 b , and fig1 c that are configured for being used with a drain assembly according to one or more embodiments disclosed herein . the one or more devices are generally depicted as 910 . the device 910 includes an insert cover skirt 912 that has one or more fasteners , illustrated as pegs 914 in fig1 a , 19 b , and 19 c , extending therefrom . the one or more pegs 914 may include one or more detents 916 on an end thereof the insert cover 912 may include one or more openings 918 for allowing from through of liquid . the insert cover 912 is configured for being received by a conventional drain skirt , illustrated as 920 . the pegs 914 are configured for extending into openings 922 defined in the conventional drain skirt such that the insert cover can nestably engage with the conventional drain skirt 920 . the detents 916 may be provided for maintaining the insert cover 912 with the drain skirt 920 and may be formed from a resilient material for releasable engagement as desired by the operator . in one or more embodiments disclosed herein , the insert cover 912 may be fabricated with an injection molding process that includes injecting fragrance , aromatic material , or other desired material into the molding material . in this manner , the insert cover 912 may have a pleasing fragrance and may be installed as shown in fig1 c to mask odors emanating from the drain assembly 1 . in one or more embodiments disclosed herein , any ofthe devices herein may be fabricated with an injection molding process that includes injecting fragrance , aromatic material , or other desired material into the molding material . in this manner , the one or more devices herein may have a pleasing fragrance and may be installed to mask odors emanating from the drain assembly 1 . while the embodiments have been described in connection with the preferred embodiments of the various figures , it is to be understood that other similar embodiments may be used or modifications and additions may be made to the described embodiment for performing the same function without deviating therefrom . therefore , the disclosed embodiments should not be limited to any single embodiment , but rather should be construed in breadth and scope in accordance with the appended claims . | 8 |
referring to fig1 , there is shown an endotracheal tube 10 having a connector 12 for connection to a conventional ventilator to assist a patient &# 39 ; s breathing function . the endotracheal tube includes an inflatable balloon 14 in proximity to its distal end 16 . the inflatable balloon is inflated by a tube 18 connected through a connector 20 to a small syringe - like air pump after the endotracheal tube has been inserted into a patient &# 39 ; s trachea . prior endotracheal tubes do not permit any visualization of a patient &# 39 ; s tracheal and bronchial passages . if such visualization is needed , connector 12 is disconnected from the ventilator and a conventional bronchoscope is inserted down through hollow passage 21 of the endotracheal tube to allow a physician to determine if a lot of mucus is present in either lung or in either of the left or right stem main bronchi . if it is necessary to suction mucus out of either of the patient &# 39 ; s lungs , a suctioning tube is inserted through hollow passage 21 . the endotracheal tube may have to be disconnected from the ventilator to allow visualization in the trachea of the lungs or to allow suctioning of the mucus , blood , etc ., if the endotracheal tube does not have a sealable side port through which the suctioning tube can be inserted . when a skilled physician , often a pulmonologist , inserts an endotracheal tube into a patient , it would be desirable for a nurse to be able to easily monitor the position of the endotracheal tube in a patient &# 39 ; s trachea to determine if its location has been shifted . if so , the nurse would know whether to call a physician to reposition the tracheal tube . it would also be desirable to determine accurately the position of the tracheal tube without requiring an x - ray of the patient . still referring to fig1 , endotracheal tube 10 includes an optical fiber , hereinafter referred to as fiber optic bundle 22 , that extends through the tracheal tube to a viewing lens 24 at distal end 16 . the fiber optic bundle can be an inexpensive plastic optical fiber costing only a few dollars and embedded in the wall of the tracheal tube . the fiber optic bundle is operatively connected to a connector 26 which includes two prongs 28 , 30 of which prong 28 carries the fiber optic bundle . a second plastic optical fiber , hereinafter referred to as fiber optic bundle 32 , extends through wall 34 of endotracheal tube 10 to an illumination port 36 at distal end 16 . fig2 is a view of the distal end of tracheal tube 10 . a hollow tube 38 extends from a flushing inlet port connector 40 ( see fig1 ) and extends through the endotracheal tube so that a transparent saline flushing liquid can be forced through the tube to wash mucus away from viewing lens 24 and illumination port 36 . such mucus may collect thereon during insertion of the tracheal tube into the patient &# 39 ; s trachea or afterward . one major advantage of endotracheal tube 10 is that the carina ( a cartilaginous structure ) 42 ( see fig3 ) can be easily viewed during insertion of the endotracheal tube so that a nurse or a physician can readily determine how far into the patient &# 39 ; s trachea to properly insert the endotracheal tube . this avoids the need for an x - ray process to determine if the endotracheal tube is properly inserted . as the endotracheal tube can become malpositioned in the patient and which would normally require a later x - ray to check for proper placement , direct visualization afforded by the present invention can avoid the need for such a repeat x - ray . another advantage is that the nurse or physician can easily view the conditions in branches 44 , 46 of trachea 48 to determine the presence of mucus or other condition and to determine whether there is a need for immediate suctioning of mucus , blood , etc ., from either lung or the passages thereto . referring to fig4 , there is shown a male connector 26 having prongs 28 , 30 extending therefrom . fiber optic bundle 32 is in functional and operative engagement with prong 28 to transmit light from the end of the prong to illumination port 36 at distal end 16 of the endotracheal tube . fiber optic bundle 22 is coupled with lens 24 at the distal end of the endotracheal tube to transmit light , that is an image , to the end of prong 30 . as illustrated , fiber optic bundles 22 and 32 may be incased within a sheath 60 . a removable module 70 includes a female connector 72 for receiving prongs 28 , 30 of connector 26 . upon mating of connectors 26 , 72 , fiber optic bundle 32 within prong 28 is placed in communication with fiber optic bundle 74 , the latter being in communication with and receiving light from light emitting diodes 76 . electrical power for the light emitting diodes is provided by circuit 80 connected to batteries 78 . prong 30 of male connector 26 mates with female connector 72 to transmit light , that is , the image visible through lens 24 ( see endotracheal tube 10 ) to convey the received light through a further fiber optic bundle 82 to a lens system 83 . the lens system is interconnected with a small sized and relatively inexpensive electronic camera 84 . cameras suitable for this purpose cost less than $ 100 . 00 and can be found for less than $ 50 . 00 from commercial outlets . the camera is interconnected with a low power radio frequency transmitter 86 to transmit the images recorded by the camera . transmitters of this type are readily available for less than $ 100 . 00 and may be found for less than $ 50 . 00 from commercial outlets . as shown in fig5 , an antenna 90 is connected to a radio frequency receiver 92 and receives the images detected by camera 84 and transmitted by transmitter 86 . the received image is conveyed via an electrical conductor or cord 94 to a video monitor 96 . the video monitor includes a screen 98 for displaying the image recorded by camera 84 . as illustrated , a power supply provides power to receiver 92 and to video monitor 96 through an electrical conductor 102 . power to the power supply may be provided by a conventional plug 104 for engagement with a conventional wall socket . in summary , the image conveyed from the lens at the distal end of the endotracheal tube is digitalized and recorded by a camera . the image recorded by the camera is displayed real time on a video monitor through a wireless interconnection . the ease of a wireless transmission system in the confines of an operatory avoids the likelihood of a patient and an attending health care provider from becoming entangled with cords and wires . moreover , presently used wires and cables extending to a video monitor creates a hazard of an attending health care provider inadvertently interfering with such wires and / or cables and causing repositioning or pulling our of the endotracheal tube . this hazard is completely avoided by the present invention due to the absence of such wires and / or cables . | 0 |
the present invention will be further illustrated by the following examples , it should be noted that the examples are not the limitations for the extent of protection of the present invention . polyisocyanate 1 ( wannate ht - 100 , wanhua , ningbo , polyisocyanates based on hdi , isocyanate groups content of 21 . 5 - 22 . 5 wt %, the average functionality of 3 . 3 - 3 . 8 ); polyisocyanate 2 ( bayer nz1 , polyisocyanate based on hdi and ipdi , isocyanate groups content of 20 wt %, the average functionality of 3 . 3 - 3 . 5 ); 4 -( cyclohexyl amino )- butane sulfonic acid : cyclohexylamine and 1 , 4 - butyl sultone , corresponding to an equivalent molar ratio of 3 : 1 , are admixed to dioxane solvent , and then react at 80 ° c . for 6 h , solids are obtained by washing with acetone until becoming white ( for example , see us2007010573 a1 ); 4 -( cyclohexylmethylamino )- butane sulfonic acid : it is prepared by cyclohexanemethylamine and 1 , 4 - butyl sultone according to the above method ; 4 -( p - methyl cyclohexylamino )- butane sulfonic acid : it is prepared by p - methyl cyclohexaneamine and 1 , 4 - butyl sultone according to the above method ; 4 -( cycloheptyl )- butane sulfonic acid : it is prepared by cycloheptane and 1 , 4 - butyl sultone according to the above method ; 3 -( cyclohexylmethylamino )- propane sulfonic acid : it is prepared by cyclohexylmethylamine and 1 , 3 - propane sultone according to the above method ; 3 -( p - methyl cyclohexyl amino )- propane sulfonic acid : it is prepared by p - methyl cyclohexylamine and 1 , 3 - propane sultone according to the above method ; 3 -( 3 , 3 , 5 - trimethyl cyclohexyl amino )- propane sulfonic acid : it is prepared by 3 , 3 , 5 - trimethyl cyclohexyl amine and 1 , 3 - propane sultone according to the above method ; 3 -( cyclohexyl amino )- 2 - methyl - 1 - propane sulfonic acid : it is prepared by cyclohexyl amine and 1 , 3 - butyl sulfone according to the above method ; 3 -( cyclohexyl methyl amino )- 2 - methyl - 1 - propane sulfonic acid : it is prepared by cyclohexyl methyl amine and 1 , 3 - butyl sulfone according to the above method ; monohydric polyether that comprises ethoxy units ( gep - 105 , wan hua rong wei , molecular weight of 500 - 600 , an average hydroxyl value of 100 - 110mg koh / g , the number of ethoxyl units of 11 - 13 ); please be noticed that the following examples are only used to testify the present invention but not to limit the invention . unless otherwise defined , all the percentages relate to weight percentages . in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine were added to 133 g polyisocyanate 1 ( 0 . 70 mol ). the reaction lasted for 5 h at 100 ° c . then 57 g ( 0 . 29 mol ) polyisocyanate 1 was added and mixed homogeneously . after cooling to room temperature , the polyisocyanates modified with sulphamic acid with the following characteristic data is obtained : in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine were added to 95 g polyisocyanate 1 ( 0 . 50 mol ). the reaction lasted for 3 h at 100 ° c . then 95 g ( 0 . 50 mol ) polyisocyanate 1 was added and mixed homogeneously . after cooling to room temperature , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 2 g ( 0 . 008 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 1 . 08 g ( 0 . 008 mol ) dimethyl cyclohexylamine were added to 138 g polyisocyanate 1 ( 0 . 73 mol ). the reaction lasted for 5 h at 100 ° c . then 60 g ( 0 . 32 mol ) polyisocyanate 1 was added and mixed homogeneously . after cooling to room temperature , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 20 g ( 0 . 084 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 10 . 8 g ( 0 . 084 mol ) dimethyl cyclohexylamine were added to 126 g polyisocyanate 1 ( 0 . 69 mol ). the reaction lasted for 5 h at 100 ° c . then 54 g ( 0 . 30 mol ) polyisocyanate 1 was added and mixed homogeneously . after cooling to room temperature , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine , 22 . 8 g ( 0 . 041 mol ) monohydric polyether gep - 105 were added to 133 g polyisocyanate 1 ( 0 . 70 mol ) . the reaction lasted for 5 h at 100 ° c . then 57 g ( 0 . 29 mol ) polyisocyanate 1 was added and mixed homogeneously . after cooling to room temperature , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine , 28 g ( 0 . 050 mol ) monohydric polyether gep - 105 were added to 133 g polyisocyanate 1 ( 0 . 70 mol ) . the reaction lasted for 5 h at 100 ° c . then 57 g ( 0 . 29 mol ) polyisocyanate 1 was added and mixed homogeneously . after cooling to room temperature , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 084 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 5 . 4 g ( 0 . 084 mol ) dimethyl cyclohexylamine , 51 . 4 g propylene glycol methyl ether acetate were added to 133 g polyisocyanate 1 ( 0 . 90 mol ) . the reaction lasted for 3 h at 100 ° c . then 57 g ( 0 . 29 mol ) polyisocyanate 1 was added and mixed homogeneously . after cooling to room temperature , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 084 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 5 . 4 g ( 0 . 084 mol ) dimethyl cyclohexylamine were added to 133 g polyisocyanate 2 ( 0 . 63 mol ) . the reaction lasted for 3 h at 100 ° c . then 57 g ( 0 . 27 mol ) polyisocyanate 2 was added and mixed homogeneously . after cooling to room temperature , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 10 g ( 0 . 042 mol ) 3 -( cyclohexyl methyl amino )- propanesulfonic acid was applied to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid in example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 10 g ( 0 . 042 mol ) 3 -( p - methyl cyclohexyl amino )- propanesulfonic acid was used to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid in example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 10 g ( 0 . 038 mol ) 3 -( 3 , 3 , 5 - trimethyl cyclohexyl amino )- propanesulfonic acid and 4 . 8 g ( 0 . 038 mol ) dimethyl cyclohexylamine were used to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid and 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine in example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 10 g ( 0 . 040 mol ) 4 -( p - methyl cyclohexyl amino )- butanesulfonic acid and 5 . 1 g ( 0 . 040 mol ) dimethyl cyclohexylamine were used to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid and 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine of example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 10 g ( 0 . 040 mol ) 4 -( cycloheptyl amino )- butanesulfonic acid and 5 . 1 g ( 0 . 040 mol ) dimethyl cyclohexylamine were used to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid and 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine in example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 10 g ( 0 . 040 mol ) 4 -( cyclohexyl methyl amino )- butanesulfonic acid and 5 . 1 g ( 0 . 040 mol ) dimethyl cyclohexylamine were used to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid and 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine in example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 10 g ( 0 . 042 mol ) 3 -( cyclohexyl amino )- 2 - methyl - 1 - propanesulfonic acid was used to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid in example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 10 g ( 0 . 040 mol ) 3 -( cyclohexyl methyl amino )- 2 - methyl - 1 - propanesulfonic acid and 5 . 1 g ( 0 . 040 mol ) dimethyl cyclohexylamine were used to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid and 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine in example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 2 . 7 g ( 0 . 021 mol ) dimethyl cyclohexylamine was used to replace the 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine in example 1 , and the reaction time was prolonged to 6 h , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : 8 . 1 g ( 0 . 063 mol ) dimethyl cyclohexylamine was used to replace the 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine in example 1 , the rest of items can be referred to example 1 , the polyisocyanate modified with sulphamic acid with the following characteristic data is obtained : in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine were added to 190 g polyisocyanate 1 ( 0 . 99 mol ). the reaction lasted for 20 h at 80 ° c . the reaction system was cloudy , which indicated that under said temperature , 4 -( cyclohexylamino )- butanesulfonic acid did not react with polyisocyanates . in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine were added to 190 g polyisocyanate 1 ( 0 . 99 mol ). the reaction lasted for 10 h at . there &# 39 ; s still a large amount of suspensions in the system , which means 4 -( cyclohexylamino )- butanesulfonic acid could hardly react with polyisocyanates under such conditions . in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid was added to 190 g polyisocyanate 1 ( 0 . 99 mol ). the reaction lasted for 10 h at 110 ° c . the system was cloudy , which indicated that 4 -( cyclohexylamino )- butanesulfonic acid did not react with polyisocyanates without the presence of tertiary amine . in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 10 g ( 0 . 084 mol ) 3 -( cyclohexyl amino )- propanesulfonic acid , 5 . 4 g ( 0 . 084 mol ) dimethyl cyclohexylamine were added to 190 g polyisocyanate 1 ( 0 . 99 mol ) . the reaction lasted for 10 h at 80 ° c . after cooling to room temperature , the polyisocyanates modified with sulphamic acid with the following characteristic data is obtained : 10 g 2 - methylamino ethanesulfonic acid ( 0 . 08 mol ) and 10 . 16 g dimethyl cyclohexylamine ( 0 . 08 mol ) were used to replace the 10 g ( 0 . 042 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid and the 5 . 4 g ( 0 . 042 mol ) dimethyl cyclohexylamine in example 1 , the rest of items can be referred to example 1 . the reaction mixture was heated to 100 ° c . for 6 h . the system was turbid . even the temperature was increased to 120 ° c ., and a further reaction for 4 h , the system was still cloudy , which indicated that the 2 - methylamino ethanesulfonic acid did not react with polyisocyanates and was present in the form of crystals in the system . 47 . 12 g hydroxyl - acrylic resin ( antkote ® 2033 ) with hydroxyl value of 3 . 3 , solid content of 46 %, ph of 7 . 5 - 8 . 0 , 0 . 6 g wetting agent ( surfynol 104bc ), 2 . 22 g dispersing agent ( borchi ® gen sn 95 ), 0 . 16 g levelling agent ( baysilone paint additive 3468 ) diluted to 10 % by ethyleneglycol butyl ether , 27 . 65 g titanium white and 7 . 06 g deionized water were mixed and then grinded to fineness of less than 20 μm . then 14 . 2 g polyisocyanates modified with sulphamic acids according to the invention from said examples or the comparative examples were added . the obtained two - component mixture was applied on different substrates and dried for 30 min at 80 ° c . after being dried on the surface . the coating films with properties shown in the table 1 below were obtained . the data showed that , compared with the sulphamic acid modified polyisocyanate according to comparative example 4 , the sulphamic acid modified polyisocyanates according to other examples through two - step adding process possess longer processing time in the two - component coating system , and the two - component coating films possess better water - resistance and base resistance . in a round bottom flask with four necks equipped with a mechanical stirrer , a condenser tube , a thermometer and a nitrogen inlet and outlet , 12 . 5 g ( 0 . 053 mol ) 4 -( cyclohexyl amino )- butanesulfonic acid , 6 . 8 g ( 0 . 053 mol ) dimethyl cyclohexylamine were added to 166 g ( 0 . 87 mol ) polyisocyanate 1 . the reaction lasted for 3 h at 100 ° c . then 71 g ( 0 . 37 mol ) polyisocyanate 1 was added and mixed homogeneously . because the viscosity of the reaction system was relative high , 64 . 7 g n - ethyl - pyrrolidone was added to dilute the mixture at 60 - 70 ° c . 114 g ( 1 . 19 mol ) the blocking agent 3 , 5 - dimethylpyrazole was added in the course of 0 . 5 h , until the nco content of the system was lower than 0 . 1 wt %, the blocked polyisocyanates modified with suphamic acid was obtained . under vigorous mechanical stirring conditions , 200 g deionized water was added slowly to the above 200 g blocked sulphamic acid modified polyisocyanate , stable white emulsions with blue light was prepared . blocked isocyanate groups content ( based on the emulsion ): 5 . 7 wt % | 2 |
referring to fig1 and fig3 alignment / welding device 45 preferably has a first jaw 46 , a second jaw 08 and a pre - lock clamping jaw 15 . the first jaw 46 has a substantially semi - cylindrical gap which forms a first alignment zone 47 . the second jaw 08 also has a substantially semi - cylindrical gap which forms a second alignment zone 48 . the pre - lock clamping jaw 15 also has a substantially semi - cylindrical gap which forms a third alignment zone 50 . the first jaw 46 and second jaw 08 are pivotally joined together in a conventional pivot fashion , as commonly found in pliers or other similar hand tools , by using a pivot pin , bolt or similar component 49 . the pre - lock clamping jaw 15 is mounted on the pivot pin 49 alongside the second jaw 08 . as illustrated in fig3 and as discussed below , when pivotally joined together and placed in the partially closed first position , the first jaw 46 aligns with and abuts against the pre - lock clamping jaw 15 , in such a manner that the first alignment zone 47 , and the third alignment zone 50 form a substantially cylindrical first section of an alignment conduit . when the device is place in the fully closed second position , the first jaw 46 also is aligned with and abuts against the second jaw in such a manner that the first alignment zone 47 and the second alignment zone 48 form a substantially cylindrical second section of the alignment conduit which is substantially the same diameter as and contiguous with , the first section of the alignment conduit . the diameter of the first section and second section of the alignment conduit preferably are substantially equal to the diameter of the pieces of weldable material to be welded together . referring to fig2 tension rod 31 connects the pre - lock clamping jaw 14 to the second jaw 08 and pivotally advances pre - lock clamping jaw 14 so that the pre - lock clamping jaw 14 leads the second jaw 08 when the device is being closed , as shown in fig3 . the device 45 is closed to a first position by actuating a double acting / single rod pneumatic cylinder 37 ( fig2 ) or similar device . in place of a pneumatic cylinder , other well - known methods for closing the device can be used , such as a ratcheting gear or even manual pressure applied by the technician . in this partially - closed first position , the pre - lock clamping jaw 14 abuts against the first jaw 46 as illustrated in fig3 and the first section of the alignment conduit is formed . as device 45 is fully closed to the second / final position , the second jaw also abuts against the first jaw and the second section of the alignment conduit is formed . in the fully closed second position , the second jaw 8 and the pre - lock clamping jaw 14 are firmly positioned against the first jaw 46 . this mechanism allows a first piece of weldable material 51 and a second weldable material piece 52 to be secured into device 45 independently of one another . the manner in which the device 45 is used to align and weld two pieces of weldable material is best demonstrated by referring to fig9 - 12 . as illustrated in fig9 the technician places the first piece of weldable material 51 between the first jaw 46 and pre - lock clamping jaw 14 , abutting against the retractable centering pin 41 , located in the first jaw . as shown in fig6 the centering pin is preferably spring - loaded and adjusted with a set screw . the centering pin is positioned such that it extends into the alignment conduit and is in the same plane of spatial orientation as the plurality of electrodes which also extend into the alignment conduit 40 . the purpose of the centering pin is to center the abutment junction of the two pieces of weldable material directly in line with the electrodes and , therefore , any mechanism that would serve this purpose , would suffice . as illustrated in fig1 , as the device 45 is closed to the partially - closed first position , the pre - lock clamping jaw 14 makes contact with the first jaw 46 , thereby firmly securing the first weldable material piece 51 in the first section of the alignment conduit , with the first terminus of the first piece of weldable material being located in the same plane of spatial orientation as the electrodes 40 . as illustrated in fig1 and fig1 , the technician then places the second piece of weldable material 52 between the first jaw 46 and second jaw 08 , with the terminus of said second piece abutting the first terminus of the first weldable material piece 51 . this action will cause the centering pin 41 to be depressed . in this manner , the two pieces of weldable material will contact each other and form an abutment junction in substantially the same plane of spatial orientation as the electrodes 40 surrounding the alignment conduit . by actuating the pneumatic cylinder 37 to the second / final position , the second jaw 08 contacts the first jaw 46 and firmly secures the second piece of weldable material 52 within the second alignment conduit . because the first section and second section of the alignment conduit are substantially the same diameter and are substantially contiguous when device 45 is in the fully closed position , the first weldable material piece 51 and the second weldable material piece 52 will be in strict alignment with each other . alignment tolerances of 10 % or better can be achieved by the device 45 where the alignment tolerance equals the distance by which the weldable material pieces deviate from perfect alignment , divided by the diameter of the weldable material pieces . the distance by which the weldable material pieces deviate from perfect alignment is shown as &# 34 ; d1 &# 34 ; in fig5 and is measured at the largest exposed edge of first weldable material piece 51 at the junction with second weldable material piece 52 . when the device 45 is in a fully closed position , the first weldable material piece 51 and the second weldable material piece 52 are in place and the junction of these two pieces are in substantially the same plane of spatial orientation as the electrodes 40 . furthermore , the first weldable material piece 51 and the second weldable material piece 52 are in alignment with each other . with the first weldable material piece 51 and the second weldable material piece 52 thus securely clamped into place , device 45 can now be used for the weld process . referring to fig7 argon gas from an external source ( not shown ) will flow into purge lines 55 via an external hose ( not shown ). the weld process is then initiated by depressing switch 44 which is depicted in fig1 . referring to fig6 and fig8 the external welder ( not shown ) will supply an electric charge via wires 56 ( fig7 ) to the contacts 39 which will then cause electrodes 40 to arc to the abutment junction , thereby beginning the weld . an electric motor 29 or similar device then rotates u - joint 28 , which , in turn , rotates the primary drive gear 25 . as shown in fig6 and fig8 the primary drive gear 25 then rotates the secondary drive gear 23 , thereby rotating insulating gears 09 and 16 a total of approximately 130 degrees . as illustrated in fig1 , the rotation of the insulating gears 09 and 16 allows the electrodes 40 to revolve around the abutment junction , thereby creating a complete weld of the abutment junction . after the weld process is over , pressure is applied to the return side of the pneumatic cylinder 37 ( fig1 ), thereby releasing the pre - lock clamping jaw 14 and second jaw and allowing the fused weldable material piece to be removed from the device 45 as illustrated in fig1 . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limited sense . various modifications of the disclosed embodiments , as well as alternative embodiments of the inventions will become apparent to persons skilled in the art upon the reference to the description of the invention . it is , therefore , contemplated that the appended claims will cover such modifications that fall within the scope of the invention . | 1 |
reference will now be made in detail to several embodiments of the invention that are illustrated in accompanying drawings . whenever possible , the same or similar reference numerals are used in the drawings and the description to refer to the same or like parts or steps . the drawings are in simplified form and are not to precise scale . for purposes of convenience and clarity only , directional terms such as top , bottom , left , right , up , down , over , above , below , beneath , rear , and front , may be used with respect to the drawings . these and similar to directional terms are not to be construed to limit the scope of the invention in any manner . the words attach , connect , couple , and similar terms with their inflectional morphemes do not necessarily denote direct or intermediate connections , but may also include connections through mediate elements or devices . a step assembly to assist the entry into or exit from a vehicle is attached to the vehicle through the cooperation of a mounting means therefor and the trailer hitch , thereon . this step assembly is usable by humans or pets . the step assembly is foldable or collapsible as desired . it may even be folded while on the vehicle , to facilitate use thereof . this step assembly offers two or three steps , which facilitate entry into a vehicle . the step assembly may be a double step assembly with two steps or a triple step assembly with three steps . in fig1 and fig2 , double step assembly 100 fits onto vehicle 110 at trailer hitch 112 . fig1 has double step assembly 100 and open position 102 and may include an optional non slip surface 138 . in this manner , a person or an animal may use double step assembly 100 . with double step assembly 100 in closed position 104 as in fig2 , it may be left on the vehicle 110 and not interfere with the use of the vehicle 110 . still considering fig2 , hitch insert 114 on double step assembly 100 slides into trailer hitch 112 . the hitch insert 114 is then secured therein by bar and cotterpin assembly 108 . thus , double step assembly 100 becomes releasably and strongly mounted on vehicle 110 . referring now to fig3 , the structure of the double step assembly 100 becomes more clear . hitch insert 114 of the double step assembly 100 is secured thereto by top hinge 116 and first upper hinge rod 118 , which creates a pivotal connection , which in turn is secured through fasteners 122 . while first upper hinge rod 118 cooperates with top step 130 , first lower hinge rods 120 use fasteners 122 to cooperate with bottom step 140 . cooperating with top step 130 are a pair of upper side plates 132 , on opposing sides thereof and roughly parallel to the hitch insert 114 . between one upper side plate 132 and top step 130 is the left vertical support 134 . on the opposing side thereof , right vertical support 136 is between the upper side plate 132 and top step 130 . while top step 130 is secured to the upper end of each of the left vertical support 134 and the right vertical support 136 , bottom step 140 is secured to the lower end thereof to in similar fashion with a pair of bottom side plates 142 . however , each of the left vertical support 134 and the right vertical support 136 secure each bottom side plate 142 between it and bottom step 140 . for further stability , second upper hinge rod 126 attaches to the left and right vertical supports 134 and 136 and the top step . second lower hinge rod 128 attaches to the lower end of the left and right vertical supports 134 and 136 and the bottom steps 140 . both the left vertical support 134 and the right vertical support 136 include support apertures 146 as desired to receive hinge rods or other mounting devices . lower support plates 168 are also present at the bottom of left vertical support 134 and the right vertical support 136 to provide further step support . both the left vertical support 134 and the right vertical support 136 include lever lock assembly 150 and ball lock assembly 180 which provide for positioning the double step assembly 100 in the open position 102 or the closed position 104 as desired . it is also possible to provide top step 130 and bottom step 140 with a non - slip surface 138 ( fig1 ). additionally , a logo plate 148 may be secured to either top step 130 or bottom step 140 as desired . logo plate 148 may be any appropriate decoration or advertising on double step assembly 100 . with fig4 , the double step assembly 100 is both expanded and further clarified . double step assembly 100 is inserted into trailer hitch 112 of vehicle 110 at hitch insert 114 . the first upper hinge rod 118 connects top hinge 116 , which is secured with top step 130 , to hitch insert 114 . first upper hinge rod 118 slides into the top step 130 at and through top hinge 116 . since first upper hinge rod 118 is hollow , a fastener 122 passes through upper side plate 132 and into first upper hinge rod 118 at each end thereof . the upper side plate 132 also receives second upper hinge rod 126 into the opposite side of top step 130 . second upper hinge rod 126 also receives left vertical support 134 and right vertical support 136 on opposing sides of top step 130 . then fasteners 122 secure each upper side plate 132 thereto . thus , second upper hinge rod 126 and first upper hinge rod 118 secure opposing ends of both of upper side plate 132 . lever lock assembly 150 fits into top step 130 adjacent to second upper hinge rod 126 and facilitates the moving of double step assembly 100 between open position 102 and closed position 104 . for bottom step 140 , second lower hinge rod 128 and first lower hinge rod 120 use fasteners 122 with bottom side plate 142 through bottom plate apertures 124 ( fig3 ) therein in order to secure bottom side plates 142 to bottom step 140 . however , with first lower hinge rod 120 , left vertical support 134 and right vertical support 136 are positioned over bottom side plate 142 before fasteners 122 are secured therein . with fig5 , strength of the step assembly 100 is improved . a honey comb type structure 166 strengthens the step assembly 100 and is shown in top step 130 and bottom step 140 . it also reduces the weight of the step assembly , while substantially maintaining strength . strength or weight support may also be increased thereby . adding fig6 , and fig7 to the considerations , lever lock assembly 150 is explained more clearly as a mechanism facilitating the transfer between closed position 102 as shown and open position 104 ( fig1 ). lever lock assembly 150 fits into top step 130 adjacent to second upper hinge rod 126 . spring cover 152 serves a dual purpose . first , spring cover 152 cooperates with the end latch bolt 154 of lever lock assembly 150 by virtue of the coupling shank 156 extending therefrom . secondly , at one end , spring cover 152 serves as sliding bushing 158 and receives large compression spring 162 . oppositely disposed from coupling shank 156 , sliding bushing 158 has finger lever 160 extending therefrom to facilitate use thereof . large compression spring 162 fits into coupling aperture 164 of sliding bushing 158 . in lever lock assembly 150 , a spring cover 152 appears on either end of the large compression spring 162 , as does a sliding bushing 158 and coupling shank 156 of end latch bolt 154 . adding fig8 , fig9 , fig1 , fig1 and fig1 , ball lock assembly 180 holds double step assembly 100 in open position 102 or closed position 104 as desired . ball lock assembly 180 has a reciprocating ball 182 communicating with a small compression spring 184 within a housing 186 , with a housing aperture 188 . a ball lock assembly 180 is mounted in each of left vertical support 134 and right vertical support 136 . small compression spring 184 then holds reciprocating ball 182 in blind aperture or dimple 190 on a side of bottom step 140 . likewise , hinge 116 is indexed with hitch insert 114 . with fig1 , fig1 , fig1 , fig1 and fig1 , the steps of folding to closed position 104 ( fig1 ) or unfolding to open position 102 ( fig1 ) are further clarified . pressure on bottom step 140 releases ball lock assembly 180 from dimple 190 and permits folding to take place . as double step assembly 100 folds , each reciprocating ball 182 is allowed enter a second dimple 190 on left vertical support 134 and right vertical support 136 , thereby holding bottom step 140 in place . whether in closed position 104 ( fig1 ) or open position 102 ( fig1 ), multiple mount adjustment 196 may be used to secure double step assembly 100 to vehicle 110 . finger lever 160 ( fig1 ) releases closed position 104 of left vertical support 134 and right vertical 136 from top step 130 . the hitch insert 114 can have a multiple mount adjustment 196 ( fig1 ). with the consideration of fig1 , the feasibility of triple step assembly 200 with third step 230 becomes clear in order to form . a second set of left vertical support 134 and right vertical support 136 support third step 230 below bottom step 140 , with a structure and folding capability similar to bottom step 140 . thus , third step 230 may be added with very little increase bulk for triple step assembly 200 relative to double step assembly 100 . fig1 shows a hitch sleeve 240 usable with a large trailer hitch 242 and applicable both to triple step assembly 200 and to double step assembly 100 . hitch sleeve 240 adjusts so that hitch insert 114 fits efficiently into large trailer hitch 242 . two of bar and cotterpin assembly 108 ( fig2 ) are used to complete the assembly . this application ; taken as a whole with the abstract , specification , claims , and drawings being combined ; provides sufficient information for a person having ordinary skill in the art to practice the invention as disclosed and claimed herein . any measures necessary to practice this invention are well within the skill of a person having ordinary skill in this art after that person has made a careful study of this disclosure . because of this disclosure and solely because of this disclosure , modification of this method and device can become clear to a person having ordinary skill in this particular art . such modifications are clearly covered by this disclosure . | 1 |
the present invention generally relates to dispensers for cartons . the present invention can be used , for example , in cartons that contain articles or other products such as , for example , food and beverages . the articles can also include beverage containers such as , for example , cans , bottles , pet containers , or other containers such as those used in packaging foodstuffs . for the purposes of illustration and not for the purpose of limiting the scope of the present invention , the following detailed description describes generally cylindrical beverage containers as disposed within the carton embodiments . in this specification , the relative terms “ lower ,” “ bottom ,” “ upper ” and “ top ” indicate relative orientations determined in relation to fully erected cartons . fig1 is a plan view of the interior side of a blank 8 used to form a carton 150 ( illustrated in fig2 a and 2b ) according to a first embodiment of the invention . the blank 8 comprises a bottom panel 10 foldably connected to a first side panel 20 at a first transverse fold line 21 , a top panel 30 foldably connected to the first side panel 20 at a second transverse fold line 31 , and a second side panel 40 foldably connected to the top panel 30 at a third transverse fold line 41 . an adhesive flap 50 can be foldably connected to the second side panel 40 at a fourth transverse fold line 51 . the blank 8 may include a handle 36 in the top panel 30 . the bottom panel 10 is foldably connected to a first bottom end flap 12 and a first bottom exiting end flap 14 . the first side panel 20 is foldably connected to a first side end flap 32 and a first side exiting end flap 34 . the top panel 30 is foldably connected to a top end flap 32 and a top exiting end flap 34 . the second side panel 40 is foldably connected to a second side end flap 42 and a second side exiting end flap 44 . when the carton 150 is erected , the end flaps 12 , 22 , 32 , 42 close one end of the carton 150 , and the exiting end flaps 14 , 24 , 34 , 44 close an exiting end of the carton 150 . the end flaps 12 , 22 , 32 , 42 may extend along a first marginal area of the blank 8 , and may be foldably connected at a first longitudinal fold line 62 that extends along the length of the blank 8 . the exiting end flaps 14 , 24 , 34 , 44 may extend along a second marginal area of the blank 8 , and may be foldably connected at a second longitudinal fold line 64 that also extends along the length of the blank 8 . the longitudinal fold lines 62 , 64 may be , for example , substantially straight , or offset at one or more locations to account for blank thickness or for other factors . the carton blank 8 includes a dispenser pattern 70 that defines a corner dispenser 100 in an upper corner of the erected carton 150 ( illustrated in fig2 a and 2b ). the dispenser pattern 70 extends across the first side panel 20 , the top panel 30 , and across the exiting end flaps 24 , 34 , 44 . a portion of the perimeter of the dispenser pattern 70 is defined by a first tear line 72 , a tear second line 74 , a third tear line 76 , and a fourth tear line 78 , all of which may be contiguous or substantially contiguous with one another . a fifth tear line 80 of the dispenser pattern 70 is formed in the exiting end flap 44 . the first tear line 72 extends in what may be a substantially straight line transversely across the blank 8 from an edge of the first side exiting end flap 24 , across the longitudinal fold line 64 , and into the first side panel 20 . the first tear line 72 divides the first side exiting end flap 24 into a first tear away section 88 and an end retainer section 90 . the first tear line 72 also defines a side retainer section 92 in the first side panel 20 . the second tear line 74 extends obliquely along at least a majority of its length through the first side panel 20 and connects to the third tear line 76 . the third tear line 76 may extend in a generally arcuate path along at least a majority of its length across the top panel 30 , and turns to extend to the second longitudinal fold line 64 . the fourth tear line 78 extends from the second longitudinal fold line 64 , adjacent to an end of the third tear line 76 , to an exterior edge of the top exiting end flap 34 . the fourth tear line 78 may be substantially straight . the fifth tear line 80 extends in an ell - shape or dogleg shape from a top edge of the second side exiting end flap 44 to an end edge of the flap 44 . the fifth tear line 80 defines a tear away section 96 and end retainer sections 95 , 98 in the second side exiting end flap 44 , and can include two orthogonal or substantially orthogonal sections . an access flap 82 can be defined in the first side panel 20 by a dogleg - shaped or ell - shaped access cut or tear line 84 that extends between the first tear line 72 and the second tear line 74 , and a fold line 86 about which the access flap 82 may pivot or otherwise deform inwardly . alternatively , the access flap 82 can be omitted and an access opening or aperture can be defined by the lines 84 , 86 . multiple access flaps may , for example , be included in the dispenser pattern 70 at selected locations within the dispenser pattern . the first through fifth tear lines 72 , 74 , 76 , 78 , 80 of the dispenser pattern 70 can be continuous or substantially continuous tear lines formed by , for example , scores , creases , cuts , gaps , cut / creases , perforations , offset cuts , and combinations thereof . if cuts are used to form the dispenser pattern tear lines 72 , 74 , 76 , 78 , 80 , the cuts may be interrupted by , for example , one or more breachable nicks . the access flap 82 can generally be disposed in any position along the first side panel 20 , the exiting end flaps 24 , 34 , or the top panel 30 . the access flap 82 can be designed to provide easy initial access for opening of the dispenser 100 , and may therefore be formed from a continuous cut 84 , a cut interrupted by nicks , and / or other easily breachable lines of disruption . the dimensions and shape of the blank 8 may be selected to accommodate the characteristic dimensions of an article or articles to be accommodated within the carton 150 . for example , the top panel 30 can have a width w 1 that generally corresponds to or slightly exceeds a height h c of containers c ( fig2 a and 2b ) to be held within the carton 150 . the first and second side panels 20 , 40 can have , for example , heights h 1 that generally correspond to or slightly exceed an integral multiple of a largest or characteristic diameter d c of the containers c . for example , if the containers c are to be stacked in two rows ( illustrated in fig2 b ) in the carton 150 , the height h 1 of the carton 150 can be slightly greater than twice the containers &# 39 ; c largest or characteristic diameter d c . if multiple generally cylindrical containers c , such as beverage containers , are to be accommodated , it may be expected that the containers will share at least one substantially equal common largest diameter d c . the end retainer section 90 in the first side exiting end flap 24 can have , for example , a height h 2 in the range of , for example , about 20 - 110 % of the characteristic dimension or diameter d c of the containers c . the end retainer section 98 in the second side end flap 44 can also have a height h 2 . the second tear line 74 can extend generally at an angle α that is in the range of , for example , about 30 - 80 degrees with respect to the second transverse fold line 31 . the second and third tear lines 74 , 76 can extend into the panels 20 , 30 a depth of d 1 in the range of , for example , about 90 - 300 % of the characteristic dimension or diameter d c . the carton 150 may be erected from the blank 8 by gluing or otherwise adhering the adhesive flap 50 ( shown in fig1 ) to the inner side of the bottom panel 10 so that the bottom panel 10 , the first side panel 20 , the top panel 30 , and the second side panel 40 may be opened or set up to form a generally tubular sleeve . the ends of the generally tubular sleeve may be closed , for example , by folding and adhering the end flaps 12 , 22 , 32 , 42 and the exiting end flaps 14 , 24 , 34 , 44 . containers c or other articles , for example , may be loaded into the sleeve in a conventional manner at any time before one or both ends of the carton are closed by the end flaps 12 , 22 , 32 , 42 , 14 , 24 , 34 , 44 . fig2 a and 2b are perspective views of the carton 150 erected from the blank 8 illustrated in fig1 . in the erected carton 150 , the end flaps 12 , 22 , 32 , 42 form an end panel 130 and the exiting end flaps 14 , 24 , 34 , 44 form an exiting end panel 120 . the dispenser pattern 70 forms a corner dispenser 100 that extends across the corner existing at the intersection of the exiting end panel 120 , the top panel 30 , and the first side panel 20 . the carton dispenser 100 includes a dispenser flap 110 that may be either wholly or partially removed in order to open the carton 150 . the dispenser flap 110 extends in the three planes occupied by the exiting end panel 120 , the top panel 30 , and the first side panel 20 . opening of the carton dispenser 100 to place the carton 150 in a dispensing configuration will be discussed below with reference to fig3 - 6 . referring to fig3 , opening of the dispenser 100 may be initiated by inserting a finger , fingers , tool , or other object into the carton 150 at the access flap 82 . the access flap 82 may be , for example , defined by the cut line 84 to allow for ease of insertion . the cut line 84 can be , for example , a continuous cut , or a cut interrupted by nicks . other lines of disruption in the carton 150 may also be used to form the access flap 82 . alternatively , an access opening or aperture may be provided at the location of the flap 82 . referring to fig4 , the dispenser 100 may be opened by pulling the dispenser flap 110 outwardly and / or upwardly and tearing the carton 150 along the first and second tear lines 72 , 74 . referring to fig5 and 6 , the dispenser 100 is fully opened by tearing the carton along the third , fourth and fifth tear lines 76 , 78 , 80 to remove the dispenser flap 110 and thereby form a dispenser opening 112 . the lower end of the dispenser opening 112 is defined by a lower edge 114 ( fig6 ) extending across the remainder of the exiting end panel 120 and the first side panel 20 . the lower edge of the dispenser opening 114 is the top edge of the horizontally extending end retainer wall 90 and side retainer wall 92 . fig7 and 8 are a partial perspective and a schematic side view , respectively , of the carton 150 in the fully opened or dispensing configuration . in the exemplary embodiment , the carton 150 encloses twelve 12 ounce beverage containers c arranged in the carton 150 in a two row and six column ( 2 × 6 ) configuration ( shown in fig2 b ). in fig7 and 8 , one container c has been removed through the dispenser opening 112 . in the dispensing configuration , containers c may be withdrawn from the upper corner of the opened carton 150 through the dispenser opening 112 . in general , with the dispenser flap 110 removed , a container or containers c adjacent to the dispenser opening 112 can be easily accessed and removed from the carton 150 . referring to fig7 , the end retainer section 90 in the first side end flap 24 and the side retainer section 92 in the first side panel 20 can have a height h 2 in the range of about 20 - 110 % of the container characteristic dimension or diameter d c , which may be sufficient to prevent a bottom or lower row of containers c from rolling out of the exiting end of the carton 150 . referring to fig7 and 8 , the vertically extending end retainer section 95 in the exiting end panel 120 may extend across the full height of the exiting end of the carton 150 to prevent containers c from inadvertently rolling out of the carton . as shown in fig8 , the height of the lower edge 114 of the dispenser opening 112 may be high enough to prevent containers c from escaping through the side of the opened carton 150 . also , the dispenser opening 112 may extend downwardly in the exiting end panel 120 such that containers c in a bottom or lower row may also be easily accessible by hand . referring to fig7 and 8 , the depth d 1 that the corner dispenser 100 extends into the top and side panels 30 , 20 may be selected so that a container c in the top row of containers c may be easily pulled through the dispenser opening 112 , as well as containers c in a bottom or lower row adjacent to the exiting end panel 120 . the depth d 1 may also be selected so that containers c further back in the carton 150 may be removed from the carton through the dispenser opening 112 . for example , the depth d 1 can be selected so that containers c two , three , four or more columns back in the carton 150 may be accessed through the dispenser opening 112 . fig7 and 8 illustrate the dispenser flap 110 completely separated from a remainder of the carton 150 . a user may optionally choose to leave a portion of the dispenser pattern 70 intact , and thus create a hingedly attached dispenser flap 110 . for example , referring to fig5 , the dispenser flap 110 has been separated from the first side panel 20 , the top panel 30 , and a portion of the exiting end panel 120 , but at least a portion of the tear lines 78 , 80 in the exiting end panel 120 have not been torn . opening of the dispenser 100 can be halted at this point at the discretion of the user . the dispenser flap 110 therefore remains pivotably attached at one or both of the tear lines 78 , 80 . the user has the option of completely removing the dispenser flap 110 at a later time , or , partially or wholly reclosing the dispenser flap 110 about the hinge tear lines 78 , 80 . the hinged attachment could alternatively be formed , for example , along the first side panel 20 or the top panel 30 . a carton 150 as illustrated in fig2 a and 2b accommodates twelve 12 ounce beverage cans having a container diameter d c of about 2 and ½ in and a height h c of about 4 and 13 / 16 in . the containers are arranged in two rows , six columns of cans to each row ( 2 × 6 configuration , as shown in fig2 b ). the carton has a height h 1 of about 5 and 7 / 32 in . and a width w 1 of about 4 and 27 / 32 in . the distance d 1 is about 130 % of container diameter d c . the height h 2 of the lower edge 114 of the dispenser opening is about 60 % of container diameter d c , and the height h 3 ( shown in fig1 ) is about 140 % of container diameter d c . the lines 74 , 76 are tear lines and the longitudinal fold lines 62 , 64 are cut / crease lines . the fold lines 21 , 31 , 41 , 51 are crease lines and the lines 72 , 78 , 80 are tear lines formed from offset cut / space lines . according to the above embodiments , articles may be easily removed from the open upper corner of a carton when the carton dispenser is opened . the corner opening provides visibility of the articles inside the carton without entirely exposing all of the articles . the corner dispenser generally may be formed by perforations or cut lines , which are of such dimensions to provide access to cans or other articles in the carton , without unnecessarily weakening the panel or panels in which the corner dispenser is formed . after the removal of the dispenser flap , the remaining portions of the carton at the exiting end and in the first side panel prevent articles , and specifically the next article in the columns or rows of articles adjacent to the exiting end , from inadvertently falling or rolling out of the carton . thus , the articles are securely retained inside the carton until selectively removed . for purposes of illustration , the present invention is generally disclosed in the context of paperboard cartons or packages sized and dimensioned to contain cylindrical beverage containers . the cartons illustrated in the drawing figures are sized to accommodate containers in a two row configuration with multiple columns of containers included in each row , although the present invention is not limited to any specific size or dimension . for example , the present invention would work satisfactorily if sized and shaped to hold containers in alternative arrangements , such as 3 × 4 , 4 × 3 , 2 × 4 , 2 × 5 , 4 × 6 , 4 × 5 , 3 × 6 , 5 × 6 , etc . if a carton according to the present invention is designed to accommodate three rows of containers , the height h 2 of the lower edge of the dispenser opening may be selected to , for example , extend across or at least partially block the second or intermediate row of containers c . the height h 2 may be also be lower , for example , and the dimensions of the end retainer wall 95 and / or the profile of the second tear line 74 extending through the first side panel 20 may be changed in order to secure the bottom and / or intermediate rows of containers when the dispenser is placed in the dispensing configuration . if four or more rows of containers are to be accommodated , the height of the lower edge of the dispenser opening , the depth d 1 , and other dimensions of the blank can be further adjusted in order to provide a desired accessibility for the various rows . the present invention can be used in cartons that include various features , including additional opening features that provide easy access to the articles , and tilt features that position the articles at the front end of the carton . one of ordinary skill will recognize that the corner dispenser according to the present invention can be disposed in any upper corner of a carton . further , although not shown in the figures , it is understood that a carton according to the present invention could include spaced corner dispensers on each side of one end of the exiting end of the carton . in such a scenario , a remaining portion of the exiting end would provide the stop or retention feature in the exiting end . corner dispensers could also be provided at opposite ends of a carton . the blanks according to the present invention can be , for example , formed from coated paperboard and similar materials . for example , the interior and / or exterior sides of the blanks can be coated with a clay coating . the clay coating may then be printed over with product , advertising , price coding , and other information or images . the blanks may then be coated with a varnish to protect any information printed on the blanks . the blanks may also be coated with , for example , a moisture barrier layer , on either or both sides of the blanks . in accordance with the above - described embodiments , the blanks may be constructed of paperboard of a caliper such that it is heavier and more rigid than ordinary paper . the blanks can also be constructed of other materials , such as cardboard , hard paper , or any other material having properties suitable for enabling the dispensers to function at least generally as described above . the blanks can also be laminated to or coated with one or more sheet - like materials at selected panels or panel sections . in accordance with the above - described embodiments of the present invention , a fold line can be any substantially linear , although not necessarily straight , form of weakening that facilitates folding therealong . more specifically , but not for the purpose of narrowing the scope of the present invention , fold lines include : a score line , such as lines formed with a blunt scoring knife , or the like , which creates a crushed portion in the material along the desired line of weakness ; a cut that extends partially into a material along the desired line of weakness , and / or a series of cuts that extend partially into and / or completely through the material along the desired line of weakness ; and various combinations of these features . in situations where cutting is used to create a fold line , typically the cutting will not be overly extensive in a manner that might cause a reasonable user to incorrectly consider the fold line to be a tear line or other line of disruption . the above embodiments may be described as having one or panels adhered together by glue during erection of the carton embodiments . the term “ glue ” is intended to encompass all manner of adhesives commonly used to secure carton panels in place . the foregoing description of the invention illustrates and describes the present invention . additionally , the disclosure shows and describes only selected embodiments of the invention , but it is to be understood that the invention is capable of use in various other combinations , modifications , and environments and is capable of changes or modifications within the scope of the inventive concept as expressed herein , commensurate with the above teachings , and / or within the skill or knowledge of the relevant art . | 1 |
fig2 a illustrates a visualization screen 1 comprising four zones ( 2 , 3 , 5 , 21 ), including a prohibited zone 21 on which the information displayed must not be masked by the pointer 7 . the device according to the invention proposes defining a zone 21 comprising three separate portions 22 , 23 and 24 represented in fig2 b . the principle of defining the portions of a zone is to define as many portions that are necessary in the prohibited zone as the prohibited zone comprises sides forming a boundary with other zones . in this way , each portion ( 22 , 23 , 24 ) has a single side in common with a neighboring zone ( 2 , 3 , 5 ). when the pointer is passed over the zone 21 , if the pointer is moving and no interruption in the movement of the pointer is detected by the device , the crossing into the zone is performed as in all the other zones of the screen . when inactivity of the pointer is detected when it is situated on the prohibited zone , each of the portions forming the prohibited zone 21 makes it possible to define a single direction for pushing back the pointer by a speed of displacement applied to the pointer . when the pointer is abandoned over the zone 21 , depending on whether it is situated on one of the portions 22 , 23 or 24 , a speed vector 26 , 27 or 25 is applied to the pointer directing it toward the outside of the zone 21 . the speed vectors are defined for each of the portions that make up the prohibited zone 21 , so that they are perpendicular to the boundary between the prohibited zone 21 and a neighboring zone 2 , 5 or 3 . the speed vectors applied to the pointer 7 are active over the entire area of each portion . thus , according to the example of fig2 a and 2b , if the pointer is abandoned on the portion 23 , it is pushed back into the zone 2 . if the pointer is abandoned on the portion 24 , it is pushed back into the zone 3 . if the pointer is abandoned on the portion 22 , it is pushed back into the zone 5 . in a variant embodiment , it can be considered that the speed vectors form a determined angle with the perpendicular of each boundary of each portion . this angle can advantageously be that made by the trajectory of the pointer with the boundary before its abandonment . the pointer is considered to be abandoned if it remains without moving for a duration that is short enough not to be a problem for the crew . an acceptable duration is between 0 ms and 300 ms . 150 ms is one example of a case of embodiment according to the invention . in as much as the prohibited zone is crossed only in order to go beyond it to pass to the other side , this time constraint is absolutely not a nuisance to the operator because the movement of the pointer is continuous . from the moment when this detection takes place , the inventive device makes it possible to drag the pointer to the edge of a portion of the prohibited zone that is closest . the speed of displacement of the pointer is fast enough for a symbol system of the zone not to be masked for too long and it is also limited so that the user can perceive the movement of the pointer . a maximum duration of 500 ms to get back to an authorized zone regardless of the position of the pointer in the prohibited zone is one example . the inventive device proposes applying a speed to the pointer so that it is displaced continuously for the operator to be able to follow it by eye . in this case , the operator visually retains the information concerning the position of his pointer , so the continuity of his mental representation is assured . if the user resumes guiding the movement of the pointer , he must resume it from the current position of the pointer , even during an automatic movement on a prohibited zone . the trajectory of the pointer is linear , but its speed can be adapted to give the impression that the pointer is sliding on a slope as if it were crossing a “ virtual hill ”. one possible embodiment case consists in modifying the color , the shape and / or the transparency of the pointer or when crossing the prohibited zone 21 . a coloring makes it possible , for example , to indicate to the crew or to the operator that the pointer is situated on a prohibited zone . in an embodiment case represented in fig3 , when the passage from the prohibited zone 21 is performed continuously by the pointer , the device proposes modifying the opaqueness and / or the transparency of the pointer 30 . the transparency of the pointer is variable along the axis 31 perpendicular to one of the boundaries of the prohibited zone 21 . the device then modifies the appearance of the pointer progressively : in the vicinity of the edges of the prohibited zone 21 , the transparency of the pointer is unmodified and in the vicinity of the center of the prohibited zone 21 the pointer is made almost transparent . one example is to render the pointer semi - transparent at mid - travel when it is crossing the prohibited zone 21 in order not to mask important information even in a continuous movement in the zone . fig4 represents an exemplary modification of the speed gradient of the pointer when the latter crosses the prohibited zone . the speed applied to the pointer on entering 40 of the prohibited zone is low , identified on the axis 43 , and increases progressively to reach a nominal speed 42 . then , when the pointer is approaching the boundary 41 of the prohibited zone to leave it again , the speed of the pointer decreases , the axis 44 representing the displacement of the pointer . in a variant embodiment , the inventive device proposes retaining the speed law defined previously over the prohibited zone even an operator is guiding the pointer . in the latter case , when the pointer begins to cross a prohibited zone by an action guided by an operator , its speed is accelerated by a little which makes it possible to ensure a certain continuity of movement and convenience for the user . then , the extra speed applied to the pointer when crossing the prohibited zone on each portion is almost constant to finally decrease in the vicinity of an edge of the prohibited zone . this solution has the advantage of accompanying the movement initiated by an operator and of guiding the pointer to the other side of the prohibited zone . fig5 a and 5b represent a second exemplary case of the arrangement of a prohibited zone 51 in a visualization screen 1 comprising two other zones 2 ′ and 5 . the prohibited zone 51 comprises two separate portions 52 and 53 . each of the portions 52 and 53 respectively comprises speed vectors 54 and 55 that are applied to the pointer 7 over their entire area . in this example , the pointer 7 can access the zones 2 ′ and 5 . when the pointer is situated over the zone 51 and an inactivity of the latter is detected , then the pointer is pushed back to the outside of the prohibited zone , either into the zone 5 if the latter is abandoned in the portion 53 , or into the zone 2 ′ if the latter is abandoned in the portion 52 . fig6 a and 6b represent a third exemplary case of the arrangement of a prohibited zone 61 in a visualization screen 1 comprising two other zones 62 and 63 . the prohibited zone 61 comprises two separate portions 66 and 67 . each of the portions 66 and 67 respectively comprises speed vectors 64 and 65 that are applied to the pointer 7 over their entire area . in this example , when the pointer is situated over the zone 61 and an inactivity of the latter is detected , then the pointer is pushed back either into the zone 63 if the latter is abandoned in the portion 64 or into the zone 65 if the latter is abandoned in the portion 67 . a fourth exemplary case is represented in fig7 a and 7b in a visualization screen 1 . a prohibited zone 73 forms an “ l ” partially separating two zones 71 and 72 in which the presence of the mouse does not affect the reading of the information presented on the screen . the critical zone is defined by the prohibited zone 73 on which the pointer must not hamper the reading of the information presented in this portion of the screen . the prohibited zone 73 is formed by five separate portions ( 701 , 702 , 703 , 704 , 705 ). there are as many different portions defined as the prohibited area has boundaries with neighboring zones . each of the portions applies a vector pushing back the pointer to its boundary with a neighboring zone . each vector is perpendicular to the boundary . thus , if the pointer is abandoned over the prohibited zone 73 , depending on the portion over which the pointer is situated , the portion 701 pushes back the pointer according to the vector 76 , the portion 702 pushes back the pointer according to the vector 75 , the portion 703 pushes back the pointer according to the vector 77 , the portion 704 pushes back the pointer according to the vector 74 , the portion 705 pushes back the pointer according to the vector 78 , toward the outside of the prohibited zone 73 . in an embodiment case , the inventive device is also applied to windows of applications of one and the same visualization screen that can each define a zone as defined previously . in this case in point , some windows are defined as prohibited zones and other windows can be defined as zones comprising symbol systems that interact with the pointer . one advantage is to be able to displace the windows and retain the properties of the prohibited zones , notably the defined speed vectors . in a variant embodiment comprising two or more visualization screens , the inventive device can be applied to zones contained on a number of screens , the pointer being able to pass from one screen to another . the main advantage of the invention is to make it possible to define as many prohibited zones as are desired according to the application . the shapes of the prohibited zones can easily be adapted to the geometry of the windows of an application and the content presented . application developments are advantageously decorrelated from the presentation and the display ergonomy and the consistency of presentation of the information and of the symbol systems can be retained . | 6 |
referring to fig1 - 5 and 10 , a metallic article , such as turbine vane 10 , has a wall 11 that contains a crack 12 . the wall may typically have a thin coating thereon , indicated at 11a . in the case of an article consisting of a superalloy material that includes nickel ( ni ) or cobalt ( co ) as a base material , the coating will for example consist essentially of nickel aluminide or cobalt aluminide . the known alloy rene 80 is a nickel base superalloy , and the known alloy x - 40 is a cobalt base superalloy , these being examples . as indicated by the fig1 diagram , the aluminide coating is first removed , as by an acid strip , nitric acid for example being used . after inspection for cracks , to determine the location of crack 12 , a tool such as cutter 13 is employed to mechanically remove article metal adjacent that part of the crack that extends down to a depth &# 34 ; d &# 34 ; i . e ., to a substantial portion of the crack &# 39 ; s total depth . as a result , a wide - mouthed , cup shaped recess 14 is formed below top surface 15 of the article to have an oxide free wall or walls 14a at opposite sides of the former crack extent . step 8 contemplates cleaning of the part surface as by suitable organic solvent application followed by vapor degreasing . step 9 is shown in fig4 as including filling of braze compound 18 into the recess 14 . the braze compound consists essentially of first and second portions in powdered state . the first portion consists essentially of the same superalloy material as the article 10 ( or on an analogous composition ) and the second portion consists essentially of a braze component containing a melting point depressant , such as boron for example . one example of a usable braze compound or mix , for use in repairing cracks in a rene 80 superalloy , comprises a first portion consisting of rene 80 and a second portion consisting of brb . about 50 weight percent of each of such weight portions is utilized in the mix for a weight ratio of 1 / 1 . the weight percent contents of the two portions are defined as follows : ______________________________________ rene 80 brb______________________________________ni base ( balance ) base ( balance ) c . 17cr 14 . 0 14 . 0co 9 . 5 9 . 5mo 4 . 0w 4 . 0ti 5 . 0al 3 . 0 3 . 5b . 015 2 . 5zr . 03non - specified . 05 max . ______________________________________ an example of a usable braze compound or mix , for use in repairing cracks in an x - 40 superalloy , comprises a first portion consisting of x - 40 and a second portion consisting of ams 4783 . about 40 weight percent of x - 40 and about 60 weight percent ams 4783 are utilized in the mix the weight ratio of ams 4783 to x - 40 being about 3 / 2 . the weight percent contents of the two portions are defined as follows : ______________________________________ x - 40 ams 4783______________________________________co based ( balance ) base ( balance ) mn . 50si . 50 8 . 0cr 25 . 0 19 . 0ni 10 . 0 17 . 0w 7 . 5 4 . 0fe 1 . 5 1 . 0b . 8c . 50 . 4p . 02 max . s . 02 max . al . 05 max . tl . 05 max . zr . 05 max . ______________________________________ in the above , the braze compound is in powder form , that will pass a 150 mesh screen . also , sufficient carrier liquid is mixed with the powder to form a paste . step 10 in fig1 constitutes subjecting the braze mix in the recess , as well as the article material adjacent the recess , to first elevated temperature and to vacuum conditions , for causing the mix to form a melt . typically , the first elevated temperature t1 is less than the melting temperature of the article material , and is between 2125 ° f . and 2175 ° f ., preferably about 2150 ° f . accordingly , t1 is not so high as to melt the article metal itself , but is high enough to melt the mix , the intention being that the ultimate braze in the repaired article have melting temperature slightly below that of the parent material . the melting point depressant in the braze functions to lower its melting point . the time interval at which the braze is held at t1 is approximately 30 minutes , to completely melt the braze . the vacuum in the treating furnace is about 10 - 4 torr . step 11 in the sequence consists in subjecting the melt and the article material adjacent the recess to second elevated temperature or temperature t2 less than t1 , and for extended time sufficient to diffuse melting point depressant ( as for example boron out of the braze melt , thereby increasing the melting point of the braze melt to slightly below that of the parent material of the article , whereby the resultant article has been repaired to have approximately the same properties at the repair zone as exist in the parent material outside that zone . typically , and by way of example , t2 is between about 2050 ° f . and 2150 ° f . ; and the extended time interval includes a primary time interval during which the t2 remains at a lower level of the range ( as for example at a level of about 2050 ° f . ), and a secondary time interval during which t2 remains at a higher level within the range ( as proximate at a level of about 2150 ° f .). the primary time interval is about 3 hours , and the secondary interval is about 4 hours , the treatment occurring in a furnace and at high vacuum , i . e ., about 10 - 4 torr . these times and temperatures produce best results for the braze materials described in the above composition tabulations . steps 12 - 15 include , respectively , mechanical removal of excess braze , inspection of the braze repaired article , surface coating the article with aluminide where required , and final inspection . fig5 shows the finished article , with protective coatings 20 . fig6 - 9 correspond to fig2 - 5 , the difference being that the notch is of substantially the same cross section throughout its length . an example is a notch in the trailing edge of the vane . accordingly , the recess 14 extends completely through the article wall . braze 18 in fig8 is filled into the recess to extend between opposite sides of the article , as shown . fig4 differs from fig8 in that the braze powder is substantially supported by the article . fig1 and 12 are the same as fig6 and 7 . fig1 shows a weld 50 formed to bridge the recess 14 , and corresponds to step 4 in fig1 . on occasion a crack will occur in association with the weld as represented at 51 , in fig1 . that crack is then notched mechanically as indicated by notch wall 52 , as seen in fig1 ( see step 7 in fig1 ). thereafter , braze compound 53 is filled into notch 52 and the treatment of the braze is then the same as per steps 9 - 15 . other nickel based , usable superalloys include inconel 713 , 713c , 713lc , 738 and 718 , b - 1900 and rene 77 . in these cases , the braze first portion could consist of the same superalloy , or rene 80 . | 8 |
fig1 shows warp threads , in this case not shown over their entire length , which are set up in known manner in a frame to form a warp thread layer 1 . a warp thread 2 from this warp thread layer 1 is located with its end 3 in the region of the path of movement 4 of several transportation clamps 8 , 8 &# 39 ; forming a transportation device 5 . in this way , the end 3 of the warp thread 2 can be grasped by one of the transportation clamps . a presentation device for moving the warp thread 2 from a position in the plane of the warp layer 1 to the presentation position shown in the drawing figure is known , for example , from wo 92 / 08830 and its u . s . counterpart , u . s . pat . no . 5 , 355 , 566 ( the entire disclosure of which is incorporated herein by reference ). this presentation device is generally arranged vertically , by means of which the end 3 of the warp thread can be brought into the illustrated position . in the known system , the presentation device was employed to move the end 3 of the warp thread 2 to the presentation position where it could be grasped by the drawing - in member . the transportation device 5 of the present invention that is utilized to transport the end 3 of the warp thread 2 from the illustrated position at the warp layer 1 to a position immediately in front of the weaving reed 13 can be designed in a manner similar to the presentation device disclosed in wo 92 / 08830 and its u . s . counterpart , u . s . pat . no . 5 , 355 , 566 . however , the transportation device is arranged substantially horizontal , or is to be arranged in the plane of the reciprocating movement of the drawing - in member 9 . the transportation device 5 is constructed in such a manner that it pulls warp threads , such as a warp thread 6 for example , around a reversing pin 7 and then releases the thread in a given position . the transportation device 5 essentially comprises a rotating member , such as a chain , with clamping members 8 , 8 &# 39 ; secured to the chain . in order to open and close the clamping members 8 , 8 &# 39 ;, sliding blocks or cam rails known per se but not illustrated are , for example , provided in the region of take - up and release sites 37 , 38 . in the illustrated position , the warp thread 6 is prepared at a transfer site 36 in such a manner that it forms a loop and can be grasped by a drawing - in member 9 . to this end , the drawing - in member 9 needs to be moved somewhat further from the illustrated position towards the warp thread 6 , so that the thread jumps into the recess 10 . the return stroke of the drawing - in member 9 can then begin . a drive 11 , which can be constructed for example as a crank drive or as a linear motor , etc ., is operatively associated with the drawing - in member 9 to effect movement of the drawing - in member . the reciprocating movement of the drawing - in member 9 is indicated by an arrow 12 . located at a short distance in front of the drive 11 is a weaving reed 13 known per se , which is also constructed as a harness element in this case . guide rails 14 and 15 are arranged in a plane located a short distance from the weaving reed 13 . the guide rails 14 , 15 act as upper and lower guides for harness elements , more particularly in this case healds 16 , 17 . since the healds 16 , 17 can be of different construction , they are prepared separately in a manner known per se in accordance with their design on separate guide rails 14a , 14b and 15a , 15b . the healds move into the position depicted as heald 17 by means of conveying devices that are also known per se . since the healds are very flexible and movable , it is possible to ensure by means of a locally arranged guide 18 that the eyelet 19 is aligned in such a manner that it forms a passage for the drawing - in member 9 and can receive a warp thread . the healds with the drawn - in warp threads are advanced and transferred to a rotating distribution member 20 which , for example comprises short sections 20a , 20b , 20c etc . of guide rails , which are arranged in spaced apart relation , for example on a rotating chain , the distances apart corresponding to the spacing of shafts 21 . the rotating chain is illustrated in the drawing by way of example by the dot - dash line 20e . the drive of the distribution member 20 is effected cyclically , so that there is always time available in which the healds can be transferred to the shafts 21 . a conveyor belt can undertake the transfer in question in place of the illustrated distribution member 20 . devices known per se can be used for transporting the healds from the sections 20a - 20d to the individual shafts . a further distribution member , not shown in further detail here , is arranged at the bottom for guiding the healds and is constructed in precisely the same manner as the distribution member 20 and is also moved synchronously therewith . the two distribution members 20 thus move substantially in a vertical plane relative to the shafts 21 . a path of movement for further harness elements , such as the plates , is indicated by dot - dash lines 22 , extending at a short distance from the plane 14 , 15 and also intersecting the reciprocating movement 12 of the drawing - in member 9 . a plurality of plates 23 , 24 , 25 , 26 and 27 are shown here in different positions along this path of movement 22 . in this respect , the plate 23 is located in a drawing - in position for the warp threads 6 . the plates 23 - 27 each comprise a transportation aperture , as indicated by reference numeral 28 on the plate 25 . this aperture is adapted to receive a carrier 29 which carries the plate 25 along the path of movement 22 . carriers 29 of this type are secured in a manner known per se , for example to a conveying device , such as a rotating chain , which rotates and is guided in a duct 30 , only partly shown in the drawing . in the illustrated position of the plates 24 - 27 , the plates are positioned to be transferred to the plate carriers 31 . a conveying device of this type is already known , for example , from pct / ch91 / 00190 , although with a path of movement having a different course . although the drawing shows only a single drawn - in warp thread 32 which is drawn through the weaving reed 13 , the heald 33 and the plate 25 , it should be assumed that the heald 34 and the plates 24 , 26 and 27 also comprise a drawn - in warp thread , which is also drawn into the weaving reed 13 . the drawing is merely shown in this form for the purpose of simplification . insofar as the method of operation is not already known , it will be summarized again briefly below . one warp thread after the other is presented from the warp thread layer 1 in such a manner that an end 3 of the warp thread moves into the path of movement 4 of the clamps 8 of the transportation device 5 , whereby the warp thread is pulled in a first movement into the position of the warp thread 6 . this occurs at a first , relatively slow velocity , which is made possible in that the following warp thread 6a is already grasped by the transportation device 5 as a result of the staggered transportation , before the preceding warp thread 6 reaches the transfer site 36 . together , the staggered warp threads form a plane 39 , which extends approximately parallel to the reciprocating movement 12 of the drawing - in member and preferably horizontally . at the same time , harness elements are prepared , for example a heald 17 and a plate 23 in the illustrated position and the weaving reed 13 with the next aperture , into which a warp thread has not yet been drawn . to this end , the harness elements which are provided for drawing - in comprise movement paths 22 , which intersect the reciprocating movement of the drawing - in member . the movement paths extend immediately adjacent and at least approximately parallel one another in the region of the drawing - in member 9 . for the drawing - in operation , the harness elements 13 , 17 , 23 remain in position so that the drawing - in member 9 can carry out the reciprocating movement 12 engaging through the harness elements . in this manner , the warp thread 6 is drawn - in with a second movement and is transferred to the subsequent securing element 35 , which secures the warp thread 6 and can be formed , for example , by a suction nozzle . this second movement is carried out at a velocity which is preferably a multiple greater than the first velocity of the warp thread in the transportation device 5 . in order to allow for rapid , problem - free drawing - in , the movement paths of the harness elements , i . e . the lateral movement of the weaving reed 13 , the lateral movement of the healds 16 , 17 in the plane 14 , 15 and the lateral movement of the plate 23 along the lines 22 , extend parallel , immediately adjacent and as close as possible to one another . this is particularly the case at the location where the lines 22 intersect the reciprocating movement 12 of the drawing - in member 9 . subsequently , the harness elements are advanced and brought to the distribution stage , which can be effected cyclically , for example , in synchronism with the drawing - in member 9 . the healds are supplied by means of the rotating distribution member 20 to the shafts 21 and are distributed in an orderly fashion to individual shafts . to this end , the healds remain on the distribution member 20 for different periods of time or for a different number of cycle times . the control of this distribution is known per se and is therefore not illustrated in further detail here . the plates 24 - 27 which are advanced by the known conveying device along the path of movement 22 are also released in a known manner to the plate carriers 31 . as a result of these movements , relative movement is produced between the drawn - in warp threads 32 and the harness elements , so that the healds and plates , for example , slide along the warp thread 32 , namely in the opposite direction to the drawing - in movement . however , this can occur without problems and without damaging the warp thread as a result of the fact that the movements are effected slowly . the principles , preferred embodiments and mode of operation of the present invention have been described in the foregoing specification . however , the invention which is intended to be protected is not to be construed as limited to the particular embodiment disclosed . further , the embodiment described herein is to be regarded as illustrative rather than restrictive . variations and changes may be made by others , and equivalents employed , without departing from the spirit of the present invention . accordingly , it is expressly intended that all such variations , changes and equivalents which fall within the spirit and scope of the present invention as defined in the claims , be embraced thereby . | 3 |
as shown in the drawings for purposes of illustration , the present invention is directed to refillable material transfer systems for dispensing various materials , including thick , viscous and other types of fluids that resist pumping and / or which might be damaging to pumping apparatus . the system includes a material containment vessel with an upper region incorporating a motive force , and a bottom region with a material ingress and egress opening . a diconical or other shaped , level - instrumented force transfer device is located in the material containment area . the force transfer device can be weighted to an amount depending upon the application . the diameter and height of the tangential element of the force transfer device forms a cylindrical interface region . the diameter of this cylindrical interface region is smaller than the inner diameter of the material container forming an annulus that is matched to the viscous fluid or liquid and to the operating conditions of the system . turning now to the drawings , in which like reference numerals represent like or corresponding aspects of the drawings , and with particular reference to fig1 , the refillable material transfer system 10 includes a pressure vessel 20 and a force transfer device 60 , having a crown ( upper portion ) 68 and a thruster ( lower portion ) 71 . the pressure vessel includes a top portion ( first end ) 22 , a sidewall 24 and a bottom portion ( second end ) 26 . the pressure vessel may be in the form of a cylindrical container or other suitable shape for containing the material to be moved in and out of the pressure vessel . for example , the container may be a vertical or horizontal high - pressure vessel , a single pipe , a pipe cluster or a pipe - spool . furthermore , the container need not necessarily be configured for or as a pressure vessel , wherein the material to be transferred in and out of the container may move with gravity or other energy or force applied to the transfer device . suitable materials of construction for the material vessel and its components include metals ( such as aluminum , copper , iron , nickel and titanium ) and alloys ( such as alloy 20 , inconel , monel , steel and stainless steel ). in addition , polymers , plastics , composites and other synthetic materials ( such as fiber reinforced plastic , polyethylene , polypropylene , polytetrafluoroethylene , polyurethane , polyvinyl chloride , acrylonitrile butadiene styrene — abs , chlorinated polyvinyl chloride — cpvc and polyvinylidene fluoride — pvdf ) may be used to construct the container and its components . wherein the present invention contemplates horizontal , vertical and tilted vessels , the references to the drawings herein are generally to a vertical vessel ; however , those of ordinary skill in the art will appreciate that terms such as upper , lower , top and bottom may be easily translated to horizontal and tilted configurations of the refillable material transfer system . the top 22 of the vessel 20 may be secured to the sidewall or may be an openable lid or otherwise removable from the sidewall portion 24 of the vessel . the top of the vessel may have a flat surface , a semi - ellipsoidal surface , or a hemispherical surface . the top may be configured as a lid that can be opened to facilitate the removal of the force transfer device 60 , changing of material service , maintenance of the systems internals and periodic cleaning . the lid of the vessel may include an access manifold 36 that extends outward from the top of the vessel and extends into the lid . the access manifold is preferably centrally positioned , for example , along the longitudinal axis of the vessel . the access manifold may include an overflow arm 32 or other device for allowing excess material to exit the container during a filling operation . the overflow arm may include a manually operated or pressure - release valve . the access manifold may further be configured to contain a stabilizer pipe or other rod to be disposed within the container along its longitudinal axis . an access flange 34 may be fitted at the outside end of the access pipe ( external of the vessel ) so as to constrain a stabilizer rod ( pipe ) 62 that may extend from the top of the vessel to proximate the bottom 26 of the vessel . the top of the container may be further configured with a valve and fitting 38 for introducing and / or releasing pressurized gas into / from the vessel . gases such as air , nitrogen or other chemically derived gases ( inert or active ) may be employed to pressurize the vessel and provide an applied force to the crown 68 . in addition , the lid may be configured with a pressure release valve ( not shown ) or other device to relieve overpressure of gas within the container . the access flange may also be used for relief of the pressurized gas from the vessel . the top 22 of the container 20 may be further configured with a retainer 61 for restraining the force transfer device 60 as it reaches the top of the container . the retainer serves at least two purposes : to prevent overflow during refilling operations , and to facilitate the removal of any of any materials retained on the upper surface of the conical crown 68 , especially semi - solid materials , by allowing them to be expelled during a fill cycle . the retainer may be formed to conform to the shape of the crown of the force transfer device . the retainer may be made from of the same or different metal , alloy or polymer as the material vessel , depending upon the construction of the vessel , force transfer device and material serviced . additionally , the top of the container and sidewall portion of the container may be configured with flanges that fit tightly together so as to form a seal when the container is configured with an openable top . a first flange 27 could be secured to the top of the vessel , wherein a second flange 28 is secured to the sidewall of the vessel . fastening mechanisms ( not shown ) may be used to secure the top flange and sidewall flange together when the container is in operation . the sidewall 24 of the vessel 20 defines a gas space 30 within the vessel . similarly , when the vessel is filled with material 42 a portion of the container includes a material space 40 . the vessel may further include a false bottom portion 50 that is defined by an arrestor 73 configured to match ( conform to ) the shape of the thruster 71 of the force transfer device . the vessel &# 39 ; s bottom may have a flat surface , a semi - ellipsoidal surface , a hemispherical surface or other suitable shape for the duty of the vessel . the arrestor is configured to prevent gas bypassing and to assure low material retain when the vessel is empty . the arrestor may be further configured with an outlet channel 55 that transverses the bottom 26 of the vessel and is in fluid communication with a material manifold 45 . preferably , the outlet channel is of sufficient length so as to prevent gas flow into the material manifold by sealing the exit with abundant material . in addition , the outlet channel may be of sufficient length to define a heat transfer area 54 such that heat transfer elements 52 may be interposed around the outlet channel and under the arrestor so as to heat or cool the material exiting the container . alternatively , the outlet channel and material exit manifold may be positioned at the top of the container , wherein the arrestor , retainer and other components of the vessel are appropriately configured . the outlet channel 55 of the arrestor 73 at the false bottom 50 of the material vessel 20 leads to a material manifold 45 . the material manifold may include a material inlet 48 and a material outlet 46 in a t - shape ( tee ). a flange 44 may be used to cap the bottom of the material manifold when formed in a t - shape . alternatively , the material may enter and exit the manifold from the same port , wherein the manifold is formed in a l - shape . one or more valves ( not shown ) may be added to the material inlet and material outlet . likewise , quick - release ( cam and groove ) couplings or other assemblies may be added to the material inlet and material outlet for connection to conventional devices for introducing ( filling ) and removing ( emptying ) material to / from the vessel . referring now to fig2 and 3 , the force transfer device 60 includes a crown ( upper portion ) 68 , a tangential member ( middle portion ) 69 and a thruster ( lower portion ) 71 . in one embodiment , the crown is configured with a conical or frustrum shape having a substantially triangular cross - section . the cone - shaped crown includes an access port ( opening ) 64 for access to a hollow interior of the force transfer device . the opening may be used to insert ballast or other weighted material into the thruster . a ballast plug ( cap ) 65 may be used to close the access port in the crown . one or more vents ( gas ports ) 66 may be drilled or otherwise formed in the crown and tangential member so as to allow gas to pressurize the internal space of the force transfer device . the force transfer device accepts the primary force and / or energy applied to the crown and transduces the applied force through the thruster , causing the material manifold 42 to be ubiquitously pressurized . when the transfer system 10 includes a stabilizing pipe or rod 62 or other central member , the crown also includes a hole or bore 75 at the vertex of the cone in which the stabilizing rod may be slidably disposed . similarly , the thruster may be configured with an opening 77 at the vertex of the cone in which the stabilizing rod may be slidably disposed . the thruster 71 may be formed in a conical or frustum shape having a substantially triangular cross - section and may be configured with a hollow interior . a tangential member 69 may be interposed between the conical crown 68 and the conical thruster . the tangential member may be configured as a disk or plate being circular or cylindrical in shape and rectangular in cross - section . the tangential member helps provide stability to the force transfer device such that the outer wall of the tangential member is configured to be positioned substantially parallel to the sidewall 24 of the vessel 20 and substantially parallel to the longitudinal axis of the crown and the longitudinal axis of the thruster . as shown in fig2 , one embodiment of the force transfer device 60 resembles a child &# 39 ; s top in cross - section , where both the crown 68 and thruster 71 are conical in shape , thereby forming a diconical force transfer device . in one embodiment , the crown is a hollow , upward - pointing cone , wherein the primary purpose is to prevent overfilling when the confined space of the vessel 20 is being filled with material 42 . of secondary importance and during the refilling process , the crown displaces any materials that may have deposited on top of the force transfer device . the conical thruster transfers the force applied to device so as to penetrate and move the material through the vessel &# 39 ; s material outlet 55 and into the material manifold 45 . the conical portion of the thruster is configured for penetrating the material in the vessel . suitable materials of construction for the force transfer device and its components include metals ( such as aluminum , copper , iron , nickel and titanium ) and alloys ( such as alloy 20 , inconel , monel , steel and stainless steel ). in addition , polymers , plastics , composites and other synthetic materials may be used to form the force transfer device , such materials include fiber reinforced plastic , polyethylene , polypropylene , polytetrafluoroethylene , polyurethane , polyvinyl chloride , acrylonitrile butadiene styrene ( abs ), chlorinated polyvinyl chloride ( cpvc ) and polyvinylidene fluoride ( pvdf ). referring again to fig1 , one embodiment of the refillable material transfer system 10 is configured with the material vessel 20 in a vertical position , wherein the bottom 26 of the container is adjacent to the floor or ground and may stand on legs or other pedestals ( not shown ). accordingly , the sidewall 24 of the vessel holds the top 22 of the container in place . the force transfer 60 device is configured to move up and down the container as the material enters and leaves the vessel . when a stabilizer rod or other device 62 is disposed within the container , the transfer device moves up and down the rod , which may be configured with a cap 63 at the end of the rod near the bottom of the vessel . movement of the force transfer device is constrained at the top of the vessel by the retainer 61 , and is constrained at the bottom of the vessel by the arrestor 73 . in one aspect of the present invention , the tangential member 69 is configured with an outer diameter that is less than the internal diameter of the vessel . accordingly , as the transfer element moves up and down the container , a portion of material 42 remains along the sidewall forming a gas seal 49 between the vessel sidewall and the tangential member . in such a vertical configuration of the transfer system , the outlet 55 is configured with a sufficient vertical length so that gas in the vessel will not move through the outlet into the bottom material manifold as material empties from the container and the transfer element approaches the arrestor . referring now to fig4 , alternative embodiments of the refillable material transfer system 10 may be configured using a mode of force other than a high pressurized gas source . for example , a drive shaft 93 may be positioned within a manifold 86 configured within the top portion 22 of the material vessel ( container ) 20 . the drive shaft is configured to provide a driving force so as to move a force transfer device 90 from the top to the bottom 26 of the vessel . a first end portion 87 of the drive shaft extends outside of the manifold from the top of the vessel . a flange 84 positioned at an end of the manifold that extends outside of the top of the vessel provides an airtight seal around the exterior portion of the drive shaft . a second end 88 of the drive shaft is disposed within an opening 102 configured at a vertex of a conical crown 94 of the force transfer device . accordingly , movement of the drive shaft from the top towards the bottom of the container drives the force transfer device towards the bottom of the container . likewise , movement of the drive shaft from the bottom towards the top of the container moves the force transfer device towards the top of the container . in operation , it is expected that when material 42 enters the material manifold 45 positioned adjacent the bottom 26 of the vessel 20 , then the force transfer device 90 rises towards the top 22 of the container . alternatively , the drive shaft 93 may be configured to move the force transfer device to the top of the container adjacent a retainer 91 configured within the top portion or lid of the vessel . further , a limit switch 92 may be configured in the retainer and electronically connected to the mode of force for the drive shaft so as to stop the force transfer device adjacent the retainer as the force transfer device approaches the top of the vessel . similarly , a limit switch 101 may be positioned at or near the arrestor 99 . thus , as the drive shaft moves the transfer device towards the bottom of the container , the limit switch serves to stop the mode of force on the drive shaft and to position the transfer device adjacent the arrestor allowing essentially all of the material to be removed from the container . alternatively , the material manifold , switches , retainer , arrestor and other vessel components may be configured so that the material is introduced and removed from the top of the container . a gas purge line and valve 89 may be configured into the top or lid 22 of the vessel 20 and through the retainer 91 to allow air or an inert gas to be fed into the vessel when material 42 is being removed from the vessel and to purge such gases when the vessel is being filled with material . in addition , a material overfill arm 82 may be included in the manifold 86 for purging excess material , air and other gases during the fill cycle . the gas inlet and valve may be used to allow gas or air to enter into the container as material is moved out of the container as the airspace 80 increases within the container and as the material space 40 reduces in the container . alternatively , the excess material discharge line 82 may be configured so as to allow air to enter and exit the container as the transfer device pushes material out of the container or material entering into the container moves the transfer device towards the top of the container . referring now to fig5 and 6 , the diconical force transfer device 90 includes a crown ( upper portion ) 94 , a tangential member ( middle portion ) 95 and a thruster ( lower portion ) 97 . the crown and thruster are configured with a conical or frustum shape , having a substantially triangular cross - section with a truncated point or vertex . the annular tangential member has a substantially vertical outer surface , and is interposed between the crown and thruster . the crown , tangential member and thruster may be machined , die - cast or otherwise manufactured as a single unit , or may be manufactured as separate components and welded , bolted or otherwise permanently or removably fastened together to form the force transfer device . the force transfer device 90 may be further configured with one or more stabilizers 96 positioned along the outer surface of the tangential member 95 of the transfer device . the stabilizers are thin blade - like members , and may be made of a similar material as the transfer device , for example , metals and their alloys , polymers , plastics , composites or other natural and synthetic materials . the plurality of stabilizers ( for example , four stabilizers ) may be affixed to the transfer device equidistant along the outer surface of the tangential member by welding , mechanical fasteners or other suitable devices and techniques . the top and bottom edges of the stabilizers may be rounded so as to limit scraping and other damage to the sidewall 24 of the material vessel 20 . one purpose of the stabilizers is to help prevent tipping of the force device as the tangential member moves along the sidewalls of the vessel . the stabilizers also allow a material space 49 adjacent the sidewall of the vessel so as to provide a gas seal between the force transfer device and the vessel &# 39 ; s sidewall . in such a configuration , the refillable material transfer system 10 may be used in a vertical position , a horizontal position or disposed at an angle as required by the user . performance of the force transfer device 90 may be enhanced by the addition of a penetrating tip or protuberance 98 . as shown in fig4 and 5 , the penetrating tip may be conical or frustum in shape , having the same or different intrinsic angle as the conical thruster portion 97 of the force transfer device ( see fig1 ). the penetrating tip may be made of the same material or alternative materials as the other components of the force transfer device . further , the configuration of the conical thruster tip need not be triangular in cross - section , but may be rounded , square or other suitable configuration so as to help displace the material as the force transfer device moves towards the portion of the container that contains the material outlet channel 55 and material outlet manifold 45 . the conical thruster may be configured at its bottom end ( furthest from the crown 94 and tangential member 95 ) with a truncated portion 104 that is configured to receive the conical thruster tip . the wide end 106 of the conical thruster tip may be configured with a threaded flange or other device for securing to the truncated portion of the thruster . alternatively , the conical thruster tip may be welded or otherwise permanently secured to the conical thruster . empirical data supports the premise that the largest diameter of the thruster tip should be about the same as the diameter of the exit channel 55 . both the conical portion of the thruster and the protuberance are configured for penetrating the material . referring now to fig7 and 8 , the force transfer device 90 may be further configured with an annulus management device 103 positioned adjacent and / or around the tangential member 95 of the force transfer device . for example , the annulus management device may include a circular , donut - shaped member that includes cutouts or notches ( not shown ) so as to fit tightly over the stabilizer fins 96 . alternatively , cutouts or notches could be made in the stabilizer fins to accommodate the annulus management device . the annulus management device also may be configured to be retained within an annular notch within the tangential member of the force transfer device . the annulus management device may be removably or permanently attached to the force transfer device ( see also fig1 , 16 ). the inner diameter of the annulus management device should be substantially the same as the outer diameter of the tangential member of the transfer device . the outer diameter of the annulus management device should be greater than the inner diameter of the material vessel 20 so as to be in close proximity to the sidewall 24 of the vessel . thus , as the force transfer device moves along the sidewalls of the vessel , any accumulated material 49 ( fig4 ) along the sidewall of the vessel is moved towards the bottom 26 of the vessel , through the outlet channel 55 and preferably out the material manifold 45 . suitable materials for the annulus management device include materials similar to the force transfer device materials , as well as leathers , natural or synthetic rubbers and other elastomers such as buna - n ( nitrile ), fluoroelastomers , neoprene and ethylene - propylene - diene - monomer ( epdm ). referring now to fig9 , one embodiment of the refillable material transfer system 110 includes configuring the material vessel 120 in a vertical format . the material vessel includes a main body 150 , a top 122 , and one or more legs or extensions 170 . the main body of the material vessel is configured in a cylindrical format having a lower portion 152 to be connected to the legs 170 and an upper portion 154 to be connected to the top 122 . an upper annular flange 124 is connected to a lower portion 156 of the top . a lower annular flange 126 is connected to the upper portion 154 of the main body of the vessel . the annular flanges are essentially cylindrical in shape , having a donut - like configuration , being significantly larger in diameter than in thickness . clamping screws 128 are secured to the bottom flange and are configured to reside within notches or slots 127 formed within the upper flange . the configuration of the top and bottom flanges and securing locks are such that when the securing locks are in place a fluid tight seal is maintained between the top and main body of the material vessel . where the duty of the material vessel includes high pressure or other requirements for a fluid tight seal , an o - ring ( not shown ) may be interposed between the upper and lower flanges or a rubber or other polymeric coating may be applied to the upper and lower flanges so as to facilitate a fluid tight seal . other mechanisms , such as latches , clamps , lifting lugs and davits may be used to secure the vessel &# 39 ; s top to the vessel &# 39 ; s main body . the top portion 122 of the material vessel 120 may be hemispherical and circular in cross - section . alternatively , the top of the pressure vessel may be configured flat , square or other suitable shape for the duty imposed on the vessel . bores , cut outs or other access ports may be provided in the top of the container so as to facilitate positioning of a gas inlet end valve 180 , an overflow or pressure relief valve 190 and a gauge mechanism 160 . for ease of insertion and removal of a gauge 160 having a display 164 , a threaded coupling 162 may be placed within the center of the top portion of the container . alternatively , the top coupling may be used to hold the stabilizer rod or pipe 62 , as shown in fig1 , or the drive shaft 93 , as shown in fig4 . so as to facilitate removal of the top 122 from the container 120 , a lifting mechanism 130 may be configured adjacent the main body 150 of the material vessel . in one embodiment , as available from rosedale products of ann arbor , mich ., u . s . a ., a hydraulic jack 132 is used to drive a piston or rod 134 to lift the annular flange 124 of the top portion of the vessel . an actuator mechanism 136 may be used to hydraulically , mechanically or electro - mechanically move the drive shaft 134 to position the top of the container . furthermore , the lifting mechanism may be configured so as to lift and allow horizontal movement of the lid without complete disengagement from the lower flange 126 . for stabilizing purposes , a support flange 138 may be secured to the main body 150 of the material vessel and to the actuator mechanism 132 of the lift mechanism 130 . the refillable material transfer system 110 may be further configured with a material inlet and outlet manifold 140 positioned below the main body 150 of the material vessel 120 and adjacent the bottom portion 152 of the vessel . for example , a pipe 144 may be connected to the bottom portion of the container and may include a t - shaped ( tee ) portion 146 that is closed on one end 146 and is connected to a discharge mechanism 148 on a second portion of the tee . the discharge portion of the material manifold may further include a ball valve and actuator mechanism 142 . a cam and groove coupler or other industry specific mechanism may be configured on the outlet of the material manifold for coupling to hoses and pipes for filling and emptying the container . for further protection of the material discharge manifold , a shield ( not shown ) of plastic , metal or other suitable material may be configured around the legs 170 or other extension supporting the material container 120 . similarly , a protective shield ( not shown ) may be formed around the upper portion of the top 122 of the container so as to protect the display mechanism 160 , gas inlet 180 and pressure relief or material discharge device 190 . cutouts in the protective mechanism surrounding the top may be provided for access to the display 164 and gas valve 180 . the refillable material transfer system 110 may be configured to hold various quantities of material 42 and various pressures of high - pressure gas 31 . for example ( see also fig1 and 4 ), the top 122 and main body 150 of the vessel 120 may be sized and the retainer 61 , 91 and arrestor 73 , 99 configured so that the internal material space 40 accommodates , for example , fifty - five , one - hundred - and - fifty , three - hundred or six - hundred gallons ( 2 . 3 cubic meters ) of fluid or other material . for an operation mode involving constant gas pressure , those skilled in the art can determine , without undue experimentation , the volume of the container required to accommodate the high - pressure gas . for an operation mode involving pre - charging the vessel with a specific amount of gas proceed as follows : ( a ) determine the final pressure ( p ), in absolute terms required to dispense the material when empty ; ( b ) multiply this absolute pressure ( p ) by the flooded volume ( v ) of the container to obtain a value referred to herein as the pv constant ; ( c ) determine the value of the absolute pressure at pre - charging a full container ; and ( d ) divide the pv constant by the absolute pressure at pre - charging to determine the volume of the container required to accommodate the high - pressure gas . when a diconical force transfer device 60 , 90 is used in the material vessel 20 , 120 , the outer diameter of the tangential member 69 , 95 ( largest diameter of the crown 68 , 94 and thruster 71 , 97 ) is configured somewhat smaller than the inner diameter of the sidewall 24 of the material vessel . refillable material transfer systems can be scaled up and down for the intended services . the services can range from small hand held systems to large cargo truck or trailer mounted systems . it is contemplated that the present invention is applicable to very small ( micro -, nano - sized ) to very large material transfer systems that would move material quantities of less than a micro - liter and at least tens of thousands of liters of material . those skilled in the art of containers can determine , without undue experimentation , the appropriate container geometries , materials , and other features . similarly , those skilled in the art of material transfer can determine , without undue experimentation , the appropriate force transfer device geometries , materials and other features . if refillable material transfer systems would be charged with finite volumes of gas , and not connected to a gas supplies , then those skilled in the art of materials transfer can determine , without undue experimentation , the appropriate minimum gas pressures . further , those skilled in the art of gas handling can determine , without undue experimentation , the appropriate initial gas pressures and gas volumes . the following are the dimensions of some examples of refillable material transfer systems : top : flat bottom : flat inside diameter : 6 . 5 inches ( 16 . 5 cm ) inside height : 14 . 5 inches ( 36 . 8 cm ) flooded volume : 2 . 1 gallons ( 481 cubic inches , 7 . 9 liters ) material : aluminum top : flat bottom : 120 degree cone bottom protuberance : none tangential diameter : 6 . 25 inches ( 15 . 9 cm ) tangential height : 1 . 0 inches ( 2 . 5 cm ) material : aluminum top : 2 : 1 semi - ellipsoidal bottom : 2 : 1 semi - ellipsoidal inside diameter : 15 . 5 inches ( 39 . 4 cm ) straight shell height : 32 . 1 inches ( 81 . 5 cm ) flooded volume : 34 . 3 gallons ( 7 , 929 cubic inches , 129 . 9 liters ) material : stainless steel top : 2 : 1 semi - ellipsoidal bottom : 2 : 1 semi - ellipsoidal bottom protuberance : diameter of 3 . 0 inches ( 7 . 6 cm ) and height of 2 . 5 inches ( 6 . 4 cm ) tangential diameter : 14 . 0 inches ( 35 . 6 cm ) tangential height : 5 . 0 inches ( 12 . 7 cm ) material : stainless steel proximity of the tangential member 69 , 95 , 230 , 232 , 234 , 236 , 330 , 332 , 334 , 346 , 348 of the force transfer device 60 , 90 , 200 and 300 to the sidewall 24 of the material container 20 , 120 is dependant , among other things , upon the nature of the material 42 . the proximity range from 0 . 2 to 1 . 0 inches ( 0 . 5 to 2 . 5 cm ). height of the tangential member 69 , 95 , 230 , 232 , 234 , 236 , 330 , 332 , 334 , 346 , 348 depends , among other things , upon the nature of the material and the size of the container 20 , 120 . heights range from zero to twelve inches ( 30 . 5 cm ). the conical crown 68 , 94 has a defining angle which depends upon , among other things , the character of the material . the angle can range from 90 to 180 degrees . the fulcrum of the thruster 71 , 97 , 210 , 212 , 214 , 215 has a defining angle 215 that depends , among other things , upon the nature of the material that can range from 90 degrees to 180 degrees . the thruster tip 98 , 220 has a defining angle 225 that depends , among other things , upon the nature of the material that can range from 30 degrees to less than 180 degrees . referring now to fig1 and 11 , the force transfer device 200 may be adapted for use with various fluids having different viscosities . the thruster portion 210 of the transfer device may be configured as conical or frustum shaped , hollow device . the plurality of tangential members 230 may be configured to be placed adjacent the thruster portion of the transfer device . for example , the tangential members 232 , 234 , 236 may be disk - like or cylindrical in shape having an aspect ratio where their height ( thickness ) is significantly less than their diameter . the tangential members may be stacked on top of each other and secured to the thruster portion using a securing rod 250 or other suitable mechanism . the securing rod may be removably attached to the plates using a top coupling 254 , and may be secured at its second ( bottom ) end 252 to the bottom portion 214 of the conical thruster 210 . in one embodiment , the securing rod is disposed in bores or holes 256 in the tangential members and within a pipe or conduit 258 in the thruster . penetration of the transfer device 200 into thick or viscous fluids may be aided by the addition of a penetration tip 220 attached to the lower portion 214 of the thruster 210 . as heretofore described , the thruster tip may be conical ( triangular in cross - section ), blunted , square or other suitable shape . the thruster tip may include an adaptor 222 for attaching the tip to the thruster by welding , threading mechanisms or for fixing the tip to the securing rod 250 . a port 264 in the conical thruster and lumens or holes 262 in the tangential members may be used to provide access to a hollow portion of the conical thruster for addition of ballast . a cap 260 may be placed on the outermost tangential member to cover the port for filling and removal of the ballast . when the force transfer device is used in a refillable material transfer system that is pressurized , holes or bores 280 may be drilled or otherwise formed into the tangential elements so as to allow pressurization of the material transfer device . the force transfer device 200 may also include a stabilizer mechanism 240 . for example , three stabilizing fins 242 , 244 , 246 may be secured to the outermost tangential member 232 to prevent tipping and otherwise stabilize the thruster 210 of force transfer device as it moves within the material vessel 20 , 120 . the stabilizer fins may be welded , bolted , screwed and permanently or removably fastened to the upper tangential member 232 of the force device by addition of one or more flanges 243 , 245 , 247 . the stabilizer fins are configured such that they extend outside of the perimeter of the tangential members so that the outermost portion of the stabilizers are adjacent the inner sidewall of the material vessel . alternatively , stabilizer fins may be attached to one or more of the tangential members as shown in fig4 - 6 . referring now to fig1 , 13 and 14 , the force transfer device 300 may be made in various configurations other than the diconical shape shown in fig1 - 8 . for example , the thruster portion 310 of the transfer device and the crown portion 315 of the transfer device may be hemispherical or semi - elliptical in shape . such hemispherical or elliptical shapes may be easier to manufacture through cold working , annealing , or casting . similarly , injected molded processes for use of various alloys and metals may be implemented . as shown in fig1 , the transfer device 300 may include a substantially tangential portion 330 so as to be parallel to the inner sidewalls of the material vessel . accordingly , the thruster or lower portion 310 of the transfer device may include a tangential portion 332 , and the upper portion 315 of the transfer device may include a tangential portion 334 . the two halves of the transfer device may be joined at a weld 340 or other technique for permanently or removably fastening the two halves together may be employed . as heretofore described , vertical stabilizer fins 342 , 344 , 346 , 348 may be spaced circumferentially around the tangential portion of the transfer device . although four stabilizer fins are shown in the reference figures , two , three , six or more stabilizer fins may be employed as appropriate , depending on the diameter and other configurations of the vessel and transfer device . when the force transfer device 300 is used in a gas - pressurized environment , the upper or top portion ( crown ) 315 of the transfer device may include one or more vents or holes 380 so as to allow the pressurized gas to enter the inside of the transfer device . in addition , an access port 360 for placing ballast into the transfer device may be provided on the upper surface of the transfer device crown . as heretofore described , the ballast access port may be configured to accept a plug or cap for removable insertion into the access port . the crown of the transfer device may also be configured with a coupling , flange or other member 350 for insertion of a stabilizer pipe 62 ( fig1 ) or drive shaft 93 ( fig4 ). for configurations of the force transfer device that accommodate a level indicating device ( fig1 , 18 ), a pipe or other tube may be configured to extend from the crown coupling to proximate the bottom surface of the thruster portion 310 . as shown in fig1 , the thruster portion is also configured with a cylindrical protuberance or flange 320 that may be configured as a coupling to accept a retaining mechanism 322 that may be used to contain a position device subassembly 600 ( fig1 ). the thruster coupling may also serve as a penetrating tip to facilitate penetrating the material and for movement of very viscous fluids through the exit channel 55 and material manifold 45 , 140 of the vessel 20 , 120 . accordingly , the diameter of the thruster tip ( protuberance 320 ) should be about the same as the diameter of the exit channel 55 . to aid in insertion and removal of the material transfer device 300 from the internals of a material vessel , holes 352 or similar mechanism may be formed in the upper coupling 350 on the crown 315 . for example , as shown in fig1 , two holes 352 may be drilled in line across the coupling such that a chain or wire may be threaded through the holes to lift the force transfer device from the pressure vessel . as heretofore described , the transferred vessel may be made from any suitable metal , alloy , plastic or other polymer that would be compatible with the material to be used in the transfer system . referring now to fig1 and 16 , the hemispherical ( semi - elliptical ) transfer device 300 ( fig1 ) may be configured with an annulus management device 400 to help remove material accumulated on the inner sidewalls of the material vessel . the annulus management device includes an annular member 410 formed of natural or synthetic rubber , elastomeric polymers or other suitable materials compatible with the material being transferred in and out of the container . the annulus management device may further include a horizontal flange or flanges 420 affixed to the annular member . the horizontal flange may include ports 452 , 454 , 456 , 458 to accommodate stop cocks 442 , 444 , 446 , 448 or other venting mechanisms so that gas or air trapped below the transfer device may be released as the transfer device moves from the top to the bottom ( from the first end to the second end ) of the material vessel . the horizontal flange may be secured to the annular member by bolts and nuts 470 or other suitable fastening means . alternatively , the annular member may be glued or otherwise bonded to the flange or directly to the crown of the transfer device . a vertical portion of the flange may be welded or otherwise formed with the horizontal flange and may be attached to the transfer device by bolts and nuts 460 or other suitable fastening means . the annulus management device may be fixedly or removably secured to the force transfer device . referring now to fig1 , the refillable material transfer system may include a level indicating device 500 . many types of level indicators may be incorporated into the material transfer system , such as contact and non - contact level devices , for example for example , container weight devices ( scales ), container gas pressure devices ( pressure gages ), linear and rotary encoding devices ( tape gages ), wave devices ( laser , magnetostrictive , radio frequency , and ultrasonic ), magnetically coupled devices ( indicating rods and tapes ), displacement devices ( limit and proximity switches ), material flow devices ( flow totalizers ), optical devices ( fiberoptic , photoelectric , and visual ), gas and material interface devices ( buoyancy , capacitance , conductivity , differential pressure , and differential temperature ) and nuclear devices ( radioisotope ). one suitable system for use with the force transfer devices described herein is available from gems sensors , inc . of plainville , conn ., usa . such a device includes a stem 520 that may be disposed within the adapter pipe or central lumen of the force transfer device ( see fig1 ). the stem may include magnetic reed switches or other level indicators that are coupled to a microprocessor in a housing 560 that is visible from outside of the material vessel . a threaded coupling 540 or other securing device may be used to attach the level indicator system to the upper flange 350 of the force transfer device 300 shown in fig1 . the housing may include a programmable microprocessor ( not shown ) and other electronics such as a digital display 564 that may be configured for use with particular sizes of material vessels . the housing 560 of the system may be made of a polymer , composite , other synthetic material ; or a more robust metal or alloy construction as available from moore industries international , inc ., of north hills , calif . referring now to fig1 , to actuate the magnetic sensors in the stem 520 , a position device subassembly 600 may be configured for positioning within the force transfer device 300 shown in fig1 . the subassembly includes an outer housing 620 to contain a magnetic position device ( magnetic actuator ) 640 , which may be cylindrical or egg - shaped . a threaded cap or other coupling 660 is configured on one side of the housing so as to be secured to an adapter 322 or other mechanism on the force transfer device . the housing cap includes a bore or lumen 680 so that the stem 520 may pass through the position device subassembly . similarly , the position device is configured within a central lumen 690 so that the stem may be slidably disposed within the position device . additionally , the position device subassembly may include a cleaning mechanism ( not shown ) to remove material deposits from the stem . in operation , as the material level increases in the vessel , the transfer device holding the position device subassembly ( magnetic actuator ) moves up the stem actuating the sensors contained within the stem . as the position device ( magnetic actuator ) approaches the highest point on the stem , then the display 564 on the device will be calibrated to read one - hundred percent or some other indication to show a full vessel . the level indicating device 500 may be calibrated to show material height , weight or volume as appropriate . likewise , as the material is drained from the vessel , the transfer device approaches the bottom of the container causing the magnetic actuator to approach the lowest point on the stem and the level indicator will show a decrease in height , weight or volume of the material . fig1 - 22 illustrate how the invention can be used to dispense a personal care product such as a hand cream , lotion , shampoo , moisturizer , or other fluid consumer products . a container 700 in the form of a canister or personal care dispenser has a cylindrical wall that defines a receptacle 720 sized to receive a refillable cartridge 730 . the container 700 may be cylindrical and include a threaded upper surface 740 that receives a screw on cap 750 to create an air - tight seal with the container 700 . the container includes a button or actuator 760 that is coupled to a flow control valve 770 that manages the flow of material through the refillable cartridge 730 . the container also includes a nozzle or outlet port 780 that is used to expel the product 795 from the container via a tubular channel 790 . the refillable cartridge operates under the principles of the refillable material transfer system described above . the cartridge has a first end 735 with a gas inlet 745 for charging the refillable cartridge 730 with compressed gas , and a second end 755 with an outlet for discharging and refilling the material 795 . the cartridge 730 includes a bi - conical force transfer device 765 that is akin to the force transfer device 60 of fig1 . as shown in fig2 , the compressed gas places a force on the force transfer device 765 which in turn compresses the material 795 . when the button 760 is depressed , the valve 770 is opened which allows the compressed material 795 in the refillable cartridge to flow through the valve 770 and into the channel 790 where it can be dispensed through the outlet port 780 . once the product is largely depleted from the refillable cartridge , as shown in fig2 the cartridge 730 is connected at the second end 755 to a pressurized supply source 800 , which fills the cartridge 730 with fresh product . the product entering the cartridge 730 forces the force transfer device 765 away from the second end 755 , recompressing the gas in the cartridge so that it may once again dispense the material . the cycle of dispensing and refilling the cartridge allows many uses of the same system without generating the normal waste that would come with purchasing a new bottle container of the product each time , saving money and the environment . fig2 illustrates an alternate embodiment of the cartridge system of fig2 , wherein a boundary layer reducing material 701 has been applied to selected wetted surfaces within the refillable cartridge 730 . it is to be understood that the drawing of the boundary layer reducing material 701 is not to scale , but rather has been greatly enlarged to illustrate the invention . the wetted surfaces on the interior of the material transfer system may include the side walls , the force transfer device 765 , and the outlet channel 790 . other surfaces and elements that come into contact with the fluid 795 may also be considered a wetted surface . in a preferred embodiment , all wetted surfaces are coated with a material that reduces the boundary layer between the moving fluid and the stationary interior surfaces ( as well as the force transfer device , collectively the “ boundary layer interfaces ”) of the refillable cartridge system . the present invention affects the boundary layers between the refillable cartridge system boundary layer interfaces and the fluid to improve the performance capabilities of the system . because reducing the boundary layer impacts relatively large geometric surface areas between the cartridge system internal surfaces and the fluid , this invention significantly improves the overall efficiency and decreases the energy required to move the fluid into and out of the system . each internal surface of the cartridge may be treated or coated to create a new boundary layer between the surface wall and the bulk fluid . treatment includes altering the surface roughness ( i . e ., the measure of the average perpendicular deviation of the surface from an ideal surface ) of these surfaces . where the surface roughness is decreased by sanding , polishing , or the like , the adhesion of the fluid to these surfaces is also reduced , lowering the friction to move the viscous fluid . that is , the cartridge &# 39 ; s native internal surfaces may be polished to make them smoother , thereby decreasing the energy required to move the fluid across these surfaces and increasing the flow rate of the fluid into and out of the cartridge . alternatively , an epoxy coating may be added to the native internal surfaces to make them smoother , reducing the average wall roughness that comes in contact with the bulk fluid and therefore reducing the boundary layer . another way to reduce the boundary layer is to apply a silicone - based release agent to the internal surfaces . release agents may be independently applied to the internal surfaces , or an epoxy coating impregnated with release agents may be applied to the native internal surfaces . on the other hand , the surface roughness can be increased to augment the adhesion of the fluid to these surfaces . for example , the cartridge &# 39 ; s internal surfaces may be sandblasted to make them rougher , increasing the energy required to move the fluid within the cartridge . this increases the boundary layer , which helps to hydraulically prime the system . alternatively , a coating containing an abrasive may be added to the native internal surfaces to make them rougher , which also serves to aid in priming the system . a binder / tackifier may be added to the internal surfaces to increase the boundary layer of the fluid on these surfaces for hydraulically priming the system . binders / tackifiers may be independently applied to the internal surfaces , or an epoxy coating impregnated with binders / tackifiers may be applied to the cartridge &# 39 ; s native internal surfaces . another way to reduce the boundary layer on the wetted surfaces of the cartridge and its components is to profile ( roughen , i . e ., increase the surface roughness ) the native or coated surfaces and apply a release agent to the surfaces , where the release agent may be present in the valleys of the surfaces , to improve the retention of the release agent with the surfaces . for example , a metal cartridge could be sandblasted and coated with vegetable oil , in the same way that an internal combustion engine &# 39 ; s cylinders may be honed to retain lubricating oil in the valleys . another way to reduce the boundary layer is to utilize the porosity of certain solid materials , where a release agent may be present in the pores of the solid material and on its surfaces and may be held in the pores by capillary action . the release agent is trapped in the pores to improve the retention of the release agent in the solid material and on its surfaces . the porous solid material may be the system &# 39 ; s components ( cartridge &# 39 ; s inner wall , arrestor , force transfer device , outlet channel , etc .) and the porous solid material added to the system &# 39 ; s components ( coating , liner , cladding , etc .) for example , a metal cartridge could be lined with a self - lubricating oil - impregnated nylon sheet . examples of solid materials that are porous with a release agent in their pores and on their surfaces include a cast iron frying pan seasoned with cooking oil , oilite ® self - lubricating oil - impregnated bronze , and self - lubricating oil - impregnated nylon . other examples can be found where materials that are porous incorporate release agents in their pores and on their surfaces to improve performance or wear characteristics of the objects . the surfaces may also be altered to change the electrical , thermal , and wave resistivities of these surfaces . for example , a silicone - based electrically conductive grease may be added to the internal surfaces of the cartridge to decrease the energy required to transmit electrical energy to and from the fluid . where heating or cooling the fluid inside the cartridge is necessary , a silicone - based thermal grease may be added to the cartridge &# 39 ; s internal surfaces to decrease the energy required to transmit thermal energy to and from the fluid to better cool and heat the fluid . in acoustically manipulated materials or fluids , a glycerin / glycerine - based acoustic coupling medium may be added to the internal surfaces of the cartridge to decrease the energy required to transmit acoustic wave energy to and from the materials or fluids to better agitate the material . a silicone - based dielectric grease may also be added to the internal surfaces to increase the energy required to transmit electrical energy to and from the fluid in the cartridge , to better isolate the fluid from being affected by static electricity or other charges . alternatively , a thermal insulation material may be added to the internal surfaces to increase the energy required to transmit thermal energy to and from the fluid to better isolate the fluid from cooling and heating . in acoustically agitated materials , an acoustic viscoelastic polymeric material may be added to the internal surfaces to increase the energy required to transmit acoustic wave energy to and from the materials to better isolate the materials from agitation . the internal surfaces of the refillable cartridge system can be supplemented with other materials to change the physical properties of these surfaces . for example , certain additives will decrease the egress and ingress of materials and fluids into and out of the cartridge . a barrier coating may be added to plastic internal surfaces to decrease the permeation of gases through the plastic surfaces , preventing or reducing air and gases from entering the cartridge which may consequently reduce the shelf life of the materials and fluids in the cartridge . this invention improves the energy efficiency and other performance aspects of the refillable cartridge system in handling the materials and fluids . by attending to the boundary layers between the internal surfaces and the materials and fluids , this invention takes advantage of the relatively large geometric surface areas between them , and capitalizes on the exponential ( square area ) function and impact that this invention affects to the boundary layers in these areas . to achieve the various objects above , selected materials are applied to the internal , wetted surfaces of the system to affect the boundary layer of the moving fluid . there are many types of coatings that can be used to affect the flow of the viscous fluids through the system , including non - stick cooking sprays , dielectric gels , silicone release agents , thermally - conductive greases , teflon ® ( polytetrafluoroethylene ) non - stick coatings , anti - slip coatings , electrically - conductive greases , release agent coatings , dielectric greases , gas barrier coatings , acoustic viscoelastic polymeric insulating materials , ultrasonic couplants , coatings with aerogel thermal insulation materials , liquid repellent coatings , silicone - impregnated ( release agent ) epoxy coatings , and tackifier products to name a few . this list is intended to be illustrative and not limiting . affecting more than one of the three individual elements of the boundary layers ( the cartrodge &# 39 ; s internal surfaces , the adjacent (“ skin ”) surfaces of the materials and fluids to be moved and stored within the cartridge , and any selected boundary layer affecting materials between these two surfaces ) may impact the performance capabilities of the refillable cartridge system . for example , adding an epoxy coating impregnated with a silicon release agent both smooths the cartridge &# 39 ; s internal surfaces and adds a slippery release agent . although this invention emphasizes the impact of affecting the boundary layers ( the internal surfaces , the adjacent (“ skin ”) surfaces of the materials and fluids , and any materials between these two surfaces ) to improve the performance capabilities , this invention may also be applied in the gas space and vapor space of the system where gases and vapors may be present . where the interior walls of the cartridge 730 are smoothed to reduce the boundary layer , polishing and sandblasting are two option for effecting this change . for example , native metal internal surfaces with a rough “ mill finish ” ( from the metal rolling mill ) may be mechanically polished to be smoother with a “ super - mirror finish .” standards for smoothing are described in asme b46 . 1 , surface roughness , waviness , and lay ( american society of mechanical engineers standard ); iso 4287 geometrical product specifications ( gps )— surface texture : profile method - terms , definitions and parameters of surface texture ; and iso 4288 geometrical product specifications ( gps )— surface texture : profile method — rules and procedures for the assessment of surface texture ( international organization for standardization standard ). to effect a reduced surface roughness , the initial surface finish may be “# 1 mill finish ” and “ 60 grit ”, “ iso n9 ”, where ra ( roughness average )= 6 . 3 μm ( micrometers )= 250 μin ( microinches ). a polishing media of 500 grit ( or finer ) abrasive media is used to polish the native surface , and then a final surface finish of “# 8 super - mirror finish ” and “ 500 grit ”, “ iso n3 ”, is achieved where ra ( roughness average )= 0 . 10 μm ( micrometers )= 4 μin ( microinches ). in the case of sandblasting , the smooth native metal cartridge internal surfaces may be sandblasted “ near - white ” with abrasive media to be rougher , thereby meeting the requirements of the following standards : “ sa 2½ ”, iso 8501 - 1 preparation of steel substrates before application of paints and related products — visual assessment of surface cleanliness — part 1 : rust grades and preparation grades of uncoated steel substrates and of steel substrates after overall removal of previous coatings ; and / or sspc - sp 10 / nace no . 2 near - white blast cleaning ( the society for protective coatings and national association of corrosion engineers joint surface preparation standard ). in particular , superhydrophobicity is obtained with a tapered cone 302 geometry but less so with a cylindrical pillar geometry ( see fig2 ). another way to reduce the boundary layer is to formulate fluid repellent structures on wetted surfaces of the system . these structures may be hydrophobic , superhydrophobic , omniphobic , and superomniphobic . a discussion of superhydrophobicity can be found in an article by antonio checco et al . entitled “ robust superhydrophobicity in large - area nanostructured surfaces defined by block - copolymer self assembly ,” adv . mater . 2013 . to achieve the desired effect , block - copolymer - based thin film patterning is used to create large - area superhydrophoibic surfaces textured with feature sizes approaching 10 nanometers . tuning the nanostructure shape and aspect ratio significantly influences the surface - wetting properties . yet another way to reduce the boundary layer is to apply a fluid repellent coating or film to the wetted surfaces of the system . these coatings may be hydrophobic , superhydrophobic , omniphobic , and superomniphobic . examples of these coatings are rust - oleum ® neverwet ™ superhydrophobic coating , http :// www . rustoleum . com / product - catalog / consumer - brands / neverwet / neverwet - kit /, http :// www . neverwet . com /, and integrated surface technologies repellix superhydrophobic ceramic coatings , http :// www . insurftech . com /.) while particular forms of the invention have been illustrated and described with regard to certain embodiments of material transfer systems , it will also be apparent to those skilled in the art that various modifications can be made without departing from the scope of the invention . more specifically , it should be clear that the present invention is not limited to any particular method of forming the disclosed devices . while certain aspects of the invention have been illustrated and described herein in terms of its use with fluids and other specific materials , it will be apparent to those skilled in the art that the refillable material transfer system and force transfer device can be used with many materials not specifically discussed herein . further , particular sizes and dimensions , materials used , and the like have been described herein and are provided as examples only . other modifications and improvements may be made without departing from the scope of the invention . accordingly , it is not intended that the invention be limited , except as by the appended claims . | 6 |
fig1 - 3 disclose various embodiments of applicants &# 39 ; novel holster and drain assembly 10 . holster and drain assembly 10 is seen to engage a bar gun 12 as is known in the art , the bar gun having a handle portion 14 and a nozzle portion or nozzle 16 . as seen in fig2 and 3 , the cylindrical nozzle portion of bar gun 12 is seen to engage the holster and drain assembly 10 through receipt into a mounting surround structure . applicants &# 39 ; novel structure achieves several advantages . it may be seen that applicants &# 39 ; holster and drain assembly 10 includes a holster portion or a holster 18 for engaging a drain body 20 and a mounting plate 22 . more specifically , the figures illustrate the manner in which applicants &# 39 ; holster and drain assembly or assembly 10 may be comprised of three pieces , with the mounting plate 22 mounted to a support surface , a subassembly comprising of the holster 18 and the drain body 20 , which subassembly is toollessly and removably assembled , and which can be removed from mounting plate 22 for subsequent cleaning . put another way , applicants provide a sub - assembly comprising a holster and drain body , which are joined together , the two elements joined slideably without tools to a mounting plate . applicants &# 39 ; drain body and holster may then be disassembled and separately washed separately . typically , the drain body portion 20 , which includes a pan portion 40 for receipt of extraneous liquids dripping from the holster nozzle , will need to be cleaned . easy and slideable disassembly from the holster and mounting plate facilitates such ease of washing . further details of applicants &# 39 ; novel assembly 10 may be appreciated with reference to the foregoing description . turning first to drain body 20 , it is seen from the figures to be in an integral body having land portions 19 and 24 laterally spaced apart from one another , which land portions have lower edges 21 and 23 . drain body 20 is seen to have walls defining an upper edge 26 , which upper edge may include upper edges 27 and 29 of the land portions 19 and 24 , as well as upper edge 31 of curved front wall 30 . applicants &# 39 ; drain body 20 typically includes a pair of spaced apart sidewalls 28 , which sidewalls join land portions 19 and 24 , and which sidewalls curve and define the curved front wall 30 . applicants &# 39 ; drain body 20 includes a curved bottom wall 32 and a flat rear wall 34 . at the bottom of rear wall 34 is lower drain channel 36 . part of curved front wall 30 includes overflow opening 38 . an imaginary horizontal line drawn between the lower edge of overflow opening 38 extending across drain body 20 to rear wall 34 defines an imaginary line below which the pan portion 40 of drain body 20 exists , to receive fluids dripping from nozzle tip 16 a , as best seen in fig2 . it is also seen in fig2 and 2a that upper drain opening may be defined by either an opening surrounded by walls ( enclosed ) or shaped like a slot 38 a extending below upper edge 31 . an opening will refer to either configuration . bottom wall 32 typically is angled downward from curved front wall 30 to lower drain channel 36 , such that fluid accumulated in the pan will flow to lower drain channel 36 . moreover , with reference to fig3 , it is seen that bottom wall 32 is curved on either side to direct fluid flow in pan portion 40 to lower drain channel 36 . turning now to applicants &# 39 ; mounting plate 22 , it is seen to be generally comprised of a horizontal tabular portion 42 integral to and joined with a vertical portion 44 , the two portions which may be braced by a pair of laterally spaced apart diagonal brace portions 46 . turning now to tabular portion 42 , it is seen that tabular portion 42 comprises an upper wall 48 , which is typically the uppermost part of assembly 10 , which upper wall 48 is flat so as to fit flush against the underside of the support surface . a multiplicity of fastener holes 50 are provided in the upper wall for receipt of fasteners , such as screws therethrough , to fixedly and rigidly maintain tabular portion and mounting plate 22 to a support surface . upper wall 48 is also seen to include retainer slot 52 ( fig2 ), which can releasably lock an engagement means of the holster member 18 as set forth in more detail below . tabular portion 42 further includes a front wall 54 , which front wall 54 , as best seen in fig3 , includes walls defining a pair of receiving channels or slots 56 , which are dimensioned to receive support legs 75 of holster member 18 as seen in fig1 and 3 . vertical portion 44 of mounting plate 22 includes a front wall 58 , including a lower portion 60 , the lower portion including a channel 62 therein . channel 62 has a drain member portion 66 that typically extends rearward from vertical portion 44 ( that is to say , opposite from the tabular portion 42 , which extends forward from the upper portion of vertical portion 44 ). channel 62 has an id of typically ⅜ inch or greater to avoid clogging ( one actual id may be 0 . 425 ″). drain member portions 66 of channel 62 is adapted to receive a drain line dl thereon . channel 62 joins a lower drain channel receiving portion 64 , which has an outer diameter slightly larger than channel 62 , which outer diameter is dimensioned to receive lower drain channel 36 of drain body 20 therein . typically a few o - rings are located between lower drain channel 36 ( outer walls ) and the walls defining lower drain channel receiving portion 64 for a fluid tight couple . channel 62 includes a drain member portion 66 acting to receive a drain line dl extending outward and rearward from lower member 60 , which channel 62 also includes a lower drain channel receiving portion 64 , as best seen in fig2 , for coupling , here , fluid tight and telescopically , with lower drain channel 36 of drain body 20 . turning now to holster member or holster 18 , it may be seen with reference to the figures that holster member includes a top wall 70 typically having a tabular or flat portion 72 designed to slideably receive and lay flush against the underside of upper wall 48 when the two parts are joined and in use as seen in fig2 . top wall 70 is also seen to have a pair of parallel , laterally spaced apart , outwardly extending support legs 75 , which are designed and dimensioned to slideably engage the paired spaced apart parallel receiving slots 56 of tabular portion 42 on mounting plate 22 ( see fig3 ). top wall 70 may also include an angled portion 74 in one embodiment , details of which will be further discussed and set forth below . holster member 18 includes a pair of sidewalls 76 depending from top wall 70 . sidewalls 76 curve and join to define a nose portion 78 which may bear a similar curve , though a larger radius of curvature , when compared to curved front wall 30 of drain body 20 . a pair of spaced apart parallel leg members 80 extend inward from the lower portion of sidewalls 76 to slideably receive lower edges 21 and 23 of land portions 19 and 24 of drain body 20 . holster member 18 will slideably receive drain body 20 through sliding engagement wherein lower edges 21 and 23 track along leg members 80 and upper edges 27 / 29 slide along the underside of top wall 70 until bumper 41 ( optional ) or the most removed part of curve on front wall 30 of drain body 20 strikes inner wall of curved nose 78 of holster member as seen in fig2 . when such contact is made , it will be seen that rear wall 34 will be generally flush with rear perimeter edge 83 of holster member as seen in fig2 . the two will typically lay flush against front wall 58 of mounting plate 22 when the subassembly 18 / 20 is coupled to mounting plate 22 as seen in fig2 . turning back to top wall 70 , it is seen that a biased or flexible retainer member 84 may be provided with a near end 84 a integral with and attached to top wall 70 , and a removed end 84 b , which is free to be depressed . depressing may release a raised locking tab 86 near the removed end from an engaged position with retainer slot 52 of mounting plate 22 . channels 85 on either side of retainer member 84 separate the retainer member from the top wall 70 , such that the only place the retainer member joins the top wall is at near end 84 a . the removed end 84 b , since the retainer member 84 is typically a resilient plastic , is capable of flexing . pressing gently downward at free removed end 84 b will allow uncoupling of the locking tab 86 when it resides in slot 52 as seen in fig2 . this allows removal of the holster member from the mounting plate . moreover , the holster member slideably couples to the drain body . the drain body is typically not lockingly engaged to the mounting plate , but has walls that “ telescope ” into the holster , which holster in turn locks to the mounting plate . the sub - assembly defined by the holster member and drain body will be removed ( without the use of tools ) from the mounting plate and be received onto the mounting plate utilizing the retainer member 84 with locking tab 86 coupling / uncoupling with retainer slot 52 of the mounting plate . turning again to holster member 18 , structure is defined and set forth herein , which structure provides a function of receiving the nozzle of a bar gun in a manner which maintains the removed or furthermost end 16 a of the nozzle at least above pan portion 40 . structure provided by applicants &# 39 ; novel holster member includes cylindrical nozzle receiving member 88 typically provided in the angled portion 74 of the top wall . nozzle receiving member 88 may include upper lip 89 . inner walls 90 of nozzle receiving member 88 may include an annular shoulder portion 92 above a lip 94 . the lip 94 may define an opening for accommodating the removed end of the nozzle and the annular shoulder portion 92 being dimensioned according to the distance between a corresponding shoulder 16 b of a nozzle . that is to say , nozzle receiving member 88 is dimensioned to receive a nozzle . annular shoulder 92 receives shoulder 16 b of the nozzle such that , and according to the distance between shoulder 16 b of nozzle and removed end 16 a of nozzle , the removed end 16 a of nozzle will stay at least above the imaginary line below which defines the pan portion 40 ( dash line in fig2 ) and preferably above a horizontal line across drain body 20 defined by upper portion or upper edge 38 b of overflow opening 38 . with such a dimension , for example , ⅛ - 1 inch , a bartender viewing overflow opening 38 , located as it is below nose 78 and below the nozzle , would notice any accumulated leakage from the pan portion and be able to remove it from the mounting member and wash it . moreover , the geometry of nozzle receiving member 88 , the nozzle , and the pan portion 40 ( dash line in fig2 ), dictate the nozzle should not rest in any accumulated , and potentially contaminating , fluid accumulated in the pan ( as , for example , if the drain is clogged ). it is to be noted that any nozzle engaging member may be provided on holster 18 to engage the bar gun to maintain the nozzle fully seated in the nozzle receiving member 88 , but with its removed end above the pan portion . structure for retaining the removed end of the nozzle above the lower lip of the overflow opening may include locating lip 94 so that its distance above pan portion 40 is greater than the distance of the nozzle ( to be used with the holster ) that the nozzle extends beyond the lip . in other words , the tip of the nozzle will be maintained above the pan portion 40 . in an alternate preferred embodiment , the removed end of the nozzle will be maintained at or above the upper edge 386 of the overflow opening ( see fig3 ). a second structure that may be provided that will maintain the removed end of the nozzle above at least the pan portion or an alternate preferred embodiment above the upper edge of the overflow opening would be to set the dimension between lip 89 and either of the pan portion or the upper edge of the overflow opening such that when the bar gun rests fully seated in the nozzle receiving member 88 , the juncture of the bar gun nozzle and the handle rests on lip 89 such that the removed end of the nozzle is set properly . that is to say , in fig2 , it can be seen that , if there were no lip 94 , the nozzle could be inserted all the way into the nozzle receiving member until the junction of the handle to the nozzle stops such motion . in such a case , even without a lip , the dimension of the assembly may set the removed end of the nozzle in the proper position . a typical clearance that has worked well to maintain a cylindrical nozzle in the cylindrical nozzle receiving member is about 0 . 012 inch , range about 0 . 003 - 0 . 070 , optimum 0 . 005 - 020 , preferably the nozzle receiving member is non - elastomeric and may be a rigid plastic , such as abs . generally , a clearance fit will have a lower end of about 0 . 003 , the upper range could exceed 0 . 070 , and still achieve the benefits of a clearance fit . that is to say , there should be sufficient clearance between the outer diameter of the bar gun nozzle and the inner diameter of the nozzle receiving member . however , if there is too great a clearance , the nozzle will not stay firmly attached and may work its way out with repeated jostling and nudging . typically , extraneous fluid from the nozzle would simply drain out by running down bottom wall 32 ( inclined as seen in fig2 ) and out to drain line dl . however , should channels 62 and 36 become clogged or the drain line itself becomes clogged , then fluid may accumulate in the pan portion 40 . regardless of the fluid accumulation , however , it should not rise above pan portion 40 , as it would then drain out overflow opening 38 ( and be visible to a user ). overflow opening is located spaced outward from holster receiving member 88 so as to be easily viewed by the bartender . fig3 , 4 , 5 , and 6 illustrate the assembly set forth above and parts thereof . fig4 and 5 illustrate an external view of applicants &# 39 ; novel holster assembly for a bar gun . in fig4 , it is seen how the nozzle of the bar gun will rest in the assembly and the manner in which the assembly may mount to the underside of a support surface . moreover , fig4 illustrates that the fluid level in the pan portion , if any , as accumulated may be viewed through the upper drain opening ( visible in fig4 ). fig5 illustrates the same view as fig4 , except with the bar gun removed and details of the sliding mechanism as well as the releasably retaining mechanism may be appreciated that allow the sub - assembly of the drain body and holster member to slide on and off a mounting surface , easily and without tools , for disassembly and washing . fig6 illustrates the sub - assembly formed by the holster member and the drain body as it is ready for receipt onto the mounting member . fig7 illustrates the drain body apart from the rest of the assembly and the manner in which the drain body is configured to receive excessive waste fluid and remove it from the pan portion through the lower drain channel . if there is blockage or other accumulation , the drain body will allow such excess fluid above the pan portion to drip out of the upper drain opening . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limited sense . various modifications of the disclosed embodiments , as well as alternative embodiments of the inventions will become apparent to persons skilled in the art upon the reference to the description of the invention . it is , therefore , contemplated that the appended claims will cover such modifications that fall within the scope of the invention . | 1 |
in the following detailed description , only the preferred embodiment of the invention has been shown and described , simply by way of illustration of the best mode contemplated by the inventors of carrying out the invention . as will be realized , the invention is capable of modification in various obvious respects , all without departing from the invention . accordingly , the drawings and description are to be regarded as illustrative in nature , and not restrictive . in detecting h . pylori , the inventors tried to substantially lower false positive rates due to the subjectivity of the readers by transforming the existing urease enzyme tests from the methods conventionally used to a composition that uses a speedy change of colors that enables an accurate determination to be made rapidly by comparing the test results simultaneously with positive and negative controls . namely , since test kits using existing urease enzyme tests detect the ph increase caused by oh − ions produced from the reaction of water with the ammonia generated by simply decomposing urea , the inventors tried to eliminate the ammonium ions themselves in order to increase the rate of ph change . to do this , the inventors applied the phenate method ( standard methods for the examination of water and wastewater 19th ed . 1995 , american public health association , pp 4 - 80 ˜ 4 - 82 .) used in quantification of ammonium ions . the urea decomposition process by urease is presented as following reaction formula : ( nh 2 ) 2 co + 2h 2 o → 2nh 3 + h 2 co 3 ( irreversible reaction ) 2nh 3 + 2h 2 o2nh 4 + + 2oh − ( reversible reaction ) total reaction : ( nh 2 ) 2 co + 4h 2 o → 2nh 4 30 + 20h − + h + + hco 3 − the constituents of this present invention increase ph promptly by transforming the products of the above described urea decomposition process , i . e ., ammonium ions , into indophenol blue to continue urea decomposition . in order to achieve the above described purpose , the phenate method , a remarkably effective method of measuring ammonia concentration in the aqueous solution , is applied . the phenate method , using the principle that ammonia under a manganic catalyst reacts with hypochlorite base and phenol to change into indophenol blue , can be described as the following reaction formula : 2nh 4 + + ocl − + 2c 6 h 5 oh → o ═ c 6 h 4 ═ n — c 6 h 4 — nh 2 that is , the constituents of this invention make the reaction speed faster in order to increase ph rapidly by adding phenate reagent solution to constituents used in the conventional urease enzyme test and transforming ammonium ion generated in the urea decomposition process by the above described urease into indophenol blue . additionally , naocl is among the constituents that acts to reduce false positives that follow increased concentrations due to urease from bacilli as it has an inhibiting effect on weak urease activity . this also allows test results to be obtained after longer testing time periods . in this invention , the added quantity of phenate reagent solution is adjusted within a range so that h . pylori urease activity is not inhibited and color change of the ph indicator is not affected . this invention &# 39 ; s constituents and the possible content range of each components is as below : kh 2 po 4 from 0 . 05 to 0 . 2 vol %, 0 . 002 ˜ 0 . 005 vol % of an indicator having pk a from 6 . 5 to 8 . 5 and a balance of water from the above described composition , urea acts as a urease substrate which h . pylori produces , about 0 . 5 ˜ 4 vol % of content is an appropriate level to measure activity of urease which h . pylori produces . kh 2 po 4 acting as a buffer solution should include 0 . 05 ˜ 0 . 2 vol %, i . e ., it can not obtain desired the ph range at lower than 0 . 05 vol % and tends to inhibit ph change at higher than 0 . 2 vol %. the phenate reagent solution , acting to transform ammonium ions into indophenol blue and to inhibit urease activities of other microorganisms should be included at 0 . 8 ˜ 1 . 7 vol %, i . e , at lower than 0 . 8 vol % the effect of increasing the ph change speed by eliminating ammonium ions and the inhibiting effect of urease activity of other microorganisms are insufficient , while at higher than 1 . 7 vol % ph is increased much too high and the urease activities of other microorganisms as well as h . pylori tend to be inhibited . an indicator having a pka from 6 . 5 ˜ 8 . 5 acts to sense ph change , with phenol red being the most appropriate in this invention , preferably between 0 . 002 ˜ 0 . 005 vol % for the precise determination . phenol red has characteristics of showing yellow in an acid solution and a purplish - red color in a basic solution . the above described phenate reagent solution containing in detail a manganous sulfate solution acting as a catalyst , hypochlorite reagent acting as a reactant reacted with ammonium ions and phenate reagent , and is especially desirably composed of 1 vol % manganous sulfate solution , 0 . 5 vol % hypochlorite reagent and 0 . 2 vol % phenate reagent . moreover , it is further desirable that this constituent contains 0 . 5 ˜ 2 vol % of a gelling agent , e . g ., agar , as it can then be used conveniently in the form of a soft gel . it is preferable that constituent is controlled in the range of ph 6 . 0 ˜ 7 . 8 because it aides precise determination when the ph is kept in this range . further desirable components and contents range of this invention &# 39 ; s constituents are as follows : 2 vol % urea , 0 . 05 vol % kh 2 po 4 , 1 vol % manganous sulfate solution , 0 . 5 vol % hypochlorite reagent , 0 . 2 vol % phenate reagent , 0 . 0025 vol % phenol red , 1 vol % agar , and a balance of water . on the other hand , desirable components and contents of stock solution of phenate reagent solution used in this invention are as follows : manganous sulfate solution ; 0 . 05 vol % mnso 4 h 2 o , and a balance of distilled water , hypochlorite reagent ; 1 vol % naocl , and a balance of distilled water , phenate reagent ; 2 . 5 vol % naoh , 8 vol % phenol , and a balance of distilled water . this invention is to react with the above described constituents by placing biopsy tissue obtained through an endoscope on the gell made of the above described constituents and observe color change . the gell is made of he above described constituents and a positive control gell is produced by adding to the above described constituents a minimum quantity of naoh that can show positive results , i . e ., 10 ˜ 20 μl 0 . 1 n naoh solution . a determination can be made as to whether or not there is an h . pylori infection comparing the color of the negative control gell in which naoh is not added at all . accordingly , a test device with positive and negative controls placed side by side for comparison at a glance with colors indicating positive or negative results will decrease erroneous test results due to the subjectivity of the reader . a perspective view of a detecting kit according to this invention is presented in fig1 and side view in fig2 respectively . an application example of a detecting kit according to this invention is also presented in fig3 . referring to the above described fig1 to 3 , 1 is a cover , 2 is a container , most desirably a transparent container made of an acrylic material , 3 is detecting composition according to this invention , 4 is a test device , 5 is the biopsy specimen area , desirably opaquely treated such that biopsy specimen is not seen from the side , 6 is the negative control , 7 is the positive control and 8 is the biopsy sample . a desirable practical example and comparative example of this invention are described . however , the below described practical example is only one of practical examples of this invention and this invention is not limited to the below described practical example . 20 vol % urea , 2 vol % kh 2 po 4 , 0 . 01 vol % phenol red , and 2 vol % agar . as stock solution of phenate reagent , 100 ml of manganous sulfate solution was made by adding distilled water to mnso 4 h2o 50 mg , 100 ml of hypochlorite reagent was made by adding distilled water to 10 ml of 10 % naocl and the ph was adjusted to 6 . 8 with concentrated hypochloric acid . 100 ml of phenate reagent was prepared by adding distilled water to 2 . 5 g of naoh and 8 ml of phenol . after the above described agar solution was autoclaved ( 121 ° c ., 1 . 5 atm ) for 15 minutes , it was left alone until it is used in the water tank at 55 ° c . and the below described 2 x reagent were produced . a 50 ml mixture was made by mixing the above described 10 ml urea stock solution , 2 . 5 ml kh 2 po 4 stock solution , 25 ml phenol red stock solution , 1 ml manganous sulfate solution , 0 . 5 ml hypochlorite reagent and 0 . 2 ml phenate reagent and adding distilled water . after bacilli of the above described produced 2 x reagent were filtered out by 0 . 2 μm filters , the same amount as 2 % agar solution was mixed . as a result of that , the final concentration of the constituents was as below and the final ph was 7 . 5 at this time : 2 % urea , 0 . 05 % kh 2 po 4 , 0 . 0005 % manganous sulfate , 0 . 005 % naocl , 0 . 2 % phenate reagent ( 0 . 005 % naoh , 0 . 016 % phenol ), 0 . 0025 % phenol red and 1 % agar . the composition manufactured from example 1 was injected into one wall of a multiwall plate , test device with biopsy tissue obtained from an endoscope , a positive control was made by injecting into another wall the composition manufactured and by further adding 10 μl of 0 . 1 n naoh to the above described composition , a negative control was made by injecting the above described composition into another wall , thereby making an h . pylori detecting kit . the above described detecting kit is called “ pet ( pylori easy test ) kit ”. after a patient &# 39 ; s biopsy tissue was obtained , a clotest and pet of example 2 were used on that biopsy tissue simultaneouly , and the positive rate per hour was compared and the results were described in the below table 1 . as a result , pet could confirm 76 . 9 % of total positives within one hour and 100 % after 3 hours . on the other hand , clotest could confirm only 17 . 6 ˜ 30 % of the positives and 100 % only after 24 hours . however , uncertain color which could not be distinguished distinctly appeared after 24 hours and the positive rate was varied from 38 . 4 % ( 10 / 26 ) to 65 . 3 % ( 17 / 26 ) depending on the observers . therefore , we can see that rapid dtermination is possible in the case where pet is used according to this invention . after that , we observed the degree of consistency of pet results with the pcr method . here , the pcr method used an amplifying method of 26 kda protein gene , a method known as the most unique and sensitive in h . pylori detection ( ho , s , et al . 1991 , direct polymerase chain reaction test for detection of h . pylori in human and animals , j . clin . microbiol , 29 pp 2543 ˜ 2549 ). the results were described the following table 2 : from the above described table 2 , we can see that all of the 26 biopsy tissues are consistent with the results of the pcr method when using this pet invention and that the consistency ratio ranges between 61 . 5 ˜ 80 . 7 % for the clotest . therefore , we can see that it is possible to judge that this pet invention is more precise than clotest . biopsy tissue obtained during an endoscoping was refrigerated at − 20 ° c . for 1 week , and the pet and clotest were then performed according to the same method as in test example 1 with the results compared and presented in table 3 and table 4 . from table 3 and table 4 , if pet according to this invention is used , it is notable that precise judgement is possible on biopsy tissue in which urease activity of h . pylori was decreased to certain degree . { p this invention could provide h . pylori detecting compositions which tell promptly and precisely whether or not an h . pylori infection ( the source bacterium causing gastrointestinal disorders ) exists , and the same results can be obtained even after time has elapsed and the compositions are easily used in an endoscope chamber . the invention provides an h . pylori detecting kit and a method of using h . pylori detecting compositions . urease decomposition capacity was examined on h . pylori bacterium and staphlococcus hominis bacterium separated from biopsy tissue obtained during an endoscoping in order to examine the h . pylori peculiarity of pet . the examination method involved first having h . pylori bacterium and s . hominis bacterium cultivated and diluted in sterilized distilled water so as to have an appropriate number of bacilli , and then pet and clotest were performed and compared according to the same method as in test example 1 . the results were described in table 5 . from the above described table 5 it is noted that if pet according to this invention is used , high peculiarity detection is possible with urease activity of h . pylori showing a fast response and urease activity of other bacilli showing low response . although preferred embodiments of the present invention have been described in detail hereinabove , it should be clearly understood that many variations and / or modifications of the basic inventive concepts herein taught which may appear to those skilled in the pesent art will still fall within the spirit and scope of the present invention , as defined in the following claims . | 8 |
in fig1 the load resistance of a cable being processed is represented by a resistor 2 . connected across the cable load resistance 2 between terminals p1 to p2 is a first series circuit 3 which includes a relay 4 having contacts 4a and 4b , a low current supply 6 , a low current shunt 8 , and if desired a fuse 17 . the low current supply may for example be any device for generating a 5 amp d . c . current of which many are known in the art and the low voltage shunt 8 may be any shunt rated at 50 millivolts for 5 amp applied current . a second series circuit 10 is connected between terminals p1 and p2 in parallel with the first circuit 3 . the second series circuit 10 includes a pringle switch 12 , a high current supply 14 , and a high current shunt 16 . the high current generator 14 may comprise d . c . rectifiers ; the pringle switch 12 is a high current switch having contacts 12a and 12b , and the high current shunt 16 may be a shunt rated at 100 millivolts for 2 , 000 amp applied current . a circuit comprising the series connection of the relay 5 and potentiometer 7 is connected across the terminals p1 and p2 . the potentiometer 7 may be of the slide wire type and have a resistance of 200 ohms . high current shunt 16 is connected through the contacts 11a and 11b of a relay 11 to the input terminals 21a and 21b of a first circuit branch y . low current shunt 8 is connected to terminals 21a and 21b of circuit y through contacts 4c of relay 4 and contacts 13a of relay 13 . by means of relays 4 , 11 and 13 the input of circuit branch y may be taken across either shunt 8 or shunt 16 . the manner of switching this input will be described more fully below . fig2 illustrates a circuit 18 which generates an output signal which is representative of cable temperature by comparing the voltage drops across either low current shunt 8 or high current shunt 16 with the voltage drop across the cable load 2 appearing across terminals p1 and p2 . in a first branch z of this circuit the voltage developed across cable load 2 between terminals p1 and p2 is applied to the input of a noise filter 20 through a parallel circuit comprising a series connection of the contacts 15a of relay 15 , resistor 21 and the contacts 11c of relay 11 in parallel with the contacts 13b of relay 13 . variable resistance 23 connected across the incoming circuit from the junction point of resistor 21 and the contacts 11c of relay 11 . the filter 20 may include a coil 31 and capacitors 33 and 35 connected to the terminals of coil 31 and across the incoming signal . the filtered output of filter 20 is then applied to the input of an amplifier 22 through a voltage divider comprising resistor 37 , which is connected between the filter 20 and one input of amplifier 22 , and resistor 65 , which is connected across amplifier 22 . the amplified output of amplifier 22 , a signal z , is applied to terminal 24 , one of two input terminals of a voltage divider network 26 . it has been found that this circuit branch z performs well when the resistors 21 and 23 have resistances of respectively 2k ohms and 50 ohms , the coil 31 has a value of 1 . 5 henry and 95 ohms resistance for 10 milliamp current , the capacitor 33 and 35 each are 150 mfd / 350 volts , the resistor 37 is 2 . 55k ohms and the resistor 65 is a variable resistance with a maximum value of 120k ohms . the amplifier 22 may be an operational amplifier such as philbrick / nexus model sq 10a with a power supply voltage of 15 volts d . c . applied across its input terminals 22a and 22b and a bias voltage of 15 d . c . volts is applied to its input terminals 22c through variable resistance 39 which may have a value of 50k ohms . in the second branch y of the circuit 18 the voltage drop appearing across terminals 21a and 21b is applied to the input of a noise filter 28 . the filter 28 may comprise a bridge circuit including coils 41 and 43 and capacitors 45 , 47 , 49 and 51 . the output of filter 28 is applied to an amplifier 30 through a first voltage divider comprising resistors 53 and 55 and a second voltage divider comprising resistors 57 and 59 . resistor 55 is connected across the amplifier 30 . it has been found that this y branch of circuit 18 performs well when coils 41 and 43 of filter 28 are each 1 . 5 henery and 95 ohms at a current of 10 milliamps , the capacitors 45 and 47 are each 300 mfd / 350 volt , capacitors 49 and 51 are each 100 mfd / 350 volts , the resistance of resistor 53 is 1k ohms while that of resistor 55 is 100k ohms in the first voltage divider and the resistance of resistor 57 is 1k ohms while that of resistor 59 is 100 k ohms in the second voltage divider . the amplifier 30 may be an operational amplifier such as a philbrick / nexus model 1003 , which is chosen to generate an output equal to 100 ( e 2 - e 1 ) where e 2 and e 1 are the voltages appearing at terminals e 1 and e 2 . a power supply voltage of 15 volts d . c . is applied to terminals 30a and 30b of the amplifier 30 and a potentiometer 61 preferably having a resistance of 5k ohms is attached across two other terminals 30c and 30d of the amplifier 30 . the outputs of amplifiers 22 and 30 are applied respectively to the z input terminal 24 and the y input terminal 32 of a divider network 26 . the divider network 26 is chosen such that it generates an output x on its output terminal 34 which conforms to the equation where z is the input appearing on terminal 24 and y is the input appearing on terminal 32 . a power supply voltage of 15 volts d . c . is applied across the bias terminals 26a and 26b of the voltage divider 26 . hybrid systems analog divider network model 106a may be used as the divider network 26 . the output x of divider network 26 which appears at terminal 34 is applied to a resistance network comprising the series connection of resistor 71 , potentiometer 73 and resistor 75 which is connected to a source of reference voltage . the resistor 71 may have a value of 9 . 1k ohms , the potentiometer 73 may have a value of 1k ohms and resistor 75 may be 1k ohms . a digital meter 38 , such as datascan model 420 - v 2 , may be connected to potentiometer 73 and to a source of reference potential 77 to provide a digital temperature readout . if desired the output terminals 38a and 38b of digital meter 38 may be connected to a high temperature alarm 80 . the alarm 80 may be any device adopted to provide an auditory or visual output when the output of the digital meter 38 reaches a predetermined maximum value . the source of reference potential 77 may include a - 15 volt d . c . power supply 79 and a voltage divider network including a resistor 81 , a potentiometer 83 and a resistor 85 which is connected to a source of common voltage and may have resistances of 33k ohms for resistor 81 , 1k ohms for potentiometer 83 and 680 ohms for resistor 85 . the operation of the inventive cable measuring circuit will now be described with reference to the relay diagram of fig3 in which the relays 4 and 11 may be potter brumfield model 14an - 120 , relays 5 , 13 , 15 and 88 may be potter brumfield model 11an - 120 and relay 90 may be a time delay relay such as guardian model tdo - 62c30 - 115a . heating current i 2 is generated in heating circuit 10 by the high current supply 14 and caused to flow through the high current shunt 16 , the cable load 2 and the pringle switch contacts 12a and 12b resulting in a voltage drop across cable load 2 between terminals p1 and p2 , and a voltage drop across shunt 16 when the pringle switch 12 is in its closed position . the cable load 2 provides a d . c . resistance which varies with the cable being processed and increases in value as the cable is heated during the drying process . the series circuit 10 which provides heating current i 2 is utilized during the actual cable drying process as a part of the circuit to measure cable temperature as described below . during periods when the pringle switch 12 is closed , relay contacts 4a and 4b are open and relay 5 is deenergized . the heating current i 2 is then flowing in circuit 10 , the voltage drop across the high current shunt 16 is applied to the noise filter 28 of the branch y of circuit 18 and after passing through filter 28 and the voltage dividers comprising the pairs of resistors 53 and 55 , and 57 and 59 is applied to the input terminals e 1 and e 2 of the amplifier 30 . the output of amplifier 30 corresponding to 100 ( e 2 - e 1 ) is then applied as signal y to input terminal 32 of the divider network 26 . the voltage drop across cable load 2 is simultaneously applied to the input terminals of the z branch of circuit 18 , through the closed relay contacts 15a and 11c and the voltage divider of resistors 21 and 23 . then through noise filter 20 and the amplifier 22 , the output of amplifier 22 is applied to input terminal 24 of divider network 26 as signal z . in response to input signals y and z the divider network 26 generates an output signal x which is a function of these input signals as described above . this output signal is in turn applied through potentiometer 73 in the series connected resistances 71 , 73 and 75 to one input of the digital meter 38 . as indicated above the digital meter 38 then responds to input signal x and a reference input signal to provide a temperature readout which may for instance be in degrees farenheit during all periods in which either the heating current i 2 or the testing current i 1 is flowing . the reference signal is supplied to a second input terminal of digital meter 38 by reference voltage supply 77 . reference supply 77 includes a - 15 volt d . c . supply 79 and a resistance network including resistors 81 and 85 and potentiometer 83 . its output is taken from potentiometer 83 . a high temperature alarm device may be connected to the output terminals 42 of digital meter 38 and may be adjusted to generate a visual or auditory alarm signal whenever the cable temperature reaches or exceeds a predetermined upper limit value . the heating current i 2 is disconnected by opening the pringle switch 12 when the pringle switch 12 is opened contacts 12a and 12b open breaking heating circuit 10 and placing the shunt circuit including the contacts of relay 5 and potentiometer 7 in parallel with the cable load 2 and energizing relay 88 . as seen in fig3 relay 88 has normally open contacts 88a which are connected across the a . c . supply . contacts 88a of relay 88 are connected in series with relays 5 , 4 , 13 and a delayed relay 90 . the relay 88 also has normally closed contacts 88b which are connected across the a . c . supply and in series with relays 11 and 15 . when relay 88 is energized it in turn energizes relay 90 and relay 5 . energizing relay 5 permits conduction in the shunt circuit including relay 5 and potentiometer 7 . the relay 90 is a delayed relay , chosen to have a delay period of 10 seconds at the end of which contact 90a is held in an open position deenergizing relay 5 and opening the shunt circuit and contact 90b closes energizing relays 4 and 13 . when relay 4 is energized contacts 4a and 4b close completing circuit 3 . low voltage d . c . supply 6 , which is preferably rated at 5 amperes , then causes a low voltage testing current i 1 to flow in circuit 3 and generates a voltage drop across low voltage shunt 8 . since contacts 4c and 13a of energized relays 4 and 13 are then closed the voltage drop across shunt 8 appears at the input terminals 21a and 21b of the y circuit . since current i 2 is not flowing , there is no voltage drop over shunt 16 during this period and in any case contacts 88b are open during this period so that relays 15 and 11 are deenergized and contacts 11a and 11b are open interrupting the connection between the y circuit and high current shunt 16 . during this period since relays 15 and 11 are deenergized and relay 13 is energized , the voltage divider at the head of the z circuit branch comprising resistor 21 and potentiometer 23 is bypassed . this voltage divider is unnecessary with the relatively low voltage drop across the cable load 2 resulting from testing current i 1 and is only utilized for the higher voltage drop across the shunt 16 resulting from the high current i 2 . circuit branches y and z operate as described above and voltage divider 26 again generates a signal at terminal 34 to activate digitalmeter 38 . when the heating current i 2 is to be restarted the pringle switch 12 is closed closing contacts 12a and 12b to complete circuit 10 and deenergizing relay 88 . this causes contact 88a to open and deenergizes relays 4 and 13 and causes opened contacts 88b of relay 88 to close energizing relays 11 and 15 . the contacts 4a , 4b , 4c and 13a are thus opened cutting circuit 3 and disconnecting shunt 8 from the y circuit while contacts 11a and 11b are closed connecting shunt 16 to the y circuit . in the z circuit bypass relay contacts 13b open and contacts 15a and 11c close to connect the voltage divider including resistor 21 and potentiometer 23 across the input filter 20 to protect against the high voltage drop across cable load 2 resulting from this passage of high heating current i 2 through the cable load 2 . as described above the circuit of fig1 and 3 provides constant cable temperature monitoring through digital meter 38 and high temperature alarm 80 during periods when the heating current i 2 is flowing as well as during periods when it is disconnected and testing current i 1 flows . this provides a constant check on cable temperature and prevents costly wastage caused by overheating . | 6 |
reference is first made to fig1 of the drawings , which illustrates expansion apparatus 10 in accordance with a preferred embodiment of the present invention , shown located in the upper end of a section of tubing in the form of bore liner of expandable metal , hereinafter referred to as liner 12 . in use , the apparatus 10 and liner 12 are run into a drilled bore together , and the liner 12 positioned in a section of unlined bore , and possibly overlapping the lower end of existing bore - lining casing . the apparatus 10 is then operated to expand the liner 12 to a larger diameter , the liner of the original , unexpanded diameter being identified as liner 12 a , and the expanded larger diameter liner being identified by the reference numeral 12 b . the apparatus 10 includes a rolling element expander 14 having a generally conical body 16 carrying a number of rolling elements 18 . the expander 14 is coupled to a hydraulic drive motor 20 mounted on a running tube 22 which extends upwardly , through a stuffing box 24 , to surface . the stuffing box 24 is provided in an upper seal assembly 26 mounted to the top of the liner 12 . mounted below the expander 14 , via a swivel 28 , is a lower seal assembly 30 which is adapted to provide a sliding seal with the unexpanded liner 12 a . in use , the volume 32 defined by the liner 12 between the seal assemblies 26 , 30 is supplied with high pressure hydraulic fluid from an appropriate source , such as a surface or downhole pump . in fig1 a hydraulic fluid inlet 34 is illustrated as passing radially through a part of the upper seal assembly 26 , however in practice the inlet 34 would be arranged axially , to allow accommodation of the apparatus 10 in a bore , and to allow supply of hydraulic fluid via a running tube in the form of a coaxial coil tubing or drill pipe . the pressure of the hydraulic fluid is selected to induce a predetermined hoop tensile stress within the liner 12 . the hydraulic fluid exhausts through the drive motor 20 , which includes a hydraulic fluid driven turbine , the exhausted fluid passing up to the surface via the running tube 22 . the exhausted fluid is throttled , or the flow and pressure of the fluid otherwise controlled , to control the pressure within the volume 32 , and also the operation of the motor . the throttling may take place downhole or at surface . the passage of fluid through the motor 20 causes the motor to rotate the expander 14 , and thus if the motor 20 is advanced through the liner 12 , the expander 14 will act on the transition portion 12 c between the section of unexpanded and expanded liner 12 a , 12 b . the forces acting on the transition portion 12 c comprise a combination of the stress induced by the elevated hydraulic fluid pressure within the volume 32 , and the mechanical pressure forces applied by the surfaces of the rolling elements 18 . the combination of forces is selected so as to be sufficient to induce yield and thus plastic deformation of the liner 12 . as noted above , the lower seal assembly 30 isolates the pressurised volume 32 from the remainder of the unexpanded liner 12 a , which is at a lower pressure than the volume 32 . accordingly , the differential pressure acting on the assembly 30 produces an axial force tending to push the apparatus 10 through the liner 12 . there is thus no requirement to apply weight from surface to the apparatus 10 . a liner 12 to be expanded is 7⅝ ″ 29 . 7 lb \ ft n80 tubing which has a burst pressure of approximately 7 , 000 psi . the hydraulic fluid supplied to the volume 32 is at 5 , 000 psi . the liner wall is therefore subjected to a tensile stress of 51 , 000 psi , which represents 63 % of the yield for the liner ( not taking into account the effect of radial stress in the region of 25 , 000 psi ). the drive fluid to the hydraulic motor 20 enters through an inlet port 36 and exhausts into the running tube 22 , thereby adding the motor pressure drop to the applied internal pressure . the hydraulic return to surface is throttled to maintain the applied liner pressure , taking into account the motor pressure drop and the parasitic losses in the running tube 22 . the net axial force applied to the expansion assembly is the pressure differential across the lower seal assembly 30 times its cross - sectional area minus the pressure differential across the stuffing box 24 times the cross - sectional area of the running tube 22 . if the running tube 22 has an outside diameter of 5 ″ and the internal diameter of the 7⅝ ″ liner is 6 . 88 ″ , then the down force applied to the assembly is 83 , 000 lbf , which is in excess of the force required to drive the expander 14 through the liner 12 , such that a braking assembly must be provided on surface for the running tube 22 . alternatively , a larger diameter running tube 22 could be utilised . reference is now made to fig2 to 6 of the drawings , which illustrate an alternative expander 40 in accordance with a further embodiment of the present invention , shown located in a section of liner 42 during expansion . from a comparison of the figures , those of skill in the art will recognise that fig2 shows various internal features of the expander 40 . the expander 40 features a generally conical body 44 on which are mounted five rows of rollers 46 , 47 , 48 , 49 and 50 ( the section shown in fig6 corresponds to both sections 6 — 6 and 6 a — 6 a of fig2 ). unlike the rolling elements 18 of the first described embodiment , the rollers 46 to 50 rotate around axes that lie substantially perpendicular to the liner axis , and the expander 40 is therefore intended to advance axially through the liner 42 , without rotation . such an expander configuration would not be practical in the absence of assisting hydraulic expansion forces , as the bearing loads experienced on expanding heavy walled tubing would far exceed the capabilities of the bearings that could be installed in the limited space available . however , with applied internal hydraulic pressure providing the bulk of the expansion forces , the roller bearings are relatively lightly loaded . reference is now made to fig7 of the drawings , which illustrates an expansion apparatus 60 in accordance with a further embodiment of the present invention located within a partially expanded borehole liner 58 . the apparatus 60 includes an expander cone 62 mounted to a tubular running string 64 , and mounted below the cone 62 is a seal assembly 66 adapted to provide a sliding seal with the unexpanded liner 58 . as with the above described embodiments , an elevated fluid pressure above the seal assembly 66 provides an initial expansion force acting on the liner 58 , while the passage of the cone 62 provides a further mechanical expansion force which , in combination with the hydraulic expansion force , is sufficient to induce yield in the liner 58 . the axial pressure force acting on the seal assembly 66 may also serve to drive the cone 60 through the tubing 58 , and the presence of the pressurising force around the cone 62 provides an effectively infinite supply of lubricant for the cone 62 ; fluid communication across the cone 62 may be assured by provided linked ports 68 , 70 above and below the cone 62 . it will be apparent to those of skill in the art that the above - described embodiments provide an alternative method for expanding tubing downhole , and that the invention offers a number of advantages over existing systems . furthermore , those of skilled in the art will recognise that the above - described embodiments are merely exemplary of the present invention , and that various modifications and improvements may be made thereto , without departing form the scope of the invention . for example , in the embodiment of fig1 , rather than providing a hydraulic fluid driven motor 20 within the pressurised volume 32 , a motor may be provided externally of the volume 32 , and may be located downhole or at surface . in this case , the upper seal assembly 26 would of course have to be modified to accommodate rotation . | 1 |
the present invention provides a method for treating fiber to achieve wet strength while retaining repulpability and / or recyclability . in an embodiment , a paper - making process is provided . the process has a first flow line which contains secondary fiber in the form of , for example , old corrugated containerboard (“ occ ”). secondary fiber may be defined as fiber which has been dried at least once . in an embodiment , a portion of this line is separated into a second line and is treated with cationic resin . a third , and separate , line contains virgin fiber . virgin fiber may be defined as a predominance of cellulosic fiber which has never been dried after a pulping process . the virgin fiber line is combined with the untreated secondary fiber in the first flow line . the treated portion is then recombined with the mixed product of the first line and the virgin fiber line . products made from the combined flow lines demonstrate wet strength as well as sufficient repulpability . moreover , separation of the virgin fiber from the secondary fiber provides the system with less cationic demand . accordingly , less resin is required to treat the secondary fiber . referring now to the drawings wherein like numerals refer to like parts , fig1 illustrates a system 2 which may be used to produce a base sheet having a first line 4 into which is fed secondary fiber in the form of , for example , untreated occ from a supply or furnish 6 . a flow rate extending from the furnish 6 may be in a range from 2500 gpm to 4500 gpm . moreover , the secondary fiber supplied may represent 10 - 40 % of the total fiber in the system . at point 8 , line 4 may be split into separate lines wherein the line 4 is untreated and wherein the line 12 is treated with a cationic resin treatment at a point 14 . the resin may be provided from a supply 15 . a flow rate for the line 12 may be in a range from 500 gpm to 3000 gpm . examples of resins which may be utilized are cationic polyamide - epichlorohydrin ( pae ) resins , as well as cationic urea - formaldehyde ( uf ) and melamine - urea - formaldehyde ( muf ) condensation products . in an embodiment , the occ and / or other secondary fiber which has been drawn off from line 4 is treated with , for example , kymene ®. a mix time for the cationic treatment may be in a range from 30 seconds to 90 seconds . the treated secondary fiber travels along line 16 to a blend chest pump 18 at a flow rate in a range from 1500 gpm to 2000 gpm . approximately 20 - 30 % of the total flow exiting the blend chest pump 18 consists of treated secondary fiber . more specifically , the total flow exiting the blend chest pump 18 may include untreated secondary fiber and / or treated secondary fiber and / or virgin fiber . of this total flow , 10 - 40 % may be treated secondary fiber ; 5 - 50 % may be untreated secondary fiber ; and 60 - 90 % may be virgin fiber . a virgin fiber furnish 20 provides a line 22 of virgin fiber to the blend chest 10 at a flow rate in a range from 5400 gpm to 7500 gpm . more specifically , the virgin fiber supplied may represent 60 - 90 % of the total fiber in the system . at the blend chest 10 , the virgin fiber may be mixed with the untreated secondary fiber flowing from the line 4 . the mix time for the virgin fiber and the untreated secondary fiber is in a range from 5 minutes to 20 minutes . next , the combined virgin fiber and untreated secondary fiber is mixed with the treated secondary fiber line 16 at the blend chest pump 18 . a mix time for the combination of the lines 4 , 12 and 22 is in a range from 1 minute to 3 minutes . the entire mixture may then be transferred to a system 24 for drying and / or pressing and / or other finishing activities . in an embodiment , the line 12 of secondary fiber which is treated may be supplied by an independent stream rather than split from the line 4 . in an embodiment , a furnish used to supply the line 12 may be different than a furnish used to supply the secondary fiber in the line 4 . the independent line may be treated with cationic resin prior to combination with the secondary fiber line 4 and the virgin fiber line 22 in a manner similar to that described above . flow rates may be adjusted to create the system parameters outlined above . for example , the flow rate of the independent line may be adjusted wherein the treated secondary fiber accounts for 20 - 30 % of the total fiber exiting the blend chest pump 18 . in another embodiment , a single line of secondary fiber may be supplied . this line may be treated with a cationic resin treatment and combined with virgin fiber . in this embodiment , the virgin fiber line may be combined with only treated secondary fiber . example 1 , illustrated in fig3 , describes an embodiment of the present invention in which fiber was treated to provide a product having wet strength and adequate repulpability . more specifically , in the example below , the objective was to produce paper with wet strength , and normal repulpablility . to achieve this , 15 % to 25 % of the furnish was treated with a strong dose of wet strength resin . the treated portion gave the sheet 50 % to 70 % of the strength found in a normal wet strength sheet . the sheet was considered repulpable because only 20 % of the sheet was treated with wet strength resin . it should be understood that , although example 1 describes an embodiment in which all of the secondary fiber is treated , this should not be construed to limit any embodiments in which a portion of the total amount of secondary fiber used is untreated . in this embodiment , top sheet wet strength was added to a top tickler pressure relief line 40 using amres ®. a tank 41 provides a supply of virgin fiber for the top ply of product . in a first step , the air was bled from the pressure relief line 40 at a point 42 . this was performed by opening a pressure control valve 44 to 50 % output . this is the pressure relief line 40 from the top tickler outlet 46 . next , isolation valves 45 on each side of an automatic pressure relief valve 44 were opened . a 1 . 5 ″ flush valve 48 was opened on the pressure relief line 40 just above an entry point in the machine chest pump suction 50 . this was performed for a duration sufficient to bleed the air from a pressure recirculation line 52 . the isolation valve 45 from the top tickler pressure relief valve 44 was opened at the top machine chest pump suction 50 . a 250 to 300 gpm difference was established between the top basis weight flow and the top tickler flow . the valve 56 on the wet strength resin addition point 58 was opened . a 2 #/ ton wet strength addition was then established . the top tickler power was minimized as shear may reduce wet strength resin efficiency . the wet strength addition set point was increased to 6 #/ ton at a point in the process which was 2 reels before starting the order . wet strength addition was adjusted to control test . the virgin fiber in this process was delivered to a blend chest 47 . base sheet wet strength resin was added before the occ refiner 60 . to this end , the total occ flow from a tank 61 was set at 20 % of the base basis weight flow ( 1600 to 1900 gpm ). the occ flow controller ( not shown ) was set to manual because the wet strength resin may negatively influence the flow indication . the flow indicator ( not shown ) from the occ refiner 60 can be used for control . as shown in the figure , treated secondary fiber and virgin fiber are mixed in a blend chest 65 . the base blend chest level set point was reduced to meet the residence time requirement in the chest because excessive mix time may reduce wet strength resin efficiency . the valve 62 on the wet strength resin addition point was then opened . a 2 #/ ton wet strength addition was then established . the wet strength addition set point was increased to 6 #/ ton at a point 2 reels before starting the order . wet strength addition was adjusted to control test . the system was then flushed . to this end , the wet strength addition rate was reduced to 2 #/ ton . the suction valve ( not shown ) on the wet strength supply tank ( not shown ) was then closed . next , the flush water valve ( not shown ) was opened for sufficient time to flush the system of resin . the wet strength pump ( not shown ) was stopped after the flush was complete . the isolation valves ( not shown ) at the base and top addition points were closed when the flush was complete . fig2 illustrates a chart of a comparison of product rejects based on conventional methods of paper manufacturing and methods of the present invention . in the embodiments of the present invention , a portion of secondary fiber is treated with cationic resin prior to combination with virgin fiber . in the figure , the square - shaped symbols represent a percentage of rejects for a set of rolls which were produced . the diamond - shaped symbols represent an amount of resin used per ton to treat the system . each diamond - shaped symbol corresponds to each square - shaped symbol , as they represent a trial collectively . from the figure , it can be seen that those products in which a portion of secondary fiber was treated prior to combination with virgin fiber provided less rejects . thus , these embodiments demonstrated greater repulpability on average . moreover , the products of the present invention required less resin , on average , in comparison to conventional products . this is due to the separation of the virgin fiber line from the secondary fiber line . this separation may prevent any possible reaction between the anionic byproduct associated with the virgin fiber and any cationic resin added to the system to treat the secondary fiber . for example , in conventional systems , a line combining secondary fiber and virgin fiber may have a charge of 0 . 3 - 3 . 0 meq / l . however , in the present invention , a secondary fiber line , prior to combination with the virgin fiber , may have a charge in a range from 0 . 1 - 1 . 0 meq / l . accordingly , less resin is necessary to treat the secondary fiber . table 1 shows data in a comparison between products prepared using conventional methods ( denoted “ ws ”) and products prepared using at least one of the methods of the present invention ( denoted reels 1 , 2 and 3 ). as can be seen in the table , the method of the present invention enables wet strength grade products . moreover , the present invention allows for greater repulpability , as evidenced by the considerably fewer percentage of rejects . while the embodiments of the invention have been illustrated and described , as noted above , many changes can be made without departing from the spirit and scope of the invention . accordingly , the scope of the invention is not limited by the disclosure of the embodiments . instead , the invention should be determined entirely by reference to the claims that follow . | 3 |
the present invention is directed to a mass producible launch system and related launch pad , supplemental propulsion and control systems , as well as corresponding construction techniques . in the following description , several alternative embodiments of the invention are described in detail . it will be appreciated that many other alternatives , modifications and configurations are possible in accordance with the present invention . one embodiment of a launch system 10 according to the present invention is shown in fig1 - 4e . referring first to fig1 the illustrated launch system 10 is a multistage system , although single stage to orbit vehicles may be provided in accordance with the present invention . generally , the illustrated launch system 10 includes a first stage 12 , a second stage 14 , a third stage 16 , and a payload fairing 18 . the payload fairing 18 houses the payload 36 ( fig2 b ) that is to be delivered to orbit , e . g ., a satellite or satellites , interplanetary probe , weapon system or other payload system . the stages are separated by separation systems 20 and 22 , such as any of various pyrotechnic or electromechanical systems , that allow for a separation and discharge of expended stages . in this manner , the stages 12 - 16 can be used in series to boost the payload into the desired orbit . the payload fairing 18 is attached to the final stage 16 by suitable payload adapter 24 . as shown in fig1 each of the stages includes a hollow central structural spine 26 extending along the longitudinal axis 28 of the system 10 , and a thrust structure 30 - 34 , as discussed in more detail below . fig2 a and 2b show a novel launch pad system 38 according to the present invention . the hollow structural spine 26 of the launch system 10 allows for receiving internal launch support structure , thereby eliminating electrical and pneumatic ports on the external surfaces of the system 10 and allowing much of the launch pad system 38 to be shielded from exposure to super heated rocket engine exhaust . the launch pad system 38 includes : an optional launcher interface 40 for engaging the launch system base about a periphery thereof , thus defining a launch pad pit area 42 beneath the interface 40 ; a launch platform 44 disposed in the pit area 42 and telescopic umbilical tower 46 that extends upwardly from the platform 44 into the hollow spine of the launch system 10 . the umbilical tower 46 provides structural support for the system 10 prior to launch and further mates with umbilical interfaces 48 - 52 at the base of each stage 12 - 16 . the umbilical interfaces 48 - 52 provide electrical support for system electrical systems and pneumatic connections for charging the system &# 39 ; s propellant and oxidizer tanks , as well as life support and any additional prelaunch support services . the umbilical tower 46 is preferably moveable between an extended position ( as shown ) to a retracted position wherein the tower 46 is withdrawn into the supporting launch platform 44 in preparation for launch . any suitable elevating motors may be employed to actuate the telescopic motion of the tower 46 . although not shown , sliding or swinging doors or the like may be provided to close off the pit area from the base of the system 10 , thereby providing shielding against launch heat and pressure , and minimizing recurring damage to the launch pad system 38 . fig3 a - 3c show details of a single stage 12 , 14 or 16 . each stage 12 - 16 is composed of multiple , preferably substantially identical elements or segments 54 that can be produced in quantity thereby allowing mass production techniques to be employed with attendant reliability and efficiency advantages . in this regard , propulsion , pneumatics and structural systems are preferably incorporated into such mass producible , substantially identical elements . the number of segments 54 in the launch system 10 can be varied depending on mission requirements and it is expected that the number of segments required for typical missions will be between about 10 - 500 . in the illustrated embodiment , the body of each stage 12 - 16 is defined by a number of generally wedge - shaped segments 54 . the segments 54 form liquid rocket fuel and oxidizer tanks as generally indicated by the markings &# 34 ; f &# 34 ; and &# 34 ; o &# 34 ; ( fig3 c ). any combination of chemical propellants can be used . it will be appreciated that the ratio of fuel tanks to oxidizer tanks and the tank arrangement can be varied to accommodate propulsion system requirements . the illustrated segments 54 are arranged to form alternating fuel and oxidizer tanks in side - by - side relationship . the segments 54 are attached to one another and to the structural spine 26 by any suitable technique . each stage 12 - 16 also includes a forward structural interface 56 and an aft structural interface 58 , each of which may be a ring - like structural flange . the forward structural interface 56 is used for interconnection to an additional stage 14 or 16 via a separation system 20 or 22 or , in the case of the final stage , for interconnection to the payload fairing 18 by way of payload adaptor 24 . the aft structural interface is used to interconnect a stage 12 - 16 to an underlying stage or , 12 or 14 in the case of the initial stage 12 to the launcher interface 40 . alternatively , the launcher interface 40 can be omitted and the vehicle 10 can be mounted on a sufficiently sturdy umbilical tower in preparation for launch . each stage 12 - 16 further includes a rocket engine system 60 . such a rocket engine system 60 may be a single rocket engine or may be partitioned , e . g ., one engine per stage or one engine per fuel tank / oxidizer tank pair or other grouping may be provided . in the illustrated embodiment , each stage includes one thrust structure 30 - 34 such as a central aerospike structure . the stages 12 - 16 may also include doors 72 for closing the spine 26 area during launch for enhanced backpressure . referring to fig4 a - 4e , the engine system 60 for each stage , further involves individual thrusters 70 associated with each fuel / oxidizer tank pair or other segment grouping . each thruster 70 receives fuel and oxidizer from associated segments . the fuel and oxidizer are brought into contact in a combustion chamber 64 of the thruster 70 and the resulting combustion product is accelerated and directed towards the thrust structure 30 - 34 by nozzle 68 . in addition to providing the thrust necessary for launching , the illustrated thrusters provide a number of control functions . in this regard , each of the illustrated thrusters 70 includes a throttle control or metering valve for adjusting the total mass flow through the thruster 70 . by adjusting the relative mass flows of opposing thrusters 70 , the overall thrust vector of the launch system can be controlled . in addition , each of the thrusters 70 can be configured to provide a small component of tangential thrust , the direction of which can alternate from thruster - to - thruster . roll control can thus be accomplished by creating a force imbalance with respect to the alternating thrusters , e . g ., via appropriate mass flow metering . it will be appreciated that separate , dedicated thrusters may be provided for thrust vector and roll control in place of or in addition to the mechanisms described above . fig4 a - 4e also show the general geometry of segment 54 and the segment / spine interface . each segment 54 in the illustrated embodiment , has a generally wedge - shaped configuration . the segments 54 are attached to the spine 26 by bolts 74 , welding or other suitable attachments . the segments 54 are also connected to one another at their ends . it will be appreciated that the segments can be connected directly to each other along the longitudinal axis forming central , hollow cavity without the need for a separate , central spine structure . it will further be appreciated that the segments 54 can be insulated for cryogenic fluid storage where applicable using external 76 and / or internal ( not shown ) insulation , with or without liners . the segments 54 can be constructed from metallic or advanced composite materials , with welded steel providing a low cost option . the system 10 will generally not require pressure for structural integrity due to the central spine 26 and skin thicknesses . as shown , each segment 54 can further include manifolds 66 for tank venting and pressurization . it will be appreciated that the manifolds 66 are configured to link with corresponding umbilical tower conduits for launch site venting and pressurization . an alternative launch system 80 according to the present invention is shown in fig5 - 8e . the launch system 80 generally includes a first stage 82 , a second stage 84 , a third stage 86 , a payload fairing 88 containing payload 90 , an aerospike engine system 92 associated with each of the stages 82 - 86 , separation systems 94 disposed between the stages 82 - 86 , and a payload adapter 95 disposed between the third stage 86 and a payload fairing 88 . the launch system 80 further includes a central spine 98 and can be used in connection with the launch platform 38 as described above in connection with fig2 . as best shown in fig6 - 8e , the launch system 80 includes in - line tanks 100 within each stage 82 - 86 . the tanks 100 include lower tanks 102 and upper tanks 104 . the upper tanks 104 are connected to the ground umbilical interface 106 of each stage by way of appropriate lines 108 that allow for upper tank 104 venting and pressurization . additional feedlines 96 connect the upper tanks 104 to thruster units 112 and similar ground umbilical manifolds . the illustrated in - line tank configuration allows fuel and oxidizer to be contained within a single segment 110 . in this regard , either the lower 102 or upper 104 tank within a given segment 110 can contain fuel whereas the other 102 or 104 tank contains oxidizer . each segment 110 can further be associated with its own thruster units 112 . in this manner , each individual segment 110 and associated thruster unit 112 can be constructed as a self - contained system integrating propulsion , pneumatics and structural elements . each segment further includes a forward structural interface 117 and an aft structural interface 118 for connecting to other stages and / or the payload fairing 88 or launch pad system 38 , and a fuel - to - oxidizer tank interface 119 . additionally , as shown in fig8 d , each stage 82 - 86 also includes avionics 114 for launch system control and guidance . the individual segments 110 are connected to the spine 98 by appropriate connections such as bolts 116 . the corresponding construction method involves mass producing segment units at a production facility by : fabricating the tanks 102 and 104 as integral , welded steel portions of the segment 10 and integrating them with interconnecting hardware , fabricating or otherwise providing a thruster unit 112 ; installing feed 96 and vent and pressurization lines 108 for interconnecting the tanks 102 and 104 to an umbilical interface and the thruster unit 112 ; and installing avionics and other control elements . these mass produced segment units can then be assembled on - site or shipped to another staging location . in either case , the segment units are assembled to form stages 82 - 86 by attaching an appropriate number of segments 110 to a structural spine 98 . the segments 110 may also be interconnected at their ends . the stages 82 - 86 can then be completed by attaching thrust structure , such as an aerospike structure , if such structure was not provided ( in segmented form ) with the individual segments . as shown , each stage may further include doors 114 that can be closed at launch time to support base pressure . finally , the stages 82 - 86 can be assembled , with intervening separation system 94 and the payload fairing 88 can be mounted via the payload adaptor 96 , to complete the launch system 80 . the launch system 80 can then be transported to the launch site and positioned on the launch pad . the umbilical tower is then extended into the spinal cavity of the system 80 , the umbilical connections are made and tank fill and pressurization may begin . alternatives for tank pressurization include a &# 34 ; blow down &# 34 ; system using high pressure bottles , or a pump and heat exchanger system using system propellants . referring to fig9 a further alternative launch system 120 according to the present invention is shown . the launch system 120 includes first 122 , second 124 , and third 126 stages separated by appropriate separation systems 128 . the system 120 further includes a payload fairing 130 containing payload 132 . the payload fairing 130 is connected to the third stage 126 by payload adapter 134 . each stage 122 - 126 further includes thruster units 136 and an external aerospike nozzle 138 . the illustrated launch system 120 makes use of the central spine 140 to provide a supplemental thrust system based on jet propulsion such as ram jet or scram jet propulsion . in this regard , air inlets 142 are provided in conjunction with the payload adapter 134 or other location to allow ambient air to enter the hollow spine 140 . a jet engine system 144 is provided at the base of the spine 140 . the jet engine system 144 generally includes a ram or scram inlet ramp 146 for introducing air into the ram or scram combuster 148 . the air is heated in the combuster 148 and is then accelerated and expelled via ram / scram nozzle 150 to provide supplemental , air breathing propulsion during launch . it will be appreciated that such jet engines 144 may be provided in connection with one or more of the stages 122 - 126 . the heat for the combuster 148 may be generated by burning fuel from the segments or separate , dedicated tanks may be provided . while various implementations of the present invention have been described in detail , it is apparent that further modifications and adaptations of the invention will occur to those skilled in the art . however , it is to be expressly understood that such modifications and adaptations are within the spirit and scope of the present invention . | 1 |
referring to fig1 to 3 , one embodiment of the present invention includes a controller 2 that detects the impact degree through a plurality of sensors 1 of a bumper ( b ) when a pedestrian accidentally impacts with the vehicle . an actuator 4 is pivotally fixed at one end thereof via a support bracket ( sb ) to a vehicle body ( c ) forming a side of the engine compartment and projects a cylinder rod 4 c by being actuated by controller 2 . a linkage is mounted between the vehicle body and hood ( h ) and is widely opened for lifting the hood ( h ) from the vehicle body while cylinder rod 4 c of actuator 4 protrudes and applies a pressing force thereto . actuator 4 instantaneously and linearly projects cylinder rod 4 c ; and a pyrotechnic type actuator is preferably used in the present invention which protrudes out cylinder rod 4 c by using the exploding force of the actuator . while the hood ( h ) is in a closed state , actuator 4 is in parallel with the hood beneath the hood ( h ). when protruding out , cylinder rod 4 c of actuator 4 faces the rear of the vehicle , and the support bracket ( sb ) supporting actuator 4 to the vehicle body ( c ) is fixed on the fender of the vehicle body ( c ). controller 2 is preferably an airbag control unit ( acu ) that controls the airbag of the vehicle . under a slight impact detected via the sensors , the acu generates an operation signal of the actuator so as to lift the hood and protect the pedestrian without inflating the airbag . the linkage is pivotally connected to a vehicle body ( c ) via a vehicle body mounting bracket 7 and a vehicle body hinge pin ( ch ). similarly , linkage is pivotally connected to the hood ( h ) via a hood mounting bracket 8 and a hood hinge pin ( hh ). the linkage includes a lower link 5 and an upper link 6 , wherein lower link 5 is coupled at one end thereof via an operation hinge pin ( wh ) to cylinder rod 4 c of actuator 4 , while the other end of lower link 5 is coupled via the vehicle body hinge pin ( ch ) to vehicle body mounting bracket 7 . upper link 6 is coupled at one end thereof via a transmission hinge pin ( th ) to lower link 5 , and the other end of upper link 6 is coupled via the hood hinge pin ( hh ) to hood mounting bracket 8 . lower link 5 includes a support body portion 5 a coupled via the vehicle body hinge pin ( ch ) to vehicle body mounting bracket 7 . an extended connection portion 5 b is extended out from support body portion 5 a between the transmission hinge pin ( th ) ( coupled with upper link 6 ) and the operation hinge pin ( wh ) ( coupled with cylinder rod 4 c of actuator 4 ). a position restricting chin 5 c protrudes downward from support body portion 5 a for restraining the pivot of lower link 5 . while the hood ( h ) is closed , position restricting chin 5 c is supported at the lower portion thereof by vehicle body mounting bracket 7 . hood mounting bracket 8 coupled with upper link 6 via a hinge is fixed at a hood reinforcing bracket ( r ) that reinforces the rigidity of the hood ( h ). vehicle body mounting bracket 7 and hood mounting bracket 8 are formed with a hood retreat preventing portion ( ka ) for preventing a removal of the hood ( h ) toward the passenger compartment while the hood ( h ) is closed . hood retreat preventing portion ( ka ) is composed of a lower hood receding lock chin 7 a upwardly protruding at one side of vehicle body mounting bracket 7 , and an upper hood receding lock chin 8 a bent to protrude out to the front of lower hood receding lock chin 7 a at one side of hood mounting bracket 8 . a link restrictor ( kb ) restrains the pivot of upper link 6 while the hood is in a closed position . the link restrictor ( kb ) is constituted by a latch protrusion 13 protruding at one end of upper link 6 . a pivot latch 10 is coupled at one end thereof via a latch hinge pin ( jh ) to vehicle body mounting bracket 7 and is formed with a latch chin 10 a , which protrudes out for engaging with latch protrusion 13 . a spring 12 is interposed between an extended support end 11 a ( protruding from vehicle body mounting bracket 7 ) and an extended latch end 10 c ( one end of pivot latch 10 ) for retaining the engaged state of pivot latch 10 with latch protrusion 13 while the hood ( h ) is closed . pivot latch 10 is also formed with an extended hinge end 10 b protrusively extended and fixed via the latch hinge pin oh ) to a hinge coupling end 11 projecting from vehicle body mounting bracket 7 . the link restrictor ( kb ) of fig4 ( a ) includes a latch protrusion 13 protruding from one end of upper link 6 . an extended pivot latch 14 extends from one end of lower link 5 toward latch protrusion 13 of upper link 6 . a latch chin 14 a protrudes from one end of extended pivot latch 14 for engaging with latch protrusion 13 of upper link 6 . the link restrictor ( kb ) of fig4 ( b ) includes a mount restraint end 18 formed at one end of upper link 6 in an arc sectional shape . a plate spring latch 15 is fixed at vehicle body mounting bracket 7 and generates a restricting force against upper link 6 through a stably mounting groove 15 a that is dented for accommodating mount restraint end 18 . the link restrictor ( kb ) of fig4 ( c ) includes a latch protrusion 13 that protrudes out from one end of upper link 6 . a pivot latch 16 is formed with an extended hinge end 16 b , which is fixed via a restricting hinge pin ( sh ) to hinge coupling end 11 protruding from vehicle body mounting bracket 7 , and a latch chin 16 a protruding out for engaging with latch protrusion 13 . a torsion spring 17 is coupled to the restricting hinge pin ( sh ). one end of torsion spring 17 is fixed to pivot latch 16 while the other end is fixed to an extended support end 17 a protruding from vehicle body mounting bracket 7 . the operation of the present invention will now be described with reference to fig5 . in a normal state , the front of the hood ( h ) is supported via a hood latch to the vehicle body , and the rear of the hood ( h ) is stably supported via the link restrictor ( kb ) to the vehicle body ( c ). if the user releases the hood latch for an inspection of the engine compartment or the like , the hood ( h ) pivots about the hood hinge pin ( hh ) as a pivot shaft and is opened upward . the link restrictor permits the hood to stably be opened and closed about the hood hinge pin ( hh ) by restraining the end of upper link 6 from upwardly pivoting . in case the pedestrian collides with the vehicle under a certain impact degree , the apparatus of the present invention lifts up the rear portion of the hood , thus preventing or attenuating the impact of the pedestrian . when receiving the impact signal from sensors 1 corresponding to the collision of the pedestrian with vehicle , the acu detects the intensity of impact and determines as to whether the operation of actuator 4 is required . if the acu determines to operate actuator 4 , cylinder rod 4 c rapidly protrudes out from actuator 4 , as illustrated in fig5 , and the linkage raises the rear portion of the hood ( h ). cylinder rod 4 c of actuator 4 slightly pivots upward , accordingly . that is , if lower link 5 of the linkage receives a force from cylinder rod 4 c , extended connection portion 5 b of lower link 5 pivots upward about the vehicle body hinge pin ( ch ) of vehicle body mounting bracket 7 . next , upper link 6 connected via the transmission hinge pin ( th ) to lower link 5 moves upward via the rotational force of lower link 5 . thus , the hood ( h ) is raised at the rear portion thereof about the hood latch as a pivot point . this separates the hood ( h ) from an engine cover ( e ) and forms a gap therebetween for absorbing or lessening impact of the pedestrian fallen on the hood ( h ). when the hood ( h ) is lifted , the link restrictor ( kb ) releases the restraint of upper link 6 . that is , when upper link 6 is raised by lower link 5 and latch protrusion 13 pushes latch chin 10 a of pivot latch 10 , pivot latch 10 slightly pivots about the latching hinge pin ( jh ) and latch protrusion 13 of upper link 6 escapes from latch chin 10 a of pivot latch 10 . spring 12 supporting pivot latch 10 is compressed in response to the pivot degree of pivot latch 10 . identical operation is accomplished in the other embodiments of the link restrictor ( kb ). in case of fig4 ( c ), under a normal state , latch chin 16 a of pivot latch 16 restricts latch protrusion 13 of upper link 6 , and thus , the rear portion of the hood ( h ) is stably supported by the vehicle body ( c ); however , once actuator 4 operates , latch protrusion 13 of upper link 6 moves upward and pushes latch chin 16 a of pivot latch 16 . the pivot of pivot latch 16 deforms torsion spring 17 and allows an upward motion of upper link 6 . if extended pivot latch 14 is integrally formed at a distal end of lower link 5 ( see fig4 ( a )), as actuator 4 operates , extended pivot latch 14 pivots with lower link 5 according to the pivot of lower link 5 and withdraws from latch protrusion 13 of upper link 6 , thus allowing the release of upper link 6 . if mount restraint end 18 of upper link 6 is restrained by plate spring latch 15 ( see fig4 ( b )), as actuator 4 operates , mount restraint end 18 elastically deforms plate spring latch 15 corresponding to the pivot of upper link 6 and escapes from stably mounting groove 15 a . since upper hood receding lock chin 8 a of hood mounting bracket 8 ( fixed to the hood ( h )) and lower hood receding lock chin 7 a of vehicle body mounting bracket 7 ( fixed to the vehicle body ( c )) are distantly installed in a fore / aft direction of the vehicle ( see fig3 ), the hood retreat preventing portion ( ka ) gives no effect to each other while the hood ( h ) ascends . provided that the hood ( h ) is raised , lower link 5 and upper link 6 are widely opened , as shown in fig5 ( c ), by cylinder rod 4 c . this state is maintained with the gas pressure maintained in actuator 4 . in case the pedestrian is fallen on the hood ( h ) of the vehicle and applies impact thereon , actuator 4 , lower link 5 , and upper link 6 attenuate the impact . if the impact from the pedestrian on the hood ( h ) is transmitted to upper link 6 , upper link 6 pivots downward and presses lower link 5 . as lower link 5 moves down , actuator 4 connected to lower link 5 is shortened in length and descends the hood ( h ) for absorbing impact transmitted to the pedestrian . when lower link 5 inserts cylinder rod 4 c into actuator 4 , cylinder rod 4 c exhausts the gas of actuator 4 and smoothly buffers the impact applied to the pedestrian . the gas exhaust from actuator 4 is a typical structure of the pyrotechnic type actuator , wherein when cylinder rod 4 c forcibly presses the gas in actuator 4 , the gas is discharged by a piston formed with a vent hole , or the like . the gas discharging speed of actuator 4 should appropriately be set through experiments and calculations for optimally buffering the impact of the pedestrian . as apparent from the foregoing , there is an advantage in that the apparatus of the present invention is configured to allow a linkage , connected to each other via hinges , to be widely opened and lift the hood ( h ) according to the linear motion of an actuator longitudinally aligned along a side of the vehicle body in the fore / aft direction of the vehicle , thereby minimizing the occupancy of the actuator and linkage , and obviating interference with adjacent components without changing the structure of the vehicle body . furthermore , the actuator of the present invention is aligned lengthwise along the side of the vehicle body and fixed at both ends thereof via hinge pins so that only the linkage is installed in the vehicle during the print coating process and the actuator may be attached after the completion of the coating process . still further , the cylinder rod of the actuator is designed to pressurize the center portion of the hinged linkage for opening the linkage , thereby enabling to lift the hood high enough according to the length adjustment of the linkage and form a compact structure by using the actuator having a relatively short stroke . | 1 |
referring initially to fig1 there is shown a combustion apparatus 10 comprising a domestic heating furnace which incorporates the invention . the walls of the apparatus enclose a combustion space 12 and a heat exchanger 14 . a conventional gas burner 15 is arranged under the heat exchanger 14 so that the combustion products of the burning gas heat the air flowing through heat exchanger 14 which functions as a heat transfer medium for room heating . a draft hood 16 is provided and is separated from the heat exchanger by a sheet metal wall 18 . a first port 20 defines a flow path from the combustion space into the upper portion of the draft hood . a second port 22 in the top wall of the hood 16 leads to a vent 24 . the draft hood encloses a chamber 26 which communicates with the ambient atmosphere through a continuously open third port 28 . in the illustrated , non - operative mode of the furnace , a vent damper 30 blocks the port 22 . the vent damper 30 comprises a flat sheet - metal plate 32 from which narrow leaf springs 34 , 36 depend . the ends of the leaf springs remote from the plate are s - shaped for greater flexibility and are fastened to respective first ends of bimetal strips 38 , 40 . the other ends of the bimetal strips are fixedly fastened to a bracket 42 in the chamber 30 . the bimetal strips 38 are located in a flow path 43 of combustion gases from the combustion zone through the port 20 into the chamber 26 . heating of the strips 38 by the hot gases causes the strips to flex so as to swing counterclockwise ( as viewed in fig1 ) about the bracket 42 into the position indicated by broken line at 38 &# 39 ;. the damper plate is moved thereby into a correspondingly indicated position 32 &# 39 ; to permit escape of the combustion gases through the port 22 into vent 24 . the thermal up - draft in the vent draws a small amount of ambient air through the third port 28 into another flow path 44 to second port 22 . the bimetal strips 40 are located in the flow path 44 and as long as the strips 40 are adequately cooled by the air stream they do not change their curvature , nor do they affect the position of the plate 32 . if the draft in the vent 24 is insufficient for drawing all of the combustion gases through the partly closed port 22 , then hot gases accumulate along a flow path leading from port 20 to the port 28 and heat the bimetal strips 40 . the strips 40 then flex and swing clockwise ( as viewed in fig1 ) about bracket 42 to position 40 &# 39 ;. this causes the damper plate to fully retract from port 22 to position 32 &# 34 ; and thereby increase the gas flow into vent 24 . when the hot gases near the strips 40 are replaced by cooler diluting air drawn into port 28 by the draft in the vent these strips flatten and move plate 32 back toward position 32 &# 39 ;. the dimensions and thermal responses of the strips 38 , 40 are readily selected to minimize the flow of dilution air in each combustion unit . unnecessary loss of heated or otherwise tempered inside air through the vent 24 is avoided . the temperature of the combustion gases and their amount may be varied by adjusting the gas supply and the air supply to the burner in a conventional manner , but varying combustion conditions in the space 12 do not affect the control of the diluting air by the bimetal strips . the bimetal strips in the specific embodiment of the apparatus shown in fig1 are selected to move the plate 32 toward closure of the port 22 when their temperatures fall below about 150 ° f ., and to move the plate away from the port at higher temperatures . the leaf springs 34 , 36 provide yieldably resilient connections between the bimetal elements and the plate 32 . they avoid the damage to the bimetal strips and the damper plate that might otherwise result from excessive pressure exerted by the bimetal strips at extremely low temperatures . they also permit the draft control arrangement to be built without hinges , bearings , shafts , or other elements subjected to friction during use , and which would otherwise require periodic lubricating or other maintenance . no external power supply is needed . all connections between the bimetal strips , the leaf springs , the damper plate , and the bracket 42 are fixed , and preferably riveted . fig2 illustrates another embodiment providing a draft control arrangement for a furnace having a heat exchanger 44 and a draft hood 46 and vent 48 similar to the structure described for fig1 . a damper plate 50 is carried by leaf springs 52 , 54 which in turn are mounted on respective bimetal strips 56 , 58 . the damper assembly shown in fig2 may be assembled in a suitably shaped frame to facilitate installation in existing draft hoods as a unit . another embodiment of the invention shown in fig3 is similar to the structure of fig1 and 2 and includes bimetal strips 60 , 62 which extend in approximately right angle directions from the associated leaf springs 64 , 66 . the bimetal strips are mounted so that the strips 60 extend across a flow path 68 from the furnace to the port 70 which is closed by damper plate 72 . the strips 62 are located well below the port 70 , and the mode of operation is similar to that described for the embodiment of fig1 . fig4 and 5 illustrate another embodiment of the invention with only the top portion of a typical draft hood being shown in frontal elevation with the front plate of the draft hood removed for clarity . a damper comprising two half - plates 73 , 74 is mounted below a vent 75 within the draft hood 76 . each half - plate is carried by respective pairs of leaf springs 77 , 78 and 79 , 80 . the leaf springs of half - plate 73 are connected to upper and lower bimetal strips 81 , 82 while the leaf springs of the other half - plate 74 are connected to another pair of upper and lower bimetal strips 83 , 84 . in operation , the upper bimetal strips 81 and 83 respond to the flow of combustion gases while the lower bimetal strips 82 and 84 respond to either the relatively cold dilution air by moving dampers 73 and 74 toward the vent port or to the heat of the combustion gases if they accumulate in the draft hood by moving damper half - blades 73 and 74 away from the vent port , thereby minimizing the flow of dilution air . the operation is similar to that described for the embodiment of fig1 . fig6 and 7 illustrate another embodiment adapted for use with a typical water heater . a draft hood 86 is mounted above a flue pipe 87 leading from the water heater , and the port 88 in a vent 89 above the hood is opened and closed by a damper plate 90 . the damper plate is controlled by three or more bimetal strips , with one or more strips 91 mounted to extend in the flow path of flue gases from the heater , and two or more strips 92 , projecting in the flow path leading from the open lower end 94 of the hood toward vent port 88 . leaf springs 95 , 96 connect the respective bimetal strips with the damper plate . the operation of the embodiment of fig6 and 7 is similar to that described for the embodiment for fig1 . fig8 illustrates another embodiment providing a draft control arrangement incorporating a vertically elongate draft hood 98 . a damper 100 closes vent port 102 and is carried on leaf springs 104 , 106 which in turn are carried on one or more pairs of bimetal strips 108 , 110 mounted on brackets 112 , 114 within the hood . in heating appliances equipped with natural draft burners some spillage of products of combustion may occur at the draft hood relief opening during start - up and when the draft changes suddenly , especially in installations with short vent systems . if such an appliance is equipped with a conventional thermally controlled vent damper then spillage may occur during start up even under normal draft conditions . the embodiment of fig8 minimizes both spillage and flow of dilution air by a combination of : ( a ) the vertically elongated draft hood , which allows more accumulation of the flue gases before spillage and thereby more time for the bimetal elements to react and to open the damper further , and ( b ) the thermally controlled vent damper having its heat sensing element located in a portion of the draft hood which becomes filled with hot products of combustion if the draft decreases or becomes filled with relatively cool ambient air if the draft increases . another embodiment of the invention is illustrated in fig9 and includes four stacks 113 , 115 , 116 , ( only three of which are illustrated ) with each stack comprising a plurality , shown as twelve , of generally u - shaped bimetal strips 118 , 120 . the stacks extend upward from a bracket 122 which is fixedly mounted in the chamber 124 of an elongate draft hood 126 similar to that described for the embodiment of fig8 . the bimetal strips are riveted or otherwise fixedly fastened together in each stack in such a manner as to extend from the bracket 122 to a damper plate 128 which is riveted to the four topmost bimetal strips . the use of bimetal stacks is a known method for achieving large linear thermal expansion and contraction of the temperature - sensitive unit . the two or more longitudinal layers of metals having different coefficients of thermal expansion are combined in each strip 118 , 120 in such a manner that the legs of the u - shape move toward each other as the temperature rises . the bimetal strips above the port 130 thus contract primarily in response to the flow of hot combustion gases along path 132 while the bimetal strips below the level of port 130 provide the desired independent control of the diluting air . the u - shaped strips 118 , 120 are resilient enough to assume the functions of the leaf springs in the draft control arrangement shown in fig2 . another embodiment of the invention is illustrated in fig1 . a draft hood 120 is mounted above a flue pipe 122 leading from a heating appliance , and ports 124 and 126 in vent 128 are opened and closed by damper sections 130 and 132 . damper section 130 is actuated by one or more bimetal elements 134 responding to the hot combustion gases flowing through flue pipe 122 and draft hood 120 into vent 128 . damper section 132 is actuated by one or more bimetal elements 136 responding to either the relatively cold dilution air by moving the damper section toward the vent port or to the heat of the combustion gases if they accumulate in the draft hood by moving the damper section away from the vent port , thereby minimizing the flow of dilution air . many variations are possible in the draft control arrangement of the invention without affecting its desired operation . the draft hoods shown in fig1 through 5 are of a type commonly used in domestic heating furnaces . draft hoods on gas - fired water heaters generally may have the form shown in fig6 and 7 . a port leading to a vent need not be installed in the top wall of a draft hood , as is well known . yet , the invention is applicable to the various modified draft hoods as long as the temperatures of the combustion gases ( or of a gas mixture predominantly consisting of combustion gases ) and the temperature of the diluting air ( or of a gas mixture predominantly consisting of diluting air ) is sensed separately , and with a damper plate moved accordingly toward and away from the position in which it occludes the port to the vent , or where the heat sensing elements are installed in an area within the draft hood which becomes filled with hot products of combustion if the draft decreases and becomes filled with relatively cool ambient air if the draft increases . the leaf springs and bimetal strips described above are generally quite narrow so as not to interfere with gas flow through the hood chambers . for adequate stability of the damper plates , it is preferred to provide at least three leaf springs and three bimetal strips . if at least one relatively wide spring and a corresponding strip are acceptable , a total of two strips and two springs may be adequate . more than four springs and strips , of course , are permissible . bimetal strips are the least expensive temperature sensing elements available at this time , but other temperature sensing elements may be employed in conjunction with actuating elements such as the described leaf springs , or the sensing elements themselves may function as direct actuating elements in the manner shown in fig9 . other variations of the illustrative embodiments of the invention described above will readily suggest themselves to those skilled in the art . it should be understood , therefore , that the foregoing disclosure relates only to presently preferred combustion apparatus and to draft control arrangements for such apparatus , and that it is intended to cover all changes and modifications of the examples of the invention chosen herein for the purpose of the disclosure which do not depart from the spirit and scope of the invention set forth in the appended claims . | 5 |
the present invention relates to a highly sensitive method for identification and / or quantification of proteins expressed within a cell . the method of the invention involves the use of a variety of different methods to separate total proteins derived from cell extracts followed by detection of said proteins using a variety of different methods including ( i ) ramification - extension amplification method ( ram ); ( ii ) hybridization signal amplification method ( hsam ); and ( iii ) detection with nanodots . specifically , the method for identifying and / or quantitating proteins expressed within a cell comprises the following steps : ( a ) extracting proteins from a sample of cells ; ( b ) separating the extracted proteins ; ( c ) modifying the proteins ; and ( d ) detecting the proteins . methods for detecting proteins include ( i ) ram ; ( ii ) hsam ; and ( iii ) detection with nanodots . a wide variety of protein mixtures can be prepared and separated into individual proteins using a variety of different methods . proteins derived from cell extracts can be separated based on physical properties including size , charge , conformation and / or immunoreactivity . such techniques include conventional chromatography , high performance liquid chromatography , electrophoretic separation of proteins , mass spectrometry and flow cytometry . such separation methods are well known to those of skill in the art ( see , for example , ausebel et al ., 1998 , current protocols in molecular biology , john wiley & amp ; sons , inc ., v1 . 2 , chapter 10 ). prior to 2d gel electrophoresis , aliquots of cells are solubilized using any one of a variety of solubilization cocktails known to those of skill in the art . for example , tissue can be solubilized by addition of lysis buffer consisting of 8 m urea , 20 ml of nonidet p - 40 surfactant , 20 ml of ampholytes ( ph 3 . 5 - 10 ), 20 ml of 2 - mercaptoethanol , and 0 . 2 mm of phenylmethylsulfonyl fluoride ( pmsf ) per liter of distilled and deionized water . in a specific embodiment of the invention , 2d gel electrophoresis may be used to separate the proteins . methods of 2d electrophoresis are known to those skilled in the art . electrophoresis in the first dimension generally separates proteins based on their net charges , while electrophoresis in the second dimension , referred to as sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ), separates proteins based on their differences in size ( i . e ., molecular weights ). one type of electrophoresis method that separates proteins based on their net charge is isoelectric focusing ( ief or carrier ampholyte based 2d gel electrophoresis ). carrier ampholyte based 2d gel electrophoresis can be done as previously described ( strahier et al , journal of clinical investigtion , 85 : 200 - 207 , 1990 ). ief is generally used as the first phase of separation , or the first dimension , in 2d electrophoresis . two proteins having different ratios of charged , or titrating , amino acids can be separated by virtue of their different net charges at some ph . under the influence of an applied electric field , a more highly charged protein will move faster than a less highly charged protein of similar size and shape . if the proteins are made to move from a sample zone through a non - convecting medium ( typically a gel such as polyacrylamide ), an electrophoretic separation will result . for example , a more positively charged protein will move to a position with relatively higher ph established by the more net negative charges within the gel . when the total net number of positive and negative charges from both the protein and the gel are equal , the protein stops moving even under an applied electric field . because ief is sensitive to charge modification , it is important to minimize protein alterations ( e . g ., proteolysis , deamidation of glutamine and asparagine , oxidation of cystine to cystic acid , carbamylation ) that can result from improper sample preparation . thus , once solubilized , samples should be stored frozen at − 80 ° c . for short periods (& lt ; 1 month ) to limit significant protein modification . approximately 30 μl aliquots containing 70 μg of protein may be loaded onto individual gels , although the amount of protein to be loaded will vary depending on the type of detection method utilized . prepared protein samples are loaded onto electrophoretic gels for ief separation in the first dimension which separates proteins based on charge . in most cases aliquots are immediately applied onto ief gels . first - dimension gels contain 50 ml of ampholytes per liter ( ph 3 . 5 - 10 ). generally , ief is done at 1 , 200 v for 10 h and 1 , 500 v for the last 2 h . twenty gels are generally run simultaneously . a key requirement for an ief procedure is the formation of an appropriate spatial ph gradient . this can be achieved either dynamically , by including a heterogeneous mixture of charged molecules ( ampholytes ) into an initially homogeneous separation medium , or statically , by incorporating a spatial gradient of titrating groups into the gel matrix through which the migration will occur . the former represents classical ampholyte - based ief , and the latter the more recently developed immobilized ph gradient ( ipg ) ief technique . the ipg approach has the advantage that the ph gradient is fixed in the gel , while the ampholyte - based approach is susceptible to positional drift as the ampholyte molecules move in the applied electric field . current methodology combines the two approaches to provide a system where the ph gradient is spatially fixed but small amounts of ampholytes are present to decrease the adsorption of proteins onto the charged gel matrix of the ipg . a number of first dimension gel preparations may be utilized including tube gels for carrier ampholyte - based separations , or gel strips for immobilized gradient based separations . alternatively , ipg gels may be used ( hanash s . m ., et al ., 1991 , proc . natl . acad . sci ., usa 88 : 5709 - 5713 ). samples are prepared using lysis buffer as discussed above . for first dimension separation an immobilized ph gradient covering the separation range of ph 4 - 10 is used . ipg gels are prepared using derivatives of acrylamide having carboxyl or tertiary amino groups with specific pk values . a linear ph gradient is prepared from a dense , acidic solution and a light , basic solution using a two - chamber microgradient former . the ph gradient is stabilized during polymerization of the immobiline acrylamide - bisacrylamide matrix by a co - linear gradient of glycerol . formulations of buffering immobiline mixtures with titrating immobiline for the ph limit solutions for narrow ph gradients ( 1 ph unit ) or for broad ph gradients (& gt ; 1 ph unit , up to 6 ph units ) have been published ( gianazza et al , electrophoresis 6 : 113 ( 1985 ) and lkb application note 324 ( 1984 )). after first dimension separation , proteins are transferred onto the second dimension gel , following an equilibration procedure and separated using sds - page which separates proteins based on differences in their molecular weight . charged detergents such as sds can bind strongly to protein molecules and “ unfold ” them into semi - rigid rods whose lengths are proportional to the length of the polypeptide chain , and hence approximately proportional to molecular weight . a protein complexed with such a detergent is itself highly charged ( because of the charges of the bound detergent molecules ), and this charge causes the protein - detergent complex to move in an applied electric field . furthermore , the total charge also is approximately proportional to molecular weight ( since the detergent &# 39 ; s charge vastly exceeds the protein &# 39 ; s own intrinsic charge ), and hence the charge per unit length of a protein - sds complex is essentially independent of molecular weight . this feature gives protein - sds complexes essentially equal electrophoretic mobility in a non - restrictive medium . if the migration occurs in a sieving medium , such as a polyacrylamide gel , however , large ( long ) molecules will be retarded compared to small ( short ) molecules , and a separation based approximately on molecular weight will be achieved . this is the principle of sds - page electrophoresis as applied commonly to the analytical separation of proteins . the second dimension separates proteins on the basis of molecular weight in an sds gel . an 11 . 5 to 14 % ( 2 . 6 % cross - linking ) acrylamide gradient provides effective separation of proteins having a mass of from 10 , 000 to 100 , 000 da . proteins outside this range may be less well resolved . proteins with molecular weight less than 10 , 000 da migrate close to the dye front and are less well resolved . it is current practice to detect proteins in 2d gels either by staining the gels or by exposing the gels to a radiosensitive film or plate ( in the case of radioactively labeled proteins ). staining methods include dye - binding ( e . g ., coomassie brilliant blue ), silver stains ( in which silver grains are formed in protein - containing zones ) ( merril et al , science , 211 : 1437 - 1438 , 1961 ), negative stains in which , for example , sds is precipitated by zn ions in regions where protein is absent , or the proteins may be fluorescently labeled . in each case , images of separated protein spot patterns can be acquired by scanners , and this data reduced to provide positional and quantitative information on sample protein composition through the action of suitable computer software . alternatively , once the proteins have been separated from one another , they may be transferred to a matrix prior to detection . for example , when utilizing electrophoretic methods of separation , the proteins may be transferred to a membrane prior to detection . such membranes include , but are not limited to , those used in western blot analysis such as nitrocellulose . alternatively , when using conventional chromatography methods or flow cytometry , the proteins may be detected directly as bound to the chromatographic material or as present in elutes . proteins immobilized on a membrane such as nitrocellulose are still capable of binding other molecules . following separation , the proteins are transferred from the 2d gels onto membranes commonly used for western blotting . the techniques of western blotting and subsequent visualization of proteins are also well known in the art ( sambrook et al , “ molecular cloning , a laboratory manual ”, 2 nd edition , volume 3 , 1989 , cold spring harbor ). the standard procedures may be used , or the procedures may be modified as known in the art for identification of proteins of particular types , such as highly basic or acidic , or lipid soluble , etc . ( see for example , ausubel , et al ., 1989 , current protocols in molecular biology , green publishing associates and wiley interscience , n . y .). in a modification of 2d gel electrophoresis , proteins can be separated using miniaturized 2d gel electrophoresis . using this technique , both dimensions can be run on the same gel that has been cast to contain an ipg strip on one side of the gel and a sds gel on the other side of the gel . in order to get appropriate separation of the proteins the electric current is switched after the first dimension electrophoretic step , before the second dimension separation . such mini - 2d gels can separate proteins more rapidly than conventional 2d gel electrophoresis and require a reduced amount of protein . in a specific embodiment of the invention a ram method , such as that described in u . s . pat . no . 5 , 942 , 391 , can be used to detect proteins bound to membranes . u . s . pat . no . 5 , 942 , 391 is hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains . total proteins lysed from target cells are separated by 2d electrophoresis , and transferred to a membrane . following transfer of the proteins onto the membrane , the proteins are modified by linkage to a ligand moiety such as biotin using a biotinylation reagent , i . e ., biotinamidocaproic acid 3 sulfo - n - hydroxysuccinimide ester ( sigma - life science ). the biotin - conjugated reagent is incubated with the membrane at a ph of between 6 . 5 - 8 . 5 resulting in covalent cross linking of the membrane bound proteins with a biotin molecule . following linkage of the membrane bound proteins to a ligand moiety , single stranded nucleic acid molecules linked to a ligand binding moiety , such as streptavidin , are added followed by washing of the reaction mixture to remove any unbound reagent . the term “ ligand ” as used herein refers to any component that has an affinity for another component termed here as “ ligand binding moiety .” the binding of the ligand to the ligand binding moiety forms an affinity pair between the two components . for example , such affinity pairs include , inter alia , biotin with avidin / streptavidin , antigens or haptens with antibodies , heavy metal derivatives with thiogroups , various polynucleotides such as homopolynucleotides as poly dg with poly dc , poly da with poly dt and poly da with poly u . any component pairs with strong affinity for each other can be used as the affinity pair , ligand - ligand binding moiety . suitable affinity pairs are also found among ligands and conjugates used in immunological methods . the biotin / streptavidin affinity pair may be used in the subject invention . applying ram technology to the system , dna polymerase and a closed circular nucleic acid molecule capable of binding to the streptavidin linked single stranded nucleic acid is added as a template . the streptavidin linked single stranded nucleic acid molecule acts as a primer for rolling circle replication ( i . e ., rolling circle amplification or rca ) of the closed circular nucleic acid molecule ( fig1 ). this results in linear amplification of the dna sequences of the circular nucleic acid molecule . in another embodiment of the present invention additional primers complementary in sequence to the single stranded dna product of the rolling circle replication are added which result in exponential amplification of the dna sequences of the circular nucleic acid molecule . in a specific embodiment of the invention , labeled nucleotides may also be utilized and subsequently incorporated into the single stranded dna with the primer extension so that the signal will be amplified . such labels include , for example , fluorescent or radiolabeled - oligonucleotides . detection may occur following either linear ( rca ) or exponential ( ram ) amplification of the circular nucleic acid molecule . in another embodiment of the present invention , the proteins are separated by 2d gel electrophoresis and then modified directly while still in the gel . then ram or rca , described herein above , or hsam , described herein below , is performed . the use of the ram as an isothermal rolling circle amplification technique provides several unique advantages for proteomic studies . for example , sensitivity is increased due to replication / amplification of 10 3 ( from rca )& gt ; 10 9 ( from ram ) copies of dna . such increased sensitivity permits the detection of a single protein molecule . in addition , the method provides increased specificity due to lack of any detectable background signal . the increased sensitivity and specificity permit analysis of proteins from a single cell . in addition , the large magnitude of amplified nucleic acid permits quantitative analysis of the expressed proteins . finally , radiolabeling is not required with ram or rca . in another embodiment of the invention , hsam , such as that described in u . s . pat . no . 5 , 876 , 924 , can be used to detect proteins bound to membranes . u . s . pat . no . 5 , 876 , 924 is hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains . total proteins lysed from target cells are separated by 2d gel electrophoresis , and transferred to a membrane . following transfer of the proteins onto the membrane , the proteins are modified by a biotinylation reagent , such as , for example , biotinamidocaproic acid 3 sulfo - n - hydroxysuccinimide ester ( sigma - life science ). the biotin - conjugated reagent is incubated with the membrane at a ph of between 6 . 5 - 8 . 5 resulting in covalent cross linking of the membrane bound proteins with a biotin molecule . an oligonucleotide conjugated with multiple biotin molecules and a streptavidin molecule is then added to the membrane . the streptavidin molecule conjugated to the oligonucleotide will first interact with the protein conjugated biotins . the multiple biotin molecules conjugated to the oligonucleotide then provide additional sites for further streptavidin binding . the resulting branched - chain like reaction will lead to a formation of a large molecule for easy detection ( fig2 ). in another embodiment of the present invention , a mixture of hsam nanoparticles with different shapes and sizes can be added to the protein mixture following cell lysis . the hsam nanoparticles can bind to the protein based on a specific , direct interaction . there are two forms of hsam nanoparticles . in one form , the oligonucleotides that make up the hsam nanoparticle contain specific sequences that form configurations that can interact with proteins specifically , such as dna aptamers ( fredriksson , s et al ., 2002 nat biotech 20 : 473 - 477 ). in another form , the hsam nanoparticle is packed into a matrix , such as agarose or acrylamide , to form a bead - like structure . the resulting beads have different surface shapes and charges that will interact with proteins similar to the nanodots , described herein below . no protein modification is necessary when using the hsam nanoparticles . in a further embodiment of the invention , nanodots , or nanoparticles ( elghanian et al ., 1997 , science , 277 : 1078 - 81 ; bruchez et al ., 1998 , science 281 : 2013 - 16 ) can be used to detect proteins bound to membranes . after electrophoretic separation of the proteins as described above , detection can be carried out with nanodots , which are coated with active groups . the nanodots can be selected from , but are not limited to , the group consisting of quantum dots , metal dots , gold dots and polystyrene dots . in addition , mixed dots of different sizes and colors may be used to distinguish between different proteins . the active groups are designed to covalently link the dots to the target proteins bound to the membrane thereby immobilizing the nanodots . the quantity of immobilized dots is proportional to the amount of proteins in a target , therefore the present invention can be successfully employed for both protein detection and quantitative analysis . the cross - linking of proteins to nanodots provides a significant increase in sensitivity compared with current methods due to the fact that a single dot can be detected . yet another advantage associated with the use of nanodots is that the proteins could immobilize nanodots selectively according to the match between the size of the dots and the surface of the protein rather than randomly . this selectivity provides a unique method to distinguish between different proteins that could not be separated by conventional 2d gel electrophoresis due to similarities in molecular weight and surface charges . one limitation of current 2d gel electrophoresis technology arises when distinct proteins have similar charge and molecular weights , which makes it very difficult if not impossible to resolve them into distinct spots on the 2d gels . the result is one spot on the gel containing multiple proteins . one way to deconvolute the proteins is through the use of the specific binding characteristics of the nanodots . if nanodots with different protein binding characteristics and different colors are used then one could resolve the proteins into distinct populations . in addition , this detection of signal is dependent on a covalent interaction ; therefore , the sensitivity of the detection can reach up to a single molecule . in yet another embodiment of the present invention , proteins that bind to hsam nanoparticles or nanodots can then be separated from each other and detected using flow cytometry , thereby foregoing the need for 2d gel electrophoresis . because the dots contain different colors and have different shapes and sizes , when they pass through the detector each dot can be detected and recorded . the following experimental details are set forth to aid in the understanding of the present invention , and are not intended , and should not be construed , to limit in any way the invention set forth in the claims which follow thereafter . pc - 3 cells , derived from human prostate cancer , were purchased from the american type culture collection ( manassas , va .). the cells were grown in a 50 : 50 mixture of dmem and f12 containing 1 % antibiotic / antimycotic acids , and 10 % fetal bovine serum . the cells were incubated at 37 ° c . with a 5 % co 2 atmosphere . pc - 3 cells were treated with scutellaria baicalensis , a chinese herbal medicine , at a concentration of 0 . 6 mg / ml for 24 hours . the proteins were extracted and treated as described below . a stock labeling solution containing 2 mg / ml biotinamidocaproic acid 3 sulfo - n - hydroxysuccinimide ester ( nhs - biotin ) in 10 % dmso was prepared by dissolving 10 mg nhs - biotin ( h1759fd ; sigma chemical co ., st . louis , mo .) in 0 . 5 - ml dmso ( cryoserv , research industries corp ., midvale , utah ), followed by addition of 4 . 5 ml pbs . this solution was sterilized by filtration through a 0 . 2 μm syringe filter ( 21062 - 25 ; corning glassware , corning , n . y .) made from dmso - resistant materials . pc - 3 cultured cancer cells were harvested by treatment of trypsin - edta and then centrifugation . the cell pellets were washed by with 1 × pbs for three times . the total protein from cell lysates was adjusted with pbs to 1 . 0 mg / ml . the appropriate volume of nhs - biotin was added to give a final concentration of nhs - biotin to 1 μg / ml . the sample was incubated at room temperature for 30 min ., followed by dialysis with 20 mm tris - hcl buffer with 5 m urea for 12 hours to remove excess unreacted nhs - biotin . the protein was then concentrated to 1 - 2 mg / ml by centrifugation with ultrafree - cl ( ufc4lcc 25 ; millipore , bedford , mass . ), and the sample buffer was changed to 20 mm tris / hcl buffer containing 7m urea , 2 % chaps , 50 mm dtt . at this point the sample was ready for 2d gel analysis . 0 . 5 ml protein suspended in 20 mm tris / hcl buffer containing 7m urea , 2 % chaps , 50 mm dtt was added to a channel in a re - hydration / equilibration tray ( bio - rad laboratories ). a readystrip ipg strip gel was placed side down onto the sample . 2 to 3 ml of mineral oil were added to cover the strip to prevent evaporation during the re - hydration process . the tray was placed on a leveled bench overnight to allow the protein samples to be absorbed into the ipg strips , which has a ph gradient . then the ipg strip was transferred into a focusing tray . the first dimension gel electrophoresis based on ph gradient on the strip was carried out using the protean ief apparatus according to the protocols provided by the manufacturer ( biorad laboratories ) with a maximum current of 50 μa / strip and 10 , 000 v for 12h . hereafter , the ipg strips were washed with equilibration buffer i ( 6m urea , 0 . 375 m tris ph 8 . 8 , 2 % sds , 20 % glycerol , 2 % dtt ) for 10 min and followed by washing with equilibration buffer ii ( 6m urea , 0 . 375 m tris ph 8 . 8 , 2 % sds , 20 % glycerol , 2 . 5 % iodoacetamide ) for 10 min . the equilibrated gel was then ready for the second dimension gel electrophoresis ( sds - page ) based on the sizes of the proteins . for sds - page , the strip gel was placed side - up on the top of an 8 - 14 % polyacrylamide gel , and then covered with 0 . 5 - 1 % agarose . after the agarose was polymerized , the buffer for the sds - page was added , and the electrophoresis was then carried out at 200 v for 5 - 5 . 5 h . the gels ( treated and control ) were stained with coomassie blue ( fig3 ). the result of the 2d gel electrophoresis was the separation of the proteins from the mixture . the preliminary results demonstrate that there are significant changes in the protein expression levels in the treated cells when compared to the control or untreated cells , including decreases ( indicated by the circles near the top of the gel ), increases ( indicated by the large arrow ), new protein synthesis ( indicated by the circle in the middle of the gel ) as well as shut down of protein synthesis ( indicated by the small arrow ). while there have been described what are believed to be the preferred embodiments of the invention , it will be recognized by those skilled in the art that other and further changes may be made thereto without departing form the spirit of the invention and it is intended to claim all such changes and modifications as fall within the true scope of the invention . | 6 |
the semiconductor device according to the first embodiment will be hereinafter explained with reference to drawings . first , a configuration of a semiconductor device according to the first embodiment will be explained with reference to fig1 . fig1 is a cross sectional view illustrating the semiconductor device according to the first embodiment . as shown in fig1 , the semiconductor device according to the first embodiment includes multiple high frequency devices 1 , and each of the multiple high frequency devices 1 is sealed via a bump electrode 3 with a cap 2 in a hollow manner . each of the high frequency devices 1 is formed on a chemical compound substrate 6 such as gaas , and has at least a pair of pad electrodes 7 made of au and the like . on the other hand , the cap 2 is made of high resistance silicon and the like and includes at least a pair of through - hole electrodes 8 filled with cu and the like at the positions corresponding to the pad electrodes 7 . in the high frequency device 1 and the cap 2 of each pair , the pad electrode 7 and the through - hole electrode 8 are bonded via the bump electrode 3 made of ausn solder , au stud bump , and the like so as to make an interval of about 50 to 100 μm , and this high frequency device 1 is sealed in a hollow manner . multiple high frequency devices 1 sealed in a hollow manner are rearranged in a row with a predetermined distance therebetween , and thereafter , the high frequency devices 1 are sealed with a mold resin 4 made of epoxy resin and the like , thus being configured as a restructured wafer . a layer insulating film 9 made of polyimide and the like and a re - wiring layers 10 made of al / ti thin film are alternately formed on this restructured wafer , so that a multi - layer wire layer 5 is formed . in this manner , the high frequency device 1 is sealed by the cap 2 in a hollow manner , and further sealed in the mold resin 4 , and further a signal of the high frequency device 1 formed with the multi - layer wire layer 5 is controlled from the outside via the pad electrode 7 , the bump electrode 3 , the through - hole electrode 8 , and the re - wiring layer 10 . subsequently , overview of the semiconductor device according to the first embodiment will be explained with reference to fig2 a and 2b . fig2 a is a partially enlarged view illustrating a semiconductor device according to the first embodiment . fig2 b is a view seen in a direction 90 degrees rotated from fig2 a . as shown in fig2 a and 2b , the bump electrode 3 in the protruding shape made of metal provided on the pad electrode 7 includes a protruding distal end portion and a bottom portion wider than the distal end portion . this distal end portion is pressed into the through - hole electrode 8 of the cap 2 , so that the through - hole electrode 8 is deformed , whereby the cap 2 and the through - hole hole electrode 8 are bonded . subsequently , the method for producing the semiconductor device according to the first embodiment will be explained with reference to fig3 a to 3f . fig3 a to 3f are step views illustrating the method for producing the semiconductor device according to the first embodiment . first , as shown in fig3 a , a trench structure of which thickness is about 200 μm is formed by reactive ion etching method ( rie ) in the cap 2 having high resistance silicon ( the thickness of the substrate is about 400 μm ). subsequently , as shown in fig3 b , the surface of the cap 2 including a trench structure is oxidized under a high temperature of about 1100 degrees celsius , and the silicon oxide film 11 is formed about 1 nm . further , as shown in fig3 c , the through - hole electrode 8 ( about 50 μm ) is formed in a trench structure portion in a liquid obtained by mixing copper sulfate , sulfuric acid , and additive by electroplating method . as shown in fig3 d , using the polishing device , the through - hole electrode 8 ( about 50 μm ) deposited on the surface of the cap 2 is removed . in the polishing , first , the cap 2 is polished by being pressed against the polishing board of which polishing surface of a roughness of about # 600 is rotated 240 rpm , and thereafter , in a polishing liquid including alumina fine particles , and then it is carried out by a polishing board of a roughness of # 1000 . further , using a grinding device , the silicon on the back surface of the cap 2 is grinded about 300 μm with a grindstone of which roughness is # 230 , and the through - hole electrode 8 is exposed , and thereafter , using the polishing device , surface polishing is carried out with a grindstone of roughness # 600 . as shown in fig3 ( e ), a resist pattern ( thickness about 2 μm ) is formed by photolithography method . subsequently , using a sputtering device , a barrier metal layer ( au / ni / ti : 0 . 2 μm / 0 . 3 μm / 0 . 1 μm ) is formed on this resist pattern . further , with acetone ultrasonic processing , the barrier metal layer on the resist pattern is separated by so - called lift - off method , and the barrier metal 13 is formed on the through - hole electrode 8 . this barrier metal 13 is formed to prevent the surface oxidization of cu of the through - hole electrode 8 . as shown in fig3 f , on the semiconductor chip 12 ( gaas chip ), the bump electrodes 3 are formed on the predetermined pad electrodes 7 using a wire bonding device with a implementation temperature of 200 degrees celsius , and an ultrasonic electric current of 50 ma to 80 ma . the semiconductor chip 12 having the bump electrodes 3 formed thereon is thermocompression - bonded to the cap 2 formed with the barrier metal 13 under a condition of a stage temperature of 200 degrees celsius , a tool temperature of 300 degrees celsius , a tool pressure 1n / bump , and a thermocompression time of 20 seconds , so that the bump electrode 3 and the through - hole electrode 8 of the cap 2 are bonded . in the semiconductor device according to the first embodiment , when the barrier metal 13 is not formed in fig3 b , the oxide film layer of cu is thinly formed on the surface of the through - hole electrode 8 , but even in such case , the bump electrode 3 penetrates through the oxide film layer , and is pressed into the through - hole electrode 8 . further , an experiment result of the bonding step of pressing - in of the bump electrode in the semiconductor device according to the first embodiment will be explained with reference to fig4 a and 4b . fig4 a and 4b are figures illustrating an experiment result of a bonding step of pressing - in of a bump electrode in the semiconductor device according to the first embodiment . as shown in fig4 a , on the semiconductor chip 12 ( gaas chip ), the bump electrodes 3 which are protruding shape electrodes are formed on the predetermined pad electrodes 7 using a wire bonding device with a implementation temperature of 200 degrees celsius , and an ultrasonic electric current of 50 ma to 80 ma . the bump electrodes 3 are made of au including about 0 . 5 to 5 % of pd in order to improve the hardness . the cap 2 includes the through - hole electrode 8 , the silicon oxide film 11 , and the barrier metal 13 . the through - hole electrode 8 is filled with cu , and the silicon oxide film 11 is formed on the side surface thereof . in this case , the silicon oxide film 11 is formed to hold the insulating property between the through - hole electrodes 8 . further , the barrier metal 13 is formed on the through - hole electrode 8 . in this case , after cu is filled in the through - hole electrode 8 , the barrier metal 13 is formed to prevent the cu surface from being oxidized . in this case , as shown in fig4 b , the bump electrode 3 and the through - hole electrode 8 of the cap 2 are bonded by thermocompression . this thermocompression is carried out using a flip chip bonder with a pressure = 1n / bump , a thermocompression time of 20 seconds , a tool temperature of 250 degrees celsius , and a stage temperature of 200 degrees celsius . when fig3 b is observed , the protruding portion of the bump electrode 3 which is the electrode in the protruding shape can be found to be pressed into the through - hole electrode 8 by a depth of about 30 μm to 50 μm . fig5 is configuration diagram after the bump electrode and the cap are bonded in the semiconductor device according to the first embodiment . as shown in fig5 , the bump electrode 3 which is the protruding shape electrode penetrates through the barrier metal 13 and pressed into the through - hole electrode 8 filled with cu . the barrier metal 13 is for the purpose of preventing the surface of the through - hole electrode 8 filled with cu from being oxidized , and therefore , when the bump electrode 3 penetrates through the barrier metal 13 and pressed into the through - hole electrode 8 , no problem would occur even if the barrier metal 13 is destroyed . the phenomenon for embedding the bump electrode 3 into the through - hole electrode 8 is caused by the fact that the hardness of the bump electrode 3 is harder than the through - hole electrode 8 . more specifically , the vickers hardness of the bump electrode 3 made of au including 5 % of pd or less is 80 hv , whereas the vickers hardness of cu filled in the through - hole electrode 8 is about 70 hv . further , a relationship of a press - in depth of a bump electrode and a bonding strength between a bump electrode and a through - hole electrode of the semiconductor device according to the first embodiment will be shown with reference to fig6 a and 6b . fig6 a and 6b are graphs illustrating a relationship of a press - in depth of a bump electrode and a bonding strength between a bump electrode and a through - hole electrode of the semiconductor device according to the first embodiment . as shown in fig6 a and 6b , about 2 . 3 times higher bonding strength can be obtained in a case where the press - in depth is 50 μm than in a case where the press - in depth is 0 μm . this is caused by an anchoring effect of the press - in and the increase in the size of area of contact between the bump electrode 3 and the through - hole electrode 8 . with the anchoring effect of the press - in of the distal end portion of the bump electrode 3 into the through - hole electrode 8 , the shear strength is improved , and this prevents failure of separation at the bonding portion between the cap 2 and the bump electrode 3 , and thus , a highly reliable connection structure is achieved . as described above , in the semiconductor device according to the first embodiment , multiple high frequency devices 1 are rearranged in proximity , further , the high frequency devices 1 are connected with the still finer re - wiring layer 10 , so that multiple high frequency devices 1 can be integrated with a high density . therefore , in the semiconductor device according to the first embodiment , on a single restructured wafer , more high frequency devices 1 can be provided , so that the cost of production can be reduced . further , in the semiconductor device according to the first embodiment , the high frequency device 1 has a space from the cap 2 made of a high resistance silicon and the like , and therefore , this reduce interference between the high frequency device 1 and the cap 2 , and the signal transmission can be done with a low loss , so that a high performance semiconductor module having multiple high performance high frequency devices 1 can be produced . a semiconductor device according to the second embodiment will be hereinafter explained with reference to fig7 . the second embodiment is different from the first embodiment only in that the through - hole electrode 14 is different . therefore , except the description of this through - hole electrode 14 , the second embodiment is the same as the first embodiment , and therefore , the same elements are denoted with the same reference numerals , and detailed description thereabout is omitted . fig7 is configuration diagram after the bump electrode and the cap are bonded in the semiconductor device according to the second embodiment . as shown in fig7 , the structure of the through - hole electrode 8 is two - layer structure including a first through - hole electrode 14 filled with cu of an ordinary density and a second through - hole electrode 15 filled with porous cu of a lower density . in this case , when the bump electrode 3 is pressed into the second through - hole electrode 15 filled with the porous cu , the second through - hole electrode 15 filled with the porous cu is more greatly deformed than the first through - hole electrode 14 , and therefore , the bump electrode 3 digs into the through - hole electrode 8 more deeply . subsequently , a method for producing the semiconductor device according to the second embodiment will be explained with reference to fig8 a to 8g . fig8 a to 8g are step views illustrating the method for producing the semiconductor device according to the second embodiment . as shown in fig8 a , a trench structure of a depth of about 200 μm is formed by reactive ion etching method ( rie ) in the cap 2 having a high resistance silicon ( the thickness of the substrate is about 400 μm ). subsequently , as shown in fig8 b , the surface of the cap 2 including the trench structure is oxidized under a high temperature of about 1100 degrees celsius , and the silicon oxide film 11 is formed about 1 nm . further , as shown in fig8 c , using the sputtering device , the second through - hole electrode 15 ( cu / ti which is about 3 μm / 0 . 1 μm ) is formed on the surface of the cap 2 . as shown in fig8 d , a metal film ( cu : about 50 μm ) is formed in a trench structure portion in a liquid obtained by mixing copper sulfate , sulfuric acid , and additive by electroplating method . further , on the second through - hole electrode 15 formed by the electroplating method , a porous first through - hole electrode 14 ( about 1 μm ) is formed in a mixed liquid including copper sulfate , sodium hypophosphite , boric acid , nickel sulfate , and additive by the electroless plating method . thereafter , a metal film ( cu : about 50 μm ) is formed in a liquid obtained by mixing copper sulfate , sulfuric acid , and additive by electroplating method . as a result , the porous first through - hole electrode 14 serving as the foundation can be made into a thicker film of 51 μm . as shown in fig8 e , the first through - hole electrode 14 and the second through - hole electrode 15 ( about 50 μm ) deposited on the surface of the cap 2 are removed by the polishing device . in the polishing , first , the cap 2 is polished by being pressed against the polishing board of which polishing surface of a roughness of about # 600 is rotated 240 rpm , and thereafter , in a polishing liquid including alumina fine particles , and then it is carried out by a polishing board of a roughness of # 1000 . further , using a grinding device , the silicon on the back surface of the cap 2 is grinded about 300 μm with a grindstone of which roughness is # 230 , and the through - hole electrode 8 is exposed , and thereafter , using the polishing device , surface polishing is carried out with a grindstone of roughness # 600 . as shown in fig8 f , a resist pattern ( thickness about 2 μm ) is formed by photolithography method . subsequently , using a sputtering device , a barrier metal layer ( au / ni / ti : 0 . 2 μm / 0 . 3 μm / 0 . 1 μm ) is formed on this resist pattern . further , with acetone ultrasonic processing , the barrier metal layer on the resist pattern is separated by so - called lift - off method , and the barrier metal 13 is formed on the through - hole electrode 8 . this barrier metal 13 is formed to prevent the surface oxidization of cu of the through - hole electrode 8 . as shown in fig8 g , on the semiconductor chip 12 ( gaas chip ), the bump electrodes 3 are formed on the predetermined pad electrodes 7 using a wire bonding device with a implementation temperature of 200 degrees celsius , and an ultrasonic electric current of 50 ma to 80 ma . the semiconductor chip 12 having the bump electrodes 3 formed thereon is thermocompression - bonded to the cap 2 formed with the barrier metal 13 under a condition of a stage temperature of 200 degrees celsius , a tool temperature of 300 degrees celsius , a tool pressure 1n / bump , and a thermocompression time of 20 seconds , so that the bump electrode 3 and the through - hole electrode 8 of the cap 2 are bonded . in the semiconductor device according to the second embodiment explained above , the inventors have confirmed that , after the bump electrode 3 and the cap 2 are bonded , the distal end portion of the bump electrode 3 penetrates through the barrier metal 13 , and is inserted into the through - hole electrode 8 . when the barrier metal 13 is not formed , the cu oxide film layer is thinly formed on the surface of the through - hole electrode 8 , but the bump electrode 3 penetrates through the oxide film layer , and is pressed into the through - hole electrode 8 . as described above , like the first embodiment , in the semiconductor device according to the second embodiment , multiple high frequency devices 1 are rearranged in proximity , further , the high frequency devices 1 are connected with the still finer re - wiring layer 10 , so that multiple high frequency devices 1 can be integrated with a high density . therefore , in the semiconductor device according to the second embodiment , on a single restructured wafer , more high frequency devices 1 can be provided , so that the cost of production can be reduced . further , in the semiconductor device according to the second embodiment , the high frequency device 1 has a space from the cap 2 made of a high resistance silicon and the like , and therefore , this reduce interference between the high frequency device 1 and the cap 2 , and the signal transmission can be done with a low loss , so that a high performance semiconductor module having multiple high performance high frequency devices 1 can be produced . further , with the semiconductor device according to the second embodiment , the anchoring effect is increased as compared with the first embodiment , and the bonding between the bump electrode 3 and the cap 2 can be achieved more strongly . a semiconductor device according to the third embodiment will be hereinafter explained with reference to fig9 . the third embodiment is different from the first embodiment only in that a recessed portion 16 is different . therefore , except the description of this recessed portion 16 , the third embodiment is the same as the first embodiment , and therefore , the same elements are denoted with the same reference numerals , and detailed description thereabout is omitted . fig9 is configuration diagram after the bump electrode and the cap are bonded in the semiconductor device according to the third embodiment . as shown in fig9 , the semiconductor device according to the third embodiment includes a silicon oxide film 11 ( film thickness is about 1 nm ), a cap 2 having a high resistance silicon ( substrate thickness is 300 μm ), a through - hole electrode 8 filled with cu , and a barrier metal 13 ( au / ni / ti : 0 . 2 μm / 0 . 3 μm / 0 . 1 μm ), and a recessed portion 16 ( first hollow portion ) of which depth is about 100 μm is formed in a portion of the cap 2 and on the surface of the cap 2 facing the semiconductor chip 12 . in the semiconductor device according to the third embodiment , the bump electrode 3 ( height 80 μm ) is formed on the semiconductor chip 12 , and the entire bump electrode 3 is pressed into the through - hole electrode 8 , so that the cap 2 and the bump electrode 3 are bonded . when the bump electrode 3 is pressed into the through - hole electrode 8 , thermocompression is performed using a flip chip bonder with a tool pressure of 5n / bump , a thermocompression time of 20 seconds , a tool temperature of 350 degrees celsius , and a stage temperature 300 degrees celsius . in the semiconductor device according to the third embodiment explained above , the inventors have confirmed that , after the bump electrode 3 and the cap 2 are bonded , the entire bump electrode 3 is inserted into the through - hole electrode 8 . further , the inventors have confirmed that a die shear strength evaluation indicates that the die shear strength has increased by twice or more as compared with a case where only the distal end portion of the protruding shape of the bump electrode 3 is pressed in . as described above , like the first embodiment , in the semiconductor device according to the third embodiment , multiple high frequency devices 1 are rearranged in proximity , further , the high frequency devices 1 are connected with the still finer re - wiring layer 10 , so that multiple high frequency devices 1 can be integrated with a high density . therefore , in the semiconductor device according to the third embodiment , on a single restructured wafer , more high frequency devices 1 can be provided , so that the cost of production can be reduced . further , in the semiconductor device according to the third embodiment , the high frequency device 1 has a space from the cap 2 made of a high resistance silicon and the like , and therefore , this reduce interference between the high frequency device 1 and the cap 2 , and the signal transmission can be done with a low loss , so that a high performance semiconductor module having multiple high performance high frequency devices 1 can be produced . further , with the semiconductor device according to the third embodiment , the anchoring effect is increased as compared with the first embodiment and the second embodiment , and the bonding between the bump electrode 3 and the cap 2 can be achieved more strongly . a semiconductor device according to the fourth embodiment will be hereinafter explained with reference to fig1 . the fourth embodiment is different from the third embodiment only in that a second recessed portion 17 ( second hollow portion ) and a solder 18 are different . therefore , except the description of the second recessed portion 17 and the solder 18 , the fourth embodiment is the same as the third embodiment , and therefore , the same elements are denoted with the same reference numerals , and detailed description thereabout is omitted . fig1 is configuration diagram after the bump electrode and the cap are bonded in the semiconductor device according to the fourth embodiment . as shown in fig1 , in the semiconductor device according to the fourth embodiment , in the cap 2 having the high resistance silicon , not only the recessed portion 16 but also the second recessed portion 17 are provided to be in two - stage structure . in this case , the second recessed portion is provided around the periphery of the side surface of the semiconductor chip 12 . further , in the semiconductor device according to the fourth embodiment , the solder 18 is formed between the side surface of the semiconductor chip 12 and the side surface of the second recessed portion 17 of the cap 2 . in this case , in the semiconductor device according to the fourth embodiment , when the bump electrode 3 is pressed into the through - hole electrode 8 , thermocompression is performed using a flip chip bonder with a tool pressure of 5n / bump , a thermocompression time of 20 seconds , a tool temperature of 350 degrees celsius , and a stage temperature 300 degrees celsius . further , after a thermosetting epoxy resin is injected into a side surface portion of the bump electrode 3 using a dispenser , it is cured at a heating temperature of 150 degrees celsius and a heating time of 5 minutes , so that the side surface is sealed . further , in the semiconductor device according to the fourth embodiment , the side surface is sealed using the solder 18 . in this case , as compared with the semiconductor device according to the third embodiment , air tightness is significantly improved in the sealing of the side surface with the solder 18 . further , when a high - melting point solder ( snagcu , ausn , sncu , and the like ) is used for the solder 18 , the heat resistivity is also improved . when the side surface is sealed with the solder 18 , the bonding strength is strong , and therefore , the shock resistance is also improved . as described above , like the first embodiment , in the semiconductor device according to the fourth embodiment , multiple high frequency devices 1 are rearranged in proximity , further , the high frequency devices 1 are connected with the still finer re - wiring layer 10 , so that multiple high frequency devices 1 can be integrated with a high density . therefore , in the semiconductor device according to the fourth embodiment , on a single restructured wafer , more high frequency devices 1 can be provided , so that the cost of production can be reduced . further , in the semiconductor device according to the fourth embodiment , the high frequency device 1 has a space from the cap 2 made of a high resistance silicon and the like , and therefore , this reduce interference between the high frequency device 1 and the cap 2 , and the signal transmission can be done with a low loss , so that a high performance semiconductor module having multiple high performance high frequency devices 1 can be produced . further , with the semiconductor device according to the fourth embodiment , the side surface is sealed with the solder 18 , and therefore , as compared with the semiconductor device according to the third embodiment , the air tightness is significantly improved and the shock resistance is also improved . according to the semiconductor device of any one of embodiments explained above , the distal end portion of the bump electrode 3 of the protruding shape provided on the semiconductor chip 12 is pressed into the through - hole electrode 8 and the cap 2 having the high resistance silicon , so that the through - hole electrode 8 is deformed and the bonding with the cap 2 is made , whereby the shear strength is improved due to the anchoring effect , and this prevents failure of separation at the bonding portion between the cap 2 and the bump electrode 3 , and thus , a highly reliable connection structure is achieved . it should be noted that the present invention is not limited to the embodiments explained above , and it is to be understood that the present invention may be modified in various manners . in short , the present invention is not limited to the embodiments explained above as they are . when the present invention is carried out , it can be embodied upon modifying constituent elements without deviating from the gist thereof . multiple constituent elements disclosed in the embodiments can be combined appropriately , and various modes may be formed . for example , some of constituent elements may be omitted from all the constituent elements disclosed in the embodiments . further , constituent elements in different embodiments may be appropriately combined . | 7 |
the preferred embodiment of this invention allows train passengers to have their personal automobiles carried on the same train . fig1 is a perspective view of such a system . a passenger 11 has just parked his car 13 on a loading pallet 15 . another automobile 17 and its pallet 19 are being loaded onto the railroad car 21 . fig2 shows the railroad car 21 in detail . the preferred railroad car 21 has a base 23 mounted on standard railroad wheels 25 , which are supported on rails 27 . a movable frame 29 is carried on the base 23 , and a movable roof 31 fits over the frame 29 . lower sidewalls 33 extend upward from the base 23 , and upper sidewalls 35 extend downward from the roof 31 . a central hydraulic cylinder 37 and a pair of outer hydraulic cylinders 39 permanently mounted below the track and between rails 27 provide lifting means for moving the frame 29 up and down relative to the base 23 . an additional pair of hydraulic cylinders 41 extend upward from the outer hydraulic cylinders 39 to provide opening means for removing the roof 31 from the railroad car 21 . in fig2 the roof 31 and the upper sidewalls 35 are shown raised to their uppermost position . the frame 29 is in the upper loading position . fig3 illustrates the components of the conveyor means for moving the automobiles laterally from a loading dock 43 into the railroad car 21 . a first automobile 17 has been parked up on a first pallet 19 , and a second automobile 13 has been parked upon a second pallet 15 . the railroad car 21 has been parked next to the loading dock 43 , and the roof 31 and upper sidewalls 35 are resting on the frame 29 . the frame 29 has an upper compartment floor 45 and a lower compartment floor 47 , and the hydraulic cylinders 37 , 39 have raised the frame 29 until the lower compartment floor 47 is located just above the lower sidewalls 33 . the pallets 15 , 19 are supported by a plurality of power driven cylindrical rollers 49 which are mounted on the loading dock 43 parallel to the railroad car 21 . a movable walkway 51 is mounted on the loading dock 43 by means of hydraulic cylinders 53 . the hydraulic cylinders 53 are the walkway elevator means for raising and lowering the movable walkway 51 . the upper position of the walkway 51 is even with the pallets 15 , 19 , and the lower position of the walkway 51 is level with the rollers 49 . a movable platform 55 is mounted on the loading dock 43 adjacent the railroad car 21 . hydraulic cylinders 57 are the elevator means for raising and lowering the platform 55 . a horizontal piston 59 is located in the loading dock 43 next to the movable platform 55 . fig3 - 7 illustrate the operation of the loading system . after the automobiles 13 , 17 have been parked upon the appropriate pallets 15 , 19 , the situation is as illustrated in fig3 . the cylindrical rollers 49 beneath the first pallet 19 are then rotated to move the pallet 19 onto the platform 55 . the drive means for rotating the rollers 49 may be any of a number of means well known in the art , such as an electric motor . once the pallet 19 and the automobile 17 have been moved completely onto the platform 55 , the situation is now as illustrated in fig4 . the platform 55 is then lowered by the hydraulic cylinders 57 until the platform 55 is level with the lower compartment floor 47 . as illustrated in fig5 the horizontal piston 59 is then used as propellant means for pushing the pallet 19 off the platform 55 and onto the lower compartment floor 47 . the pallet 19 is supported upon a plurality of casters 61 in order to facilitate the movement of the pallet 19 across the surface of the platform 55 . the horizontal piston 59 is then retracted into the loading dock 43 and the platform 55 is returned to its upper position . as illustrated in fig6 the frame 29 is lowered until the upper compartment floor 45 is located just above the lower sidewalls 33 . the movable walkway 51 is lowered to the level of the cylindrical rollers 49 , and the rollers 49 beneath the second pallet 15 begin to rotate . the pallet 15 and the automobile 13 are moved across the walkway 51 and onto the second set of rollers 49 . these rollers 49 also rotate to continue the movement of the pallet 15 onto the platform 55 . the second pallet 15 and the second automobile 13 are then loaded onto the upper compartment floor 45 in the same manner that the first pallet 19 and the first automobile 17 were loaded onto the lower compartment floor 47 . the horizontal piston 59 is then retracted and the roof 31 , upper sidewalls 35 , and frame 29 are lowered to the transit position . the situation is then as illustrated in fig7 wherein the automobiles 13 , 17 are completely covered by the roof 31 , the sidewalls 33 , 35 , and the base 23 of the railroad car 21 . the process of unloading the automobiles 13 , 17 from the railroad car 21 is in the opposite order of loading . during unloading , a hook ( not shown ) on the end of the horizontal piston 59 attaches to the pallets 15 , 19 in order to pull the pallets 15 , 19 off the compartment floors 45 , 47 onto the movable platform 55 . the roller pallet system offers a number of advantages over prior art methods for loading automobiles aboard a train . it is possible to load hundreds of automobiles in a matter of minutes in a simple , two - step operation . the system functions automatically after automobiles are positioned on the pallets by their owners , minimizing the need for terminal employees . the use of pallets permits automobiles to be loaded in compartments only slightly larger than the largest vehicles , saving space and eliminating contact between the vehicles and the railroad car . the latter would abolish vehicle damage experienced through traditional loading procedures . the method for inserting palletized automobiles in a storage module within the railroad car totally eliminates the possibility of thieves or vandals gaining access to the vehicles . it also would permit the automobile storage module to be carried between the wheels of the railroad car , in a drop - center position , reducing center of gravity and car height . a lower center of gravity ensures stability at higher speeds , facilitating operation in the consist of a fast passenger train . lower car height would permit freight cars to utilize non - circuitious freight train routings now denied because of overhead clearance problems . while the invention has been shown in only one of its forms , it should be apparent to those skilled in the art that it is not so limited , but is susceptible to various changes and modifications without departing from the spirit thereof . | 1 |
the particulars shown herein are by way of example and for purposes of illustrative discussion of the embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the present invention . in this regard , no attempt is made to show structural details of the present invention in more detail than is necessary for the fundamental understanding of the present invention , the description taken with the drawings making apparent to those skilled in the art how the several forms of the present invention may be embodied in practice . according to one embodiment of the present invention , and not intending to be limiting , the nvd method can be used for : ( 1 ) production of support structures on different metallic components , ( 2 ) production of combustion chamber base bodies with cooling channels of nvd nickel , ( 3 ) production of combustion chamber support structures and the necessary input and discharge distributors as an integral component for rocket drives and gas generators , ( 4 ) production of support structures on ceramic components , ( 5 ) coating of ceramic components for surface sealing , ( 6 ) production of connecting elements on metallic and ceramic base structures , ( 7 ) mechanical connection of base bodies to a nickel jacket , and ( 8 ) nvd deposition in combination with a soldered connection . exemplary advantages of the nvd method are , for example , high deposition rate , and application of nickel layers of uniform thickness to bodies of any shape in a manner conforming to the surface , and the removal in open cavities . in one embodiment , the production of support structures on different metallic and non - metallic components pursuant to the method according to the invention is described below . the base body to be coated can be positioned and prepared in the nvd chamber in the known manner . with the aid of the nvd method , a specific nickel layer is then applied , which is used as a support structure . the connection of the base body to the nickel layer is then further processed as a component . in two embodiments , the nvd coating can be used in rocket technology in the production of metallic and non - metallic cooled bodies that are very highly loaded thermally , and structurally . examples are combustion chambers , expansion nozzles and cooled gas generators . the body to be coated can be composed , for example , of a ( milled ) metallic base structure ( fig1 ; 10 ) provided with cooling channels , a ceramic fiber composite structure ( fig4 ; 11 ), or of a composite of individual tubular elements ( fig3 ; 12 a and 12 b ). in one embodiment , the coating method can be carried out in different ways , for example with the cooling channels open or closed on the coating side , as shown for example in fig1 and 2 , and as described below . for example , in an embodiment , for cooling channels ( 25 ) open on the coating side , the cooling channels can be filled completely , or partially with a suitable material ( 13 ) and then coated with nickel ( 14 ) in the nvd method . in this coating method , a structure with molecular connection of the nvd layer ( 14 ) to the base structure ( 10 ) by suitable chemical or electroplating pretreatment of the surfaces to be coated can be achieved , but not required . in another embodiment , the open cooling channels can be covered with a layer ( 15 ) before the coating by a different method , e . g ., electroplating ( 15 ), and then coated in the nvd method . in this coating method , a structure with the molecular connection of the nvd layer ( 14 ) to the base structure ( 10 ) by suitable chemical or electroplating pretreatment of the surfaces to be coated can be achieved , but not required . in yet another embodiment , the cooling channels can be processed mechanically or chemically ( 16 a , 16 b , 16 c ) on the surface to be coated such that a contoured geometry or engagement - like microstructures ( 16 a ) form that render possible an nvd cavity deposition . in this manner , a positive connection is ensured between a support structure and a base structure . the covering of the cooling channel before the coating can be carried out with a suitable filler ( 13 ). in a further embodiment , a structure with the molecular connection of the nvd layer to the base structure by suitable chemical or electroplating pretreatment of the surfaces to be coated is contemplated . again , referring to fig1 and 2 , nvd deposition in combination with a soldered connection pursuant to the method according to the invention is contemplated and described below . the base body can be coated in the area of the bonding zone to the nvd nickel or a partial area thereof by electrodeposition with a suitable solder . alternatively , the solder material can also be applied to the base body in the form of a foil . the nvd coating can then take place , and subsequently the soldering process is carried out in a soldering furnace . the described method has an advantage of precise form closure especially when large components are to be connected . thus , a uniform soldering gap even with complex and undercut shaping of the bonding zone and with tolerance fluctuations from the production process of the individual parts can be provided . as an example , in the case of combustion chambers , the base body ( 10 ) could be covered with solder in this manner at the bond surface ( 25 ) to the nickel jacket . subsequently the cooling channels can be milled and filled with suitable material ( 13 ) before carrying out by way of an nvd coating , the application of the nickel jacket ( 14 ) without gaps . after the coating operation , the soldering process can be carried out between the base body and the nvd layer . in another embodiment , the cooling channels ( 12 a , 12 b ) can be closed on the coating side , see , e . g ., fig3 . with such closed channels , structures with the molecular connection of the nvd layer to the base structure by suitable chemical or electroplating pretreatment of the surfaces can be coated . in a further embodiment , it may be advantageous to form structures without a molecular connection of the nvd layer to the base structure to avoid thermal reactive forces with the influence of different temperatures . in addition , based on material or application , a separating layer of greater or lesser thickness by suitable pretreatment of the surfaces can be utilized . in yet a further embodiment , the surfaces to be coated can be processed mechanically or chemically such that a geometry is formed that renders possible an nvd cavity deposition . thus , a positive connection can be provided between the support structure and the base structure . in another embodiment , when the surfaces to be coated are typically porous due to the material or manufacture , nvd cavity deposition can be advantageous in that a positive connection can be provided between the support structure and the base structure . in another embodiment , the coating of ceramic components for surface sealing pursuant to the method according to the invention is shown for example in fig4 , and is described below . like the nvd coating of metallic materials , the nickel deposited in the nvd method can fill up the pores , such as formed in the production of ceramic components . thus , the nickel coating can produce a seal from gases or liquids on the surface ( 18 ). moreover , with thermally highly stressed components , the high ductility of the nvd nickel is thereby advantageous . in a further embodiment , the production of combustion chamber base bodies from nvd nickel with integrated cooling channels pursuant to the method according to the invention is shown for example in fig5 , and described below . a combustion chamber base body of 100 % nickel is advantageous for certain engine types or when certain fuels are used . thus , the nvd method is suitable for the production of a base structure ( liner ) provided with ribs as well as for the production of an integral overall body provided with cooling channels . in an exemplary embodiment , a ribbed base structure can be produced through deposition of the nvd nickel on a female mold of corresponding shape , and wall thicknesses and finished contour of the ribbed base structure can be subsequently adapted and optimized by processing . in another embodiment , the cavities ( 22 ) conducting coolant can be subsequently produced from suitable materials as dead cores and subsequently coated with nvd nickel ( 19 ). wall thicknesses and the finished contour ( 20 ) of the base body can be subsequently adapted and optimized by processing . the cavities are formed by the core material being released after the coating operation with suitable auxiliaries . in yet a further embodiment , the production of support structures on ceramic components pursuant to the method according to the invention is shown for example in fig4 , and is described below . similar to the coating of metallic materials , the nvd method can provide deposition on ceramic surfaces ( 11 ). the deposited nickel thereby penetrates into the porous surface ( 18 ), becomes anchored there and with continued coating forms the basis for the structural build - up ( 17 ). in yet another embodiment , the production of connecting elements on metallic and ceramic base structures pursuant to the method according the present invention is shown for example in fig5 and 6 , and is described below . in an embodiment , nvd having nickel layer thicknesses of more than 35 mm can currently be applied . these high layer thicknesses make it possible to build up connecting elements such as flanges ( 19 ), input and discharge distributors ( 20 ) and reinforcing rings ( 22 ) on the coated components directly or to produce them by subsequent mechanical processing of the nvd layer . further , the mechanical connection of base bodies and a nickel jacket pursuant to the method according to the invention is shown for example in fig6 , and described below . the method described above for connecting cooling channel segments to a nickel jacket can be generally used to form mechanical connection ( s ) of base bodies and a nickel jacket . this method is of particular interest if nickel fittings ( 23 ) are to be connected to materials with different properties ( 24 ) and complex geometry without gaps . examples would be nickel sandwich constructions with ceramics , fiber composite materials , and metals . it is noted that the foregoing examples have been provided merely for the purpose of explanation and are in no way to be construed as limiting of the present invention . while the present invention has been described with reference to an exemplary embodiment , it is understood that the words which have been used herein are words of description and illustration , rather than words of limitation . changes may be made , within the purview of the appended claims , as presently stated and as amended , without departing from the scope and spirit of the present invention in its aspects . although the present invention has been described herein with reference to particular means , materials and embodiments , the present invention is not intended to be limited to the particulars disclosed herein ; rather , the present invention extends to all functionally equivalent structures , methods and uses , such as are within the scope of the appended claims . further , when an amount , concentration , or other value or parameter , is given as a list of upper preferable values and lower preferable values , this is to be understood as specifically disclosing all ranges formed from any pair of an upper preferred value and a lower preferred value , regardless whether ranges are separately disclosed . | 2 |
for a more complete understanding of the present disclosure , needs satisfied thereby , and the objects , features , and advantages thereof , reference now is made to the following descriptions taken in connection with the accompanying drawings . hereinafter , illustrative embodiments of the disclosure will be described in detail with reference to the accompanying drawings . as depicted in fig1 , a developing device 1 may comprise a developing roller 2 ( an example of a developer carrier ), a supply roller 3 , a blade unit ( or blade assembly ) 4 , and a developing case 5 that may hold these components . the developing case 5 may be a container having therein a toner storage chamber 53 capable of storing toner therein . the developing case 5 may also be formed to define an opening 51 in one of its surfaces . the developing case 5 may define an edge of the opening 51 and comprise a blade support surface 52 to which the blade unit 4 may be fixed . as depicted in fig2 , a conveyor member 7 for conveying toner toward the supply roller 3 may be disposed in the toner storage chamber 53 . the conveyor member 7 may comprise a shaft portion 71 that may be rotatably supported by the developing case 5 , and a film 72 ( or other agitator ) that may rotate along with rotation of the shaft portion 71 . as depicted in fig1 , the developing roller 2 may comprise a cylindrical roller body 2 a and a shaft 2 b that may be inserted into the roller body 2 a and may rotatably interface with the roller body 2 a . the roller body 2 a may have elasticity and may be capable of holding toner on its cylindrical surface . the developing roller 2 may be disposed to close or partially close the opening 51 of the developing case 5 . the shaft 2 b may protrude from the roller body 2 a in an axial direction of the developing roller 2 and may be rotatably supported by the developing case 5 . the supply roller 3 may be disposed inside the developing case 5 in contact with the developing roller 2 , and may be rotatably supported by the developing case 5 . the supply roller 3 may be configured to supply toner stored in the developing case 5 to the developing roller 2 as the developing roller 2 rotates . the blade unit 4 may comprise a blade 41 and a supporting member 42 . the blade 41 may be disposed near the developing roller 2 such that a tip of the blade 41 may be placed on the developing roller 2 . the supporting member 42 may hold the blade 41 . the blade 41 may comprise sheet metal having an approximately rectangular shape ( e . g ., sheet metal having two longer sides and two shorter sides ). the blade 41 may be positioned so that a longer side of the blade extends in a direction that an axis of the developing roller 2 may extend ( hereinafter , this direction may be referred to as the longer direction ld ( see fig3 a )). that is , a longer side of the blade 41 may be approximately parallel to the axial direction of the developing roller 2 , and a shorter side of the blade 41 may be approximately perpendicular to the axial direction of the developing roller 2 ( hereinafter , this approximately perpendicular direction may be referred to as the shorter direction sd ( see fig3 a )). the blade 41 may be made of metallic material , for example , stainless steel . in other embodiments , for example , the blade 41 may comprise a sheet metal whose surface may have a coating including press oil . for example , the blade 41 may have a thickness of 0 . 05 to 2 . 5 mm , a thickness of 0 . 05 to 0 . 12 mm , a thickness of 0 . 05 to 1 . 00 mm , a thickness of 0 . 07 to 0 . 15 mm , or a thickness of 0 . 08 to 0 . 12 mm . a longer dimension ( e . g ., a length ) of the blade 41 ( extending in the longer direction ) may be greater than a dimension of the roller body 2 a of the developing roller 2 in the axial direction . for example , the blade 41 may have a length of 218 to 270 mm , a length of 220 to 260 mm , or a length of 222 to 250 mm . the blade 41 may comprise a contact portion 411 , which may protrude toward the developing roller 2 and directly contact the roller body 2 a of the developing roller 2 . the contact portion 411 may protrude from a distal end 41 e of a lower surface 41 f ( e . g ., a surface facing the developing roller 2 ) of the blade 41 ( see fig2 ). the contact portion 411 may be made of , for example , rubber and may extend in the longer direction of the blade 41 . the supporting member 42 may be a member for fixing or otherwise holding a fixed end of the blade 41 to the developing case 5 . the supporting member 42 may be made of metallic material , for example , electrolytic zinc - coated carbon steel sheet . the supporting member 42 may have a thickness greater than the blade 41 and an approximately or substantially rectangular shape . a longer side of the supporting member 42 may be positioned so that it extends in a direction that is approximately parallel to the longer side of the blade 41 . the supporting member 42 may extend so as to exceed both ends 413 of the blade 41 . that is , the longer side of the supporting member 42 may be longer than the longer side of the blade 41 . the ends of the supporting member 42 may extend past the ends 413 of the blade 41 . the supporting member 42 may extend over the blade 41 on a side opposite to the blade support surface 52 so that the supporting member 42 may pinch the blade 41 in conjunction with the blade support surface 52 of the developing case 5 . in other words , the supporting member 42 and blade support surface 52 may be positioned such that the blade 41 is interposed therebetween . the blade 41 may be pinched between an edge 42 e of the supporting member 42 and an edge 52 e of the support surface 52 . a portion , which may contact the edge 42 e of the supporting member 42 and the edge 52 e of the blade support surface 52 , of the blade 41 may function as a fulcrum when the blade 41 bends . the blade unit 4 configured as described above may be fixed to the developing case 5 using screws 6 through holes h in the blade 41 and the supporting member 42 . in this state , the blade unit 4 may be configured to regulate a thickness of a toner layer attaching to the developing roller 2 . in particular , the contact portion 411 of the blade 41 , which may contact the rotating developing roller 2 , may regulate a thickness of the toner layer by blocking excess toner from passing as the developing roller 2 rotates . as depicted in fig3 a , the supporting member 42 may comprise a positioning protrusion 421 , which may be engaged with the blade 41 , e . g ., at opposite end portions of the longer side of the blade 41 . the positioning protrusion 421 may protrude from a surface of the supporting member 42 that faces the blade 41 . as shown in the example embodiment of fig3 a , the blade 41 may have a pair of openings 412 that may be engaged with a pair of positioning protrusions 421 . one of the pair of openings 412 may be a circular opening and the other of the pair of openings 412 may be an elongated opening . the elongated opening of the pair of openings 412 may absorb a dimensional deviation between the two openings 412 and linear expansion of the blade 41 and / or the supporting member 42 in the longer direction that may occur during welding . in other words , for example , the elongated opening 412 may be elongated in order for the blade 41 to stay engaged with one of the positioning protrusions 421 if the blade 41 expands as a result of welding . the blade 41 may be positioned with respect to the supporting member 42 by the engagement of the openings 412 and the corresponding positioning protrusions 421 , respectively . the blade 41 may be welded to the supporting member 42 at a plurality of locations along the blade 41 in the longer direction . more specifically , the blade 41 may be joined to the supporting member 42 by laser welding at multiple portions of the blade 41 , including portions of the blade 41 at end portions of the blade 41 , portions of the blade 41 between the positioning protrusions 421 and the ends 413 of the blade 41 and portions of the blade 41 between the positioning protrusions 421 themselves . the blade 41 may have a first combined weld mark 43 , which may join the blade 41 and the supporting member 42 at a position between the positioning protrusions 421 , and second combined weld marks 44 , which may join the blade 41 and the supporting member 42 at respective positions located towards an outer edge of the supporting member 42 from the respective positioning protrusions 421 in the longer direction . the first combined weld mark 43 may extend from a vicinity of one of the openings 412 to a vicinity of the other of the openings 412 along the longer dimension of the blade 41 . as depicted in fig3 b , the first combined weld mark 43 may include a plurality of weld marks 43 a that may be aligned along the longer direction of the blade 41 , wherein adjacent weld marks of the plurality weld marks 43 a may overlap each other . that is , the plurality of weld marks 43 a that the blade 41 may have may partially overlap one another , thereby forming the combined weld mark 43 . a weld mark may refer to a welded portion ( e . g ., a modified portion of the blade and / or supporting member ) that may be formed by one continuous application ( e . g ., one pulse ) of a laser beam . each weld mark 43 a may have a shape and size corresponding to the shape and size ( e . g ., diameter ) of the laser beam used to create the weld mark . the circular shape , as shown in the example of fig3 b , may include a circular shape in which a dimension of a most elongated portion ( e . g ., longest diameter ) may be within a range of 110 % to 330 % of a dimension of a least elongated portion ( e . g . shortest diameter ). in other embodiments , for example , the dimension of the most elongated portion ( e . g ., longest diameter ) may be within a range of 110 % to 250 %, a range of 100 % to 120 %, a range of 100 % to 110 %, a range of 101 % to 105 %, or a range of 101 % to 115 % of the dimension of the least elongated portion ( e . g . shortest diameter ). for example , the weld marks 43 a may have a size of 0 . 1 to 0 . 4 mm . the plurality of weld marks 43 a may overlap on top of one another in an order in which the plurality of weld marks 43 a may be arranged in the longer direction of the blade 41 . for example , when creation of the weld mark 43 a begins from the circular opening 412 side of the blade 41 , a weld marks 43 a formed further from the circular opening 412 may be formed over the adjacent weld mark 43 a formed closer to the circular opening 412 ( see dotted lines illustrated in fig3 b ). as depicted in fig3 a , the second combined weld marks 44 may extend from respective vicinities of the openings 412 to respective vicinities of the ends 413 of the blade 41 along the longer direction of the blade 41 . in a similar manner to the first combined weld mark 43 depicted in fig3 c , each second combined weld mark 44 may include a plurality of circular weld marks 44 a that may be arranged along the longer direction of the blade 41 , and that may overlap with one another . of the weld marks 44 a included in the second combined weld mark 44 , the outermost ones of the weld marks 44 a may be formed on the blade 41 along the longer direction of the blade 41 while a gap is left between edges of the outermost weld marks 44 a and the ends 413 of the blade 41 . the gap may be smaller than a nugget diameter d of the weld mark 44 a . as depicted in fig3 b and 3c , the first combined weld mark 43 and the second combined weld marks 44 may have substantially the same dimension ( e . g ., a width ) in the shorter direction of the blade 41 . comparing a dimension w2 ( e . g ., a width ) in the shorter direction of the blade 41 of the outermost weld marks 44 a included in one of the second combined weld marks 44 in the longer direction of the blade 41 with a dimension w1 ( e . g ., a width ) in the shorter direction of the blade 41 of a middle weld mark 43 a included in the first combined weld mark 43 in the longer direction of the blade 41 , the dimension w2 of the outermost weld mark 44 a of the second combined weld mark 44 may be 0 . 80 to 1 . 20 times as large as the dimension w1 of the middle weld mark 43 a of the first combined weld mark 43 . in other embodiments , for example , the dimension w2 of the outermost weld mark 44 a of the second combined weld mark 44 may be 0 . 90 to 1 . 01 times , 0 . 85 to 1 . 25 times , or 0 . 90 to 1 . 1 times as large as the dimension w1 of the middle weld mark 43 a of the first combined weld mark 43 . that is , the dimension w2 in the shorter direction of the blade 41 of one of the outermost weld marks of all the weld marks in the weld marks 43 a and 44 a formed on the blade 41 in the longer direction of the blade 41 may be 0 . 80 to 1 . 20 times as large as the dimension w1 in the shorter direction of the blade 41 of the middle weld mark of all the weld marks in the weld marks 43 a and 44 a formed on the blade 41 in the longer direction of the blade 41 . in other embodiments , for example , the dimension w2 in the shorter direction of the blade 41 of one of the outermost weld marks of all the weld marks in the weld marks 43 a and 44 a formed on the blade 41 in the longer direction of the blade 41 may be 0 . 90 to 1 . 01 times , 0 . 85 to 1 . 25 times , or 0 . 90 to 1 . 1 times as large as the dimension w1 in the shorter direction of the blade 41 of the middle weld mark of all the weld marks in the weld marks 43 a and 44 a formed on the blade 41 in the longer direction of the blade 41 . the weld mark positioned at the middle of all the weld marks in the weld marks 43 a and 44 a formed on the blade 41 in the longer direction of the blade 41 may be determined as the middle weld mark . if there is no weld mark formed on the middle of the line of the weld marks , a weld mark formed at a position closest to the middle of the line of the weld marks in the longer direction of the blade 41 may be determined as the middle weld mark . hereinafter , advantages of the blade unit 4 , configured in accordance with this disclosure , are described . the weld marks 43 a of the first combined weld mark 43 and the weld marks 44 a of the second combined weld mark 44 formed on the blade have substantially the same size , thereby reducing or preventing an occurrence of variations in contact pressure between the blade 41 and the developing roller 2 when the blade 41 contacts the developing roller 2 . therefore , the quality of the blade unit 4 may be improved . the blade 41 may be welded to the supporting member 42 while the slight gap that is smaller than the nugget diameter d is left between the edges of the outermost weld marks and the ends 413 of the blade 41 in the longer direction of the blade 41 , whereby the blade 41 might not come off from the supporting member 42 easily . next , a manufacturing method of the blade unit 4 is described . when the blade unit 4 is assembled , as depicted in fig4 a , the blade 41 may first be placed on the supporting member 42 ( e . g ., a preparation process ). at that time , the openings 412 in the blade 41 may be engaged with the corresponding positioning protrusions 421 of the supporting member 42 . then , the blade 41 and the supporting member 42 may be fastened on a worktable . thereafter , as depicted in fig4 b , while a laser beam 81 irradiated from the welding machine 8 is moved with respect to the blade 41 , the laser beam 81 may be irradiated onto the blade 41 to weld the blade 41 and the supporting member 42 to each other ( e . g ., a welding process ). in some embodiments , the welding machine 8 may be configured to irradiate a portion , which may face the welding machine 8 , of an object with a pulsed laser . that is , pulses of the laser beam 81 may be emitted . in other embodiments , for example , another welding machine that may be configured to irradiate the blade 41 with a laser beam by moving a reflector provided inside the welding machine , without moving the welding machine itself , may be used . for example , an yttrium aluminum garnet (“ yag ”) laser or a fiber laser may be used as the pulsed laser . in particular , a fiber laser ( which emits a laser beam with a relatively small diameter ) may be used so that the welding process for creating overlapping weld marks does not cause overheating and / or deformation of the blade 41 and / or the supporting member 42 . in the welding process , the laser beam 81 may be moved with respect to the blade 41 along the longer direction of the blade 41 from one end portion , in which the circular opening 412 may be defined , to the other end portion , in which the elongated opening 412 may be defined . more specifically , the laser beam 81 may be moved with respect to the blade 41 along the longer direction of the blade 41 from a position more outside than the one end 413 of the blade 41 to a position more outside than the other end 413 of the blade 41 . at that time , the welding machine 8 may be moved at a speed which may allow formation of adjacent weld marks 43 a or weld marks 44 a that may overlap each other when the laser beam 81 is irradiated onto the blade 41 . the welding machine 8 may be moved first and the laser beam 81 may be then irradiated onto the blade 41 . more specifically , as depicted in fig4 c , the laser beam 81 may be irradiated onto the blade 41 when the center of the laser beam 81 reaches a position a predetermined distance i inside from the one end 413 of the blade 41 while the laser beam 81 is moved from the outside to the inside of the blade 41 with respect to the one end 413 located close to the circular opening 412 . the predetermined distance i may be longer than or equal to a half of the nugget diameter d and shorter than the nugget diameter d . while the welding machine 8 is moved , the irradiation of the laser beam 81 may be stopped . thus , the movement of the welding machine 8 may be stopped after the irradiation of the laser beam 81 is stopped . more specifically , the irradiation of the laser beam 81 may be stopped when the center of the laser beam 81 reaches a position the predetermined distance i inside the other end 413 of the blade 41 while the laser beam 81 is moved from the inside to the outside of the blade 41 with respect to the other end 413 located close to the elongated opening 412 . according to the above - described manufacturing method , while the laser beam 81 is irradiated onto the blade 41 , the laser beam 81 moves with respect to the blade 41 at a constant speed . therefore , the weld marks 43 a and 44 a having substantially the same size may be formed across the blade 41 in the longer direction of the blade 41 . starting the welding from the circular opening 412 side as described above may allow the elongated opening 412 to absorb a thermal expansion of the blade 41 that may occur during welding . while the disclosure has been described in detail with reference to the example drawings , it is not limited to such examples . various changes , arrangements , and modifications may be realized without departing from the spirit and scope of the disclosure . in the description below , common parts have the same reference numerals as those of the above - described embodiments , and the detailed description of the common parts is omitted . as described above , the blade 41 may be welded to the supporting member 42 while the slight gap that is smaller than the nugget diameter d is left between the edges of the outermost weld marks and the ends 413 in the longer direction . however , the configuration of the blade 41 might not be limited to that example . in other embodiments , for example , as depicted in fig5 a , a portion of each end 413 of the blade 41 in the longer direction of the blade 41 may be welded to the supporting member 42 . more specifically , the blade 41 may have a plurality of third weld marks 45 between the positioning protrusions 421 along the longer direction of the blade 41 and fourth weld marks 46 at respective positions located towards an outer edge of the supporting member 42 from the respective positioning protrusions 421 in the longer direction . as depicted in fig5 b , the weld marks 45 and 46 may be formed on the blade 41 using a continuous wave laser such as a fiber laser and extend along the longer direction of the blade 41 . the fourth weld marks 46 may extend from the inside to the outside of the blade 41 beyond the respective ends 413 of the blade 41 in the longer direction of the blade 41 , and may thus be formed on respective portions of the supporting member 42 where there may be no blade 41 . the fourth weld mark 46 may have a dimension w4 ( e . g ., a width ) in the shorter direction of the blade 41 . the dimension w4 of the fourth weld mark 46 may be a dimension in the shorter direction of the blade 41 of an outer end portion of an outermost fourth weld mark 46 in the longer direction of the blade 41 . the dimension w4 of the fourth weld mark 46 in the shorter direction of the blade 41 may be 0 . 8 to 1 . 2 times as large as a dimension w3 ( e . g ., a width ) of one of the third weld marks 45 in the shorter direction of the blade 41 . the blade unit 4 configured as described above may have thereon the weld marks 45 and 46 that may have substantially the same width in the shorter direction of the blade 41 , thereby improving the quality of the blade unit 4 as in the case of the illustrative embodiment . the portions of the ends 413 of the blade 41 may be welded to the supporting member 42 . as in the case of the illustrative embodiment , the blade 41 therefore might not come off from the supporting member 42 easily . to assemble the blade unit 4 configured as described above , in the welding process , the irradiation of the laser beam 81 may be started before the center of the laser beam 81 reaches the end 413 located close to the circular opening 412 in the blade 41 . the irradiation of the laser beam 81 may be continued until the center of the laser beam 81 passes the end 413 located close to the circular opening 412 in the blade 41 . the irradiation of the laser beam 81 may be started before the center of the laser beam 81 reaches the end 413 located close to the elongated opening 412 in the blade 41 . the irradiation of the laser beam 81 may be continued until the center of the laser beam 81 passes the end 413 located close to the elongated opening 412 in the blade 41 . as described above , the blade 41 may be welded to the supporting member 42 in the vicinities of the ends 413 in the longer direction of the blade 41 . however , the configuration of the blade unit 4 might not be limited to that example . in other embodiments , for example , as depicted in fig6 , in a case where the supporting member 42 is shorter in length than the blade in the longer direction of the blade 41 , the second weld marks 47 may be formed inside of respective ends 422 of the supporting member 42 and towards the outer edges of the blade 41 from the respective positioning protrusions 421 in the longer direction of the blade 41 . the supporting member 42 may be welded to the blade 41 while the slight gap that is smaller than the nugget diameter d is left between the second weld marks and the ends 422 of the blade 41 in the longer direction of the blade 41 . in still other embodiments , as depicted in fig7 , the fourth weld marks 48 may be formed over the respective ends 422 of the supporting member 42 in the longer direction of the blade 41 and towards the respective outer edges of the blade 41 from the respective positioning protrusions 421 in the longer direction of the blade 41 . the portions of the ends 422 of the supporting member 42 may be welded to the blade 41 in the longer direction of the blade 41 . as described above , the weld marks 43 a may overlap one another to form the combined weld mark 43 on the blade 41 and the weld marks 44 a may overlap one another to form the combined weld mark 44 on the blade 41 . however , the manner of arranging the weld marks might not be limited to that example . in other embodiments , for example , the blade 41 may have circular weld marks that may be spaced apart from each other . as described above , in the welding process , the laser beam 81 may be moved with respect to the blade 41 . however , the manner of moving the laser beam 81 with respect to the blade 41 might not be limited to that example . in other embodiments , for example , the blade 41 and the supporting member 42 may be moved with respect to the laser beam 81 and the laser beam 81 may be stationary . in still other embodiments , the laser beam 81 and the set of the blade 41 and the supporting member 42 may be moved at the same time . as described above , the contact portion 411 may be formed on the blade 41 to protrude from the blade 41 . however , the configuration of the blade 41 might not be limited to that example . in other embodiments , for example , as depicted in fig8 , the blade 41 a might not comprise a contact portion made of , for example , rubber , but may comprise a bent portion 411 a in which the distal end portion of the blade 41 a may be bent toward the supporting member 42 ( e . g ., toward a side opposite to the developing roller 2 ). the bent portion 411 a ( e . g ., the distal end of the blade 41 ) may directly contact the roller body 2 a of the developing roller 2 . as described above , the distal end portion of the blade 41 may be placed on the developing roller 2 , and the blade 41 may be pinched by the supporting member 42 and the developing case 5 . however , the configuration of the blade unit 4 might not be limited to that example . in other embodiments , for example , as depicted in fig1 , the supporting member 42 to which the blade 41 may be welded may be fixed to the developing case 5 directly while the supporting member 42 is pinched by the blade 41 and the developing case 5 . in the blade unit 4 , the distal end portion of the blade 41 ( e . g ., the contact portion 411 ) may contact the developing roller 2 from the conveyor member 7 side , and the surface , which may be opposite to the surface 41 f having the contact portion 411 thereon , of the blade 41 may be supported by the supporting member 42 . as described above , the developing roller 2 comprising the roller body 2 a and the shaft 2 b are illustrated as the developer carrier . however , in other embodiments , the developer carrier might not be limited to that example . in other embodiments , for example , a brush roller , a developing sleeve , or a belt - shaped developer carrier may be adopted as the developer carrier . as described above , the contact portion 411 ( e . g ., the distal end ) of the blade 41 may be in direct contact with the roller body 2 a of the developing roller 2 ( as an example of the developer carrier ). however , the configuration of the blade might not be limited to that example . in other embodiments , for example , the blade may be disposed such that its distal end portion may be substantially 0 . 1 - 1 . 0 mm apart from the roller body 2 a . as described above , stainless steel may be used as the metallic material for the blade 41 . however , the material of the blade 41 might not be limited to that example . for example , the blade 41 may be made of , for example , steel used for springs , phosphor bronze , beryllium copper , or carbon tool steel . in a case where the steel used for springs or the carbon tool steel is used , a nickel , chromium , or zinc coating may be applied to the blade 41 to prevent or reduce rust . as described above , the electrolytic zinc - coated carbon steel sheet may be used as the metallic material for the supporting member 42 . however , the configuration of the supporting member 42 might not be limited to that example . in other embodiments , for example , the supporting member 42 may be made of a cold rolled steel plate or a tin plate , or a plate made of one of the cold rolled steel plate and the tin plate whose surface may be applied with treatment such as parkerizing , chromating , or nickel coating . the supporting member 42 may also have a coating including press oil thereon . | 1 |
referring to fig1 of the drawings , a data input signal is applied through an input terminal 10 to a six stage shift register 12 which is clocked at eight times the data rate by a clock signal generator 14 . the outputs q 0 to q 5 of the shift register 12 are applied to respective inputs of a seven input majority logic circuit 16 . an output of the circuit 16 is connected to a latching circuit 18 which is clocked in antiphase relative to the clocking of the shift register 12 . an output of the latching circuit 18 is applied to an output terminal 20 and is also fed back to the seventh input of the circuit 16 . in operation the clock waveforms ( a ) and ( d ) of fig2 are applied to the clock inputs of the shift register 12 and the latching circuit 18 , respectively , both of which are clocked on a low to high transition as indicated by the arrows applied to these transitions . the data signal , waveform ( b ) of fig2 is applied to the input terminal 10 . the value of the input signal when sampled is stored serially in the shift register 12 . the outputs q 0 to q 5 of the respective stages of the shift register 12 are applied to the majority logic circuit 16 together with the output of the latch circuit 18 . as the circuit 16 has an odd number of inputs there will always be a majority decision output . thus if three inputs are &# 34 ; 1 &# 34 ; s and the three others are &# 34 ; 0 &# 34 ; s then the output will be dependent on the output of the latch 18 . if this output is a &# 34 ; 1 &# 34 ; then the majority output will be a &# 34 ; 1 &# 34 ; and conversely if it is a &# 34 ; 0 &# 34 ; then the majority output will be a &# 34 ; 0 &# 34 ;. in effect the output produced by the latch 18 in one clock cycle influences the majority decision in the next following clock cycle . when the clock input to the latch 18 next goes high the majority decision of the circuit 16 , waveform ( c ) in fig2 is stored . there is a majority logic circuit propagation delay τ between the transitions in the data and the majority logic decision . the number of input signal errors which can be corrected is related to the number ( n + 1 ) of the inputs to the majority logic circuit 16 and is defined generally as [( n )/ 2 ]. in the case of n = 6 then three error bits can be corrected , for example in fig3 ( a ) the three &# 34 ; 0 &# 34 ; s will be corrected to all &# 34 ; 1 &# 34 ; s and conversely in fig3 ( b ) the three &# 34 ; 1 &# 34 ; s will be corrected to all &# 34 ; 0 &# 34 ; s . if feedback from the output of the latching circuit 18 to the seventh input of the majority logic circuit is not provided , then in order to be able to correct three errors , a seven stage shift register would be required . thus the number of shift register stages and the number of majority logic circuit inputs equals an odd number ( n + 1 ). fig3 ( c ) and 3 ( d ) illustrate that in order to correct three successive errors , that is the &# 34 ; 0 &# 34 ; s in fig3 ( c ) and the &# 34 ; 1 &# 34 ; s in fig3 ( d ), it is necessary to have four correct digits before and after the erroneous ones as opposed to three correct digits before and after the erroneous ones as shown in fig3 ( a ) and 3 ( b ). fig3 ( e ) illustrates a signal having a distorted transition from 1 to 0 and fig3 ( f ) illustrates how this signal can be estimated by the circuit in accordance with the present invention so that there is a single transition from &# 34 ; 1 &# 34 ; to &# 34 ; 0 &# 34 ;. fig4 is a schematic circuit diagram of an embodiment of the present invention having a feedback connection between the output of the latching circuit 18 and the majority logic circuit 16 . in this embodiment the latching circuit 18 comprises part of an integrated circuit type cd 4013 and the shift register 12 comprises two six stage shift register integrated circuits 12a , 12b of type cd 4015 , both of these integrated circuit types being manufactured by the radio corporation of america . the majority logic circuit 16 is constituted by a plurality of nand - gates , ex - or gates and inverters . for convenience of description circuit 16 may be regarded as comprising four identical modules 30 , 40 , 50 and 60 and several other components . only the module 30 , will be described in detail . outputs q 0 and q 1 of the shift register circuit 12a are connected to the inputs of a nand gate 22 and an ex - or gate 24 . the output of the nand gate 22 is inverted by an inverter 26 and is applied as one ( 31 ) of two inputs to the module 30 , the other ( 32 ) of the two inputs being the output of the ex - or gate 24 . the input 31 is applied to an ex - or gate 33 and a nand gate 34 and the other input 32 is applied to the ex - or gate 33 and an ex - or gate 35 . the output of the ex - or gate 33 is applied as an input to a nand gate 36 . an output q 2 of the shift register circuit 12a is connected as an input to the ex - or gate 35 and the nand gate 36 , and , through an inverter 37 , to the nand gate 38 . an output of the nand gate 38 and an input of the ex - or gate 35 comprise , respectively , inputs 41 and 42 of the module 40 . a third input to the module 40 comprises the output q 3 of the shift register circuit 12a . these three inputs are applied as respective inputs to a nand gate 70 whose output comprises one input of a four input nand gate 78 . the outputs of the module 40 are applied as inputs 51 and 52 of the module 50 . additionally an output q 0 &# 39 ; of the shift register circuit 12b is applied as a third input to the module 50 . these three inputs are also applied to a nand gate 72 whose output is connected to a second input of the nand gate 78 . in a similar manner the outputs of the module 50 comprise inputs 61 and 62 of the module 60 whose third input is the output q 1 &# 39 ; of the shift register circuit 12b . these three inputs are connected to a nand gate 74 whose output comprises a third input of the nand gate 78 . the two outputs of the module 60 together with the feedback connection from the output of the latch 18 are applied to a nand gate 76 whose output comprises a fourth input of the nand gate 78 . the output of the nand gate 78 is connected to the data input d of the latch 18 . as an example of the operation of the majority logic circuit 16 , it can be shown that in the event of shift register outputs q 0 , q 1 and q 2 being &# 34 ; 1 &# 34 ; and the outputs q 3 , q 0 &# 39 ;, and q 1 &# 39 ; being &# 34 ; 0 &# 34 ; then the binary value of the feedback signal determines whether the output or the latch , when clocked , will be a &# 34 ; 1 &# 34 ; or a &# 34 ; 0 &# 34 ;. in the event of not having a feedback input , then it will be necessary to have an extra module in the circuit 16 together with a further output from the shift register 12 . | 7 |
the present invention describes a technique which allows structural forms of data to be identified and extracted , such as identifying and extracting data based on it being a domain name , an email address , or a data and time format . other examples include , in search engine indexing automating the process of document retrieval and classification , e . g . if using a web spider for extraction of hyperlinks from html documents in order to construct a list of urls to subsequently retrieve . given the vast quantities of html content available on the internet efficient extraction of hyperlinks from web pages is required . another example is use in real time spam classification . part of spam classification involves the identification of urls / urls , domain names or email addresses associated with spam objects . such identification is used with whitelist / blacklists of spam items to filter out spam content . due to the large quantities of spam present in modern communications networks , an efficient identification and filtering of spam content is desired . a section of data , typically representing an end point identifier , label , or meta - data , which section is to be identified and extracted , is broken down by encoding each subsection of the format within an individual state machine . particular characters can then be used as bridges to move between one state machine and another , where a bridge character is used to move between the different machines describing a meta - data format . thus , a complete format is defined by creating a number of smaller machines that describe each subsection of the format . the machines are then used with the bridges to create a super machine that describes the entire format . complete traversal of the super machine from its start state to its terminal state is used to identify the end point identifier format . anchors are signatures that are associated with the label of interest , in particular , single characters or sequences of characters that are statistically rare in free text , or binary data . this property can be used to quickly lock on to a location in free text that has a higher than average probability of being a subpart of the label of interest . for example of the present invention may be described with respect to identification and extraction of a hyperlink consisting of a sequence of characters followed by a domain name e . g . href = http :// www . roke . co . uk . in general a hyperlink can be identified by recognising the domain name part of the format . the domain name part of the hyperlink can be described using the following syntax : [ ]— square brackets are used to signify one or more optional components . dniv — this is the set of characters that are illegal within the domain name part . domain — this is the set of character that are legal within the domain name part . .— the dot symbol is a bridge between two domain name parts . in general the set of characters that compose the dniv , and domain name parts of the syntax are defined by the standards for internet based computer names . dniv is also defined by the expression -! domain . fig1 illustrates a typical system for operating the method of the present invention . an input data stream 30 which could be from a store ( not shown ), or a real time data source , is input to a processor 31 which applies the method of the present invention . whenever a section of the data stream satisfies the test criteria , the section is output 39 to a store 32 , or output 40 to a comparison stage 33 , such as a look up table . data which is not extracted is discarded 34 , although the discarded data steam could be subjected to additional tests , for example for an alternative label , or end user identifier . for convenience , the extracted sections of data may be stored before an optional filtering step 35 is applied and the sections which are filtered out can be returned to the store , or sent on for further processing in the comparison stage 33 . sections which are not extracted in the filter stage 35 are discarded 36 . thus , the output 38 of the extracted and optionally , filtered data stream may be obtained from the store 32 , or as an output 39 from the comparison stage 33 . the mechanism for extracting sections of the data stream is described in more detail with respect to fig2 and 3 . let a single valid domain name character be ch d , the term ! ch d means not in the set ch d then an example of a possible state machine for the domain name is defined in fig2 . in the example the ‘.’ symbols are examples of bridge characters . the ‘.’ character is used as a bridge between the sub - domains of the complete domain name . from start domain name 1 , if a valid domain name character ch d 2 is identified , the test moves on to the next point 3 . if an invalid character 4 , or bridge character 5 , are found , the test fails 6 . from point 3 , an invalid character 7 causes a fail 8 and a valid character 9 loops back on itself , but a bridge character 10 moves the test on to the next point 11 . from point 11 a bridge character 12 , or an invalid character 13 cause a fail 6 , whereas a valid character 14 moves on to the next point 15 . a bridge character 16 moves to point 11 , a valid character 17 loops back on itself to point 15 and an invalid character 18 moves to the end point , end domain name 19 . for start dniv , an invalid character moves the test to end dniv ( not shown ). having determined a start and end point for the domain name , the series of sequences making up this section of the data stream can be extracted for storage , or further processing . in the state machine the domain name format is identified in a left to right fashion as the text is examined . however , in principal the sub parts of the format can be identified in any order . the label or end point identifier which is used to determine which sections of the data stream are extracted is made up of parts , some of which may be statistically rarer than others in free text . consequently , an effective method to increase the practical performance of the identification algorithm is to look for these parts before the others . these parts , known as anchor points , can be used to ‘ lock on ’ to a position in the data stream that may be an instance of the end point identifier type sought . once an anchor point has been found in the data stream , validation of the data is carried out by parsing outwards ( forward and backwards ) around the anchor point . for the domain name example the ‘.’ symbols are statistically rarer in free text than the other characters contained in the domain name format . this modification splits the domain name algorithm into two distinct machines as shown in fig3 a and fig3 b . the identification algorithm first finds the signature ‘. domain ’ using the machine defined in fig3 a and then starting at the ‘.’ position in the data stream moves backwards and applies the smaller state machine defined in fig3 b . the domain name part is validated first as failure at any point allows the algorithm to continue moving forward through the data stream without expending unnecessary effort on validating the smaller part . from start point , start . domain name 41 , a bridge character 42 moves the test to the next point 43 , where an invalid character 44 causes the test to fail 45 and a valid character 46 moves on to the next point 47 . from here the process steps and results are the same as for the equivalent reference numbers in fig2 . from point 43 a bridge character 48 moves back to start . domain name 41 . the machine in fig3 a moves from left to right starting at point 41 , whereas the machine in fig3 b moves from right to left starting at 41 . so for the pattern roke . co . uk , fig3 a would find the part ‘. co . uk ’ at character position 5 . fig3 b would then start at position 5 and move from right to left to find the part ‘ roke ’. the pattern roke . co . uk is then subsequently extracted . the series of steps in fig3 b starts at the same position in the text as point 41 , a valid character 148 takes us from start domain name 41 to the next state 149 . from this state 149 an invalid domain name character 150 identifies the start of the complete pattern 151 ( i . e . start domain name or the ‘ r ’ in roke . co . uk ). a valid domain name character 152 loops back on itself . a dot 153 indicates another sub - domain and moves us to the next state 154 . from here a valid domain name character 155 moves us back and an invalid domain name character 156 results in failure 157 . finally performance can be further improved by exploiting the machine word size . the meta - data format is defined as a collection of bytes . however , modern processors have register sizes that are multiple bytes wide . the machine register size can be exploited by adapting the state machines so that the state machine transitions are labelled with multi byte values rather than single byte values . in this instance the input byte stream is processed multiple bytes at a time instead of a single byte at a time . thus , in effect the multi - byte state machine runs multiple instances of the single byte state machine each starting at different byte offset , i . e . the throughput is increased by processing the data in multiple machines operating in parallel . an example of a simplified ‘. domain ’ state machine that processes two bytes at a time is shown in fig4 . starting the state machine at the upper most arc in fig4 , the machine is entered when any of the 16 bit patterns defined by ch d . or . ch d is found . let a single valid domain name character be ch d , the term ! ch d means not in the set ch d . the term ch d ch d means a valid domain name character followed by a valid domain name character . the term ch d ! ch d means a valid domain name character followed by an invalid domain name character . the term ! ch d ch d means an invalid domain name character followed by a valid domain name character . the term ch d . means a valid domain name character followed by a dot character . the term ch d means a dot character followed by a valid domain name character . the machine is started by finding a pair of bytes defined by either of the following sequences ch d . or . ch d 50 followed by a valid domain name that satisfies this version of the domain name state machine . thus , the algorithm no longer looks for the ‘.’ symbol specifically but searches for a 16 bit sequence containing the ‘.’ symbol . this modification also has the advantage that a 16 bit sequence containing an ‘.’ is statistically rarer than a bare ‘.’ symbol . consequently , the algorithm rejects a larger fraction of potential alignments by enforcing the formatting of the characters around the ‘.’. the machine is started by finding a pair of bytes defined by either of the following sequences , ch d . or . ch d 50 and in this case the test moves to the next point 51 . at point 51 if the next two bytes are ch d . or . ch d the search loops back on itself 52 . at point 51 if the next two bytes are ch d ch d 53 the test moves to the next point 54 . at point 54 if the next two bytes are ch d . or . ch d 55 the search moves back to point 51 . at point 54 if the next two bytes are ch d ch d the search loops back on itself 56 . at point 54 if the next two bytes are any of the following ch d ! ch d or ! ch d ch d or ! ch d ! ch d 57 the search has failed 58 . at point 54 if the next two bytes are ch d . or . ch d 59 then the search moves to point 60 . at point 60 if the next two bytes are ch d . or . ch d 61 then the search moves to point 51 . at point 60 if the next two bytes are ch d ch d 62 then the search loops back on itself . at point 60 if the next two bytes are ch d ! ch d or ! ch d ch d or ! ch d ! ch d 64 then a domain name has been found 65 . at point 60 if the next two bytes are ch d . or . ch d 63 then a domain name has been found 69 . at point 69 if the next two bytes are ch d ch d 66 then the search moves to point 54 . at point 69 if the next two bytes are ch d . or . ch d 67 then the search moves back to point 51 . in summary , the invention uses a set of state machines to describe the format of an end point identifier , label or meta - data . a super machine is created by linking the smaller machines using bridge characters . anchor points may be defined in the format , so these are identified first to increase throughput . a further feature is that multi - byte versions of the state machines may be defined to enable the input to be processed in parallel . rather than process the byte stream 8 bits at a time a pointer is used to access the data several bytes at a time . each vertex of the machine is labelled using a multi byte value . the value of the sequence of bytes pointed at by the pointer is then used to traverse the vertices of the machine . this means that several bytes of the input are processed for each transition of the machine which improves the throughput . in effect this can be thought of as running several single character machines in parallel i . e . the state machine design exploits the machine word size to enable parallel processing in software . more generally , in the example of searching for a hyperlink_ . the pattern is : the labels are separated by a sequence of characters from the valid set of characters that can be used within a url . the example is shown in fig5 starting at point 78 , the sequence href =“ http :// 79 takes the search to point 80 . from point 80 a symbol from the set churl ( the set of valid url characters ) 82 takes the search to point 85 . from point 80 a symbol that is not in the set churl (! churl ) 81 takes the search to point 83 and the search fails . from point 85 a valid url character 86 loops the search back to point 85 . from point 85 an invalid url character 84 results in failure 83 . from point 85 the quote character 87 takes the search to point 88 . at this point a valid hyperlink has been found and can be extracted . the labels are separated by a sequence of characters from the set a - z , a - z , 0 - 9 as illustrated in fig6 starting at 70 the sequence & lt ; title & gt ; 71 takes the search to point 72 . at point 72 the characters a - z , a - z , 0 - 9 ( 73 ) loop the search back to point 72 . at point 72 the symbols in the set ! ( a - z , a - z , 0 - 9 )! (& lt ;/ title & gt ;) 76 take the search to point 77 and the search fails . at point 72 the sequence & lt ;/ title & gt ; 74 takes the search to point 75 and the end . thus , the identification of the pair of sequences & lt ; title & gt ; & lt ;/ title & gt ; identifies a page title between them . the month can be one from the set of patterns jan , feb , mar , apr , may , jun , jul , aug , sep , oct , nov , dec . num indicates one of the characters 0 - 9 and ! ( num ) means not one of the characters 0 - 9 . in this case a bridge character is needed to link the date and time parts . a suitable bridge is the space character after the year . the example is shown in fig7 . starting at point 89 , a valid month 90 moves the search to point 91 . from point 91 any character 92 takes the search to point 93 . at point 93 any character loops the search back to point 93 . at point 93 the space character 95 takes the search to point 96 . at point 96 any character 97 takes the search to point 98 . at point 98 any character 99 loops the search back to point 98 . at point 98 the sequence : numnum ! ( num ) 100 completes the search 101 . the present invention allows sections of data to be identified and extracted . although the examples have been described using hyperlinks and domain names , the invention can be applied to many other end user identifier types including email address identification ; uri / url identification ; session initiation protocol ( sip ) uri identification ; e . 164 telephone number detection ; tag detection in other data formats ; ip addresses , port range , protocol and session identifier detection ; xml data structures , xml objects ; html structures and objects ; and detection of content types and identification of content from packet payloads . the basic method can be improved to increase throughput and processing speed by use of an anchor structure , or looking for an ngram containing an anchor symbol . the combination of separate encoded sequences represented by smaller state machines into a group of state machines to produce the full format of an end user identifier , or label , allows labels of arbitrary complexity to be detected . further improvements in throughput arise from the use of parallel processing , exploiting machine word size to run several instances of a super machine in parallel . fig8 a - 8d illustrate exemplary extraction and filtering arrangements for electronic mail in accordance with the present invention . in the arrangement of fig8 a a separate filtering and extraction server ( e . g ., spam filter ) 805 a is provided for performing the extraction and filtering described above . spam filter 805 a can be executed by an application specific integrated circuit ( asic ), microprocessor executing computer code , field programmable gate array and / or the like to perform the extraction and filtering functions . the spam filter 805 a is coupled to an e - mail server 810 a , which in turn is coupled to a terminal 815 a . terminal 815 a can be any type of terminal , including a desktop computer , laptop computer and / or a wireless computing device ( e . g ., a wireless telephone and / or e - mail device ). terminal 815 a includes an e - mail client 820 a for receiving the e - mails that pass from spam filter 805 a through e - mail server 810 a to terminal 815 a . terminal 815 a can include an application specific integrated circuit ( asic ), microprocessor executing computer code , field programmable gate array and / or the like to execute the e - mail client . the e - mails can be output on printer 825 , display 830 or any other type of output device . in particular , if an e - mail is filtered then it would not be provided to terminal 815 a , whereas those that are not filtered would be provided to the terminal . in other words , the e - mails that are discarded by spam filter 805 a are those that are passed to the terminal , whereas those that are output from lookup table 6 are filtered and not passed to the terminal . in the arrangement of fig8 b spam filter 805 b can be included in e - mail server 810 b . in this arrangement spam filter 805 b can be a separate program on the same hardware as the e - mail server 810 b and / or can be a program executing within the e - mail server program . in the arrangement of fig8 c spam filter 805 c can be included in terminal 815 c . in this arrangement spam filter 805 c can be a program executing on terminal 815 c . in the arrangement of fig8 d spam filter 805 d can be included in e - mail client 820 d . in this arrangement spam filter 805 d can be , for example , a plug - in for e - mail client 820 d . fig9 a - 9d illustrate exemplary extraction and filtering arrangements for urls in accordance with the present invention . in the arrangement of fig9 a a separate server 905 a is provided for performing the extraction and filtering described above . server 905 a can include an application specific integrated circuit ( asic ), microprocessor executing computer code , field programmable gate array and / or the like to perform the extraction and filtering functions . the extraction and filtering server 905 a is coupled to a web server 910 a , which in turn is coupled to a terminal 915 a . terminal 915 a can be any type of terminal , including a desktop computer , laptop computer and / or a wireless computing device ( e . g ., a wireless telephone and / or e - mail device ). terminal 915 a includes a browser client 920 a for browsing web pages that pass from the extraction and filtering server 905 a through web server 910 a to client 915 a . terminal 915 a can include an application specific integrated circuit ( asic ), microprocessor executing computer code , field programmable gate array and / or the like to execute the e - mail client . the web pages can be output on printer 925 , display 930 or any other type of output device . in particular , if a web page passes through the filter then it would not be provided to terminal 815 a , whereas those that are not filtered would be provided to the terminal . in other words , the web pages that are discarded by the extraction and filtering server 805 c are those that are passed to the terminal , whereas those that are output from lookup table 6 are filtered and not passed to the terminal . in the arrangement of fig9 b extraction and filtering server 905 b can be included in web server 910 b . in this arrangement server 905 b can be a separate server executing on the same hardware as the web server 910 b and / or can be a program executing within the web server program . in the arrangement of fig9 c extraction and filtering server 905 c can be included in terminal 915 c . in this arrangement server 905 c can be a separate server or can be a program executing on terminal 915 c . in the arrangement of fig9 d extraction and filtering server 905 d can be included in browser client 920 d . in this arrangement server 905 d can be , for example , a plug - in for browser client 920 d . although fig8 a - 8d and 9 a - 9 d are described in connection with so - called blacklists , in which a match with the lookup table causes the email or web page to be excluded and not delivered to the terminal , the present invention can also be implemented with so - called whitelists . in this case a match with the lookup table allows the email or web page to be delivered to the terminal and a failure to match with the lookup table excludes the email or web page from being delivered . it will be recognized from the discussion of fig8 a - 8d and 9 a - 9 d above that the designation of the filtering and extraction element as being a server is used to cover a variety of different arrangements , including a physical server , a server program , a regular executable program and a plug - in program . accordingly , the term server should be interpreted accordingly in connection with the claims . the foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed to include everything within the scope of the appended claims and equivalents thereof . | 6 |
referring to fig1 , the on - road energy conversion and vibration absorber apparatus receives the energy ( static , kinetic energy of the rolling wheel ) delivered by a vehicle 100 and even pedestrians when being weighed down on a pressure chamber 210 formed in a compression unit . the fluid contained in the pressure chamber 210 is pressurized to output a kinetic energy and at the same time , alleviating the vibration of the vehicle 100 . in the apparatus , a compression unit 200 is installed beneath the road surface 150 . when the vehicle 100 and pedestrians weigh down on a pressure receiver plate 220 of the compression unit 200 , the fluid in the pressure chamber 210 is pressurized to store the potential energy and then conducted to pass through a check valve 250 to flow in one direction , and the vibration of the vehicle is also alleviated by the cushion effect of the restoring force of the compression unit 200 performed by a restorable elastic element 218 . the restorable elastic element 218 is a spring , or replaceable with the fluid in the pressure chamber 210 . the fluid to be used is essentially air . referring to fig2 , in this embodiment , in addition to the component parts described in fig1 , a fluid conduit 260 is connected behind the check valve 250 to conduct the pressurized fluid to pass through in one direction along the fluid conduit 260 so as to make use of its kinetic energy . referring to fig3 , a governor valve 300 is provided to the exit of the fluid conduit 260 so as to control discharge of the fluid . referring to fig4 , the pressurized fluid discharged from the fluid conduit 260 is used to drive a vane wheel 400 ( windmill , watermill ) or a water spray gun by releasing its potential energy . referring to fig5 , a generator 500 is connected to the vane wheel 400 or a water spray gun to be driven to generate electric energy . referring to fig6 , the pressure receiver plate 220 has a structure of a large square plate whose surface contains a number of small square grid shaped meshes , or is patterned in a beehive configuration 215 . after being liberated from the weight of the vehicle 100 or the pedestrian , the pressure receiver plate 220 recovers its initial state with the aid of the restorable elastic element 218 and ready for successively coming vehicles 100 or pedestrians to weigh down . the present invention further provides a large - scale operation that shares similar concepts with the embodiments disclosed above . the present invention further provides an energy - generating system . as shown in fig7 , one embodiment of an energy generating system comprises at least one object holder 771 , 772 , 773 , 774 , at least one energy transformer 78 ( shown in fig8 ), at least one fluid storage 721 , at least one power converter 1974 , at least one first pipeline 751 , 752 , 7521 , 7522 , 7523 , at least one second pipeline 753 , 7531 , 7532 , 7533 , at least one third pipeline 754 , and at least one energy storage 633 . for some embodiments , as shown in fig9 , an energy generating system 9 of the present invention does not need an energy storage ( as the element 633 in fig7 ). for some embodiments , the energy storage 633 is not a necessary component . as shown in fig8 , for some embodiments , the energy transformer 78 comprises a fluid machinery 731 , an electrical power generator 761 , and a mechanism 741 . the fluid machinery 731 transfers energy to the electrical power generator 761 through the mechanism 741 . please refer to fig7 . the fluid machinery 733 comprises a fluid inlet 7331 and a fluid outlet 7332 . it should be mentioned that in fig7 , the fluid machineries 731 , 732 , also have a fluid inlet and a fluid outlet . as shown in fig7 , the object holders 771 , 772 , 773 , 774 are embedded near a ground surface 900 . the ground surface 900 may be a road , a street , or an entrance of any construction ( e . g ., a house , apartment , building , and so on ). the object holder may hold an object 800 ( e . g ., a car ). as shown in fig1 , the object holder 771 , 772 , 773 , 774 comprises at least one pressure - transferring device 1007 , 1001 . as shown in fig1 , for some embodiments , the pressure - transferring device 1007 at least comprises a fluid tube 1019 , an outlet non - return valve 1003 , and an inlet non - return valve 1002 . the outlet non - return valve 1003 and inlet non - return valve 1002 are disposed in the fluid tube 1019 . as shown in fig1 , for some embodiments , the pressure - transferring device 1007 further comprises a contact member 1311 , a chamber member 1300 , and a pushing member 1313 , 1049 . the pushing member is connected to the contact member 1311 and the fluid tube 1019 . besides , the pushing member 1313 is disposed in the chamber member 1300 . please refer to fig1 again . the chamber member 1300 comprises a main body 1300 , a chamber 1006 , and a cap 1005 . the pushing member 1313 is disposed in the chamber 1006 . the cap 1005 comprises a hole 55 . the contact member 1311 extends to a region that is above the hole 55 . furthermore , for some embodiments , as shown in fig1 , the chamber 1006 is vacuum . it should be noted that , for some embodiments , “ vacuum ” occurs during the operation . that is , the chamber 1006 , cap 1005 , and contact member 1311 are designed to let three parts to be able to precisely fit each other in terms of dimensions . when the contact member 1311 receives the pressure , the space formed between the cap 1005 and the chamber 1006 will be a vacuum region . in such way , the force for moving the contact member 1311 to its original level can be reduced . please refer to fig1 again . the contact member 1311 comprises a tunnel 1312 and a gas outlet member 1004 . the gas outlet member 1004 is disposed in the tunnel 1312 . specifically , the gas outlet member 1004 is located at the end of the tunnel 1312 . when the fluid in the fluid tube 1019 is accompanied by gas , the gas outlet member 1004 can release such gas . the present invention also provides alternative embodiments regarding the pressure - transferring device . please refer to fig1 . in some embodiments , the pressure - transferring device 1007 at least comprises a fluid tube 1019 , an outlet non - return valve 1003 , and an inlet non - return valve 1002 . the outlet non - return valve 1003 and inlet non - return valve 1002 are disposed in the fluid tube 1019 . in addition , for some embodiments , the pressure - transferring device 1007 further comprises a material 1049 covering part of the fluid tube 1019 . please refer to fig1 again . in some embodiments , the object holder 771 further comprises a cast 1212 . the pressure - transferring device 1001 , 1007 is exposed on a top surface 7710 of the cast 1212 . it should be noted that , for some embodiments , the object holder 771 has no cast . so , the element 1212 in fig1 is expressed as a road 900 as shown in fig7 and 9 - 11 . please refer to fig9 again . the present invention provides one embodiment of an energy generating system which comprises at least one object holder 771 , 772 , 773 , 774 , at least one energy transformer 78 ( shown in fig8 ), at least one fluid storage 721 , at least one power converter 1974 , at least one first pipeline 751 , 752 , 7521 , 7522 , 7523 , at least one second pipeline 753 , 7531 , 7532 , 7533 , and at least one third pipeline 754 . as shown in fig9 , one part 751 of the first pipeline 751 , 752 is connected to the fluid tube 443 of the pressure - transferring device of one object holder 771 . one part 7523 of the first pipeline 751 , 752 is connected to the fluid inlet 7331 of the fluid machinery 733 . in some embodiments , some parts 7521 , 7522 , 7523 of the first pipeline 751 , 752 are connected to the fluid inlets of the fluid machineries 731 , 732 , 733 , separately . as shown in fig9 , one part 7533 of the second pipeline 753 is connected to the fluid outlet 7332 of the fluid machinery 733 . one part of the second pipeline 753 is connected to the fluid storage 721 . in some embodiments , some parts 7531 , 7532 , 7533 of the second pipeline 753 are connected to the fluid outlets of the fluid machineries 731 , 732 , 733 , separately . please refer to fig9 again . the third pipeline 754 is connected to the fluid storage 721 . the third pipeline 754 is also connected to the fluid tube 444 of the pressure - transferring device of one object holder 774 . as shown in fig9 , some embodiments of an energy generating system of the present invention comprise at least one power converter 1974 . the power converter 1974 is electrically connected to the electrical power generator 761 , 762 , 763 . the power converter may transform the current generated by the electrical power generator 761 , 762 , 763 , into a / c or d / c current . please refer to fig7 again . for some embodiments which comprises at least one energy storage 633 . the energy storage 633 is located between the object holder 771 and the fluid machinery 731 , 732 , 733 . the energy storage 633 has a fluid input 6331 and a fluid output 6332 . the fluid input 6331 of the energy storage 633 is connected to one part 751 of the first pipeline . the fluid output 6332 of the energy storage 633 is connected to one part 752 of the first pipeline . please refer to fig1 . the energy storage 633 comprises a fluid tank 2002 , a piston member 1511 , and a spring member 2007 . as shown in fig1 , for some embodiments , the fluid tank 2002 comprises a gas region 2110 , a gas region tube 2122 , a fluid region 2111 , and a tank cap 2004 . the gas region tube 2122 comprises a gas valve 2010 . the gas region tube 2122 is also attached to the gas region 2110 . as shown in fig1 , the tank cap 2004 covers the fluid tank 2002 . for some embodiments , the tank cap 2004 comprises a cap opening 2112 and a first ball region 2006 . the cap opening 2112 comprises an inner sidewall . the first ball region 2006 comprises a plurality of first balls 2006 . and , the first ball region 2006 is attached to the cap opening 2112 . as shown in fig1 , the piston member 1511 comprises a top member 2005 , a piston body member 2001 , and a head member 2003 . the top member 2005 is attached to the top of the piston body member 2001 . the head member 2003 is attached to the bottom of the piston body member 2001 . the top member 2005 is disposed above the tank cap 2004 , as shown in fig1 . the piston body member 2001 penetrates through the cap opening 2112 , as shown in fig1 . as shown in fig1 , the head member 2003 comprises a second ball region 2611 and a head body 2003 . the second ball region 2611 comprises a plurality of second balls 2611 . the head body 2003 comprises an outer sidewall 2311 . the second ball region 2611 is attached to the outer sidewall 2311 . as shown in fig1 , for some embodiments , a portion of the piston member 1511 is disposed in the fluid tank 2002 . as shown in fig1 , the spring member 2007 is attached to the piston member 1511 . for some embodiments , the spring member 2007 is attached to the head member 2003 of the piston member 1511 . for some embodiments , the spring member 2007 is disposed in the fluid tank 2002 . it should be noted that there could be more than one spring member used in the present invention . it should be noted that , for some embodiments , the spring member is not a necessary component . as shown in fig1 , the fluid input 2008 and fluid output 2009 are attached to the fluid region 2111 of the fluid tank 2002 . it should be noted that , for some embodiments , as shown in fig1 , there are tunnels 2144 in the head body 2003 ( or , head member 2003 , so the fluid in the fluid region 2111 can move to the gas region 2110 through these tunnels 2144 . therefore , during the operation , for some embodiments , the gas region 2110 may contain fluid . under such circumstance , such the fluid in the gas region 2110 can reduce the backside pressure imposed on the head body 2003 . meanwhile , the gas absorbed in the fluid can be led to the gas valve 2010 to leave the tank 2002 . please refer to fig1 that shows a fluid tank 2002 used in some embodiments of the present invention . the fluid tank 2002 comprises a gas region 2110 , a gas region tube 2122 , a fluid region 2111 , and a tank cap 2004 . the gas region tube 2122 comprises a gas valve 2010 . the gas region tube 2122 is also attached to the gas region 2110 . it should be noted that , for some embodiments , as shown in fig1 , the pressure in the gas region 2110 is kept constant through injecting gas into the tank 2002 via the gas valve 2010 . then , the fluid that flows into the fluid region 2111 will impose more pressure on the gas in the gas region 2110 so as to store more internal energy inside the gas . the operation of an energy storage used in the present invention is described as follows . please refer to both fig1 . the piston member 1511 moves up and down through the first ball region 2006 and second ball region 2611 . the gas region tube 2122 is used for adjusting the fluid tank 2002 pressure through the gas valve 2010 . for some embodiments , the gas valve 2010 , as shown in fig1 , is used for letting the gas absorbed in the fluid emit from the fluid and leave the fluid tank 2002 , but not used for injecting gas into the fluid tank 2002 to result in a higher pressure . if a higher pressure is required , gas can be input into the fluid tank 2002 through the gas valve 2010 . if the fluid tank pressure is too high , the gas inside the tank 2002 can be released through the gas valve 2010 . please refer to fig1 . when the fluid coming from the first pipeline enters the fluid tank 2002 through the fluid input 2008 , the fluid inside the fluid region 2111 will push the piston member 1511 up . as a result , a form of potential energy is stored in the piston member 1511 . next , when the fluid inside the fluid region 2111 leaves through the fluid output 2009 , the potential energy stored can be poured into the fluid again through the work done by the piston member 1511 on the fluid . for some embodiments , where a spring member 2007 is used , the spring member 2007 is stick to the head member 2003 , as shown in fig1 . when the fluid enters the fluid tank 2002 through the fluid input 2008 , a form of elastic energy will be stored in the spring member 2007 , because the spring member 2007 is expended . when the fluid leaves the tank 2002 through the fluid output 2009 , the elastic energy can be poured into the fluid again because the spring member 2007 will return to its normal length . for some embodiments , as shown in fig1 , the present invention uses an energy storage without the piston member . the operation of such the energy storage is described as follows . first , a predetermined amount of gas is input into the fluid tank 2002 through the gas region tube 2122 . then , the gas region 2110 of the tank 2002 has a stable pressure and volume . second , the fluid coming from the first pipeline enters the tank 2002 through the fluid input 2008 . then , the volume of the fluid region 2111 will increase . as a result , the volume of the gas region 2110 will decrease , so that the gas pressure of the gas region 2110 will increase . that is , a form of potential energy will be stored in the gas region 2110 . third , when the fluid inside the fluid region 2111 leaves the tank 2002 through the fluid output 2009 . the stored , potential energy will be poured into the fluid because the gas will do work on the fluid . for the operation of all kinds of energy storage used in the embodiments of the present invention , when the fluid is leaving the tank 2002 through the fluid output 2009 , the leaving fluid will have more stable energy so as to force an fluid machinery 731 , 732 , 733 to generate energy . for some embodiments , the energy provided by the car movement will be accumulated in the energy storage , and when the accumulation reaches a certain amount , the overall amount energy is then provided for driving fluid machineries . please refer to fig1 and 11 . the present invention provides alternative practices of an energy generating system . the energy generating system 10 , 11 comprises a different energy transformer that has a fluid machinery 931 , 932 , 933 , an electrical power generator 761 , 762 , 763 , and a mechanism 941 , 942 , 943 . the fluid machinery 931 , 932 , 933 transfers energy to the electrical power generator 761 , 762 , 763 through the mechanism 941 , 942 , 943 . please refer to fig1 . the fluid machinery 931 comprises a fluid inlet 9311 and a fluid outlet 9312 . it should be mentioned that in fig1 , 11 , the fluid machineries 931 , 932 , 933 also have a fluid inlet and a fluid outlet . the energy transformers used in fig7 - 9 have a fluid machinery which is a fluid cylinder . the energy transformers used in fig1 and 11 have a fluid machinery which is a fluid motor . for some embodiments , the applied fluid machinery is a fluid cylinder . for some embodiments , the applied fluid machinery is a fluid motor . the present invention also provides a variety of choices regarding mechanism used in the energy transformers of the present invention . as shown in fig1 ( a ), for some embodiments , the mechanism is a belt drive . as shown in fig1 ( b ), for some embodiments , the mechanism is a chain drive . as shown in fig1 ( c ), for some embodiments , the mechanism is a gear drive . as shown in fig1 ( d ), for some embodiments , the mechanism is a crank mechanism . as shown in fig1 ( e ), for some embodiments , the mechanism is a rack and pinion . the operation of an energy generating system of the present invention is described as follows . please refer to fig7 , 9 , 10 and 11 . a vehicle 800 enters an area where there are several object holders 771 , 772 , 773 , 774 . please refer to fig1 , the vehicle 800 is moving in one direction 8001 . the weight of the vehicle 800 then is a force applied onto several pressure - transferring devices 1007 , 1001 . it should be noted that , for some embodiments , the car 800 moving direction is perpendicular to the movement of the pressure - transferring devices . please refer to fig1 , when the pressure - transferring device 1007 receives the weight force provided by the vehicle 800 , the force will be transferred from the contact member 1311 to the pushing member 1313 , 1049 . consequently , the pushing member 1049 will press the fluid tube 1019 . then , the fluid inside the fluid tube 1019 will leave the tube 1019 through the outlet non - return valve 1003 . please refer to fig1 again . when the weight force is removed from the pressure - transferring device 1007 ( e . g ., the vehicle 800 has passed the object holder ), there is no force applied onto the contact member 1311 . then , the pushing member 1049 will return to its original state . because the part 1049 of the pushing member covering the fluid tube 1019 is made of elastic materials , the part 1049 will return to its original shape . so , the pushing member will move up . the contact member 1311 then will return to its original level . meanwhile , the fluid in the energy generating system will enter the fluid tube 1019 through the inlet non - return valve 1002 . it should be noted that , for some embodiments , after the contact member 1311 is pressed , the fluid stored in the fluid storage 721 can be used for moving the contact member 1311 back to its original level . for some embodiments , a spring member can be used for doing so . such the spring member can be inserted into the pressure - transferring device to perform such function . for some embodiments , after the contact member 1311 is pressed , the fluid stored in the fluid storage 721 is then pressurized to be used for moving the contact member 1311 back to its original level . for some embodiments , a spring member could be incorporated with the pushing member 1313 to perform the function of moving the contact member 1311 back to its original level . alternatively , when a pressure - transferring device 1001 shown in fig1 is applied , the weight force provided by the vehicle 800 will be directly applied onto the pushing member 1049 that covers the fluid tube 1019 . after the vehicle 800 passes the object holder , because of the elastic characteristics of the pushing member 1049 , the pushing member 1049 will return to its original shape . by doing so , the fluid will leave the fluid tube 1019 through the outlet non - return valve 1003 and then enter the fluid tube 1019 through the inlet non - return valve 1002 . it should be noted that , for some embodiments , after the pushing member 1049 is pressed , the fluid stored in the fluid storage 721 can be used for moving the pushing member 1049 back to its original level . for some embodiments , a spring member can be used for doing so . for some embodiments , after the pushing member 1049 is pressed , the fluid stored in the fluid storage 721 can be pressurized to be used for moving the pushing member 1049 back to its original level . for some embodiments , the elastic material 1049 of the pushing member 1049 could be functioning to move the pushing member 1049 back to its original level . after the fluid leaves the object holders , as shown in fig7 and 10 , the fluid will enter the energy storage 633 . the energy storage 633 may provide additional energy to the fluid . then , when the fluid leaves the energy storage 633 , it may have more stable power to run the fluid machinery . it should be noted that , for some embodiments , the energy storage 633 is used for accumulating the energy input from the pressure - transferring devices and , then , providing the stable energy to the fluid machineries . alternatively , as shown in fig9 and 11 , when the energy storage is not used , the fluid will directly enter the fluid machinery to run it . please refer to fig7 , 9 , 10 and 11 again . the fluid enters the fluid machinery 731 , 732 , 733 , 931 , 932 , 933 to use hydraulic force to produce mechanical power . then , the fluid will leave the fluid machinery . next , the fluid will enter the fluid storage 721 . then , the fluid will leave the fluid storage 721 to begin a new cycle of the operation . for some embodiments , during the operation , the pressure in the fluid storage 721 will first maintain constant , and then force the reflux to flow to the object holders 771 , 772 , 773 , 774 . the present invention also provides more details about the operation of the energy transformer 78 . when the fluid machinery is driven to create mechanical power , the mechanical power will run the mechanism 741 , 742 , 742 , 941 , 942 , 943 as shown in fig7 , 9 , 10 and 11 . then , the mechanism will begin to drive the electrical power generator to generate electricity . it should be noted that , for some embodiments , the device 78 comprises a fluid actuator and a power transmission . the fluid actuator may be a hydraulic cylinder or hydraulic motor . the power transmissions are shown in fig1 . the electricity from the electrical power generators 761 , 762 , 763 will be transferred in the power lines that are set in parallel . the electricity is transferred to the power converter 1974 . as a result , the energy generating system can begin to provide electricity . it should be noted that , for some embodiments , the power converter 1974 can provide the electricity generated to the general public in terms of parallel circuits . alternatively , the generated electricity may be stored in a battery . it is apparent to a person skilled in the art that the basic idea of the invention can be implemented in many different ways . the invention and its embodiments are thus not restricted to the examples described above , but may vary with the scope of the appended claims . | 7 |
fig1 is a vertical cross - sectional view of a microwave oven embodying the present invention . in a casing 1 of the microwave oven , a heating chamber 2 is disposed , and a magnetron 3 for generating microwave is provided at the back of the heating chamber 2 via a waveguide 4 . a turntable 6 rotated by a turntable motor 7 is provided at the bottom of the heating chamber 2 , and a heating object 5 is placed on the turntable 6 . on the top of the heating chamber 2 is disposed an infrared sensor 8 , whereby it is able to detect and measure the temperature emitted by infrared signals from the top of the object 5 . an exhaust duct 9 is provided at the top of the heating chamber 2 for letting air or steam out of the heating chamber 2 , and a hygrosensor 10 is provided in the exhaust duct 9 . in this embodiment , the object 5 consists of a food 5d packaged in a tray 5b with a lid 5a and a plastic wrap 5c wrapping the tray 5b and the lid 5a . fig2 is a block diagram showing the electrical system of the above microwave oven . a controller 20 is composed of one or plural microcomputers and peripheral elements including a timer 21 , random access memory ( ram ) 22 , etc . an operation unit 23 having a plurality of keys is connected to the controller 20 , and signals corresponding to operations on the keys are sent to the controller 20 . to the controller 20 , a temperature signal and a humidity signal are also sent from the infrared sensor 8 and the hygrosensor 10 , respectively . responsive to the input signals , the controller 20 executes calculations according to control programs stored in a read only memory ( rom ) ( not shown ), and generates various control signals . the control signals include a signal for driving the magnetron 3 , a signal for controlling a lamp 24 disposed in the heating chamber 2 , a signal for driving the turntable motor 7 , and a signal for driving a blower motor 25 for an exhaust fan disposed in the exhaust duct 9 ( not shown ). next , referring to the flow chart in fig3 a heating by the microwave oven constituted as above is described . first a user places a packaged food as the object 5 on the turntable 6 , selects an &# 34 ; automatic heating for packaged food &# 34 ; course on the operation unit 23 , and pushes a start key ( step s1 ). in response to the key operation , the controller 20 turns on the lamp 24 and sends start signals to the turntable motor 7 , the blower motor 25 and the magnetron 3 ( step s2 ), whereby the turntable 6 starts rotating at a low speed and the irradiation of microwave is started . the power of the magnetron 3 is determined by a heating sequence selected as explained later . at the moment the heating is started , the timer 21 in the controller 20 starts counting time ( step s3 ). since , generally , it takes a certain short period of time for the infrared sensor 8 to be stabilized after it is energized , the operation is suspended and the temperature signal is disregarded for the first 5 sec ! ( step s4 ). when the timer 21 counts up 5 sec !, the controller 20 starts using the temperature signal from the infrared sensor 8 ( step s5 ). the temperature obtained based on the temperature signal from the infrared sensor 8 is hereinafter referred to as the &# 34 ; detected temperature &# 34 ;. in the above process , first the detected temperature obtained just after the process is started is stored in the ram 22 as t0 ( step s6 ). when the detected temperature attains t0 + 18 ° c .! ( step s7 ), a time length t0 required for the temperature to rise by 18 ° c .! is calculated by subtracting 5 sec ! ( which is the time elapsed in step s4 ) from the current time counted by the timer 21 . the time length t0 calculated here and the current temperature t1 ° c .! (= t0 + 18 ° c .!) is stored in the ram 22 ( steps s8 , s9 ). from the time when the detected temperature attains t0 + 18 ° c . !, the operation is again suspended for 5 sec ! ( step s10 ). when the 5 sec ! elapses , the current temperature t2 ° c .! is detected and the temperature change α ° c .! in the 5 sec ! is calculated as α = t2 - t1 ( step s11 ), where t1 is restored from the ram 22 . the temperature change α is stored in the ram 22 ( step s12 ). based on the time length t0 and the temperature change α , a heating mode is selected from a plurality of the heating modes stored in the rom beforehand ( steps s13 , s14 ). fig4 shows an example of a list of heating modes classified by the parameters of the time length t0 and the temperature change α . each heating mode provides a heating sequence including a first stage , second stage and third stage . in fig4 : &# 34 ; t &# 34 ; used in the third stage represents the length of time from the beginning of the first stage to the end of the second stage ; &# 34 ; tmax &# 34 ; is the maximum heating time ; and &# 34 ; tmax &# 34 ; is the maximum temperature . when the maximum temperature tmax is attained , or when the maximum heating time tmax elapses , whichever occurs first , the operation proceeds to the third stage in case of the second stage , or the operation is finished in case of the third stage . the heating sequences are classified into three patterns a , b and c according to the time length t0 . each of the three patterns a , b and c further includes three modes corresponding to the temperature change α . thus , one of the nine modes of a1 - a3 , b1 - b3 and c1 -- c3 is selected according to the time t0 and the temperature change α . the heating sequences as shown in fig4 are normally predetermined through prior experiments in which a variety of packaged foods are actually heated . the heating sequences are stored as a part of the control programs in the rom provided in the controller 20 . fig5 shows a result of experiments wherein three samples of the packaged foods were heated . in fig5 the abscissa represents the time elapsed since the heating is started , the ordinate represents the detected temperature , and the legends a3 , b2 and c1 beside the curves correspond to modes in fig4 . in japan , various packaged foods are sold in convenience stores , food shops , etc . some of the examples are as follows . &# 34 ; souzai &# 34 ; is one of a variety of foods , such as , for example , boiled beans , shredded vegetables , etc ., served and taken as side dishes , and is normally packaged in a small package . &# 34 ; donburi &# 34 ; is an amount of rice with a topping of , for example , boiled meat , tempura , sea food , etc ., and is normally packaged in a medium - sized deep bowl - like package . &# 34 ; bentou &# 34 ; is an assortment of rice and some side dishes packaged together , like a so - called tv dinner , and the package is normally large and flat . the curve a3 in fig5 is the result of heating a souzai package , the curve b2 is the result of heating a donburi package , and the curve c1 is the result of heating a bentou package . the time length t0 reflects the degree of rise in the detected temperature in the initial phase of heating . accordingly , it can be said that the shorter the time length t0 is , the more rapidly the detected temperature rises in the initial phase of heating . the rise in the detected temperature in the initial phase of heating greatly depends on the heat capacity of the food 5d since the rise in the temperature of the air in the package is mainly caused by the heat conducted from the food 5d . that is , when the amount of the food 5d is large , the food 5d cannot be warmed rapidly , so that the degree of rise in the temperature is small . for example , when a packaged food consists of a small amount of food in a small package , as in the case of souzai described above , the temperature of the food rises so rapidly that the time length t0 is very short . see the curve a3 in fig5 . after the temperature at the surface of the lid 5a has risen to some extent , the degree of rise in the detected temperature depends more on the type of the food 5d and the size of the space between the food 5d and the lid 5a rather than on the amount of food 5d , as explained before . for example , when a food in a flat package , such as a bentou package as described above , is heated , the temperature at the surface of the lid 5a is hardly influenced by the hot steam or gas released from the food since little or no space exists between the lid 5a and the food 5d . therefore , the temperature rises slowly and the temperature change α is small . the heating control according to the sequences of fig4 is explained in detail . the first stage in fig4 corresponds to steps s2 - s9 in fig3 . for example , the output power of the magnetron 3 is set at 1500 w ! after the heating is started . when the detected temperature has risen by 18 ° c . !, the operation proceeds to the second stage . when the initial temperature of the object 5 is high , the maximum temperature of 50 ° c .! may be reached before the detected temperature rises by 18 ° c .!. in this case , the time elapsed until then ( exactly speaking , the elapsed time minus 5 sec !) is adopted as the time length t0 before proceeding to the second stage . the second stage corresponds to step s10 and the subsequent steps . the heating power is still maintained at 1500 w !. when 5 sec ! has elapsed since entry into the second stage , one of the heating modes is selected according to the time length t0 and the temperature change α . when the detected temperature attains the maximum temperature , the operation proceeds to the third stage . if the maximum heating time elapses before the maximum temperature is attained , the operation also proceeds to the third stage at that time . in case that , referring back to step s10 , the maximum temperature of 60 ° c .! is attained while the temperature change α is being measured ( i . e . while the operation is suspended for 5 sec !) in step s10 , the temperature change α ( which is defined for 5 sec !) is calculated based on the time needed for the detected temperature to rise from the initial temperature to the maximum temperature 60 ° c .!. then , one of the heating modes is selected according to the time length t0 and the temperature change α , and the operation proceeds to the third stage . in the third stage , the heating is continued keeping the power at 1500 w !. the heating is finished when the detected temperature attains the maximum temperature predetermined corresponding to the selected heating mode . the heating is otherwise finished when the maximum heating time ( 0 . 7 × t ) elapses before the detected temperature rises to the maximum temperature . for example , referring to the curve b2 in fig5 time length t0 in the first stage is 25 sec ! and the temperature change α after the start of the second stage is 9 ° c .!. therefore , the heating mode b2 is selected when 5 sec ! elapses since the start of the second stage ( i . e . at the point x in fig5 ). according to the heating mode b2 , the maximum heating time in the second stage is set at 0 . 75 min ! ( 45 sec !) and the maximum temperature is set at 60 ° c .!. at the point y in fig5 the detected temperature attains the maximum temperature of 60 ° c .! before the maximum heating time of 45 sec ! elapses since the start of the second stage . thus , at the point y , the operation proceeds from the second stage to the third stage . the length of time t from the start of the first stage to the end of the second stage is 37 sec !. therefore , the maximum heating time in the third stage is set at 0 . 7 × 37 = 26 sec ! and the maximum temperature is set at 65 ° c .!. at the point z in fig5 the detected temperature attains the maximum temperature of 65 ° c .! before the maximum heating time of 26 sec ! elapses . hence , at the point z , the magnetron 3 is stopped and the heating is completed . normally , the maximum temperature is attained in each stage before the maximum heating time elapses as described above . in other words , the maximum heating time is provided for unusual cases as follows . when the object 5 is not placed in the proper position , the infrared sensor 8 detects the temperature of the turntable 6 instead of the temperature of the lid 5a . the maximum heating time prevents overheating of the food in such a case , and assures safety . also , the hygrosensor 10 may be utilized for safety . for example , such a situation should be considered that the object 5 is placed out of the detectable scope of the infrared sensor 8 . in this case , an abnormal reference level for the detection signal of the hygrosensor 10 is predetermined in each stage , and when the detection signal exceeds the abnormal reference level , the operation proceeds to the next stage as when the detected temperature has attained the maximum temperature ( or the operation is stopped ). in the microwave oven of the above embodiment , a plurality of input keys may be provided to the operation unit 23 and a plurality of heating sequences may be prepared corresponding to respective input keys . for example , the input keys may be provided corresponding to various types of packaged food such as &# 34 ; souzai &# 34 ;, &# 34 ; donburi &# 34 ;, &# 34 ; bentou &# 34 ;, &# 34 ; onigiri &# 34 ; ( rice ball ) and &# 34 ; bread &# 34 ;. the input keys may be otherwise provided corresponding to the preserving states of the food , or the temperature of food before a heating is started , such as &# 34 ; freezed &# 34 ;, &# 34 ; chilled &# 34 ; and &# 34 ; preserved at normal temperature &# 34 ;. by the microwave oven as described above , various types of packaged foods can be heated more appropriately . in the above embodiment , the time required for the temperature to rise by a predetermined amount is used as the parameter representing the degree of rise in the temperature in the initial phase of the heating and the change in the temperature per unit time is used as the parameter representing the degree of rise in the temperature in the following phase of the heating . of course the degree of rise in the temperature in the initial phase may be represented by the change in the temperature per unit time , and the degree of rise in the temperature in the following heating phase may be represented by the time required for the temperature to rise by a predetermined amount . in the initial phase , however , the inclination of the temperature curve changes much as the time elapses , as shown in fig5 . therefore , the degree of rise in the temperature in the initial phase of the heating can be detected more precisely and easily by the method of the above embodiment . | 7 |
embodiments provide an implantable medical system including an implantable medical lead that may be coupled to a stimulation device where the implantable medical lead has a strain relief loop . according to various embodiments , a strain relief loop holder and / or the strain relief loop of the lead itself inhibits restriction by tissue growth of the function of the strain relief loop . this allows the strain relief loop to assist in maintaining the position of the distal end of the lead at the target site during movements of the body of the patient . fig1 shows an example of an implantable medical system 100 . in this particular view , the implantable medical system 100 is implanted within tissue 101 of a patient . the implantable medical system 100 includes a stimulation device 102 that includes a housing 106 that encloses a stimulation engine 110 . a header 108 that is affixed to the housing 106 or is integral to the housing 106 receives a proximal end of an implantable medical lead 104 to establish electrical connectivity to conductors within the lead . the lead 104 provides an electrically conductive pathway from the implantable device 102 to electrodes 118 at a distal end 116 of the lead 104 which is positioned at a target site 120 within the patient . here , the electrodes 118 are in close proximity to tissue 122 to be stimulated , such as neurological tissue or cardiac tissue . a lead body 112 of the lead 104 forms a strain relief loop 114 where various embodiments may be present to inhibit restriction of the strain relief loop 114 by tissue growth 124 that otherwise adheres to the strain relief loop 114 within the patient . here , the electrodes 118 are in close proximity to tissue 122 to be stimulated , such as neurological tissue or cardiac tissue . a lead body 112 of the lead 104 forms a strain relief loop 114 that is subject to restriction by tissue growth 124 . various embodiments may be present at the strain relief loop 114 to inhibit restriction by the tissue growth 124 that otherwise adheres to the strain relief loop 114 . fig2 - 8b show examples of these various embodiments which include various objects and / or coating / dopant configurations for obstructing tissue growth as shown in fig2 - 4b . these various embodiments also include various objects that create a mechanical advantage to overcome restriction by tissue growth as shown in fig5 a - 8b . fig2 shows an embodiment of an object in the form of a strain relief loop cover 202 that is an enclosure that surrounds the strain relief loop 114 . the cover 202 has an entry aperture 204 and an exit aperture 206 that allows the lead body 112 to enter and exit the holder 202 while forming the loop 114 inside of the holder 202 . the interior of the cover 202 may be empty space as shown or may have interior details for structural support so long as such details do not restrict the function of the loop 114 . the cover 202 obstructs the tissue from being able to grow within the loop 114 as the loop 114 and in particular the surface 115 of the lead body 112 that forms the inner circumference of the loop 114 is effectively isolated from surrounding tissue and tissue growth . the strain relief loop cover 202 may be constructed of various biocompatible materials , including compliant materials such as polymers including silicones , poly ( ethylene ), polyurethanes , poly ( vinyl chloride ), and polylactides and / or rigid materials such as ceramics and metals including stainless steel , cobalt alloys , and titanium alloys . additionally , the strain relief loop cover 202 may include either a coating or dopant of material 210 that inhibits tissue growth , and in particular inhibits monocyte adhesion and collagen growth . examples of such a material 210 include synthetic polymers including poly ( vinyl alcohol ), poly ( lactic co - glycolic ) acid and poly ( lactic acid ), oxymatrine , and hydrogels such as poly ( hydroxyethyl methacrylate ) and polyethylene glycol , and phospholipid - containing materials . this material 210 may be present throughout the cover 202 or at least in areas surrounding the entry aperture 204 and exit aperture 206 so help prevent tissue growth within the apertures 204 , 206 that might otherwise restrict the function of the loop 114 . fig3 shows an example of an object in the form of a mesh structure 302 that is present within the loop 114 and is adhered to the surface 115 of the lead body 114 that forms the inner circumference of the loop 114 . the mesh structure 302 obstructs the interior of the loop 114 to inhibit tissue from growing through the interior of the loop 114 while being compliant to allow the loop 114 to function . examples of the material that forms the mesh structure 302 include polymers including silicones , poly ( ethylene ), polyurethanes , poly ( vinyl chloride ), and polylactides . to aid the mesh structure 302 in eliminating tissue growth from the interior of the loop 114 , the mesh structure 302 may have a tissue growth inhibitor as a dopant or coating material 304 . this material 304 may be the same as the material 210 discussed above in relation to fig2 . this material 304 reduces the occurrence of tissue growth onto the mesh structure 302 so that the mesh structure 302 maintains adequate compliance for the loop 114 to function . fig4 a shows an example where there is no object such as a holder or a mesh structure associated with the loop 114 . instead , the lead body 112 has a dopant or coating of material 402 at least in the section forming the loop 114 where the material 402 inhibits tissue growth . while tissue may grow to some degree within the loop 114 , the ability of the tissue to grow onto the loop 114 is reduced to thereby preserve at least some of the function of the loop 114 . the material 402 may be the same as the material 210 discussed above in relation to fig2 . fig4 b shows an example where there is a mesh structure 404 like the mesh structure 302 of fig3 , and the lead body 112 also has a dopant or coating of material 402 at least in the section forming the loop 114 where the material 402 inhibits tissue growth as in fig4 a . tissue growth is obstructed within the loop 114 while the ability of the tissue to grow onto the loop 114 is also reduced to further preserve the function of the loop 114 . fig5 a shows an example of an object 502 that creates a mechanical advantage to overcome restriction by tissue growth . the object 502 of this example is a pair of arms 504 , 508 connected at a hinge point 512 which provides a scissor - like operation . one arm 508 is attached at fixed points 510 along the loop 114 to the lead body 112 . the fixation may be provided by a clamping structure on the ends of the arm 508 , by an adhesive , by a weld , and the like . the other arm 504 has ends 506 that are loosely coupled to the loop 114 to allow the ends 506 to slide along the loop 114 . the arms 504 , 508 may be constructed of various rigid and biocompatible materials such as biocompatible plastics or metals . the arms 504 , 508 are biased relative to one another to a steady state position shown in fig5 a . the bias may be provided by a spring 514 located at the hinge 512 where one side of the spring 514 is attached to the arm 504 and the other side is attached to the arm 508 . the arm 504 may be anchored by the presence of tissue and / or by being surgical anchored via suturing or another anchoring technique . the spring 514 causes the arm 508 to resist motion relative to the arm 504 , although providing less resistance to motion than the resistance to motion of the distal end 116 of the lead 104 . upon a force 516 being applied due to movement of the patient , the proximal end of the lead moves which overcomes the bias of the spring 514 without dislodging the distal end 116 and causes the arm 508 to rotate away from the steady state position as shown . this rotation in opposition to the bias from the spring 514 results in the state of the object 502 ′ shown in fig5 b , where the loop 114 ′ now has a different diameter than the steady state diameter and the spring 514 ′ is stressed relative to the steady state position . in this example , the force 516 has produced a smaller diameter loop 114 ′ which produces excess lead length that extends toward the proximal end to relieve tension on the distal end 116 . when the movement of the patient returns , the excess lead length produced by the reduction in loop diameter should be regained by the loop 114 to increase the loop diameter back to the steady state configuration of fig5 a . however , the tissue growth around the loop 114 may constrain the ability of the excess length of the lead body 112 to return to the loop 114 , especially considering the loop is compliant and may tend to buckle . the mechanical advantage provided by the bias of the stressed spring 514 ′ effectively pulls the excess length of the lead body 112 back into the loop by the return rotation 518 of the arm 508 as shown in fig5 b . fig6 a shows an example of another object 602 that creates a mechanical advantage to overcome restriction by tissue growth . the object 602 of this example is an elastic mesh 602 connected to the surface 115 forming the inner circumference of the loop 114 . the elastic mesh 602 has a steady state position shown in fig6 a and may resist motion in all directions , although to a lesser degree than the resistance to motion of the distal end 116 of the lead . the elastic mesh 602 may be constructed of various biocompatible materials such as polymers including silicones , poly ( ethylene ), polyurethanes , poly ( vinyl chloride ), and polylactides which provide the mechanical advantage by attempting to return to the steady state position . upon a force 604 being applied due to movement of the patient , the proximal end of the lead moves which causes the mesh 602 to crumple away from the steady state position to the crumpled mesh 602 ′ of fig6 b . this movement and resulting crumpling in opposition to the bias from the mesh 602 results in the loop 114 ′ having a different diameter than the steady state diameter . in this example , the force 604 has produced a smaller diameter loop 114 ′ which produces excess lead length that extends toward the proximal end to relieve tension on the distal end 116 . when the movement of the patient returns , the excess lead length produced by the reduction in loop diameter should be regained by the loop 114 to increase the loop diameter back to the steady state configuration of fig6 a . however , the tissue growth around the loop 114 may constrain the ability of the excess length of the lead body 112 to return to the loop 114 , especially considering the loop is compliant and may tend to buckle . the mechanical advantage provided by the bias 606 of the crumpled mesh 602 ′ forcing the smaller loop 114 ′ to grow in diameter back to the steady state effectively pulls the excess length of the lead body 112 back into the loop 114 . the primary benefit of the mechanical advantage is to assist the strain relief loop in countering the forces exerted by the tissue encapsulation . the goal is to have tissue encapsulation occurring at the strain relief loop last , as per the cover and doping mechanisms discussed above , or in the case of mechanical advantage embodiments , having the effect of the encapsulation ( i . e ., resisted motion ) occurring at the strain relief loop last relative to the effect of the encapsulation at the electrodes . fig7 a shows an example of another object 702 that creates a mechanical advantage to overcome restriction by tissue growth . the object 702 of this example is a loop holder in the form of a tubular loop 702 having an entry aperture 704 and an exit aperture 706 . the lead body 112 passes through the tubular loop 702 to form the loop 114 . the tubular loop 702 has a steady state position shown in fig7 a and may resist motion in all directions , although to a lesser degree than the resistance to motion of the distal end 116 of the lead . the tubular loop 702 may be constructed of various materials such as polymers including silicones , poly ( ethylene ), polyurethanes , poly ( vinyl chloride ), and polylactides which produce the mechanical advantage by attempting to return to the steady state position . upon a force 708 being applied due to movement of the patient , the proximal end of the lead 104 moves which causes the tubular loop 702 to bend to a greater degree away from the steady state position to the smaller diameter tubular loop 702 ′ of fig7 b . this movement and resulting reduction in loop diameter in opposition to the bias from the tubular loop 702 results in the loop 114 ′ also having a different diameter than the steady state diameter . in this example , the force 708 has produced a smaller diameter loop 114 ′ which produces excess lead length that extends toward the proximal end to relieve tension on the distal end 116 . when the movement of the patient returns , the excess lead length produced by the reduction in loop diameter should be regained by the loop 114 to increase the loop diameter back to the steady state configuration of fig7 a . however , the tissue growth around the loop 114 may constrain the ability of the excess length of the lead body 112 to return to the loop 114 , especially considering the loop is compliant and may tend to buckle . the mechanical advantage provided by the bias 710 of the tubular loop 702 ′ forcing the smaller loop 114 ′ to grow in diameter back to the steady state effectively pulls the excess length of the lead body 112 back into the loop 114 . fig8 a shows an example of another object 802 that creates a mechanical advantage to overcome restriction by tissue growth . the object 802 of this example is a holder in the form of a polymer mold 802 . the lead body 112 is press fit into the polymer mold 802 , where the mold 802 may either deform to receive the lead body 112 or may have a pre - formed channel 806 to receive the lead body 112 . the lead body 112 forms the loop 114 where the loop 114 is then held by the mold 802 . the mold 802 has a steady state position shown in fig8 a and may resist motion in all directions , although to a lesser degree than the resistance to motion of the distal end 116 of the lead . the mold 802 may be constructed of various materials such silicones , poly ( ethylene ), polyurethanes , poly ( vinyl chloride ), and polylactides which produce the mechanical advantage by attempting to return to the steady state position . upon a force 804 being applied due to movement of the patient , the proximal end of the lead 104 moves which causes the mold 802 to deform away from the steady state position to the smaller diameter mold 802 ′ of fig8 b having the ripples 808 . this movement and resulting reduction in loop diameter in opposition to the bias from the mold 802 results in the loop 114 ′ also having a different diameter than the steady state diameter . in this example , the force 804 has produced a smaller diameter loop 114 ′ which produces excess lead length that extends toward the proximal end to relieve tension on the distal end 116 . when the movement of the patient returns , the excess lead length produced by the reduction in loop diameter should be regained by the loop 114 to increase the loop diameter back to the steady state configuration of fig8 a . however , the tissue growth around the loop 114 may constrain the ability of the excess length of the lead body 112 to return to the loop 114 , especially considering the loop is compliant and may tend to buckle . the mechanical advantage provided by the bias 810 of the mold 802 ′ forcing the smaller loop 114 ′ to grow in diameter back to the steady state effectively pulls the excess length of the lead body 112 back into the loop 114 . while embodiments have been particularly shown and described , it will be understood by those skilled in the art that various other changes in the form and details may be made therein without departing from the spirit and scope of the invention . | 0 |
one or more detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed structure . fig1 shows one embodiment of an anterior locking interbody cage for use as an anterior interbody fusion device 100 in the lumbar spine 105 . the disc interspace is shaped like a “ d ” 110 . the device 100 has a generally oval or circular shaped body or cage , when viewed from above , having an annular wall enclosing a hollow interior or area 115 that would permit bony growth into spinal bones above and below the device when implanted . the hollow area 115 would be filled with bone autograft , allograft or a bone graft substitute . fig2 shows a “ d ” shaped body 200 body or cage , when viewed from above , having an annular wall enclosing a hollow interior or area 215 that would permit bony growth into spinal bones above and below the device when implanted . the hollow area 215 would be filled with bone autograft , allograft or a bone graft substitute . there are some advantages using the oval or circular shape shown in fig1 over “ d ” shape 200 shown in fig2 . for example , the “ d ” shaped device can only be placed in the disc space in one orientation . the “ d ” shape has posterior corners that can impinge on the aortic / venous iliac vessels . the “ d ” design is not suitable for a lateral approach 120 . in contrast , an oval shaped device permits more implant options , so that the device could be placed in different rotational orientations within the spine , and would have the advantage of sliding safely past aortic / venous iliac vessels . the oval shaped device 100 also allows variability to approach the disc space from multiple angles 120 , again permitting variability to better accommodate the vascular anatomy , such as . for example , oval shaped device may also be placed into patients through a lateral approach 120 , which a “ d ” design does not afford , the lateral approach being favored by many surgeons in an anterior approach to l4 / 5 . fig3 a shows a l5 / s1 anterior view of one embodiment of a modular anterior locking interbody cage ( malic ) system 300 configured to be placed between vertebra . the system 300 includes an interbody fusion device or implant 305 and an attachment plate 310 . the implant 305 may be made of a metal , a non metal synthetic material , or a nmsm / metal amalgam , discussed below . the attachment plates 310 are coupled to the implant with a screw , and would allow a variation of attachment plates 310 to be attached onto the implant 305 , making the system 300 modular . the attachment plates are designed to accommodate the vascular 325 anatomy . using a screw or other fixation means such as a rivet or snap locking mechanism for attachment with the implant allows the attachment plate to rotate to various orientations to avoid the vascular anatomy . the attachment plate may be coupled to the implant either before , during , or after implantation . the screw attachment also allows the attachment plate to be removable from the body in case it needs to be replaced or repositioned . the attachment plate 310 has a superior portion ( anatomically cranial ) and an inferior portion ( anatomically caudal ). the superior portion is narrower than the inferior portion . the attachment plate 310 in turn would have holes that would allow the placement of bone screws 320 into the vertebra above and / or below , locking the implant 305 in place . the attachment plate 310 may be made from metal , such as titanium , stainless steel or cobalt - chromium . the attachment plate 310 may also be made from high strength composites or plastics such as peek . in addition , the attachment plate 310 adjacent to the device 305 may have a contouring that would allow a male / female counterpart contouring on a front surface of the device . this would allow a surface interlock that would resist rotational forces between the attachment plate 310 and the device 305 . the primary reason for the attachment plate 310 shape is the complexity of the vascular anatomy , especially at the spinal levels superior to l5 - s1 , that can make access in one area of the spine easier than another . this would allow the surgeon a variety of attachment plates 310 to choose from , selecting the best shape to accommodate the complex vascular anatomy . by creating this modularity in attachable plates this device would have a variety of attachable plates that would accommodate different vascular anatomic challenges , allowing surgery to be performed in a safer manner . this would be done without sacrificing biomechanical strength and the plate would in turn lock onto the malic . fig3 b is a side view showing one embodiment of attaching the attachment plate 310 to the implant 305 . screw 335 attaches the attachment plate 310 to the implant 305 , in particular , attaching to the embedded metal plate 340 within the implant 305 . bone screws 325 are then used to attach the attachment plate to the vertebra above and / or below implant 305 . fig4 a shows one example of an anterior view of the spine in which a vascular portion requires retraction for implantation and attachment of an attachment plate 310 to a body 305 and adjacent vertebrae . in this example of the vertebral levels above l5 - s1 area , the vascular portion 325 is draped over the left side of the vertebrae . the vascular 325 a and / or 325 b is retracted 330 , such as shown in fig4 b , to make room for the attachment plate 310 to attach to the implant 305 and vertebrae . fig4 c - 4e show different sizes and shapes of attachment plates 310 that may be used to avoid the vascular , having superior portions narrower than inferior portions . in fig4 c , attachment plate 310 a may include provisions for one screw attaching to a vertebra above the implant 305 and two screws attaching to a vertebra below the implant 305 . in fig4 d , attachment plate 310 b attaches to a vertebra below the implant 305 . in fig4 e , attachment plate 310 c may include provisions for one screw attaching a vertebra above the implant 305 and two screws attaching to a vertebra below the implant 305 . in some cases , it may be desirable to have surface treatment of the attachment plate 310 and implant 305 where they join . for example , fig5 shows two examples a and b . the mating surfaces in a have adjacent irregular contouring and b have regular pyramidal male / female interlocking features to provide additional stability of the assemble components that may include rotational stability . fig6 a shows one embodiment an implant 400 , having a generally oval or circular shape similar to device 100 , with an amalgam body of non metal synthetic material ( nmsm ) and metal material . in some embodiments , implant 400 may be used in place of implant 300 in the systems describe above . the device 400 includes an oval body 405 or cage with an annular wall 415 having upper and lower surfaces enclosing a central opening 410 or hollow interior . the upper and lower surfaces are configured to contact adjacent spine member and may have raised ridges projecting outwardly from each of the surfaces for engaging the spinal column . the annular wall 415 of the implant 405 includes an anterior portion 415 a , a posterior portion 415 b and lateral portions 415 c . the implant 405 is made from a non - metal synthetic material with a metal plate 420 integrally formed within the anterior side of the non metal synthetic material implant 405 . the metal plate 420 does not fully extend around the implant 405 . the non - metal synthetic material may be made from carbon , peek ( polyethylketone ), graphite , woven carbon , kevlar , or other suitable synthetic material that has strength capable of withstanding compression and rotational forces . the metal material may be titanium , stainless steel or cobaltlchromium . the amalgam feature could also be applied to nmsm threaded cages placed in the anterior lumbar spine , as well as cages placed in the interbody space from a lateral approach . this amalgam feature may also apply to cages , cylindrical or rectangular placed in the cervical or thoracic spine . while the preferred shape of the implant is oval , other shapes may also be used , such as circular , kidney or “ d ” shaped . there are numerous advantages of a nmsm / metal amalgam for an implant . for example , one advantage is the metal within the device allows a surgeon to identify the position of the device in space to assist in implantation at the proper location and orientation with in the spine . another advantage is that the nmsm material allows a surgeon to assess fusion postoperatively after the implantation of the device . this is due to the fact that x - rays penetrate the nmsm to allow bony visualization through the device . the surgeon would be able to evaluate the fusion of the device to the spine by using the lateral x - rays taken only through lateral portions of the nmsm device alone . one weakness of using a nmsm device alone ( i . e ., without metal ) is the difficulty in holding the device with instruments or less durable antirotation feature . often the holding instruments ( typically made of peek ) overwhelm the nmsm device during implantation , resulting in deformation and damage . another advantage of the disclosed nmsm / metal amalgam is that the metal can allow a firmer “ grabbing ” of the device with implantation tools . holding or grabbing the proposed nmsm / metal amalgam device with an implantation tool , which would hold the metal plate ( s ), would avoid such damage to the implant and allow better control during implantation . advantage of more durable feature to prevent rotation between the implant and plate . the combination of metal in the form of a fixation element within the nmsm device is a novel concept . in some embodiments , a plurality of tool engaging openings ( not shown ) may be disposed in the annular wall 415 having the metal plate ( s ) 420 . the openings can be threaded or otherwise configured to receive a conventional insertion tool ( not shown ). fig6 b - 6e show other embodiments of a nmsm / metal amalgam implant . in fig6 b , the metal within the device may include one or more metal plates , for example , plates 420 a , 420 b . in fig6 c , the metal within the nmsm / metal amalgam device could take the form of multiple washers or threaded inserts 425 . in fig6 d , the metal within the nmsm / metal amalgam device could take the form of a plate 430 with threaded screw holes 435 . in fig6 e , the metal within the nmsm / metal amalgam device could include both anterior plate ( s ) 420 on the anterior side and posterior plate ( s ) 440 on the posterior side of the device . fig7 shows a view of a lateral x - ray showing the implant 400 positioned within between adjacent vertebrae 450 . by positioning the metal within the anterior portion 415 a , and optionally the posterior portion 415 b , the surgeon would be able to evaluate the fusion of the device to the spine by using the lateral x - rays taken only through lateral portions 415 c of the nmsm device alone . an anterior 415 a / posterior 415 b x - ray would not be as desirable as the metal components of the device would obscure the fusion . there are numerous advantages of a nmsm / metal amalgam for an implant . for example , one advantage is the metal within the device allows a surgeon to identify the position of the device in space to assist in implantation at the proper location and orientation with in the spine . another advantage is that the nmsm material allows a surgeon to assess fusion postoperatively after the implantation of the device . this is due to the fact that x - rays penetrate the nmsm to allow bony visualization through the device . surgeons typically do not assess fusion through an anterior / posterior x - ray , and this is the view of the fusion that the metal components of the device would obscure . example embodiments of the methods and components of the present invention have been described herein . as noted elsewhere , these example embodiments have been described for illustrative purposes only , and are not limiting . other embodiments are possible and are covered by the invention . such embodiments will be apparent to persons skilled in the relevant art ( s ) based on the teachings contained herein . thus , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents . | 0 |
fig1 illustrates a typical prior art digital effects apparatus and video switcher apparatus interfaced together , wherein the switcher apparatus includes a video input matrix 12 , a keyer 14 , a mixer 16 and a pattern generator 18 . a plurality of video input signals are supplied by selected video sources to the input matrix 12 via input lines 20 , wherein the sources may include video cameras , videotape recorders , character generators , etc . the input matrix is coupled to the mixer 16 via a source a bus 21 and a source b bus 23 , as well as to the keyer 14 via at least one key bus 22 . the pattern generator 18 is coupled to the pattern input of the mixer 16 via a pattern bus 24 , and the keyer 14 supplies and key signals to the respective inputs of the mixer 16 via insert and key buses 26 , 28 . the mixer supplies the switcher video output on an output terminal 30 . the digital effects apparatus employs an auxiliary video matrix 32 of the switcher , which is coupled to a digital effects unit 34 such as , for example , an ampex digital optics system , manufactured by ampex corporation , redwood city , california . one or more video input signals are supplied to the auxiliary matrix 32 via multiple lines 36 by a video source or sources . an optional key signal may be coupled to the digital effects unit 34 via a line 38 . the digital effects unit 34 supplies a transformed digital effects video signal to the input matrix 12 via a bus 40 , and an external key signal to the keyer 14 via an external bus 42 . accordingly , it may be seen that the above switcher / digital effects apparatus comprise essentially an interfacing of the output of the digital effects unit 34 with the main input of the switcher apparatus , utilizing an auxiliary video matrix 32 at the input of the digital effects device . the digital effects unit 34 outputs are applied as input video and external key sources to the main input matrix of the switcher apparatus . these signals are utilized by the switcher in the conventional fashion , with keying done on the output of the digital effects unit as depicted in fig1 . it follows that whenever digital effects signals are fed to the switcher , an auxiliary bus therein must be dedicated to accommodate the signals , thus tying up the auxiliary bus . this in turn restricts the capabilities of the switcher . in fig2 a digital effects unit is &# 34 ; inserted &# 34 ; within the internal paths of a switcher apparatus to utilize fully the advantageous features of each apparatus while further optimizing additional advantages inherent in integrally combining the apparatuses . in the figures , similar components are similarly numbered . accordingly , a switcher apparatus includes the video signal input lines 20 coupled to the input matrix 12 , with the key bus 22 coupled thence to the keyer 14 . the video source , the insert video , the key and the pattern buses extending to the mixer 16 from the input matrix 12 , the keyer 14 and the pattern generator 18 are indicated via numerals 21 , 23 , 26 , 28 and 24 respectively , as in fig1 . however , as shown in fig2 and as contemplated by the invention , the paths defined as the buses 21 , 23 , 26 , 28 and 24 are interrupted , and a switching or digital effects &# 34 ; loop &# 34 ; 50 is inserted therein prior to the mixer 16 . the switching loop 50 ( as hereinafter termed ) supplies outputs corresponding to the continuations of the respective paths and are identified herein via the same numerals 21 , 23 , 26 , 28 and 24 . a digital effects unit 52 corresponding , for example , to the unit 34 of fig1 is modified to include digital effects video and key input buses 54 , 56 , which are dedicated to the digital effects unit 52 and which form part of the switching loop 50 . the digital effects unit 52 is supplied with at least one video input source signal and , in some effects also with at least a corresponding input key signal , by virtue of the switching loop 50 . in turn , the unit 52 is further modified to include digital effects video and key output buses 58 , 60 which are dedicated thereto and which also form part of the switching loop 50 . the digital effects unit 52 provides at least one digital effects output video signal and one output key signal back to the interrupted buses via the switching loop 50 , which includes the dedicated video and key output buses 58 , 60 , respectively . interrupting the internal paths of the source and control signals fed to the mixer 16 , including the pattern generator bus 24 to the mixer , and effectively inserting the digital effects unit 52 , allows enhancing the switcher operation to include performing the added digital effects of previous mention , which effects appear on the video output terminal 30 . source signals for the digital effects unit 52 now are internally provided from within the switcher , and the digital effects signals from the unit 52 are directly re - inserted as source and control signals for the mixer 16 . thus by virtue of the internally combined switching loop 50 , the digital effects unit 52 appears as an integral part of the switcher apparatus , whereby switcher transitions and effects are performed in conventional fashion , with the digital special effects appearing as additions to these operations . the switching or digital effects loop may be used in the internal configuration since the path through the digital effects unit 52 , although temporarily delayed , appears as a zero time delay to the switcher apparatus . fig3 includes further details of the interrupted paths within the switcher and the insertion of the digital effects unit 52 via the switching loop 50 . similar components are similarly numbered in the figures . thus , input matrix 12 is supplied with a plurality of video and key signals from corresponding video sources on the input lines 20 . the signals on lines 20 may include , for example , multiple background video input signals on lines 62 , and video key signals on lines 64 . in generally conventional configuration , the input matrix 12 in turn supplies background video signals via the a and b buses 21 , 23 respectively , as well as a pair of key video signals k1 and k2 via a pair of key input buses 66 , respectively . a further downstream ( dsk ) key signal is provided via a dsk key input bus 67 and functions in the manner of the k1 , k2 key signals as described below . in conventional fashion , the input video and key sources are fed via the input video lines 62 , 64 through the input matrix 12 , whereby any source signal may be supplied to any of the matrix output buses 21 , 23 , 66 and 67 , depending upon the desired mode of operation and which of the corresponding internal crosspoints in the input matrix are enabled . conventionally , the crosspoints are one - way electronic switches that select a respective input or reentry signal for use as a background or key video signal . since the input matrix configuration and function is well known in the switcher art , it is not further described herein . in addition , the input video lines 62 , 64 also are supplied to an auxiliary matrix 65 which corresponds to the auxiliary matrix 32 in the system of fig1 which supplied the input signals to the digital effects unit 34 . the auxiliary matrix 65 and its function in fig3 is further described below . the key source signals on buses 66 are supplied to the keyer 14 which , in turn , supplies k1 insert video and key signals on buses 26a , 28a , and k2 insert video and key signals on buses 26a , 28b , respectively . the key on bus 67 is used in the keyer to supply downstream ( dsk ) insert video and key signals on buses 26c , 28c , respectively . as seen from the fig3 the a bus 21 and b bus 23 are interruptible via respective crosspoints 68 , 70 . likewise , the various insert video and key buses 26a , 28a , 26b , 28b , 26c and 28c are interruptible via respective crosspoints 72 , 74 , 76 , 78 , 80 and 82 . as previously mentioned , the crosspoints are one - way electronic switches that in this arrangement may be selectively enabled or disabled to allow normal switcher operation , or added digital effects operation via the switching loop 50 and digital effects unit 52 when open and the respective buses are interrupted . to this end , the a bus 21 , b bus 23 , and insert video buses 26a , 26b and 26c are coupled via respective connecting lines 83 and crosspoints 88 and 89 to dedicated digital effects video input buses 84 , 86 ( corresponding to the dedicated video input bus 54 of fig2 ). the dedicated video input buses 84 , 86 extend to digital effects video inputs in the digital effects unit 52 via amplifiers 85 , 87 . likewise , the key signal buses 28a , 28b and 28c are coupled via respective connecting lines 81 and crosspoints 90 and 91 to dedicated digital effects key input buses 96 , 98 ( corresponding to the dedicated key input bus 56 of fig2 ) via respective amplifiers 92 , 94 and thence to the digital effects key inputs of unit 52 . the amplifiers 92 , 94 , as well as the amplifiers 85 , 87 are used to match the externally generated video signal levels with the switcher signal levels , whereby the switcher signals are made compatible with the signals from external apparatus . thus , for example , amplifiers 85 , 87 amplify the signals , while amplifiers 92 , 94 attenuate the signals . as depicted , the input buses 84 , 96 define a first digital effects input channel , while input buses 86 , 98 define a second input channel , of the unit 52 . an inverted a pattern signal is supplied via a connecting line 100 and an inverter 102 coupled to the dedicated key input buses 96 , 98 of channels 1 and 2 , via respective crosspoints 104 inserted prior to the amplifier circuits 92 , 94 . such an a pattern input allows the digital effects unit to use the a pattern signal as a key to cut a hole in the video supplied therefrom . input video signals corresponding , for example , to the background video on a bus and b bus , are supplied via the auxiliary matrix 65 , delays 106 , 108 and amplifiers 110 , 112 whose outputs are coupled to the dedicated digital effects input buses 84 , 86 via respective crosspoints 114 . a pair of auxiliary signals 1 and 2 conventionally are supplied on buses 116 , 118 from amplifiers 110 , 112 via crosspoints 120 and are used in external apparatus such as monitoring devices , which is not pertinent to this description . a preview ( pvw ) signal on a line 122 is coupled to the auxiliary signal buses 116 , 118 via crosspoints 124 and provides means for selecting and monitoring the output signals from any bus or mixer via the auxiliary buses 116 , 118 , in generally conventional fashion . in addition , a switcher input bus includes external lines 126 , 128 for supplying selected external video signals to the dedicated input buses 84 , 86 via crosspoints 130 . thus , the input video supplied to the digital effects unit 52 via the dedicated video input buses 84 , 86 may comprise video signals from the auxiliary matrix 65 , from the external sources on buses 126 , 128 , from the switcher internal video paths a bus , b bus or buses 26a , 26b , 26c , or from the mixer 16 output as described below , depending upon which of the corresponding crosspoints are enabled . in turn , the digital effects unit 52 supplies digital effects output video signals and output key signals via dedicated digital effects video output buses 132 , 134 and dedicated digital effects key output buses 136 , 138 , respectively . the dedicated video output bus 132 and dedicated video output bus 134 are coupled via respective connecting lines 133 back to the continuations of a bus , b bus and the insert video lines 26a , 26b and 26c via respective crosspoints 140 , 142 , 144 , 146 , 148 , and 150 , 152 , 154 , 156 and 158 . the dedicated key output buses 136 and 138 are coupled via amplifier circuits 160 , 162 and respective connecting lines 135 back to the key buses 28a , 28b , 28c via respective crosspoints 164 , 166 , 168 and 170 , 172 , 174 . the continuations of the various video and key buses 21 , 23 , 26a , 26b , and 28a , 28b , are coupled to their respective inputs of the effects mixer 16 . the continuations of the buses 26c and 28c are coupled to the respective inputs of a downstream mixer 17 . digital graphics ( dfx ) insert and key inputs of the downstream mixer 17 are supplied with external graphics signals via lines 184 , 186 and respective crosspoints 188 , 190 . in addition , the dedicated video output buses 132 , 134 are connected to the dfx insert input of the downstream mixer via crosspoints 176 , 178 , and the dedicated key output buses 136 , 138 and amplifiers 160 , 162 are connected to the dfx key input via crosspoints 180 , 182 . thus , the downstream mixer 17 may be supplied with video signals and key signals from the keyer 14 , from the digital effects unit 52 , or from an external graphics source . in addition , the downstream mixer 17 is supplied with program / preset ( pgm / pst ) video . the dfx inputs on the downstream mixer 17 provide the feature of an external unity gain isolated key on a downstream mixer . this isolated key conventionally may be used for a character generator . in the present invention the isolated key may be used in conjunction with the dedicated key output buses 136 , 138 , for keying in the digital effects unit 52 output with its boundary signal . the location of this key below the downstream key and on top of the program / preset video , enables keying in an m / e output from the mixer 16 , allowing wipes inside a shrunken raster . digital wipes are possible if a dual channel digital effects unit 52 is used such as depicted in fig3 . thus , the external isolated key is very useful for generating &# 34 ; over the shoulder &# 34 ; effects . conventionally , the pattern generator 18 provides a border signal and a and b pattern signals on the bus 24 of previous mention and shown here as respective lines 189 , 191 and 192 coupled to the effects mixer 16 via respective crosspoints 194 , 196 and 198 . in addition , the output key signals on the dedicated key output buses 136 , 138 from the digital effects unit 52 are coupled to the a and b pattern lines 191 , 192 via a connecting line 199 , crosspoints 200 and 202 , and a matching amplifier 204 . the latter connection allows the key signals from the digital effects unit 52 to be supplied to the effects mixer 16 in place of the a or b pattern signals from the pattern generator 18 , to perform digital wipe effects . the effects mixer 16 supplies a mix effects ( m / e ) signal on a connecting line 206 , which is coupled back to an m / e input of the dedicated video input buses 84 , 86 of the digital effects unit 52 via crosspoints 208 , 210 respectively . the m / e signal also is fed to the downstream mixer 17 , which supplies the output video signal from the switcher via an output line 212 . as may be seen , when the various ( switchable ) connecting lines are connected to the digital effects unit 52 and the respective crosspoints 68 - 82 are opened , the digital effects unit 52 effectively is inserted into the video and key paths of the switcher apparatus via the dedicated input / output buses , that is , the switching loop 50 . the unit 52 supplies corresponding video and key signals to the effects mixer 16 and / or the downstream mixer 17 , to provide selected digital effects additions to the switcher operation . to this end , the various crosspoints depicted herein are controlled in conventional fashion via digital control signals supplied thereto , which turn the crosspoints on or off . thus , in fig3 a control console computer unit ( cpu ) 214 monitors the faders , positioners and switches ( not shown ) of the switcher apparatus in conventional fashion . when a switch is pressed as when identifying a desired effect , or a fader or the positioner is moved to execute the desired effect , the cpu 214 encodes data identifying the change for that effect and sends it in serial form to an associated signal system cpu 216 . the cpu 216 stores the data and sends the appropriate instructions to device control circuits 218 which supply the control signals as digital words to the respective matrix , mixer and keyer , as well to the switching loop 50 herein , via corresponding control buses 220 . the control signals selectively control the crosspoints , including those crosspoints pertinent to the switching loop 50 and dedicated input / output buses , to execute the desired effect . the signal system cpu 216 responds to the control console , essentially echoing the data received . the control console provides corresponding indicator messages for the operator . the digital effects made possible via the digital effects loop 50 / unit 52 are assigned numbers in the manner of conventional analog effects generated by the switcher apparatus . thus when an effect is desired and the corresponding switch is pushed , the effect is automatically encoded via the signal system cpu 216 . in a desired key effect with added special effects such as movement , a menu may be supplied to provide interface with the operator . employing the configuration of fig2 the inserted digital effects unit 52 can supply various digital effects which will be seen as modifications to the output signal supplied by the switcher . to illustrate by way of example only , various canned transitions , or wipe effects , now are available to an operator which will appear as digital wipe effects added to the switcher analog patterns or wipes . one example of an analog wipe is the effect of moving a vertical bar across a television raster from left to right to reveal a second video picture corresponding to the new bus video . the digital effects means 50 / 52 provides a digital version of the wipe by sliding the second picture over the raster while sliding the first picture away . a second example of an analog wipe starts with a small rectangle which grows until it completely reveals a new background video picture . the digital equivalent performed by the digital effects means 50 / 52 herein , includes a compressed video raster of the new background video expanding over the previous video picture until it becomes full size . in generating such digital wipe effects , an operator uses the same switcher controls as when selecting an analog wipe or pattern number with the corresponding a and b bus sources . the transition is performed using the wipe mode . to illustrate , a wipe from b bus video to a bus video is performed by supplying the a bus video via the connecting line 83 to , for example , the channel 1 dedicated video input bus 84 of the digital effects unit 52 by enabling the respective crosspoint 88 on bus 84 . two fields later , the unit 52 supplies the manipulated a bus signal on the dedicated digital effects video output bus 132 and connecting line 133 , at which time the crosspoint 68 is opened while the crosspoint 140 is closed to supply the a bus video to the effects mixer 16 . the digital effects unit 52 also supplies a digital effects output key signal to the a and b pattern inputs of the effects mixer 16 via the dedicated key output bus 136 , crosspoint 200 , connecting line 199 , amplifier 204 and crosspoints 202 . pattern bus crosspoints 196 , 198 are opened . thus , the unit 52 generates a boundary signal that is used by the effects mixer 16 instead of the pattern control signals from the generator 18 to replace the existing b bus video with the a bus video . in an alternate mode of operation , channel 2 of the digital effects unit 52 may be used to slide the b bus video off the raster while replacing it with the a bus video . the b bus video is supplied to the dedicated video input bus 86 of channel 2 via a crosspoint 89 , with the effects unit 52 supplying the b bus video to the effects mixer 16 via the dedicated video output bus 134 and crosspoint 152 . crosspoint 70 is opened . in either mode , the resulting digital wipe effect is supplied on the video output 212 via the downstream mixer 17 . the digital effects means 50 / 52 also may be employed to digitally process a key hole cutting signal along with the keyed video . this gives the effect of manipulating a key instead of the entire raster , and the digital effects unit 52 appears as a modifier to the key . thus , given a video source , for example , on input k2 from the input matrix 12 , a key source is selected by the keyer 14 and the corresponding k2 insert signal k2 key signal are derived on buses 26b , 28b , respectively . the k2 insert signal is fed to , for example , the channel 2 dedicated video input bus 86 of the digital effects unit 52 via the respective connecting line 83 , crosspoint 89 and bus 86 , while the k2 key signal is fed to the key input of unit 52 via the respective crosspoint 91 , connecting line 81 , amplifier 94 and dedicated bus 98 . the digital effects unit 52 provides the digital effects output video and key signals to the effects mixer 16 two fields later in time , via the dedicated output buses 134 , 138 , connecting lines 133 , 135 and crosspoints 156 , 172 respectively . crosspoints 76 and 78 are opened simultaneously with the closing of crosspoints 156 , 172 to enable routing the video and key signals through the unit 52 via the switching loop 50 . if the insert level is adjusted to the maximum level the entire raster is keyed in , and the switcher directs the digital effects unit 52 to ignore the key signal and instead generate its boundary signal . the digitally manipulated signals are mixed in the effects mixer 16 , whereby colored borders , soft transitions , etc ., are provided with the keys entire raster . the resulting effect is supplied on output 212 via the downstream mixer 17 . | 7 |
referring now to the drawings and to fig1 in particular , there is shown a reclining chair 10 having a seat 12 , a backrest 14 , and side supports 16 . the chair is moveable between an upright position ( shown ), a fully reclined position ( fig7 ) and intermediate positions there - between . a leg rest 109 is provided beneath the seat 12 . a headrest 122 is mounted above the backrest 14 . referring to fig2 and 3 , a 4 - bar linkage mechanism in each of the side supports 16 connects the seat and backrest together for reclining functions and supports the same on the side supports 16 . for purposes of simplicity , only one linkage mechanism has been shown . the 4 - bar linkage comprises a seat support bracket 30 , a backrest bracket 34 , a side support bracket 18 and a coupler link 40 . as shown in fig3 and 4 , each side support bracket 18 comprises an outwardly extending horizontal flange 20 having openings 22 adapted to receive conventional screws 24 to secure the side support bracket 18 to a plate 25 secured to the side support 16 . a downwardly depending vertical flange portion 26 is provided at the inner edge of horizontal flange 20 and is adapted to receive a pivot pin 28 pivotably mounting a seat support bracket 30 and to receive a pivot pin 32 pivotably mounting a backrest bracket 34 . each backrest bracket 34 includes a rearwardly extending plate 36 adapted to receive a pivot pin 38 pivotably mounting a coupler link 40 and to receive a pivot pin 32 pivotably connecting the backrest bracket 34 to the side support bracket 18 . each backrest bracket 34 further includes an inwardly - extending flange portion 42 having openings 44 therein adapted to receive screws 46 to rigidly affix the backrest 14 to a plate 47 secured to the backrest bracket 34 . each coupler link 40 comprises an elongated link being pivotably mounted at one end at a pivot pin 38 to the backrest bracket 34 and being pivotably mounted at another end at a pivot pin 48 to the seat support bracket 30 . the seat support bracket 30 comprises an elongated cross - member 50 having openings 52 therein . the cross - member 50 is adapted to support the seat 12 and the openings 52 are adapted to receive screws 54 to secure the seat 12 to the seat support bracket 30 . upwardly extending vertical flanges 56 are provided at opposing ends of the cross - member 50 and are adapted to receive a pivot pin 48 pivotably mounting the coupler link 40 to the upward flange 56 and to receive a pivot pin 28 pivotably mounting the seat support bracket 30 to the side support flange 26 . the linkages provided betweer the pivot pins 28 , 32 , 38 and 48 thereby form a 4 - bar linkage comprising the coupler link 40 , the backrest bracket 34 , the side support bracket 18 and the seat support bracket 30 . the linkages are configured and arranged so that the center of gravity of the occupant moves horizontally as the chair is moved from an upright position to a reclined position or an intermediate position there - between , or vice versa . this movement is illustrated in fig8 in which the reclining position of the chair is illustrated in phantom lines . the movement of center of gravity of the occupant is illustrated in fig8 by the phantom lines between the x -- x . in this manner , a minimum of effort is required to move the chair from the upright to recline position and vice versa . further , the linkages are configured and arranged so that the axis of rotation of chair 10 passes approximately through the hips of a chair occupant . in this manner , relative movement of backrest 14 with respect to seat 12 approximates the relative movement of the occupant &# 39 ; s back with respect to the occupant &# 39 ; s thighs . this approximate correspondence is achieved by means of the location of the axis of rotation of backrest 14 at or near the occupant &# 39 ; s hips . as a result , the shear between the chair occupant &# 39 ; s back and backrest 14 is minimized . referring now to fig2 and 7 , the seat support bracket 30 further comprises a forwardly - extending central portion 58 extending from cross - member 50 to support a leg rest mechanism 60 . downwardly - extending vertical flanges 68 depend from opposing edges of the forwardly - extending central portion 58 to receive the leg rest mechanism 60 . the downwardly - extending flanges 68 are adapted to receive a pin 72 adapted to mount a rear rocker arm 74 and a pivot pin 76 adapted to mount a front rocker arm 78 . rear rocker arm 74 comprises an elongated link adapted to receive pivot pin 72 at the upper end thereof and also adapted to receive a pivot pin 86 at the opposite end thereof pivotably mounting a coupler arm 88 to the rear rocker arm 74 . the front rocker arm 78 comprises an elongated link having a forwardly - extending portion 90 at the lower portion thereof . the front rocker arm 78 is adapted to receive pivot pin 76 and is also adapted to receive a pivot pin 96 to mount the front rocker arm 76 to a pair of rotation couplers 98 . the front rocker arm 78 is also adapted to receive a pivot pin 102 at the upper portion of the forwardly - extending portion 90 to pivotably mount the front rocker arm 78 to a coupler arm 88 . each coupler arm 88 comprises a first portion 104 extending between the lower opening ( not shown ) of rear rocker arm 74 and intermediate opening ( not shown ) of front rocker arm 78 . each coupler arm 88 further comprises a second portion 106 extending forwardly and upwardly from intermediate opening ( not shown ) of front rocker arm 78 . a forward end of second portion 106 of coupler arm 88 is pivotably mounted to a leg rest support bracket 108 . each rotation coupler 98 comprises an elongated link pivotably mounted at one end to front rocker arm 78 by means of pivot pin 96 and being pivotably mounted at an opposite end to leg rest support bracket 108 . an actuator arm 110 comprises an elongated link being pivotably mounted at one end thereof to rear rocker arm 74 and being pivotably mounted at an opposite end thereof to a lower portion of backrest 14 . as shown in fig9 and 10 , a leg rest 109 is slidably mounted to leg rest support bracket 108 by means of a u - shaped track 107 secured within leg rest 109 . in fig9 and 10 , a foam cushion layer has been broken away to expose the supports and track 107 . the foam cushion layer is mounted to a curved plate 113 . the u - shaped track 107 is in turn mounted to the curved plate 113 . track 107 slidably engages an upper plate 111 which is secured to the leg rest support bracket 108 at the side thereof . leg rest 109 may thereby be moved with respect to leg rest support bracket 108 to a position suited to the individual chair occupant . a latchtype mechanism ( not shown ) can be utilized to control the location of leg rest 109 with respect to bracket 108 . a spring retracting mechanism ( not shown ) can also be utilized to return leg rest 109 to a retracted position with respect to bracket 108 automatically . as shown in fig2 , and 7 , a release mechanism 112 is provided to permit the reclining chair 10 to be secured in an upright , fully reclined , or intermediate position . the release mechanism 112 comprises a number of teeth 114 protruding from , and integral with , a forward portion of backrest bracket 34 . the teeth 114 are arranged in an arc - like arrangement . a release arm 116 is pivotably mounted to the side support 16 and includes a tooth - like projection 118 protruding therefrom and adapted to engage the teeth 114 . a handle 120 is secured to release arm 116 to allow the tooth - like projection 118 to be disengaged from the teeth 114 . the reclining chair 10 may thereby be moved between upright , recline or intermediate positions when the handle 120 is depressed so as to disengage the tooth - like projection 118 from the teeth 114 . the reclining chair 10 may not be moved between upright , recline or intermediate positions when the handle 120 is not depressed and the tooth - like projection 118 is engaged in the teeth 114 . alternatively , pneumatic positioner mechanisms or friction clutch mechanisms ( not shown ) can be utilized in place of the described release mechanism 112 . as shown in fig5 and 6 , a headrest 122 is mounted to the top of backrest 14 . the headrest 122 includes a downwardly - extending plate 124 at the rear portion thereof and a ramp surface 126 . a link 128 having a slot 130 at the lower end thereof is provided to mount headrest 122 to backrest 14 . link 128 is pivotably mounted at an upper end thereof to headrest 122 . the slot 130 in link 128 is engaged by a pin 132 secured to a lower portion of a cam 134 . the cam 134 has a slot 136 at the upper portion thereof . the cam 134 also comprises a ramp surface complementary to ramp surface 126 so that as headrest 122 is pulled forwardly and upwardly by a chair occupant , ramp surface 126 slides over ramp surface 138 until the bottom of plate 124 engages slot 136 in the upper portion of the cam 134 . as a result , the headrest 122 may be manually moved by the chair occupant from a first position adjacent to the backrest 14 to a second , inclined position and vice versa . this movement of headrest 122 adjusts both the relative inclination of the headrest . an extension mechanism ( not shown ) can be provided to adjust the relative height of headrest 122 with respect to backrest 14 . in use , a horizontal shift in the center of gravity of the chair occupant will cause the 4 - bar linkage comprising the seat support bracket 30 , backrest bracket 34 , coupler link 40 , and side support bracket 18 to rotate . this rotation causes the backrest 14 to rotate with respect to the seat 12 about an axis of rotation passing approximately through the hips of the chair occupant . this configuration maintains the position of the backrest 14 with relation to the seat 12 so as to avoid &# 34 ; pulling &# 34 ; of the chair occupant &# 39 ; s upper garment . this configuration is such that the chair may be moved from the upright to the fully reclined position , and vice versa , by a horizontal shift of the center of gravity of the chair occupant . because the center of gravity of the chair occupant need only be shifted horizontally , rather than vertically , a large force is not necessary to overcome the occupant &# 39 ; s body weight to initiate tilting . as the reclining chair 10 is moved , a second linkage comprising seat support bracket 30 , front rocker arm 78 , rear rocker arm 74 , and coupler arm 88 also rotates . leg rest mechanism 60 is thereby automatically actuated . movement of this second linkage causes the forward and upward movement of rotation coupler 98 and coupler arm 88 . leg rest 109 is thereby moved from a vertical position to a horizontal position . this footrest mechanism and the 4 - bar linkage comprising seat support bracket 30 , backrest bracket 34 , coupler link 40 and side support bracket 18 share a common element in seat support bracket 30 . relative movement between those two positions of the invention is made by means of actuator arm 110 . the horizontal location of leg rest 109 may be adjusted by the chair occupant by sliding leg rest 109 forwardly or rearwardly with respect to leg rest support bracket 108 . the principles of the invention are not limited to the specific embodiment herein described . reasonable variations and modifications are possible within the scope of the foregoing disclosure without departing from the spirit of the invention . | 0 |
referring to the drawings and more particularly to fig1 and 2 , there is shown in partial perspective at a generally conventional m16 or ar15 type gas operated firearm which can incorporate the improved bolt carrier of this invention . the firearm includes an upper receiver section 12 and lower receiver section 14 . upper receiver section 12 is provided with a chamber ( not shown ) for receiving a bolt carrier assembly . firearm 10 also includes butt stock 16 , hand guard assembly 18 , rear sight assembly 22 and a carrying handle 24 . trigger 28 , trigger guard 32 are shown in fig1 along with pistol grip 26 . front hinge 34 is provided to permit the opening of the lower receiver 14 as shown in fig2 . a so - called magazine latch button 36 is used to release the magazine ( not shown ). charging handle 42 functions to pull the bolt carrier assembly rearwardly when the first round of ammunition is chambered . thus , pulling on the charging handle picks up a round of ammunition from the magazine and inserts it into the chamber ( not shown ). the forward assist 44 is used to help to properly place the bolt carrier assembly into the forward battery position if need be . finally , in the overall view of the firearm an ejection port cover 38 functions during operation of the firearm and opens to allow the ejection of a spent round of ammunition . its primary function is to keep dirt out of the internal portion of the firearm . as previously noted , a bolt carrier assembly typically includes a bolt carrier , a bolt mounted in the carrier for axial sliding movement and rotation , a firing pin slidably mounted within the bolt and bolt carrier for restrictive reciprocating axial movement , and a cam pin for producing relative rotation between the bolt and the bolt carrier . fig3 , 7 , 9 and 11 show only a prior art bolt carrier 50 without the other structures included in a bolt carrier assembly . fig4 , 8 , 10 , and 12 show a preferred embodiment of the improved bolt carrier , shown generally at 60 , of the invention , again without the other structures of a typical bolt carrier assembly . as shown in fig3 , 7 , 9 and 11 and referring particularly to fig3 a typical prior art bolt carrier 50 includes a hammer clearance slot 54 which permits the hammer to extend into the bolt carrier and strike a firing pin ; gas key mounting holes 56 ; gas port 58 ; door opener 62 which provides room for the door latch to close ; and cam slot 64 which functions to allow the bolt to move rearwardly and rotate axially in the carrier . as shown in fig7 one side of the bolt carrier is provided with forward assist notches 74 which are engaged by the forward assist 44 to help place the bolt carrier assembly to the forward battery position . as shown best in fig5 and 6 , a longitudinal bore 52a extends from the forward end 78 of the bolt carrier rearwardly for a distance to accommodate the forward portion of the bolt . a smaller bore 52 , continues for a further distance to accommodate the tail of the bolt . additionally , and as best shown in fig5 and 7 , there is a charging handle contact point 76 . thus far , virtually the same construction features are found in the improved bolt carrier of this invention as shown in fig4 , and 8 . as shown in fig3 , 7 , 9 and 11 , the prior art bolt carrier is provided with a series of four ( 4 ) lands which extend from the forward end 78 of the bolt carrier rearwardly for a distance of about one - half the length of the bolt carrier . in fig3 two ( 2 ) of the lands are shown at 66a and 66b . the third land 66c is shown best in fig7 and the remaining land 66d is shown in fig9 . the same four ( 4 ) lands 66a - 66d are to be found in the improved bolt carrier 60 as shown in fig4 , 8 and 10 . however , as shown in fig4 two ( 2 ) additional lands 68a and 68b along with groove 72 are provided in the top portion of the bolt carrier . additional lands 68c and 68e are best shown in fig8 along with grooves 72 . land 68d is best shown in fig1 . as will be understood from the foregoing description and drawings , the invention provides substantially more area of lands on the exterior surface of the forward end portion of the bolt carrier . in a specific example of the invention , in the prior art bolt carrier , the total length of the carrier is 6 . 675 inches ; its diameter at the front end is about 1 inch ; and the lands extend a distance of about 2 . 75 inches from the forward end 78 of the bolt carrier and are about 0 . 1 inches in width . thus in the prior art bolt carrier the lands occupy about 16 % of the exterior surface of the forward end portion of the bolt carrier . in the improved bolt carrier of the invention , the bolt carrier itself was of the same length and diameter but each of the additional lands 68a - d were about 0 . 11 inches in width and of the same length of the lands in the prior art bolt carrier . land 68e was about 0 . 35 inches by about 0 . 70 inches . thus , in the improved bolt carrier , all of the lands occupied about 35 % of the exterior surface of the forward end portion of the bolt carrier . to obtain the benefits of this invention , the lands should constitute at least about 25 % to about 50 % of the exterior surface of the forward end portion of the bolt carrier , preferably from about 30 % to about 40 % and most preferred about 35 %. fig1 - 15 inclusive show additional embodiments of an improved bolt carrier and in which the side views shown in such figs . are the same as the side views of fig7 and 8 . as shown in fig1 , lands 82 of bolt carrier 70 do not run parallel to the longitudinal axis of the bolt carrier but are positioned at an acute angle to such longitudinal axis ; for example , an angle of about 20 °. lands 82 are generally parallel to each other and separated by grooves 72a . in fig1 , lands 88 of bolt carrier 80 are positioned at about a 90 ° angle to the longitudinal axis of the bolt carrier . again , the lands are generally parallel to each other and separated by groove 72b . in fig1 , lands 98 of bolt carrier 90 are generally rectangular shaped and arranged in a sort of checkerboard pattern on the exterior surface of the forward end of bolt carrier 90 . grooves 72c are positioned so that they are on each of the four sides of lands 98 . | 5 |
illustrative embodiments of the present invention , described below are directed to methods and systems for managing contact information , and in particular , business contact information such as that typically contained on a business card . however , embodiments of the present invention are not limited to methods and systems that manage business contact information , but rather , include methods and systems that manage other information as well . embodiments of the present invention will now be described with reference to fig1 - 3 . fig1 shows a computer system 10 functioning as a contact information management system in accordance with one embodiment of the present invention . the computer system 10 includes a first personal computer 12 , a second personal computer 14 , and a remote computer 16 coupled to a database 18 . the first computer and the second computer are coupled to the remote computer 16 over a network 20 . in one embodiment of the present invention , the network 20 includes the internet , and the remote computer includes a web server and is accessible over the internet . the remote computer has an assigned uniform resource locator ( url ) to allow the personal computers to access the remote computer over the internet . in other embodiments , the first and second personal computers may be coupled to the remote computer over a private dedicated computer network or the first and second personal computers may access the remote computer over a standard telephone line using a modem . in one embodiment , the first computer 12 and the second computer 14 contain a web browser that enables the computers to access the remote computer over the internet using the url of the web site , as is known in the art . in embodiments of the present invention , the web browsers may be implemented using one of several known internet browsers such as navigator ® available from netscape communications , inc ., preferably version 4 . 0 or higher , or internet explorer ® available from microsoft , inc , preferably version 4 . 0 or higher . as shown in fig1 the second personal computer includes a synchronizer 24 and a personal information manager ( pim ) 26 . the pim may be implemented using , for example , one of a number of personal information programs , such as such as microsoft outlook , symantec &# 39 ; s act ! and 3com &# 39 ; s pilot , that allow a user to maintain a database of contact information . the synchronizer may be implemented in embodiments of the present invention using software installed in the second computer . in embodiments of the present invention , the synchronizer may be implemented as a software utility downloadable over the internet from the remote computer 16 . the synchronizer provides synchronization of contact information in the pim with contact information contained in the database 18 . in embodiments of the present invention , the first computer , as well as other computers coupled to the network 20 , may also include a synchronizer and a pim . in addition , in one embodiment , the synchronizer may be located in the remote computer in addition to or in place of the synchronizer in the second computer . also , the synchronizer may be integrated into available pim software . a general method 100 in accordance with one embodiment of the present invention for operating the computer system 10 to implement a contact management system will now be described with reference to fig2 a and 2b . in a first step 110 of the method , a user ( hereinafter user 1 ) of the first personal computer 12 accesses the remote computer over the internet to input business contact information of user 1 or other information that user 1 wishes to store in the database 18 . in response , in step 120 , the remote computer 16 establishes an account for user 1 , stores the contact information for user 1 in the database 18 , and provides a unique identification number for user 1 . in embodiments of the present invention , the database 18 may contain contact information for a number of users each of whom is assigned a unique identification number . in the next step 130 , user 1 ( or a commercial printer selected by user 1 ) prints business cards for user 1 containing the unique identification number , and in step 140 , passes one of the business cards to a second user ( hereinafter user 2 ). in one embodiment , in place of , or in addition to the unique identification number , a bar code , or some other code representative of the unique identification number , may be printed on the business card . fig3 shows a business card 30 used with embodiments of the present invention having a bar code 32 , representative of the identification number , printed on the back , and having the unique identification number 34 , identified as a onepin ™ number , printed on the front and on the back . in embodiments of the present invention , the bar code 32 and / or the unique identification number 34 can be printed at other locations on the business card 30 . in one embodiment of the present invention , a 16 digit number and / or letter combination or any other symbol combination can be used for the unique identification number . the use of 16 digits for the identification numbers provides sufficient unique numbers to allow random assignment of numbers to users with low probability of an unauthorized user guessing the unique identification number of an authorized user . in other embodiments , identification numbers may have more or less digits than 16 . in addition , in embodiments of the present invention one of a number of known check sum schemes is used as part of a verification procedure of identification numbers . in step 150 of the method 100 , user 2 enters the unique identification number of user 1 into the second computer 14 . user 2 can enter the unique identification number by typing the onepin ™ number or by scanning the number into the synchronizer of the second personal computer using a wand , or some other bar code reader , coupled to the second personal computer 14 . user 2 also can type in or scan the onepin number into pim . as discussed below , the identification number is stored in the synchronizer and in the pim of the second personal computer . the synchronizer and the pim may already contain identification numbers for users of the contact management system other than user 1 . in step 160 , the second personal computer 14 makes a request to the remote computer 16 for contact information corresponding to unique identification numbers contained in either the synchronizer or the personal information manager , and in step 170 , the remote computer 16 accesses the database 18 to retrieve data corresponding to the identification numbers contained in the request from user 2 . in step 180 , the information retrieved from the database 18 is sent from the remote computer 16 to the second personal computer 14 , wherein contact information for users corresponding to the unique identification numbers contained in the request in step 150 is updated in the pim . the request provided in step 150 can be for contact information of user 1 or for contact information of several users , each of whom is identified by a unique identification number . users that have been assigned identification numbers may access the database through the remote computer to edit the contact information contained for them in the web database at any time . in the embodiment of the present invention described above , the computer system 100 has only two users , as understood by those skilled in the art , other embodiments of the present invention may include computer systems having many more users than two , and the web database may contain contact information for a large numbers of users . the architecture of the computer system 10 in accordance with one embodiment of the present invention will now be described in further detail . the remote computer 16 includes a web server 21 to provide access to the internet and includes a database server 23 to provide access to the database 18 . the remote computer also includes application specific software modules 25 that implement functions of the computer system 10 in conjunction with the web server and the database server . the web server 21 , the database server 23 , and the software modules 25 may be contained within one computer or may be installed in separate networked computers that together comprise the remote computer 16 . in a preferred embodiment , the operating system used for the computer or computers comprising the remote computer is microsoft &# 39 ; s windows nt ® operating system . in this preferred embodiment , the web server is implemented using microsoft &# 39 ; s internet information server ( iis ), version 4 . 0 or higher , and the database server is implemented using microsoft &# 39 ; s sql server , version 6 . 5 or higher . the web server includes application specific active server pages to implement functionality of systems and methods of the present invention . in addition , in this preferred embodiment , the software modules 25 contain software code written in object oriented programming paradigm . in one embodiment , this includes an n - tiered architecture with a database layer including interfaces and stored procedures ; a middle ware layer including ms com models , javabeans , and third party languages ; and a client interface layer using javascript , dhtml , pear and asp . the steps of method 100 described above , as well as additional functions that may be implemented in contact information management methods and systems of the present invention , will now be described in further detail . fig4 a - 4c provide a flow chart of a registration procedure 200 of the remote computer 16 that allows a user , such as user 1 , to register with a contact information management system of the present invention . in a first step 202 of the procedure 200 , the system asks the user to provide a registration type . in embodiments of the invention , a variety of registration types may be used to distinguish a number of different services and / or payment plans that are available to users . for example , in one embodiment , there are different registration types for professionals , corporations , individuals , and children . after the user selects a registration type , in step 204 , the system asks the user to input contact data . the contact data includes , for example , the user &# 39 ; s name , telephone numbers , facsimile numbers , pager number , home address , business address , employer , title , e - mail address , and any other information the user wishes to make available to other users of the contact information management system . once the contact information is entered , then in step 206 the system attempts to determine whether the user has previously registered with the system . in one embodiment , the system makes this determination by scanning the database for names matching that input by the user , and if any matching names are found , the system compares the e - mail address of the user with the matching name with that input by the user to determine if a duplicate entry has been made . if the system determines that a duplicate entry has been made , then the registration process 200 terminates and the system performs a user verification process . the user verification process allows a prior - registered user who has forgotten his / her password to verify their identify and change their password . in one embodiment , the user is requested to enter either their mother &# 39 ; s maiden name or the last four digits of their social security number to verify their identity . once their identity has been verified , the user is allowed to change their password . the user verification process allows users who have forgotten their passwords to access the system without creating unwanted , and memory consuming duplicate entries . if in step 206 a duplicate entry is not found , then in step 208 , the user is asked to establish a password , selected by the user , by entering the password twice . in step 210 , the system determines whether the user entered the same password twice . if the outcome of step 210 is “ no ”, then in step 212 , a warning message is provided to the user and the process then returns to step 208 . if the outcome of step 210 is “ yes ”, then the password entered by the user is assigned to the user . the process continues with step 214 , wherein account preferences are established for the user . in one embodiment , account preferences are established using a process 300 which will now be described with reference to fig5 . in a first step 302 of the process 300 , the system queries the user as to whether the user wishes to allow public access to the user &# 39 ; s contact information . if the response to the query in step 302 is “ no ”, then a private access flag is set on for the user in step 304 , and the process continues with step 306 . if the response to the query in step 302 is “ yes ” then process 300 proceeds directly to step 306 . in step 306 , the system queries whether the user wishes to allow access to the user &# 39 ; s contact information by all registered users of the contact management system . if the response to the query in step 306 is “ no ”, then a limited access flag is set on for the user in step 308 , and in step 310 , the user is asked to enter a list of identification numbers of privileged users that will be allowed access to the user &# 39 ; s contact information . process 300 then continues with step 312 . if the response to the query in step 306 is “ yes ” then process 300 proceeds directly to step 312 . in step 312 , the system queries whether the user wishes to block access to the user &# 39 ; s contact information by any specific registered users . if the response to the query in step 312 is “ yes ”, then a blocked access flag is set on for the user in step 314 , and in step 316 , the user is asked to enter a list of identification numbers of blocked users that will be denied access to the user &# 39 ; s contact information by the system . process 300 then continues with step 318 . if the response to the query in step 306 is “ no ” then process 300 proceeds directly to step 318 . in step 318 of process 300 , the system queries whether the user wishes to allow other users to search for his account to receive contact information using the user &# 39 ; s unique identification number . if the response to the query in step 318 is “ no ”, then in step 320 , a “ no - search by id ” flag is set indicating that the user &# 39 ; s account is not retrievable using an identification number search , and the process continues with step 322 . if the response to the query in step 318 is “ yes ” then process 300 proceeds directly to step 322 . in step 322 of process 300 , the system queries whether the user wishes to allow other users to search for the user &# 39 ; s account to retrieve contact information using the user &# 39 ; s name . if the response to the query in step 322 is “ no ”, then in step 324 , a “ no - search by name ” flag is set indicating that the user &# 39 ; s account is not retrievable using a name search , and process 300 ends . if the response to the query in step 318 is “ yes ” then process 300 ends . as understood by one skilled in the art , in step 214 of process 200 , account preferences may be set for a user using a process other than process 300 . further , in other embodiments , users may be requested to select other preferences , either in addition to or in place of , the preferences selected in process 300 . after the user &# 39 ; s account preferences are set in step 214 of process 200 , a unique identification number is assigned for the user in step 216 . in one embodiment , the unique identification number is assigned by randomly selecting an identification number from a pool of available identification numbers . after an identification number is assigned to a user , it is removed from the pool of available identification numbers . as discussed above , in one embodiment , the pool of available identification numbers includes 16 digit numbers that satisfy a check sum criteria . process 200 continues with step 218 , wherein the system displays an account profile of the user . in one embodiment , the account profile includes a listing of the account preferences selected by the user and the user &# 39 ; s unique identification number . next , in step 220 , the user is asked if the profile is acceptable . if the response to step 220 is “ yes ”, then the process continues on with step 222 . if the response to step 220 is “ no ”, then the process 200 returns to step 214 to allow the user to input new account preferences . in step 222 of process 200 , the system displays billing information for the user , and in step 224 , the user is asked if the billing information is acceptable . in one embodiment , the billing information displayed in step 222 includes customized billing information for the user based on the type of registration selected in step 202 and based on the account preferences selected by the user . in step 224 , the user is asked to accept charges for use of the contact information management system based on the billing information displayed in step 222 . if the outcome of step 224 is “ yes ”, then in step 226 , the user is requested to provide information for a credit card to be used by the user to pay the charges . if the outcome of step 224 is “ no ”, then in step 223 , the user is asked if they would like to exit the system . if the outcome of step 223 is “ no ”, then the process returns to step 222 . if the outcome of step 223 is “ yes ”, then in step 225 , the entry for the user is deleted , and in step 225 , the process ends . in step 228 , the system determines whether the credit card is valid using one of a number of known procedures . if the outcome of step 228 is “ no ,” indicating that the credit card is not valid , then in step 230 a warning indicating invalid card entry is displayed , and process 200 returns to step 226 . in one embodiment , after a predetermined number of unsuccessful attempts by a user to enter a valid credit card number , process 200 ends . if the outcome of step 228 is “ yes ,” indicating that the credit card entered is valid , then the process 200 continues with step 232 , wherein the charges are applied to the user &# 39 ; s credit card . the system then displays a message “ receipt e - mailed ” and sends an e - mail to the user to provide a receipt of the credit card transaction . next , in step 236 of process 200 , the system generates a display to ask if the user would like a file containing a bar code corresponding to the user &# 39 ; s assigned unique identification number to be downloaded to the user &# 39 ; s computer . if the response to the query in step 236 is “ yes ,” then in step 238 , the system creates and downloads to the user &# 39 ; s computer a file containing the bar code . in one embodiment , the file containing the bar code is an encapsulated postscript file , however , other file formats could be used as well . after downloading the file , process 200 proceeds to step 240 . if the response to the query in step 236 is “ no ,” then the process continues with step 240 , wherein a message “ registration completed ” is displayed . process 200 terminates after step 240 . after a user has registered with contact information management systems of the present invention , the user can subsequently access the remote computer 16 to edit the contact data stored for the user or to check on account activity for the user &# 39 ; s account established with the contact information management system . a process 400 for accessing the remote computer 16 in accordance with one embodiment of the present invention will now be described with reference to fig6 . in a first step 402 of the process 400 , the user is asked to input the user &# 39 ; s name and password . next in step 404 , the system verifies the name and password of the user . if the output of step 404 is “ no ,” indicating that the system was not able to verify the entered name and password , then in step 406 , the system generates a display “ wrong entry .” the process 400 then returns to step 402 . if the output of step 404 is “ yes ,” indicating that the system was able to verify the entered name and password , then the process continues with step 408 . in step 408 , the system displays a profile for the user . in one embodiment , the information displayed in step 408 is the same as that displayed in step 218 of process 200 . the system then queries whether the user would like to check account activity in step 410 . if the response to the query in step 410 is “ yes ,” then in step 416 , the system displays a list showing dates of access to the user &# 39 ; s contact data by other users of the contact information management system . the process 400 then continues with step 412 . if the response to the query in step 410 is “ no ,” then the process 400 proceeds with step 412 . in step 412 , the system queries whether the user would like to change the user &# 39 ; s profile . if the response to the query in step 412 is “ yes ,” then in step 414 , the user repeats portions of the registration process 200 to change profile data of the user . if the response to the query in step 412 is “ no ,” then process 400 ends . the operation of the synchronizer in the second personal computer 14 of the computer system 10 will now be further described with reference to fig7 which shows a flow chart of a synchronization process 500 . the synchronization process 500 allows a user ( user 2 ) to obtain and update data for registered users of the contact management system using the unique identification numbers of the registered users . in a first step 510 of the process 500 a user identification number of user 1 is input into the synchronizer of the second computer . as described above , the identification number can be input into the synchronizer using a bar code reader , by typing the number in using a keyboard , or using other data entry techniques . in step 520 , the synchronizer determines whether a valid identification number has been entered into the synchronizer . as discussed above , in some embodiments of the present invention , a check sum scheme is used for the identification numbers , and this scheme can be used in step 520 to verify numbers entered . if the outcome of step 520 is “ no ” indicating that the number entered is not a valid identification number , then in step 522 an error message is displayed , and the process returns to step 510 . if the outcome of step 520 is “ yes ”, then the process 500 continues with step 524 , wherein the system checks whether the identification number entered into the system is already stored in a synchronizer list in the synchronizer . if the outcome of step 524 is “ yes ,” then in step 526 a warning message is displayed , and the process returns to step 520 . if the outcome of step 524 is “ no ,” then in step 528 , the identification number is added to the synchronization list . the synchronizer then connects to the database through the remote computer to obtain contact information of user 1 and to update contact information of other users whose identification number is contained in the synchronizer list . next , in step 532 , the synchronizer selects one identification number from the synchronizer list , and in step 534 , an account preferences subroutine is conducted for the identification number selected in step 532 . the account preferences routine reviews preferences established by the user corresponding to the identification number selected in step 532 to determine whether user 2 should be allowed access to the contact information . one embodiment of an account preferences subroutine 600 used with process 500 will now be described with reference to fig8 . in a first step 602 of the process 600 , a determination is made as to whether the private access flag has been set on for the identification number . if the outcome of step 602 is “ yes ,” then in step 604 , a determination is made as to whether user 2 is a registered member of the contact information management system . if the outcome of step 604 is “ no ,” then the process 600 proceeds to step 606 , wherein a message “ requested data is not available ” is sent to user 2 . process 600 then returns to step 538 of process 500 . if the outcome of step 604 is “ yes ,” or if the outcome of step 602 is “ no ,” then the process 600 continues with step 608 . in step 608 , a determination is made as to whether the limited access flag has been set on for the identification number . if the outcome of step 608 is “ yes ,” then in step 610 , a determination is made as to whether user 2 is on an access list established by user 1 . if the outcome of step 610 is “ no ,” then the process 600 proceeds to step 612 , wherein a message “ requested data is not available ” is sent to user 2 . process 600 then returns to step 538 of process 500 . if the outcome of step 610 is “ yes ,” or if the outcome of step 608 is “ no ,” then the process 600 continues with step 614 . in step 614 , a determination is made as to whether the blocked access flag has been set on for the identification number . if the outcome of step 614 is “ yes ,” then in step 616 , a determination is made as to whether user 2 is on a blocked access list established by user 1 . if the outcome of step 616 is “ yes ,” then the process 600 proceeds to step 618 , wherein a message “ requested data is not available ” is sent to user 2 . process 600 then returns to step 538 of process 500 . if the outcome of either step 614 or step 616 is “ no ,” then the process 600 ends and process 500 continues with step 536 . in step 536 of process 500 , contact information for the user corresponding to the identification number selected in step 532 is downloaded to the second computer wherein it is stored in the pim of the second computer . next , in step 538 , the process returns to step 532 wherein a next identification number in the synchronizer list is selected . process 500 continues with steps 532 to 538 until contact information for all identification numbers in the synchronizer list has been downloaded to the second computer . in one embodiment of the present invention , a copy of all unique numbers in the synchronizer may also be stored in the remote database and be accessible by user 2 through an “ account login ” screen of the remote computer . this allows user 2 to access the remote computer and remote database from a computer other than the second computer to obtain contact information . in some embodiments of the present invention , both the synchronizer and the database maintain an update log indicating the last time that contact information for a user has been updated . the update log in the database indicates the last time that the user edited his contact information in the database , and the update log in the synchronizer indicates the last time that the contact information in the pim for the user has been updated . in these embodiments , contact information for a first user is not updated in the pim of a second user unless the date in the update log of the database is more recent than the date in the update log of the synchronizer of the second user . in embodiments of the present invention , users can utilize the synchronizer to periodically update contact information in the pim . in one embodiment , the synchronizer is configured to automatically contact the remote computer and database on a periodic basis to update information in the pim . in this embodiment , the synchronizer can access the remote computer over the internet using the web browser in the personal computer in a manner that is substantially transparent to a user of the personal computer . embodiments of the present invention discussed above provide an electronic personal contact information management system that allows users of the system to easily maintain up - to - date contact information on other users of the system . in embodiments of the present invention described above , a user of the system uses business cards having the user &# 39 ; s unique identification number encoded thereon to pass the user &# 39 ; s unique identification number to other users . in other embodiments , the user &# 39 ; s unique identification number may be contained on documents other than business cards such as on letterhead for the user &# 39 ; s business or on a user &# 39 ; s resume , and may also be contained within e - mails and other electronic documents such as a card . in other embodiments , identification numbers may be used in management systems of the present invention to manage the ordering of replacement parts in industries such as the automotive industry . in still other embodiments , known numbering systems , such as the isdn numbering scheme used to identify books , may be used with systems of the present invention to allow users to update information related to books or other items . the methods and systems of embodiments of the present invention described above allow users to communicate business contact information to other users . other embodiments of the present invention may be used in a similar manner to allow users to communicate personal contact information to friends and acquaintances . in still other embodiments , businesses may use contact information systems of the present invention to provide customers , vendors , or others with contact information regarding a particular position within the business . for example , a unique identification number may be assigned to a business &# 39 ; s sales manager , and the unique identification number may be included on the sales manager &# 39 ; s business card . customers of the business may include the identification number of the sales manager in a synchronizer and / or pim as described above and the customers can receive and update contact information of the sales manager . if a new sales manager is appointed by the company to replace the existing sales manager , then the contact information for the sales manager position in the system database can be updated to include the new sales manager &# 39 ; s name . the name of the sales manager in the customer &# 39 ; s pim will be updated upon the next synchronization by the customer with the system database . having thus described at least one illustrative embodiment of the invention , various alterations , modifications and improvements will readily occur to those skilled in the art . such alterations , modifications and improvements are intended to be within the scope and spirit of the invention . accordingly , the foregoing description is by way of example only and is not intended as limiting . the invention &# 39 ; s limit is defined only in the following claims and the equivalents thereto . | 8 |
the terminology used herein should be interpreted in its broadest reasonable manner , even though it is being utilized in conjunction with a detailed description of a certain specific preferred embodiment of the present invention . this is further emphasized below with respect to some particular terms used herein . any terminology that the reader should interpret in any restricted manner will be overtly and specifically defined as such in this specification . the preferred embodiment of the present invention will now be described with reference to the accompanying drawings , wherein like reference characters designate like or similar parts throughout . as mentioned in the summary of invention , the invention is comprised of three major sub - assemblies . these include the power drive and electronics control box system ( fig1 , 3 and 5 ), the conveyor track system ( fig1 , 2 , and 3 ) and the saddle nut with hanging carrier system ( fig1 , 3 and 4 ). each sub - system will be described in kind . the power drive and electronics control box 1 ( as shown in fig1 , 3 ) and the power drive and electronic control box cover 5 ( as shown in fig1 , 2 ) house the power drive motor 7 ( as shown in fig2 , 5 ), the gear reduction 8 ( as shown in fig2 , 5 ) and the control circuit board 9 ( as shown in fig2 ), which provides the operational logic for the device . the control logic circuit board 9 ( as shown in fig2 ) and the power drive motor 7 ( as shown in fig2 , 5 ) and the gear reduction 8 ( as shown in fig2 , 5 ) are located and attached to the inside of the power drive and electronics control box 1 ( as shown in fig1 , 3 ). the control logic circuit board 9 ( as shown in fig2 ) is wired to the power drive motor 7 ( as shown in fig2 , 5 ) and is connected to the vehicle &# 39 ; s power system through a fused circuit . additionally , the control logic circuit board 9 ( as shown in fig2 ) is connected to the two limit switches 6 , 12 ( as shown in fig1 , 2 ) as well as the start / stop button , located elsewhere in the vehicle , for operational control input . a removable power drive and electronics control box cover 5 ( as shown in fig1 ) is attached to the bottom of the power drive and electronics control box 1 ( as shown in fig1 , 3 ) with four counter sunk screws located in each corner . this seals the power drive electronic control box 1 ( as shown in fig1 , 3 ) from all access and outside elements . the power drive and electronics control box 1 ( as shown in fig1 , 3 ) is mounted to the end of the conveyor track 2 ( as shown in fig1 , 3 ) using counter sunk screws located inside the power drive and electronics control box wall , and provide proper registration of the power drive motor shaft 17 ( as shown in fig5 ) with the lead screw coupling 10 ( as shown in fig2 , 4 ). there may be from one to several start / stop buttons provided . these buttons are simple normally open contact buttons used to either start or stop the operation of the device . the start / stop button is wired to the control logic circuit board 9 ( as shown in fig2 ) located in the power drive and electronics control box 1 ( as shown in fig1 , 3 ). when more then one button is used they are to be wired in parallel . as the name implies , this button , when pressed , will either start or stop the operation of the device . the control logic circuit board 9 ( as shown in fig2 ) provides electronic circuitry that will control the operation of the power drive motor 7 ( as shown in fig2 , 5 ) and gear reduction 8 ( as shown in fig2 , 5 ) through the input from either limit switches 6 , 12 ( as shown in fig1 , 2 ) or start / stop buttons . both the limit switches 6 , 12 ( as shown in fig1 , 2 ) and the start / stop buttons are wired to the control logic circuit board 9 ( as shown in fig2 ). when either of the limit switches 6 , 12 ( as shown in fig1 , 2 ) or a start / stop button is closed , the control logic circuit board 9 ( as shown in fig2 ) will stop the power drive motor 7 ( as shown in fig2 , 5 ) and gear reduction 8 ( as shown in fig2 , 5 ) if currently running . if the start / stop button is pressed while the power drive motor 7 ( as shown in fig2 , 5 ) and gear reduction 8 ( as shown in fig2 , 5 ) is stopped , the device will start and the saddle nut 4 ( as shown in fig1 , 3 , 4 ) will move in the opposite direction it was last stopped in . this allows the device to be started and stopped at any point in its travel as well as automatically stopping when the saddle nut 4 ( as shown in fig1 , 3 , 4 ) arrives at either limit switch 6 , 12 ( as shown in fig1 , 2 ) located at the ends of the conveyor track 2 ( as shown in fig1 , 3 ). the conveyor track 2 ( as shown in fig1 , 3 ) is the principal element in this design . it provides housing for the linear motion device , in this case an acme lead screw 11 ( as shown in fig2 , 4 ) and saddle nut 4 ( as shown in fig1 , 3 , 4 ). it also holds one of the two limit switches 6 , 12 ( as shown in fig1 , 2 ) used to stop the power drive 7 ( as shown in fig2 , 5 ) and gear reduction 8 ( as shown in fig2 , 5 ) when the saddle nut 4 ( as shown in fig1 , 3 , 4 ) reaches the end of the conveyor guide rail 2 ( as shown in fig1 , 3 ). the conveyor track 2 ( as shown in fig1 , 3 ) can be made from an extruded composite material that provides a minimum amount of conformity to irregular mounting surfaces . the acme lead screw 11 ( as shown in fig2 , 4 ) is comprised of a self - lubricating composite material such as ultra high molecular weight polyethylene ( uhmw - pe ). this material also allows the acme lead screw 11 ( as shown in fig2 , 4 ) to conform to irregular curves in the above - mentioned conveyor track 2 ( as shown in fig1 , 3 ). the conveyor track 2 ( as shown in fig1 , 3 ) provides the housing for the acme lead screw 11 ( as shown in fig2 , 4 ) and the saddle nut 4 ( as shown in fig1 , 3 , 4 ). it also provides locations for the limit switches 6 , 12 ( as shown in fig1 , 2 ), limit switch end cap 3 ( as shown in fig1 , 3 ), the power drive and electronics control box 1 ( as shown in fig1 , 3 ) and device &# 39 ; s mounting holes 13 ( as shown in fig1 , 2 ). an end cap 3 ( as shown in fig1 , 2 , 3 ) is pressed into and attached to the opposite end of the conveyor track 2 ( as shown in fig1 , 3 ) from the power drive and electronics control box 1 ( as shown in fig1 , 3 ). this end cap 3 ( as shown in fig1 , 2 , 3 ) also centers the acme lead screw 11 ( as shown in fig2 , 4 ) in the conveyor track 2 ( as shown in fig1 , 3 ) as well as provides a mounting place for the end - limit switch assembly 12 ( as shown in fig1 , 2 ). there are two limit switches 6 , 12 ( as shown in fig1 , 2 ) used to automatically stop the movement of the saddle nut 4 ( as shown in fig1 , 3 , 4 ) when it arrives at either end of the conveyor track 2 ( as shown in fig1 , 2 , 3 ). these limit switches 6 , 12 ( as shown in fig1 , 2 ) are wired to the control logic circuit board 9 ( as shown in fig2 ) to provide for automatic stopping of the device . additionally , a traveler button spring 12 ( as shown in fig1 , 3 ) is located in the limit switch end cap 3 ( as shown in fig1 , 3 ) to provide a compressible action for the end - limit switch 12 ( as shown in fig1 , 3 ). this traveler button spring 12 ( as shown in fig1 , 3 ) provides relief between the switch closure 12 ( as shown in fig1 , 2 ) and the stopping of the saddle nut 4 ( as shown in fig1 , 3 , 4 ) movement . another limit switch 6 ( as shown in fig1 , 2 ) is mounted into the conveyor track 2 ( as shown in fig1 , 3 ) just short of the power drive and electronics control box 1 ( as shown in fig1 , 3 ). this limit switch assembly 6 ( as shown in fig1 , 2 ) consists of a micro - switch with a traveler spring arm 6 ( as shown in fig1 , 2 ) that passes through the channel that the saddle nut 4 ( as shown in fig1 , 3 , 4 ) travels through . this micro - switch with a traveler spring arm 6 ( as shown in fig1 , 2 ) provides some timing relief between the switch closure 6 ( as shown in fig1 , 2 ) and the stopping of the saddle nut 4 ( as shown in fig1 , 3 , 4 ) movement . the acme lead screw 11 ( as shown in fig2 , 4 ) is affixed to the power drive motor shaft 17 ( as shown in fig5 ) using a fixed coupling and a socket head setscrew located in the lead screw coupling 10 ( as shown in fig2 , 4 ). this setscrew affixes the acme lead screw 11 ( as shown in fig2 , 4 ) to the power drive motor shaft 17 ( as shown in fig5 ) by tightening to the surface of a weldon flat located on one side of the power drive motor shaft 17 ( as shown in fig5 ). the acme lead screw 11 ( as shown in fig2 , 4 ) is captured inside the conveyor track cavity 2 ( as shown in fig1 , 3 ) and held in place by the limit switch end cap 3 ( as shown in fig1 , 3 ), power drive motor shaft 17 ( as shown in fig5 ) and the saddle nut 4 ( as shown in fig1 , 3 , 4 ). the acme lead screw 11 ( as shown in fig2 , 4 ) is driven in either direction by the power drive motor 7 ( as shown in fig2 , 5 ) and gear reduction 8 ( as shown in fig2 , 5 ) located in the power drive and electronics control box 1 ( as shown in fig1 , 3 ). the functional mechanism of the invention is the saddle nut 4 ( as shown in fig1 , 3 , 4 ), which rides along an acme lead screw 11 ( as shown in fig2 , 4 ). the saddle nut 4 ( as shown in fig1 , 3 , 4 ) is threaded onto the acme lead screw 11 ( as shown in fig2 , 4 ) and travels the length of the acme lead screw 11 ( as shown in fig2 , 4 ) until contact with either limit switch 6 , 12 ( as shown in fig1 , 2 ) located in the conveyor track 2 ( as shown in fig1 , 3 ) or in the limit switch end cap 3 ( as shown in fig1 , 3 ). using a gear reduction 8 ( as shown in fig2 , 4 ) between the motor and lead screw ( as shown in fig1 , 2 , 4 ) allows the reduction in the rpm of the motor to a more useful rotational speed and provides an increased amount of torque . the saddle nut 4 ( as shown in fig1 , 3 , 4 ) is captured between the inside cavity of the conveyor track 2 ( as shown in fig1 , 3 ) and the acme lead screw 11 ( as shown in fig2 , 4 ). a saddle nut flange 4 ( as shown in fig1 , 3 , 4 ) is allowed to protrude through a slot , which runs the length of the conveyor track 2 ( as shown in fig1 , 3 ), and provides access between the acme lead screw 11 ( as shown in fig2 , 4 ) cavity and the outside hanger hook holes 4 ( as shown in fig1 , 3 , 4 ). the carrier 14 ( as shown in fig1 , 6 ) is a simple wire framed basket outfitted with two hanger hooks 15 ( as shown in fig6 ) that allow it to be hung from the saddle nut 4 ( as shown in fig1 , 3 , 4 ). the carrier 14 ( as shown in fig1 , 6 ) is used to transport items from one end of the device to the other . this is only one of many types of containers that may be affixed to the device &# 39 ; s saddle nut . other types may include coat hangers , mesh bags with drawstrings , or carabineers attached to any type of container whose contents weigh a minimal amount . the basket 14 ( as shown in fig1 , 6 ) is made from a wire mesh and comprises a pair of hanger handles , which capture a pair of hanger hooks 15 ( as shown in fig6 ). the two basket hanger hooks are placed through two hanger hook holes located in the sides of the saddle nut flange 4 ( as shown in fig1 , 3 , 4 ). the operational control of the invention is similar to that of a common garage door opener . pushing any of the start / stop buttons will initiate the invention to move the carrier and its contents in the direction away from either end of the conveyor track 2 ( as shown in fig1 , 3 ). when the carrier 14 ( as shown in fig1 , 6 ) reaches the opposite end of the conveyor guide rail the device will automatically stop . upon pressing the start / stop button the carrier 14 ( as shown in fig1 , 6 ) will move back to the opposite end of the conveyor track 2 ( as shown in fig1 , 3 ). the start / stop button may also be used to stop the travel of the carrier 14 ( as shown in fig1 , 6 ) at any point in its cycle . when pressed again after stopping , it will resume in the opposite direction and return back to its starting point unless the start / stop button is yet again pressed . installation of the device is simple . the device is affixed to the roof liner of the vehicle using small screws located at the rib points in the vehicles roof . power for the device may be obtained from the vehicles electrical system by tapping into the fuse box . the device may share the same fuse with the vehicles widow wipers or other comparable systems that use a fused circuit . the invention is also designed such that it may be customized to the correct length as needed in any given vehicle by removing the guide rail limit switch end cap 3 ( as shown in fig1 , 3 ) and trimming the non - power drive end of the conveyor track 2 ( as shown in fig1 , 3 ) and acme lead screw 11 ( as shown in fig2 , 4 ). the foregoing description details certain preferred embodiments of the present invention and describes the best mode contemplated . it will be appreciated , however , that no matter how detailed the foregoing description appears , the invention can be practiced in many ways without departing from the spirit of the invention . therefore , the description contained in this specification is to be considered exemplary , rather than limiting , and the true scope of the invention is only limited by the following claims and any equivalents thereof . | 1 |
in the following description , numerous details are set forth to provide a more thorough explanation of embodiments of the present invention . it will be apparent , however , to one skilled in the art , that embodiments of the present invention may be practiced without these specific details . in other instances , well - known structures and devices are shown in block diagram form , rather than in detail , in order to avoid obscuring embodiments of the present invention . reference in the specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification do not necessarily all refer to the same embodiment . according to certain embodiments of the invention , a usb storage device such as a usb flash device includes a dual personality extended usb plug which includes a metal case , and a connector substrate in multiple different form factors that can be coupled to a pcba ( printed circuit board assembly ) having a flash memory such as multi - level cell ( mlc ) flash memory and a flash controller ic ( integrated circuit ) or a mlc chip - on - board ( cob ) design . fig4 a - 4b are diagrams illustrating perspective views of a usb extended plug having multiple personalities according to one embodiment of the invention . referring to fig4 a , a usb extended plug is showed in a complete view 401 and an exploded view 402 . in one embodiment , usb extended plug 400 includes a casing or housing 403 and a usb connector substrate 404 , where the connector substrate 404 can be plugged into the casing 403 . casing 403 may be made of metal , also referred to as a metal case herein . connector substrate 404 includes a first end having multiple electrical contact fingers or tabs 405 and a second end having multiple electrical contact pins 407 . in a particular embodiment , pins 407 include 9 or more pins . connector substrate 404 further includes one or more springs or metal contacts 406 which may be used to provide pressure to another usb connector to have physical contact with contact fingers 405 when the other usb connector is inserted into an opening of the extended usb plug . in one embodiment , contact fingers 405 may be disposed on a top surface of connector substrate 404 and additional contact fingers ( not shown ) may be disposed on a bottom surface of connector substrate 404 . for example , contact fingers 405 may be compatible with standard usb specification while the additional contact fingers may be designed compatible with other interfaces such as pci express or ieee 1349 specifications . as a result , extended usb plug 400 may be used for multiple different communication interfaces , also referred to as dual personalities . further detailed information regarding the extended usb plug having dual personalities can be found in certain above - referenced applications and / or patents , such as , for example , u . s . pat . no . 7 , 021 , 971 and u . s . patent application ser . no . 11 / 864 , 696 , which have been incorporated by reference . referring now to fig4 b , where extended usb plug 400 may be attached to a pcba having a memory device and a memory controller for controlling the memory device . as shown in fig4 b as top view 408 , side view 409 , and bottom view 410 , extended usb plug 400 may be attached to pcb substrate 411 , for example , by soldering pins 407 on the pcb substrate 411 . in addition , a memory device such as flash memory device may be disposed on a surface of the pcb substrate 411 and a memory controller such as a flash controller may be disposed on the other surface of the pcb substrate 411 . in this example , memory device 415 is disposed on a bottom surface 413 of pcb substrate 411 and memory controller 414 is disposed on a top surface 412 of pcb substrate 411 . in one embodiment , memory device 415 may be an mlc compatible memory ic and controller 414 may be an mlc compatible memory controller ic . according to a further embodiment , techniques as described with respect to fig4 a - 4b may also be applied to a configuration where a flash memory and a flash controller are integrated into a single package such as a chip on board ( cob ) package as shown in fig4 c . referring to fig4 c , a cob package 416 , which may an mlc package , may be disposed on a surface such as a top surface 412 of pcb substrate 411 , where the cob package 416 may be attached ( e . g ., soldered ) via one or more contact fingers 417 disposed on a surface of cob 416 . cob 416 may be any of the cob packages such as , for example , as those shown in fig6 a - 6b . fig5 a and 5b are diagrams illustrating perspective views of a usb extended plug having multiple personalities according to another embodiment of the invention . referring to fig5 a , a usb extended plug is showed in a complete view 501 and an exploded view 502 . in one embodiment , similar to extended usb plug 400 of fig4 a - 4b , extended usb plug 500 includes a casing or housing 503 and a usb connector substrate 504 , where the connector substrate 504 can be plugged into the casing 503 . casing 503 may be made of metal , also referred to as a metal case herein . connector substrate 504 includes a first end having multiple electrical contact fingers or tabs 505 and a second end having multiple electrical contact pins 507 . in one embodiment , pins 507 include multiple rows of pins , each having multiple pins . in a particular embodiment , pins 507 include a first row and a second row , where the first row includes 5 pins and the second row includes 4 or more pins . connector substrate 504 further includes one or more springs or metal contacts 506 which may be used to provide pressure to another usb connector to have physical contact with contact fingers 505 when the other usb connector is inserted into an opening of the extended usb plug . in one embodiment , similar to extended usb plug 400 , contact fingers 505 may be disposed on a top surface of connector substrate 504 and additional contact fingers ( not shown ) may be disposed on a bottom surface of connector substrate 504 . for example , contact fingers 505 may be compatible with standard usb specification while the additional contact fingers may be designed compatible with other interfaces such as pci express or ieee 1349 specifications . as a result , extended usb plug 500 may be used for multiple different communication interfaces , also referred to as dual personalities . referring now to fig5 b , where extended usb plug 500 may be attached to a pcba having a memory device and a memory controller for controlling the memory device . as shown in fig5 b as top view 508 , side view 509 , and bottom view 510 , extended usb plug 500 may be attached to pcb substrate , for example , by soldering pins 507 on the pcb substrate . in this example as shown in side view 509 , the first row of pins 507 may be soldered on a top surface of the pcb substrate while the second row of pins 507 may be soldered on a bottom surface of the substrate , or vice versa . in addition , a memory device such as flash memory device may be disposed on a surface of the pcb substrate and a memory controller such as a flash controller may be disposed on the other surface of the pcb substrate . in this example , similar to the configuration as shown in fig4 a - 4b , a memory device is disposed on a bottom surface of pcb substrate and a memory controller is disposed on a top surface of pcb substrate . further , the memory device may be an mlc compatible memory ic and the controller may be an mlc compatible memory controller ic . similarly , according to a further embodiment , techniques as described with respect to fig5 a - 5b may also be applied to a configuration where a flash memory and a flash controller are integrated into a single package such as a chip on board ( cob ) package as shown in fig5 c , where a cob package may be any of the cob packages such as , for example , as those shown in fig6 a - 6b . other configurations may also exist . according to certain embodiments of the inventions , certain form factors as described above with respect to fig4 - 6 can also be utilized in an embedded configuration , for example , embedded within an ordinary computer chassis as a usb component . fig1 a - 14 c are block diagrams illustrating certain configurations of an extended usb device according to certain embodiments of the invention . referring to fig1 a , an embedded usb flash drive or ready boost drive is to use with a mlc dual - personality extended usb header vertical receptacle 1401 . the usb header vertical receptacle 1401 may include a 9 - pin socket that is compatible with an ordinary socket or connector used in an ordinary computer . in this example as shown in fig1 a , usb header vertical receptacle 1401 includes two rows of pins 1402 - 1403 , each having five pins . one of the rows 1402 - 1403 , in this example , row 1402 only includes 4 pins , leaving one of the plugs 1404 unattached . as a result , a total of 9 pins are implemented in this example , where functionality of each pin is shown in table 1405 . note that the usb header vertical receptacle 1401 is shown for illustration purposes only ; other forms of receptacles may also be implemented . according to one embodiment , as shown in fig1 b , each of the rows 1402 - 1403 may be mounted or soldered on corresponding electrical contact pads of a surface of a pcba , for example , one for each of top and bottom surfaces of the pcba , where a pcba may be any of the above configurations . for example , referring to fig1 b , usb header vertical receptacle 1401 is mounted onto a pcba 1400 having a mlc controller 1409 and one or more mlc memory ics 1410 - 1411 , which may be mounted ( e . g ., surface mounted ) on a top surface 1407 and a bottom surface 1408 of pcb 1406 . as described above , the usb header vertical receptacle 1401 include two rows of pins , each being mounted on a surface ( e . g ., top or bottom surfaces ) of pcb 1406 . as a result , the orientation of plugs of usb header vertical receptacle 1401 is in a direction parallel with the top and bottom surfaces 1407 - 1408 of pcba 1400 , which would enable the finished usb package to be mounted on ( e . g ., via a corresponding connector , in this example , a male connector of ) a chassis such as a motherboard of a computer in a vertical orientation with respect to a surface of the motherboard . alternatively , as shown in fig1 c , the pcba may be implemented as a cob package 1416 mounted on a top surface 1417 of a pcb substrate 1415 , for example , by surface mounting one or more metal pads 1418 on the pcb substrate 1415 . the cob package 1416 may be implemented a traditional cob 1420 having one row of metal contact pads 1423 or alternatively , an extended cob 1419 having two rows of electrical contact pads 1421 - 1422 , similar to those configurations described above . the above usb devices may be assembled in a variety of usb drive form factors . fig1 a - 15c are block diagrams illustrating certain configurations of an extended usb drive according to certain embodiments of the invention . referring to fig1 a , the structure of a ubs flash drive 1500 includes a top housing 1501 and a bottom housing 1502 for enclosing a usb device 1400 using a snap - together method or apply ultrasonic press for sealing around edges 1503 of housing . the usb device 1400 may include a pcba 1406 coupled to an extended usb header vertical receptacle 1401 . the usb flash drive 1500 is coupled with a motherboard inside a computer chassis by way of 9 - pin header receptacle 1401 and a plug . the housing of device 1500 is designed for the purpose of convenience for removing or attaching usb flash drive off or to the mother board . the top and bottom surfaces of housings are used for marking or labeling company &# 39 ; s logo or unit specifications descriptions . referring now to fig1 b , according to an alternative embodiment , the structure of the ubs flash drive 1520 includes a top housing 1521 , a bottom housing 1522 , and a pcba 1400 using snap - together method or apply ultrasonic press for sealing around edges 1525 of the housing . the usb flash drive 1520 is coupled with a motherboard inside computer chassis ( not shown ) by way of 9 - pin header receptacle 1401 and a plug . the housing of device 1520 is designed for the purpose of convenience for removing or attaching usb flash drive 1520 off or to the motherboard . the top and bottom housings 1521 - 1522 have certain perforations 1523 - 1524 for a weigh reduction and air flow purpose . fig1 c shows an alternative embodiment of the design similar to the one shown in fig1 b . referring to fig1 c , in this embodiment , the extended usb device 1400 is enclosed by a housing having a top housing portion 1551 and a bottom housing portion 1552 , forming an extended usb drive 1550 , where each housing portion includes an opening or cut - out 1553 - 1554 for a weigh reduction and air flow purpose . as described above , an extended usb drive is coupled to a motherboard of a computer chassis via a 9 - pin receptacle , where the extended usb driver is position in a vertical orientation with respect to a surface of the motherboard . according to certain embodiments of the invention , the 9 - pin receptacle may be designed in a way such that an extended usb driver is positioned in a horizontal orientation ( e . g ., parallel ) with respect to a surface of the motherboard . fig1 a - 16c are block diagrams illustrating certain configurations of an extended usb device according to certain embodiments of the invention . referring to fig1 a , an embedded usb flash drive or ready boost drive is to use with a mlc dual - personality extended usb header vertical receptacle 1601 . the usb header vertical receptacle 1601 may include a 9 - pin socket that is compatible with an ordinary socket or connector used in an ordinary computer , such as , for example , ata style connector . in this example as shown in fig1 a , usb header vertical receptacle 1601 includes two rows of pins 1602 - 1603 , each having five pins . one of the rows 1602 - 1603 , in this example , row 1602 only includes 4 pins , leaving one of the plugs 1604 unattached . as a result , a total of 9 pins are implemented in this example , where functionality of each pin is shown in table 1605 . receptacle 1601 is designed similar to receptacle 1401 of fig1 a , except that pins 1602 - 1603 are configured as a surface mount pins . unlike the configuration as shown in fig1 a - 14c where the pins 1402 - 1403 are mounted or soldered on two sides of a pcba , pins 1602 - 1603 are surface mounted on one side of the pcba , for example , as shown in fig1 b . as a result , the finished usb driver can be plugged into a socket ( e . g ., male socket ) of the motherboard in parallel with a surface of the motherboard . note that the usb header vertical receptacle 1601 is shown for illustration purposes only ; other forms of receptacles may also be implemented . according to one embodiment , as shown in fig1 b , each of the rows 1602 - 1603 may be mounted or soldered on corresponding electrical contact pads of a surface of a pcba , for example , the same surface of the pcba , where a pcba may be any of the above configurations . for example , referring to fig1 b , usb header vertical receptacle 1601 is surface mounted onto a pcba 1600 having a mlc controller 1609 and one or more mlc memory ics 1610 - 1611 , which may be mounted ( e . g ., surface mounted ) on a top surface 1607 and a bottom surface 1608 of pcb 1606 . as described above , the usb header vertical receptacle 1601 includes two rows of pins , each being surface mounted on the same surface ( e . g ., top surface ) of pcb 1606 . as a result , the orientation of plugs of usb header vertical receptacle 1601 is in a vertical direction with the top and bottom surfaces 1607 - 1608 of pcba 1600 , which would enable the finished usb package to be mounted on ( e . g ., via a corresponding connector , in this example , a male connector of ) a chassis such as a motherboard of a computer in a horizontal orientation with respect to a surface of the motherboard . alternatively , as shown in fig1 c , the pcba may be implemented as a cob package 1616 mounted on a top surface 1617 of a pcb substrate 1615 , for example , by surface mounting one or more metal pads on the pcb substrate 1615 . the cob package 1616 may be implemented a traditional cob 1620 having one row of metal contact pads 1623 or alternatively , an extended cob 1619 having two rows of electrical contact pads 1621 - 1622 , similar to those configurations described above . note that usb device as shown in fig1 a - 16c may be enclosed by a housing similar to those as shown in fig1 a - 15c . other configurations may exist . according to certain embodiments of the invention , the pcba and / or cob packages as described above with dual personality can also be used with a mini - usb and / or micro - usb connectors . smaller usb plugs and receptacles such as mini usb and later on micro usb have been introduced to the usb systems . the applications have used mostly in handheld or small , light mobile devices such as digital camera , cellular phone , mp3 , pda , cam recorder , etc . the data transferring from such devices to host computer is taken place by using a cable assembly . fig1 a - 17c are diagrams illustrating a dual personality extended usb plug having a small form factor according to one embodiment of the invention . referring to fig1 a - 17c , according to one embodiment , extended usb plug 1700 includes a front portion 1701 formed with a metal case 1706 for shielding purposes and a rear portion 1702 having a connector substrate 1707 having dual personality . the front portion 1701 includes a tip portion 1708 having a tongue portion 1709 extended from the metal shield case 1710 as shown in fig1 b . referring to fig1 a and 17b , four electrical contact pins 1781 are disposed on a bottom surface of the tongue portion 1709 labeled as pins 6 - 9 having functionality as showed in table 1703 . in addition , five electrical contact pins 1782 are disposed on a top surface of the tongue portion 1709 labeled as pins 1 - 5 having functionality as shown in table 1703 . in one embodiment , the four pins disposed on the bottom surface of the tongue portion are configured to be compatible with a standard usb specification and the five pins disposed on the top surface of the tongue portion are configured to be compatible with the extended usb specification . note that the number of pins used with the extended usb plug 1700 is described for the purposes of illustration only . more or fewer pins , as well as different positions , may also be applied . in addition , rear portion 1702 includes a couple of tabs , at least one on each side of the rear portion 1702 and the front portion 1701 includes a couple of slots or opening 1712 disposed on the corresponding sides of the front portion 1701 . when the rear portion 1702 is inserted into front portion 1701 , the front portion 1701 and the rear portion 1702 are snapped together via the tabs 1711 and the slots 1712 . in this example , the tabs 1711 are used as locking pieces that lock the rear portion 1702 inserted into the front portion 1701 . the front portion 1701 includes the tongue portion 1709 and its shielding case 1710 having nine pins disposed thereon as shown in fig1 b . according to one embodiment , rear portion 1702 includes a first row 1704 of pins and a second row 1705 of pins corresponding to the extended usb specification and a standard usb specification respectively . the tip portion 1713 of rear portion 1702 includes multiple contact pins or pads 1783 corresponding to and extended from the pins of the rows 1704 - 1705 . when the tip portion 1713 of the rear portion 1702 is inserted into the tip portion 1708 of the front portion 1701 and snapped together via tabs 1711 and slots 1712 , the electrical contact pins of the tip portion 1713 are engaged with the corresponding contact pins 1781 and 1782 disposed on the tongue portion 1709 of the front portion 1701 . furthermore , the tip portion 1713 of the rear portion 1702 further includes a couple of lock pieces 1715 that can be extended and exposed through the corresponding slots 1714 of the tip portion 1708 of the front portion 1701 , when the rear portion 1702 is inserted into the front portion 1701 . the locking pieces 1715 are pushed upwardly through the slots 1714 by a couple of springs 1716 disposed on a bottom surface of the tip portion 1708 . the lock pieces 1715 may be used to lock a usb receptacle , such as the one shown in fig1 a , when the plug 1700 is engaged with the usb receptacle . according to one embodiment , as described above , the pins of rows 1704 - 1705 may be mounted on a top and bottom surface of a pcba or a cob package as shown in fig1 b . referring to fig1 b , extended usb plug with dual personality 1700 is mounted on a pcba 1730 with a flash controller ic 1731 disposed on a top surface 1733 and one or more flash memory ics 1732 disposed on a bottom surface 1734 of the pcba 1730 . furthermore , according to another embodiment , an extended usb plug similar to the one as shown in fig1 a may also be used in a usb cable assembly as shown in fig1 c . referring to fig1 c , an extended usb plug 1750 similar to the one shown in fig1 a is attached to a cable as shown in an exploded view 1751 . similar to the one shown in fig1 a , the usb plug 1750 includes a front piece 1753 and a rear piece 1754 . the front and read pieces 1753 - 1754 may be attached together via one or more tabs 1755 snapped into the corresponding slots 1756 . the rear piece 1754 includes multiple electrical pins or pads 1757 to allow multiple wires 1758 to be connected or soldered thereon . the front piece 1753 includes one or more loops 1759 made of elastic material bent around wires 1758 after the front and rear pieces 1753 - 1754 are snapped together , where the wires 1758 are enclosed by an outer jacket 1760 . the assembly 1751 may then be covered by a plastic molding cover 1761 forming an extended usb cable assembly having dual personality . fig1 a - 18c are diagrams illustrating a dual personality extended usb receptacle having a small form factor according to one embodiment of the invention . referring to fig1 a , an extended usb receptacle 1800 , which may be coupled to an extended usb plug connector such as the one shown in fig1 a , includes a connector substrate 1801 which may be inserted or covered by a metal case 1802 . the connector substrate 1801 includes a tongue portion 1804 having multiple pins disposed on both surfaces of the tongue portion which forms a dual personality . in this example , five pins compatible with the extended usb specification are disposed on a top surface of the tongue portion and four pins compatible with the standard usb specification are disposed on a bottom surface of the tongue portion . the connector substrate 1801 further includes multiple pins 1803 on a rear end opposite to the tongue portion , where each of the pins 1803 is electrically coupled to each of the pins disposed on the tongue portion 1804 . the functionally of the pins are listed in table 1805 . the receptacle 1800 may be mounted , via mounting brackets 1871 , on a pcba or cob 1806 as shown in fig1 b . similar to the configuration as shown in fig1 c , the assemblies as shown in fig1 a may also be applied to a usb cable assembly as shown in fig1 c . referring to fig1 c , similar to the extended usb receptacle 1800 , extended usb receptacle 1850 may be attached to a usb cable 1860 via a loop 1859 , forming a cable assembly in an exploded view 1851 . the cable assembly 1852 includes an upper metal case 1871 and a lower metal case 1872 snapped together via one or more tabs 1855 and slots 1856 . the cable assembly 1852 further includes a connector substrate 1854 , having a configuration similar to the one as shown in fig1 a , attached to multiple wires 1858 via corresponding pins 1857 , where the wires 1858 are covered by an outer jacket 1860 . thereafter , the assembly is covered by a plastic molding cover 1861 , forming a finished extended usb cable assembly having dual personality . fig1 is a diagram illustrating an extended usb plug and receptacle having dual personality according to an alternative embodiment . referring to fig1 , extended usb receptacle connector 1901 may be implemented similar to the one as shown in fig1 a and the extended usb plug connector 1902 may be implemented similar to the one as shown in fig1 a . other configurations may also be implemented . according to certain embodiments of the invention , the techniques described above with respect to above figs . can be used in designing an extended usb portable storage device . fig7 is a block diagram illustrating an example of an extended usb device having an extended usb plug with multiple personalities according to one embodiment of the invention . referring to fig7 , usb package 703 which may include an extended usb plug 701 having multiple interfaces or personalities as described and a pcba 704 may be enclosed by a housing as an extended usb device 700 . note that package 703 may be an apparatus as described in fig4 a - 4b or alternatively , as an apparatus as shown in fig5 a - 5c . the housing for housing the package 703 includes a top housing 705 and a bottom housing 706 . the top housing 705 and the bottom housing 706 may be attached to each other via a variety of methods , including using a snap together method or applying ultrasonic press for sealing around edges of top housing 705 and bottom housing 706 . note that extended usb device 700 as shown in fig7 may be implemented in a variety of configurations , such as , those as shown in fig8 a - 8b and 9 . fig8 a - 8b are block diagrams illustrating examples of usb devices having an extended usb plug with multiple interfaces or personalities . referring to fig8 a , extended usb device 800 includes an extended usb plug 801 as described above and a press / push button 802 that can be used to push and / or pull the extended usb plug 801 as well as the attached herein pcba 803 having a flash memory controller 812 ( e . g ., mlc controller ) and a memory ic 804 ( e . g ., mlc memory ic ) in and out of a housing of extended usb device 800 . the housing includes a top housing 805 and a bottom housing 806 which may be attached together via a snap together method or via ultrasonic sealing . in addition , extended usb device 800 includes a pcb holder 807 to maintain a press / push mechanism to deploy and retract usb plug in and out of the housing . according to an alternatively embodiment as shown in fig8 b , a press / push button may be implemented on a side surface . referring to fig8 b , extended usb device 850 includes an extended usb plug 851 as described above and a press / push button 857 that can be used to push and / or pull the extended usb plug 851 as well as the attached herein pcba 853 having a flash memory controller 852 ( e . g ., mlc controller ) and a memory ic 804 ( e . g ., mlc memory ic ) in and out of a housing of extended usb device 850 . the housing includes a top housing 855 and a bottom housing 856 which may be attached together via a snap together method or via ultrasonic sealing . in addition , extended usb device 850 includes a pcb holder 858 to maintain a press / push mechanism to deploy and retract usb plug in and out of the housing . further detailed information regarding the press / push mechanism above can be found in a co - pending u . s . patent application ser . no . 11 / 845 , 747 , filed aug . 27 , 2007 , which has been assigned to a common assignee of the present application and is incorporated by reference herein in its entirety . fig9 is a block diagram illustrating an example of extended usb device having an extended usb plug with multiple personalities according to one embodiment of the invention . referring to fig9 , extended usb device 900 is a mlc compatible usb flash drive in which a swivel cap 901 is attached to the extended usb device 900 by a pivot pin with at least two locking positions 902 . referring to fig . 9 , extended usb flash drive 900 includes a dual - personality extended usb plug 903 as described above and a pcba 904 with mlc flash memory and / or controller ic 905 . specifically , usb flash drive includes an extended usb device 900 and a swivel cap 901 which is attached to the extended usb device 900 by pressing pivot pins 910 ( swivel cap ) into pivot holes 906 ( top / bottom housing ). locking positions of swivel cap related to the usb device are obtained whenever lock pins 909 ( swivel cap ) snap into lock holes ( top / bottom housing ). the extended usb device 900 includes a top , bottom housing 907 - 908 and a pcba 904 as described above . the assembly of top and bottom housing 907 - 908 utilizes snap - together method or apply ultrasonic press for sealing around edges of housing 907 - 908 . other configurations may exist . fig1 a is a block diagram of an exemplary host with one embodiment of an extended - usb socket that supports extended - mode communication . the configuration as shown in fig1 a may be utilized with embodiments of techniques described above . a variety of extended - usb or usb peripherals 168 could be plugged into extended - usb socket 166 of host 152 . for example , a sata peripheral , a pci - express peripheral , a firewire ieee 1394 peripheral , a serial - attached scsi peripheral , or a usb - only peripheral could be inserted . each can operate in its own standard mode . host 152 has processor system 150 for executing programs including usb - management and bus - scheduling programs . multi - personality serial - bus interface 160 processes data from processor system 150 using various protocols . usb processor 154 processes data using the usb protocol , and inputs and outputs usb data on the usb differential data lines in extended usb socket 166 . the extended metal contact pins in extended usb socket 166 connect to multi - personality bus switch 162 . transceivers in multi - personality bus switch 162 buffer data to and from the transmit and receive pairs of differential data lines in the extended metal contacts for extended protocols such as pci - express , firewire ieee 1394 , serial - attached scsi , and sata . when an initialization routine executed by processor system 150 determines that inserted peripheral 168 supports sata , personality selector 164 configures multi - personality bus switch 162 to connect extended usb socket 166 to sata processor 158 . when the initialization routine executed by processor system 150 determines that inserted peripheral 168 supports pci - express , personality selector 164 configures multi - personality bus switch 162 to connect extended usb socket 166 to pci - express processor 156 . then processor system 150 communicates with either pci - express processor 156 or sata processor 158 instead of usb processor 154 when extended mode is activated . fig1 b is a block diagram of an exemplary peripheral with one embodiment of an extended - usb connector that supports extended - mode communication . the configuration as shown in fig1 b may be utilized with embodiments of techniques described above . multi - personality peripheral 172 has extended usb connector 186 that could be plugged into extended - usb socket 166 of host 152 that has extended - mode communication capabilities such as sata , 1394 , sa - scsi , or pci - express . alternately , extended usb connector 186 of multi - personality peripheral 172 could be plugged into standard - usb socket 187 of host 188 that only supports standard usb communication . multi - personality peripheral 172 has processor system 170 for executing control programs including usb - peripheral - control and response programs . multi - personality serial - bus interface 180 processes data from processor system 170 using various protocols . usb processor 174 processes data using the usb protocol , and inputs and outputs usb data on the usb differential data lines in extended usb connector 186 . the extended metal contact pins in extended usb connector 186 connect to multi - personality bus switch 182 . transceivers in multi - personality bus switch 182 buffer data to and from the transmit and receive pairs of differential data lines in the extended metal contacts for extended protocols such as pci - express , 1394 , sa scsi , and sata . when a control or configuration routine executed by processor system 170 determines that host 152 has configured multi - personality peripheral 172 for sata , personality selector 184 configures multi - personality bus switch 182 to connect extended usb connector 186 to sata processor 178 . when the initialization routine executed by processor system 170 determines that inserted peripheral 188 supports pci - express , personality selector 184 configures multi - personality bus switch 182 to connect extended usb connector 186 to pci - express processor 176 . then processor system 170 communicates with either pci - express processor 176 or sata processor 178 instead of usb processor 174 when extended mode is activated . if a pci express device with an extended usb plug is plugged into a host system with a conventional usb receptacle , nothing will be recognized if the pci express device does not support usb . the host system will not see anything that has plugged into the system . the same is true for a sata - only device , etc . fig1 is a flowchart of one embodiment of an initialization routine executed by a host for detecting a device plugged into an extended usb socket . a host such as a pc can have an extended usb socket . either an extended usb device , or a standard usb device can be plugged into the extended usb socket . this routine detects whether the inserted device supports extended - usb mode or only standard usb mode . the routine may be executed by processor system 150 of fig1 a . the host detects a newly - inserted device plugged into the extended usb socket , step 200 , such as by detecting resistance changes on the metal contact pins of the extended usb socket . when the newly - inserted device is detected , a usb reset command is sent over the usb differential signal lines to the device , step 202 . a usb read - status command is then sent by the host , step 204 . the peripheral device responds by sending its status information using usb protocols . the host examines this status information , and in particular looks for a mode identifier indicating that the peripheral supports extended - usb mode . this mode identifier can be a status bit or a unique code in an area reserved for use by the peripheral vendor to identify the peripheral &# 39 ; s type or capabilities . when the peripheral responds with a status indicating no extended - usb support , step 206 , then processing continues in native usb mode , step 214 . standard usb transactions are performed between the host and the peripheral using the differential usb data pins in the four - pin side of the extended usb socket . the peripheral likely has a standard usb connector that has only 4 metal contact pins , not the extension with the 8 additional metal contact pins . when the peripheral responds with a status indicating extended - usb support , step 206 , then the host further examines the packet from the peripheral to determine that the peripheral can support higher - speed communication using the extended metal contact pins , step 208 . the peripheral has an extended usb connector with the 8 additional metal contact pins in an extension portion of the connector . the host can further examine the capabilities of the peripheral , such as to determine which extended modes are supported , step 210 . some peripherals may support pci - express communication in extended mode , while others support serial - ata , serial attached scsi , or ieee 1394 as the extended - mode protocol . the host then sends a vendor - defined usb out command to the peripheral , step 212 . this command instructs the peripheral to activate its extended mode of operation . the host verifies that the device received the command by reading its status again , step 216 . the peripheral responds with a ready status , step 218 . if the status read back from the device does not indicate that the peripheral is ready to switch to extended mode , step 220 , then the device fails , step 224 . the host could fall back on standard usb mode , step 214 , or attempt again to activate extended mode , step 202 . after trying a predetermined number of times , the host falls back on standard usb mode , step 214 . when the peripheral responds with the correct ready , step 220 , then the host and peripheral can begin communicating in the extended mode . the 8 additional metal contact pins in the extended portion of the usb connector and socket are used for communication rather than the 4 usb metal contact pins . for example , the pci - express transmit and receive differential pairs can be used to bidirectionally send and receive data when the device has a pci - express personality . the host uses these extended pins to send a read - status command to the peripheral , step 222 . data can be sent and received at the higher rates supported by pci - express rather than the slower usb rates . fig1 is a flowchart of one embodiment of an initialization routine executed by a peripheral device plugged into an extended usb socket . a peripheral can have an extended usb connector that can be plugged into either an extended usb socket or a standard usb socket . this routine executes on the peripheral device and helps the host detect that the inserted device supports extended - usb mode . the routine may be executed by peripheral - device processor system 170 of fig1 b . when the peripheral device is plugged into the usb socket , power is received though the power and ground pins on the 4 - pin usb portion of the connector , step 226 . the peripheral device executes any initialization procedures to power itself up , step 228 , and waits for a reset command from the host , step 230 . once the reset command is received from the host , the peripheral device resets itself , step 232 . the peripheral device waits for further commands from the host , step 234 , such as a read - status command . the status read by the host , or further data read by the host can contain capability information about the peripheral device , such as which extended modes are supported , pci - express , sata , ieee 1394 , sa scsi , etc ., step 236 . the reset and read - status commands are standard usb commands from the host . the peripheral device then waits for a command from the host to enable extended - mode communication , step 238 . an enable command followed by another read - status command must be received , so the peripheral waits for the read - status command , step 240 . once the read - status command is received , the peripheral responds with an ok or ready status to indicate that it is ready to switch to using the extended metal contact pins on the connector , step 242 . then the peripheral device switches its bus transceivers to match the bus - protocol specified by the host to be able to communicate over the 8 extension metal contact pins , step 244 . the 4 usb metal contact pins are not used . the peripheral device waits for a read - status command sent by the host over the extended metal contact pins and responds to this read - status command , step 246 , initializing for the new protocol mode . the peripheral device can then receive extended commands such as pci - express commands that are received over the extended metal contact pins on the extended portion of the connector , such as the pci - express transmit and receive differential lines , step 248 . fig1 is a table of extended and standard pins in one embodiment of an extended usb connector and socket . the a side of the pin substrates contains the four standard usb signals , which include a 5 - volt power signal and ground . the differential usb data d −, d + are carried on pins 2 and 3 . these pins are not used for extended modes . side b of the pin substrates , or the extension of the primary surfaces , carries the extended signals . pin 1 is a 3 . 3 - volt power signal for modified pci - express generation 0 and serial - ata ( sata ), while pin 2 is a 1 . 5 - volt supply for modified pci - express generation 0 and reserved for sata . for modified pci - express generations 1 , 2 , and 3 , pins 1 and 2 carry the transmit differential pair , called petn , petp , respectively . pin 8 is a 12 - volt power supply for sata and reserved for modified pci - express generation 0 . pin 8 is a ground for modified pci - express generations 2 and 3 . pin 5 is a ground for modified pci - express generation 0 and sata . pins 3 and 4 carry the transmit differential pair , petn , petp , respectively , for modified pci - express generation 0 , and t −, t +, respectively , for sata . pin 3 is a ground for modified pci - express generations 1 , 2 , and 3 . pin 4 and pin 5 carry receive differential pair , called pern and perp , respectively , for modified pci - express generations 1 , 2 , and 3 . pins 6 and 7 carry the receive differential pair , pern , perp , respectively , for modified pci - express generation 0 and r −, r +, respectively , for sata . pins 6 and 7 carry a second transmit differential pair , called petn 1 and petp 1 , respectively , for modified pci - express generations 2 and 3 . pins 9 and 10 carry a second receive differential pair , called pern 1 and perp 1 , respectively , for modified pci - express generations 2 and 3 . pins 11 and 12 carry a third transmit differential pair , called petn 2 and petp 2 , respectively , for modified pci - express generation 3 . pin 13 is a ground for modified pci - express generation 3 . pins 14 and 15 carry a third receive differential pair , called pern 2 and perp 2 , respectively , for modified pci - express generation 3 . pins 16 and 17 carry a fourth transmit differential pair , called petn 3 and petp 3 , respectively , for modified pci - express generation 3 . pin 18 is a ground for modified pci - express generation 3 . pins 19 and 20 carry a fourth receive differential pair , called pern 3 and perp 3 , respectively , for modified pci - express generation 3 . the expresscard pins refclk +, refclk −, cppe #, clkreq #, perst #, and wake # are not used in the extended usb connector to reduce the pin count . additional pins may be added to the extended usb connector and socket if some or all of these pins are desired . furthermore , the pin names and signal arrangement ( or order ) illustrated in fig1 is merely one embodiment . it should be apparent that other pin names and signal arrangement ( or order ) may be adopted in other embodiments . some portions of the preceding detailed descriptions have been presented in terms of algorithms and symbolic representations of operations on data bits within a computer memory . these algorithmic descriptions and representations are the ways used by those skilled in the data processing arts to most effectively convey the substance of their work to others skilled in the art . an algorithm is here , and generally , conceived to be a self - consistent sequence of operations leading to a desired result . the operations are those requiring physical manipulations of physical quantities . usually , though not necessarily , these quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the above discussion , it is appreciated that throughout the description , discussions utilizing terms such as “ processing ” or “ computing ” or “ calculating ” or “ determining ” or “ displaying ” or the like , refer to the action and processes of a computer system , or similar electronic computing device , that manipulates and transforms data represented as physical ( electronic ) quantities within the computer system &# 39 ; s registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage , transmission or display devices . embodiments of the present invention also relate to an apparatus for performing the operations herein . this apparatus may be specially constructed for the required purposes , or it may comprise a general - purpose computer selectively activated or reconfigured by a computer program stored in the computer . such a computer program may be stored in a computer readable storage medium , such as , but is not limited to , any type of disk including floppy disks , optical disks , cd - roms , and magnetic - optical disks , read - only memories ( roms ), random access memories ( rams ), erasable programmable roms ( eproms ), electrically erasable programmable roms ( eeproms ), magnetic or optical cards , or any type of media suitable for storing electronic instructions , and each coupled to a computer system bus . the algorithms and displays presented herein are not inherently related to any particular computer or other apparatus . various general - purpose systems may be used with programs in accordance with the teachings herein , or it may prove convenient to construct more specialized apparatus to perform the required method operations . the required structure for a variety of these systems will appear from the description below . in addition , embodiments of the present invention are not described with reference to any particular programming language . it will be appreciated that a variety of programming languages may be used to implement the teachings of embodiments of the invention as described herein . a machine - readable medium may include any mechanism for storing or transmitting information in a form readable by a machine ( e . g ., a computer ). for example , a machine - readable medium includes read only memory (“ rom ”); random access memory (“ ram ”); magnetic disk storage media ; optical storage media ; flash memory devices ; electrical , optical , acoustical or other form of propagated signals ( e . g ., carrier waves , infrared signals , digital signals , etc . ); etc . in the foregoing specification , embodiments of the invention have been described with reference to specific exemplary embodiments thereof . it will be evident that various modifications may be made thereto without departing from the broader spirit and scope of the invention as set forth in the following claims . the specification and drawings are , accordingly , to be regarded in an illustrative sense rather than a restrictive sense . | 7 |
fig1 shows a configuration of a complex second - order integrator of the first embodiment . a complex second - order integrator 100 of this embodiment includes : a second - order integrator 100 i that receives a signal v ini and outputs a signal v outi : a second - order integrator 100 q that receives a signal v inq displaced 90 ° in phase from the signal v ini and outputs a signal v outq displaced 90 ° in phase from the signal v outq ; and two coupling circuits 30 and 40 that couple the second - order integrators 100 i and 100 q together . the second - order integrators 100 i and 100 q each can be formed using one operational amplifier 10 . specifically , an input - part filter having resistance elements 11 , 12 , and 14 and a capacitance element 21 is provided between the signal input terminal and the inverted input terminal of the operational amplifier 10 . one terminal of each of these elements is connected to a node 101 , the other terminals of the resistance elements 11 and 12 are respectively connected to the signal input terminal and the inverted input terminal of the operational amplifier 10 , and the other terminals of the resistance element 14 and the capacitance element 21 are grounded . a feedback - part filter having capacitance elements 22 and 23 and a resistance element 13 is provided between the inverted input terminal and output terminal of the operational amplifier 10 . one terminal of each of these elements is connected to a node 102 , the other terminals of the capacitance elements 22 and 23 are respectively connected to the inverted input terminal and output terminal of the operational amplifier 10 , and the other terminal of the resistance element 13 is grounded . the coupling circuit 30 cross - couples the capacitance elements 23 of the second - order integrators 100 i and 100 q together . specifically , the coupling circuit 30 can be formed of resistance elements 31 and 32 . the resistance element 31 couples one of the two terminals of the capacitance element 23 of the second - order integrator 100 i that is connected to the output terminal of the operational amplifier 10 to one of the two terminals of the capacitance element 23 of the second - order integrator 100 q that is connected to the node 102 with the polarity mutually inverted . the resistance element 32 couples the other terminal of the capacitance element 23 of the second - order integrator 100 q that is connected to the output terminal of the operational amplifier 10 to the other terminal of the capacitance element 23 of the second - order integrator 100 i that is connected to the node 102 with no polarity inversion involved . the coupling circuit 40 cross - couples the capacitance elements 22 of the second - order integrators 100 i and 100 q together . specifically , the coupling circuit 40 can be formed of resistance elements 41 and 42 . the resistance element 41 couples one of the terminals of the capacitance element 22 of the second - order integrator 100 i that is connected to the node 102 to one of the terminals of the capacitance element 22 of the second - order integrator 100 q that is connected to the inverted input terminal of the operational amplifier 10 with the polarity mutually inverted . the resistance element 42 couples the other terminal of the capacitance element 22 of the second - order integrator 100 q that is connected to the node 102 to the other terminal of the capacitance element 22 of the second - order integrator 100 i that is connected to the inverted input terminal of the operational amplifier 10 with no polarity inversion involved . in the complex second - order integrator 100 of this embodiment , when the resistance values of the resistance elements 11 - 14 are respectively r 1 , r 2 , r 3 , and r 4 , the capacitance values of the capacitance elements 21 - 23 are c 1 , c 2 , and c 3 , the resistance values of the resistance elements 31 and 32 are r f1 , the resistance values of the resistance elements 41 and 42 are r f2 , the voltages at the nodes 101 and 102 in the second - order integrator 100 i are v 1 and v 2 , and the voltages at the nodes 101 and 102 in the second - order integrator 100 q are v 3 and v 4 , the following nodal equations are satisfied . assuming that , in each of the second - order integrators 100 i and 100 q , the overall admittance where the elements connected to the node 101 are in parallel connection is equal to the overall admittance where the elements connected to the node 102 are in parallel connection , e . g ., c 1 = c 2 + c 3 , 1 / r 3 = 1 / r 1 + 1 / r 2 , and 1 / r 4 = 1 / r f1 + 1 / r f2 , the following transfer function is derived for the complex second - order integrator 100 . as is evident from the above transfer function , the frequency characteristic of the complex second - order integrator 100 shifts in the positive direction by 1 / c 2 r f2 and 1 / c 3 r f1 . in other words , the complex second - order integrator 100 has a transfer characteristic asymmetric with respect to the positive and negative frequencies , and exhibits a complex integral characteristic equivalent to the conventional complex second - order integrator that uses operational amplifiers heavily . fig2 shows a configuration of a complex second - order integrator of the second embodiment . a complex second - order integrator 100 of this embodiment includes the following in addition to the components of the complex second - order integrator 100 of fig1 . in each of the second - order integrators 100 i and 100 q , a resistance element 15 and a capacitance element 24 are connected in parallel between the node 102 and the signal input terminal . in addition , a coupling circuit 50 is provided , which cross - couples the capacitance elements 24 of the second - order integrators 100 i and 100 q together . a difference from the first embodiment will be described hereinafter . the coupling circuit 50 can be formed of resistance elements 51 and 52 . the resistance element 51 couples one of the two terminals of the capacitance element 24 of the second - order integrator 100 i that is connected to the signal input terminal to one of the two terminals of the capacitance element 24 of the second - order integrator 100 q that is connected to the node 102 with the polarity mutually inverted . the resistance element 52 couples the other terminal of the capacitance element 24 of the second - order integrator 100 q that is connected to the signal input terminal to the other terminal of the capacitance element 24 of the second - order integrator 100 i that is connected to the node 102 with no polarity inversion involved . in the complex second - order integrator 100 of this embodiment , when the resistance value of the resistance element 15 is r 5 , the capacitance value of the capacitance element 24 is c 4 , and the resistance values of the resistance elements 51 and 52 are r f3 additionally , the following nodal equations are satisfied . assuming that , in each of the second - order integrators 100 i and 100 q , the overall admittance where the elements connected to the node 101 are in parallel connection is equal to the overall admittance where the elements connected to the node 102 are in parallel connection , e . g ., c 1 = c 2 + c 3 + c 4 , 1 / r 3 = 1 / r 1 + 1 / r 2 , and 1 / r 4 = 1 / r f1 + 1 / r f2 + 1 / r f3 + 1 / r 5 , and moreover assuming that r f2 = c 3 / c 2 × r f1 , r f3 = c 3 / c 4 × r f1 , for simplicity , the following transfer function is derived for the complex second - order integrator 100 . as is evident from the above transfer function , the frequency characteristic of the complex second - order integrator 100 is equal to that obtained by shifting the following transfer function h ( s ) of a general second - order integrator by 1 / c 3 r f1 in the positive direction . in other words , the complex second - order integrator 100 has a transfer characteristic asymmetric with respect to the positive and negative frequencies , and exhibits a complex integral characteristic equivalent to the conventional complex second - order integrator that uses operational amplifiers heavily . moreover , the terms of the numerator of the transfer function can be changed freely and independently from one another . for example , only the second - order term can be changed by changing the capacitance value c 4 , only the first - order term can be changed by changing the resistance value r 5 , and only the zero - order term can be changed by changing any one of the resistance values r 1 and r 2 and the capacitance value c 2 . note that the complex second - order integrators 100 of the first and second embodiments can be transformed into complex second - order resonators by providing a resistive path between the node 101 and the output terminal of the operational amplifier 10 in each of the second - order integrators 100 i and 100 q . note however that , since the complex second - order integrator 100 virtually acts as a resonator by setting the element values so that the overall admittance where the elements connected to the node 101 are in parallel connection is equal to the overall admittance where the elements connected to the node 102 are in parallel connection , it is unnecessary to take the trouble to provide a resistive path . fig3 shows a configuration of a ctds - adc of the third embodiment . in fig3 , the reference character 110 denotes a general complex first - order integrator , 120 denotes an adder , 130 denotes a quantizer , and 140 denotes d / a converters ( voltage - current converters ). each of complex second - order integrators 100 may be the one of the first embodiment or the second embodiment . by the cascade connection of the complex first - order integrator 110 and the two complex second - order integrators 100 , the ctds - adc of this embodiment exhibits the fifth - order complex integral characteristic . fig4 shows a quantization noise transfer characteristic of the ctds - adc of this embodiment . the ctds - adc of this embodiment has an asymmetric transfer characteristic shifted in the positive direction . thus , in this embodiment , a ctds - adc having a high - order complex integral characteristic can be implemented with a reduced number of operational amplifiers . | 7 |
various embodiments of the present invention are now illustrated in following figures using terms commonly employed by those skilled in the art . it will be understood that they are not intended to limit the invention to these embodiments . the invention can be practiced without one or more of the specific details , or with other methods , components , materials . in other instances , well - known structures , materials , process steps , or operations are not shown or described in detail in order not to obscure aspect of the invention . fig4 illustrates a 3 × 3 cross - point memory array wherein each memory cell mc is shown before programming . wordlines ( wl ) are positioned in the horizontal direction and bitlines ( bl ) in the vertical direction . note that the orientation and terminology used to describe the lines may be switched or different terminology used altogether . a memory cell consisting of a “ metal - insulator - semiconductor ” ( mis ) capacitor is located at each cross point . note that while the term “ metal ” is used in mis , the metal in many embodiments is actually doped polysilicon — in the context of the present disclosure , the term metal is meant to include any and all conductive structures . the wl and bl are so named for convenience only and they are , for example , referred to as rows ( r ) and columns ( c ) interchangeably in this specification . further , the array may be of arbitrary size m by n , where m or n ranges , in one embodiment , from 1 to 1024 , but may be larger . fig5 shows a cross - sectional view of two different types of the mis memory cell . fig5 ( a ) is for an n - type mis cell where the body is p - type and the gate is of n - type conductivity . fig5 ( b ) is for a p - type mis cell where the doping is opposite to that of fig5 ( a ). it should be noted that the cells have a gate stack which are the same as that of a standard mosfet . however , there are no source / drain implants ( charge reservoirs ) physically connected to the channel . the gate dielectric can be of any commonly used materials in the industry such as oxide , nitride , oxynitride , and other high dielectric constant materials . for convenience , p - type doped poly gate conductors will be used to describe various embodiments . in practice , n - type doped poly or metal gate can be implemented as well . in accordance with a disclosed embodiment , fig6 shows a partial layout diagram of a 3 × 3 array . for simplicity , only a few relevant layers are drawn . active stripes are formed in vertical stripes in the substrate . the active stripes are formed by a doping implant . for a p - type doped poly gate conductor , the implant would be an n - type implant into a p - type substrate . a typical doping concentration for the n - type bitlines bl could range from 1 × 10 18 to 1 × 10 19 . in one embodiment , the width of the stripes range from between 1 × to 2 × of the minimum feature size ( f ) that can be patterned at a given technology node . formed between the active stripes are isolation regions , which may be , as an example , locos or shallow trench isolation ( sti ). isolation regions may also be formed from floating doped regions and any other myriad types of isolation structures used in the industry . the width of the isolation regions between active stripes may also range between 1 × to 2 × of the minimum feature size f . still referring to fig6 , arranged in horizontal stripes are gate conductor wordlines wl . like the bitlines bl , the wl width and spacing therebetween ranges from 1 × to 2 × of the minimum feature of a given process technology . thus , for high density applications , the cell size can be as low as 4f 2 , assuming that the width of the bl , wl , and isolation spacings are all at the minimum feature size . as noted , the embodiments disclosed herein follow standard cmos process flow except for the addition of a bitline bl implant mask that is used to form the bitlines ( active stripes ) in the substrate . fig7 shows a process flow that may be used to manufacture the disclosed embodiments . first at box 701 , a standard n - well implant is performed generally in those areas outside of the memory array . those of skill in the art recognize that n - wells are conventionally formed in a p - type substrate in a cmos process . while the n - wells are being formed , a mask is used to cover the memory array region . the mask covers the memory array while the n - wells are formed . next , the mask is further exposed and developed to provide a bitline mask . thus , the mask serves two purposes : ( 1 ) to cover the memory array while n - wells are being formed in other areas of the substrate , and ( 2 ) after the mask is further defined , to use as a bitline mask to form the active stripes . in some embodiments , this process may be performed by two separate masks . next at box 703 , once the bitline mask has been formed , the active stripes are formed by implantation of the n - type dopant . as will be seen below , the active stripes in one embodiment have an n + deeper implant and an n − shallower implant . the active stripe implant ( also referred to as a cell bitline implant ( cbi )) may be done either before or after the regular n - well implant , without extra thermal annealing . in this embodiment , the implant is n - type dopant , similar to the n - well implant , but with a lower energy . the retrograde implant profile ( where there is an n + deeper in the substrate and an n − shallower ) aids in program disturb and reverse leakage considerations . in some embodiments , it is advantageous to have the cbi : ( 1 ) have its n - p substrate junction shallower than the isolation sti ( see fig8 ), and ( 2 ) have a super retrograde profile so that the bl resistance is low . for example , a reasonable value is about 500 ohm to 3000 ohm between two bl strap contacts . those skilled in the art will appreciate that the standard process modules such as the shallow trench isolation ( sti ), p - well implant , well annealing , and other processes are skipped for clarity and referred to as the standard cmos flow . fig8 ( a ) is a cross - sectional view of fig6 taken along a - a ′. due to the use of lower energy implants , bls consists of heavily doped n + regions near bl / p - sub junction and lightly doped n − regions near the gate dielectric interface . the bitlines bl are separated by sti isolations ( though other isolation structures may be used ) so that there is no leakage between bls . fig8 ( b ) is a cross - sectional view of fig6 taken along the line b - b ′. note that the cross section is different from standard pmosfets due to the removal of ldd / halo implants . p + doped regions formed in the substrate can be formed from the standard p + source / drain implant and self - aligned to the sidewall spacers . note that they are electrically floating and not physically connected to the channel regions . unlike the prior art , the p + regions do not extend to under the gate , and thus are not in electrical contact with a channel region under the gate . the sidewall spacers on the gates separate the p + regions from the channel . indeed , as noted above , the p + floating regions are not part of the active cell devices and therefore are optional ( and can be masked out ). however , the avoid additional masking steps , they can be left in ( since they are floating and electrically isolated ) and are formed from self - aligned source / drain implant when standard cmos poly gate design rules are used . one way to eliminate the optional p + floating regions is illustrated in fig9 and 10 , which show another embodiment of the memory array . here the gate spacing is so designed such that when standard sidewall spacer deposition is performed , the sidewall spacers conformally fills the space between adjacent wordlines wl as a result , as seen in fig1 ( b ), the space between adjacent gates are substantially filled after spacer etch . this prevents the p + source / drain implants from reaching the semiconductor substrate . cross - sectional views along both a - a ′ and b - b ′ of fig9 are shown in fig1 . as seen in fig1 ( b ), there are no p + regions in the substrate . the benefit of this cell is a more compact array with a potential cell size of 4f 2 . yet another embodiment is illustrated in fig1 and 12 . the memory cell can be made from standard dual - oxide cmos processes . in this embodiment , the gate oxide underneath the gate has a thicker region and a thinner region . the gate dielectric formed under a thicker gate dielectric mask is used to grow a thicker gate dielectric 1101 , which can be the same as that of standard i / o oxide . the objective is to further restrict the breakdown locations away from the gate edges so that cell to cell sneak leakages can be significantly reduced . an example of the use of a thicker gate oxide is shown in commonly assigned u . s . pat . no . 6 , 940 , 751 , which is herein incorporated by reference . cross - sectional views are shown in fig1 . it can be appreciated that various combinations of the multiple concepts described herein may be combined into yet other embodiments . for example , the thicker gate oxide technique may be combined with the blocked source drain implant of fig9 and 10 . still , in yet another embodiment , the floating doped semiconductor regions can be n +- type . as shown in fig1 and 14 , a channel stop implant layer 1301 is used to block the p + source / drain implant and to open an n + channel stop implant 1401 . cross - sectional views are given in fig1 . although this structure provides even better cell to cell leakage current protection after they are programmed , it does require extra process steps and the addition of critical implant masks , with the associated alignment tolerance issues . for otp memories of smaller capacity , the memory array itself is a relatively small percentage of the total die area . in these embedded applications , it is advantageous to develop antifuse memories without introducing added mask and process steps in addition to standard cmos processes . as such , yet another embodiment eliminates the additional cbi mask described above . fig1 shows a layout view of this embodiment . in this embodiment , the bit line implant 1501 is the standard n - well implant mask . instead of covering the whole memory array area , the n - well implant mask covers each active stripe 1503 individually . n - well spacing is designed to prevent bl to bl leakage during programming . the cell size of this embodiment is larger than the others because the regular n - well is deeper than that of sti . cross - sectional views are given in fig1 . note that the above embodiments are for p - type mis cells and can be easily switched to n - type mis cells . programming and read operations are the same for all p - type implementations . a simple polarity change applies to all n - type mis cell embodiments . with fig1 as a reference for a p - type cell implementation , table 1 below provides example bias conditions for both programming and read operations . the cell marked by ‘ sel a ’ is assumed to be the selected cell for both program and read . here the program vpp and read vread are for example only and their actual levels depend on the specific process technology used . for gate dielectrics with thickness of 6 nm to 32 nm , vpp and vread are preferred to be in the range of 3v - 9v and 0 . 7v - 3 . 3v , respectively . for the selected cell ‘ a ’, the capacitor is under accumulation and the full vpp is applied across its gate dielectric . its gate dielectric breaks down and the cell is programmed . for an un - selected cell at ( wli , bln ), the mis capacitor is under deep depletion and the cell will not be disturbed . for the un - selected cell at ( wli , bli ), the programmed cell behaves as a reverse biased diode and its leakage current is extremely small . there is no effective voltage developed across mis cells at ( wlj , bli ) and ( wlj , bln ). during read operations , bias conditions are similar to those of programming except the change from vpp to vread . as described above , the optional floating p + doped regions ( first seen in fig8 ( b )) are a result of self - aligned poly gate and source / drain ion implantations in standard cmos processes . in general , the occurrence of the p + doped regions is undesirable in certain cell array operations . for example , wordline to wordline leakage can potentially occur if the gate sidewall spacer is not thick enough and two neighboring memory cells breakdown at the gate edges towards the same p + region . further , bitline sheet resistance can be much higher underneath the p + regions compared to those under the gate . the above embodiments to remove the p + doped regions have potential drawbacks in that they either require an extra critical mask or the gate spacing is pushed to be smaller than standard cmos design rules . specifically , while the teachings of the embodiment of fig1 may also result in the removal of the p + doped regions , in order to achieve that result using sidewall spacers , the narrow spacing between adjacent gates may be difficult to obtain in a viable manufacturing context . the additional embodiments described below address these issues . the first embodiment described is to “ predope ” the polysilicon gate . in other words , in contrast to other embodiments , the polysilicon layer is doped prior to masking and etching into the gate structure . the layout of the memory array is the same cross - point memory array , like that shown in fig6 . in this embodiment , a mask , such as but not necessarily a cell bitline implant ( cbi ) mask , is used to perform a p + doping of the polysilicon after the polysilicon deposition . this p + doping of the polysilicon is done prior to the gate etch . fig1 is a simplified process flow of this embodiment . as can be seen , in this process ( contrasted to fig7 ), a gate polysilicon “ p + poly pre - implant ” step 1807 is performed after the polysilicon deposition at 1805 . note that step 1805 is meant to represent a myriad of conventional semiconductor manufacturing process steps up to and even after the deposition of the gate polysilicon layer . various embodiments and process nodes will have different combination of steps at box 1805 . however , what is important in this embodiment is that the p + poly pre - implant is performed prior to the gate etching step at the standard cmos flow box 1809 . the implant dose and energy can be the same as those used for a standard p + source and drain implant for a particular process node . with the gate poly pre - implanted , the standard p + source / drain implant at box 1811 can be blocked in the memory cell array after the gate etch . as a result , the cell array has high conductivity p + poly gate without p - ldd ( lightly doped drain ) and p +− s / d regions , as shown in fig1 . yet another alternative embodiment is shown in fig2 . this embodiment may be used , as one example , in conjunction with cmos processes with high - k gate dielectrics and / or replacement metal gate . in such a situation , the polysilicon pre - implant of fig1 is not necessary . fig2 shows an alternative brief process flow . in this process flow , p - type lightly doped drain and halo implantations at box 2007 are blocked in the memory cell array portion of the semiconductor die . the halo implant is known in the art and is used in standard cmos fabrication to suppress punch - through effect . it is a low energy , low current implantation carried out at large incident angle so that implanted dopants penetrate underneath the edge of the mos gate stack . at step 2009 , the sidewall spacers are formed . at step 2011 , there are two alternatives whereby the n + source / drain implants ( commonly used in cmos process ) are either blocked in the cell array or are unblocked in the cell array . finally , at step 2013 , the remaining steps in a standard high - k metal gate process are completed . fig2 illustrates two different cell structures : fig2 ( a ) shows the cell with the n + source / drain implant and fig2 ( b ) shows the cell without the n + source / drain implant in the cell array . the structure of fig2 ( a ) has at least two advantages : ( 1 ) bitline resistance is reduced due to the much higher conductivity of the n + regions , and ( 2 ) the n + regions can prevent any possible wordline to wordline leakage after adjacent cells are programmed . finally , a last embodiment is shown in fig2 which improves parasitic leakage in the memory array . for the exemplary embodiments shown above , diodes are formed between a wordline and bitline after the cell is programmed . as shown in fig1 , the diode at wli and bli is reverse - biased at vpp or vread during programming and read of cell ‘ a ’, respectively . if many of these diodes are “ leaky ” during reverse bias in the cell array , programming or read of the selected cell ‘ a ’ can become difficult . it is well known that diodes formed post dielectric breakdown are not well controlled and of lower quality than process diodes formed from dopant diffusion or implant . this can be particularly true for metal gates where the schottky contact ( between the metal gate and silicon substrate ) formed post - breakdown can be much more leaky compared to doped polysilicon . one way to further improve the memory cell array leakage is to have process diodes between wordlines and bitlines even prior to the cells being programmed . fig2 shows a cross - sectional view of a 3 × 3 cell array along a wordline ( fig2 ( a )) and a bitline ( fig2 ( b )). as shown , one of the cells is programmed with a conductive link 2201 . in contrast to the cells in fig2 , a layer of p - type conductivity is added between the gate dielectric and the n - type bitline . prior to a cell being programmed , it is similar to an n - type enhancement mos transistor in that it has a n + source and drain regions and a p - type channel region ( see fig2 ( b )). when a selected cell is to be programmed by applying program voltage vpp at the gate and vbl at the bitline and therefore n + regions , the channel region of the selected cell is inverted and the gate dielectric breaks down due to the applied high voltage ( vpp − vbl ). cell array operation is similar to fig1 and the difference is in the presence of p - n diodes prior to programming . this can be seen schematically in fig2 . after a cell is programmed , leakage from bitline to wordline is now limited by the reverse - biased leakage of a process diode formed by the doped regions of n - type bitline and the p - type surface layer . there are at least two simple methods for forming the shallow surface p - region . firstly , one can implant the special n - type retrograde bitline inside a nmos p - well such that a surface region remains as p - type . second , a shallow p - type dopant such as boron or bf2 can be implanted right after the n - type bitline implant . this technique may be used if it is difficult to optimize the existing p - well and n - type bitline doping profile . features and aspects of various embodiments may be integrated into other embodiments , and embodiments illustrated in this document may be implemented without all of the features or aspects illustrated or described . one skilled in the art will appreciate that although specific examples and embodiments of the system and methods have been described for purposes of illustration , various modifications can be made without deviating from the spirit and scope of the present invention . moreover , features of one embodiment may be incorporated into other embodiments , even where those features are not described together in a single embodiment within the present document . accordingly , the invention is described by the appended claims . | 7 |
the present invention is described in detail below with reference to embodiments . fig1 is a schematic sectional drawing of a ceramic - coated heat resisting alloy member in an embodiment of the present invention . fig5 and 6 are respectively schematic sectional views of conventional ceramic - coated heat resisting alloy members . in each of fig1 and 6 , reference numeral 1 denotes a ceramic coating layer ; reference numeral 2 , a heat resisting alloy base metal ; reference numeral 3 , an alloy layer comprising an alloy exhibiting resistance to high temperature oxidation and resistance to high temperature corrosion which are superior to the resistance of the base metal ; and reference numeral 4 , a mixture layer comprising the above - described alloy and ceramics . the material comprising the ceramic coating layer 1 is a zro 2 - type ceramics which is composed of zro 2 as a main component and y 2 o 3 , mgo , cao and so on as additional components . the material comprising the alloy layer 3 is composed of at least one of co and ni , cr and al and at least one of hf , ta , y , si and zr . the mixture layer 4 comprises a mixture containing zro 2 - type ceramics and the alloy material . in the embodiment of the present invention shown in fig1 the two alloy layers 3 may comprise the same alloy or alloys composed of different components . the method of forming each of the layers is not particularly limited , but a plasma spray coating method is preferable from the viewpoint of the high material deposition velocities and the good workability . an electron beam vacuum evaporation method or a sputtering method may be used as a method of forming a coating layer such as an alloy layer or the like with a relatively small thickness . an ni - based alloy in - 738 was used as a base metal , and a surface thereof was then degreased and then subjected to blasting using an alumina grit . an alloy layer was then formed on the base metal by plasma spray coating using an alloy material comprising 32 % by weight of ni , 21 % by weight of cr , 8 % by weight of al , 0 . 5 % by weight of y and the balance composed of co . the plasma spray coating was performed at pressure of 200 torr in an atmosphere of ar . the power of plasma was 40 kw . the alloy layer formed under these conditions had a thickness of 0 . 1 mm . a mixture comprising a ceramic powder containing zro 2 and 8 % by weight of y 2 o 3 and alloy powder having the above - described composition was then spray - coated on the alloy layer formed . the mixing ratio between the metal and ceramic power was 2 : 1 . the conditions of spray coating were the same as those employed in the formation of the alloy layer . in this way , a mixture layer comprising the mixture of ceramics and a metal was formed on the alloy layer . the thickness of the mixture layer was 0 . 02 to 0 . 6 mm . an alloy powder having the above - described composition was then spray - coated on the mixture layer under the same conditions as those employed in the formation of the alloy layer to form an alloy layer having a thickness of 0 . 02 to 0 . 6 mm . a powder comprising zro 2 and 8 % by weight of y 2 o 3 was further spray - coated on the alloy layer formed . the spray coating was performed with a plasma power of 50 kw in the atmosphere . the thickness of the coating layer comprising zro 2 and 8 % by weight of y 2 o 3 was 0 . 3 to 1 . 2 mm . heating treatment was then effected at 1120 ° c . for 2 hours under vacuum so that the base metal and the alloy layer in contact with the base metal were subjected to diffusion treatment . conventional tbc test pieces comprising a base metal , an alloy layer and a ceramic coating layer and comprising a base metal , an alloy layer , a mixture layer and a ceramic coating layer were also produced for the purpose of comparison . the production conditions and coating material used were the same as those of the tbc test pieces of the present invention . each of the test pieces had a size of 20 mm × 70 mm × 3 mm . table 1 shows the results of repeated load tests conducted for the ceramic - coated test pieces of the present invention and conventional ceramic - coated test pieces which were formed for the purpose of comparison . in table 1 , sample nos . 1 and 8 concern the conventional ceramic - coated test pieces and sample nos . 9 to 23 concern the ceramic - coated test pieces of the present invention . each of the repeated heat load tests was performed by repeatedly heating and cooling between 170 ° c . and 1000 ° c ., and evaluation was conducted by examining the presence of damage in each of the ceramic - coated test pieces . the thickness of the ceramic coating layers in each of the ceramic - coated test pieces of the present invention is preferably 1 . 0 mm or less . table 1______________________________________results of repeated heat load teststhickness of ( mm ) sample ceramic alloy mixture alloyno . layer layer i layer layer ii n * ______________________________________ 1 0 . 3 -- -- 0 . 1 500 2 0 . 4 -- -- 0 . 1 250 3 0 . 6 -- -- 0 . 1 70 4 0 . 4 -- -- 0 . 05 230 5 0 . 4 -- 0 . 2 0 . 1 90 6 0 . 6 -- 0 . 2 0 . 1 45 7 0 . 8 -- 0 . 2 0 . 1 25 8 0 . 4 -- 0 . 4 0 . 1 120 9 0 . 4 0 . 1 0 . 2 0 . 1 125010 0 . 6 0 . 1 0 . 2 0 . 1 90011 0 . 8 0 . 1 0 . 2 0 . 1 75012 1 . 0 0 . 1 0 . 2 0 . 1 60013 1 . 2 0 . 1 0 . 2 0 . 1 9514 0 . 4 0 . 02 0 . 2 0 . 1 25015 0 . 4 0 . 03 0 . 2 0 . 1 90016 0 . 4 0 . 3 0 . 2 0 . 1 120017 0 . 4 0 . 5 0 . 2 0 . 1 80018 0 . 4 0 . 6 0 . 2 0 . 1 16019 0 . 4 0 . 1 0 . 02 0 . 1 27020 0 . 4 0 . 1 0 . 03 0 . 1 95021 0 . 4 0 . 1 0 . 3 0 . 1 110022 0 . 4 0 . 1 0 . 5 0 . 1 85023 0 . 4 0 . 1 0 . 6 0 . 1 200______________________________________ n *: number of times of repeated heat load until damage occurs in ceramic coating there is a tendency that the durability of a test piece to the repeated heat load test deteriorates if the thickness of the ceramic coating layer is more than 1 mm , as in sample no . 13 shown in table 1 . the thickness of the alloy layer ( the alloy layer 1 shown in table 1 ) between the ceramic coating layer 1 and the mixture layer 4 is preferably within the range of 0 . 03 to 0 . 5 mm . there is also a tendency that the durability to the repeated heat load test deteriorates if the thickness of the alloy layer i is out of the above - described range , as in sample nos . 14 and 18 shown in table 1 . if the thickness of the alloy layer i is small , the alloy layer is unsatisfactory as a layer for preventing any oxidation or corrosion through the ceramic coating layer . on the other hand , if the thickness of the alloy layer i is large , the alloy layer itself functions as a layer which newly produces thermal stress and thus cancels the thermal stress reducing function of the mixture layer 4 . the thickness of the mixture layer 4 is preferably within the range of 0 . 03 to 0 . 5 mm . when the thickness of the mixture layer is out of the above - described range , as in example nos . 19 and 23 shown in table 1 , the durability to the repeated heat load test deteriorates . when the thickness of the mixture layer is small , the mixture layer has an unsatisfactory function of reducing thermal stress . while when the thickness of the mixture layer is large , the mixture layer itself has a relatively low level of strength , as compared with the alloy layer and so on , and is thus broken owing to the thermal stress produced by the increase in the thickness of the mixture layer . the thickness of the alloy layer ii shown in table i is not particularly limited , but it is preferably within the range of 0 . 03 to 0 . 5 mm . the reason for this is the same as the alloy layer i shown in table 1 . the mixing ratio between the ceramics and the metal in the mixture layer is not particularly limited . the mixing ratio of the metal to the ceramics in each of the mixture layers shown in table 1 is 2 / 1 . when the inventors have investigated mixture layers with other mixing ratios , the results obtained with the other mixing ratios were substantially the same as those shown in table 1 . investigations have also been made on mixture layers in which a mixing ratio was gradually changed from a high ratio of metal to a high ratio of ceramics . the effect was not so clear and was substantially the same as that obtained by the provision of a mixing layer with a uniform mixing ratio . after each of the test pieces had been subjected to the high temperature oxidation test , it was subjected to a repeated heat load test which was the same as that described above . the temperature of the high temperature oxidation test was 1000 ° c ., and the oxidation time was 500 hours . as a result , the ceramic coating layer of each of the ceramic - coated test pieces of sample nos . 5 to b shown in table 1 was damaged and separated . on the other hand , as a result of repeated heat load tests of the other test pieces , each of the test pieces of sample nos . 1 to 4 exhibited a number of the times of heat load tests repeated until damage occurred which was reduced by 20 to 40 % and thus exhibited deteriorated durability . while the ceramic - coated test pieces shown in table 1 within the range of the present invention exhibited substantially the same results as those shown in table 1 . it was also observed that some of the test pieces within the range of the present invention exhibited increased numbers of the times of tests repeated until damage occurred . each of the test pieces was then subjected to a high temperature corrosion test using a molten salt coating method . the test was conducted by a method in which a molten salt comprising 25 % nacl and 75 % na2so4 was coated on each of the test pieces which was then heated at 850 ° c . for 300 hours in the atmosphere . each of the test pieces was then subjected to the repeated heat lead test which was the same as that described above . as a result , the ceramic coating of each of the test pieces of sample nos . 5 to 8 shown in table 1 was damaged after the high temperature corrosion test . the results of the repeated heat load tests showed that each of the test pieces of sample nos 5 to 8 exhibited a number of the times of tests repeated until damage occurred in the ceramic coating which was reduced by 20 to 0 %, and thus exhibited slightly deteriorated durability . while the test pieces shown in table 1 within the range of the present invention exhibited a number of the times of the tests repeated until damage occurred in the ceramic coatings which were the substantially the same as the results shown in table 1 and particularly no deterioration in the durability thereof . fig2 and 4 respectively show other embodiments of the present invention . in each of the embodiments , reference numeral 1 denotes a ceramic coating layer ; reference numeral 2 , a base metal ; reference numeral 3 , an alloy layer ; reference numeral 4 , a mixture layer ; and a reference numeral 5 , an oxide layer mainly composed of al . in each of the embodiments shown in fig2 and 4 , the oxide layer mainly composed of al can be formed by heat treatment of the ceramic coated alloy member . the heat treatment is preferably carried out in the atmosphere under such conditions that the temperature is within the range of 600 ° to 1200 ° c . and the time is 1 to 200 hours . the thickness of each oxide layer is preferably 0 . 1 μm to 20 μm . if the oxide layer is thin , the oxide layer exhibits a reduced level of the effect , while if the oxide layer is thick , the oxide layer itself newly produces thermal stress . in each of fig3 and 4 , the embodiment has a structure in which the mixture layer directly contacts with the base metal . in the ceramic coating of the present invention , since the thermal stress reducing function of the mixture layer is stably maintained under the conditions of high temperature oxidation or high temperature corrosion , there is no particular problem even if no alloy layer is interposed between the mixture layer and the base metal . although the method of producing the alloy layer in any of the above - described ceramic - coated heat resisting alloy member of the present invention is not particularly limited , it is preferably to use plasma spray coating at a pressure which is reduced to a value below the atmospheric pressure in an atmosphere which comprises a shield gas or an inert gas . the method of producing the mixture layer of ceramics and a metal is the same as that above described . in the case of the alloy layer formed by plasma spray coating in an atmosphere at a reduced pressure , the alloy powder used is not easily oxidized during spray coating , and thus the alloy layer formed is a coating layer having a dense structure in which no contaminants such as oxide coating is mixed . in the mixture layer , the alloy powder comprising the mixture layer is not easily oxidized , and thus the metal portion in the mixture layer is a coating layer having no contaminants such as the oxide coating mixed therein . in addition , when each of the embodiments of the ceramic - coated heat resisting alloy member of the present invention shown in fig1 and 3 is used for a long period under conditions of high temperature oxidation , an oxide layer mainly composed of al is formed at the boundary between the ceramic coating layer and the alloy layer . as described above , in each of conventional known ceramic - coated members , the mixture layer itself which comprises a mixture of a metal and ceramics is damaged and thus cannot exhibit its primary function of reducing the thermal stress produced between the ceramic coating layer and the base metal under the conditions of high temperature oxidation or high temperature corrosion . the mixture layer rather produces new thermal stress and thus exhibits durability which is inferior to that of a ceramic coating provided with no mixture layer , for example , in a repeated heat load test . while , in the ceramic coating of the present invention , the mixture layer exhibits its function of reducing thermal stress even at high temperature or under high temperature corrosive conditions and is thus effective to improve the durability of the ceramic coating . in addition , when the thickness of the ceramic coating layer is increased , the ceramic - coated heat resisting alloy member formed exhibits no deterioration in its durability , as well as exhibiting a high level of heat barrier effect and high performance . pretreatment of an ni - based alloy in - 738 which was used as a base metal was performed by the same method as in example 1 , and an alloy layer and a mixture layer were then formed using the materials and the method which were the same as those used in example 1 . the thickness of the alloy layer formed was 0 . 1 mm and the thickness of the mixture layer was 0 . 2 mm . the mixing ratios between the ceramics and the metals used in the mixture layers are as shown in table 2 . an alloy powder having the same composition as in example 1 was then spray - coated on the mixture layers under the same conditions as those employed in example 1 to form an alloy layer having a thickness of 0 . 1 mm . a ceramic layer was then formed on the alloy layer using the materials and the method which were the same as those employed in example 1 . the thickness of the ceramic layer was 0 . 4 mm . heating treatment was then effected at 1120 ° c . for 2 hours under vacuum so that the base metal and the alloy layer in contact with the base metal were subjected to diffusion treatment . table 2______________________________________number of times of heat load tests repeated untildamage occurs in ceramic coatingtest mixing ratio . sup . ( 4 ) ( m / c ) method 4 / 1 2 / 1 1 / 1 1 / 2 1 / 4______________________________________repeated heat load test . sup . ( 1 ) 1170 1250 1200 1270 1150repeated heat load test 1250 1170 1250 1350 1100after high temperatureoxidation test . sup . ( 2 ) repeated heat load test 1100 1150 1150 1170 1050after high temperaturecorrosion test . sup . ( 3 ) ______________________________________ . sup . ( 1 ) repeated heat load test : 1000 ° c . . sub . [ 170 ° c . . sup . ( 2 ) high temperature oxidation test : 1000 ° c ., 500 hours ( heating in the atmosphere ) . sup . ( 3 ) high temperature corrosion test : 850 ° c ., 300 hours ( 25 % nacl + 75 % na . sub . 2 so . sub . 4 ) . sup . ( 4 ) m / c : a ratio by volume of the metal to ceramics each of the thus - formed ceramic - coated heat resisting alloy test pieces was then subjected to the repeated heat load test which was the same as that described above . table 2 shows the number of the times of heat load tests repeated until the ceramic coating of each of the test pieces was damaged . in the high temperature oxidation tests at 1000 ° c . for 500 hours , no damage was observed in any ceramic coating after the oxidation tests . when the repeated heat load tests of the test pieces were conducted in the same way as that described above , the numbers obtained of the times of tests repeated until the ceramic coatings were damaged are shown in table 2 . when a molted salt comprising 25 % nacl and 75 % na 2 so 4 was then spray - coated on each of the test pieces which were then subjected to high temperature corrosion tests performed by heating in the atmosphere at 850 ° c . for 300 hours , no damage was observed in any ceramic coating . when the repeated heat tests using the test pieces which had been subjected to high temperature corrosion tests were conducted in the same manner as that described above , the number obtained of the times of tests repeated until each ceramic coating was damaged are shown in table 2 . on the other hand , a conventional ceramic - coated test pieces formed for the purpose of comparison showed substantially the same results as those exhibited by samples nos . 1 to 8 in table 1 . the ceramic coating of the present invention is therefore superior to conventional coating with respect to its resistance to high temperature oxidation and resistance to high temperature corrosion , as well as exhibiting excellent thermal durability . pretreatment of a ni - based alloy in738 which was used as a base metal was effected by the same method as that employed in example 1 . an alloy layer and a mixture layer were then formed on the base metal using the materials and the method which were the same as those employed in example 1 . the mixing ratio between the ceramics and the metal in the mixture layer was 1 : 1 . the thickness of the mixing layer was also the same as that in example 1 . an alloy layer having a thickness of 0 . 02 mm was then formed on the mixture layer by sputtering using as a target an alloy material comprising 32 % by weight of ni , 21 % by weight of cr , 8 % by weight of al , 0 . 5 % by weight of y and the balance composed of co . the sputtering was performed under such conditions that the applied voltage was 2 kv and the treatment time was 2 hours . a ceramic coating layer was then formed in the same method as that employed in example 1 . heat treatment was then effected at 1120 ° c . for 2 hours so that diffusion treatment was effected . when the thus - formed ceramic - coated heat resisting alloy test piece was subjected to the durability test in the same manner as that in example 1 , the results obtained were substantially the same as those in example 1 . a ceramic - coated heat resisting alloy test piece was formed by using the materials and the method which were the same as those employed in example 1 . the thus - formed test piece was then heated in the atmosphere at 950 ° c . for 20 hours to form an oxide layer mainly composed of al 2 o 3 at the boundary between the ceramic coating layer and the alloy layer . as a result of observation of the cross - section texture of the test piece , the thickness of the oxide layer was about 5 μm . as a result of x - ray microanalyzing observation , al and o were present in a large part of the portion which correspond to the oxide layer , with cr being present in part of the portion . the thus - formed ceramic - coated heat resisting alloy test piece was then subjected to the durability test which was conducted in the same way as in example 1 . as result , the performance of the test piece was substantially the same as that obtained in example 1 . pretreatment of a co - based alloy fsx414 used as a base metal was performed by the same method as that employed in example 1 . a ceramic - coated heat resisting alloy test piece was formed by using the same materials those used in example 1 . the method of producing the test piece was a method in which a mixture powder comprising a metal and ceramics in a mixing ratio of 1 : 1 was spray - coated on a surface of the base metal . the spray coating was effected at pressure of 200 torr in an atmosphere of ar . the plasma power was 40 kw . the thickness of the mixture layer was 0 . 3 mm . an alloy layer was then formed on the mixture layer by spray coating under the same conditions as those employed in the formation of the mixture layer . the thickness of the alloy layer was 0 . 1 mm . a ceramic coating layer was then formed on the alloy layer by spray coating in the atmosphere with a plasma power of 50 kw . the thickness of the ceramic coating layer was 0 . 4 mm . the thus - formed ceramic - coated heat resisting alloy test piece of the present invention was then subjected to the durability test which was the same as in example 1 . the results obtained were substantially the same as those obtained in example 1 . a ceramic - coated heat resisting alloy test piece was formed by using the materials and the method which were the same as those employed in example 5 . the test piece was then heated in the atmosphere at 1000 ° c . for 15 hours to form an oxide layer mainly composed of al 2 o 3 at the boundary between the ceramic coating layer and the alloy layer . as a result of observation of the cross - sectional texture of the test piece , the thickness of the oxide layer was about 7 μm . the result of x - ray microanalyzing observation showed that al and o are present in a large area of the oxide layer , with cr being present in part of the oxide layer . when the thus - formed ceramic - coated heat resisting alloy test piece of the present invention was then subjected to the durability test which was the same as that employed in example 1 , substantially the same results were obtained . as described above , the present invention is capable of preventing the progress of high temperature oxidation or high temperature corrosion of the mixture layer comprising a metal and ceramics . the function of reducing thermal stress which is the principal purpose of the provision of the mixture layer can thus be stably maintained , as well as the reliability of the ceramic - coated heat resisting alloy member formed being improved . | 8 |
referring now to the drawings , in which like numerals refer to like components or steps , there are disclosed broad aspects of various exemplary embodiments . fig1 illustrates an exemplary subscriber network 100 for providing various data services . exemplary subscriber network 100 may be a communications network , such as an lte or 4g mobile communications network , for providing access to various services . the network 100 may include user equipment 110 , base station 120 , evolved packet core ( epc ) 130 , packet data network 140 , and application function ( af ) 150 . user equipment 110 may be a device that communicates with packet data network 140 for providing an end - user with a data service . such data service may include , for example , voice communication , text messaging , multimedia streaming , and internet access . more specifically , in various exemplary embodiments , user equipment 110 is a personal or laptop computer , wireless email device , cell phone , television set - top box , or any other device capable of communicating with other devices via epc 130 . base station 120 may be a device that enables communication between user equipment 110 and epc 130 . for example , base station 120 may be a base transceiver station such as an evolved nodeb ( enodeb ) as defined by 3gpp standards . thus , base station 120 may be a device that communicates with user equipment 110 via a first medium , such as radio waves , and communicates with epc 130 via a second medium , such as ethernet cable . base station 120 may be in direct communication with epc 130 or may communicate via a number of intermediate nodes ( not shown ). in various embodiments , multiple base stations ( not shown ) may be present to provide mobility to user equipment 110 . note that in various alternative embodiments , user equipment 110 may communicate directly with epc 130 . in such embodiments , base station 120 may not be present . evolved packet core ( epc ) 130 may be a device or association of devices that provides user equipment 110 with gateway access to packet data network 140 . epc 130 may further charge a subscriber for use of provided data services and ensure that particular quality of experience ( qoe ) standards are met . thus , epc 130 may be implemented , at least in part , according to the 3gpp ts 29 . 212 , 29 . 213 , and 29 . 214 standards . accordingly , epc 130 may include a serving gateway ( sgw ) 132 , a packet data network gateway ( pgw ) 134 , a policy and charging rules node ( pcrn ) 136 , and a subscription profile repository ( spr ) 138 . serving gateway ( sgw ) 132 may be a device that provides gateway access to the epc 130 to an end user of network 100 . sgw 132 may be the first device within the epc 130 that receives packets sent by user equipment 110 . sgw 132 may forward such packets toward pgw 134 . sgw 132 may perform a number of functions such as , for example , managing mobility of user equipment 110 between multiple base stations ( not shown ) and enforcing particular quality of service ( qos ) characteristics for each flow being served . in various implementations , such as those implementing the proxy mobile ip ( pmip ) standard , sgw 132 may include a bearer binding and event reporting function ( bberf ). in various exemplary embodiments , epc 130 may include multiple sgws ( not shown ) and each sgw may communicate with multiple base stations ( not shown ). packet data network gateway ( pgw ) 134 may be a device that provides gateway access to packet data network 140 to an end user of network 100 . pgw 134 may be the final device within the epc 130 that receives packets sent by user equipment 110 toward packet data network 140 via sgw 132 . pgw 134 may include a policy and charging enforcement function ( pcef ) that enforces policy and charging control ( pcc ) rules for each service data flow ( sdf ). therefore , pgw 134 may be a policy and charging enforcement node ( pcen ). pgw 134 may include a number of additional features such as , for example , packet filtering , deep packet inspection , and subscriber charging support . pgw 134 may also be responsible for requesting resource allocation for unknown application services . upon receiving a request for an unknown application service from ue 110 , pgw may construct a credit control request ( ccr ), such as , for example , ccr 170 , requesting an appropriate allocation of resources and forward the request to pcrn 136 . it should be noted that while exemplary network 100 corresponds to one particular implementation of long term evolution ( lte ), many variations may exist . for example , sgw 132 may not be present , pgw 134 may not be present , and / or the functions of sgw 132 and pgw 134 may be consolidated into a single device or spread across multiple additional devices . policy and charging rules node ( pcrn ) 136 may be a device that receives requests related to service data flows ( sdfs ) and ip - can sessions , generates pcc rules , and provides pcc rules to the pgw 134 and / or other pcens ( not shown ). pcrn 136 may be in communication with af 150 via an rx interface . pcrn 136 may receive an application request in the form of an aa - request ( aar ) 160 from af 150 . upon receipt of aar 160 , pcrn 136 may generate at least one new pcc rule for fulfilling the application request 160 . pcrn 136 may also be in communication with sgw 132 and pgw 134 via a gxx and a gx interface , respectively . pcrn 136 may receive a request in the form of a credit control request ( ccr ) 170 from sgw 132 or pgw 134 . as with aar 160 , upon receipt of ccr 170 , pcrn may take appropriate action in response , such as , for example , generating at least one new pcc rule for fulfilling and / or responding to the ccr 170 . in various embodiments , aar 160 and ccr 170 may represent two independent requests to be processed separately , while in other embodiments , aar 160 and ccr 170 may carry information regarding a single request , and pcrn 136 may take action based on the combination of aar 160 and ccr 170 . in various embodiments , pcrn 136 may be capable of handling both single - message and paired - message requests . upon creating a new pcc rule or upon request by the pgw 134 , pcrn 136 may provide a pcc rule to pgw 134 via the gx interface . in various embodiments , such as those implementing the pmip standard for example , pcrn 136 may also generate quality of service ( qos ) rules . upon creating a new qos rule or upon request by the sgw 132 , pcrn 136 may provide a qos rule to sgw 132 via the gxx interface . in processing various requests and other messages , pcrn 136 may make use of one or more behavioral rules , the details of which will be described below with reference to fig2 - 6 . pcrn 136 may locate an applicable behavioral rule for a particular request , conflict , or event , and take at least one action specified by the applicable behavioral rule . in various embodiments , such a behavioral rule may include a reference to a predefined routine that the pcrn 136 may perform in response to a request or other message . subscription profile repository ( spr ) 138 may be a device that stores information related to subscribers to the subscriber network 100 . thus , spr 138 may include a machine - readable storage medium such as read - only memory ( rom ), random - access memory ( ram ), magnetic disk storage media , optical storage media , flash - memory devices , and / or similar storage media . spr 138 may be a component of pcrn 136 or may constitute an independent node within epc 130 . data stored by spr 138 may include an identifier of each subscriber and indications of subscription information for each subscriber such as , for example , subscriber category , bandwidth limits , charging parameters , and subscriber priority . packet data network 140 may be a network ( e . g ., the internet or another network of communications devices ) for providing data communications between user equipment 110 and other devices connected to packet data network 140 , such as af 150 . packet data network 140 may further provide , for example , phone and / or internet service to various user devices in communication with packet data network 140 . application function ( af ) 150 may be a device that provides a known application service to user equipment 110 . thus , af 150 may be a server or other device that provides , for example , a video streaming or voice communication service to user equipment 110 . af 150 may further be in communication with the pcrn 136 of the epc 130 via an rx interface . when af 150 is to begin providing known application service to user equipment 110 , af 150 may generate an application request message , such as an aa - request ( aar ) 160 defined by the diameter protocol , to notify the pcrn 136 that resources should be allocated for the application service . this application request message may include information such as an identification of a subscriber using the application service and an identification of the particular service data flows desired to be established in order to provide the requested service . af 150 may communicate such an application request to the pcrn 136 via the rx interface . having described the components of subscriber network 100 , a brief summary of the operation of subscriber network 100 will be provided . it should be apparent that the following description is intended to provide an overview of the operation of subscriber network 100 and is therefore a simplification in some respects . the detailed operation of subscriber network 100 will be described in further detail below in connection with fig2 - 6 . pcrn 136 may receive a request for establishment of a service data flow ( sdf ) such as , for example , aar 160 and / or ccr 170 . in attempting to establish the requested sdf , pcrn 136 may determine that there is a conflict between the request and a subscriber profile . for example , the request may specify that 512 kbps of bandwidth is requested while a subscriber record may indicate that the subscriber is only allowed to have 256 kbps of bandwidth . to resolve this conflict , pcrn 136 may locate an applicable behavioral rule that indicates that the request should be rejected . subsequently , pcrn 136 may reject the request in accordance with the applicable rule . fig2 illustrates an exemplary policy and charging rules node ( pcrn ) for providing externalized behavior . pcrn 136 may include a gxx interface 205 , a gx interface 210 , an rx interface 215 , a message handler 220 , a context information module 225 , a policy decision engine 230 , a rule storage 235 , a routine storage 240 , a user interface 245 , a rule manager 250 , and a routine manager 255 . gxx interface 205 may be an interface comprising hardware and / or executable instructions encoded on a machine - readable storage medium configured to communicate with a sgw such as sgw 132 . such communication may be implemented according to the 3gpp ts 29 . 212 . thus , gxx interface 205 may receive requests for qos rules and transmit qos rules for installation . gxx interface 205 may further receive ue - originated application requests , session requests , and event notifications in the form of a ccr . gx interface 210 may be an interface comprising hardware and / or executable instructions encoded on a machine - readable storage medium configured to communicate with a pgw such as pgw 134 . such communication may be implemented according to the 3gpp ts 29 . 212 . thus , gx interface 210 may receive requests for pcc rules and transmit pcc rules for installation . gx interface 210 may further receive ue - originated application requests , session requests , and event notifications in the form of a ccr . rx interface 215 may be an interface comprising hardware and / or executable instructions encoded on a machine - readable storage medium configured to communicate with af 150 . such communication may be implemented according to the 3gpp ts 29 . 214 . for example , rx interface 215 may receive application requests , session requests , and event notifications in the form of an aar . message handler 220 may include hardware and / or executable instructions on a machine - readable storage medium configured to process application and session requests received via gxx interface 205 , gx interface 210 , and rx interface 215 . for example , message handler 220 may create and install new pcc rules in response to an application request . as a further example , message handler 220 may establish , modify , or terminate ip - can sessions and gateway control sessions in response to a session request . after fully processing a message , message handler 220 may construct and transmit a message over gxx interface 205 , gx interface 210 , and / or rx interface 215 to notify other nodes as to the result of processing the message . for example , if message handler 220 creates a new pcc rule in response to a request message , it may construct a reauthorization request ( rar ) message to push the new pcc rule to an appropriate pgw . in processing various messages , message handler 220 may request a policy decision from policy decision engine 230 and base at least part of its response to the message on the policy decision results . message handler 220 may provide context information from the message to policy decision engine 230 , either directly or via context information module 225 . policy decision results may include an indication of an action that the message handler 220 should take in response to the message , in which case message handler may perform the specified action . alternatively or additionally , policy decision results may include an indication of a predefined routine . in such a case , message handler 220 may retrieve the predefined routine from routine storage 240 and subsequently perform the routine . as will be described in further detail with reference to fig4 below , such a predefined routine may include one or more steps or actions to be taken by the message handler 220 . context information module 225 may include hardware and / or executable instructions on a machine - readable storage medium configured to provide various context information to policy decision engine 230 . for example , context information module 225 may store information carried by a received message . context information module 225 may further store previously received and / or transmitted messages associated with a subscriber , session , and / or service data flow . context information module 225 may further access information stored elsewhere such as , for example , subscriber information stored in an spr such as spr 138 . policy decision engine 230 may include hardware and / or executable instructions on a machine - readable storage medium configured to identify rules stored in rule storage 235 that are applicable to a received message or current context . as will be described in further detail below with respect to fig3 , each rule may include a criteria section which indicates when a rule is applicable . policy decision engine 230 may compare this criteria section to context information passed by message handler 220 and / or retrieved from context information module 225 . upon locating an applicable rule , policy decision engine 230 may return the results portion of the rule to message handler 220 . rule storage 235 may be any machine - readable medium capable of storing policy decision rules for use by policy decision engine 230 . accordingly , rule storage 235 may include a machine - readable storage medium such as read - only memory ( rom ), random - access memory ( ram ), magnetic disk storage media , optical storage media , flash - memory devices , and / or similar storage media . in various alternative embodiments , rule storage 235 may be a device that is external to pcrn 136 . as will be described in further detail below with respect to fig3 , rule storage 235 may store definitions of numerous policy decision rules . routine storage 240 may be any machine - readable medium capable of storing predefined routines for use by message handler 220 . accordingly , routine storage 240 may include a machine - readable storage medium such as read - only memory ( rom ), random - access memory ( ram ), magnetic disk storage media , optical storage media , flash - memory devices , and / or similar storage media . routine storage 240 may be an independent storage device or may be the same as rule storage 235 . in various alternative embodiments , routine storage 240 may be a device that is external to pcrn 136 . as will be described in further detail below with respect to fig4 , routine storage 245 may store definitions of numerous predefined routines . such definitions may include , for example , a name , conditional statements , and / or indications of actions to be taken . user interface 245 may include hardware and / or executable instructions on a machine - readable storage medium configured to provide a user with access to pcrn 136 . user interface 245 may receive input from a user and may include hardware such as , for example , a keyboard and / or mouse . user interface 245 may also display information as output to the user and may include , for example , a monitor . a user may access rule manager 250 and / or routine manager 255 via user interface 245 . rule manager 250 may include hardware and / or executable instructions on a machine - readable storage medium configured to define , modify , and otherwise manage policy decision rules . for example , rule manager 250 may receive a definition of a new policy decision rule via user interface 245 , format the definition according to a standard policy decision rule syntax used by pcrn 136 , and store the definition in rule storage 235 . rule manager 250 may further provide a definition of an existing policy decision rule to a user upon request via user interface 245 . rule manager 250 may subsequently receive a modified rule definition , format the definition if necessary , and store the definition in rule storage 235 . in storing a modified definition , rule manager 250 may overwrite an existing definition or store the modified definition as a new version of the policy decision rule while preserving the old definition . thus , rule manager 250 may provide version control functionality . routine manager 255 may include hardware and / or executable instructions on a machine - readable storage medium configured to define , modify , and otherwise manage routines . for example , routine manager 255 may receive a definition of a new routine via user interface 250 , format the definition according to a standard routine syntax used by pcrn 136 , and store the definition in routine storage 240 . routine manager 255 may further provide a definition of an existing routine to a user upon request via user interface 250 . routine manager 255 may subsequently receive a modified routine definition , format the definition if necessary , and store the definition in routine storage 240 . in storing a modified definition , routine manager 255 may overwrite an existing definition or store the modified definition as a new version of the routine while preserving the old definition . thus , routine manager 255 may provide version control functionality . fig3 illustrates an exemplary data arrangement 300 for storing policy decision rules . data arrangement 300 may be , for example , a table in a database stored in rule storage 235 ( fig2 ), spr 138 ( fig1 ), or another node ( not shown ) within epc 130 ( fig1 ). alternatively , data arrangement 300 could be a series of linked lists , an array , or a similar data structure . thus , it should be apparent that data arrangement 300 is an abstraction of the underlying data ; any data structure suitable for storage of the underlying data may be used . data arrangement 300 may include various rule sets for use in policy decisions related to various types of messages and in other contexts . rule sets may be defined based on various context aspects . for example , each rule set may be defined to apply to certain received messages such as an ip - can modification request or service data flow request . additionally or alternatively , rules sets may be defined to apply to particular conflicts or events that may prompt the request for a policy decision function such as , for example , the loss of a bearer , a request for more resources than are available , or a request for more resources than are allowed for a particular subscriber . in the example of data arrangement 300 , rule set 310 may include rules applicable when a subscriber has requested more bandwidth than the subscriber is allowed . it should be noted that rule set 310 is a simplification in some respects . for example , rule set 310 may be applicable to requests for one or more of the following : aggregate maximum bandwidth , maximum bandwidth , and guaranteed bandwidth . data arrangement 300 may include additional rule sets 320 . rule set 310 may include a number of rules 312 , 314 , 316 , 318 . each rule may include a criteria section for use in determining whether the rule is applicable and a result section for indicating an action to be taken if the rule is applicable . as an example , rule 312 indicates that it is applicable when the subscriber category is ‘ silver .’ it should be noted that the exemplary criteria section is in some respects a simplification and that various implementations may use additional and / or alternative conditions for application of a rule . rule 312 further indicates that , when applicable , the pcrn 136 should reject the message being processed . a result section may indicate more than one action to be taken by a pcrn such as pcrn 136 . as an example , rule 314 may indicate that it is applicable when the subscriber category is ‘ gold .’ when applicable , rule 314 indicates that the request should be first resized such that it would not create a conflict . rule 314 further indicates that the resized request should be returned to the requesting node as a counteroffer . thereafter , the requesting node may submit an additional request in accordance with the counter offer which the pcrn 136 may process as a new request . in various embodiments , a rule may indicate a predefined routine that the pcrn 136 should follow in responding to the message . thus , rule 316 indicates that it is applicable when the subscriber category is ‘ platinum ,’ and that the pcrn should perform a routine having the name plat_bw in responding to the current message . as will be described in further detail with respect to fig4 below , plat_bw may include indications of actions to be taken and / or instructions to be executed by the pcrn 136 . rule set 310 may include additional rules 318 . fig4 illustrates an exemplary data arrangement 400 for storing predefined routines . data arrangement 400 may be , for example , a table in a database stored in routine storage 240 ( fig2 ), spr 138 ( fig1 ), or another node ( not shown ) within epc 130 ( fig1 ). alternatively , data arrangement 400 could be a series of linked lists , an array , or a similar data structure . thus , it should be apparent that data arrangement 400 is an abstraction of the underlying data ; any data structure suitable for storage of the underlying data may be used . data arrangement 400 may include a routine 410 and additional routines 420 . in various embodiments , routines 410 , 420 may be organized within routine sets ( not shown ) similar to the rule sets 310 , 320 used in data arrangement 300 ( fig3 ). in such embodiments , rules within a particular rule set can reference those routines within the corresponding routine set . in other embodiments , data arrangement 400 may not include routine sets , and any rule may be able to reference any routine , regardless of the rule set to which the rule belongs . routine 410 may be identified as “ plat_bw ,” and may contain instructions for execution by the pcrn 136 . it should be noted that the particular routine 410 is defined in terms of pseudocode . in various implementations , routine 410 may contain compiled instructions , interpreted instructions , and / or enumerated actions to be taken similar to those used in exemplary rules 312 , 314 . thus , predefined routines such as routines 410 , 420 may be of any complexity , including single step routines . routine 410 may indicate that pcrn 136 should compare the requested bandwidth to the bandwidth allowed for the relevant subscriber . such allowed bandwidth may be retrieved from , for example , a record stored in an spr such as spr 138 . if the requested bandwidth does not exceed the allowed bandwidth by more than 128 kb , then the pcrn 136 should simply create a pcc rule according to the request . if , on the other hand , the requested bandwidth exceeds the allowed bandwidth by more than 128 kb , then the pcrn 136 should create a pcc rule according to the request with the exception that the allowed bandwidth should be used instead of the requested bandwidth . finally , the pcrn 136 should push the new pcc rule to the relevant pgw for installation . fig5 illustrates an exemplary method 500 for processing a received message in accordance with an action indicated by a policy decision result . method 500 may be performed by the components of pcrn 136 and / or pcrn 136 such as , for example , message handler 220 . method 500 may begin in step 505 and proceed to 510 where pcrn 136 may receive a message via gxx interface 205 , gx interface 210 , and / or rx interface 215 . method 500 may then proceed to step 515 , where pcrn 136 may determine whether a policy decision should be made in order to process the received message . for example , pcrn 136 may determine that a requested parameter conflicts with a subscriber record or the currently available resources . alternatively , pcrn 136 may determine that the message is of a type or contains an indication of an event for which a policy decision is necessary . if such a policy decision is necessary , method 500 may proceed to step 520 ; otherwise method 500 may proceed to step 565 . pcrn 136 may invoke a policy decision in step 520 and then receive a policy decision result in step 525 . method 500 may then proceed to step 530 where pcrn 136 may determine whether the received result includes an indication of a predefined routine . if so , pcrn 136 may retrieve the specified routine in step 535 and perform the steps specified by the routine in step 540 . if , on the other hand , the result does not contain a routine reference , method 500 may proceed from step 530 to step 555 , where pcrn 136 may determine whether the result indicates an action to be taken . if the result does indicate an action , pcrn 136 may perform the action in step 560 and proceed to step 565 . if the result does not indicate an action , pcrn 136 may take other appropriate steps ( not shown ) and proceed directly to step 565 . at step 565 , pcrn 136 may finish processing the message . for example , pcrn 136 may complete a response message and send it to the requesting node , if this has not been done already . alternatively , if all processing has already been completed through the processing of a rule , pcrn 136 may do nothing at step 565 . method 500 may then end in step 570 . fig6 illustrates and exemplary method 600 for performing a policy decision . method 600 may be performed by the components of pcrn 136 and / or pcrn 136 such as , for example , policy decision engine 230 . method 600 may correspond to step 520 ( fig5 ) or may be performed in parallel to method 500 after the execution of step 520 . method 600 may begin in step 605 and proceed to step 610 where pcrn 136 may retrieve a first rule from the applicable rule set . pcrn 136 may determine the applicable rule set from context information stored in context information module 225 or message handler 220 may specify a rule set when invoking a policy decision . after retrieving a first rule , method 600 may proceed to step 615 . at step 615 , pcrn 136 may compare the criteria portion of the rule to relevant context information passed by message handler 220 and / or context information module 225 . if the criteria does not match the context information , method 600 may proceed to step 620 where pcrn 136 may retrieve the next rule from rule storage 230 . method 600 may then loop back to step 615 . if , on the other hand , pcrn 136 determines that the criteria section of a rule matches the context information at step 615 , method 600 may proceed to step 625 . at step 625 , pcrn 136 may retrieve the result from the result section of the matching rule . method 600 may then proceed to step 630 where pcrn 136 may return the rule result for further processing . method 600 may then end in step 635 . having described exemplary components and methods for the operation of exemplary subscriber network 100 and pcrn 136 , an example of the operation of exemplary network 100 and pcrn 136 will now be provided with reference to fig1 - 6 . pcrn 136 may correspond to pcrn 136 . the contents of rule storage 235 may be indicated by data arrangement 300 and the contents of routine storage 240 may be indicated by data arrangement 400 . the process may begin when pcrn 136 receives ccr 170 requesting the establishment of a new service data flow with 512 kbps bandwidth . message handler 220 then attempts to create a pcc rule establishing the data flow but determines in step 515 that the subscriber is only allowed to have 256 kbps bandwidth . message handler 220 then requests a policy decision from policy decision engine 230 in step 520 , indicating that rule set 310 should be used . policy decision engine 230 retrieves rule 312 in step 610 . since the criteria section uses the subscriber_cat variable , policy decision engine 230 may request this information from context information module 225 . context information module , in turn , may retrieve the record associated with the subscriber id from spr 138 and determine that subscriber_cat is “ gold .” policy decision engine 230 then determines that rule 312 is not applicable at step 615 because “ gold ” does not match “ silver .” policy decision engine 230 then retrieves rule 314 at step 620 . since the criteria of rule 314 specifies that the rule is applicable when subscriber_cat is “ gold ,” policy decision engine 230 determines that rule 314 is applicable in step 615 , extracts the result ‘ resize ; counter ’ from rule 314 in step 625 , and returns the result in step 630 . message handler 220 receives the result in step 525 and determines that the result is not a routine identifier in step 530 . then , in step 555 , message handler 220 determines that the result indicates an action to be taken . message handler 220 then resizes the request according to the allowed bandwidth for the subscriber and sends it as a counteroffer to pgw 134 in step 560 , as specified by rule 314 . pcrn 136 may determine that no further action should be taken at this time in step 565 , since the counteroffer has already been sent . according to the foregoing , various exemplary embodiments provide for the externalization of pcrn behavior . particularly , by providing behavioral rules for determining what action a pcrn should take in response to a received message , a manufacturer or a user may define how a pcrn responds to a message under various circumstances . thus , the behavior of a pcrn may be fine - tuned to handle differing situations in appropriate manners and may be updated to evolve with the network . it should be apparent from the foregoing description that various exemplary embodiments of the invention may be implemented in hardware and / or firmware . furthermore , various exemplary embodiments may be implemented as instructions stored on a machine - readable storage medium , which may be read and executed by at least one processor to perform the operations described in detail herein . a machine - readable storage medium may include any mechanism for storing information in a form readable by a machine , such as a personal or laptop computer , a server , or other computing device . thus , a machine - readable storage medium may include read - only memory ( rom ), random - access memory ( ram ), magnetic disk storage media , optical storage media , flash - memory devices , and similar storage media . it should be appreciated by those skilled in the art that any block diagrams herein represent conceptual views of illustrative circuitry embodying the principals of the invention . similarly , it will be appreciated that any flow charts , flow diagrams , state transition diagrams , pseudo code , and the like represent various processes which may be substantially represented in machine readable media and so executed by a computer or processor , whether or not such computer or processor is explicitly shown . although the various exemplary embodiments have been described in detail with particular reference to certain exemplary aspects thereof , it should be understood that the invention is capable of other embodiments and its details are capable of modifications in various obvious respects . as is readily apparent to those skilled in the art , variations and modifications can be affected while remaining within the spirit and scope of the invention . accordingly , the foregoing disclosure , description , and figures are for illustrative purposes only and do not in any way limit the invention , which is defined only by the claims . | 7 |
the fatty acids or salts thereof utilized in the present invention are preferably of lower to mid chain length , for example , c 4 to c 14 and especially c 6 to c 12 fatty acids which may be liberated from fats and oils having c 4 to c 14 triglycerides . the aeration is conveniently achieved by passing air through the culture medium , for instance at a rate of from 200 to 1500 cc / min , preferably from 400 to 1200 cc / min and especially from 600 to 1000 cc / min . although the quantity of the free fatty acids or salts thereof used in the culture medium may be up to , for instance , 10 % by weight , the desired flavour may be obtained with much less , for example , from 0 . 5 to 5 %, preferably from 0 . 75 to 4 %, and especially from 1 to 3 % by weight based on the total weight of the culture medium . the free fatty acids or salts thereof may be incorporated in the culture medium in the form of the mixture obtained by the hydrolysis of the oil or fat , comprising fatty acids or salts thereof , unhydrolysed oil and water . the culture medium also contains water , the total amount of which is conveniently from 50 to 95 % and preferably from 70 to 80 % by weight based on the total weight of the culture medium . the culture medium may also optionally contain sodium citrate in an amount of , for example , up to 4 %, preferably from 0 . 5 to 1 . 0 % by weight and dextrose in an amount of , for example , up to 6 . 0 % and preferably from 0 . 5 to 1 . 0 % by weight , based on the total weight of the culture medium . the fermentation may be carried out in either a sterilisable fermenter or a sanitized closed jacketed vessel . if a sanitized closed jacketed vessel is used , the water should be first sterilised , for instance , by boiling . the ph of the fermentation mixture may be , for instance , from 4 . 0 to 8 . 0 , preferably from 5 . 0 to 7 . 0 and especially from 5 . 9 to 6 . 1 . although penicillium roqueforti mycelia may be used in the fermentation , the spores are preferred because the mycelial stage has a tendency to metabolise the methyl ketones further whereas the spore stage does not and because the mycelia are more susceptible to fatty acid toxicity than the spores . the spores are preferably used at a level of from 1 × 10 6 to 8 × 10 8 spores / gram and more usually from 4 to 6 × 10 8 spores per gram . they may conveniently be used at a concentration of from 1 to 6 gm / 100 ml and preferably from 3 to 5 gm / 100 ml in the fermentation . the spores may , if desired , be cultured and then centrifuged to a pellet which can be used as the inoculum , or they may be used on bread crumbs . although methyl ketones can be detected by gas chromatography after 3 hours , the fermentation may proceed for up to approximately 72 hours . however , it is preferred that the fermentation is allowed to proceed for a period of from 6 to 30 hours , while a duration from 8 to 24 hours usually provides the optimum flavour production . by the fermentation process a liquid product is obtained which is pasteurised by any conventional method to deactivate the penicillium roqueforti , for example , by means of a high temperature - short time treatment . the liquid product may then be separated into the oil and water fractions and the oil fraction which contains most of the methyl ketones can be used as the flavouring agent itself . alternatively , the liquid product , after pasteurisation , may be made into a paste by concentrating the flavour by conventional means such as reverse osmosis or volatile stripping and used as a flavour either by itself or in admixture with dairy solids . in another variation , the liquid product , after pasteurisation may be spray dried using carriers such as maltodextrins or milk solids , etc ., and used as a flavour . the fat or oil from which the fatty acids are produced by hydrolysis may be of animal origin such as butterfat from milk or a vegetable derived fat , preferably coconut oil . advantageously , the fat contains lower to mid - chain length fatty acids , especially c 6 to c 12 fatty acids which may be liberated from fats and oils having c 6 to c 12 triglycerides . the fat or oil can be hydrolyzed by any conventional means such as chemically using naoh , enzymatically using lipases or by high temperature and pressure to produce the free fatty acids . the preferred enzyme is one that liberates c 4 - c 14 fatty acids from oils or fats . they may be derived from the following micro - organisms : mucor sp ., aspergillus niger , rhizopus oryzae , candida cylindracea , penicillum sp . or from animal origin such as pancreatic lipase from porcine pancreas . the preferred method of lipolysis is by using a lipase derived from rhizopus oryzae . the amount of oil or fat used in enzyme hydrolysis may be from 5 to 25 % by weight and preferably from 15 to 20 % by weight based on the total weight while the amount of water may be from 75 to 95 % by weight and preferably from 80 to 85 % by weight . the amount of enzyme is conveniently from 0 . 025 to 0 . 25 % and preferably from 0 . 05 to 0 . 15 % by weight based on the total weight of the hydrolysis reaction medium . the hydrolysis time , temperature and ph depend on the particular enzyme employed but , typically , the time ranges from 0 . 5 to 2 . 0 hours , the temperatures ranges from 25 ° c . to 45 ° c . and the ph ranges from 4 to 8 . when using a lipase derived from rhizopus oryzae , the preferred temperature is from 35 ° to 40 ° c ., the preferred time is from 45 to 75 minutes and the ph is preferably maintained at a value from 6 . 5 to 7 . 5 using a buffer such as sodium hydroxide or a phosphate , etc . the use of sodium hydroxide is preferred to produce the sodium salts of the fatty acids . after hydrolysis , the hydrolysed oil or fat is conveniently heat treated to deactivate the enzyme . any conventional method of heat treatment may be employed , for example , a high temperature short time treatment . by this hydrolysis process a mixture comprising the hydrolysed fat or oil usually together with about 40 - 60 % unhydrolysed oil in water is obtained , which may advantageously be used as the fatty acid source for the fermentation process in the culture medium , if desired , after separation from the unhydrolysed oil . the following examples further illustrate the present invention . parts and percentages are given by weight unless otherwise indicated . seventeen parts of coconut oil were heated to 35 °- 40 ° c . then 79 parts of water were added to the coconut oil . this mixture was heated to 37 ° c . a slurry of 4 parts of water and 0 . 1 parts of lipase ( from rhizopus oryzae were added to the oil / water mixture . this mixture was agitated in an open vessel using a polytron , from the tekmar company , at 37 ° c . for 1 hour . the ph was monitored and maintained at ph 7 . 0 with 5 - 10 parts of a 25 % naoh solution throughout the reaction . the temperature was increased to 100 ° c . and maintained at 100 ° c . for 7 to 15 minutes depending on the sample size to deactivate the lipase . the hydrolyzed oil / water mixture is then used in the process of blue cheese flavor production . a mixture of 0 . 5 parts dextrose , 0 . 5 parts of sodium citrate and 20 parts of water was made and vacuum filtered through a sterile filter ( 0 . 45 μm ). 4 parts of penicillium roqueforti spores ( dried on bread crumbs -- midwest blue mold -- dairyland food labs ) were added to the sterile filtrate mixture which was shaken to disperse the spores into the water to make a slurry . seventeen parts of hydrolyzed coconut oil / water from part a of this example containing 14 parts water , 1 . 5 parts free fatty acids or salts thereof , and 1 . 5 parts unhydrolysed oil were mixed with 57 . 60 parts of water and put into either a sterilisable fermenter or a sanitized closed jacketed vessel . ( if put into sanitized closed jacketed vessel , the water should be sterilized , i . e ., boiling ). the mixture whose temperature was 30 ° c . was agitated while the penicillium roqueforti spore slurry prepared in part b of this example was slowly added to the vessel . the ph of the reaction mixture was taken and if it was not at ph 6 . 0 ± 0 . 1 , the ph was then adjusted to 6 . 0 using 50 % naoh , if the solution was acidic , or 33 %, hcl if the solution was basic . aeration was then sparged into the vessel at a rate of 800 cc ./ min / l . substrate . ( the vessel contained another opening so the pressure would not build up but a positive air flow was maintained . the reaction was run for 8 hours keeping the temperature of the product at 30 ° c . with aeration and agitation continued throughout the 8 hour period . when the 8 hour period was finished the product was centrifuged or decanted to take the bread crumbs out which the spores had been inoculated on and then dried . the liquid product was then pasteurized to htst to deactivate the penicillium roqueforti spores . the product was separated into the oil and wate fractions . the oil layer contains most of the flavoring compounds ( methyl ketones ) and can be used as a flavoring by itself . a similar procedure to that described in example 1 was followed but in which the pasteurised product from part c was made into a paste by concentrating the flavor via conventional means such as reverse osmosis , volatile stripping , etc ., and used as a flavor by itself or in a mixture with dairy solids . a similar procedure to that described in example 1 was followed but in which the pasteurised product from part c was spray dried using carriers such as maltodextrins , milk solids , etc . | 0 |
a valve graft 1 according to the present disclosure is shown in fig1 - 3 . the valve graft generally comprises a valve frame 10 defining a valve frame open area ( 18 in fig4 ). the open area is spanned by a pair of valve flaps 12 constructed of a biomaterial , discussed below . the valve flaps have positioned therebetween an aperture 14 . the valve frame 10 is preferably a closed loop and is commonly constructed of fine - gauge metal ( e . g ., 0 . 014 inch diameter ), although other materials can be effectively employed . for example , the valve frame can alternatively be made of a synthetic material such as teflon ( polytetrafluoroethylene ). as well , the valve frame can be fabricated of a resorbable or biodegradable composition . in one embodiment , the valve frame 10 is a memory wire formed into a desired shape . as illustrated herein , the valve frame is rhomboidal , although other shapes can be utilized to effect a variety of valve shapes and dimensions . such a shape memory wire frame is known in the art as a frame that substantially returns to its original shape after it is deformed and then released , as described in u . s . pat . no . 4 , 512 , 338 ( to balko et al .). the alternative compositions disclosed above also can be of a memory character if desired . the valve flaps 12 span the valve frame open area 18 and are suturelessly bonded to the valve frame 10 . an aperture 14 separates the valve flaps and serves as a port through which fluid can traverse the valve graft when in use in a patient &# 39 ; s vessel . the valve flaps 12 preferably are of a collageneous biomaterial and can be constructed using a variety of collagen - rich biomaterials , e . g ., a synthetic collagen matrix or of native tissue - derived , collagen - rich biomaterials such as pericardium , peritoneum , dura mater , fascia and bladder or ureteral acellular matrices . an exemplary method for making the valve graft described above is shown in fig4 - 8 . in this method , a valve frame 10 is distorted into a flexed state ( fig4 ). in this flexed state , the ratio of the long axis of the frame to its short axis is increased as compared to the base state . in the preferred embodiment wherein the frame is composed of a memory material , it should be apparent that the valve frame will therefore be under tension when flexed . the valve frame is then placed on a first major surface 22 of a sheet of biomaterial 20 ( fig5 - 6 ). a cross - section through line 6 - 6 of fig5 , corresponding to the short axis of the valve frame , is shown in fig6 . an edge 24 of the biomaterial 20 is folded over the valve frame 10 to contact the edge with the first major surface 22 of the biomaterial ( fig7 ) and form thereby a first bonding locus 30 . in this embodiment , the biomaterial 20 is a trimmed portion of porcine intestinal submucosa . the intestinal submucosa graft is harvested and delaminated in accordance with the description in u . s . pat . nos . 4 , 956 , 178 and 4 , 902 , 508 ( both to badylak et al .). an intestinal submucosa segment is thereby obtained that can be effectively used as a biomaterial sheet as described herein . sutureless bonding of the edge 24 of the biomaterial sheet to the first major surface 22 of the sheet is illustrated in fig8 . the sutureless bonding can be achieved using thermal bonding or chemical cross - linking techniques . in thermal bonding shown in fig8 , the at least first bonding locus 30 , in which the edge 24 of the biomaterial 20 is apposed to the first major surface 22 thereof , is irradiated with energy 32 sufficiently to heat , denature and fuse together the components of the biomaterial . the bonding technique is preferably confined to the selected bonding loci , such that the sutureless bonding effectively “ spot - welds ” the biomaterial edge to the first major surface of the sheet . alternatively , the edge can be welded to the first major surface in one or more weld lines . in irradiating the at least first bonding locus with energy from an energy source 34 , wherein the energy source is an 800 nm diode laser , propagation of laser energy is preferably directed perpendicular to the biomaterial . the biomaterial , preferably being transparent to the laser light at the chosen light wavelength , absorbs little energy and hence sustains minimal thermal damage . however , the energy - absorbing material at the at least first bonding locus absorbs energy and thereby conducts heat to the adjacent biomaterial . sutureless bonding using thermal energy preferably creates a weld while minimizing transfer of heat to surrounding tissues , thereby reducing collateral thermal damage . the chromophore also can aid in thermal confinement and thereby reduce denaturation of surrounding tissue . with sufficient energy irradiation , the biomaterial edge and first major surface at the at least first bonding locus are denatured at the protein level . it is believed that the molecules in the biomaterial intertwine with one another . upon cooling , the bond site is weld - sealed , wherein the biomaterial edge and first major surface of the biomaterial are welded together . as has been mentioned , the valve frame alternatively can be constructed so as to comprise a biological material amenable to laser fusion techniques . with such an embodiment , the collagen - rich biomaterial sheet can be attached to the valve frame by fusion directly thereto , rather than folding the sheet around it and fusing the edge to the first major surface . the combination of an energy - absorbing material ( i . e ., a chromophore , such as indocyanine green ( icg )) and an 800 nm diode laser is the preferred equipment for sutureless bonding in the method herein disclosed . the chromophore can be an endogenous or exogenous substance . the at least first bonding locus at the folded - over edge preferably includes the chromophore , either by treatment of the biomaterial before sutureless bonding or by topical application of a chromophore during sutureless bonding . thermal bonding can be accomplished according to either of two models . in a first model as discussed above , a device is remotely employed to generate heat within the biomaterial . a second thermal bonding model involves contacting a device with the at least first bonding locus for direct generation of heat at the biomaterial contact site . such devices for contact - heating are known in the art and include a contact thermo - electric transducer . in a first alternative sutureless bonding model , the biomaterial edge can be bonded to the first major surface by photo - chemical cross - linking . in a first embodiment of this technique , methylene blue is introduced to the at least first bonding locus and the region is irradiated with white light or other non - collimated light . conventional chemical or photo - crosslinking agents frequently present toxicity concerns if introduced into a patient . for this reason , it is preferable that such agents be avoided or the valve graft well rinsed to remove as much of the agent as possible . methylene blue is a preferred substance for photochemical cross - linking as described above , because the dye has been shown to be easily rinsed from collagen - rich biomaterials such as sis . the sutureless bonding technique used can vary according to desired locus size , biomaterial , speed , cost , and procedural considerations . in all cases , however , it is apparent that the disclosed method avoids the use of sutures to attach the biomaterial to the prosthesis frame . sutureless bonding as disclosed herein possesses a satisfactory bond strength to permit the valve graft to be implanted into a patient &# 39 ; s tubular vessel without increasing the risk of bond failure over that of conventional sutured attachment schemes . as has been mentioned , the presence of sutures at an implantation site increases the probability of post - procedure complications , such as foreign body reaction , thrombogenesis , leakage and reflux of fluid . use of the sutureless bonding method therefore produces a valve graft more readily received by a patient &# 39 ; s body . the present method results in thermal fusion of the biomaterial to generate a strong bond . as well , the resulting valve graft provides a high affinity , migratory , and integrative capability for host cell and tissue ingrowth . the bioprosthesis also prevents fluid leakage while retaining a soft , pliable character . employment of a biomaterial sheath and avoidance of sutures provide a non - carcinogenic valve stent that greatly minimizes calcification and foreign body reactions . an aperture 14 is formed in the biomaterial sheet 20 , creating the bidentate valve graft shown herein . the width of the aperture can be varied to control the flexibility of the valve and the maximum flow rate through the valve . fig9 - 10 are diagrams of one embodiment of a method for implanting a valve graft 1 at an implantation site 40 in a patient &# 39 ; s tubular vessel 50 . the valve graft 1 first is folded along one axis ( i . e ., along reference line a - a in fig1 ), bringing proximate the distal corners of the frame . the biomaterial sheet typically is stretched thereby and preferably curves below the short axis and toward the distal corners , taking on a saddle - like shape . owing to both the composition of the valve frame and the tensile strength of the biomaterial , tension on the biomaterial is not so great as to tear the biomaterial or to pull open the aperture . a catheter 60 is preferably employed to introduce the folded valve graft to the implantation site . the valve graft 1 is sufficiently tightly folded to permit the valve graft to be placed within the catheter 60 . this fitment is generally achieved by bringing the distal corners closer and also compressing the frame along the fold axis . the resultant folded valve graft has a high aspect ratio relative to its relaxed orientation ( i . e ., as shown in fig9 ). the catheter 60 is then maneuvered to position the distal tip thereof at the implantation site 40 , such as in a vein 50 . the tightly - folded valve graft is introduced into the vein or other tubular vessel by deployment from the distal tip of the catheter 60 , as shown in fig1 . such release can be achieved by pushing the valve graft from inside the catheter with a ramrod - type element 62 , such as a guidewire . upon release from the catheter , the valve graft will tend to spring back to its original conformation , limited by the walls of the tubular vessel ( fig1 - 11 , with the valve aperture shown open ). this expanding tendency is due to the shape memory material of which the valve frame is constructed . the valve graft will remain at the implantation site in a folded state , though not so tightly folded as in fig9 . over time , native tissue overgrowth occurs , further anchoring the valve graft in place . a collagen - rich biomaterial sheet can serve as a layer ( s ) ( single or multiple sheets ) applied to a supporting structure ( e . g ., valve frame ) to control fluid flow direction through the conduit while preventing leakage out of the conduit . such valve grafts might be used , for example , in the cardiovascular system ( blood vessels ), gastrointestinal tract , urinary tract , and trachea fig1 - 13 show simplified views of the implanted valve graft of fig1 - 11 , illustrating unidirectional flow control via valve action . for purposes of explanation , it will be assumed that a valve graft has been implanted in a vein of a patient . it should be noted that the flaps 12 or leaflets of the valve graft 1 have a flexible character imparted by the composition of the biomaterial sheet 20 . the flaps 12 therefore can be flexed or bowed by the force of the incident fluid . such pliant or elastic property is known in the art for “ natural tissue ” valves , as opposed to mechanical valves . in fig1 , anterograde blood flow in the vein 50 is occurring , consistent with normal circulation , i . e ., from right to left . pressure on the upstream surface of the valve graft flaps 12 by the blood ( solid arrow ) causes the flaps 12 to be bowed toward the walls of the vein 50 . the valve graft aperture 14 is opened thereby , permitting the blood to flow through the valve graft 1 and further downstream ( solid arrow ) through the vein 50 . in retrograde blood flow to the valve ( solid arrow , fig1 ), blood fills and is trapped in the “ dead - end ” regions between the valve graft flaps 12 and the vein wall 50 . this phenomenon , coupled with the continuing - fluid pressure on the flaps 12 caused by physiological blood flow , causes blood to contact and press on the downstream surface of the valve graft flaps , flexing them inward and away from the vessel walls 50 . by bowing the flaps inward , the valve graft aperture 14 is effectively closed and retrograde flow through the valve graft is substantially prevented ( dashed arrow ). a valve graft preferably is constructed in which the aperture is substantially closed when the valve graft is in a resting - state conformation ( i . e ., its state when implanted in a vessel having no fluid flow ). such construction is dependent on the size , shape , and dimensions of the valve frame , the presence and degree of tension that can be applied to the biomaterial sheet during valve graft fabrication , and the dimensions and orientation of the aperture . in another alternative valve graft , the aperture can be designed to incompletely close or to substantially narrow in the face of retrograde flow , depending on the particular configuration and dimensions of the implanted valve graft . if a partial retrograde flow is desired , for example , the aperture dimensions can be chosen to prevent complete closure of the aperture in an in situ implantation . implantation of a valve graft according to the present disclosure provides several benefits over prior art prostheses . collagen and sis are known to provide a matrix that encourages native cell repopulation and may ultimately enhance tissue repair and regeneration as well as integration of implanted supporting structure materials . one advantage of the disclosed method for making a valve graft is that thermal bonding , and especially laser fusion of the biomaterial edge to the first major surface is a rapid technique that yields water - tight bonds . as well , laser fusion has the capability of attaching multiple biomaterial sheets at numerous locations on their major surfaces , reducing the chance of leakage between the biomaterial sheets . heretofore , laser fusion has not gained widespread acceptance for bonding approximated tissue edges , largely because of weak bond strength . however , laser fusion of collagen - rich biomaterials as described herein resulted in strong tissue bonds . further , collagen - rich biomaterials have been observed to readily incorporate chromophores such as icg , further enhancing the efficacy of laser fusion in the present invention . another advantage of the present valve graft over prior art prostheses is that the use of sutures is obviated in the present invention . the risk of a foreign body response is therefore substantially mitigated . a further advantage is that a valve graft as disclosed herein and constructed with collageneous biomaterial flaps will retain the excellent bio - active properties of small intestinal submucosa graft with greatly reduced risk of cytotoxicity and foreign body reactions . the sutureless bonding welds provide sufficient mechanical and structural strength to enable the valve graft to be employed in medical procedures and to function acceptably in situ . a person skilled in the art will be able to practice the present invention in view of the description present in this document , which is to be taken as a whole . numerous details have been set forth in order to provide a more thorough understanding of the invention . in other instances , well - known features have not been described in detail in order not to obscure unnecessarily the invention . while the invention has been disclosed in its preferred form , the specific embodiments presented herein are not to be considered in a limiting sense . indeed , it should be readily apparent to those skilled in the art in view of the present description that the invention can be modified in numerous ways . the inventor regards the subject matter of the invention to include all combinations and sub - combinations of the various elements , features , functions and / or properties disclosed herein . | 0 |
according to a first embodiment of the invention , the multiplexer 21 of fig4 is replaced with a multiplexer 21 &# 39 ;. as shown in fig6 multiplexer 21 &# 39 ; now has two outputs s1 and s2 , both providing a 15 . 36 - mhz frequency signal drawn from the ring oscillator 16 . the two outputs s1 and s2 are mutually shifted by 13 . 6 ns corresponding to the propagation time of four inverters . indeed , the state of a flip - flop b ( j ) of register 20 is used both to control a switch k ( i ) of a first series and to provide an output signal s1 drawn from an inverter i ( i ) as previously , and also to control another switch k &# 39 ; ( i + 4 ) or a second series which provides a second signal s2 drawn in the present case from the output of an inverter i ( i + 4 ). the two signals s1 and s2 are provided to a logic &# 34 ; exclusive - or &# 34 ; ( exor ) gate 22 which provides signal clk1 . for the sake of simplicity , only the ring oscillator 16 , the multiplexer 21 &# 39 ; and the shift register 20 are represented in fig6 . the phase - locked loop for biasing the ring oscillator 16 is not modified with respect to the embodiment shown in fig4 . fig7 contains the timing diagrams of the outputs of inverters i ( i ), of the output signals s1 and s2 of multiplexer 21 &# 39 ;, and of signal clk1 . first , it is assumed that the circulating &# 34 ; 1 &# 34 ; of the shift register 20 is present in flip - flop b ( 1 ). then , under the influence of a positive pulse of signal av / ret generated by comparator 13 , it is assumed that the circulating &# 34 ; 1 &# 34 ; is present in flip - flop b ( 2 ). since the shift frequency of register 20 is determined by clock clk0 to maintain synchronization on the 8 - khz signal , the phase difference of signal clk1 is determined , if necessary , only every 12 . 5 μs . as shown in fig7 signal clk1 first corresponds to the exor combination of the output signals of inverters i ( 1 ) and i ( 5 ), which are controlled by switches k ( 1 ) and k &# 39 ; ( 5 ), respectively . the synchronizing and multiplying circuit 14 &# 39 ; remains in this state until a pulse of signal av / ret occurs and until signal gel is reset . since the pulse of signal av / ret is positive , the circulating &# 34 ; 1 &# 34 ; moves from flip - flop b ( 1 ) to flip - flop b ( 2 ), thus causing the switching off of switches k ( 1 ) and k &# 39 ; ( 5 ) and the switching on of switches k ( 3 ) and k &# 39 ; ( 7 ). accordingly , signal clk1 now corresponds to the combination of the output signals of inverters i ( 3 ) and i ( 7 ). signal clk1 is then delayed by 6 . 8 ns , which causes the 8 khz frequency resynthetized by the counter 15 &# 39 ; to be delayed so that it is locked back on the 8 khz reference frequency of the telephone exchange . according to the invention , the alu 11 &# 39 ; now adds on 9 bits the signals received from counter 15 &# 39 ; and from the line delay counter 10 &# 39 ;. counter 15 &# 39 ; has an additional stage so that it becomes a 9 - bit counter and behaves like a divider by 384 to provide the 80 - khz signal clk2 . an additional bit is added to the line delay counter 10 &# 39 ; to count on 9 bits . therefore , the alu now adds the value included in counter 10 &# 39 ; to each state of counter 15 &# 39 ;. signal clk1 is provided , as previously , as a clock signal to decoder 12 , but it has a 30 . 72 - mhz frequency . now , decoder 12 detects the states 112 and 496 , which causes , in case of phase skip , the skips to have a 32 . 5 - ns duration . the sampling pulses of a / d converter 8 have a 32 . 5 ns width . it is also possible not to add a stage to counter 15 and to provide it , as a clock signal , with signal s1 of the synchronizing and multiplying circuit 14 &# 39 ;. it would then operate , as previously , as a counter / divider by 192 . as a consequence , this would maintain sampling phase skips having a duration of 32 . 5 ns , which is determined by signal clk1 , but to maintain a 65 - ns width of the sampling pulses . due to the propagation time of each inverter i ( i ), signal clk1 is not a square wave signal but has pulses with a 13 . 6 - ns width corresponding to the propagation time of four inverters i ( i ). its quiescent time , determined by a difference with respect to the 15 . 36 - mhz frequency , is therefore 18 . 9 ns . this is not a drawback since only the rising edges of the clock signal clk1 are used for the operation of the transmission circuit . according to a second aspect of the invention , as represented in fig8 the clock input of the line delay counter 10 &# 39 ; receives a signal clk4 from the detection circuit 9 . signal clk4 is locked on the detection of the first quaternary code of the synchronization words . in other words , the detection circuit 9 provides a pulse every first quaternary code of a simple or super - frame synchronization word , the pulse width being fixed by the 80 - khz frequency is then 12 . 5 μs . the emission of this signal does not impair the detection circuit 9 since its function is precisely to decode the received signal , the decoded frame being provided in this circuit . since a first code of a synchronization word occurs on the frame every 120 codes , the occurrence frequency of this first code of the synchronization word is 1 . 5 ms , which provides counter 10 &# 39 ; with a clock frequency and therefore a counting frequency of approximately 666 . 6 hz . the phase error signal &# 34 ; e &# 34 ; has a zero , positive or negative value depending on the absence or presence ( advance or lag ) of a phase error . therefore , the phase error signal sets counter 10 &# 39 ; to an inhibited position , or to an up / down counting position , respectively . at each clock pulse clk4 , the value contained in counter 10 &# 39 ; is then either unchanged , incremented , or decremented depending on the value of signal &# 34 ; e &# 34 ;. fig9 not drawn to scale for simplification , shows timing diagrams of the waveforms of signals clk4 and clk2 , and the waveforms of signals &# 34 ; e &# 34 ; and clk3 , in the absence of a phase error , in the presence of a phase advance , and in the presence of a phase lag , respectively . for simplification of the drawing , the initial value of the phase shift φ between the emitted signal and the received signal is , in this example , 180 ° so that in the absence of a phase error signal clk3 ( 0 ) is in phase with signal clk2 . as can be seen in fig9 a pulse of signal clk4 has a 12 . 5 - μs width and occurs at each first code sw ( 1 ) of a synchronization word , the frequency of these pulses being 1 . 5 ms . signal clk2 corresponds to the 80 - khz emission clock and has a 12 . 5 - μs frequency . the first error signal , e ( 0 ), is a signal indicating the absence of phase error . accordingly , signal clk3 ( 0 ) constituting the 80 - khz sampling signal with pulses having a 32 . 5 - ns width is shifted by φ with respect to the emission clock clk2 . in the case where the phase of the received signal is delayed with respect to this initial value , the error signal e ( 1 ) has a rising edge when this phase error is detected and therefore sets the line delay counter 10 &# 39 ; in the up - counting mode . however , since the clock of counter 10 &# 39 ; is provided by signal clk4 , the counter is incremented by 1 only upon the occurrence of the next clock pulse corresponding to the incoming of the first code sw ( 1 ) of a synchronization word . signal clk3 ( 1 ) is then shifted by a 32 . 5 - ns value corresponding to the 30 . 72 - mhz clock frequency of decoder 12 . if the phase of the received signal is advanced with respect to the initial value , the error signal e (- 1 ) has a falling edge when it is detected and sets the line delay counter 10 &# 39 ; in down - counting mode . as in the preceding case , the counter is incremented by 1 only at the occurrence of a pulse on signal clk4 , and signal clk3 (- 1 ) is then shifted in the reverse direction . in both cases , e ( 1 ) and e (- 1 ), signal &# 34 ; e &# 34 ; recovers its zero value as soon as the phase error has disappeared , that is , as soon as the value of counter 10 &# 39 ; corresponds to the current phase shift between the emitted signal and the received signal . as is apparent to those skilled in the art , various modifications can be made to the above disclosed preferred embodiments . more particularly , each component described above can be replaced with one or more elements fulfilling the same function . having thus described at least one illustrative embodiment of the invention , various alterations , modifications , and improvements will readily occur to those skilled in the art . such alterations , modifications , and improvements are intended to be within the spirit and scope of the invention . accordingly , the foregoing description is by way of example only and is not intended to be limiting . the invention is limited only as defined in the following claims and the equivalents thereto . | 7 |
where l - amino acids or amino acids are mentioned in the following , this means one or more amino acids , including their salts , chosen from the group consisting of l - asparagine , l - threonine , l - serine , l - glutamate , l - glycine , l - alanine , l - cysteine , l - valine , l - methionine , l - isoleucine , l - leucine , l - tyrosine , l - phenylalanine , l - histidine , l - lysine , l - tryptophan , l - homoserine and l - arginine . l - threonine is particularly preferred . in this context the term “ attenuation ” describes the reduction or switching - off , in a microorganism , of the intracellular activity of one or more enzymes ( proteins ) which are coded for by the appropriate dna , for example by using a weak promoter or a gene or allele which codes for an appropriate enzyme with low activity , or inactivating the appropriate enzyme ( protein ), and optionally combining these measures . by attenuation measures , the activity or concentration of the corresponding protein is in general reduced to 0 to 75 %, 0 to 50 %, 0 to 25 %, 0 to 10 % or 0 to 5 % of the activity or concentration of the wild - type protein or of the activity or concentration of the protein in the starting microorganism . the process is characterized in that the following steps are carried out : a ) fermentation of microorganisms of the family enterobacteriaceae in which at least the pcka gene is attenuated , b ) enrichment of the appropriate l - amino acid in the medium or in the cells of the microorganisms of the family enterobacteriaceae , and c ) isolation of the desired l - amino acid . the microorganisms provided by the present invention can produce l - amino acids from glucose , sucrose , lactose , fructose , maltose , molasses , optionally starch or optionally cellulose , or from glycerol and ethanol . said microorganisms are representatives of the family enterobacteriaceae selected from the genera escherichia , erwinia , providencia and serratia . the genera escherichia and serratia are preferred . the species escherichia coli and serratia marcescens may be mentioned in particular among the genera escherichia and serratia respectively . examples of suitable strains , particularly l - threonine - producing strains , of the genus escherichia , especially of the species escherichia coli , are : escherichia coli tf427 escherichia coli h4578 escherichia coli ky10935 escherichia coli vniigenetika mg442 escherichia coli vniigenetika m1 escherichia coli vniigenetika 472t23 escherichia coli bkiim b - 3996 escherichia coli kat 13 escherichia coli kccm - 10132 . examples of suitable l - threonine - producing strains of the genus serratia , especially of the species serratia marcescens , are : l - threonine - producing strains of the family enterobacteriaceae preferably possess , inter alia , one or more genetic or phenotypic characteristics selected from the group comprising resistance to α - amino - β - hydroxyvaleric acid , resistance to thialysine , resistance to ethionine , resistance to α - methylserine , resistance to diaminosuccinic acid , resistance to α - aminobutyric acid , resistance to borrelidine , resistance to rifampicin , resistance to valine analogues such as valine hydroxamate , resistance to purine analogues such as 6 - dimethylaminopurine , need for l - methionine , optionally partial and compensable need for l - isoleucine , need for meso - diaminopimelic acid , auxotrophy in respect of threonine - containing dipeptides , resistance to l - threonine , resistance to l - homoserine , resistance to l - lysine , resistance to l - methionine , resistance to l - glutamic acid , resistance to l - aspartate , resistance to l - leucine , resistance to l - phenylalanine , resistance to l - serine , resistance to l - cysteine , resistance to l - valine , sensitivity to fluoropyruvate , defective threonine dehydrogenase , optionally capability for sucrose utilization , amplification of the threonine operon , amplification of homoserine dehydrogenase i - aspartate kinase i , preferably of the feedback - resistant form , amplification of homoserine kinase , amplification of threonine synthase , amplification of aspartate kinase , optionally of the feedback - resistant form , amplification of aspartate semialdehyde dehydrogenase , amplification of phosphoenolpyruvate carboxylase , optionally of the feedback - resistant form , amplification of phosphoenolpyruvate synthase , amplification of transhydrogenase , amplification of the rhtb gene product , amplification of the rhtc gene product , amplification of the yfik gene product , amplification of malate quinone oxidoreductase and amplification of a pyruvate carboxylase and attenuation of acetic acid formation . it has been found that the production of l - amino acids , especially l - threonine , by microorganisms of the family enterobacteriaceae is improved after attenuation and , in particular , switching - off of the pcka gene coding for pep carboxykinase ( ec 4 . 1 . 1 . 49 ). the nucleotide sequence of the pcka gene of escherichia coli has been published by medina et al . ( journal of bacteriology 172 , 7151 - 7156 ( 1990 )) and can also be taken from the genome sequence of escherichia coli published by blattner et al . ( science 277 , 1453 - 1462 ( 1997 )). the nucleotide sequence of the pcka gene of escherichia coli is represented in seq id no . 1 and the amino acid sequence of the corresponding gene product is represented in seq id no . 2 . the pcka genes described in the above literature references can be used according to the invention . it is also possible to use alleles of the pcka gene which result from the degeneracy of the genetic code or from neutral sense mutations . attenuation can be achieved for example by reducing or switching off the expression of the pcka gene or the catalytic properties of the enzyme protein . both measures may optionally be combined . gene expression can be reduced by an appropriate culture technique , by genetic modification ( mutation ) of the signal structures of gene expression , or by means of antisense rna technology . examples of signal structures of gene expression are repressor genes , activator genes , operators , promoters , attenuators , ribosome binding sites , the start codon and terminators . those skilled in the art will find relevant information inter alia in e . g . jensen and hammer ( biotechnology and bioengineering 58 , 191 - 195 ( 1998 )), carrier and keasling ( biotechnology progress 15 , 58 - 64 ( 1999 )), franch and gerdes ( current opinion in microbiology 3 , 159 - 164 ( 2000 )) and well - known textbooks on genetics and molecular biology , for example the textbook by knippers (“ molekulare genetik ” (“ molecular genetics ”), 6th edition , georg thieme verlag , stuttgart , germany , 1995 ) or the textbook by winnacker (“ gene und klone ” (“ from genes to clones ”), vch verlagsgesellschaft , weinheim , germany , 1990 ). mutations which cause a change or reduction in the catalytic properties of enzyme proteins are known from the state of the art . examples which may be mentioned are the studies of qiu and goodman ( journal of biological chemistry 272 , 8611 - 8617 ( 1997 )), yano et al . ( proceedings of the national academy of sciences usa 95 , 5511 - 5515 ( 1998 )) and wente and schachmann ( journal of biological chemistry 266 , 20833 - 20839 ( 1991 )). surveys can be found in well - known textbooks on genetics and molecular biology , e . g . the textbook by hagemann (“ allgemeine genetik ” (“ general genetics ”), gustav fischer verlag , stuttgart , 1986 ). mutations to be taken into consideration are transitions , transversions , insertions and deletions . depending on the effect of amino acid exchange on the enzyme activity , the term missense mutations or nonsense mutations is used . insertions or deletions of at least one base pair in a gene cause frame shift mutations , the result of which is that false amino acids are incorporated or translation is terminated prematurely . deletions of several codons typically lead to a complete loss of enzyme activity . instructions for the production of such mutations form paft of the state of the art and can be found in well - known textbooks on genetics and molecular biology , e . g . the textbook by knippers (“ molekulare genetik ” (“ molecular genetics ”), 6th edition , georg thieme verlag , stuttgart , germany , 1995 ), the textbook by winnacker (“ gene und klone ” (“ from genes to clones ”), vch verlagsgesellschaft , weinheim , germany , 1990 ) or the textbook by hagemann (“ allgemeine genetik ” (“ general genetics ”), gustav fischer verlag , stuttgart , 1986 ). an example of a plasmid by means of which the pcka gene of escherichia coli can be attenuated and , in particular , switched off by position - specific mutagenesis is plasmid pmak705δpcka ( fig1 ). it contains only part of the 5 ′ region and part of the 3 ′ region of the pcka gene . a 349 bp segment of the coding region is missing ( deletion ). the sequence of this dna , which can be used for mutagenesis of the pcka gene , is represented in seq id no . 3 . the deletion mutation of the pcka gene can be incorporated into suitable strains by gene or allele exchange . a common method is the method of gene exchange using a conditionally replicating psc101 derivative , pmak705 , as described by hamilton et al . ( journal of bacteriology 174 , 4617 - 4622 ( 1989 )). other methods described in the state of the art , for example that of martinez - morales et al . ( journal of bacteriology , 7143 - 7148 ( 1999 )) or that of boyd et al . ( journal of bacteriology 182 , 842 - 847 ( 2000 )), can also be used . when exchange has been carried out , the form of the δpcka allele represented in seq id no . 4 , which is a further subject of the invention , is present in the strain in question . mutations in the pcka gene or mutations involving expression of the pcka gene can also be transferred to different strains by conjugation or transduction . furthermore , for the production of l - amino acids , especially l - threonine , with strains of the family enterobacteriaceae , it can be advantageous not only to attenuate the pcka gene but also to amplify one or more enzymes of the known threonine biosynthetic pathway , or enzymes of the anaplerotic metabolism , or enzymes for the production of reduced nicotinamide adenine dinucleotide phosphate . in this context the term “ amplification ” describes the increase in the intracellular activity , in a microorganism , of one or more enzymes or proteins which are coded for by the appropriate dna , for example by increasing the copy number of the gene ( s ), using a strong promoter or using a gene coding for an appropriate enzyme or protein with a high activity , and optionally combining these measures . by amplification measures , in particular over - expression , the activity or concentration of the corresponding protein is in general increased by at least 10 %, 25 %, 50 %, 75 %, 100 %, 150 %, 200 %, 300 %, 400 % or 500 %, up to a maximum of 1000 % or 2000 %, based on that of the wild - type protein or the activity or concentration of the protein in the starting microorganism . thus , for example , one or more genes selected from the group comprising : the thrabc operon coding for aspartate kinase , homoserine dehydrogenase , homoserine kinase and threonine synthase ( u . s . pat . no . 4 , 278 , 765 ), the pyc gene coding for pyruvate carboxylase de - a - 19 831 609 ), the pps gene coding for phosphoenolpyruvate synthase ( molecular and general genetics 231 , 332 ( 1992 )), the ppc gene coding for phosphoenolpyruvate carboxylase ( gene 31 , 279 - 283 ( 1984 )), the pnta and pntb genes coding for transhydrogenase ( european journal of biochemistry 158 , 647 - 653 ( 1986 )), the rhtb gene for homoserine resistance ( ep - a - 0994190 ), and the rhtc gene for threonine resistance ( ep - a - 1013765 ), the gdha gene coding for glutamate dehydrogenase ( gene 27 : 193 - 199 ( 1984 ) furthermore , for the production of l - amino acids , especially l - threonine , it can be advantageous not only to attenuate the pcka gene but also to attenuate and , in particular , switch off one or more genes selected from the group comprising : the tdh gene coding for threonine dehydrogenase ( ravnikar and somerville , journal of bacteriology 169 , 4716 - 4721 ( 1987 )), the mdh gene coding for malate dehydrogenase ( ec 1 . 1 . 1 . 37 ) ( vogel et al ., archives in microbiology 149 , 36 - 42 ( 1987 )), the gene product of the open reading frame ( orf ) yjfa ( accession number aac77180 of the national center for biotechnology information ( ncbi , bethesda , md ., usa ) and seq id no . 5 ), and the gene product of the open reading frame ( orf ) ytfp ( accession number aac77179 of the national center for biotechnology information ( ncbi , bethesda , md ., usa ) and seq id no . 5 ), it is preferred to attenuate the open reading frame yjfa and / or the open reading frame ytfp . it is also possible according to the invention to attenuate the open reading frames yjfa and / or ytfp independently of the pcka gene , in order to achieve an improvement in the amino acids , in particular l - threonine production . the invention accordingly also provides a process , characterized in that the following steps are carried out : d ) fermentation of microorganisms of the enterobacteriaceae family in which at least the open reading frame yjfa and / or ytfp is attenuated , e ) enrichment of the l - amino acid in the medium or in the cells of the microorganisms of the enterobacteriaceae family , and f ) isolation of the l - threonine , constituents of the fermentation broth and the biomass in its entirety or portions thereof optionally being isolated as a solid product together with the l - amino acid . an example of a plasmid by means of which the open reading frames yjfa and ytfp of escherichia coli can be attenuated and , in particular , switched off by position - specific mutagenesis is plasmid pmak705δyjfa ( fig2 ). it contains only the 5 ′ and 3 ′ flanks of the ytfp - yjfa region , including very short residues of the open reading frames yjfa and ytfp . a 337 bp long part of the ytfp - yjfa region is missing ( deletion ). the sequence of this dna , which can be used for mutagenesis of the ytfp - yjfa region , is represented in seq id no . 6 . an further example of a plasmid by means of which the open reading frames yjfa and ytfp of escherichia coli can be attenuated and , in particular , switched off by position - specific mutagenesis is the plasmid pmak705δ90bp ( fig5 ). it also contains only the 5 ′ and 31 flanks of the ytfp - yjfa region including very short residues of the open reading frames yjfa and ytfp . a 90 bp long part of the ytfp - yjfa region is missing ( deletion ). the sequence of this dna , which can be used for mutagenesis of the ytfp - yjfa region , is represented in seq id no . 7 . this deletion mutation can be incorporated into suitable strains by gene or allele replacement . it is also possible to transfer mutations in the open reading frames yjfa and / or ytfp or mutations affecting expression of these open reading frames into various strains by conjugation or transduction . when replacement has been carried out , the form of the δytfp and δyjfa allele represented in seq id no . 6 or seq id no . 7 , which are a further subject of the invention , is present in the strain in question . furthermore , for the production of l - amino acids , especially l - threonine , it can be advantageous , in addition to the individual or joint attenuation of the pcka gene or of the open reading frames yjfa and / or ytfp , to switch off undesired secondary reactions ( nakayama : “ breeding of amino acid producing microorganisms ”, in : overproduction of microbial products , krumphanzl , sikyta , vanek ( eds . ), academic press , london , uk , 1982 ). the microorganisms prepared according to the invention can be cultivated by the batch process or the fed batch process . a summary of known cultivation methods is provided in the textbook by chmiel ( bioprozesstechnik 1 . einführung in die bioverfahrenstechnik ( bioprocess technology 1 . introduction to bioengineering ) ( gustav fischer verlag , stuttgart , 1991 )) or in the textbook by storhas ( bioreaktoren und periphere einrichtungen ( bioreactors and peripheral equipment ) ( vieweg verlag , brunswick / wiesbaden , 1994 )). the culture medium to be used must appropriately meet the demands of the particular strains . descriptions of culture media for various microorganisms can be found in the handbook “ manual of methods for general bacteriology ” of the american society for bacteriology ( washington d . c ., usa , 1981 ). carbon sources which can be used are sugars and carbohydrates , e . g . glucose , sucrose , lactose , fructose , maltose , molasses , starch and optionally cellulose , oils and fats , e . g . soya oil , sunflower oil , groundnut oil and coconut fat , fatty acids , e . g . palmitic acid , stearic acid and linoleic acid , alcohols , e . g . glycerol and ethanol , and organic acids , e . g . acetic acid . these substances can be used individually or as a mixture . nitrogen sources which can be used are organic nitrogen - containing compounds such as peptones , yeast extract , meat extract , malt extract , corn steep liquor , soya bean flour and urea , or inorganic compounds such as ammonium sulfate , ammonium chloride , ammonium phosphate , ammonium carbonate and ammonium nitrate . the nitrogen sources can be used individually or as a mixture . phosphorus sources which can be used are phosphoric acid , potassium dihydrogenphosphate or dipotassium hydrogenphosphate or the corresponding sodium salts . the culture medium must also contain metal salts , e . g . magnesium sulfate or iron sulfate , which are necessary for growth . finally , essential growth - promoting substances such as amino acids and vitamins can be used in addition to the substances mentioned above . suitable precursors can also be added to the culture medium . said feed materials can be added to the culture all at once or fed in appropriately during cultivation . the ph of the culture is controlled by the appropriate use of basic compounds such as sodium hydroxide , potassium hydroxide , ammonia or aqueous ammonia , or acid compounds such as phosphoric acid or sulfuric acid . foaming can be controlled using antifoams such as fatty acid polyglycol esters . the stability of plasmids can be maintained by adding suitable selectively acting substances , e . g . antibiotics , to the medium . aerobic conditions are maintained by introducing oxygen or oxygen - containing gaseous mixtures , e . g . air , into the culture . the temperature of the culture is normally 25 ° c . to 45 ° c . and preferably 30 ° c . to 40 ° c . the culture is continued until the formation of l - amino acids or l - threonine has reached a maximum . this objective is normally achieved within 10 hours to 160 hours . l - amino acids can be analyzed by means of anion exchange chromatography followed by ninhydrin derivation , as described by spackman et al . ( analytical chemistry 30 , 1190 ( 1958 )), or by reversed phase hplc , as described by lindroth et al . ( analytical chemistry 51 , 1167 - 1174 ( 1979 )). a pure culture of the escherichia coli k - 12 strain dh5α / pmak705 was deposited on 8 th sep . 2000 at the deutsche sammlung für mikroorganismen und zellkulturen gmbh ( dsm ), mascheroder weg 1b , d - 3300 braunschweig , germany ( dsmz = german collection of microorganisms and cell cultures , braunschweig , germany ) in accordance with the budapest treaty as dsm 13720 . a pure culture of the escherichia coli k - 12 strain mg442δpcka was deposited on 2 nd oct . 2000 at the deutsche sammlung für mikroorganismen und zellkulturen gmbh ( dsm ), mascheroder weg 1b , d - 3300 braunschweig , germany ( dsmz = german collection of microorganisms and cell cultures , braunschweig , germany ) in accordance with the budapest treaty as dsm 13761 . a pure culture of the escherichia coli k - 12 strain b - 3996kurδtdhδpcka / pvic40 was deposited on 9 th mar . 2001 at the deutsche sammlung für mikroorganismen und zellkulturen gmbh ( dsm ), mascheroder weg 1b , d - 3300 braunschweig , germany ( dsmz = german collection of microorganisms and cell cultures , braunschweig , germany ) in accordance with the budapest treaty as dsm 14150 . a pure culture of the escherichia coli k - 12 strain mg442δ90yjfa was deposited on 9 th may 2001 at the deutsche sammlung für mikroorganismen und zellkulturen gmbh ( dsm ), mascheroder weg 1b , d - 3300 braunschweig , germany ( dsmz = german collection of microorganisms and cell cultures , braunschweig , germany ) in accordance with the budapest treaty as dsm 14289 . it is also possible according to the invention individually to attenuate the open reading frames ytfp and yjfa in order to improve the production of l - amino acids . the process according to the invention is used for the preparation of l - amino acids , e . g . l - threonine , l - isoleucine , l - methionine , l - homoserine and l - lysine , especially l - threonine , by fermentation . the present invention is illustrated in greater detail below with the aid of examples . the isolation of plasmid dna from escherichia coli and all the techniques for restriction , klenow treatment and alkaline phosphatase treatment were carried out as described by sambrook et al . ( molecular cloning — a laboratory manual ( 1989 ), cold spring harbor laboratory press ). unless indicated otherwise , the transformation of escherichia coli was carried out as described by chung et al . ( proceedings of the national academy of sciences usa 86 , 2172 - 2175 ( 1989 )). the incubation temperature for the preparation of strains and transformants was 37 ° c . temperatures of 30 ° c . and 44 ° c . were used in the gene exchange process of hamilton et al . parts of the 5 ′ and 3 ′ regions of the pcka gene of escherichia coli k12 were amplified using the polymerase chain reaction ( pcr ) and synthetic oligonucleotides . the nucleotide sequence of the pcka gene in e . coli k12 mg1655 ( seq id no . 1 ) was used to synthesize the following pcr primers ( mwg biotech , ebersberg , germany ): pcka ′ 5 ′- 1 : 5 ′ - gatccgagcctgacaggtta - 3 ′ ( seq id no : 8 ) pcka ′ 5 ′- 2 : 5 ′ - gcatgcgctcggtcaggtta - 3 ′ ( seq id no : 9 ) pcka ′ 3 ′- 1 : 5 ′ - aggcctgaagatggcactatcg - 3 ′ ( seq id no : 10 ) pcka ′ 3 ′- 2 : 5 ′ - ccggagaagcgtaggtgtta - 3 ′. ( seq id no : 11 ) the chromosomal e . coli k12 mg1655 dna used for the pcr was isolated with “ qiagen genomic - tips 100 / g ” ( qiagen , hilden , germany ) according to the manufacturer &# 39 ; s instructions . an approx . 500 bp dna fragment from the 5 ′ region of the pcka gene ( denoted as pck1 ) and an approx . 600 bp dna fragment from the 3 ′ region of the pcka gene ( denoted as pck2 ) could be amplified with the specific primers under standard pcr conditions ( innis et al . ( 1990 ), pcr protocols . a guide to methods and applications , academic press ) using taq dna polymerase ( gibco - brl , eggenstein , germany ). the pcr products were each ligated with vector pcr2 . 1topo ( topo ta cloning kit , invitrogen , groningen , the netherlands ) according to the manufacturer &# 39 ; s instructions and transformed into e . coli strain top10f ′. plasmid - carrying cells were selected on lb agar containing 50 μg / ml of ampicillin . after isolation of the plasmid dna , vector pcr2 . 1topopck2 was cleaved with the restriction enzymes stui and xbai and , after separation in 0 . 8 % agarose gel , the pck2 fragment was isolated with the aid of the qiaquick gel extraction kit ( qiagen , hilden , germany ). after isolation of the plasmid dna , vector pcr2 . 1topopck1 was cleaved with the enzymes ecorv and xbai and ligated to the isolated pck2 fragment . the e . coli strain dh5α was transformed with the ligation mixture and plasmid - carrying cells were selected on lb agar containing 50 μg / ml of ampicillin . after isolation of the plasmid dna , control cleavage with the enzymes spei and xbai was used to detect plasmids containing , in cloned form , the mutagenic dna sequence represented in seq id no . 3 . one of the plasmids was denoted as pcr2 . 1topoδpcka . after restriction with the enzymes spei and xbai and separation in 0 . 8 % agarose gel , the pcka allele described in example 1 was isolated from vector pcr2 . 1topoδpcka and ligated to plasmid pmak705 ( hamilton et al ., journal of bacteriology 174 , 4617 - 4622 ( 1989 )) which had been digested with the enzyme xbai . dh5α was transformed with the ligation mixture and plasmid - carrying cells were selected on lb agar containing 20 μg / ml of chloramphenicol . after isolation of the plasmid dna and cleavage with the enzymes hpai , kpni , hindiii , sali and psti , successful cloning was detected . the exchange vector formed , pmak705δpcka (= pmak705deltapcka ), is shown in fig1 . position - specific mutagenesis of the pcka gene in the e . coli strain mg442 the l - threonine - producing e . coli strain mg442 is described in patent u . s . pat . no . 4 , 278 , 765 and deposited in the russian national collection of industrial microorganisms ( vkpm , moscow , russia ) as cmim b - 1628 . the strain mg442 has a resistance to α - amino - β - hydroxyvaleric acid and has an optionally partial and compensable need for l - isoleucine . for exchange of the chromosomal pcka gene for the plasmid - coded deletion construct , mg442 was transformed with plasmid pmak705δpcka . the gene exchange was carried out by the selection method described by hamilton et al . ( journal of bacteriology 174 , 4617 - 4622 ( 1989 )) and was verified by standard pcr methods ( innis et al . ( 1990 ), pcr protocols . a guide to methods and applications , academic press ) using the following oligonucleotide primers : pcka ′ 5 ′- 1 : 5 ′ - gatccgagcctgacaggtta - 3 ′ ( seq id no : 8 ) pcka ′ 3 ′- 2 : 5 ′ - ccggagaagcgtaggtgtta - 3 ′ ( seq id no : 11 ) mg442δpcka was cultivated on minimum medium of the following composition : 3 . 5 g / l of na 2 hpo 4 . 2h 2 o , 1 . 5 g / l of kh 2 po 4 , 1 g / l of nh 4 cl , 0 . 1 g / l of mgso 4 . 7h 2 o , 2 g / l of glucose and 20 g / l of agar . the formation of l - threonine was checked in 10 ml batch cultures contained in 100 ml erlenmeyer flasks . these were inoculated with 10 ml of a preculture medium of the following composition : 2 g / l of yeast extract , 10 g / l of ( nh 4 ) 2 so 4 , 1 g / l of kh 2 po 4 , 0 . 5 g / l of mgso 4 . 7h 2 o , 15 g / l of caco 3 and 20 g / l of glucose , and incubated for 16 hours at 37 ° c . and 180 rpm on an esr incubator from kühner ag ( birsfelden , switzerland ). 250 μl of this preculture were transferred to 10 ml of a production medium ( 25 g / l of ( nh 4 ) 2 so 4 , 2 g / l of kh 2 po 4 , 1 g / l of mgso 4 . 7h 2 o , 0 . 03 g / l of feso 4 . 7h 2 o , 0 . 018 g / l of mnso 4 . 1h 2 o , 30 g / l of caco 3 , 20 g / l of glucose ) and incubated for 48 hours at 37 ° c . after incubation , the optical density ( od ) of the culture suspension was determined with an lp2w photometer from dr . lange ( berlin , germany ) at a measurement wavelength of 660 nm . the concentration of l - threonine formed was then determined in the sterile - filtered culture supernatant with an amino acid analyzer from eppendorf - biotronik ( hamburg , germany ) by means of ion exchange chromatography and postcolumn reaction with ninhydrin detection . the glutamate dehydrogenase gene from escherichia coli k12 is amplified using the polymerase chain reaction ( pcr ) and synthetic oligonucleotides . starting from the nucleotide sequence for the gdha gene in e . coli k12 mg1655 ( gene library : accession no . ae000270 and no . ae000271 ) pcr primers are synthesized ( mwg biotech , ebersberg , germany ): gdh1 : 5 ′ - tgaacacttctggcggtacg - 3 ′ ( seq id no : 12 ) gdh2 : 5 ′ - cctcggcgaagctaatatgg - 3 ′ ( seq id no : 13 ) the chromosomal e . coli k12 mg1655 dna employed for the pcr is isolated according to the manufacturers instructions with “ qiagen genomic - tips 100 / g ” ( qiagen , hilden , germany ). a dna fragment approx . 2150 bp in size , which comprises the gdha coding region and approx . 350 bp 5 ′- flanking and approx . 450 bp 3 ′- flanking sequences , can be amplified with the specific primers under standard pcr conditions ( innis et al . : pcr protocols . a guide to methods and applications , 1990 , academic press ) with the pfu - dna polymerase ( promega corporation , madison , usa ). the pcr product is cloned in the plasmid pcr2 . 1topo and transformed in the e . coli strain top10 ( invitrogen , leek , the netherlands , product description topo ta cloning kit , cat . no . k4500 - 01 ). successful cloning is demonstrated by cleavage of the plasmid pcr2 . 1topogdha with the restriction enzymes ecori and ecorv . for this , the plasmid dna is isolated by means of the “ qiaprep spin plasmid kits ” ( qiagen , hilden , germany ) and , after cleavage , separated in a 0 . 8 % agarose gel . the plasmid pcr2 . 1topogdha is cleaved with the enzyme ecori , the cleavage batch is separated on 0 . 8 % agarose gel and the gdha fragment 2 . 1 kbp in size is isolated with the aid of the “ qiaquick gel extraction kit ” ( qiagen , hilden , germany ). the plasmid pmw218 ( nippon gene , toyama , japan ) is cleaved with the enzyme ecori and ligated with the gdha fragment . the e . coli strain dh5α is transformed with the ligation batch and pmw218 - carrying cells are selected by plating out on lb agar ( lennox , virology 1955 , 1 : 190 ), to which 20 μg / ml kanamycin are added . successful cloning of the gdha gene can be demonstrated after plasmid dna isolation and control cleavage with ecori and ecorv . the plasmid is called pmw218gdha ( fig3 ). the strain mg442δpcka obtained in example 3 and the strain mg442 are transformed with the plasmid pmw218gdha and transformants are selected on lb agar , which is supplemented with 20 μg / ml kanamycin . the strains mg442δpcka / pmw218gdha and mg442 / pmw218gdha are formed in this manner . the preparation of l - threonine by the strains mg442δpcka / pmw218gdha and mg442 / pmw218gdha is tested as described in example 4 . the minimal medium and the preculture medium are additionally supplemented with 20 μg / ml kanamycin . the rhtc gene from escherichia coli k12 is amplified using the polymerase chain reaction ( pcr ) and synthetic oligonucleotides . starting from the nucleotide sequence for the rhtc gene in e . coli k12 mg1655 ( gene library : accession no . ae000458 , zakataeva et al . ( febs letters 452 , 228 - 232 ( 1999 )), pcr primers are synthesized ( mwg biotech , ebersberg , germany ): rhtc1 : 5 ′ - ctgttagcatcggcgaggca - 3 ′ ( seq id no : 14 ) rhtc2 : 5 ′ - gcatgttgatggcgatgacg - 3 ′ ( seq id no : 15 ) the chromosomal e . coli k12 mg1655 dna employed for the pcr is isolated according to the manufacturers instructions with “ qiagen genomic - tips 100 / g ” ( qiagen , hilden , germany ). a dna fragment approx . 800 bp in size can be amplified with the specific primers under standard pcr conditions ( innis et al . : pcr protocols . a guide to methods and applications , 1990 , academic press ) with pfu - dna polymerase ( promega corporation , madison , usa ). the plasmid pmw219 ( nippon gene , toyama , japan ) is cleaved with the enzyme sami and ligated with the rhtc - pcr fragment . the e . coli strain dh5α is transformed with the ligation batch and pmw219 - carrying cells are selected on lb agar , which is supplemented with 20 μg / ml kanamycin . successful cloning can be demonstrated after plasmid dna isolation and control cleavage with kpni , hindiii and ncoi . the plasmid pmw219rhtc is shown in fig4 . the strain mg442δpcka obtained in example 3 and the strain mg442 are transformed with the plasmid pmw219rhtc and transformants are selected on lb agar , which is supplemented with 20 μg / ml kanamycin . the strains mg442δpcka / pmw219rhtc and mg442 / pmw219rhtc are formed in this manner . the preparation of l - threonine by the strains mg442δpcka / pmw219rhtc and mg442 / pmw219rhtc is tested as described in example 4 . the minimal medium and the preculture medium are additionally supplemented with 20 μg / ml kanamycin . the result of the experiment is summarized in table 3 . the strain b - 3996 has , inter alia , a resistance to α - amino - β - hydroxyvaleric acid , has an attenuated , in particular switched - off , or defective threonine dehydrogenase , has an enhanced homoserine dehydrogenase i aspartate kinase i in the feed back resistant form , has an optionally partial and compensable need for l - isoleucine and has the ability to utilize sucrose . after culture in antibiotic - free complete medium for approximately ten generations , a derivative of strain b - 3996 which no longer contains the plasmid pvic40 is isolated . the strain formed is streptomycin - sensitive and is designated b - 3996kur . the method described by hamilton et al . ( journal of bacteriology ( 1989 ) 171 : 4617 - 4622 ), which is based on the use of the plasmid pmak705 with a temperature - sensitive replicon , was used for incorporation of a deletion into the tdh gene . the plasmid pdr121 ( ravnikar and somerville , journal of bacteriology ( 1987 ) 169 : 4716 - 4721 ) contains a dna fragment from e . coli 3 . 7 kilo - base pairs ( kbp ) in size , on which the tdh gene is coded . to generate a deletion of the tdh gene region , pdr121 is cleaved with the restriction enzymes clai and ecorv and the dna fragment 5 kbp in size isolated is ligated , after treatment with klenow enzyme . the ligation batch is transformed in the e . coli strain dh5α and plasmid - carrying cells are selected on lb agar , to which 50 μg / ml ampicillin are added . successful deletion of the tdh gene can be demonstrated after plasmid dna isolation and control cleavage with ecori . the ecori fragment 1 . 7 kbp in size is isolated , and ligated with the plasmid pmak705 , which is partly digested with ecori . the ligation batch is transformed in dh5α and plasmid - carrying cells are selected on lb agar , to which 20 μg / ml chloramphenicol are added . successful cloning is demonstrated after isolation of the plasmid dna and cleavage with ecori . the pmak705 derivative formed is designated pdm32 . for the gene replacement , b - 3996kur is transformed with the plasmid pdm32 . the replacement of the chromosomal tdh gene with the plasmid - coded deletion construct is carried out by the selection process described by hamilton et al . and is verified by standard pcr methods ( innis et al . ( 1990 ), pcr protocols . a guide to methods and applications , academic press ) with the following oligonucleotide primers : the strain formed is tested for kanamycin sensitivity and is designated b - 3996kurδtdh . for the position - specific mutagenesis of the pcka gene , b - 3996kurδtdh is transformed with the replacement vector pmak705δpcka described in example 2 . the replacement of the chromosomal pcka gene by the plasmid - coded deletion construct is carried out as described in example 3 . the strain obtained is called b - 3996kurδtdhδpcka . b - 3996kurδtdh and b - 3996kurδtdhδpcka are transformed with the plasmid pvic40 isolated from b - 3996 and plasmid - carrying cells are selected on lb agar with 20 μg / ml streptomycin . in each case a selected individual colony is called b - 3996kurδtdh / pvic40 and b - 3996kurδtdhδpcka / pvic40 . the preparation of l - threonine by the strains b - 3996kurδtdh / pvic40 and b - 3996kurδtdhδpcka / pvic40 is tested as described in example 4 . the minimal medium , the preculture medium and the production medium are additionally supplemented with 20 μg / ml streptomycin . the l - lysine - producing e . coli strain pda1 / toc21r is described in the patent application f - a - 2511032 and deposited at the collection nationale de culture de microorganisme ( cncm = national microorganism culture collection , pasteur institute , paris , france ) under number i - 167 . the strain and the plasmid - free host are also described by dauce - le reverend et al . ( european journal of applied microbiology and biotechnology 15 : 227 - 231 ( 1982 )) under the name tocr21 / pda1 . 8 . 1 position - specific mutagenesis of the pcka gene in the e . coli strain toc21r after culture in antibiotic - free lb medium for approximately six generations , a derivative of strain pda1 / toc21r which no longer contains the plasmid pda1 is isolated . the strain formed is tetracycline - sensitive and is called toc21r . for replacement of the chromosomal pcka gene by the plasmid - coded deletion construct , toc21r is transformed with the plasmid pmak705δpcka ( example 2 ). the gene replacement is carried out by the selection method described by hamilton et al . ( 1989 ) journal of bacteriology 174 , 4617 - 4622 ) and is verified by standard pcr methods ( innis et al . ( 1990 ) pcr protocols . a guide to methods and applications , academic press ) with the following oligonucleotide primers : pcka ′ 5 ′- 1 : 5 ′ - gatccgagcctgacaggtta - 3 ′ ( seq id no : 8 ) pcka ′ 3 ′- 2 : 5 ′ - ccggagaagcgtaggtgtta - 3 ′ ( seq id no : 11 ) the formation of l - lysine by the strains toc21rδ pcka and toc21r is checked in batch cultures of 10 ml contained in 100 ml conical flasks . for this , 10 ml of preculture medium of the following composition : 2 g / l yeast extract , 10 g / l ( nh 4 ) 2 so 4 , 1 g / l kh 2 po 4 , 0 . 5 g / l mgso 4 * 7h 2 o , 15 g / l caco 3 , 20 g / l glucose are inoculated and the batch is incubated for 16 hours at 37 ° c . and 180 rpm on an esr incubator from kühner ag ( birsfelden , switzerland ). 250 μl of this preculture are transinoculated into 10 ml of production medium ( 25 g / l ( nh 4 ) 2 so 4 , 2 g / l kh 2 po 4 , 1 g / l mgso 4 * 7h 2 o , 0 . 03 g / l feso 4 * 7h 2 o , 0 . 018 g / l mnso 4 * 1h 2 o , 30 g / l caco 3 , 20 g / l glucose , 25 mg / l l - isoleucine and 5 mg / l thiamine ) and the batch is incubated for 72 hours at 37 ° c . after the incubation the optical density ( od ) of the culture suspension is determined with an lp2w photometer from dr . lange ( berlin , germany ) at a measurement wavelength of 660 nm . the concentration of l - lysine formed is then determined in the sterile - filtered culture supernatant with an amino acid analyzer from eppendorf - biotronik ( hamburg , germany ) by ion exchange chromatography and post - column reaction with ninhydrin detection . the strain b - 3996kurδtdh , which is in need of l - isoleucin , obtained in example 7 . 1 is transduced with the aid of the phage p1kc ( lennox , virology 1 , 190 - 206 ( 1955 ); miller , experiments in molecular genetics , cold spring harbor laboratory 1972 ) and l - isoleucine - prototrophic transductants are isolated . for this , the phage p1kc is multiplied on the strain mg1655 ( guyer et al ., cold spring harbor symposium of quantitative biology 45 , 135 - 140 ( 1981 ) and blattner et al ., science 277 , 1453 - 1462 ( 1997 )) and the phage lysate is employed for the transduction of the strain b - 3996kurδtdh . the multiplicity of the infection is approximately 0 . 2 . selection for l - isoleucine - prototrophic transductants is carried out on minimal agar , which contains 2 g / l glucose and 10 mg / l l - threonine . an l - isoleucine - prototrophic transductant is isolated , smeared on to lb agar for purification or isolation and called b - 3996kurδtdhilva + . the pcka gene of the strain b - 3996kurδtdhilva + is then replaced , as described in example 3 , by the δpcka allele prepared in example 1 and 2 . the strain obtained is called b - 3996kurδtdhilva + δpcka . the strains b - 3996kurδtdhilva + and b - 3996kurδtdhilva + δpcka are transformed with the plasmid pvic40 isolated from strain b - 3996 and plasmid - carrying cells are selected on lb agar , which is supplemented with 20 μg / ml streptomycin . in each case a selected individual colony is called b - 3996kurδtdhilva + δpcka / pvic40 and b - 3996kurδtdhilva + / pvic40 . the preparation of l - isoleucine by the strains b - 3996kurδtdhilva + / pvic40 and b - 3996kurδtdhilva + δpcka / pvic40 is tested under the test conditions as described in example 4 . the minimal medium , the preculture medium and the production medium are additionally supplemented with 20 μg / ml streptomycin . for replacement of the chromosomal pcka gene by the plasmid - coded deletion construct , aj11502kur is transformed with the plasmid pmak705δpcka ( see example 2 ). the gene replacement is carried out by the selection method described by hamilton et al . ( 1989 ) journal of bacteriology 174 , 4617 - 4622 ) and is verified by standard pcr methods ( innis et al . ( 1990 ) pcr protocols . a guide to methods and applications , academic press ) with the following oligonucleotide primers : pcka ′ 5 ′- 1 : 5 ′ - gatccgagcctgacaggtta - 3 ′ ( seq id no : 8 ) pcka ′ 3 ′- 2 : 5 ′ - ccggagaagcgtaggtgtta - 3 ′ ( seq id no : 11 ) the strain obtained is called aj11502kurδpcka . the plasmid described in the patent specification u . s . pat . no . 4 , 391 , 907 , which carries the genetic information in respect of valine production , is isolated from strain nrrl b - 12288 . the strain aj11502kurδpcka is transformed with this plasmid . one of the transformants obtained is called b - 12288δpcka . the formation of l - valine by the strains b - 12288δpcka and nrrl b - 12288 is checked in batch cultures of 10 ml contained in 100 ml conical flasks . for this , 10 ml of preculture medium of the following composition : 2 g / l yeast extract , 10 g / l ( nh 4 ) 2 so 4 , 1 g / l kh 2 po 4 , 0 . 5 g / l mgso 4 * 7h 2 o , 15 g / l caco 3 , 20 g / l glucose and 50 mg / l ampicillin are inoculated and the batch is incubated for 16 hours at 37 ° c . and 180 rpm on an esr incubator from küthner ag ( birsfelden , switzerland ). 250 μl of this preculture are transinoculated into 10 ml of production medium ( 25 g / l ( nh 4 ) 2 so 4 , 2 g / l kh 2 po 4 , 1 g / l mgso 4 * 7h 2 o , 0 . 03 g / l feso 4 * 7h 2 o , 0 . 018 g / l mnso 4 * 1h 2 o , 30 g / l caco 3 , 20 g / l glucose , 5 mg / l thiamine and 50 mg / l ampicillin ) and the batch is incubated for 72 hours at 37 ° c . after the incubation the optical density ( od ) of the culture suspension is determined with an lp2w photometer from dr . lange ( berlin , germany ) at a measurement wavelength of 660 nm . the concentration of l - valine formed is then determined in the sterile - filtered culture supernatant with an amino acid analyzer from eppendorf - biotronik ( hamburg , germany ) by ion exchange chromatography and post - column reaction with ninhydrin detection . the ytfp - yjfa gene region is amplified from escherichia coli k12 using the polymerase chain reaction ( pcr ) and synthetic oligonucleotides . starting from the nucleotide sequence of the ytfp - yjfa gene region in e . coli k12 mg1655 ( seq id no . 5 ), the following pcr primers are synthesized ( mwg biotech , ebersberg , germany ): ytfp - 1 : 5 ′ - ggcgatgtcgcaacaagctg - 3 ′ ( seq id no : 18 ) ytfp - 2 : 5 ′ - ctgttcatggccgcttgctg - 3 ′ ( seq id no : 19 ) the chromosomal e . coli k12 mg1655 dna employed for the pcr is isolated according to the manufacturers instructions with “ qiagen genomic - tips 100 / g ” ( qiagen , hilden , germany ). a dna fragment approx . 1300 bp in size can be amplified with the specific primers under standard pcr conditions ( innis et al . ( 1990 ) pcr protocols . a guide to methods and applications , academic press ) with taq - dna polymerase ( gibco - brl , eggenstein , germany ). the pcr product is ligated with the vector pcr2 . 1topo ( topo ta cloning kit , invitrogen , groningen , the netherlands ) in accordance with the manufacturers instructions and transformed into the e . coli strain top10f ′. selection of plasmid - carrying cells takes place on lb agar , to which 50 μg / ml ampicillin are added . after isolation of the plasmid dna , successful cloning of the pcr product is checked with the restriction enzymes ecori and nsii . to generate a 337 bp deletion in the yftp - yjfa region , the vector pcr2 . 1topoytfp - yjfa is cleaved with the restriction enzymes ndei and sspi and the dna fragment 4 . 8 kbp in size is ligated , after treatment with klenow enzyme . to generate a 90 bp deletion , the vector pcr2 . 1topoytfp - yjfa is cleaved with the enzymes ndei and spli and the dna fragment 5 kbp in size is ligated , after treatment with klenow enzyme . the e . coli strain dh5α is transformed with the ligation batches and plasmid - carrying cells are selected on lb agar , to which 50 μg / ml ampicillin is added . after isolation of the plasmid dna those plasmids in which the mutagenic dna sequence shown in seq id no . 6 and seq id no . 7 is cloned are detected by control cleavage with the enzyme ecori . the plasmids are called pcr2 . 1topoδyjfa and pcr2 . 1topoδ90bp . the ytfp - yjfa alleles described in example 11 are isolated from the vectors pcr2 . 1topoδyjfa and pcr2 . 1topoδ90bp after restriction with the enzymes saci and xbai and separation in 0 . 8 % agarose gel , and ligated with the plasmid pmak705 ( hamilton et al . ( 1989 ) journal of bacteriology 174 , 4617 - 4622 ), which is digested with the enzymes saci and xbai . the ligation batches are transformed in dh5α and plasmid - carrying cells are selected on lb agar , to which 20 μg / ml chloramphenicol are added . successful cloning is demonstrated after isolation of the plasmid dna and cleavage with the enzymes saci and xbai . the replacement vectors formed , pmak705δyjfa (= pmak705deltayjfa ) and pmak705δ90bp (= pmak705delta90bp ), are shown in fig2 and in fig5 . position - specific mutagenesis of the ytfp - yjfa gene region in the e . coli strain mg442 for replacement of the chromosomal ytfp - yjfa gene region with the plasmid - coded 90 bp deletion construct , mg442 is transformed with the plasmid pmak705δ90bp , the gene replacement is carried out by the selection method described by hamilton et al . ( 1989 ) journal of bacteriology 174 , 4617 - 4622 ) and is verified by standard pcr methods ( innis et al . ( 1990 ) pcr protocols . a guide to methods and applications , academic press ) with the following oligonucleotide primers : ytfp - 1 : 5 ′ - ggcgatgtcgcaacaagctg - 3 ′ ( seq id no : 18 ) ytfp - 2 : 5 ′ - ctgttcatggccgcttgctg - 3 ′ ( seq id no : 19 ) the preparation of l - threonine by the strain mg442δ90yjfa is tested as described in example 4 . the result of the experiment is summarized in table 8 . | 2 |
fig4 is a cross - sectional view of an actuator according to an embodiment of the present invention . on one side of a layer 402 of an electroactive polymer ( eap ), with characteristics that have been discussed in preceding sections , is disposed a stretchable electrode structure 403 . the structure 403 is shown on the drawing as a solid layer covering the top side of the eap layer 402 but may , however , be embodied as an openwork structure , e . g ., a lattice of intersecting elongated tabs or tongues having a total density suitably chosen to unite a low overall elastic stiffness with an adequate ( tangential ) uniformity of the applied electric field . suitable materials for the stretchable electrode structure have been exemplified above . the actuator further comprises a counter electrode layer 401 secured to the eap layer 402 . the counter electrode layer 401 is electrically conductive and differs from the stretchable electrode structure 403 primarily by being substantially stiffer , at least in the tangential ( in - plane ) direction . guidelines for the choice of mechanical properties of the counter electrode material have been given above ; for instance , the elastic modulus of the counter electrode may be above 1 gpa , suitably about 4 gpa , while the elastic modulus of the eap may be in the range from 10 kpa to 5 mpa . together with a power unit 410 , the stretchable electrode structure 403 and the counter electrode layer 401 are operable to apply an electric field across the eap layer 402 . as further shown in fig4 , each of the electrodes 401 , 403 is segmented into a plurality of alternative regions which can be selected using respective switches 411 , 413 for connecting a region to a voltage source 412 in the power unit 410 . fig5 shows the actuator of fig4 in an actuated state , in which a non - zero electric field induces a deformation of the eap layer 402 into reduced thickness and , by incompressibility , into greater surface area . the actuator relaxes into the shape shown on the drawing , wherein a portion of the surface - area increase is absorbed by the fact that the boundary zone of the selected active region extends outwardly from the plane of the eap layer 402 , thereby limiting the in - plane expansion around the active region . notable are the relatively sharp corners along the boundary zone of the active region , in which the voltage is applied . these corners give rise to an embossed pattern on the top surface of the actuator . to manufacture the actuator shown in fig4 and 5 , one may proceed according to the example given below or one of its possible variations . fig6 is a cross - sectional view of an actuator . the actuator consists of a counter electrode layer 601 , an eap layer 602 of thickness d p and a stretchable electrode structure 603 . the actuator further comprises a passive layer 604 that is secured to the stretchable - electrode side of the actuator and has thickness d eap . the passive layer 604 is preferably somewhat thicker than the eap layer 602 , so as to allow the actuator to deform in an unrestricted manner even if the passive layer 604 is attached to a substrate ( not shown ) located on the top side of the actuator on this drawing . indeed , at large transversal compression of the passive layer 604 between the actuator and the substrate , the passive layer 604 may locally exert an appreciable reactive force onto the actuator , thus deviating from its intended purpose to support the actuator in a neutral and even fashion . the actuator shown in fig6 can be manufactured in a similar fashion as that of fig4 , either with a reflective ( e . g ., metalized ) or non - reflective counter electrode layer . the passive layer 604 may be deposited and cured directly on top of the stretchable electrode structure 603 as long as this operation does not involve chemical substances , radiation , temperature or other treatments that are potentially harmful to the actuator . as an alternative , the passive layer 604 is manufactured in a separate process and is then bonded to the actuator . the latter alternative is likely to reduce the time required for manufacturing and may also be advantageous in that it limits contamination and damages to those layers of the laminate which are already finalized . the passive layer 604 may generally consist of the same material as the eap layer 602 or of a similar material . preferably , the passive layer 604 is as soft as , or softer than , the eap layer 602 . the passive layer 604 may for instance be made of a soft elastomer , such as silastic ®. when choosing the passive layer material , one may also take into account its capacity to bond to the intended substrate . although symbolically shown as a solid body on the drawing , the passive layer 604 may comprise one or more cavities . as one example , cavities may be provided next to each active region ( or each separately operable electrode portion ). hence , in the particular case that the actuator is deployed in a horizontal position , there is a cavity immediately above or below each active region . as another example , one cavity may extend over all active regions , so that the actuator is supported ( retained ) mainly at its edges . if the support layer 604 comprises cavities , then preferably these are aligned with the active regions of the respective electrodes before the support layer 604 is secured to the actuator . it is contemplated to apply the present invention to adaptive optics , in particular adaptive lighting applications . for example , luminaires may be provided with adaptive mirrors allowing the emitted light to be redirected spatially . when transparent electrode and eap materials are chosen , the invention can also be embodied as an adjustable refractive element . moreover , the top layer of the actuator can be used to realize a tactile surface for interaction with a user , such as a touch screen with a topography of elevated buttons . the person skilled in the art realizes that the present invention by no means is limited to the preferred embodiments described above . on the contrary , many modifications and variations are possible within the scope of the appended claims . for example , the embodiments disclosed in this application may be varied by substituting materials or adding further layers and may nevertheless by virtue of the asymmetry of the new structures exhibit a duck - mode - like behavior when energized . without being limited thereto , the invention will be illustrated by an example concerning an actuator of the type shown in fig4 and 5 . an eap film in the form of a 80 - μm layer of nusil ® cf19 - 2186 was made by doctor - blade coating on a suitable surface , e . g ., a teflon ® plate . after curing in an oven , a well - performing dielectric actuation film was obtained . secondly , a stretchable electrode was disposed on one side of the dielectric film . for the purposes of this application , “ stretchable ” particularly means that it can significantly change in length without significant material failures , such as mechanical rupture or loss of conductivity . in this example , the stretchable electrode was made of carbon black . on the other side of the dielectric film , aluminum - coated mylar ® foil of 1 . 5 μm thickness was deposited ( draped ) to serve both as the counter electrode and as a reflective surface . the mylar ® foil was applied with its reflective surface on the outside , as this gives a more neutral reflection , unaffected by the optical properties of the mylar ® film . the actuator according to the above example behaved in duck mode , which was believed to be caused by the asymmetry of the system that the pet film introduced . in an active region , where an electric field was applied , the pet film would duck below the actuator plane in well - defined areas . in the particular case of a grid - shaped , non - solid stretchable electrode , the electric field would be strongest below the stripes making up the grid , where the electrode structures on each side overlap . in these regions of high electric field intensity , height differences of up to 30 μm and steep local bending angles were measured using an optical probe . if the stripes of the grid were disposed in a sparse fashion , there appeared intermediate regions in which the local electric field was not sufficiently strong to cause the actuator to deform . even though the electric field is expected to vary continuously with respect to the tangential coordinate , the intermediate regions with an electric field below the actuation threshold were generally clearly delimited . the thickness of the eap layer , which may range from 10 to 150 μm ; the choice of eap material : generally soft dielectric elastomers can be used ; alternatives to nusil ® are acrylics ( such as 3m ™ vhb ™ 4905 or 4910 ), polyurethanes , polyvinyl chloride and several silicone rubbers ( such as wacker elastosil ® rt625 , dow corning wl3010 , wl5331 , hs3 , sylgard ® 186 , 184 ); the choice of stretchable electrode material : alternatives include pedot or carbon nanotubes ; and the choice of counter electrode material , which could be replaced by steinerfilm ® or some other pet film , which is purchased as a manufactured article or is produced in a separate , possibly parallel , process . | 7 |
fig1 shows an rf base station 100 having a signal generator 120 driving an antenna 110 . the signal generator 120 is activated and deactivated by a on / off control line 140 driven by the signal generator controller 130 . an optional circulator 170 is shown between the signal generator 120 and the antenna 110 which may take signals received by antenna 110 and route them to optional receiver 180 . receiver 180 then sends demodulated signals to the base station electronics which may be part of the signal generator controller 130 . the signal generator controller 130 has conceptually an external trigger input 150 and an external trigger output 160 . although these can be physically separate signals , the preferred embodiments combine them into a bidirectional signal . the signal generator controller 130 is programmed by an application controller ( shown later ) through input / output 170 . in a typical application , the signal generator controller 130 is programmed to activate the on / off control line 140 after a count n of trigger deactivations , where the count could be zero or greater . the application controller initiates an application command . if the count n programmed into the signal generator controller 130 is zero , the signal generator controller activates the signal generator 120 immediately . otherwise , the signal generator controller 130 continuously polls the trigger input 150 , counts deactivations , and activates the signal generator 120 after the count n is reached . the signal generator controller 130 could be implemented as a state machine using logic gates , a programmable logic device ( pld ), or an application specific integrated circuit ( asic ). creating a state machine using these techniques is well known . alternatively , the signal generator controller 130 could be implemented using a micro controller running a software polling program . writing a program to poll a general purpose micro controller input and activate a general purpose output uses well known techniques . fig2 shows a detail of a preferred implementation of the trigger input circuit . in a preferred embodiment , the trigger input 150 is a multi - state signal wire . the states can be detected using a comparator with a fixed threshold . comparator 220 compares the trigger input 150 to a threshold 240 which is set to a point between the states “ none active ” and “ one active .” the comparator 220 distinguishes these two states . comparator 210 compares the trigger input 150 to a threshold 230 which is set to a point between the states “ one active ” and “ more than one active .” the comparator 220 distinguishes these two states . thus the output of the circuit of fig2 distinguishes three states . the transition of signal 260 from “ one active ” to “ none active ” is counted as a trigger deactivation . the assertion of the signal 250 in the state “ more than one active ” indicates that more than one base station has its signal generator activated . this can be used as an error condition . fig3 shows a detail of a preferred implementation of the trigger output circuit . in a preferred application , the “ none active / one active ” input 310 is actually the rf field on / off signal 140 . the input 310 turns on or off a fixed current source 330 . the current source 330 drives the trigger out signal 160 , the current sinking into a fixed resistive terminator 320 . when the input 310 indicates “ none active ”, the current source is off , no current flows through the terminator 320 , and the voltage at trigger out 160 is zero . when the input 310 indicates “ one active ”, the current source is on , current flows through the terminator 320 , and the voltage at trigger out 160 is a fixed non - zero level . in a preferred implementation , multiple base stations have their trigger out signal 160 bused together , but there is only one terminator 320 . if more than one base station drives current into the terminator , a higher voltage indicating “ more than one active ” results on line 160 . fig4 shows a preferred implementation of a system of multiple base stations 100 connected to a single application controller 410 . for example , three base stations 102 , 104 , and 106 are shown , along with an optional article detector 480 . in the preferred embodiment , the base stations 102 , 104 , and 106 and application controller 410 are connected by a local area network 420 , but other connections are also contemplated . in the preferred embodiment , the external trigger in 150 and external trigger out 160 are a single bidirectional signal , and the trigger from the first , second , and third base stations are connected to a trigger bus 430 and a resistive terminator 320 . two rf tags 440 with associated tag electronics 450 , and tag antennas 460 are shown receiving rf radiation 470 from base station 104 . the tags 440 may optionally be relatively moving with respect to the base stations with a tag velocity 480 . one typical application , shown by the block diagram of fig5 is to identify all tags currently in the field . in this case , the first base station a would be programmed by the application controller in step 510 to turn on immediately , the second base station b after one trigger negation , and the third base station c after two negations . the application controller sends out the identification command in step 520 . once the base stations receive the identification command , the first base station a activates its rf field , performs its algorithm , sends out an external trigger negation signal on line 150 / 160 , and turns off in step 530 . the second base station b , sensing the first trigger negation , activates its rf field in step 540 and follows the same path . likewise , when the second base station b finishes sending and sends out the second trigger negation signal , the third base station c activates in step 550 . after all the base stations have completed their turns , the process is ended in step 560 . the timing between one base station turning off , and another base station turning on is critical . the time elapsed must be less than the time t max where a passive tag 440 ( a tag without a separate battery to provide the tag electronics 450 with power ) in the rf field loses so much energy that the tag electronics 450 no longer function . the time t max must also be less than a time t min where the tag can distinguish that the base station transmission has terminated , since the tags are programmed to reset themselves a time t min after transmission ceases from the base station . the time t max is preferably 1 millisecond , more preferably 100 microseconds , and most preferably 30 microseconds . this setup need only be performed once in making a single pass through the identification algorithm . 1 . only one command need be sent by the application controller 410 . this minimizes network 420 traffic and application controller 410 processing . 2 . the switch over among base stations is performed independent of application controller 410 processing and network 420 traffic . the switching time can be minimized and a worst case maximum switchover time t max can be specified . a second typical application is continuous identification shown in fig6 . in this variation , base station a is told by the application controller in step 610 that it is first in a ring of three base stations . base station b is told that it is second of three , and base station c the third of three . then the application controller sends out the identification command in step 620 . once base stations a , b , and c receive the identification command , base station a becomes active in step 630 . base station b is programmed to start after one trigger , and base station c after two triggers . once base station a completes , rather than terminating as before , it is reprogrammed to start again after two triggers . base stations b and c are programmed identically after they complete the first round . control passes to base station b in step 640 , and base station c in step 650 . the system returns to step 630 to cycle continuously . the result is a continuous identification , with control passing to base stations a , b , c , a , b , c and so on indefinitely . once again , there is no application controller 410 processing or network 420 traffic required as the identification process passes from base station to base station . the actual termination of the process of fig6 can be programmed to be after a tag is identified , after a preset time limit , after a command from the application controller , or other application determined criteria . a third typical application is processing a moving tag as shown schematically in fig4 . again the setup would be to transmit from base station a followed by base station b followed by base station c if the tag were known to always move in the direction where it would enter the zone of base station a followed by zone b followed by zone c , as an example , tags on a conveyer belt would enter the relevant zones sequentially . base station a , would first try to process the tag for a time corresponding to the time that a tag would be in the zone of base station a . once base station a completed its attempt , control would pass to base station b and then to base station c . in this application , the first trigger signal might come from a detector 480 which detected a moving object moving into the zone covered by base station a . in one preferred embodiment , the signal generator controller is a digital state machine whose input is the trigger and a programming mechanism . the output of the state machine is the rf field on / off control . in another preferred embodiment , the signal generator controller is a micro controller programmed to insure guaranteed response time . the trigger is a software readable input and the rf field on / off control is a software controlled output . when suitably programmed , the micro controller continuously polls the trigger input . in either preferred embodiment , the signal generator controller can be programmed to turn on the rf field after the trigger activates and deactivates one or more times , or turn off the rf field and record an error if the trigger indicates that more than one base station &# 39 ; s rf field is on . in one preferred embodiment , the trigger output is a single signal line with multiple states . in another preferred embodiment , the trigger output is a set of signal lines , each line having only two states . in another preferred embodiment , the trigger signal is a resistively terminated wire , and the driver is a current source . the resulting voltage across the termination is proportional to the number of base stations driving the trigger . in a preferred embodiment , the trigger signal is bidirectional , a single wire connected in a bus architecture to each base station . this single wire is both detected by and potentially driven by each base station . in a preferred system embodiment , multiple base stations covering a zone have their trigger circuits connected together in a bus structure . each base station is programmed to turn on its rf field based on a programmable count of trigger signals . the result is that the application controller need only initiate the first base station in the sequence , after which time the other base stations will activate in turn without further intervention from the application controller . the sequence can be a series , with the application command terminating after the final base station in the series completes , or it can be a loop , with the command continuing indefinitely until an event is detected . the event can be the detection of tags meeting a certain criteria , reaching a time limit , an object moving out of the zone covered by the tags , or the application controller indicating that the loop should terminate . in a preferred sequence , base stations which have overlapping fields are adjacent in the programmed sequence , so that tags within the overlap region do not detect the field switching . in an alternate preferred sequence , base stations turn on in a sequence related to the typical movement of the rf tag in the zone , so that the speed at which moving tags are located is optimized . given this disclosure , equivalent embodiments of this invention will be apparent to those skilled in the art . these embodiments are also within the contemplation of the inventors . a multiple two state digital wire encoding of the trigger state 430 rather than the multi - state analog encoding disclosed . a base station 100 with separate trigger in 150 and trigger out 160 rather than the bidirectional unified trigger signal 420 disclosed . a chaining of trigger signals rather than the bus architecture 420 disclosed . a star arrangement where a trigger pulse is sent from a base station , from the application controller , or from an event detector to a central location , which then sends a trigger pulse to all the base stations . | 6 |
the embodiments of the invention and the various features and advantageous details thereof are explained more fully with reference to the non - limiting embodiments and examples that are described and / or illustrated in the accompanying drawings and detailed in the following description . it should be noted that the features illustrated in the drawings are not necessarily drawn to scale , and features of one embodiment may be employed with other embodiments as the skilled artisan would recognize , even if not explicitly stated herein . descriptions of well - known components and processing techniques may be omitted so as to not unnecessarily obscure the embodiments of the invention . the examples used herein are intended merely to facilitate an understanding of ways in which the invention may be practiced and to further enable those of skill in the art to practice the embodiments of the invention . accordingly , the examples and embodiments herein should not be construed as limiting the scope of the invention , which is defined solely by the appended claims and applicable law . moreover , it is noted that like reference numerals represent similar parts throughout the several views of the drawings . according to an aspect of the invention , a player may be provided with an option to play a feature game when the player elects to participate in a game of chance by , for example , purchasing a base game and an add - on feature game or purchasing a feature game alone . the base game may be any game of chance where a player is provided with a predetermined set of characters from which the player must select a smaller subset of characters . for example , the base game may be a lottery game having two , three , four , five , six , seven or more characters that may be selected by a player ( or a computer device such as , for example , a lottery computer terminal ) and subsequently matched to an equal number ( or lesser number ) of characters that are randomly selected or randomly drawn by a game of chance provider , such as , for example , a lottery administering entity using , e . g ., a lottery number drawing machine . the feature game may be a multidimensional game having a plurality of cells . the cells may be configured in rows and columns to form , for example , a multidimensional matrix or grid . each of the cells may be populated with a character that was previously selected by a player from a larger set of characters . further , the cells may be populated with characters that are selected by a computer device ( such as , for example , a lottery computer terminal , a remote computer that is linked to a game of chance computer device through a network , or the like ). in this regard , the characters may be selected or generated by the computer device using , for example , a random number generator . the characters may be selected individually to populate the cells of a grid for a particular feature game , or a completed grid of characters may be selected from a plurality of completed grids of characters that may be stored locally in the computer device or stored remotely in another computer device . further , the characters ( or the completed grids of characters ) may be selected or generated by the computer device so that a predetermined number of winners may likely result from a particular game of chance drawing . the characters that may be selected by a player or a computer device for the base game or the feature game include numeric characters such as , for example , the numbers 0 to 9 . the player may select the characters by , for example , filling a playing card , entering data into a computer device , communicating the characters to a game of chance administering attendant using spoken and / or written communication , or the like . as the skilled artisan will readily appreciate , the characters may include alphanumeric characters selected from at least one of the world languages ( such as , e . g ., arabic , chinese , english , french , german , japanese , korean , latin , and the like ), pictorial characters ( such as , e . g ., images of animals , images of toys , images of fruits , images of food types , images of famous persons , images of landmarks , images of building structures , or the like ), symbol characters ( such as , e . g ., squares , triangles , circles , or the like ), or a combination of alphanumeric characters , pictorial characters and / or symbol characters , without departing from the scope or spirit of the invention . the player may be provided with multiple opportunities to win a prize . for example , the player may be provided with an opportunity to win a prize if the characters in the base game purchased by the player match an equal or lesser number of subsequently selected or randomly drawn characters . the player may be provided with further opportunities to win a prize ( or to win an additional prize ) if the characters in the feature game match one or more subsequently selected or randomly drawn characters and the characters in the feature game are configured in one or more predetermined geometric configurations . further , the winning characters for the feature game may be determined prior to providing the player with an option of playing the feature game . fig1 shows a preferred embodiment of the invention . according to the preferred embodiment of the invention , a player may participate in a game of chance , for example , by purchasing a pick 3 lottery game . the player may be provided with an opportunity to play a feature game of a random tic - tac - toe style grid 8 , which may be reproduced on a game ticket 50 . the game ticket 50 may be a single game ticket , including both the base game and the feature game , or a plurality of game tickets , including only the base game or only the feature game . further , the game ticket may be a physical ticket with characters reproduced on a base material ( such as , e . g ., paper , plastic , metal , wood , cloth , or the like ) or a virtual ticket ( such as , e . g ., an electronic ticket ) that may be associated with a record ( or file ) entry in a database and that may be reproduced as an image on a display device , such as , for example , a computer display , a telephone display , a personal data assistant ( pda ) display , or the like . the grid 8 may include characters , such as , for example , the numbers 0 through 9 , in a plurality of cells 45 of the game ticket 50 . the game ticket 50 may also include the player &# 39 ; s original wager information 7 , which may be reproduced in a predetermined area of the game ticket 50 along with the grid 8 , which may be reproduced in another predetermined area of the game ticket 50 . the grid 8 may be generated at the start of a game to ensure that no grid 8 contains any character more than a predetermined number of times ( such as , e . g ., three times ) and that there is an even distribution of winning grids 8 amongst a plurality of reproduced game tickets . following a game drawing , the player may play the base game ticket 50 by matching the characters on the game ticket 50 to an equal number ( or lesser number ) of base game winner characters that have been randomly drawn or selected from a larger group of base game characters . additionally , the player may play the feature game by matching the characters reproduced in the cells 45 of the grid 8 to a feature game winner grid having an equal number of cells . fig2 shows an illustration of the exemplary grid 8 . in fig2 , a prize may be awarded for a particular game ticket 50 based on one or more geometric configurations of the characters populating the cells 45 of the grid 8 . for example , a prize may be awarded by matching three characters that are drawn for the pick 3 game to the characters populating the cells 45 on the grid 8 . hence , a game ticket 50 can be a winning ticket if the grid 8 includes three consecutive cells arranged in at least one of a row l h , a column l v and / or a diagonal line l d that comprise adjoining characters that match the winning characters . specifically , the characters may be matched in order ( or not in order ) in any one of the columns l v1 , l v2 , l v3 , any one of the rows l h1 , l h2 , l h3 , or along one of the diagonals lines l d1 or l d2 . the characters in the grid 8 may be compared to the winning characters to determine whether the game ticket 50 has one or more winning rows l h , columns l v , or diagonal lines l d . prizes , such as , for example , cash , may be awarded for each winning row l h , column l v , or diagonal line l d . the prizes may be awarded on a basis of a number of winning rows l h , columns l v , or diagonal lines l d for a particular game ticket 50 . for example , the value or the size of a prize to be awarded for a particular game ticket 50 may be determined on a basis of the number of winning rows , winning columns and / or winning diagonals on the particular game ticket 50 . hence , multiple wins may be awarded a higher prize and may be programmed into a grid generation process , discussed below with reference to fig5 . additionally , the value or the size of the prize to be awarded for a particular game ticket 50 may be determined on a basis of a match type . the match type may include , for example , an identification of a particular row in a plurality of rows in the grid 8 ; an identification of a particular column in a plurality of columns in the grid 8 ; or an identification of a particular diagonal in a plurality of diagonals in the grid 8 . hence , a prize to be awarded for a game ticket 50 having a particular matching column may have a different value or size from a prize to be awarded for a game ticket 50 having another matching column , row or diagonal . also provided on the game ticket 50 may be one or more of the following : a name of the game 26 , a game owner / sponsor 27 , a date ( or dates ) of the drawing event ( s ) 28 , a game ticket identifier 37 and / or a machine readable game ticket identifier 40 . as the skilled artisan will readily appreciate , other kinds of information may be reproduced or associated with a game ticket 50 , depending on , e . g ., a particular application of the invention , without departing from the scope or spirit of the invention . for instance , the game ticket 50 may include player identifying information ( such as , e . g ., an image of a player , a fingerprint of a player , or the like ). fig3 illustrates an exemplary system 200 for carrying out a game of chance , including the base game and an add - on feature game or a feature game alone , according to an aspect of the invention . referring to fig3 , the system 200 includes a local terminal 210 , a remote computer 250 and a drawing machine 270 . the local terminal 210 may be coupled to the remote computer 250 via communication links 220 , 240 and a network 230 . the remote computer 250 may be coupled to the drawing machine 270 via a communication link 260 . the local terminal 210 and the remote computer 250 may each include , but are not limited to , for example , any one or more of a general purpose computer , a personal computer , a laptop computer , a notebook computer , a palm - top computer , a workstation , a server , a lottery game computer terminal device , a lottery game server , a database , or the like , depending on the particular application , without departing from the scope and / or spirit of the invention . moreover , the local terminal 210 and the remote computer 250 may include software and / or hardware configured to carryout aspects of the invention . the local terminal 210 may be strategically located at , for example , a vendor location , a personal site location ( such as , e . g ., a home , a place of business , or the like ), a public site location ( such as , e . g ., a public facility ), or the like , depending on a particular application of the invention , as the skilled artisan will readily appreciate . further , the remote computer 250 may be located at the same location as the local terminal 210 or at a different location , which is remote from the location of the local terminal 210 , such as , for example , a central data warehouse facility , or the like . the communication links 220 , 240 and 260 may include at least one of , or a combination of a wired communication medium , a wireless communication medium , an optical communication medium , or the like , capable of bidirectionally transporting communication data , as is known by those skilled in the art . the network 230 may include a local area network ( lan ), a wide area network ( wan ), a broadband network , the internet , or the like , or any combination of a lan , a wan , a broadband network , the internet , or the like . the drawing machine 270 may be a machine that randomly selects one or more objects from a group of objects . moreover , the drawing machine 270 may include a plurality of machines , each of which may randomly select one or more objects from a particular group of objects associated with the particular machine . each of the objects may be provided with a character marker . for example , the objects may be balls labeled with numbers and the drawing machine 270 may be a lottery ball drawing machine that randomly selects lottery balls from a bin of lottery balls , as is known by those skilled in the art . fig4 illustrates an exemplary game ticket generation process that may be performed to reproduce the feature game on the game ticket 50 , shown in fig1 . the process may begin when a predetermined number of characters are received from a player ( such as , e . g ., three or more characters ) or randomly generated by a computer for the player ( step s 310 ). a grid may be generated according to a grid generation process , an example of which is discussed below with reference to fig5 ( step s 320 ). the generated grid may be reproduced on a game ticket as an add - on feature game or a feature game ( step s 330 ). in generating the grid with cells ( step s 320 ), a completed grid may be randomly selected ( or systematically selected , if so desired ) from a predetermined set of completed grids using predefined rules . the predetermined set of grids may include all possible permutations of grids for a particular set of characters that have been generated and stored in a grid storage according to the predefined rules , such as , but not limited to , for example , a predetermined repetition frequency threshold for each character in a given grid , a predetermined number of single win grids , double win grids , etc ., and the like . alternatively , a grid may be generated ( step s 320 ) by , for example , populating each of the cells of the grid with one or more characters that have been provided by a player or one or more characters that have been provided by a computer device into n x m x o x . . . cells configured in a multidimensional grid ( where n and m are positive integers greater than or equal to two , and o and subsequent dimensions are positive non - zero integers , all of which may have the same or different values ). in the latter instance , the one or more characters may be generated using , for example , a random number generator ; or the characters may be systematically selected from a larger group of characters . the predefined rules may include , but are not limited to , for example , a number of occurrences of a particular character , a number of occurrences of a particular grid , a prize ( or prizes ) to be awarded to a single win grid , a double win grid , a triple win grid , a quadruple win grid , etc ., a number of winners for a particular game of chance drawing , a number of winners for a particular geographic location , and the like . for example , the grid may be generated so that no character may be repeated more than x times on any single grid , where x is a positive integer greater than zero . further , a particular grid may be generated so that no more than y occurrences ( such as , e . g ., eight occurrences ) of the grid occur per z feature games ( such as , e . g ., one thousand games ), where y and z are positive integers . a prize may be preset and associated with a particular winning grid . a preset number of winners may be provided for a particular feature game so that the number of winning grids may be controlled for the particular feature game . moreover , the grid may be generated so that a particular winning grid is reproduced in a predetermined geographic location , which may be determined on a basis of , e . g ., an area code , a zip code , geographic coordinates of longitude and latitude , a vendor address , a vendor identification , past winnings history at a particular vendor , the number of wins for a particular vendor , or the like . the skilled artisan will readily appreciate that other rules may be defined and applied without departing from the scope or spirit of the invention , depending on , for example , a particular application of the invention . where the winning characters are predetermined for a particular feature game , the predefined rules may be used to accurately and selectively control , for example , but not limited to , a number of winning game tickets , a number of certain types of winning game tickets , a number of prizes and / or a value of a prize to be awarded to a particular winning game ticket , the locations where the winning tickets may be provided , and the like . for example , in generating a three - by - three ( 3 × 3 ) grid for a particular game ticket using the predefined rules ( e . g ., step s 320 in fig4 ), a populated grid may be randomly selected ( or systematically selected ) from a plurality of stored grids , or the grid may be populated with characters provided by a player or by a computer . each of the cells in the selected grid may be compared to , for example , three winning characters for the feature game . additionally , each of the eight configurations of the cells on the grid may be compared to the three winning characters . in this regard , each row of cells on the grid , each column of cells on the grid and each diagonal line of cells on the grid may be compared to the three winning characters . as the skilled artisan will readily appreciate , a winning grid may be selected for a three - by - three grid that is populated by numbers having a value of 0 to 9 so that eight winning grids are provided for every one thousand feature games provided . as a result of the above process , an even and random distribution of winning grids may occur starting at about ten thousand grids . according to a further aspect of the invention , a computer program may be provided in at least one computer readable medium that , when executed on a general purpose computer ( such as , for example , the remote computer 250 or local terminal 210 shown in fig3 ) causes the computer to execute the steps s 310 to s 330 of the game ticket generation process . in this regard , the computer program may include a code section for executing each of the steps s 310 to s 330 ( discussed above ) on the general purpose computer to carry out the exemplary process shown in fig4 . fig5 illustrates an exemplary grid generation process that may be executed for each feature game drawing or executed once for a predetermined number of feature game drawings . the exemplary grid generation process generates a bank grid having n × m cells configured in a multidimensional grid , where n and m are positive integers greater than or equal to two , which may have the same or different values ( step s 335 ). the bank grid may be generated by , for example , populating each of the n × m cells of the bank grid with a character , which may be randomly or systematically selected from a set of available characters . once all of the n × m cells of the bank grid are populated , a determination may be made regarding the frequency ( rate ) of repetition of each of the characters populating the bank grid ( step s 340 ). the determined repetition frequency for each of the characters may then be compared to a repetition frequency parameter in the predefined rules , which may include a repetition frequency parameter of x , where x is a positive integer greater than zero ( step s 345 ). if a determination is made that a repetition frequency for any character in the bank grid is greater than x (“ yes ” at step s 345 ), then the bank grid may be rejected ( step s 350 ). the grid generation process will then return to generate another bank grid ( step s 335 ). if , however , a determination is made that a repetition frequency for each of the characters populating the bank grid is less than , or equal to x (“ no ” at step s 345 ), then the bank grid is compared to all stored bank grids for the feature game ( step s 355 ). in particular , each of the possible winning combinations on the bank grid ( such as , for example , the eight possible winning combinations in a 3 × 3 grid ) may be compared to an equal number of possible winning combinations in each of the stored bank grids . for example , each of the rows of cells , the columns of cells and the diagonal lines of cells in the bank grid may be compared to the rows of cells , the columns of cells and the diagonal lines of cells in each of the stored bank grids . once the comparison of the bank grid to all of the stored bank grids is complete , the bank grid is categorized as a single win grid , a double win grid , a triple win grid , a quadruple win grid , etc . ( step s 360 ). a determination may be made whether the bank grid categorization complies with a predefined rule , such as , for example , a parameter y setting a number of permissible wins , such as , for example , single wins , double wins , triple wins , quadruple wins , or the like , for the feature game , where y is a non - zero integer ( step s 365 ). if a determination is made that the bank grid categorization exceeds the predefined rule ( e . g ., the bank grid characterization is greater than y ) (“ yes ” at step 365 ), then the bank grid is rejected ( step s 350 ). however , if a determination is made that the bank grid categorization does not exceed the predefined rule (“ no ” at step 365 ), then the bank grid is tagged and stored ( step s 370 ). in this regard , the bank grid may be tagged by , for example , entering a grid - type identification in a field of a record associated with the bank grid , identifying the bank grid as , for example , a single win bank grid , a double win bank grid , a triple win bank grid , etc . similarly , a grid - type identification may be entered or updated in a record associated with the stored bank grid ( s ) that were determined to match the winning combinations of the generated bank grid . next , a determination is made whether all possible bank grids have been generated and stored for a feature game grid having n × m cells , in accordance with the predefined rules ( step s 380 ). if a determination is made that all of the possible bank grids have not been generated and stored (“ no ” at step s 380 ), then a new bank grid is generated ( step s 335 ), otherwise the process ends (“ yes ” at step s 380 ). according to a still further aspect of the invention , a computer program may be provided in at least one computer readable medium that , when executed on a general purpose computer , causes the computer to execute the steps s 335 to s 380 shown in fig5 . in this regard , the computer program may include a code section for each of the steps s 335 to s 380 ( discussed above ) to cause the general purpose computer to carry out the exemplary process shown in fig5 . fig6 illustrates an exemplary feature game redemption process according to an aspect of the invention . the process may begin when a player submits a game ticket for redemption ( step s 410 ). the game ticket may be submitted physically or electronically , as is known by those skilled in the art . after receiving the game ticket , all of the characters are retrieved from the grid on the game ticket or from a record associated with the particular game ticket , which may be stored in a local computer or in a remotely located computer and retrieved according to known record retrieval processes , as will be understood by those skilled in the art ( step s 420 ). after retrieving all of the characters from the game ticket ( or associated with the game ticket ), winning characters may be retrieved for the particular drawing ( s ) relevant to the game ticket ( step s 430 ). the retrieved characters are compared to the retrieved winning characters for the relevant drawing ( s ) ( step s 440 ). if one or more matches are determined to exist (“ yes ” at step s 450 ), then a message is displayed , such as , for example , “ winner ” ( step s 470 ), otherwise a message is displayed , such as , for example , “ no winner ” ( step s 460 ). in this regard , one or more matches may be determined to exist when the retrieved characters in one or more rows , columns or diagonals of cells in an n x m grid ( where n and m are positive integers greater than or equal to two , which may have the same or different values ) on the received game ticket are found to match the winning characters . after the message “ winner ” is displayed ( step s 470 ), a prize is determined and awarded on a basis of the number of matches ( step s 480 ). the prize may be determined on a basis of the number of matching rows , the number of matching columns , and / or the number of matching diagonal lines , with a more valuable prize being awarded with a greater number of matches , or types of matches . for example , matching characters in a diagonal line may be awarded a different prize from matching characters in a row or column . further , the prize may be determined on a basis of , for example , the statistics of certain matches occurring in a feature game . for example , in a feature game having a three - by - three grid with characters having a value between 0 and 9 , there may exist a predetermined number of chances to win . of these , a first subset may be single win chances , where the combination of winning characters appears only once on a grid . further , a second subset may be double wins , where the combination of winning characters appears twice on a grid . further , a third subset may be triple wins , where the combination of winning characters appears three times on the grid . still further , a fourth subset may feature a quadruple win situation , where the combination of winning characters appears four times on a grid . since more than , for example , but not limited to , ninety - five percent ( 95 %) of winners may be single win game tickets , a first payout prize may be associated with a single win game ticket . further , a second payout prize , a third payout prize and a fourth payout prize may be associated with a double win , a triple win and a quadruple win game ticket , respectively , where the payout prizes are different and increase in value and / or size with the number of wins . the double , triple or quadruple winner frequency can be increased by changing the parameter x in the predefined rule mentioned above to a higher number . according to a still further aspect of the invention , a computer program may be provided in at least one computer readable medium that , when executed on a general purpose computer , causes the computer to execute the steps s 410 to s 480 shown in fig6 . in this regard , the computer program may include a code section for each of the steps s 410 to s 480 ( discussed above ) to cause the general purpose computer to carry out the exemplary process shown in fig6 . while the invention has been described in terms of exemplary embodiments , those skilled in the art will recognize that the invention can be practiced with modifications in the spirit and scope of the appended claims . these examples given above are merely illustrative and are not meant to be an exhaustive list of all possible designs , embodiments , applications or modifications of the invention . | 6 |
the following detailed description is merely exemplary in nature and is not intended to limit the present disclosure or the application and uses of the present disclosure . furthermore , there is no intention to be bound by any theory presented in the preceding background or the following detailed description . fig1 shows a general overview of an aircraft 2 having a drive system 4 for driving control surfaces 6 ( leading edge slats ) and 8 ( trailing edge flaps ). the drive system 4 comprises a first transmission shaft 10 located at a wing leading edge 12 as well as a second transmission shaft 14 located at a wing trailing edge 16 . several drive stations 18 and 20 are distributed along the leading edge 12 and the trailing edge 16 , respectively . the drive stations 18 and 20 are designed for converting rotary power into a translational movement of the control surfaces 6 and 8 . the transmission shaft 10 and 14 are driven by drive units 22 and 24 , exemplarily located inside the fuselage 26 of the aircraft 2 . these drive units 22 and 24 are usually referred to as pcu and in one example , comprise two motors , one hydraulic motor and one electric motor for providing a hybrid operation . two independent slat flap computers ( sfcc ) 25 may control and monitor the system . in fig2 , the transmission shaft 14 arranged at the trailing edge 16 is shown in a schematic view . the pcu 24 hereby comprises a differential gear 28 with two input shaft sections 30 and 32 to which two motors 34 and 36 are coupled , each via one power - off brake 38 and 40 , respectively . a power - off brake for a hydraulic motor may be a pressure - off brake that is activated automatically on a loss of pressure . the differential gear 28 may be a speed - summing differential gear 28 that rotates a distribution gear section 42 to which two transmission shaft sections 44 and 46 are coupled . drive stations 20 are distributed along the transmission shaft sections 44 and are coupled to control surfaces 8 . exemplarily , two drive stations 20 are coupled to two edges of a single control surface 8 in order to drive it . additionally , to prevent a failure in the drive system in case of a shaft break or a similar event , wing tip brakes 48 are arranged at end sections of the transmission shaft sections 44 . by activating these wing tip brakes 48 the whole shaft section 44 may be arrested . according to fig2 , the pcu 24 exemplarily comprises an electric motor 36 and a hydraulic displacement machine 34 . as shown in fig3 the electric motor 36 , controlled by a motor control electronic 50 , may provide rotational power over the power - off brake 40 into the respective input shaft 32 of the differential gear 28 . at the same time the hydraulic displacement machine 34 provides rotational power over the power - off brake 38 into the respective input shaft 30 of the differential gear 28 . this leads to the rotation of a transmission output 52 of the differential gear 28 . in case only one of the electric motor 36 and the hydraulic displacement machine 34 supplies rotational power to the transmission output 52 , the power - off brake of the other motor , which is in a standby state , is arrested . thereby , the respective input shaft 30 or 32 is arrested such that the input of rotary power from the other input shaft 30 or 32 leads to the rotation of the transmission output 52 . as the exemplary control surfaces 6 and 8 shown in fig1 are high - lift control surfaces , the transmission sections 44 and 46 are powered seldomly . most of the time they are arrested , e . g . by the pcu itself in a high lift mode or by the wing tip brakes 48 in case the control surfaces are retracted or in failure cases , and are in a standby state , waiting for the next high - lift flight state . in the default high lift operating mode the wing tip brakes 48 are released and the pcu 24 is providing power to operate the high lift system with the commanded speed into any gated position . for the hydraulic displacement machine 34 a digitally controlled over - center variable displacement motor may be used . the electric motor 36 may be a digitally controlled brushless dc motor . the control of the motors 34 and 36 may be established by a closed loop layout to maintain speed and torque command inputs . the control algorithms are implemented in a controller , which is provided with all required data to control the motors . for example , the controller may be integrated in an existing controller of the aircraft , such as an sfcc 25 . the hydraulic displacement machine 34 is supplied by an aircraft hydraulic supply system 54 , while the electric motor 36 is supplied with electric power by an aircraft electrical busbar 51 . a manifold as part of the hydraulic displacement machine 34 may be interfacing with the sfcc 25 and the hydraulic supply system 54 and contains all components to pressurize the hydraulic displacement machine 34 and to control the respective pressure - off brake 38 . for the electric motor 36 the motor control electronic 50 may be interfacing with the sfcc 25 and the aircraft electrical busbar 51 . the motor control electronic 50 converts the electric power as required for the brushless dc motor or any other type of electric motor 36 . according to fig4 , the electric motor 36 and the hydraulic motor 34 are coupled with the differential gear 28 and power the transmission output 52 . the torque and hence the speed of the hydraulic displacement machine 34 , e . g . realized as an over - center variable displacement machine , is controlled by commanding the motor swash plate into the required position . the hydraulic power is provided by the associated hydraulic system 54 . the motor flow demand is , as part of the closed loop control algorithm , limited with the objective not to overload the hydraulic supply system 54 . this requires information regarding the hydraulic pressure provided by a pressure transducer as part of a hydraulic drive channel and pressure data provided by the hydraulic system 54 to the motor controller . the electric motor closed loop speed control is established accordingly . the associated hydraulic system 54 is generally pressurized by engine driven pumps 58 . additionally the hydraulic system 54 is usually equipped with electric motor pumps 56 to provide the hydraulic power in case the engine driven pumps are not active , e . g . in a ground or failure case , or to increase the power of the hydraulic system in case of high flow demand . besides that , filters 60 , check valves 62 and 64 and connecting sections 66 for the integration of other hydraulic loads 68 are present for filtering hydraulic fluid and for assigning flow directions . as indicated above and shown in fig5 , electric power may be converted into hydraulic power by simply arresting the transmission output 52 and rotating the electric motor 36 such that the hydraulic displacement machine 34 rotates in an opposite direction through the differential gear 28 . generally , the objective is to use a hybrid pcu of a high lift system also as an electric motor pump within the aircraft hydraulic supply system 54 . a hybrid pcu , equipped with a digital controlled over - center variable displacement hydraulic displacement machine 34 and an electric motor 36 coupled via a differential gear 28 , comprises all features required for an electric motor pump to pressurize the aircraft hydraulic system 54 . to operate the hybrid pcu in an electric motor pump mode the transmission output 52 of the differential gear 28 is locked by engagement of the wing tip brakes 48 as first brakes . the power - off brakes 38 and 40 as second and third brakes associated to each motor 34 and 36 are released by corresponding command inputs , e . g . by the sfcc 25 . this provides power flow from the electric motor 36 to the hydraulic displacement machine 34 via the differential gear 28 . in this configuration the high lift system is safely fixed by the wing tip brakes 48 . after operation of the pcu 24 as an electric motor pump the reaction torque in the transmission is relieved by a corresponding sequence already implemented for the high lift application . this is further depicted in fig6 where the transmission output 52 is arrested and the hydraulic displacement machine 34 is driven and rotates . due to the rotation , a hydraulic pressure is generated and fed into the hydraulic system 54 . by controlling the hydraulic motor 34 , e . g . through a controller interface 70 connected to the sfcc 25 or any other control logic , the generated pressure as well as the generated volume flow is controllable . alternatively the pump performance can be controlled by adjusting the speed of the electric motor 36 depending on the required flow to maintain the hydraulic system pressure . in this case the pump displacement is controlled and maintained into a fixed position by the spring loaded swash plate actuation mechanism and corresponding command input from the controller . generally , a swash plate actuation mechanism of the hydraulic motor 34 , e . g . in form of an over - center hydraulic drive , is spring loaded to provide an initial pump displacement for start - up when the hydraulic system 54 is not yet pressurized . the electric motor 36 is commanded to a desired speed , in one example , by the sfcc or any other controller . the electric motor 36 is now powering the hydraulic motor 34 via the differential gear 28 . in consequence of the initial swash displacement the hydraulic motor 34 is operating in a pump mode and is pressurizing the hydraulic system 54 . the hydraulic interface to the pcu is adapted to the needs for a hydraulic pump . while at least one exemplary embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the present disclosure in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment , it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope of the present disclosure as set forth in the appended claims and their legal equivalents . | 1 |
referring to fig1 to 13 , one embodiment of a mud pump is illustrated . in this embodiment , mud pump 10 can comprise lattice frame 18 and pump modules 24 mounted thereon . frame 18 can further comprise mounting tabs 14 for attaching mud pump 10 to a platform , to a skid or to a pump house . for the purposes of this specification , and as shown specifically in the figures , each pump module 24 can comprise inlet port 25 , outlet port 35 , top access port 37 and side access port 36 . pump module 24 , as illustrated , can be any suitable pump module that is readily available to the mud pump industry and is well known to those skilled in the art . as shown in fig1 , pump module 24 is shown as a singular device having three pump units disposed therein . it is obvious to those skilled in the art that pump module 24 can comprise one or more pump units use in combination . representative examples of pump module 24 are pump modules having an 800 horsepower rating as manufactured by continental emsco in the u . s . a . or their equivalent . such pumps have interchangeable liners of different diameters whereby the volume of mud handled by a pump module per pump cycle can be adjusted upwards or downwards depending on the diameter of the liner . generally speaking , the smaller the volume per pump module , the greater the pressure the mud can be pumped at . referring to fig1 , mud pump 10 is shown having cover 20 disposed on top of lattice frame 18 . input shaft 12 can be connected to a motor ( not shown ) to provide rotational input power to mud pump 10 . in some embodiments , an internal combustion motor can be used to provide rotational input power to mud pump 10 . in other embodiments , an electric motor of suitable power rating can be used . in further embodiments , a variable frequency drive mechanism ( not shown ) as well known to those skilled in the art can be used to control the electrical power provided to the electric motor thereby controlling the rotational speed the motor operates at to supply rotational input power to mud pump 10 . in one embodiment , mud pump 10 can comprise transmission 22 to couple shaft 12 to the operating components of mud pump 10 . transmission 22 can be a single - stage or dual - stage gear transmission to reduce the rotational speed of input shaft 12 to the required rotational speed for proper operation of pump shaft 30 rotatably disposed in mud pump 10 . in other embodiments , transmission 22 can comprise a planetary gear transmission . in further embodiments , transmission 22 can comprise helical gears . in yet other embodiments , transmission 22 can comprise spur gears . intake manifold 52 , comprising inlet 54 , is shown attached to pump module inlet ports 25 . outlet manifold 58 , comprising couplers 62 and end caps 66 , is shown attached to pump module outlet ports 35 . in one embodiment , frame 18 can comprise return lines 68 that provide communication from galleys 38 to reservoir 70 . when in operation , lubricating oils are used to lubricate the moving components of mud pump 10 . these oils will collect in galleys 38 and return to reservoir 70 through return lines 68 to be re - circulated through mud pump 10 . referring to fig2 , a rear elevation view of mud pump 10 is shown . in this figure , piston rod support bushings 31 are shown disposed on sidewalls 19 of frame 18 . piston liners 26 are shown disposed between pump modules 24 and support bushings 31 . couplers 41 can be used to couple liners 26 to support bushings 31 . as noted above , liners 26 can be comprised of various diameters depending on the volume and the pressure drilling mud is to be produced by mud pump 10 . referring to fig3 and 4 , front views of mud pump 10 are shown . in this embodiment , pump modules 24 are shown with outlet ports 35 exposed having no output manifold attached thereon to show valve mechanism 39 disposed therein . in one embodiment , pump module 24 can comprise “ sucker - cup ” pump mechanisms as well known to those skilled in the art . in the illustrated embodiment , an output manifold ( not shown ) can be attached to the shown outlet ports 35 to collect drilling mud pumped by pump module 24 , in addition to outlet manifold 58 shown in fig1 and 2 , or it can be capped with a cover ( not shown ). input ports 25 can be coupled together with intake manifold 52 that directs drilling mud into pump modules 24 . in one embodiment , coolant pump 34 can be used to circulate coolant through piston liners 26 and oil pump 32 can be used to pump lubricating oil through support bushings 31 to lubricate the moving components therein , as described in more detail below and as shown in fig1 . referring to fig5 and 6 , front cross - section views of mud pump 10 are shown revealing the internal components of the embodiment shown therein . in this embodiment , pump shaft 30 rotates as a result of input rotational power applied to input shaft 12 that is operatively coupled to pump shaft 30 via transmission 22 as shown in fig4 . in one embodiment , pump shaft 30 can comprise eccentric 80 disposed thereon and affixed thereto with pin 82 . rotatably disposed on eccentric 80 is connecting rod 84 . in another embodiment , eccentric bearing 83 is disposed between eccentric 80 and connecting rod 84 . in a further embodiment , connecting rod 84 is rotatably pinned to slide 28 via pin 86 . in yet another embodiment , bearing 85 can be disposed between pin 86 and connecting rod 84 . in fig5 , eccentric 80 is shown rotating clockwise thereby moving connecting rod 84 upwards and to the right in this figure . in so doing , slide 28 is being pushed to the right . in one embodiment , slide 28 is disposed between upper support plate 44 and lower support plate 46 to help keep slide 28 moving in a horizontal linear path , and to resist the bending moment caused by the rotation of pump shaft 30 and eccentric 80 . in another embodiment , upper slide bearing 43 can be disposed between upper plate 44 and slide 28 , and lower slide bearing 45 can be disposed between lower plate 46 and slide 28 as a means to reduce the friction between slide 28 and upper and lower plates 44 and 46 as slide 28 moves side - to - side . as slide 28 moves to the right , it pushes piston rod 27 a and , hence , piston 40 a to the right in liner 26 a to push fluids in pump chamber 42 a out through valve 39 ao to outlet ports 35 ( not shown ) and outlet manifold 58 ( not shown ). in so doing , piston rod 27 b also pulls piston 40 b in liner 26 b to the right thereby drawing in fluid through valve 39 bi from intake manifold 52 . in fig6 , eccentric 80 is shown rotated further clockwise ( from fig5 ) thereby moving connecting rod 84 downward and to the left . in so doing , piston 40 a is being pulled to the left thereby drawing in fluid into pump chamber 42 a through valve 39 ai from intake manifold 52 while piston 40 b is pushed to the left thereby pushing fluid out of pump chamber 42 b through valve 39 bo to outlet ports 35 ( not shown ) and outlet manifold 58 ( not shown ). in this figure , the connecting rods 84 of two adjacent stages rising above the top of frame 18 . referring to fig7 , mud pump 10 is shown without pump modules 24 , cover 22 , piston liners 26 , pump shaft 30 , slides 28 and connecting rods 84 . in this illustrated embodiment , frame sidewalls 19 are visible as are removable caps 17 , which are configured hold pump shaft 30 in place in frame 18 . also visible are piston rods 27 , rod support bushings 31 , couplers 41 and pistons 40 . in one embodiment , mud pump 10 can comprise means for applying a loading force to upper support plates 44 to keep slide 28 confined to a horizontally linear range of motions . in some embodiments , these means can comprise a plurality of setscrew rails 48 disposed on frame 18 near sidewalls 19 and disposed on caps 17 . in further embodiments , setscrew rails 48 can comprise a plurality of setscrews 47 threadably attached to and through said setscrew rails . setscrews 47 can be tightened to apply forces to various locations on upper support plates 44 whereby the loading force applied to upper support plates can be adjusted at each location of setscrews 47 to ensure that slide 28 is constrained to horizontal linear movement . while the illustrated embodiment shows setscrews 47 as being manually adjustable for applying force to slide 28 , it is obvious to those skilled in the art that mud pump 10 can comprise further means for monitoring the movement of slides 28 and for automatically adjusting setscrews 47 with electro - mechanical servo motors , or the like , so that setscrews 47 are dynamically adjusted in real - time to ensure that proper force is being applied to slide 28 at all times to keep its movement linearly horizontal . referring to fig8 , the mud pump 10 of fig7 is now shown with frame 18 removed to reveal slides 28 . in this embodiment , slides 28 can comprise openings 29 for pump shaft 30 ( not shown ) to pass through and pin openings 88 configured to receive connecting rod pins 86 ( not shown ). in some embodiments , mud pump 10 can further comprise one or more eccentric rods 49 disposed beneath lower support plates 46 for applying upwards force thereto for ensuring that slide 28 is constrained to horizontal linear movement . this is also shown in fig9 , 10 , 11 and 12 . in some embodiments , eccentric rods 49 can be rotated or adjusted and then set into position by turning rod adjusters 50 . while the illustrated embodiment shows eccentric rods 49 as being manually adjustable for applying force to slide 28 , it is obvious to those skilled in the art that mud pump 10 can comprise further means for monitoring the movement of slides 28 and for automatically adjusting eccentric rods 49 with electro - mechanical servo motors , or the like , operatively coupled to rod adjusters 50 so that eccentric rods 49 are dynamically adjusted in real - time to ensure that proper force is being applied to slide 28 at all times to keep its movement linearly horizontal . referring to fig1 , a cross - section view is shown of the internal pumping mechanism of mud pump 10 . in some embodiments , piston rod 27 can be coupled to slide 28 by threading piston rod 27 into threaded opening 91 disposed on slide 28 . in other embodiments , piston rod 27 can be further secured with lock nut 101 threaded on piston rod 27 and tightened against slide 28 . in yet further embodiments , piston rod stud 92 can be disposed in an opening disposed through piston rod 27 and secured to slide 28 in threaded opening 93 . in some embodiments , piston rod stud 92 can further comprise flange 95 that can rest against shoulder 94 disposed within piston rod 27 . piston rod stud 92 can also serve as means for mounting piston 40 and piston retaining caps 96 and 97 thereon . nut 98 can be used to secure piston 40 and caps 96 and 97 on piston rod stud 92 . in some embodiments , mud pump 10 can comprise means for circulating coolant in piston liner 26 behind piston 40 to prevent overheating of the mechanism when in operation . as shown in fig1 , coolant can be pumped by coolant pump 34 ( as shown in fig4 ) into liner chamber 106 through coolant inlet 102 via lines , hoses or piping ( not shown ). coolant can the flow through , and circulate within , chamber 106 and then exit through coolant outlet 104 . lines , hoses and piping ( not shown ) can be coupled to outlet 104 so that the heated coolant can be collected , cooled and re - circulated . in other embodiments , inlet 102 and outlet 104 can further comprise one - way valves , such as ball - valves as one example obvious to those skilled in the art , such that coolant can be drawn into chamber 106 through inlet 102 as piston 40 is moving towards pump module 24 ( not shown ), and then expelled from chamber 106 through outlet 104 and piston 40 is moving away from pump module 24 . in some embodiments , mud pump 10 can comprise means for circulating lubricating oil to piston rod 27 as it reciprocates back and forth through support bushing 31 . as shown in fig1 , lubricating oil can be pumped by oil pump 32 ( as shown in fig4 ) into oil inlet 108 where it can flow into annulus 110 between piston rod 27 and support bushing 31 thereby maintaining a layer of lubricating oil therebetween . oil can then flow out of annulus 110 into galleys 38 ( as shown in fig1 ) where the oil can be collected and re - circulated . in other embodiments , barrier seals 99 and ice - breaker wear band 100 can be disposed between piston rod 27 and support bushing 31 as sealing means to separate and isolate chamber 106 from annulus 110 so that coolant does not intermingle with and contaminate the lubricating oil , and vice - versa . in the embodiments illustrated the figures herein , there are three slides 28 shown , each coupled to two pump modules 24 thereby resulting in the operation of six pump modules . it is obvious to those skilled in the art that fewer or more slides mechanisms can be implemented to either decrease or increase the number of pump modules that can be operated . it is also obvious to those skilled in the art that a slide frame can be releasably coupled to a single piston rod to , therefore , operate a single pump module . referring to fig6 , pump shaft 30 is shown turning three connecting rods 84 . this necessarily requires pump shaft 30 having three eccentric lobes 80 . in this configuration , the lobes can be displaced nominally 120 ° apart from each other such that the lobes can be substantially spaced equally apart around the circumference of pump shaft 30 . in embodiments where pump shaft 30 comprises two eccentric lobes 80 , the lobes can be displaced nominally 180 ° apart . in other embodiments where pump shaft 30 comprises two lobes 80 , one lobe 80 can be displaced 178 ° from the other lobe 80 so that pump shaft 30 can more easily turn from a dead stop . in other embodiments where additional eccentric lobes are disposed on pump shaft 30 , the lobes can be substantially spaced equally apart on pump shaft 30 . for example , for a four - lobe shaft , each lobe 80 can be displaced 90 ° nominally from each other lobe 80 . if five lobes are disposed on pump shaft 30 , the lobes can be displaced nominally 72 ° apart on pump shaft 30 . for six lobes disposed on pump shaft 30 , the lobes can be displaced nominally 60 ° apart , and so on . in operation , mud can be supplied to inlet 54 on intake manifold 52 from an external pump ( not shown ) drawing mud from a mud tank ( not shown ) as well known to those skilled in the art . as slides 28 operate pump modules 24 , mud is drawn into pump modules 24 from intake manifold 52 and pumped out of pump modules 24 into outlet manifold 58 via outlet manifold couplers 62 disposed between pump modules 24 and outlet manifold 58 . the pumped mud can exit outlet manifold 58 via outlet 60 that can be connected to a mud delivery pipe and / or hose for use on a drilling rig ( not shown ) as well known to those skilled in the art . in one embodiment , the diameter of inlet 54 and the pipe that make up intake manifold 52 can be nominally ten inches whereas the diameter of outlet and the pipe that make up outlet manifold 58 can be nominally four inches . in another embodiment , outlet manifold 58 can comprise couplings ( not shown ) for connection with a pressure gauge to provide a visual indication of the pressure of the mud being pumped and / or a pressure relief valve to provide means to limit the pressure of the mud being pumped by mud pump 50 . it is obvious to those skilled in the art that the diameters of inlet 54 , intake manifold 52 , outlet manifold 58 or outlet 60 can be increased or decreased depending on the volume and pressure of drilling mud required in the drilling of a well . in operation , it is expected that mud pump 10 can operate up to 65 revolutions per minute using a 1000 horsepower motor , which translates up to 130 pump module strokes per minute per slide frame mechanism given that each slide frame can be coupled to two pump modules . it is also anticipated that mud pump 10 can pump up to 800 gallons or 4 cubic metres of drilling mud per minute . using 7 - inch liners in the pump modules , it is expected that mud pump 10 can pump mud up to 1500 pounds per square inch in pressure . it is also expected that mud pump 10 would weigh approximately 45 , 000 pounds and deliver the equivalent volume and pressure of drilling mud as a conventional mud pump powered by a 1600 horsepower motor weighing up to 120 , 000 pounds . referring to fig1 , mud pump 10 is shown positioned in pump house 56 , a structure used to house mud pumps at drilling sites . access to mud pump 10 is done through doorways 64 . in this configuration , mud pump 10 is positioned “ lengthwise ” in pump house 56 . referring to fig1 , mud pump 10 is shown in pump house 56 rotated 90 degrees . the compactness of mud pump 10 can allow it to be installed in this manner in pump house 56 whereby access to the inlet and outlet to mud pump 10 is through doorway 64 . in addition , more than one mud pump 10 can be installed in pump house 56 thereby reducing the number of pump houses required at a drilling site if the well being drilled requires a volume of pressurized drilling mud greater than what one mud pump 50 can provide . although a few embodiments have been shown and described , it will be appreciated by those skilled in the art that various changes and modifications might be made without departing from the scope of the invention . the terms and expressions used in the preceding specification have been used herein as terms of description and not of limitation , and there is no intention in the use of such terms and expressions of excluding equivalents of the features shown and described or portions thereof , it being recognized that the invention is defined and limited only by the claims that follow . | 5 |
fig1 is a block diagram of an embodiment of the present invention . when a memory location is read and there is an uncorrectable error in the data read from that location , corrective action may need to be taken . some errors may be transient errors such as may be caused by noise or by a collision on a data bus , and are not stuck - at faults . if the data is uncorrectable because of transient errors then valid data may be obtained by simply executing that read transaction again , that is , reading that memory location again . valid data may then be provided to a data utilization or destination device , such as core logic 10 , which may contain or interface with a program or programs requesting data . a problem that may arise when a transient error occurs may be that if there is a subsequent write transaction to that memory location , executed before the read transaction is performed again , then the original data may be , and likely will be , destroyed . thus , although the data appears to be valid , it is not the original data and therefore may have the same effect ( wrong result , program crash , operating system crash ) as corrupted data . some receiving processes need data in the order requested , so data from subsequent memory read transactions , that is , memory read transactions which occurred after that erroneous memory read transaction , may need to be discarded . also , as data may be read again from the memory location which resulted in the erroneous data , then data in that memory location should be protected , so subsequent write transactions to that memory location may need to be disabled . further , if data from subsequent memory read transactions are discarded , then those memory locations may need to be protected so they may be read again , so subsequent write transactions to those memory locations may need to be disabled . the memory location which resulted in the erroneous data may then be read again and , regardless of whether the data from that memory location is still erroneous , the data from that memory location may be provided to the requesting process , the appropriate subsequent memory locations may be read again , the subsequent data may be provided to the requesting process and , write transactions to those memory locations may be enabled or re - enabled . thus , upon detection of an uncorrectable error , the associated data in the memory may be preserved until it can be read again , and then the requested data and other data may be provided to the requesting process . if the error was due to a transient , such as noise , the second read attempt may produce valid data . however , if the error was due to a stuck - at fault , such as the data at that memory location actually being corrupted , then the second read may again produce erroneous or invalid data . thus , an infinite loop may need to be prevented from occurring when the data in the memory location is actually corrupted . this may be accomplished by creating a record that the data has been read once and found to be erroneous , such as by setting a bit . then , when the data is read again , if the bit has been set , the data may be provided , and the record may be cleared , regardless of whether the data is valid or not . thus , there will be two attempts to read the data from a memory location . however , this is a design choice , and a counter or register may be used to keep such a record , and some other number of attempts may be used , for example , three or four , which may be desirable in noisy locations or in environments where there are frequent data bus collisions . however , more attempts may result in more delay in sending data to the core logic 10 . for convenience of discussion , “ erroneous memory location ” means the memory location from which the data was read , and does not mean that the location was erroneous , or that the data in the memory was necessarily erroneous , but means that the data , as received by the memory controller 12 , was erroneous and uncorrectable . it is convenient to first consider a memory transaction in which there are no errors . the core logic 10 may contain or may interface with the process , device or system requesting the read or write memory transaction . when a memory transaction is desired , the core logic 10 may send the desired transaction to the retry mechanism 11 which , in turn , may send the desired transaction to the memory controller 12 which , in turn , may cause the memory 13 to execute the desired transaction , reading or writing the data . if data is being read , then the memory 13 may send the data to the memory controller 12 which , in turn , sends the data to the retry mechanism 11 which , in turn sends the data to the core logic 10 for use by the requesting process . the retry mechanism 11 may comprise a transaction queue 22 , a data tenure completion processing unit 28 , and a retry master control 42 . the transaction queue 22 may contain several pending memory transactions . when a memory transaction is desired , the core logic 10 may signal that transaction to the transaction queue 22 via the “ enqueue transaction ” signal 20 . the transaction queue 22 or the retry master control 42 may then make a determination whether another transaction should be accepted . this determination may be based upon available space in the queue 22 , whether a retry procedure is in process , or any other desired criteria . if the transaction may be accepted then the transaction queue 22 may send the “ enqavail ” signal 23 back to the core logic 10 and , in return , the corelogic 10 may send the desired transaction or transactions 21 to the transaction queue 22 . if the transaction queue has pending transactions , then the transaction queue 22 may then signal the memory controller 12 that a memory transaction is desired via the dispatch available (“ dispatchavail ”) signal 24 . the memory controller 12 may then send the “ dispatchpop ” signal 25 to the transaction queue 22 , which may cause the transaction queue 22 to pop a pending transaction and send the transaction 26 , which then becomes a dispatched transaction rather than remaining as a pending transaction . to prevent data from being inadvertently overwritten , the retry master control 42 and / or the transaction queue 22 may monitor for incoming write transactions . if an incoming transaction is to the same address as a previous , and not yet completed transaction , then the incoming transaction is held in abeyance until the previous transaction has been completed . once that previous transaction has been completed then the transaction held in abeyance may be dispatched . also , to provide for data from read transactions to be provided in the order requested , all incoming transactions , or at least all incoming write transactions , subsequent to the transaction held in abeyance may be held in abeyance . in some memory systems and subsystems , memory read and write transactions include an allocated time , or tenure , for an address or command , and an allocated time , or tenure , for the data associated with the address or command . address and / or command tenures may be on busses that are common or shared with data tenures , or the address and / or command tenures may be on separate busses . when a tenure is complete , the associated bus may be released for the next transaction . however , numerous issues , including but not limited to multiple independent memory channels , divergent read and write cycle timings , and divergent data pipeline handling , cause variations in data tenure completion . the transaction queue 22 does not know how long it will take for the transaction to occur so the transaction may be maintained in the transaction queue 22 until a data tenure completion signal 27 a , 27 b is provided . the memory controller 12 may then send the memory transaction information to the memory 13 for execution . once the memory 13 executes the memory transaction the memory controller 12 may send a “ read data tenure completion ” signal 27 a or a “ write data tenure completion ” signal 27 b to the data tenure completion processing unit 28 . this may be used to indicate that the read / write tenure has now elapsed . the unit 28 may then send a “ popretire ” signal to the transaction queue 22 , which may be used to advise the queue 22 that the popped transaction has been completed and may be retired . if the controller 12 has not asserted the uncorrectable error flag , then the retry master control 42 may allow the queue 22 to act upon the popretire signal , so the queue 22 may remove (“ retire ”) that memory transaction from the transaction queue 22 if all previous pending transactions have been retired . if any previous pending transaction has not been retired then the current transaction may not be retired . this is in case a previous pending transaction eventually results in an uncorrectable error condition and , in that case , that previous pending transaction , and subsequent transactions , may need to be performed again . if the dispatched memory transaction was a read transaction the memory 13 may send the data to the memory controller 12 , which may then test the data for errors . if the data is not erroneous then the memory controller 12 may send the data 30 to the core logic 10 and may send a “ read data strobe ” 40 to a retry master control 42 . the retry master control 42 may then send a data available signal , such as the “ read data strobe ” 43 , to the core logic 10 . in response to the strobe 43 , the core logic 10 may accept the data 30 for processing . thus , the core logic 10 has now received and accepted the requested data . the data may be stored in the memory 13 using an error correction code ( ecc ) of some sort . if a correctable error is found when the controller 12 is testing the data then the controller 12 corrects the data before sending it on to the core logic 10 . consider now that an uncorrectable error has occurred . that is , the memory controller 12 has found that the data is corrupted and cannot be recovered using the ecc . the memory controller 12 may then send an uncorrectable error flag 41 to the retry master control 42 . this may be used to instruct the retry master control 42 to begin the data recovery procedure and not to send the read data strobe 43 , even if the read data strobe 40 is also present . the retry master control 42 may also prevent the data tenure completion processing unit 28 from sending the popretire signal , or may cause the transaction queue 22 to ignore the popretire signal . the retry master control 42 may then cause the transaction queue 22 to disable write transactions to the erroneous memory location . this preserves the data in the erroneous memory location so that it can be read again . the retry master control 42 may also cause the transaction queue 22 to disable write transactions to the subsequent memory locations to preserve the data at those memory location so that this data can be read again once the data from the erroneous memory location has been read again . turn now to fig2 which is a diagram of the queue mechanism of the transaction queue 22 of an embodiment of the present invention . the queue mechanism 200 may have a circular or rotary table 201 which may have a plurality of rows a through n and thus a queue size (“ qsize ”) of n , may have a transaction attribute column 202 , and may have a common access method ( cam ) function column 203 , and each column 202 , 203 may have a corresponding plurality of entries 202 a – n and 203 a – n , respectively . the cam function column 203 may be the cam function of the address attribute on read transactions which have been dispatched . an “ enqptr ” pointer 204 points to the next location in table 201 where the incoming transaction may be placed for execution . the enqptr pointer 204 may move generally incrementally , as shown by line 205 , from the bottom of the table ( row a ) to the top of the table ( row n ), and may then return to the bottom of the table again . a “ dispatchptr ” pointer 206 may point to the next pending transaction in table 201 that will be dispatched to the memory controller 12 , and may also move generally incrementally , as shown by line 208 , from the bottom of the table to the top of the table , and then return to the bottom of the table again . finally , a “ retireptr ” 207 may point to the oldest transaction in table 201 that has been dispatched to the memory controller 12 , and may also move generally incrementally , as shown by line 208 , from the bottom of the table to the top of the table , and then return to the bottom of the table again . the movement of the pointers is a design choice and could be , if desired , in the reverse direction . thus , the next incoming transaction may be placed , if at all , in the location in the queue specified by the enqptr pointer 204 ; the next transaction to be dispatched to the memory controller 12 may be read from the location in the queue specified by the dispatchptr 206 pointer ; and the retireptr 206 may specify the next transaction to be treated as completed and therefore retired , thereby making that location empty and available for a subsequent incoming transaction . in the example shown , enqptr 204 is pointing to row m ; dispatchptr 206 is pointing to row k ; and retireptr 207 is pointing to row d . thus , rows k and l have transactions in them which are pending , that is , they have not been dispatched to the memory controller ; rows m through c are currently empty ; and rows d through j have been dispatched to the memory controller and are awaiting a signal that the tenure for these transactions has elapsed or that these transactions have been completed . the enqavail flag signal 23 signal may indicate whether any space is available in the queue to accept another transaction . as such , the relationship “ qsize −|( enqptr − retireptr )|” may be tested , keeping in mind the circular or rotary nature of the table 201 . if the relationship is greater than zero then space may be available , and if the relationship is zero then space may not be available . the situation “ less than zero ” should not occur as it means that an unexecuted transaction has already been overwritten . the dispatchavail flag signal 24 may be used to indicate whether there is a transaction in the queue which is available for dispatch to the memory controller 12 . if the dispatchptr 206 is pointing to an address which shows a cam function from a dispatched read transaction , then there may be an address collision so , even if enqptr 204 is greater than dispatchptr 206 , then a transaction may not be available . if there is not an address collision , and if enqptr 204 is greater than dispatchptr 206 , then a transaction may be available . finally , the retireavail signal may indicate whether there are transactions which have been dispatched , but not yet completed . if enqptr 204 is greater than retireptr 207 then the retireavail signal flag may be true . if a data tenure completion signal 27 a , 27 b is present , and if the data tenure completion signal is the same type ( read , write ) as the type of the transaction ( read , write ) pointed to by the retireptr 207 , then the retireptr 207 may be popped and incremented . if not , a deferredreadpop counter ( not shown ) may be used to keep count of the number of outstanding ( dispatched , not yet retired ) read transactions . so , if the retireptr is pointing to a read transaction and the deferredreadpop counter is greater than zero then the retireptr 207 may be popped and incremented , and the deferredreadpop counter may be decremented . likewise , a deferredwritepop counter ( not shown ) may be used to keep count of the number of outstanding ( dispatched , not yet retired ) write transactions . so , if the retireptr is pointing to a write transaction and the deferredwritepop counter is greater than zero then the retireptr 207 may be popped and incremented , and the deferredwritepop counter may be decremented . finally , if the read data tenure completion signal 27 a is present then the deferredreadpop counter may be incremented , or if the write data tenure completion signal 27 b is present then the deferredwritepop counter may be incremented . as a consequence , when read data tenure completion ( 27 a ) for the oldest dispatched read transaction occurs and there is an uncorrectable error for the data for that oldest dispatched read transaction , then : if a previouserror flag ( not shown ) has been set to indicate that an uncorrectable error has previously occurred for that memory location then the uncorrectable error may be ignored , the previouserror flag may be cleared , and normal processing may be resumed ; if the previouserror flag has not been set , then the retireptr may be inhibited so no additional transactions may be dispatched to the memory controller ; the read data for that oldest dispatched read transaction may be discarded , data tenure completions ( 27 a ) for subsequent outstanding dispatched read transactions may be discarded and the data from those subsequent read transactions may be discarded ; write transactions are inhibited ; the dispatchptr 206 may be set to the value of the retireptr 207 ( thus reverting the process back to the oldest dispatched read transaction ); the previouserror flag may be set to indicate that an uncorrectable error just occurred for that memory location ; and normal processing may be resumed , starting with another attempt to read the data requested by that oldest dispatched read transaction . when a read data tenure completion ( 27 a ) for the oldest dispatched read transaction occurs and there is not an uncorrectable error for the data for that oldest dispatched read transaction , then the previouserror flag may be set . it will be noted that write transactions are not dispatched until previous pending read transactions have been successfully completed or retried . this prevents the overwriting of data which may need to be read again in the course of a retry procedure . some transactions can complete data tenures out of order for various reasons , but they should still be retired strictly in order for the requesting program . for example , multiple data tenure completions may happen concurrently or even out of order ( in a different order than the order in which they were requested ). as a consequence , additional read data storage may be needed if read data tenures can be completed out of order with respect to other , prior dispatched , read transactions . the retry mechanism 11 may thus process data completion tenures and generate a pop / increment signal for the retireptr . the read transaction retry mechanism 11 thus may provide for autonomous recovery of transient uncorrectable read faults . also , except for those cases which are extremely time - sensitive and for which a delay caused by a retry attempt may be a problem , neither the memory controller 12 nor the core logic 10 are aware of the process , so the recovery attempt is transparent . the retry mechanism 11 preserves the read data and the read data ordering , and augments server reliability and maintainability by discarding data which is momentarily corrupt and by then providing valid data . finally , the retry mechanism 11 also provides for handling of out - of - order data tenure completions , even when a data error occurs . turn now to fig3 which is a flow chart of an operation of the present invention . operation may begin after a read data strobe 40 is received . test 301 may be for the assertion or presence of the uncorrectable error flag 41 . if the uncorrectable error flag 41 is not present then the data may be sent 302 to the core logic . however , if the uncorrectable error flag 41 is present then test 303 may be for the assertion or presence of the previous error flag . if the previous error flag is present then the previous error flag may be cleared 304 because this is a subsequent attempt to read the data but the data is still erroneous , and so the data may be sent 302 to the core logic . if the previous error flag is not present then this may be the first attempt to read the data , and the data was erroneous , so the retry procedure may be implemented . process 307 may halt the dispatch of pending operations , may wait for the completion of dispatched operations , may discard the previously read data , may reset the transaction dispatch pointer to the erroneous read transaction , may dispatch the read to that memory location again , may set the previous error flag , may send the newly read data from that memory location to the core logic , and may then enable the transaction dispatch pointer , so that the previously - dispatched , but now pending , transactions may be dispatched again . a return may then be made to test 301 . thus , in accordance with process 307 , the data may be read again and then , regardless of whether 301 the data is still uncorrectable or not , the data may be sent 302 to the core logic . thus , when the controller 12 provides the data read from memory locations subsequent to reading the erroneous memory location the data will be not be read by the core logic 10 because the read data strobe 43 has not been provided by the master control 42 . therefore , the data in those memory locations must be preserved so that they can be read again after the data from the erroneous memory location has been read again . accordingly , the master control 42 will then cause the transaction queue 22 to disable pending write transactions to those memory locations . the retry master control 42 will then cause the queue 22 to send a memory read transaction to the controller 12 for the erroneous memory location and those subsequent memory locations . once the controller 12 has delivered the data for the erroneous memory location then the master control 42 will cause the transaction queue 22 to enable pending write transactions to that memory location , including any write transactions that have been held in abeyance . in addition , as each subsequent memory read transaction is processed and the data from a memory location is determined to be valid , subsequent write transactions to those memory locations are enabled . therefore , in the event that the data read from a memory location is erroneous and uncorrectable , further write operations to the erroneous memory location are disabled until the data is read again from that memory location . once the data is read again , then write operations to the erroneous memory location are enabled . similarly , if the data read from a memory location is erroneous and uncorrectable then subsequent data reads from other memory locations are not provided to the core logic 10 . rather , the data is read again from the erroneous memory location , that data is provided to the core logic 10 , and then the subsequent data from the other memory locations are provided to the core logic 10 . other methods and details of operation , both exclusive and non - exclusive , are also possible and contemplated . for example , master control 42 can provide the erroneous memory location address to queue 22 , and queue 22 can defer any pending transactions for that memory location , or master control 42 can obtain a list of queued transactions from queue 22 , store any pending transactions for that erroneous memory location , and then cause queue 22 to delete those pending transactions from queue 22 , or the retry master control 42 may simply cause the transaction queue 22 to disable all pending write transactions until the erroneous memory location and any other necessary memory locations have been read again . the retry master control 42 communicates with the transaction queue 22 via a bus , line , or lines 44 . further , an optional read data cache ( not shown ) may be provided between the data output of memory controller 12 and the data input of core logic 10 . the read data cache may be used to reduce the delays caused by a read retry because most of the cached data may not need to be read again . that is , only the erroneous memory location may need to be read again , and the data from that subsequent attempt will be placed in the proper location in the data cache so as to preserve the order of the data which has been read and which is to be provided to the core logic 10 . if cache 31 is present then the data from certain memory locations has already been read , determined to be valid , and is waiting to be delivered to the core logic 10 . therefore , the transaction queue 22 can write data to those memory locations without affecting the validity of the data from those locations . however , in order to preserve the requested order of delivery of the data , the retry master control 42 will not provide the read data strobe 43 to the core logic . thus , when the controller 12 provides the data read from memory locations subsequent to reading the erroneous memory location the data will be not be read by the core logic 10 . therefore , the data in those memory locations will be preserved by the cache 31 so that they can be provided to the core logic 10 after the data from the erroneous memory location has been read again and provided . the retry master control 42 will then cause the queue 22 to send a memory read transaction to the controller 12 for the erroneous memory location . once the controller 12 has delivered the data for the erroneous memory location then the master control 42 will cause the transaction queue 22 to enable subsequent write transactions to that memory location and will begin providing the read data strobe 43 to the core logic for the erroneous memory location and subsequent memory locations . the retry mechanism 11 may be implemented in hardware , software , or a combination of hardware and software . further , the retry mechanism 11 may be a separate stand - alone circuit or may be part of the memory controller 12 , may be part of the core logic 10 , or may have some components or features in the memory controller 12 and other components or features in the core logic 10 . the core logic 10 may be , but is not limited to being , a processor another component , subsystem or system which requests read and / or write transactions . although one environment of the present invention is for use with a core logic circuit and a memory controller circuit , the present invention is not so limited and may be used in any situation where it is desirable or preferable to read data again instead of sending corrupted data . also , while one environment is with respect to uncorrectable data from a memory , the present invention may be used whenever invalid data has been obtained and it is desired to attempt to obtain valid data . further , while an embodiment has been described wherein the memory controller 12 attempts to correct the data from the memory before sending an uncorrectable error flag , the memory controller 12 may simply check the data and send an uncorrectable error flag without attempting to correct the data from the memory . while an embodiment and its environment have been described above and shown in the accompanying figures , the present invention is not so limited as various modifications may occur to those of ordinary skill in the art upon reading this disclosure . the scope of embodiments of the invention should , therefore , be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled . further , it is emphasized that the abstract is provided to comply with 37 c . f . r . § 1 . 72 ( b ) requiring an abstract that will enable the united states patent and trademark office and the public generally to determine quickly from a cursory inspection the nature and gist of the technical disclosure . it is submitted with the understanding that , in accordance with 37 c . f . r . § 1 . 72 ( b ), the abstract will not be used to interpret or limit the scope or meaning of the claims . | 6 |
fig1 shows a hanging , spinning , swinging , bobbing , shaking seat for erotic purposes which can be folded up , therefore a spinning , swinging bobbing , shaking love - seat which hangs from the room ceiling . it will be fastened with a plug . the standard position is : the man is lying on his back , the woman floats cross - legged above him . when you rotate the woman , the rope winds up . when let go , the woman winds down by herself . fig3 shows a hanging , swinging bobbing , shaking seat for erotic purposes which can be folded up , therefore a swinging bobbing , shaking love - seat which hangs from the room ceiling . it will be fastened with a plug . the standard position is : the man is lying on his back and the woman floats above him . an accompanying stand ( 23 ) ( fig1 ) is available for both seats ! it consists of 65 cm ( longest part ) long aluminium parts which , when put together , stands at a height of 2 . 38 m ( corresponding to the height of the ceiling ). the width is 1 . 90 m and fits over any double - bed . when taken apart it takes up only half of a tennis bag and weighs only 25 kg . it can be put together anywhere . the stand has the capacity to hold even over 100 kg . both seats can be used singly and together ! fig1 there has not been gear like this erotic - seat which allows turning during love - making in the three million years before christ and the 2000 years since ! until today there have not been any functionable devices available in the history of erotic , in movies , in erotic shops ( like beate uhse , orion , dr . muller , anne summers etc .)! there is no device that revolves smoothly without interruption and then reverses automatically . this erotic - seat can be folded very small and rolled up ( approximately 85 cm by 15 cm )! the man or the woman turns the seat ( fig1 ) e . g . to the right by using their hands ( counter clock - wise ) because the rope is twisted like a corkscrew and automatically rewinds when released : fast and slow , left or right , without disturbing the feet and without electric power . the unusual , excellent while also seemingly simple rope construction smoothly corrects irregularies in balance , which could be created through shifts in weight . the arrangement and mounting of the rope and the three poles is one of the most important prerequisite for the functioning of the device . the construction appears simple , but once has to have come up with the idea for it -- which hasn &# 39 ; t happened in the last 2000 years ! the form of the chair with its four mounting loops also plays a decisive role ! the seat is also adjustable and comfortable . the mounting loops and the upper pole ( near the ceiling ) spread the weight for the turning and make sure that even long - legged women will not be smothered by the chair due to body weight . the name &# 34 ; love - spin / love - swing &# 34 ; was created by me , since such a device and such technology did not exist before ! it was and is up until now in the described form and design unknown to the world ! the principle of construction and the purpose - specific design are the deciding factors ! the erotic seat allows many love positions to be used , which i have also created ! the arrangement of the ropes , the arrangement and type of knots used and the three poles are some of the most important prerequisites for the functioning of the device . these make the spinning , the balance , the retaining of balance , the ability to fold up and set up possible ! the knots and mounting loops are all directed internally , in order to provide greater stability . the screw holes , through which the ropes are run , result in two upper mounting loops ( 8 , 9 ) in the ceiling pole ( 7 ) which guarantees balance and suspension . the seat ( 13 ) is adjustable and comfortable . the four mounting loops ( 15 , 16 , 17 , 18 ) spread the weight for the spinning further and make sure that even long - legged women will not be smothered by the chair due to body weight ! the knees can , when necessary , be put through the space between the material and the poles ( 19 , 20 ) on both sides of the erotic seat ! the hole in the seat ( 14 ) has a size established through much experimentation and can be either square or round . it is double reinforced and specially sewn so that it can not fall apart . the fabric is also very strong . netting or belts can also be substituted for the fabric ! the belt variation is designed more for swinging , shaking , and bobbing , but can also turn . the variations work with the same principle and only look a little different due to the belts and size ! these variations allow many different love positions to be used ! if the love - spin and love - swing are used together , even more positions can be explored ! fig8 shows that the poles are also connectable to the ropes with screws and eyes . fig9 shows that the ropes could also be substituted by poles , so that the three components of the triangle ( a b c ) are connected . the square and symmetrical seat element ( 13 , see fig2 ) is made up of strong material or a similar flexible material , for instance netting or belts ( fig4 ). this material has a square or round central hole ( 14 ) in the middle . the chair element has four mounting loops ( 15 , 16 , 17 , 18 ), which function as the first mounting ( from the bottom ). the frame is made up of three identical round poles ( 7 , 19 , 20 ). on each side are two screw holes placed exactly in the middle ( four total ): two which are distanced 2 centimeters from the ends of the pole and two which are distanced e . g . 8 cm . from the ends of the pole . the distance from one edge of the hole to the other is the same width as the belt , about 5 cm . each of the two mounting loops is layed over the two holes in the round pole on either side of the belt ( fig1 ). the mounting loops are found then between the two screw holes of the pole ( 15 , 16 , 17 , 18 ). one end of a rope ( 3 ) with a loop ( 6 ) in the middle is put from above through the inner ( 8 cm .) hole in the pole underneath . then the rope is pulled from underneath the pole back through , through the outer hole ( 2 cm . ), and then a bowline knot ( fig1 / a ) is made around the inner rope . then the other end of the rope ( 3 ) is pulled through the inner hole in the pole ( 8 cm .) from above , and then pulled from underneath back through the outer hole ( 2 cm . ), and then a bowline knot ( fig1 / a ) is made around the inner rope . the loop ( 6 ) from the rope ( 3 ) must now be exactly over the middle of the pole . the mounting loops ( 15 , 16 ) are held by the rope exactly in between the two inner and outer holes of the pole . the other side of the mounting of the seat element on the pole ( 20 ) is identical : one end of a rope ( 4 ) with a loop ( 5 ) in the middle is put from above through the inner ( 8 cm .) hole in the pole ( 20 ) underneath . then the rope is pulled from underneath the pole back through , through the outer hole ( 2 cm . ), and then a bowline knot ( fig1 / a ) is made around the inner rope . then the other end of the rope ( 4 ) is pulled through the inner hole in the pole ( 8 cm .) from above , and then pulled from underneath back through the outer hole ( 2 cm . ), and then a bowline knot ( fig1 / a ) is made around the inner rope . the loop ( 5 ) from the rope ( 4 ) must now be exactly over the middle of the pole . the mounting loops ( 17 , 18 ) are held by the rope exactly in between the two inner and outer holes of the pole . a loop is made with a bowline knot ( 10 ) on the end of another rope ( 1 ) ( fig1 / a ). then the long end of the rope is pulled from above through the third pole ( 7 ) ( ceiling pole ) through the outer hole , then at ( 8 ) through the rope loop ( 3 ) of the seat part , and then is pulled from underneath through the inner hole and then through the free bow - line - knot loop ( 10 ) ( fig1 / a ). the other side of the seat ceiling part mounting ( fig7 ) is the same : a loop is made with a bowline knot ( 11 ) on the end of another rope ( 2 ) ( fig1 / a ). then the long end of the rope is pulled from above through the third pole ( 7 ) ( ceiling pole ) through the outer hole , then at ( 9 ) through the rope loop of the seat part , and then is pulled from underneath through the inner hole and then through the free bowline knot loop ( 11 ) ( fig1 / a ). both long ends run to the middle of the of the pole and are joined together with a double figure eight knot ( 12 ) ( fig1 / b ). the pole ( 7 ) for the mounting of the seat - ceiling part stands at a 90 - degree angle to the other two poles ( 19 , 20 ). it spreads and keeps open the length of the seat element ( 13 ), while the other two poles ( 19 , 20 ) keep the width of the seat element ( 13 ) open . a steel spring ( 21 ) is hung between a second double figure eight knot ( 12 ) ( fig1 / b ) ( fig1 - 12 ). this seat is able to turn left or right , because the rope ( 22 ) is twisted around itself like a corkscrew between two double figure eight knots ( 12 , 22 ) and automatically rewinds when released . the suspension is a result of the steel spring ( 21 ) and is strengthened by the stand ( 23 )! the swinging and shaking is automatically made possible by the mounting . the four mountings through the four ropes and the arrangement of the three poles are the most important features of the device . all of the knots and holes can also be substituted by other mounting possibilities such as eyes and screws ( fig8 ). love - spin is a spinning , bobbing , swinging love - seat on the room ceiling ! it will be installed with a plug or an accompanying stand . love - swing is a swinging , bobbing love - seat on the room ceiling ! it will be installed with a plug or an accompanying stand . the product nr . 1000 - 06 and nr . 1000 - 07 can be used singly and together ! 1 . love - spin is made up of three identical , 3 cm in diameter and 85 cm of length , round poles ( fig1 ) out of pine or beech ( 7 , 19 , 20 ). on each side are two screw holes placed exactly in the middle ( 1 . 5 cm ): two of which are distanced 2 centimeters from the ends of the pole ( 24 ) and ( 27 ) ( fig1 ) and two of which are distanced 8 cm from the ends of the pole ( 25 ) and ( 26 ). the 12 screw holes total in the round poles ( 7 , 19 , 20 ) are made with an 8 mm drill ( fig1 )! 2 . the love - spin is also made out of : 2 polyamid ropes ( 1 , 2 ) that are 2 . 00 meters long and 6 mm in diameter ( fig1 ) and 2 polyamid ropes ( 3 , 4 ) which are each 2 . 00 meters long for the seat part ( fig1 ). 3 . the love - spin is also composed of a seat ( 13 ) of canvas nature 520 gram per square meter ( fig1 , 12 ). 2 . 4 small pieces of fabric for the reinforcement of the corners and ends of the hole ( 28 ) ( 5 cm .× 30 cm .) ( fig1 ). a . the 100 cm . side of the material is folded 10 cm under ( left ) and sewed ( 29 ). the seam is about 9 cm from the outer edge of the material . it results in a long loop of about 9 cm in diameter ! b . the other 100 cm . side of the material is folded 10 cm under ( left ) and sewed ( 30 ). the seam is about 9 cm from the outer edge of the material . it results in a long loop of about 9 cm in diameter ! c . the third 100 cm . side of the material ( 80 cm after completion of the other seams ) is folded 10 cm under ( left ) and sewed ( 31 ). the seam is about 9 cm from the outer edge of the material . it results in a long loop of about 9 cm in diameter ! d . the fourth 100 cm . side of the material ( 80 cm after completion of the other seams ) is folded 10 cm under ( left ) and sewed ( 32 ). the seam is about 9 cm from the outer edge of the material . it results in a long loop of about 9 cm in diameter ! the resulting seat is 0 . 80 meters by 0 . 80 meters ( fig2 ). the corners are therefore four - times reinforced . the thread is from amann ( 1222 ), 30 / 3 polyester ( seralon ) for industrial sewing machines . e . both opposite corners ( d , f ) ( fig1 ) are folded together along the diagonal , in order to find the middle point . the middle point is then marked by ironing , the same is done to the other comers ( e , g ); they are folded together along the diagonal and the middle is marked by the use of an iron . f . then 10 cm must be measured from the edge of each side . a square of dimensions 20 cm × 20 cm must then be lightly drawn on to the left side of the fabric ( 34 ) with chalk ( on the side parallel to the square side ( 33 )). the four fabric pieces for the corner reinforcement ( 5 cm × 30 cm ) are now sewn exactly on the 20 cm × 20 cm markings on the outside border ( 36 ) underneath ( left ) ( 34 ). around the edge is now a border of about 4 cm wide ( 36 ), since the smaller fabric pieces must be hemmed approx . 0 . 5 cm . from the center working outwards , four cuts must be made along the ironed - in diagonal to near the fabric pieces on each corner of the 20 cm × 20 cm square ( fig1 ) ( 41 , 42 , 43 , 44 ). g . the points of the resulting four triangles must then be cut off so that the edge ( 46 ) is about 4 cm long , and can be tucked underneath the fabric reinforcements . now the square hole ( 20 cm × 20 cm ) must be sewn around the inside . a second seam must also be made 1 cm away from the hole . this results in a triple - reinforced edge underneath ( material , triangular pieces , fabric reinforcers ( 45 )) of about 4 cm , since the fabric reinforcements must be hemmed on each side about 0 . 5 cm . as a result , the seat has a triple - reinforced hole ( 14 ) of 20 cm × 20 cm ( fig1 ) so that it will not come apart . h . the seat of the love - spin is also made out of four 60 cm by 5 cm polyester belts ( 15 , 16 , 17 , 18 ) ( fig1 ). the four belts must be folded in half ( 30 cm ) and inserted into the loops ( 31 , 32 ) ( which have a 9 cm diameter ) at a distance of 10 cm from the open side of the folded belting ( fig1 ) and sewn as close to the seat edges ( 37 , 38 , 39 , 40 ) as possible . twenty cm of the belting is outside of the loop . the seams are sewn at right angles of about 4 . 5 cm × 8 cm with a cross in the middle ( 37 , 38 , 39 , 40 )! the four 20 cm . long belts with the loops on the ends appear in the shape of an &# 34 ; h &# 34 ; and will herewith be called the &# 34 ; h - cut .&# 34 ; a . rope with a length of 2 . 00 meters must be folded in half and then a simple 1 / 2 knot must be made at 18 cm from the end so that a loop results ( 5 ). the two loops on either side of the seat ( i7 , 18 ) with dimensions of 5 cm × 20 cm must now be pulled over both of the wooden poles and placed between the two holes ( 2 cm and 8 cm from the edge )! between ( 24 ) and ( 25 ) and on the opposite side between ( 26 ) and ( 27 ). one end of a rope with a loop in the middle is pulled from above through the inner ( 8 cm .) ( 25 ) hole in the pole underneath . then the rope is pulled from underneath the pole back through , through the outer hole ( 2 cm .) ( 24 ), and then a bowline knot is made around the inner rope . then the other end of the rope is pulled through the inner hole in the pole ( 8 cm .) ( 26 ) from above , and then pulled from underneath back through the outer hole ( 2 cm . )( 27 ), and then a bowline knot must be made around the inner rope made 18 cm from the end of the rope . the simple 1 / 2 knot ( 5 ) with the loop must now be positioned exactly over the middle of the pole -- this is very easy to correct ! rope with a length of 2 . 00 meters must be folded in half and then a simple 1 / 2 knot must be made at 18 cm from the end so that a loop results ( 6 ). the two loops on either side of the seat ( 15 , 16 ) with dimensions of 5 cm × 20 cm must now be pulled over both of the wooden poles and placed between the two holes ( 2 cm and 8 cm from the edge )! between ( 24 ) and ( 25 ) and on the opposite side between ( 26 ) and ( 27 ). one end of a rope with a loop in the middle is pulled from above through the inner ( 8 cm .) hole ( 25 ) in the pole underneath . then the rope is pulled from underneath the pole back through , through the outer hole ( 2 cm .) ( 24 ), and then a bowline knot is made around the inner rope . then the other end of the rope is pulled through the inner hole in the pole ( 8 cm .) ( 26 ) from above , and then pulled from underneath back through the outer hole ( 2 cm . )( 27 ), and then a bowline knot must be made around the inner rope made 18 cm from the end of the rope . the simple 1 / 2 knot ( 6 ) with the loop must now be positioned exactly over the middle of the pole -- this is very easy to correct ! measure 18 cm from the rope end and then make a 2 cm loop and a bowline knot . then the long end of the rope is pulled from above through the pole ( 85 cm long ceiling pole ( 7 )) through the outer hole ( 24 ), and then through the rope loop ( 9 ) of the seat part , and then is pulled from underneath through the inner hole ( fig2 ) and then through the free bowline knot loop ( 11 ). measure 18 cm from the rope end and then make a 2 cm loop and a bowline knot . then the long end of the rope is pulled from above through the pole ( 7 ) ( ceiling pole ) through the outer hole ( 27 ), then through the rope loop of the seat part ( 8 ), and then is pulled from underneath through the inner hole and then through the free bowline knot loop . both long ends run to the middle of the of the pole and are joined together with a double figure eight knot ( 12a ) ( or a 1 / 2 knot )-- easy to undo ( 12 ), then at a distance of 20 cm - 50 cm , a second double figure eight knot ( 12b ) is made ( 22 ) turning part of the rope : between ( 12a ) and ( 12b ). one of the two long rope ends can now be pulled with the use of a positioning chain ( 21a ) ( 20 cm long ), which can determine the fast and exact height position ( and can also be left off ( 21a ). then a double figure eight knot ( 12b ) ( easier to undo for faster height adjustments ) must be made . a steel spring ( 21 ) of about 5 cm in diameter and about 12 cm long and 6 - 7 mm strength is hung in the resulting loop ( 22 ). it produces the vertical swing . the spring is attached to a swinging hook on the ceiling or on a special stand ( 23 ). the spin - stand / sex - swing - stand consists of 65 cm ( longest part ) long aluminium parts which , when put together , stand at a height of 2 . 38 m ( corresponding to the height of the ceiling ). the width is 1 . 90 m and fits over any double - bed . when taken apart it takes up only half of a tennis bag and weighs only 25 kg . it can be put together anywhere in the world . the stand has the capacity to hold over 100 kg . 1 . the love swing is made up of a round pole out of beechwood or pine of about 3 cm in diameter and 85 cm long ( 7 ) and two round wooden poles of about 35 cm in length ( 19 / 35 ) and ( 20 / 35 ). four holes ( as described ) are made in the middle ( 1 . 5 cm ) on each side and on each pole . the manufacturing process is the same as that of the love - spin as described . 1 . the 2 poles ( 19 / 35 ) and ( 20 / 35 ) are only 35 cm long instead of 85 cm . 2 . the 2 polyamid ropes for the seat are each only 1 . 95 m long instead of 2 . 00 m . 3 . the seat is smaller and made only out of polyester belting : love - swing ( fig4 ) is made out of polyester belting , like the 2 mm strength of an automobile safety belt . a . belts of dimension 160 cm × 5 cm are laid in 20 cm strips on each of the 4 ends and 10 cm of the length of the belts must be sewn under to form a loop of about 10 cm in diameter ( fig4 )! the seams are about 4 . 5 cm × 10 cm with a cross in the middle ( 47 , 48 , 49 , 50 )! the entire length of the seat is now 120 cm ( fig4 ) b . at a distance of 45 cm from the end of the 1 . 20 m belt , the 30 cm long belt must be sewn at a right angle to the 1 . 20 m belt without overlapping ( 51 ). the same must be done on the other end ( 53 ). c . the same must be done for the opposite side ; at a distance of 45 cm from the end of the 1 . 20 m belt , the 30 cm long belt must be sewn at a right angle to the 1 . 20 m belt without overlapping ( 52 ). the same must be done on the other end ( 54 ). the result is a hole in the seat ( 14 / 35 ) of dimension 20 cm × 20 cm . the four belts make an &# 34 ; h &# 34 ; shape and will herewith called the &# 34 ; h - cut ,&# 34 ; as it is called in the manufacturing of the love - spin ( fig4 ). | 8 |
now turning to fig1 that illustrates an overview of an exemplary computer system of the present invention 10 . the present invention ( referred to herein as ethassist ) is a saas ( software as a service ) technical software model 12 , which is software that resides on a remote computer server 14 and data storage 16 managed by an outside service that guarantees capacity , network speed , and security back up . this strategy also provides system access by users 18 from anywhere ( for example , location a — first personal computer , location b — laptop , location c — mobile device , location d — second personal computer , etc .) in the world via the internet cloud 20 . though the exemplary system 10 illustrates ethics topics , system 10 is not limited to ethics topics . system 10 can be setup for educating any subject matter using the same rlo concept . now turning to fig2 a and 2b for illustrations of ethassist 10 that can comprise four software modules : knowledge - icb 22 , ethicsconsult 26 , curriculum builder 28 , and internal review board quality assurance ( irbqa ) 30 . knowledge - icb 22 and in a category of tools - icb 24 ( previously referred to as reliance - icb ), are the other three software modules : ethicsconsult 26 , curriculum builder 28 , and internal review board quality assurance ( irbqa ) 30 . the core idea of the product is the bridge and integration of knowledge - icb 22 ( the academic modules ), and tools - icb 24 ( the applied ethics module ). the intelligence built into components of tools - icb 24 extracts information from knowledge - icb 22 integrating it into the other modules 26 , 28 , 30 as required and directed by the users 18 . this integration provides users 18 with relevant ethics learning or process guidance , in a 24 / 7 environment , pertinent to the situation at - hand . ethicsconsult 26 and irbqa 30 are self - documenting tools . both use embedded logic trees with decision points as indicated in fig7 a - 7f . a report 34 is generated at the conclusion of each tool processing documents , questions posed , and corresponding responses . irbqa 30 reports critical and warning messages based on the importance of the question and response . see fig3 for an example of a report 34 . in fig2 a and 2b , the block labeled “ ethical considerations ” 36 are thought processes humans inject as indicated on fig7 c steps 34 and 40 , into decisions based on conditions presented by the software . in both ethicsconsult 26 and irbqa 30 , the interviewer or irb member has the option to extract an rlo from knowledge - icb regarding the particular ethics situation . this on the spot education would be available to be viewed by anyone involved in the ethicsconsult or irbqa process . fig2 a and 2b depict the interrelationship of ethassist modules and human and machine interfaces . interfaces between knowledge - icb 22 and ethicsconsult 26 , fig1 a , and interfaces between knowledge - icb 22 and irbqa 30 , fig2 a , are similar in nature . in both cases intelligent logic , is built into each of the tools . the logic is driven by the human interface responses to questions the software presents to either an interviewer , or internal review board committee member depicted on the flow charts as “ input / facts of industry segments ” 32 . the curriculum builder module 28 , depicted on fig2 a , relies heavily on the human interface ( input / fact of industry segments 38 ) and data interface 40 to knowledge - icb 22 . the curriculum builder module 28 allows educators to extract predetermined lessons and classes 42 , use them as is , modify existing or build customized education by the course developer 44 to build a course 46 that suites the needs of a medical facility , clinical research organization or university . bioethicists research , synthesize , and incorporate the latest knowledge and best - of - breed practices and theories into the searchable database 50 of knowledge - icb 22 . database 50 updates occur on an as - need basis , which can be continuously updated when new material is available or batch updated at a predetermined period , such as hourly , daily , monthly , quarterly , bi - annually , or annually , to best meet the needs of the clients . this model also contains reusable learning objects ( rlo ) 52 class outlines and content suitable for teaching the associated topic 48 . the users 18 of the system can extract information on hundreds of ethical topics 48 directly from knowledge - icb 22 . users 18 of the system 10 can use drop down menus of word search technology to find topics 48 that they need information about . once the particular topic 48 is found , knowledge - icb 22 presents the user 18 with a set of related topics 49 for more in - depth information . information is presented in three forms : on - screen text , video 54 , and or voiceover narrations of powerpoint slides . knowledge - icb 22 is built on a relational database 50 with a keyword search and topic selection capability . users 18 navigate to the relational database 50 directly from a selection on a home page menu selection . once there , and option is presented to search knowledge - icb relational database 50 by the entry of a word or subject matter query . an alternate method is to select a grouping of topics 48 by ethical subject area and the system presents the user with an number of topics 48 within that group , and another selection is then made from that list to extract the requested information 49 . in both query methods , a narrative is presented to the user 18 that contains information of the topic 48 . within the narrative are hyperlinks to related topics 49 pertaining to the subject area . knowledge - icb 22 is also built to send and receive queries from tools - icb . in these instances information on a topic 48 is sent to any of the three modules in tools - icb . ethicsconsult 26 and irbqa 30 receive topical narratives to be used for reference or as assistance in a required activity . queries for information are also sent to knowledge - icb 22 received from curriculum builder 28 where subject matter training material is available from predefined curriculums or sent to the user 18 to construct customized courses . requests for video extracts or voice over narrations are sent to a multimedia database noted in fig8 m and used in classroom or individual training sessions when they occur . the key data elements of knowledge - icb 22 are as follow : see fig4 a - 4e for an exemplary database schema and fig5 for an exemplary database structure of present invention 10 . further , fig6 a - 6g are examples of screen shots including navigation and date flow with the notation “ call ” for input and output movement of information to knowledge - icb &# 39 ; s database 50 . now turning to fig6 a - 6g . this is a description of the users interaction of knowledge - icb 22 . depicted in fig6 a , a user 18 is first presented with a secure login screen 102 where a user id 104 and password 106 is required for entry into the system 10 . the user 18 information is setup prior to the user 18 attempting to login by a system administrator . there is a reset password process a user 18 can follow should they forget their password . once into knowledge - icb 22 , a menu 68 of navigation options is presented . the menu 68 allows the user 18 to select a database 50 by industry segment 32 or select an applied tool from tools - icb 24 . for this example , the user 18 , selects the clinical ethics 56 in database 50 . on fig6 b , the user 18 is presented with a screen 110 that provides instructions about the structure 111 of the database 50 and a drop down box 58 of categories 60 to choose from . once a category 60 is selected , a call 112 is initiated to the database 50 to retrieve the desired information 116 . at this point the system 10 presents another dropdown box 114 to the user 18 with a list of sub - categories 62 to choose from as depicted of fig6 c . once a sub - category 63 is selected ( e . g ., informed consent ), another call 118 is initiated to the database 50 to retrieve the information 120 requested as depicted in drop down box 122 in fig6 d , where the user 18 is presented with topics 64 ( e . g ., topics for informed consent ). the user 18 next selects to desired topic 64 and yet another call 124 is initiated to the database 50 to retrieve the information 126 . at this point , the topic 64 information is presented in the form of an rlo 52 that has the topic 64 content ( e . g ., informed consent ) as shown in fig6 e . the topic 64 content describes the clinical ethics 56 subject , addressing ethics issues , religious and cultural considerations and any legal concerns . additionally as shown on fig6 e , the user 18 has the option to view a video 54 that has more information about the topic 64 . if the user 18 selects the video 54 , a video call 128 is initiated to the database 50 to retrieve 130 the video 54 . a listing 222 of related topics 224 ( e . g ., do not resuscitate orders ) of the selected sub - category 63 ( e . g ., informed consent ) can be displayed as shown in fig6 f if user 18 desires more information . user 18 selects related topic 224 ( fig6 d , 6 e ) to send a call 134 to database 50 to return content 138 ( fig6 f ) of related topic 224 . also as depicted on fig6 f , a dropdown box 132 is presented with a list of related topics 48 that the user 18 can request from the system 10 if further information is required on the selected topic content 138 . now turning to fig6 g , users 18 of knowledge - icb 22 also have the ability to go directly to a topic 64 by using the systems 10 keyword search 66 capability . a keyword search call 140 is sent to database 50 to search stored topics 64 containing the search criteria ( e . g ., human ) that are retrieved 142 from the system 10 and displayed 144 to the user 18 . so they can review and select the desired topic 64 . tool - icb module 24 is the applied ethics component of ethassist 10 . as mentioned above , tools - icb 24 has three separate and distinct software modules that work independently from one another which send and retrieved information from knowledge - icb 22 . the ethicsconsult module 26 is an automated methodology to guide patient interviews to ensure all information pertaining to demographic , family relationships , patient condition , and ethical situation is collected and reported consistently . it is built upon a foundation of best - of - breed healthcare ethics procedures and practices . it includes sequenced , connected steps supplied by information from knowledge - icb 22 with well - defined inputs and outputs that can interface to any hospital administration system . the following are examples of the instructions for medical staff conducting clinical interview using ethicsconsult module 26 . these examples of questions are not intended to limit the invention . there are information points during the interview that will require information to be retrieved from knowledge - icb 22 via calls for data link 40 ( fig2 a ). a case , in most instances , will require interviews of several people , family members , decision makers , medical staff and so on . no actual names are recorded but are codified so as to avoid meaningful use issues . the interview data for each case must be maintained until the interviewer feels that all necessary people are interviewed . once the interview is complete , the interviewer can either print a summary report ; send an electronic version to the hospital admiration system , or both . once that occurs , all interview data regarding the case is removed from the system 10 . fig7 a - 7f are exemplary questions ( also listed below ) that can be asked during an interview and match the prototype functionally : 2 . clinician : who is being interviewed : patient , family , decision maker pull down menu for those three choices . clinician : at this point the interview begins . you can introduce the start of the interview as you feel is best . some suggestions include , “ i am going to a few questions now to get a little background information .” then proceed to gather , in your own language , medical and social history as well as where the patient resides . also , 3 . patient &# 39 ; s medical history : clinician this includes the following information : current problem , brief past history , any relevant information pertaining to current admit to hospital text box to enter 7 . with whom does / do patient / you live ? ( pull down menu : alone , family , nursing home , other ) b — if nursing home — in which facility does patient / you reside ? text box to enter 8 . is the patient is a relationship ? if so , with whom ? text box to enter 9 . are you / is the patient working , retired ? text box to enter 11 . clinician , now you will gather information on patient medical history . you may prompt with a question such as , “ now i am going to ask a few questions about your medical history .” 15 . clinician , now you will gather information on family medical history . you may prompt with a question such as , “ now i am going to ask a few questions about your family &# 39 ; s medical history .” patients who have non - biologically related siblings or parents may state this at this point , however there is no need to specifically ask if this person is a blood relative . you may state this in the notes . 17 . is the patient &# 39 ; s parent &# 39 ; s living ? yes , age and significant medical issues . no , age and cause of death . 18 . how many brothers / sisters do you / does the patient have ? pull down for number of siblings &# 39 ; numbers : 0 - 10 . if 0 siblings , skip 18 if yes , ( any are deceased ): what did your / the patient &# 39 ; s sibling die from ? no , age and any significant medical issues . 19 . does the patient have any children ? pull down for number of children numbers : 0 - 10 . if 0 children , skip 19 20 . any additional family medical history that is important ? ( text box ) to begin select the main topic which the consultation may utilize : ( pull down ) 25 . has the patient been given all of the information regarding his or her medical procedures and firmly understands all of the associated risks and benefits to the procedure ? the questions below should be specific to how patient answered question 25 . if 25 is a no , go to 26 . if 25 is a yes , got to 29 . was enough information given to the patient ? what aspect is not clearly understood ? if there family conflict ? is the patient expressing fear or anxiety ? is there a language barrier ? is there cultural barrier ? is patient able to read ? is the patient overwhelmed , cannot decide and needs more time than given to decide ? was information provided in technical terminology or not easily understood language to the patient ? was the information provided too quickly by physician ? have all of the patient &# 39 ; s questions have been answered ? ( text field to enter reason why , include this note : clinician : please ever why you feel that patient understanding is compromised . if needed , use probes for guidance .) 29 . is the patient decisionally capable of making these decisions ? question 25 must be considered along with questions 29 . rules : both questions get asked . if yes to 29 and 25 , stop section 1 . to indicate section ends insert a prompt stating : this patient is capable of making his or her own medical decisions . if no to either or both question 29 or question 25 , continue with subsequent follow - up questions . one no to either question , 29 or 25 warrants continuing as one no to 29 or 29 is a sub - threshold criteria . 30 . if no to 25 . why is the patient not decisionally capable of giving informed consent ? 31 . clinician : if at this time , the barrier to informed consent in relation to understanding is able to be resolved and the patient has decision making capacity . this patient can now give informed consent . 33 . clinician : addressing each barrier to understanding requires clinical judgment and to determine interviewer should engage the patient in conversation to gather this information . this would be a good breaking point to do so . clinicians should look for signs of confusion or incoherence from the patient , as well as opinion of the patient &# 39 ; s family to determine if the patient is not himself or herself when trying to determine signs that capacity may be lacking . 35 . to have mental capacity is the possess the ability to hear and comprehend information , appreciate all of the consequences of a medical procedure , communicate a choice , and deliberate ones &# 39 ; values in decisions between the patient and the doctor . capacity may be compromised by a number of factors . capacity must be present in order to give informed consent to any medical procedures . jonsen , 65 . 36 . is there a specific indication that patient may not have decisional capacity ? clinician probes ( pull down ) is the patient &# 39 ; s illness rendering him / her obviously unable to communicate ? ( for example , unconscious , comatose , delirium ) has the patient always lacked capacity ? ( for example , profound mental retardation ) 37 . * note to clinicians for psychiatric patients : if patient has a psychiatric diagnosis this does not mean the patient is unable to make his or her own medical decisions , however is does make determining capacity more difficult . having a mental illness does not make on decisionally incapable , however , the illness may at the time inhibit the patient from understanding in a particular situation . altering medications or psychiatric interventions can help one regain capacity but delusions , for example , may not be able to be remedied . consult with psychiatry for patients with mh diagnosis . i ( text field to enter reason why , include this note : clinician : please ever why you feel that patient decision making capacity is compromised . if needed , use probes for guidance ) 38 . capacity assessments should be conducted by your specific hospital department ( psychiatry , neuropysch , etc .). however due to your recommendation this may help to determine if such an assessment should be conducted . if you recommend there be an official capacity assessment , please contact the appropriate contact within your facility . 39 . clinician : is the barrier or hindrance to decision making capacity able to be overcome ? yes ( if yes and no to question a , stop here . include note : clinician : how will this be overcome ?) no , ( if no patient needs a surrogate decision maker to make decisions on his or her behalf ) proceed to surrogate decision maker 40 . 41 . when patients are no longer able to make medical decisions , often times the duty falls upon another who is the patient &# 39 ; s surrogate decision maker . a surrogate is an individual who is authorized to make medical decisions on behalf of another . while they are still healthy many will appoint a surrogate decision maker in their advance directive . a surrogate may be appointed under a health care power of attorney and often is in combination with a living will . surrogates can also be appointed without a health care power of attorney as many states have family consent statutes . a surrogate may be a patient &# 39 ; s next of kin such as a husband or wife , child , sibling , or parent as a family member most often serves in the surrogate role . 45 . is the patient &# 39 ; s surrogate decision maker aware of the patient &# 39 ; s wishes , please explain ? ( text field ) 46 . does the patient have an advance directive ? yes no pull down is the surrogate familiar with the patient &# 39 ; s values enough to gauge what the patient would want ? please explain . ( text field ( note to clinician : probing for additional details and other patient information is acceptable ) 47 . clinician : do you think the surrogate is acting to uphold this patient &# 39 ; s autonomy and wishes in a sincere fashion ? ( text field ). if yes , then stop , you have identified surrogate decision maker . if no , then proceed to box 48 . 48 . is there any next of kin or contact listed in patient &# 39 ; s chart or any record from any facility ? ( pull down . yes no pull down . if yes ( there is a contact found ), then go to box 49 . clinician : contact this person . if no , go to box 53 . consensus needed for conflict among siblings , see pennsylvania act 169 to determine proper order for surrogacy in pa . 50 . are they willing to take on this role and are they reasonably available to do so ? ( text box ) 51 . is the surrogate familiar with the patient &# 39 ; s values enough to gauge what the patient would want ? ( text box ) 52 . clinician : do you think the surrogate is acting to uphold this patient &# 39 ; s autonomy and wishes in a sincere fashion ? ( text box ) 53 . no next of kin or contacts can be found : include this text if all avenues are exhausted to locate a potential surrogate decision maker . options include : 1 . if applicable , a private investigator to locate a potential surrogate . 2 . a legal guardian can be appointed by a court for this patient . 3 . for cases that are critical , the ethics committee can be involved and uphold beneficence and nonmaleficence as long as any conflict of interests are not a factor , for cases which are outside consultants should be contacted . ii ( text box for notes here ) 55 . text : often consultations are for treatment and goal planning for patients and families . these may help guide a patient in determining their wishes in regard to a variety of treatments for many different conditions . however , many times this is something utilized for end of life care . for either case , it is a good time to introduce an advance directive to a patient and / or his or her family . 56 . see fig7 d for a definition of an advance directive . if yes , clinician : obtain a copy for review and continue with next question . if no , clinician : encourage patient to complete one in the future . help them in the process by explaining what the selections mean and have them go over the form with their family . obtain a copy the version ( or provide the various kinds ) that your hospital uses to the patient and explain terminology and answer all questions . continue with next question . who do you want to make your decisions for you should you be unable to make them for yourself ? ( do you have a durable power of attorney for health care ? a health care power of attorney is a person , called and health care agent , who will legally make all of your medical decisions if you are not able to do so for yourself due to your illness . you can place limitations of this . if you do not appoint a person to do so , in pennsylvania health care providers will ask your next of kin or another person who knows you well for these medical preferences . you will have to complete a legal document to appoint a health care agent . this is why it is very important to have an advance directive to help guide your agent in your treatment preferences . see boxes 58 - 61 of fig7 e for a discussion on health care power of attorney and living will and treatment preferences . 62 . is this a consultation for end of life care planning ? if yes , ( text ) to clinician : this is a good time to begin a conversation with patients and families about treatment goals . these are very similar to an advance directive . values and beliefs may guide the patient in making their choices . questions should be open ended and include : i . what medical treatments are acceptable and which would you never want should you become very sick and may not recover ? ii . if your heart stops beating and / or you stop breathing , do you want to be resuscitated ? iii . would you want to have a machine breathe for you if you were not able to breathe for yourself ( placed on a ventilator ) if you were not going to get better ? iv . how do you feel about feeding tubes if you are very sick ? v . if you become seriously or terminally ill , where would you rather be at the hospital , someplace your family can get help taking care of you , or at home ? boxes 64 - 68 are further boxes that address religious and spiritual issues . as mentioned above , fig7 a - 7 e illustrate information flow chart with interface data calls for information from knowledge - icb 22 for decision in the ethicsconsult tool 26 . also fig3 a - 3c is a sample ethicsconsult output report which can be created as a data file for input into patients records of a hospital control system . now returning to fig2 a , the curriculum builder module 28 is a tool that uses rlo &# 39 ; s 52 enabling educators to customize healthcare ethics training in any number of topics in any order and duration of time . knowledge - icb 22 is the source for the information . after constructing a training course 46 , the system 10 generates course outlines , teaching guides and scripts . the system 10 is designed to integrate brief video snippets 54 and voiceover narrations into the training on the related topics 49 . curriculum builder 28 also performs assessment testing providing a variable number of questions , one to five , determined by the educator . these questions are randomized using a total group of seven for each rlo 52 . there are also embedded comprehension questions that are interactive using drag and drop and grouping technology . additionally , curriculum builder 28 has a function that allows the trainer to develop and deliver out of system assignments for students to complete . curriculum builder 28 is a tool that allows an individual responsible for education and training to build a customized curriculum or modify an existing one by selecting from hundreds of reusable learning objects ( rlo &# 39 ; s ) 52 for any type of healthcare ethics that are stored in knowledge - icb 22 . rlo &# 39 ; s contain multimedia content , either a video 54 or a voice over narration . curriculum builder 28 , educator function is the process begins with an educator logging into the building a lesson portion of the system . the organizational administrator grants an educator access to the process . it begins with a selection menu display similar to one used in knowledge - icb 22 . once a training topic 48 is identified , a selection is made and information extracted from knowledge - icb 22 regarding the course outline and multimedia duration . this information is placed in a course - building table and displayed to the educator . a running total of the training duration is accumulated and displayed to the user 18 so that they can determine if the total time required to complete the course meets the requirements or restrictions . the system 10 will allow the user 18 to edit their rlo 52 selection as needed . once the educator is satisfied with the rlo &# 39 ; s , which constitute the class , a complete button is selected , and all the information that is contained in knowledge - icb 22 for the selected rlo &# 39 ; s is extracted and stored by the educators deification number and a lesson number assigned by the educator . curriculum builder 28 , student function allows students who are assigned to complete an ethassist course 46 to will be given security access and will log into the student section of curriculum builder 28 . once logged in , they will be presented with the courses they are required to complete . when the student chooses to take the class , they select the rlo &# 39 ; s in the sequence displayed . once a topic 48 is selected the multimedia is streamed from the multimedia library . rol &# 39 ; s may have engagement activities assigned with a topic 48 or they may have embedded drag and drop comprehension questions . the student can review the class material up too three occurrences before an assessment test is given . these assessment questions can number from one to five and are presented randomized from a pool of seven questions for each topic in the test . a numerical percentage is displayed and stored for the educators review . the student has an opportunity to improve their score by retaking the assessment test as many as three times . all student activity is logged and date stamped to review by the educator . see fig8 a - 8p for a conceptual diagram of curriculum builder 28 : fig8 a - 8k are screen shots of the educator template process ; fig8 l - 8p are screen shots of the student my lessons process . notations on the flow charts , “ calls ,” indicate information input to ( requests ) and outputs from ( responses ) knowledge - icb 22 . now turning to fig8 a - 8p . this is a description of the user &# 39 ; s 18 interaction with curriculum builder 28 . as depicted in fig8 a , a user 18 is first presented with a secure login screen 102 where a user id 104 and password 106 is required for entry into the system 10 . the user 18 information is setup prior to the user 18 attempting to login by a system administrator . there is a reset password process a user 18 can follow should they forget their password . the user 18 is now at the ethassist 68 menu page where navigation options are presented . the menu 68 allows the user 18 to select curriculum builder 28 from the tool - icb 24 section of the menu page . fig8 b is another menu 108 illustration and selection of curriculum builder 28 is next executed to take the user 18 into the educator template creation 70 process shown on fig8 c , where a secondary menu selection 146 is presented to the user 18 . the user 18 selects course templates 72 from the browse course template screen 82 to begin the process of creating a new course . the user 18 in this process is called admin 74 . the admin 74 selects a template design 148 as depicted on fig8 d . in this example , a new blank template 76 is called from the database 50 in the lesson template screen 75 . next the admin 74 will customize a lesson 76 by assigning a name 150 , lesson number 78 and engagement activity 80 to the lesson 76 as illustrated on fig8 e . once the admin 74 completes entry of the required data , they will mark status 152 of the lesson 76 as draft or active and submit 154 the lesson 76 to the database 50 for storage . after the admin 74 submits the lesson 76 , the system 10 takes the admin 74 to the browse course template 82 screen where the admin 74 can see the lesson 76 they just completed . on fig8 f , the admin 74 clicks on the lesson 76 just created and activate it . at this point , the admin 74 can select the new template topic button 86 and the system 10 will allow the admin 74 to browse the database 50 in knowledge - icb 22 selecting rlo &# 39 ; s 52 ( fig2 a ) that they want to include in the lesson 76 . upon finding the desired rlo 52 , the admin 74 by selecting it initiates a call 158 to the system 10 by clicking on the insert new template topic 86 button to launch an insert new template topic screen 160 ( fig8 g ). as depicted on fig8 g , the admin 74 can also search the knowledge - icb 22 database 50 using a search capability and a dropdown box 162 containing topics 64 that can be included in the lesson 76 . after selection of a topic ( e . g ., assent ), a request or call 164 for the related media type 88 is sent to database 50 , either video 54 or narration 90 ( e . g ., narration 94 ), for selection , which is required . the admin 74 then selects the submit button 166 and the lesson 76 is stored in the knowledge - icb 22 database 50 ( fig8 h ). the admin 74 can repeat this process as shown on fig8 h as many times as required , by returning ( via return key 168 ) to the lesson template screen 75 . the next step in educator template creation 68 is assigning students to the lesson 76 . students are loaded into the systems validation table 226 by the admin 74 for security validation as shown in fig8 q . the educator 98 does a search of the validation table 226 by typing the student &# 39 ; s name into user name box 228 to assign students enrolled in lesson 76 they are teaching . call 230 is sent to validation table 226 for retrieval of all the students in the validation table 226 that meet the search criteria . the admin 74 must navigate from the browse course templates screen 82 via a dropdown menu 170 when module key 172 is selected that launches a menu page 174 where a call 176 is sent to database 50 to select a lesson 76 to which students will be assigned as illustrated on fig8 i . the last step in creating a lesson 76 is to assign quiz questions . the questions module 178 in fig8 c is selected to launch insert new lesson screen 176 , as shown on fig8 j , where the admin 74 activates the quiz questions 92 that are associated to the lesson 76 . user 18 enters template name 150 , status 152 , whether or not to use comprehension questions 180 , and the number of questions 182 . submit button 154 will send a call 184 to the database 50 to activate the quiz questions 92 . questions are randomly generated for each quiz based on known techniques . user 18 will be directed back to ( or a call to return to ) the browse course template screen 82 to view lesson 76 being created ( or updated ) and saved . after selection of lesson 76 on fig8 j , out of class homework can be given for lesson 76 by selecting insert new course assignment 94 to launch insert new course assignment screen 188 . lesson assigner can search for users 18 by typing a user &# 39 ; s name into user name box 190 . a user name call 194 is sent to database 50 for each letter typed into user name box 190 . a dropdown menu 192 is displayed showing likely known users based on the letters typed into user name box 190 . lesson assigner has the option to select one of the names listed in the dropdown menu 192 or type the full name of the user 18 . all calls to the database 50 are depicted on the figures in proper location . the student “ my lesson ” 96 process starts on fig8 l with the secure login and ethassist 68 menu screen . a student assigned to a class after login will select student “ my lesson ” button 96 from tool - icb 24 . upon selection of the “ my lesson ” button 96 , system 10 launches the my lessons screen 196 that will present the student with a list of lessons 76 assigned to the student as shown in fig8 m . the student can select a lesson 76 ( e . g ., four principles approach ) and the system 10 will send a call 200 to the database 50 to display the topics 64 contained in the lesson 76 in lesson screen 202 . when the student is ready to take lesson 76 , the student selects the topic 64 in the order displayed . system 10 indicates ( e . g ., check mark ) that a topic 64 has been completed as shown in fig8 n . once the student takes the lesson 76 , the system 10 indicates ( e . g ., check mark ) that the lesson 76 was completed . at the same time , a historical record of the student &# 39 ; s activity is maintained on database 50 such that the educator 98 can view the progress of the student . once the student has completed a lesson 76 , the student is required to take a quiz 100 . the student selects take quiz button 204 that launches the first question 206 of quiz 100 . the system 10 will randomly call 208 questions for database 50 . for example , quiz 100 can consist of one to four questions randomized from a list of seven questions for each topic . the number of correct and incorrect answers are stored on database 50 , as well as the questions taken and not taken , for course analytics and student individualized evaluation . one embodiment of system 100 provides options to repeat lesson 76 prior to taking quiz 100 . after completing the quiz 100 , system 10 calls 209 the stored quiz results ( e . g ., correct and incorrect answers ) from database 50 and calculates a numerical score based on the stored quiz results ( e . g ., correct and incorrect answers ) and displays the score 210 in quiz score screen 212 to the student , as shown in fig8 o . the system 10 has the ability to give the student the option to taken a quiz , up to a predetermined value set by the curriculum builder , for example , three times , after review of the lesson 76 again . the system 10 stores the results of the quiz 100 and the number of attempts 214 the student completed and can be called 215 from database 50 and displayed on the my lessons screen 196 , along with length of time 216 to complete lesson 76 and status 218 ( e . g ., not taken , in - progress , completed ) of lesson 76 each time the my lessons screen 196 is launched . as mentioned above , the system 10 also stores incorrect answers such that educators 98 can do analysis on the effectiveness of the course material . all transactions that are stored on database 50 are time and date stamped . fig8 p illustrates a screen 218 that an educator can use to view the status of a student &# 39 ; s progress through an educator login screen ( similar to user login screen 102 ) that provides access to students who are assigned to either the educator or a particular course or both . the student &# 39 ; s summary is called 220 from database 50 . now turning to fig2 b , the last module is internal review board quality assurance ( irbqa ) 30 . irbqa module 30 is an automated guide to walk internal review boards ( irb ) members through the irb process out lined in the irb hand book . irbqa module 30 requires users 18 to respond to each question specific to the particular trial under review . it is self - documenting proving a report of outstanding responses and note which board member responded to the questions with a time and date stamp . this provides a complete record of irb &# 39 ; s actions to improve quality of clinical trials and can be stored in defenses of their decisions . the irbqa module 30 functions as an automated check - list and chronological documentation of internal review boards ( irb ) answers to questions to ensure that clinical trials conducted on humane subjects are following best practices to safeguard patients . irbqa module 30 starts by requiring that the board membership document whom they are and that they have the required education and experience to make decisions regarding the particular clinical trial in which they are participating . if the membership does not have the correct membership the chairman has the responsibility to stop the trial review until the membership is corrected . irbqa records all answers to the qualification questions and will not allow it use unless the chairman overrides the stop condition , which the override is documented as such . this jeopardizes the fundamental existence of the irb and any decisions made by them . the next steps are taken depending upon the type of clinical trial and the groups of subjects that are in the trial . decisions are made within the process the direct the irb to follow automated process that record actions and decisions made during the trial . a report is generated that indicates warning messages and critical messages as the trial proceeds . all response to questions are time and date stamped to maintain an audit trial of the ird decisions . the following are the sub - set clinical trial review subject topics and sequential questions and decision points within the subject topics automated by irbqa . fig9 a 1 - 9 m 2 are the flow charts that document decision points and warning or critical responses to questions and “ calls ” to send and receive information to knowledge - icb 22 . see fig9 a 1 for the decision flow chart for the following questions : 1 ) does the irb have at least 5 members of varying backgrounds to promote complete and adequate review of research activities commonly conducted by the institution ? 2 ) will the irb review a protocol that involves a vulnerable population such as children , prisoners , and pregnant women , handicapped or mentally disable persons . a ) if “ yes ” please answer following : does the irb have a member who specializes in the specific vulnerable population ? 4 ) does the irb have at least one member with a scientific background ? b ) if “ no ”, irb must admit a member with a scientific background . 5 ) does the irb have at least one member with a non - scientific background ? b ) if “ no ” irb must have at least one member with a non - scientific background . 6 ) does the irb include at least one member who is not otherwise affiliated with the institution and who is not part of the immediate family of a person who is affiliated with the institution ? 7 ) does the irb have a member in the irb &# 39 ; s initial or continuing review of any project in which the member has a conflicting interest ? a ) if “ yes ” please review for conflict of interest ( note : example , can insert a link for conflict of interest from education module ) see fig9 a 2 for the decision flow chart for the following questions : 8 ) does the irb need a non - member individual with competence in special areas to assist in the review of issues for the research protocol , which require expertise beyond or in addition to that available on the irb ? a ) if “ yes ,” enter all irb members names and background information . 11 ) does this research involve children as defined as persons who have not attained the legal age for consent to treatments or procedures involved in the research under the applicable law of the jurisdiction in which the research will be conducted ? fig9 b 3 are gateways to policies related to other possible subjects ( e . g ., women , neonates , prisoners ) and other topics ( e . g ., placenta , advertising , compensation ). this list is not intended to limit the invention but to provide examples of the broad and flexible capabilities of system 10 . see fig9 c 1 - 9 c 3 for the decision flow chart for the following questions : c ) has the reviewer read the full protocol and supporting or supplemental materials ? d ) does the reviewer have a conflict of interest with this protocol ? 5 ) are the objectives likely to be achievable in the stated timeframe of the research ? 6 ) is the scientific design , such as placebo controls , phase i , ii , or iii , randomization etc ., described and adequately justified ? 7 ) are inclusion and exclusion criteria for subjects clearly specified and appropriate ? 8 ) if women , children or minorities are excluded , is this justifiable ? 9 ) is the choice of subjects appropriate for the questions being asked ? 10 ) is the principle of distributive justice adequately incorporated into the inclusion and exclusion criteria for the protocol ? see fig9 d 1 - 9 d 3 for the decision flow chart for the following questions : 13 ) are the location and timing of the recruitment process appropriate for the process ? 15 ) is the rationale and details of the research procedures accurately described and acceptable ? 16 ) is there a clear differential between research procedures and standard care ? 18 ) is the location of where the procedures will be performed acceptable ? 19 ) is there adequate plans to inform subject about specific clinical results ? 20 ) is the status of the drug , biological or device described ? ( e . g . investigational new drug biological or device , fda - approved drug , biological or device etc .) 22 ) is the drug , biological or device safety and efficacy data sufficient to warrant the proposed phase of testing ? 23 ) is the significant risk or nonsignificant risk status of the drug , biological or device described and appropriate ? 25 ) are the plans for data and statistical analysis defined and justified , including the use of stopping rules and end points ? 28 ) are the potentials risks minimized and the likelihood of benefits maximized ? see fig9 e 1 - 9 e 3 for the decision flow chart for the following questions : 29 ) is the risk to benefit ratio acceptable for proceeding with the research ? 30 ) if children are involved , which regulatory category of risk / benefit does the protocol fall within ? 31 ) is the amount and type of compensation or reimbursement reasonable ? 32 ) are there adequate provisions for the subject to avoid out of pocket expenses or sufficient justification for the subjects to incur costs ? 33 ) are there adequate provisions to protect the privacy and ensure the confidentiality of the research &# 39 ; s subjects ? 34 ) are there adequate plans to store and code the data ? 38 ) is the process of obtaining consent or assent adequately described ? 40 ) is a waiver of consent or assent possible and justifiable ? 41 ) does any investigator have a conflict of interest with this protocol ? 42 ) have conflict of interest statements of forms been filed and reviewed ? see fig9 f 1 - 9 f 3 for the decision flow chart for the following questions : 1 ) has a consent document been prepared for this trial ? — core 2 ) does the document discuss the research purpose and procedures , including but not limited to , duration of the study and identification of experimental procedures to be followed ? 3 ) does the document adequately discuss the risks , discomfort and side effects to the trial participant ? 4 ) does the document describe possible benefits to the subject that may be reasonably be expected from the research ? 5 ) does the document discuss alternative procedures or treatments that may be advantageous and beneficial to the subject ? 6 ) does the document describe the confidentiality and privacy of the data to the subject ? 7 ) does the document discuss the subjects recourse for research related illness or injury ? 8 ) does the document list research contacts for the subject to inquire or comment during the course of the trials ? 9 ) does the document have a statement regarding the voluntary nature of enrolling in the research , including the right to cease participation at any time without consequences ? i . does the document contain a statement about the risks to the subject of any unforeseen risks as a result of the research ? 11 ) does the document have a statement noting that the researcher without regard to subjects consent can terminate the research ? 12 ) does the form disclose if any additional costs may be expected from the subject ? 13 ) does the form have procedure listed for the subject to terminate from the research and the subsequent consequences from voluntary termination ? 14 ) does the form disclose how any significant new findings from the research may be communicated to the subjects ? see fig9 g 1 - 9 g 2 for the decision flow chart for the following questions : 2 ) has scientifically appropriate , preclinical studies , including studies on pregnant animals , and clinical studies , including studies on nonpregnant women , been conducted and provided data for assessing potential risks to pregnant women and fetuses ? 3 ) is the risk to the fetus caused solely by interventions or procedures that hold out the prospect of direct benefit for the woman or the fetus ? i ) is the risk to the fetus not greater than minimal and the purpose of the research is the development of important biomedical knowledge , which cannot be obtained by any other means ? 4 ) is the risk the least possible to achieve the results of the research ? 5 ) does the research hold out the prospect of direct benefit to the pregnant woman , the prospect of a direct benefit both to the pregnant woman and the fetus , or no prospect of benefit for the woman nor the fetus when risk to the fetus is not greater than minimal and the purpose of the research is the development of important biomedical knowledge that cannot be obtained by any other means ? a ) if “ yes ”, has the woman &# 39 ; s consent been obtained in accordance with informed consent revisions of all applicable regulations ? 6 ) does the research hold out direct benefit for the fetus solely ? a ) if “ yes ”, has the father &# 39 ; s consent been given , except in the cases if he is unable to consent because of unavailability , incompetence , or temporary incapacity or the pregnancy resulted from rape or incest ? 7 ) has each individual necessary to give consent on the fetus behalf been fully informed of consent and regarding the reasonably foreseeable impact of the research on the fetus ? 8 ) is the pregnant women or father of the fetus considered children who have not attained the legal age for consent to treatments or procedures involved in the research , under the applicable law of the jurisdiction in which the research will be conducted ? 9 ) is there a monetary or other inducement to the subject to terminate the pregnancy ? 10 ) is any individual engaged in the research involved in any decisions as to the timing , method , or procedures used to terminate a pregnancy ? see fig9 h 1 - 9 h 5 for the decision flow chart for the following questions : 1 ) have scientifically appropriate , preclinical and clinical studies been conducted and provide data for assessing potential risks to the neonates ? 2 ) do individuals engaged in the research have a part in determining the viability of a neonate ? 3 ) has the legally effective informed consent of both parents of the neonate been obtained in accord with proper informed consent procedures ? i ) is either parent unable to consent because of unavailability , incompetence , or temporary incapacity ? is informed consent obtained from at least one competent and available parent ? 4 ) after delivery of the nonviable neonate will all of the following conditions apply : a ) vital functions of the neonate will not be artificially maintained ; b ) the research will not terminate the heartbeat or respiration of the neonate ; c ) there will be no added risk to the neonate resulting from the research ; d ) the purpose of the research is the development of important biomedical knowledge that cannot be obtained by other means . 1 ) has the irb determined that he research holds out the prospect of enhancing the probability of survival of the neonate to the point of viability , and any risk is the least possible for achieving that objective ? 2 ) has the irb determined the purpose of the research is the development of important biomedical knowledge , which cannot be obtained by other means , and there will be no added risk to the neonate resulting from the research ? 3 ) has the legally effective informed consent of both parents of the neonate been obtained in accord with proper informed consent procedures ? i ) is either parent unable to consent because of unavailability , incompetence , or temporary incapacity ? is informed consent obtained from at least one competent and available parent ? 1 ) have scientifically appropriate , preclinical and clinical studies been conducted and provide data for assessing potential risks to the neonates ? 2 ) do individuals engaged in the research have a part in determining the viability of a neonate ? 3 ) has the legally effective informed consent of both parents of the neonate been obtained in accord with proper informed consent procedures ? i ) is either parent unable to consent because of unavailability , incompetence , or temporary incapacity ? is informed consent obtained from at least one competent and available parent ? § 46 . 206 research involving , after delivery , the placenta , the dead fetus or fetal material . 1 ) does the research involve , after delivery , the placenta ; the dead fetus ; macerated fetal material ; or cells , tissue , or organs excised from a dead fetus ? 2 ) is information associated with material described in question # 1 recorded for research purposes in a manner that living individuals can be identified , directly or through identifiers linked to those individuals ? a ) if “ yes ” those individuals are research subjects and proper methods of consent must be obtained . § 46 . 207 research not otherwise approvable which presents an opportunity to understand , prevent , or alleviate a serious problem affecting the health or welfare of pregnant women , fetuses , or neonates . 1 ) is the research not otherwise approvable which presents an opportunity to understand , prevent , or alleviate a serious problem affecting the health or welfare of pregnant women , fetuses , or neonates ? a ) if “ yes ”. notification by the secretary of hew must be sought to approve this protocol . see fig9 i 1 - 9 i 3 for the decision flow chart for the following questions : 1 ) does this research involve children as defined as persons who have not attained the legal age for consent to treatments or procedures involved in the research under the applicable law of the jurisdiction in which the research will be conducted ? 3 ) does this research involve greater than minimal risk and no prospect of direct benefits to the subjects but will yield generalized knowledge about the subject &# 39 ; s disorder or condition ? i ) the risk is justified by the anticipated benefits to the subjects . ii ) the relation of the anticipated benefit to the risk is at least as favorable to the subjects as that presented by available alternative approaches iii ) adequate provisions are made for soliciting the assent of the children and permission of their parents or guardians . 5 ) does this research involve greater than minimal risk and no prospect of direct benefits to the subjects but will yield generalized knowledge about the subject &# 39 ; s disorder or condition ? 6 ) does this research risk represent a minor increase over minimal risk ? 7 ) does the intervention or procedure presents experiences to subjects that are reasonably commensurate with those inherent in their actual or expected medical , dental , psychological , social , or educational situations ? 8 ) does the intervention or procedure likely to yield generalizable knowledge about the subjects &# 39 ; disorder or condition , which is of vital importance for the understanding or amelioration of the subjects &# 39 ; disorder , or condition ? 9 ) have adequate provisions made for soliciting assent of the children and permission of their parents or guardians ? 10 ) is this research not otherwise approvable which presents an opportunity to understand , prevent , or alleviate a serious problem affecting the health or welfare of children ? 11 ) does the irb the irb find that the research presents a reasonable opportunity to further the understanding , prevention , or alleviation of a serious problem affecting the health or welfare of children ? 12 ) has the irb received approval from the secretary of dhhs , after consultation with a panel of experts in pertinent disciplines ( for example : science , medicine , education , ethics , law ) and following opportunity for public review and comment that the research is warranted ? 13 ) if the research involves greater than minimal risk , but presenting the prospect of direct benefit to the child , has permission of at least one parent or guardian been given ? 14 ) if the research involves greater than minimal risk and no prospect of direct benefits to the subjects but will yield generalized knowledge about the subjects disorder or condition has the irb obtained both parents &# 39 ; permission ? 15 ) if the irb has not received both parents &# 39 ; permission for research on the child is one of these conditions applicable : v ) only one parent has legal responsibility for the child &# 39 ; s care and custody . 16 ) if this research is not otherwise approvable which presents an opportunity to understand , prevent , or alleviate a serious problem affecting the health or welfare of children and has been approved by the secretary of dhhs , has permission of one parent been given ? 17 ) if the irb has not received both parents &# 39 ; permission for research on the child is one of these conditions applicable : v ) only one parent has legal responsibility for the child &# 39 ; s care and custody . 18 ) has a written permission or consent form , which details the appropriate requirements for informed consent been signed by the parents ? 19 ) has the irb sought and received the assent of the child for research ? 20 ) is the capability of the child so limited that they cannot reasonably be consulted or that the intervention or procedure involved in the research holds out a prospect of direct benefits that is important to the health of the child and is available only in the context of the research ? see fig9 j 1 - 9 j 3 for the decision flow chart for the following questions : 1 ) does this research involve at least one of the following categories ? ( i ) study of the possible causes , effects , and processes of incarceration , and of criminal behavior . ( ii ) study of prisons as institutional structures or of prisoners as incarcerated persons , ( iii ) research on conditions particularly affecting prisoners as a class ( for example , vaccine trials and other research on hepatitis which is much more prevalent in prisons than elsewhere ; and research on social and psychological problems such as alcoholism , drug addiction , and sexual assaults ) ( iv ) research on practices , both innovative and accepted , which have the intent and reasonable probability of improving the health or well - being of the subject . 2 ) does this research involve minimal risk which is defined as the probability and magnitude of physical or psychological harm that is normally encountered in the daily lives , or in the routine medical , dental , or psychological examination of healthy persons ? 3 ) are the risks involved in the research commensurate with risks that would be accepted by non - prisoner volunteers ? 4 ) is at least one member of the board a prisoner , or a prisoner representative with appropriate background and experience to serve in that capacity ? 5 ) does the majority of the board ( exclusive of prisoner members ) have no association with the prison ( s ) facilities involved in the research ? 6 ) does any possible advantages accrue to the prisoner through his or her participation in the research , when compared to the general living conditions , medical care , quality of food , amenities and opportunity for earnings in the prison and are not of such a magnitude that his or her ability to weigh the risks of the research against the value of such advantages in the limited choice environment of the prison is impaired ? 7 ) are the procedures for the selection of subjects within the prison fair to all prisoners and immune from arbitrary intervention by prison authorities or prisoners ? 8 ) is the research information presented to the prisoner consistent with his language skills and educational levels to make an informed decision ? 9 ) is their adequate assurance that parole boards will not take into account a prisoner &# 39 ; s participation in the research in making decisions regarding parole , and each prisoner is clearly informed in advance that participation in the research will have no effect on his or her parole ? 10 ) have adequate provisions been made if there may be a need for follow - up examinations or care of participants after the end of their participation in the research and taking into account the varying lengths of individual prisoners &# 39 ; sentences , and for informing participants of this fact ? see fig9 l 1 - 9 l 2 for the decision flow chart for the following questions : 1 ) will the research involve advertisements , through various posters , brochures , scripts or other advertising for recruitment of subjects ? core 2 ) is the name , address of the investigator and / or research facility or institution listed on advertising materials ? 3 ) is the medical condition or affliction or the purpose of the research listed on the advertising materials ? 4 ) is the inclusion criteria or exclusion criteria noted on the advertising materials ? 5 ) if a list of procedures are involved in the research , is a brief summary of those procedures on advertising materials ? 6 ) are potential benefits to the subject listed and explained on the advertising materials ? 7 ) is time and commitments such as number of visits , duration of research , follow - ups etc ., noted on the advertising materials . 8 ) are the details of the compensation or reimbursement noted on the advertising materials ? 10 ) is the location of the research and contact information for further details noted on the advertising materials ? 11 ) is the advertising material free from deceptive phrases and words such as , free , exciting , last chance , cutting edge etc .? 12 ) is the advertising material free from misleading information regarding the purpose and type of research ? see fig9 m 1 - 9 m 2 for the decision flow chart for the following questions : 2 ) is the informed consent document the only record linking the subject and the research and would the principle risk would be potential harm from a breach of confidentiality ? a ) if yes , warning — obtaining informed consent document may be eligible to be waived . go to core . 3 ) does the research present no more than minimal risk to the subject and involves no procedures for which written consent is normally required outside of the research context ? a ) if yes , warning — obtaining informed consent document may be eligible to be waived . go to core . b ) if no , “ warning - obtain a written informed consent document ,” go to core # 4 4 ) does the research involve minimal risk and a waiver or alteration of informed consent will not adversely affect the welfare and rights of the subjects ? core 5 ) would the research be impaired or could not practicably be carried out without an alteration or waiver of the informed consent process ? 6 ) in this research , is it possible to provide subjects with additional pertinent information during a debriefing after participation in the research ? a ) if yes , “ warning — an alteration or waiver of informed consent may be appropriate . go to , core — compensation module ( note : skip informed consent module ) b ) if no , “ warning - obtain a written informed consent document ” go to core — informed consent module see fig9 b 1 - 9 b 3 for the decision flow chart for the following questions : 1 ) does this research protocol involve the use of human test subjects ? core b ) if no , warning : research may be exempt and not subject to full irb 2 ) is the research being conducted in established or commonly accepted educational settings , involving normal educational practices , such as ( i ) research on regular and special education instructional strategies , or ( ii ) research on the effectiveness of or the comparison among instructional techniques , curricula , or classroom management methods ? core a ) if yes , warning : research may be exempt and not subject to full irb review . 3 ) does the research involve the use of educational tests ( cognitive , diagnostic , aptitude , achievement ), survey procedures , interview procedures or observation of public behavior , unless : ( i ) information obtained is recorded in such a manner that human subjects can be identified , directly or through identifiers linked to the subjects ; and ( ii ) any disclosure of the human subjects &# 39 ; responses outside the research could reasonably place the subjects at risk of criminal or civil liability or be damaging to the subjects &# 39 ; financial standing , employability , or reputation ? core a ) if yes , warning : research may be exempt and not subject to full irb review . 4 ) does the research involve the use of educational tests ( cognitive , diagnostic , aptitude , achievement ), survey procedures , interview procedures , or observation of public behavior if : ( i ) the human subjects are elected or appointed public officials or candidates for public office ; or ( ii ) federal statute ( s ) require ( s ) without exception that the confidentiality of the personally identifiable information will be maintained throughout the research and thereafter ? core a ) if yes , warning : research may be exempt and not subject to full irb review . 5 ) does the research involve the collection or study of existing data , documents , records , pathological specimens , or diagnostic specimens , if these sources are publicly available or if the information is recorded by the investigator in such a manner that subjects cannot be identified , directly or through identifiers linked to the subjects ? core a ) if yes , warning : research may be exempt and not subject to full irb review . 6 ) is the research or demonstration projects which are conducted by or subject to the approval of governmental department or agency heads , and which are designed to study , evaluate , or otherwise examine : ( i ) public benefit or service programs ; ( ii ) procedures for obtaining benefits or services under those programs ; ( iii ) possible changes in or alternatives to those programs or procedures ; or ( iv ) possible changes in methods or levels of payment for benefits or services under those programs ? core a ) if yes , warning : research may be exempt and not subject to full irb 7 ) does the research involve taste and food quality evaluation and consumer acceptance studies , ( i ) if wholesome foods without additives are consumed or ( ii ) if a food is consumed that contains a food ingredient at or below the level and for a use found to be safe , or agricultural chemical or environmental contaminant at or below the level found to be safe , by the food and drug administration or approved by the environmental protection agency or the food safety and inspection service of the u . s . department of agriculture ? core a ) if yes , warning : research may be exempt and not subject to full irb review . 1 ) does the primary research present no more than minimal risk to human subjects , and involve clinical studies of drugs and medical devices , and only when condition ( a ) or ( b ) is met ? core i ) ( a ) research on drugs for which an investigational new drug application ( 21 cfr part 312 ) is not required . ( note : research on marketed drugs that significantly increases the risks or decreases the acceptability of the risks associated with the use of the product is not eligible for expedited review .) ii ) research on medical devices for which ( i ) an investigational device exemption application ( 21 cfr part 812 ) is not required ; or ( ii ) the medical device is cleared / approved for marketing and the medical device is being used in accordance with its cleared / approved labeling . a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb 2 ) does the primary research present no more than minimal risk to human subjects , and involve collection of blood samples by finger stick , heel stick , ear stick , or venipuncture as follows : core i ) ( a ) from healthy , nonpregnant adults who weigh at least 110 pounds . for these subjects , the amounts drawn may not exceed 550 ml in an 8 week period and collection may not occur more frequently than 2 times per week ; or ii ) from other adults and children 2 , considering the age , weight , and health of the subjects , the collection procedure , the amount of blood to be collected , and the frequency with which it will be collected . for these subjects , the amount drawn may not exceed the lesser of 50 ml or 3 ml per kg in an 8 week period and collection may not occur more frequently than 2 times per week . a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb see fig9 k 1 - 9 k 3 for the decision flow chart for the following questions : 3 ) does the research present no more than minimal risk to human subjects , and involves prospective collection of biological specimens for research purposes by noninvasive means . examples : ( a ) hair and nail clippings in a nondisfiguring manner ; ( b ) deciduous teeth at time of exfoliation or if routine patient care indicates a need for extraction ; ( c ) permanent teeth if routine patient care indicates a need for extraction ; ( d ) excreta and external secretions ( including sweat ); ( e ) uncannulated saliva collected either in an unstimulated fashion or stimulated by chewing gumbase or wax or by applying a dilute citric solution to the tongue ; ( f ) placenta removed at delivery ; ( g ) amniotic fluid obtained at the time of rupture of the membrane prior to or during labor ; ( h ) supra - and subgingival dental plaque and calculus , provided the collection procedure is not more invasive than routine prophylactic scaling of the teeth and the process is accomplished in accordance with accepted prophylactic techniques ; ( i ) mucosal and skin cells collected by buccal scraping or swab , skin swab , or mouth washings ; ( j ) sputum collected after saline mist nebulization . core a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb 4 ) does the research present no more than minimal risk to human subjects and involve collection of data through noninvasive procedures ( not involving general anesthesia or sedation ) routinely employed in clinical practice , excluding procedures involving x - rays or microwaves . where medical devices are employed , they must be cleared / approved for marketing . ( studies intended to evaluate the safety and effectiveness of the medical device are not generally eligible for expedited review , including studies of cleared medical devices for new indications .) examples : ( a ) physical sensors that are applied either to the surface of the body or at a distance and do not involve input of significant amounts of energy into the subject or an invasion of the subject = s privacy ; ( b ) weighing or testing sensory acuity ; ( c ) magnetic resonance imaging ; ( d ) electrocardiography , electroencephalography , thermography , detection of naturally occurring radioactivity , electroretinography , ultrasound , diagnostic infrared imaging , doppler blood flow , and echocardiography ; ( e ) moderate exercise , muscular strength testing , body composition assessment , and flexibility testing where appropriate given the age , weight , and health of the individual . core a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb 5 ) does the primary research present no more than minimal risk to human subjects and involve materials ( data , documents , records , or specimens ) that have been collected , or will be collected solely for nonresearch purposes ( such as medical treatment or diagnosis ). ( note : some research in this category may be exempt from the hhs regulations for the protection of human subjects . 45 cfr 46 . 101 ( b )( 4 ). this listing refers only to research that is not exempt .) core a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb 6 ) does the primary research present no more than minimal risk to human subjects and involve the collection of data from voice , video , digital , or image recordings made for research purposes ? core a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb 7 ) does the primary research present no more than minimal risk to human subjects , and is conducted on individual or group characteristics or behavior ( including , but not limited to , research on perception , cognition , motivation , identity , language , communication , cultural beliefs or practices , and social behavior ) or research employing survey , interview , oral history , focus group , program evaluation , human factors evaluation , or quality assurance methodologies . ( note : some research in this category may be exempt from the hhs regulations for the protection of human subjects . 45 cfr 46 . 101 ( b )( 2 ) and ( b )( 3 ). this listing refers only to research that is not exempt .) core a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb 8 ) is this protocol a continuing review of research previously approved by the convened irb as follows : core i ) where ( i ) the research is permanently closed to the enrollment of new subjects ; ( ii ) all subjects have completed all research - related interventions ; and ( iii ) the research remains active only for long - term follow - up of subjects ; or ii ) where no subjects have been enrolled and no additional risks have been identified ; or iii ) where the remaining research activities are limited to data analysis . a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb 9 ) is this protocol a continuing review of research , not conducted under an investigational new drug application or investigational device exemption where it is not listed in the prior questions for exempt or expedited categories but the irb has determined and documented at a convened meeting that the research involves no greater than minimal risk and no additional risks have been identified . core a ) if yes , warning an expedited review procedure consists of a review of research involving human subjects by the irb chairperson or by one or more experienced reviewers designated by the chairperson from among members of the irb alternative embodiments of the present invention include computer generated notices to users ( e . g ., curriculum builders ) that the knowledge - icb database has been updated and that information previously pulled or downloaded from the knowledge - icb database for course building , for example , may be outdated . system 10 will maintain the old version of the lesson 76 until all students complete the lesson 76 when topic 64 is updated in a rlo 52 that are part of a lesson 76 . further embodiments of the present invention can include identifying the particular course that contains the outdated information and identifying the students whom have taken test questions that relate to the outdated information . another embodiment of system 10 can be used by an organization to load their organization policies and procedures for electronic distribution and training of employees . for example , carlow university can access the knowledge icb 22 through ethassist web page 68 by selecting the carlow university button 232 on fig8 a . the subsequent web pages can be customized to meet the educational and training needs of the organization , where the organization can place its policies and procedures on knowledge icb 22 for exclusive use by its employees and other authorized personnel . the educational and training modules can be developed based on the techniques described above . yet another embodiment of system 10 can allow patients to directly access knowledge - icb 22 to educate themselves regarding healthcare ethics they are facing . a separate login screen , possibly through an insurance company web site , is provided for read - only access to ethics topics and other applicable topics . still yet another embodiment of system 10 can allow the general public to take specific lessons in curriculum builder 28 for continuing education units , for example for a subscription fee , pay for play transaction . while the disclosure has been described in detail and with reference to specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the embodiments . thus , it is intended that the present disclosure cover the modifications and variations of this disclosure provided they come within the scope of the appended claims and their equivalents . | 6 |
the principles of the present invention are now described with reference to fig1 to 5 . fig1 illustrates a particular signal constellation for 8psk in which the symbol mapping is arranged for one coded bit per symbol . in particular , a three - bit symbol ( v u c ) mapping that defines the 8 psk one coded bit per symbol is shown . the notation ( v &# 39 ; u &# 39 ; c &# 39 ;) is used further herein to indicate a symbol succeeding symbol ( vuc ), where it can be seen that v and v &# 39 ; represent the most significant bits and c and c &# 39 ; represent the least significant bits . each of the three - bit symbols corresponds to a particular carrier phase shift as shown in table 1 below : table 1______________________________________bits 000 001 010 011 100 101 110 111phase shift 0 ° 45 ° 90 ° 135 ° 180 ° 225 ° 270 ° 315 ° ______________________________________ it is apparent from fig1 that a 45 ° phase rotation leads to the following transformation as indicated in table 2 below : table 2______________________________________ 45 ° rotation transformation______________________________________c = 0 vuc → vu ( c ⊕ 1 ) c = 1 vuc → v ( u ⊕ 1 )( c ⊕ 1 ) if u = 0 vuc → ( v ⊕ 1 )( u ⊕ 1 )( c ⊕ 1 ) if u______________________________________ = 1 the same transformations hold for the primed symbol ( v &# 39 ; u &# 39 ; c &# 39 ;). the transformations in table 2 can be written as follows : for example , the symbol ( v u c )=( 101 ) becomes ( 110 ) after a 45 ° phase rotation , i . e ., u =( 10 ) decimal = 2 is transformed to u =( u + 1 ) mod [ 4 ]= 3 =( 11 ) decimal . referring now to fig2 a block diagram of an embodiment of a 45 ° phase invariant 8psk encoder is shown . the encoder comprises a pair of encoding assemblies 102 , 104 , a differential encoder 122 and a convolutional encoder 124 . the encoding assembly 102 includes a pair of multiplexers 106 , 112 and a pair of differential encoders 108 , 110 connected between the multiplexers . like - vise , the encoding assembly 104 includes a pair of multiplexers 114 , 120 and a pair of differential encoders 116 , 118 connected between the multiplexers . the differential encoder 122 has an output connected to an input of the convolutional encoder 124 . the differential encoders 108 , 110 , 116 , 118 , 122 are binary differential encoders of the type shown in fig3 . referring again to fig2 the convolutional encoder 124 is preferably a conventional rate 1 / 2 convolutional encoder , though it can also comprise a rate ( n / n + 1 ) convolutional encoder for punctured coding schemes . the encoding operation for rate 5 / 6 tcm for a set of information bits a 5n + k , where n ≧ 0 and 4 ≧ k ≧ 0 is now described . bit a 5n is input to differential encoder 122 and the output of encoder 122 is then encoded using the rate 1 / 2 convolutional encoder 124 . the coded bits output from the convolutional encoder 124 are designated as ( c &# 39 ; 5n c 5n ). bits a 5n + 1 , a 5n + 2 , a 5n + 3 , and a 5n + 4 are referred to as uncoded bits since such bits are not convolutionally encoded . the uncoded bits a 5n + 1 , a 5n + 2 , a 5n + 3 , a 5n + 4 are differentially pre - encoded by the encoding assemblies 102 , 104 to resolve the 45 ° phase ambiguity . more particularly , uncoded bits a 5n + 2 , a 5n + 4 are successively differentially encoded by the encoding assembly 102 while uncoded bits a 5n + 1 , a 5n + 3 are successively differentially encoded by the encoding assembly 104 . the output bits from the encoding assemblies 102 , 104 are denoted by v 5n , v &# 39 ; 5n and u 5n and u &# 39 ; 5n respectively . the three - bit symbols are constructed as ( v 5n u 5n c 5n ) and ( v &# 39 ; 5n u &# 39 ; 5n c &# 39 ; 5n ). it can be seen that each such three - bit symbol includes one coded bit per symbol , namely respective coded bits c 5n , c &# 39 ; 5n . from fig2 it can also be seen that the three information streams have different rates . for instance , if the information rate is denoted by inf -- rate , then the input bit rate of the a 5n path is equal ## equ1 ## and the input bit rate of the other two paths is equal ## equ2 ## therefore , the output bit rate on each of the three output paths is equal to ## equ3 ## the particular logic by which the encoding assemblies select among possible paths is now described . as shown in fig2 the multiplexers 106 , 112 , 114 and 120 have respective select inputs 106 - 1 , 106 - 2 , 112 - 1 , 112 - 2 , 114 - 1 , 114 - 2 , 120 - 1 , 120 - 2 . multiplexers 106 , 114 are conventional 1 : 2 multiplexers . multiplexers 112 , 120 are conventional 2 : 1 multiplexers . the signals that are presented on these select inputs include the uncoded bits u 5n , u &# 39 ; 5n and coded bits c 5n , c &# 39 ; 5n . in particular , for encoding assembly 102 , multiplexers 106 , 112 select a path from paths 108 - 1 , 108 - 2 and 110 - 1 , 110 - 2 according to the following logic : if {( c &# 39 ;= 0 ) c = 0 } or if {( c &# 39 ;= 1 ) c = 1 & amp ;( u &# 39 ;= 0 ) u = 0 } then path 108 - 1 , 108 - 2 is 10 selected . if {( c &# 39 ;= 1 ) c = 1 & amp ;( u &# 39 ;= 1 ) u = 1 } then path 110 - 1 , 110 - 2 is selected . for encoding assembly 104 , multiplexers 114 , 120 select a path from paths 116 - 1 , 116 - 2 and 118 - 1 , 118 - 2 according to the following logic : next , it can be seen that the differential pre - encoding provided by the encoding assemblies 102 , 104 indeed resolves any 45 ° phase ambiguity rotation . first consider that it is desirable to differentially pre - encode the bit that can flip ( 110 ) value when it is rotated by 45 °. as indicated in table 2 , the information bits are pre - coded as follows : 1 . bit c 5n always transforms to ( c 5n ⊕ 1 ). therefore , the information bit a 5n should always be differentially pre - encoded . 2 . the uncoded bit a 5n + 1 is differentially pre - encoded with the previous bits a 5m + 1 or a 5m &# 39 ;+ 3 , where m and m &# 39 ; are less than n , provided that c 5n = c 5m or c &# 39 ; 5n = c &# 39 ; 5m &# 39 ; , respectively . 3 . the uncoded bit a 5n + 3 is differentially pre - encoded with the previous bits a 5m + 1 or a 5m &# 39 ;+ 3 where m and m &# 39 ; are less than n , provided that c &# 39 ; 5n = c 5m or c &# 39 ; 5n = c 5m &# 39 ; , respectively . 4 . the uncoded bit a 5n + 2 is differentially pre - encoded with the previous bits a 5m + 2 or a 5m &# 39 ;+ 4 , where m and m &# 39 ; are less than n , provided that { c 5n = c 5m and u 5n = u m } or { c 5n = c &# 39 ; 5m &# 39 ; and u 5n = u &# 39 ; 5m &# 39 ; }, 5 . the other uncoded bit a 5n + 4 is differentially pre - encoded with the previous bits a 5m + 2 or a 5m &# 39 ;+ 4 , where m and m &# 39 ; are less than n , provided { c &# 39 ; 5n = c 5m or u &# 39 ; 5n = u 5m } and { c &# 39 ; 5n = c &# 39 ; 5m &# 39 ; or u &# 39 ; 5n = u &# 39 ; 5m &# 39 ; }, respectively . referring now to fig4 a block diagram of an embodiment of a 45 ° phase invariant 8psk decoder is shown . the decoder includes 8psk phase mapper 202 , branch metrics calculator & amp ; sector determination block 204 , a pair of decoding assemblies 206 , 208 , a viterbi decoder 226 , a convolutional encoder 228 and a differential decoder 230 . the decoding assembly 206 includes a pair of multiplexers 210 , 216 and a pair of differential decoders 212 , 214 connected between the multiplexers . likewise , the decoding assembly 208 includes a pair of multiplexers 208 , 224 and a pair of differential decoders 220 , 222 connected between the multiplexers . the differential decoder 230 has an input connected to the output of viterbi decoder 226 . the differential decoders 212 , 214 , 220 , 222 , 230 are binary differential decoders of the type shown in fig5 . referring again to fig4 the convolutional encoder 228 is a conventional rate 1 / 2 convolutional encoder or alternatively a rate n /( n + 1 ) convolutional encoder for punctured codes which also connects to the output of viterbi decoder 226 . phase mapper 202 receives signals that have been transmitted as 8psk signals as described above . the received signals are converted to quantized i and q components which are provided to branch metrics calculator & amp ; sector determination block 204 . block 204 provides sector values and branch metrics corresponding to estimates for v 5n , v &# 39 ; 5n , u 5n , u &# 39 ; 5n , c 5n , c &# 39 ; 5n , to the decoding assemblies 206 , 208 and viterbi decoder 226 . note that since the coding of the present invention provides 45 ° phase ambiguity resolution , a sector rotation is not required . a decoded bit estimate a 5n from viterbi decoder 226 is re - encoded by the convolutional encoder 228 to deduce bits c 5n and c &# 39 ; 5n . coded bits c 5n and c &# 39 ; 5n are used with decoding assembly 208 to differentially decode the bits u 5n and u &# 39 ; 5n , respectively . the bits v 5n and v &# 39 ; 5n are decoded in decoding assembly 206 using the bits { c 5n and u 5n } and { c &# 39 ; 5n and u &# 39 ; 5n }, respectively . thus , the decoder provides decoded bits a 5n , a 5n + 1 , a 5n + 2 , a 5n + 3 , a 5n + 4 . the particular logic by which the decoding assemblies select among possible paths is now described . as shown in fig4 the multiplexers 210 , 216 , 218 , 224 have respective select inputs 210 - 1 , 210 - 2 , 216 - 1 , 216 - 2 , 218 - 1 , 218 - 2 , 2241 , 2242 . multiplexers 210 , 218 are conventional 1 : 2 multiplexers . multiplexers 216 , 224 are conventional 2 : 1 multiplexers . the signals that are presented on these select inputs include the uncoded bits u 5n , u &# 39 ; 5n and coded bits c 5n , c &# 39 ; 5n . in particular , for decoding assembly 206 , multiplexers 210 , 216 select a path from paths 212 - 1 , 212 - 2 and 214 - 1 , 214 - 2 according to the following logic : if {( c &# 39 ;= 1 ) c = 1 } or if {( c &# 39 ;= 0 ) c = 0 & amp ;( u &# 39 ;= 1 ) u = 1 } then path 212 - 1 , 212 - 2 is selected . for decoding assembly 208 , multiplexers 218 , 224 select a path from paths 220 - 1 , 220 - 2 and 222 - 1 , 222 - 2 according to the following logic : while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
one embodiment of the apparatus has two components . an iol measurement means is used to characterize the optical properties of one or more iols and to determine the modulation of the wavefront of an image that is necessary to reproduce or emulate the optical properties of the iol once it is implanted in the patient &# 39 ; s eye following removal of the patient &# 39 ; s crystalline lens . the second component is an iol emulator means that recreates the optical properties of the iol for patient testing . in an alternative embodiment , the optical properties of the iol are provided elsewhere . fig1 shows three multi - focal iols a , b , c that are made by different manufacturers and that have different optical designs . three lenses are shown for exemplary purposes to illustrate the three major types of presbyopia correcting iols in use today ; refractive , diffractive , and accommodating . the instrument is not limited to emulating these types of designs and it may be used to measure and emulate new iol designs that are developed in the future . in addition , the instrument can be used to measure any number of designs of a given type but that vary in their design characteristics , dimensions , materials , and / or other properties . optical characterization means d , is used to characterize the optical properties of each iol , independently . such optical characterization means suitable for use in this apparatus are known . in a preferred embodiment , optical characterization means d may be a spatially resolved refractometer , a schack - hartmann wavefront sensor , or an atomic surface profiler . in addition to measuring the phase change imparted to an image by the iol , the change in image intensity and / or image intensity as a function of wavelength can be measured by a suitable device such as a spectrometer . following measurement with optical characterization means d , the optical properties of the iol may be described by a mathematical function e , for example by a zernicke series or a fournier transform series function . those skilled in the art are familiar with these , and other mathematical functions , that may be used to describe the phase changes , or modulation to the wavefront of light , that occurs as light passes through the iol . it is also known to those skilled in the art that the total phase change imparted to a wave of light by an iol is a function of both the shape of the front and back surfaces of the iol and the difference between the index of refraction of the iol and the index of refraction of the medium surrounding the iol . the index of refraction of a material is a ratio of the speed of light in a vacuum to the speed of light through the material . because the iol is designed to be implanted in the eye , and it is known that fluids in the eye that surround the iol have a refractive index of approximately 1 . 3 , appropriate correction factors can be applied to accurately determine the optical properties of the iol when it is implanted in the eye even though the measurements of the iol were made in air . fig2 - 4 show the iol emulation apparatus . the iol emulation apparatus consists of tower 1 , an examination chair 2 a , a viewport 3 which houses a reflective field mirror 4 and optional camera 4 a , and an operator control terminal 5 . the patient 1 a undergoing vision testing with iol emulator is seated in the examination chair seat 8 which is adjusted to place the patient &# 39 ; s eyes within the desired examination position noted by box 9 . images are generated by optical elements in the wavefront generator 10 and directed to a field mirror 4 in the viewport 3 where they are reflected to the patient &# 39 ; s eyes located within the desired examination position 9 . behind the patient , rear cabinet 1 houses a computer , a power supply , and other specialty electronics to control the wavefront generators 10 . images projected from the wavefront generators are reflected by field mirror 4 and viewed by the patient seated in the exam chair 8 . fig4 shows a perspective view of the examination chair 2 a of the iol emulator that is located adjacent , and forward of , the vertical tower 1 , and it is preferentially mechanically isolated from the tower 1 so that patient movements in the chair are not transmitted to the components in the tower . the examination chair has a seat portion 8 , the position of which is adjustable through motor means located in the base of the chair 11 that may be made responsive to the system computer . the seat back has a head rest 12 that may be adjustable through manual or by automatic means made responsive to the system computer . optional head restraint ( not shown ) may be deployed from the underside of optical tray 10 to aid in stabilizing the patient &# 39 ; s head during the exam . the examination chair has arm rests 13 , each of which has a platform 14 for supporting patient input means 15 . in one embodiment , the input means is a rotary haptic controller that the patient may rotate , translate , or depress to provide input to the system computer during the examination . suitable haptic controllers are manufactured by immersion technologies , san jose , calif . 95131 , and such controllers are particularly suited to providing intuitive input to the system during the exam . numerous other input devices are known , such as a mouse , a joystick , a rotary control , touch - sensitive screen , voice , and other control means , any of which may be employed as alternative embodiments . fig5 shows a top view of the wavefront generators for the right eye 18 and left eye 19 with the adjustable lenses and accessory lenses removed . display means for the right eye 20 and left eye 21 generate images . one suitable image generating means is model sxga oled - xl ™, made by emagin company , bellevue , wash . numerous other image generating means and modalities are known in the art including led , oled , dlp , crt and other means , any and all of which may be suitable for alternative embodiments . images generated by 20 and 21 pass through collimating lens 22 and 23 . collimated light of the images then traverses the stack of adjustable optical elements and accessory lens elements , shown in detail in fig6 , and described below , where they are redirected by beam turning mirrors 24 and 26 for the right eye , and by turning mirrors 25 and 27 for the left eye where they are then directed towards the field mirror 29 . the position and angle of turning mirrors 24 , 25 , 26 , and 27 can be made responsive to the system computer by actuator means ( not shown ) in order to direct the beam to the field mirror and to adjust the spacing between the left and right beam paths to that of the patient &# 39 ; s inter - pupillary distance , 28 . in a preferred embodiment , turning mirrors 24 , 25 , 26 , and 27 may be made responsive to an eye and / or gaze tracking system to aid in directing the beam along the desired path for patient testing . suitable adjustable lenses for use in the wavefront generators are lenses described by alvarez in u . s . pat . no . 3 , 305 , 294 . in general , these lenses are comprised of two elements , each surface of which may be described by a cubic polynomial equation and each element is a mirror image of its fellow element . it is known to those skilled in the art that the coefficients of the equations that define the shape of the alvarez lens elements may be optimized to improve their optical performance and to minimize undesirable aberrations , by , for example , using suitable optical design software such as zemax ( radiant zemax llc , 3001 112th avenue ne , suite 202 , bellevue , wash . 98004 - 8017 usa ). such modifications of the adjustable lenses are fully envisioned within the scope of the present disclosure . as the elements of the alvarez lens pairs are made to translate relative to each other in a direction that is perpendicular to the optical axis of the element , the optical power imparted to an image passing through them changes as a function of the translation distance . the lenses are mounted in surrounding frames and they are translated by actuator means such as , by example , control cables 18 a such that their motion is made responsive to the system computer . alternate lens actuation means are known in the art and are within the scope of the present disclosure . other types of adjustable lenses and mirrors are known in the art that may be used in the wavefront generator to modulate the wavefront of an image and they are considered to be within the scope of the invention . deformable mirrors that may be made responsive to a computer are known such as those manufactured by edmunds optics , 101 east gloucester pike , barrington , n . j . 08007 - 1380 . as an alternative embodiment , the adjustable alvarez lenses described above may be replaced by fixed lenses , by one or more deformable mirrors , or by any combination of fixed lenses , deformable mirrors , and alvarez lenses and remain under the scope of the present disclosure . another embodiment involves the use of one or a plurality of discrete lenses , disposed in a rack or other arrangement , and used to modulate the wavefront of the image . fig6 shows a more detailed view of the wavefront generator for the right eye showing the adjustable alvarez lens pairs and the accessory lens pairs 29 - 45 that are used to modify the wavefront of the image that is created by display means 20 . the identity of these lenses of one embodiment is listed in fig7 . in general , it is envisioned that the optical elements listed in fig7 will be selected to modulate the wavefront of an image in order to provide a full range of correction of refractive errors from − 20d to + 20d and astigmatic corrections up to , or beyond , 8d . in addition to providing spherical and cylindrical modulations to the wavefront , the lenses will be able to impart higher order aberrations to the wavefront including spherical aberration and comatic aberrations . as an alternative embodiment , the wavefront generator may utilize fixed and adjustable lens elements to impart spherical and cylindrical modulations to the wavefront , and employ deformable mirror elements to impart higher order aberrations to the wavefront of the image . phase plates , such as those prepared by lathing a pmma or other suitable optical material into the desired shape , may be inserted in accessory slots 29 , 30 , and 41 - 45 of the wavefront generator in order to impart additional modulations to the wavefront that are not imparted by the adjustable optical components in order to effectively emulate the wavefront modulation of the iol measured by the optical characterization system , d . fig3 shows a side view of the viewport 3 , that houses the field mirror 4 . in a preferred embodiment , the field mirror is round in shape and it has a spherical concave curvature with a radius of curvature approximately 2 . 5m and a diameter between 10 ″ and 24 .″ such mirrors are known in telescopic applications and a suitable mirror may be procured from star instruments , newnan , ga . 30263 - 7424 . alternative embodiments for spherical mirrors are known such as cfrp ( carbon fiber reinforced polymer ) spherical rectangular mirrors which may be procured from composite mirrors applications in arizona . alternative embodiments for the focusing system include the use of an aspheric mirror , a toroidal mirror , a mirror that is non - circular in shape , and a plano mirror . in a preferred embodiment , the radius of curvature of the mirror 4 corresponds to the approximate distance between the spectacle plane of the patient &# 39 ; s eyes ( at the nominal testing position 9 ) to the mirror , and from the center of the wavefront generator 10 to the field mirror 4 . it is known to those skilled in the art that an object located at a distance from a spherical concave mirror that is equal to the radius of curvature of the mirror , produces an image at a conjugate optical plane of the mirror with a magnification of one . because the adjustable lenses and the spectacle plane are located at optical planes that are conjugate with respect to the field mirror , the adjustable lenses will have the same effective power at the patient &# 39 ; s spectacle plane as they do in the wavefront generator . stated differently , the field mirror optically relays the adjustable lenses in the wavefront generator to , or near , the patient &# 39 ; s spectacle plane , while leaving the spectacle plane in front of the eye free of physical lenses or other instrumentation . operating the instrument at , or near , this condition of “ unity magnification ” is a preferred embodiment . however , it is known that changes in effective lens power that result from alvarez lenses imaged from the wavefront generator to the spectacle plane at non - unity magnifications may be compensated for by calibration tables and / or by adjusting the adjustable optical elements in wavefront generator 10 to correct for the operation of the device at such non - unity magnifications . such corrections may be made by the system computer automatically without the input by the operator . it is also known that only one location in the alvarez stack can be at the center of curvature along the optical axis of the mirror , and that some correction factor ( s ) must be applied to the lenses in the wavefront generator that are located adjacent the center of curvature . as shown in fig3 , a desk 5 a is provided to support the display terminal 5 used by the operator to provide control inputs to the computer and to receive displays from the device . operator input may be provided by conventional keyboard , mouse , or optional haptic means to control the iol emulator during the examination . these devices are connected to the system computer through conventional cable , fiber optic , or wireless means . fig8 shows inputs and outputs of the system computer 50 to different subsystems of the apparatus . camera 46 provides information to the patient position detector 49 , which provides input to system computer 50 . operator inputs 47 and patient inputs 48 are provided to the system computer . the system computer 50 receives inputs and provides outputs to database storage system 52 , which in a preferred embodiment may be transmitted through the internet 51 . the system computer 50 provides outputs to display drivers 55 which run the digital displays 57 and 58 , which in a preferred embodiment , may be organic light emitting diodes described above . the system computer 50 provides outputs to lens motion control system 56 which directs the actuators that drive the adjustable lenses for the right and left channels of the wavefront generators , 59 and 60 , respectively . the lens motion control 60 , also controls the positions of accessory lenses which may include phase plates that may be introduced into one or more of the accessory lens slots of the wavefront generator as shown in 29 , 30 and 41 - 45 , and described in more detail below . fig9 shows a side view of a preferred embodiment in which two wavefront generators per eye , four total , are included in the apparatus . for the right eye channels , the images of upper wavefront generator 61 and lower wavefront generator 62 are combined by beam combining element 63 and thereafter directed out of the wavefront generator towards field mirror 4 . as will be described below , a plurality of wavefront generators per eye allows for patients to view and compare the images produced by the emulated optical properties of iols of a different design on a side - by - side and simultaneous basis . fig1 shows a near - viewing display 64 of the focusing system of the apparatus . when the field mirror 4 is caused to redirect the path of the beam paths from 65 to 66 , mirrors ( not shown ) inside the near viewing display 64 redirect the beams to the patient &# 39 ; s eyes along paths 67 and 68 . the mirrors cause the images to diverge with respect to one another , and to appear to the patient in the exam chair as if they emerged from the viewing surface 73 of the near viewing display 64 . fig1 shows the patient &# 39 ; s right eye view of the viewport 4 and the surface of the near viewing display 73 . when an embodiment with two or more wavefront generators is employed , the patient is able to preview and compare images formed by emulation of wavefronts created by iol a and iol b on a side - by - side basis , at both near and distance viewing distances through the field mirror 4 and the surface 73 of the near viewing display 64 . the use of the apparatus to determine the optical characteristics of a plurality of iols and the emulation of the performance of those iols in a prospective implant patient will now be described . it is known to those skilled in the art that when opacities develop in the crystalline lens , the optical properties of the eye change , including the eye &# 39 ; s refractive and transmissive characteristics . because this disclosure envisions testing the eye before the crystalline lens has been removed during a cataract procedure , those skilled in the art will recognize that it is preferred to use the disclosed method and apparatus before the patient &# 39 ; s cataract has advanced to the point that the patient is unable to perceive the differences in image quality that different iols designs provide . three iols of three different designs are shown as a , b , and c in fig1 . the optical properties of each iol are measured by iol measuring means d , and these wavefronts are represented by mathematical functions e a , e b , and e c , respectively . these mathematical functions describe the three dimensional shape of a wavefront of light at a particular distance after it passes through the iol . suitable functions for describing this wavefront include a zernicke polynomial expansion series , a fournier function , or similar mathematical expressions . optionally , optical properties in addition to the phase change that are imparted by the iols can be measured , for example , the transmission of light as a function of wavelength and this information can be used to increase the fidelity of the emulation of the iol by the wavefront generator . it is known to those skilled in the art that the crystalline lens of the eye imparts primarily a positive spherical optical power . because the emulation of the iol &# 39 ; s properties with the apparatus is to be conducted in an eye that usually has a crystalline lens with its attendant spherical power intact , it is necessary to subtract the spherical component of the wavefront from the total measured optical power of the iols that have been measured and that are represented by functions e a , e b , and e c . in fig1 the subtraction of the spherical optical power from the total power measurement of the iols is shown as operation f , and this operation yields new mathematical functions e ′ a , e ′ b , and e ′ c . these functions represent the residual optical power of the iols after their spherical power has been subtracted . this value is referred to herein as the iol residual aspheric optical power . optionally , optical properties in addition to the phase change that are imparted by the iols can be added to the wavelength generator to increase the fidelity of the emulation of the iol by the wavefront generator . for example , an appropriate neutral density filter can be added to the wavefront generator to replicate the spectral transmission properties of a particular iol to be emulated . next , it is necessary to determine if the aspheric powers e ′ a , e ′ b , and e ′ c of the iols can be emulated by the adjustable optical components of the wavefront generator that are listed in fig7 . in general , for iols of refractive designs that have contiguous power transitions , it may be possible to emulate the iol power with a combination of adjustable alvarez lenses and deformable mirrors . however , for diffractive iols that employ fresnel optics and for refractive designs that have abrupt changes in optical power between zones , it may be necessary to procure a phase plate of pmma or other suitable optical material that , when placed in series with the adjustable optical elements in the wavefront generator will result in an accurate emulation of the optical properties of the iol . in general , the shape of the phase plate required can be determined by subtracting the closest - fit wavefront that can be generated by the adjustable lenses listed in fig7 from the residual aspheric power of the iol measurement , for example , e ′ a , e ′ b , and e ′ c , described above . once the necessary phase plate ( s ) has been procured , if required for the for the iol ( s ) to be emulated , the emulation of the iol in a prospective implant patient may proceed as described above . in an alternative embodiment , the actual iol to be emulated is placed into the wavefront generator by placing it in an appropriate containment holder and interposing it in the wavefront generator in the appropriate location , such as accessory slot 29 shown in fig6 . various embodiments of the apparatus allow placing the iol in air or in a suitable fluid . the adjustable optical elements in the wavefront generator 18 are first adjusted to neutralize the refractive errors of the patient &# 39 ; s visual system in the eye being testing . next , the adjustable optical elements in the wavefront generator are interposed in the beam path to emulate the optical properties of the iol as if the iol were implanted in the lenticular plane of the eye following removal of the eye &# 39 ; s crystalline lens . when an image produced by image generation means 20 traverses the wavefront generator 18 , and is focused by the field mirror 4 , it will appear to the patient as if the image passed through the iol after the iol replaced the patient &# 39 ; s crystalline lens . stated differently , to a patient viewing a distant object in mirror 4 , the object would appear as if light rays from the object passed through the iol after it was implanted in the patients eye , following removal of the eye &# 39 ; s crystalline lens . assessing the quality of vision for both near , distant , and intermediate viewing distances is desirable for patients to evaluate the performance of presbyopia - correcting iols fig1 shows the patient viewing near images in the apparatus . for near - image viewing , field mirror 4 is tilted down in order to re - direct the light beams from paths 65 to paths 66 , which causes them to pass through near - viewing assembly 64 . for near viewing , the adjustable spherical lenses in the wavefront generators 18 and 19 are adjusted to impart the appropriate divergence to the wavefront of the image that is associated with the near viewing distance . for example , to properly emulate the viewing of an image that emerges from the viewing surface 73 of near viewing assembly 64 when it is located 25 cm from the patient &# 39 ; s eyes , approximately − 4d of spherical lens power would be added to the pre - existing settings of the adjustable optical elements in the wavefront generator and this − 4d of divergence is then optically relayed to the patient &# 39 ; s spectacle plane by the field mirror as described above . to the patient , it will appear as if the image is emerging from the surface 73 of the near viewing assembly . in a preferred embodiment , the field mirror 4 is made responsive to an eye and gaze tracking system which receives inputs from camera ( s ) 4 a . when the eye and gaze tracking system detects that the patient &# 39 ; s gaze is directed downward to the viewing surface 73 of the near viewing assembly 64 , the field mirror 4 is tilted downward so that it redirects the beams from paths 65 to 66 , thereby causing them to pass through the near viewing assembly 64 . fig1 shows the patient &# 39 ; s right eye view of the field mirror 4 and the near viewing surface 73 of the near viewing assembly 64 . the wavefront generator 61 is producing image a through the necessary combinations of optical elements required to emulate the optical properties of iol a , and wavefront generator 62 is producing image b through the necessary combinations of optical elements required to emulate the optical properties of iol b . thus , the patient can preview , compare , and select the iol optics of either iol a or iol b that provides the best quality of image . these images may be compared simultaneously on a side - by - side basis . similarly , when viewing the near viewing surface 73 , images a and b are produced in a similar fashion by redirecting field mirror 4 and by adjusting the adjustable lenses in the wavefront generator to generate the appropriate divergence of light for the viewing distance of viewing surface 73 of the near viewing assembly 64 . by activating the wavefront generators for the left eye , a binocular comparison of images a and b can be attained . the disclosure above provides many useful inventive features over prior art methods . means are provided to characterize the optical properties of any iol , and to accurately emulate those optical properties in a prospective implant patient under realistic viewing conditions over near , intermediate , and far away distances . this allows the prospective implant patient to preview , compare , and select a particular iol design that they prefer based upon the patient &# 39 ; s subjective appraisal . unlike prior art methods , the present apparatus and method provide the ability to compare the performance of different iol designs over a variety of viewing distances under natural viewing conditions free of obstructing optical instrumentation . since a major benefit of a presbyopia - correcting iol design is to provide clear vision over the typical range of viewing distances , the device provides a useful means for the patient to test the performance of the iol design over the full range of viewing distances that the patient requires . another novel feature of the present apparatus and method is its ability for patients to assess the performance of various iol designs over a range of image illuminations , colors , and contrasts . by adjusting the output of the image projectors , patients can see how the different iol designs compare as illumination and contrast rises or falls and as colors change . no prior art method offers this ability . the novel capabilities provided by this device will allow doctors to determine which patients are good candidates for a presbyopia correcting iol , or other type of iol , and which are not , and it will provide information that is useful to select the particular type of iol that is most likely to provide the patient with the most satisfactory visual outcome . the emulation of iols of diffractive and refractive designs was described above . the actual accommodative amplitude of accommodating lenses can also be measured and emulated in the apparatus by adjusting the spherical power lenses in the wavefront generator when the patient views a near object . thus , the device has utility in its novel capability to characterize and emulate iols of existing and future designs , including iols that change in shape or position during the viewing of near objects . another novel feature is the ability to stabilize the image into the appropriate image plane by using an eye and gaze tracker . this relieves the patient of the need to hold still during the test and it facilitates a more realistic emulation of iol performance under natural viewing conditions . | 0 |
referring to fig1 a , 1 b , 2 a and 2 b , an injector fuel system 100 , in accordance with the invention , includes a fuel rail assembly 110 , at least one fuel injector 130 and , for each fuel injector , a coupling 150 . fuel rail assembly 110 includes a fuel distribution conduit 112 that may be , for example , an elongated tube as shown in fig1 or may be a non - round conduit . at least one injector socket 120 is assembled to conduit 112 to be in fluid communication with the interior of conduit 112 via an opening 114 , shown in a right - most position on the fuel rail in fig1 before socket 120 is attached to conduit 112 . fuel rail assembly 110 is connected to a typical fuel supply system ( not shown ). fuel rail assembly 110 is secured to cylinder head 116 by , for example , bolts 118 such that , through coupling 150 , each fuel injector 130 is precisely aligned with its associated cylinder / combustion chamber ( not shown ). injector socket 120 may include a cylindrical body 121 that is closed at one end 122 and that is open at an opposite end 123 for receiving fuel injector 130 . accordingly , injector socket 120 may have , but is not limited to , the shape of a cup as shown in fig1 . injector socket 120 may be straight sided as shown , or may include a flange ( not shown ) proximate to open end 123 . in one aspect of the invention , socket 120 includes a mating feature 126 , such as for example , opposing flatted sections 127 , disposed substantially 180 ° from one another , for rotationally positioning the injector relative to the cylinder head , which will be later described . fuel injector 130 includes a fuel inlet end 132 , a fuel discharge end 134 , and an overmold 136 surrounding a fuel tube 138 . fuel tube 138 communicates fuel through the injector from fuel inlet end 132 to discharge end 134 . overmold 136 is positioned such that fuel inlet end 132 of fuel tube 138 extends beyond an upper end 140 of overmold 136 for assembly into injector socket 120 . fuel tube 138 includes a circumferential groove 141 , having a width 142 , that is positioned adjacent the upper end 140 of overmold 136 . in one aspect of the invention , overmold 136 includes anti - rotation feature 144 extending from proximate circumferential groove 141 to beyond an outer surface 139 of overmold 136 . the width 145 of anti - rotation feature 144 is approximately equal to twice the radius 146 of the root surface 143 of circumferential groove 142 . during manufacture of the injector , anti - rotation feature 144 is indexed to features of the injector , for precisely orienting the injector , rotationally , to the cylinder head . while fuel injector 130 is illustrated as a fuel injector for gasoline direct injection , it may be any other type fuel injector . coupling 150 includes a retainer clip 152 and a collar 172 . retainer clip 152 paired with collar 172 enables a positive mechanical retention of fuel injector 130 to socket 120 even under relatively high separating loads . accordingly , fuel injector 130 is suspended from fuel rail assembly 110 via mechanical coupling 150 such that no hard , metal - to metal contact is necessary between fuel injector 130 and the cylinder head itself to secure the injector to the cylinder head . retainer clip 152 may take a shape generally of a boxed - u having leg portions 154 , substantially parallel to each other , and bridge portion 156 joining the leg portions 154 to form the boxed - u shape . referring to fig3 a and 3 b , leg portions 154 include lower sections 158 and upper sections 160 intermediate the lower sections and bridge portion 156 . in one aspect of the invention , lower sections 158 of retainer clip 152 each include a window 160 sized and positioned for close - fittingly receiving locating features in collar 172 to be described below . lower edge 168 of each window may include a slight curvature ( fig3 b ) for making point contact with the locating features . lower sections 158 are flat on their inside surfaces to snuggly engage mating features 126 of socket 120 , such as flats 127 , while , at the same time , bridge portion 156 engages closed end 122 of socket 120 , when the clip is assembled to collar 172 and socket 120 . upper sections 160 may depart from the planar surfaces of lower sections 158 , on an angle α as shown in fig3 a , in order to provide clearances 161 ( fig1 a ) between the section of socket 120 shown as 125 and clip 152 to assure that the clip is firmly in contact with the socket at flats 127 and closed end 122 . lower sections 158 may include chamfered or outwardly flanged ends ( not shown ) to facilitate assembly of the clip onto the socket and collar 172 . retainer clip 152 may be formed from sheet spring steel , such as by stamping . in its free state before assembly , width 162 across the lower sections 158 of retainer clip 152 may be slightly less than width 128 across socket flats 127 ( fig1 b ). in one aspect of the invention , bridge portion 156 may be slightly concaved ( not shown ), in the retainer clip &# 39 ; s free state . referring to fig4 , collar 172 is generally circular in shape on its periphery 174 . slot 176 of collar 172 defines central opening 178 having parallel edges 180 and radial inner end 182 for being received in circumferential groove 141 of fuel injector 130 . radius 184 of inner end 182 is equal to or slightly larger than radius 146 of the groove &# 39 ; s root surface 143 . width 186 of slot 176 is equal to or slightly larger than width 145 of anti - rotation feature 144 . thickness 188 of collar 172 is slightly less than width 142 of circumferential groove 141 . as such , referring to fig2 a , collar 172 fits snuggly into circumferential groove 141 of the fuel injector . when assembled into the groove , parallel edges 180 abut anti - rotation feature 144 of the injector thereby preventing the collar from rotating about the longitudinal axis 148 of the injector . in one aspect of the invention , one or more collar locating features such as tabs 190 project from periphery 174 and are indexed relative to slot 176 for precisely positioning fuel injector 130 axially and rotationally about its longitudinal axis 148 relative to its associated combustion chamber . in the embodiment shown , tabs 190 are located approximately 90 ° clockwise and counterclockwise ( as shown in fig4 ) relative to the center of slot 176 . collar 172 may be formed from a non - resilient cold - formable material , such as by stamping , and may be plated for corrosion protection . next , a sequence for assembling coupling 150 will be described . first , collar 172 is inserted into circumferential groove 141 of fuel injector 130 so that parallel edges 180 of slot 176 abut anti - rotation feature 144 and radial inner end 182 of slot 176 fits snuggly against root surface 143 of the circumferential groove . next , with tabs 190 aligned generally with socket flats 127 , the inlet end 132 of injector 130 is inserted into open end 123 of socket 120 until collar 172 abuts the open end 123 of the socket . finally , retainer clip 152 is slipped over the closed end 122 of socket 120 so that bridge portion 156 of the retainer clip contacts closed end 122 of the socket , lower sections 158 of the retainer clip firmly engage flats 127 of socket 120 and tabs 190 of collar 172 snap into windows 160 of the retainer clip . in one aspect of the invention , before retainer clip 152 is slipped over closed end 122 , the distance 164 between point 166 of bridge portion 156 of the retainer clip and edges 168 of windows 160 is slightly less than the dimension measured between the closed end 122 of socket 120 and a lower surface 192 of tabs 190 when collar 172 is abutted against the open end 123 of the socket . as such , when tabs 190 of collar 172 snap into windows 160 of the retainer clip after the retainer clip is in place , injector 130 is held firmly in place in its associated socket to withstand the separating loads originating from the relatively high fuel pressures of a direct injection fuel system . the coupling also provides for a load path centralized by bridge portion 156 and windows 160 of the retainer clip along the longitudinal axis 148 of the fuel injector and fuel rail socket . moreover , since the injector is precisely positioned axially and rotationally relative to its associated socket via anti - rotation feature 144 , tabs 190 , windows 160 and flats 127 , correct alignment of the injector relative to its associated combustion chamber in the cylinder head is readily maintained . as shown in fig4 , complementary mating features 194 may be incorporated in the collar and in the anti - rotation feature so that the collar may be installed to the injector and held in place by the mating features during injector shipment and prior to assembly of the injector to the fuel rail / engine . as can be seen in fig1 a , one coupling 150 is needed per fuel injector 130 . accordingly , coupling 150 may be utilized in an internal combustion engine employing two , four , six , eight , or any other number of cylinders . while coupling 150 may be especially useful for applications in fuel injection systems for direct injection , applications in fuel injection systems for port injection may be possible . while the locating feature in the collar and retention clip are shown as tabs and windows , respectively , it is understood that the mating features , in accordance with the invention , are not limited as such . while the mating feature on the socket is shown as a pair of flats located 180 ° from each other , it is understood that the mating features can be other types of indexing features and need not be 180 ° apart and , moreover , can be more or less than two . while the invention has been described by reference to various specific embodiments , it should be understood that numerous changes may be made within the spirit and scope of the inventive concepts described . accordingly , it is intended that the invention not be limited to the described embodiments , but will have full scope defined by the language of the following claims . | 5 |
a pattern defect inspection apparatus according to an embodiment of the present invention will be explained , referring to the accompanying drawings . fig7 shows the entire schematic diagram for a pattern defect inspection apparatus according to the present invention . the most different feature from a conventional pattern defect inspection apparatus is the addition of a parameter conditioner 9 , which will be explained later . before entering the explanation of the parameter conditioner 9 characteristic of the present invention , the entire apparatus will be described . in fig7 a photomask 10 is placed on a specimen carrier 4 , which is moved in the x and y directions by a table control circuit 8 receiving the instruction from a computer 6 . the coordinates of the specimen carrier 4 are measured with a positioning circuit 12 composed of a laser interferometer 11 , for example . located above the specimen carrier 4 is a light source 1 as a radiation section , which sheds rays of light on the photomask 10 . the transmitted light is introduced to the light receiving surface of the photodiode array 2 as a signal detector section . the photodiode array 2 consists of a plurality of photosensors arranged in one direction as shown in fig4 at reference character s . thus , by moving the specimen carrier 4 continuously , the photodiode array 2 detects an inspection signal ( measurement signal ) corresponding to the inspected pattern on the photomask 10 . this measurement signal , which is expressed as f ( x , y ) in two dimensions as shown in fig2 b , is sent to a data comparator circuit 3 . the design pattern data transferred from a magnetic disk device 13 undergoes various processes at the computer 6 . the processed design pattern data is transferred from the computer 6 to a bit pattern generator circuit 7 , in which the design pattern is expressed as p ( x , y ) by 1s and 0s as shown in fig2 a by dividing the design pattern data into pieces of data with suitable dimensions . conventionally , various problems arose because the dividing ratio was fixed . the data created at bit pattern generator circuit 7 is sent to the data comparator circuit 9 , which performs the process shown in fig1 to determine whether or not defects exist . as shown in fig8 the necessary part for inspection of the pattern data converted at the computer 6 is stored in the pattern memory 71 in the bit pattern generator circuit 7 . in this case , the symbolized data in the design pattern data is generated as basic data at the subsequent data generating circuit 72 . that is , as shown in fig1 , the symbolized data is generated into basic figure data including a quadrangle , a triangle , and a trapezoid . the generated data is sent to the dot pattern generator 73 , which expresses a figure corresponding to that in fig1 as a bit pattern of 1s and 0s based on the generated data it received . the specific figure is now defined as a bit pattern . the data fixed as a bit pattern is then stored temporarily in the bit pattern memory 74 , the output of which is supplied via the sorting circuit 75 so that the bit pattern generator circuit 7 may supply the output compatible to the input and output of the data comparator circuit 3 . the parameter conditioner 9 receives the inspection magnification δb , the magnification difference δb between the design data and the figure on the actual photomask 10 , and the scaling factor k , etc , from the computer 6 , and based on these parameters , changes the magnification in generating the design data into the figure data at the data generating circuit 72 . the change of the magnification causes the bit dimension of the bit pattern data based on the design data to be equal to the single pixel dimension of the sensor by multiplying the bit dimensions by one or by ( 1 / an integer ). the magnification changing is performed automatically on the basis of the above parameters β , δβ , and k . the operation of the data generating circuit 72 controlled on the basis of the above parameters will be explained . for example , if the bit pattern data ( the design pattern ) based on the design data is a quadrangle shown in fig1 , or the figure ( quadrangle ) defined by the information of the coordinates ( x 1 , y 1 ) with respect to the origin and the lengths δx and δy , the following expression holds for the dimension corresponding to the sensor pixel f ( p ): where n is an integer indicating the number of the pixel , n is counted up to represent the number of pixels . fractions , if any , are rounded off in a suitable manner such as rounding up numbers of five and above and rounding down anything under five . where at the position m = m in the y direction , n in a range of 1 to n 1 in the x direction is defined as 0 . then , n 1 is given by the following expression : where at the position m = m in the y direction , n in a range of n to n 1 in the x direction is defined as 1 , whereas n in the subsequent range is defined as 0 . with this definition , at the position m = m in the y direction , the figure ( quadrangle ) is defined with the 10 dimensions corresponding to the sensor pixel . following the similar procedures at m = m + 1 in the y direction produces the dot data for defining the figure equal to the sensor pixel . it is important to make f ( p ) equal to the sensor pixel . for example , if f ( p ) is changeable with the inspection magnification ( β ), the magnification difference ( δβ ) between the design data and the actual data , and the scaling factor ( k ), then f ( p ) will be expressed as : that is , f ( p ) is a function of β , δβ , and k . this value must be calculated in a way peculiar to each apparatus . in this way , bit data coinciding with the actual pixel dimension can be created by defining actual coordinate dimensions and obtaining pixel dimension changeable depending on various conditions . while in the above embodiment , a function of β , δβ , and k is used as f ( p ), the following functions f 1 ( p ), f 2 ( p ), f 3 ( p ), f 4 ( p ), f 5 ( p ), and f 6 ( p ) may be used : the bit pattern generator circuit of fig8 is composed of a known bit pattern generator circuit 7 and additional parameter conditioner 9 . as shown in fig9 the parameter conditioner 9 may be installed within the bit pattern generator circuit . that is , the bit pattern generator circuit 7 &# 39 ; incorporates an additional function of the parameter conditioner 9 . although in fig8 all the parameters ( β , δβ , k ) of the parameter conditioner 9 are controlled by the computer 6 , some of the parameters may be controlled by other devices . for instance , scaling k , included in the design pattern data , may be supplied from the pattern memory 71 to the parameter conditioner 9 . the technique of changing the aforementioned generated bit dimension to the desired value by a combination of the bit pattern generator circuit 7 and the parameter conditioner 9 is particularly important and has great versatility . thus , the technique will be discussed in further detail . as shown in fig1 , vector data 21 is stored in the computer 6 of fig7 or the disk device or memory in the other higher - level computer . vector data here is defined as a set of simple , basic figure elements such as segments , triangles , and quadrangles , which is obtained by analysis of the shape of a given figure . it also has vector information including the position , the size , and the direction of segment for each figure element . fig1 a shows an example of stored vector data 21 . the figure ( a trapezoid ) of fig1 a is divided into a right triangle figure element and a quadrangle figure element and then stored . they are expressed by the bit data as shown in fig1 b . the figure ( the trapezoid ) of fig1 a is defined as a set of basic figure elements as shown in fig1 . here , the figure elements indicated by α , β , and γ combine to form the figure of 12a . in fig1 , the figure elements indicated by α and γ are recognized as two different right triangles : α indicates a positive slope right triangle and γ represents a negative slope right triangle . the difference shows that each right triangle is in a different position with respect to the x - y coordinates . each figure element information includes coordinate information . the figure code contained in the figure element information in the vector data 21 is written into the figure code register 26 , whereas the ( x , y ) coordinates and the figure side lengths are written into the registers 22 , respectively . the parameter conditioner 27 converts the coordinates and dimensions specified in the vector data into memory addresses in the bit pattern memory 33 , and then writes them into x - coordinate register 28 , y - coordinate register 29 , and figure - side length registers 30 and 31 . in a write operation , the parameter conditioner 27 receives parameters from the higher - level computer to make the precise calculation of address allocation . the parameters here include the magnification of the image - forming system and the inspection mode as described above . then , the initial value in the y direction obtained by analyzing the figure code is set to the y - upper end counter 42 and the y - lower end counter 43 , each of which is composed of an up - down counter with a preset function . the recording format for basic figures is the same as in fig1 and 14 . in fig1 , if the figure code is triangle ( 1 ), both the y - upper end counter 42 and the y - lower end counter 43 have y as the initial value . if the figure code is triangle ( 4 ), both the y - upper end counter 42 and the y - lower end counter 43 have y + l 2 as the initial value . if the figure code is triangle ( β ), y + l 2 is set to the y - upper end counter 42 and y is set as the initial value to the y - lower end counter 43 . the figure element α of fig1 a has the figure code of 1 , causing both the y - upper end counter 42 and the y - lower end counter 41 to have y as the initial value . the x counter 41 of fig1 is preset with the contents of the x - coordinate register 28 as the initial value . the length in the x direction of the figure element is l 1 . the counter 41 counts up starting from the initial value and stops when reaching the initial value + l 1 . this completes the processing for a single figure element . in synchronism with the progress of the x counter 41 , the bit generating process proceeds while calculating the outline bits for the upper and lower ends of the parallel data in the y direction at the x position . the slope of a triangle is calculated using suitable rules , which are not necessarily special rules and may be any known suitable techniques . in dividing figure data into basic figure elements , several basic figures can be represented overlapping each other . to cope with this situation , when generated data is written into the bit pattern memory , the data for the address is read out once and then subjected to logical calculation with the data to be written in the read - modify - write process . in this embodiment , the existence of the bit pattern memory 33 is not essential . thus , in place of supplying data from the bit pattern memory 33 , data may be supplied directly from the computer or memory means . in this case , the parameter conditioner 27 calculates addresses in advance for the registers 28 through 31 , not for the bit pattern memory 33 . a second embodiment of a data generating circuit according to the present invention will be explained , referring to fig1 a through 17c . in cases where the position at which a figure element exists cannot be expressed by a form coinciding with a quantization unit ( bit ) address or where the outline of the figure element passes between quantization units ( bits ), allocation of a figure element to the bit pattern simply based on round - down calculation creates a figure as shown in fig1 c . when the pixel indicated by reference character s in fig1 a is observed with the sensor , the black portion is so small that the white portion occupies most of the area . when the observed value is compared with the design reference data , it is judged to be a defect because the reference data is a black pixel . to avoid this problem , correction is made in quantizing a figure element in bits by rounding off fractions less than one bit , as shown in fig1 c . this is achieved by the parameter conditioner . in this case , the design reference data corresponding to the observed value is a white pixel , resulting a proper comparison . as with the first embodiment , in writing the obtained bit pattern into the memory , it is necessary to take into account the overlap with the already generated figure . the following process may be used in place of the above round - off correction . in fig1 a , all the bits through which the outline of a figure element passes are divided into subpixels . specifically , as shown in fig1 , a single bit is further divided into subpixels 50 and based on the result of decision by majority regarding the white and black portions of the subpixels , correction of the outline is made appropriately as with rounding off . the process is applied to the pixels indicated by reference character s , for example . the subpixels 50 are 5 by 5 , for example . a third embodiment of a bit pattern generating circuit according to the present invention will be explained . in this embodiment , attention is given to the boundaries between figure elements in dividing a figure into figure elements . when figure elements are connected as a and d in fig1 a , the connecting portion can be discarded for each figure elements because each figure element undergoes an independent bit pattern generating process . if it is true , a gap of one bit interposes between two figure elements which are supposed to be connected according to the data . to overcome this problem , a circuit configuration shown in fig1 is used . for the data length of the bit pattern memory 33 , two bits are allocated to each array sensor pixel . although two bits can represent four states , only three states are used here following the conventional manner : the absence of bit is 0 , the presence of bit is 1 , and a fraction less than a bit rounded down is 2 . this causes the figure of fig2 a to be represented as shown in fig2 b . the second embodiment is different from this embodiment in that the memory data length is one bit and a fraction less than one bit rounded down is expressed as 0 . further , in the second embodiment , the address for the bit pattern memory 33 is obtained on the basis of the values from the x counter 41 and the y counter 42 , and then written directly into the address . in the third embodiment of fig1 , before new bit pattern data is written into the bit pattern memory 33 , the address to which the data is to be written into is read out . by comparing the read data with the data to be written into , a confirmation is made whether or not a figure is already written . the result of the confirmation is rewritten as the logic circuit 51 performs or operations . that is , in the previous bit pattern generation , with the data being 1 ( the presence of a bit ), if 0 or 1 is written into the desired address in the memory 33 , the data remains unchanged as 1 . on the other hand , in the previous bit pattern generation , if the data at the address in the memory is 0 ( the absence of a bit ), writing 1 into the address changes the contents to 1 . when the data to be written is 2 , or when data was rounded down in the previous bit pattern generation , the data 2 to be written into the corresponding address in the memory 33 is treated as normal data 1 . fig2 illustrates the relationship between the old and new data . this process eliminates one - bit gaps previously found between basic figure elements . in the second and third embodiments , two - way data transfer between the bit pattern memory 33 and the bit pattern generating circuit 32 is essential . the bit generator circuit 52 and the memory address recorder 53 , and the bus buffer 54 are used for the above - mentioned purposes . while in the first embodiment of the bit pattern generator circuit , the array sensor pixel dimension is matched with the design data bit dimension ( quantization dimensions ), the present invention is not restricted to this . for instance , design data is divided into pieces , which are then allocated to an integral multiple of bits for a single sensor bit . this technique may be applicable to each component in each embodiment . the results of bit generation obtained at the bit pattern generator circuit find the following applications : the bit generation results are displayed on the display device ; they are printed out for hard copy ; they are used in a pattern defect inspection apparatus ; and they may be used as a database of design data in a pattern defect inspection apparatus . a pattern defect inspection apparatus according to another embodiment of the present invention will be explained . in the aforementioned pattern defect inspection apparatus , with the sensor pixel dimension being constant , the design data pixel dimension is matched with the sensor pixel dimension without or with the design data pixel dimension being divided into an integral multiple of pieces . methods have been proposed which subdivide the sensor pixel dimension based on the calculation using the output from the sensor pixels to obtain seemingly narrower sensor pixels , and then perform comparison . one of them is disclosed in the precision exterior inspection of lsi wafer patters by local sliding pattern matching method in the electronic information communications society papers d - iii vol . j72 - dii no . 12 / december , 1989 pp . 2041 - 2050 by matsuya ma et al . such a method can be used with the method according to the present invention . what is essential here is that the finally compared sensor pixel dimension ( subdivided dimension , in this case ) coincides with or an integral number of times as large as the pixel dimension obtained from the design data . another embodiment of the pattern defect inspection will be explained . conventionally , there were cases where the rough mode and the precision mode were selectively used for individual substrates being inspected . one reason for a different inspection accuracy is that masks or reticles have different minimum line widths for integrated circuits to be formed . a more basic reason is that each substrate has a different production accuracy . the change between the rough mode and the precision mode is achieved by changing the magnification of the object lens . the object lens , however , involves errors due to the varying magnification , resulting in a problem described in the related art . since the design data corresponds to each substrate , it is possible to adjust the inspection accuracy for each substrate . however , it was difficult to change the inspection accuracy while inspecting the same substrate . to change the inspection accuracy , it is necessary either to change the magnification of the object lens or to vary the apparent sensor pixel dimension by interpolation as described in the above literature . conventionally , there was no means for changing the design data pixel dimension according to the sensor pixel dimension , making it difficult to inspect a substrate while changing the inspection accuracy . as a result , it was a common practice to inspect a single substrate in the same mode . however , in the present invention that allows the design data bit dimension to be changed to the desired value , for a single substrate , it is possible to make the design data bit dimension more precise for the precision mode inspection or make it rougher for the rough mode inspection . such changes of the inspection mode and design data bit dimension are accomplished by the change of the projection magnification . conventionally , inspecting the entire substrate in the precision mode to increase the inspection accuracy took a long time for inspection even though there were portions to which the rough mode was sufficient . in another case , shortening the inspection time results in poor inspection accuracy . the present invention provides perfect solutions to these problems , assuring the desired inspection accuracy as well as the shorter inspection time . as described above , a method for allowing use of the rough and precision modes for a single substrate according to the present invention enables the substrate edge portions to be inspected in the rough mode and the internal circuit portions to be inspected in the precision mode . thus , even elements in which integrated circuit elements of various dimensional accuracy are packed in the same substrate such as asics can be inspected with a high accuracy at a high speed . as explained in detail , according to the present invention , when a figure ( pattern ) is generated into a bit pattern , the dimension of a single pixel can be set to a given value . therefore , the application of the present invention to the pattern defect inspection ensures the elimination of spurious defects and a great improvement in the inspection accuracy . by correcting fractions less than a pixel resulted from the generation of a figure ( pattern ) into a bit pattern under specified conditions , the figure can be generated into a bit pattern that most closely reflects the original figure ( pattern ). therefore , the application of the present invention to the pattern defect inspection ensures the elimination of spurious defects and a great improvement in the inspection accuracy . when at least two figures are connected in generating a figure ( pattern ) into a bit pattern , the rounding down of the fractions at the boundary portions of the at least two figures can be prevented . therefore , the application of the present invention to the pattern defect inspection ensures the elimination of spurious defects and a great improvement in the inspection accuracy . further , the present invention allows the change of inspection accuracy for a single substrate , ensuring the elimination of spurious defects and a great improvement in the inspection accuracy . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details , representative devices , and illustrated examples shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents . | 6 |
the objective of fig1 to 10 is to illustrate certain concrete aspects of the invention , without wishing to restrict the scope thereof in any way . the objective of fig1 to 4 is to illustrate the principle of a process according to a variant of the invention ; fig5 and 6 illustrate a 1 st subvariant of this process variant ; fig7 to 9 , a 2 nd subvariant ; and finally , fig1 and 11 , a 3 rd subvariant . the objective of fig1 to 15 is to illustrate the process in an additional variant of the invention . 1 : a mould comprising two cavities ; 2 : a noise reduction baffle ; 3 : a support for the baffle ; 4 : parts that move in the cavities ; 5 : a parison ; 6 : a device for separating and guiding the parison ; and 7 & amp ; 7 ′: a lower sealing device of the parison comprising an inner block ( 7 ) and two outer moving parts ( 7 ′). in fig1 , it can be seen how the device ( 6 ) guides the parison ( 5 ) in order to introduce it around the baffle ( 2 ) while keeping it open / apart . the baffle ( 2 ) has been previously loaded onto a support ( 3 ). this device is operated by a robot and stops underneath the sealing device ( 7 , 7 ′) as illustrated in fig2 . the mould cavities have an internal surface ( 1 ′) that corresponds to the external surface of the tank to be moulded . in fig2 , it can be seen how the inner block ( 7 ) makes it possible to separate the parison and to avoid contact between the baffle and the parison , and how the outer parts ( 7 ′) clamp the parison ( 5 ) to this block ( 7 ) so as to carry out a pre - blow moulding in a leaktight manner using the extrusion head ( not represented ), to which the parison is still attached . in fig3 , the mould ( 1 ) can be seen in an intermediate closure position which is such that the moving parts ( 4 ) have locally pushed the parison to bring it into contact locally with the baffle ( 2 ). once the points of contact ( welding in this variant ) are produced , the baffle support ( 3 ) may be withdrawn ( it is moreover no longer represented in this figure ) and it is possible to close the mould ( 1 ) for the final moulding of the tank . during the closure , the moving parts ( 4 ) retract inside the mould ( although they are immobile in absolute terms and keep the welding spots under pressure ) and become flush with the surface of the cavities ( 1 ). the blow - moulding needles ( represented as dotted lines ) then pierce the parison to carry out the blow - moulding operation . the mould is shown closed in fig4 , where it can be seen that the mould cavities are placed side by side over their perimeter . when the assembly has been cooled , the tank may be demoulded . the baffle illustrated in fig1 to 4 is a “ conventional ”, voluminous and incompressible baffle . the use of a baffle that has large dimensions when in service may be facilitated ( reduction in the risk of contact between the parison and the baffle before blow moulding ) when the baffle is compressible ( i . e . has larger dimensions when in service , in the tank , than when it is inserted into the parison ). this is illustrated by 3 subvariants in fig5 to 10 . in a 1 st subvariant that is the subject of fig5 and 6 , the baffle ( 2 ) comprises drawers ( 21 ) which are closed throughout the manufacture of the tank ( fig3 ), and which are opened ( manually or automatically ; cf . fig4 ) during a subsequent finishing step and this being carried out through one or more orifices . these may be openings for pump / gauge module ( s ) which are cut out on the finishing line and the location of which is indicated in fig3 by two solid arrows . in a 2 nd subvariant that is the subject of fig7 to 9 , the baffle ( 2 ) is in fact composed of two separate parts ( 22 , 23 ) which are each supported by independent supports ( 3 ′, 3 ″) which are positioned side by side until the pre - blow moulding of the parison ( see fig7 ) and which are separated ( see fig8 ) before attachment of the baffles ( 22 , 23 ) by the moving parts ( 4 ) ( see fig9 where horizontal arrows show the movement of these parts and vertical arrows show the withdrawal movement of the supports ). in a 3 rd subvariant that is the subject of fig1 and 11 , the baffle ( 2 ) is composed of a foldable structure , a radial view ( through a plane perpendicular to the axis of the parison ) of which is illustrated in fig1 . this structure comprises two end zones ( 24 , 25 ) which act as points of compression for the moving parts ( 4 ) of the mould during step c ) or even during the subsequent closure of the mould . this is illustrated by the central arrows in fig1 , which represents an axial cross section of the moulded tank with its walls “ ghosted out ”. the closure of the mould ( not represented ) creates additional attachment points ( illustrated by the side arrows in fig1 ). in order to avoid shell damage during burst / drop test ( and of course , in real life , in the case of crash ), it is prefeable to provide at least one weak point ( notch ) around the weld zones ( i . e . the points where the baffle and the tank are joined by the moving part inside the mould ). according to a preferred embodiment , the weld zones are equipped with weld feet and there is a break zone ( weak point ) provided between said weld feet and the body of the accessory so that in the case of drop / crash , the accessory can eventually be detached from the tank without damaging it . such a feature is for instance disclosed in patent application us 2003 / 0201021 , the content of which is incorporated by reference into the present application . also , since the accessory is generally cold when it is attached to the molten parison and since said parison generally retracts afterwards during cooling , it is preferable to provide the accessory with an appropriate design so that said retraction does not damage the tank and / or break the above mentioned break zones ( weak points ). providing parts in the accessory with an appropriate thickness and shape so that they are flexible and can easily be deformed , gives good results . fig1 illustrates the above mentioned features , namely : weld feet ( 26 ), a notch zone ( 27 ) and parts with improved flexibility ( 28 ). the support 100 of fig1 is fork - type support , i . e . it comprises a trunk 102 and two branches 104 and 106 . each branch 104 , 106 is able to hold an accessory ( not shown ) for its insertion into the parison before blow molding . the support 200 of fig1 is a branch - type support . it comprises a trunk 202 and three branches 204 , 206 and 208 . each branch 204 , 206 , 208 is able to hold an accessory ( not shown ). the support 200 is used in the blow molding process illustrated by fig1 . the support 200 is placed between two cavities 300 , 302 . each cavity 300 , 302 is able to move transversally ( direction d ) to open and close the mold . each branch of the support holds an accessory : branch 204 holds an anti - slosh - noise baffle 400 , branch 206 holds a valve 402 and branch 208 holds another anti - slosh - noise baffle 404 . the cavities include moving pins 304 , 306 for carrying out a fixation process between each accessory and the parison . indeed , depending on the fixation process selected , it may be required that the plastic material forming the parison be pushed back in a recess of the accessory for reliable mechanical connection between them . as shown on fig1 , at the beginning of the process , the support 202 holding the three accessories 400 , 402 and 404 is placed between the mold cavities 300 and 302 . the cavities are moved towards each other and the mold is closed with the parison ( not shown ) around the support and accessories . during the closure , the moving pins 304 , 306 retract inside the mold ( although they are immobile in absolute terms and keep the welding spots under pressure ) and become flush with the surface of the cavities . then , the parison is blown to conform it to the mold and the moving pins are moved towards the parison to push some plastic material against the accessories . once the fixation of each accessory ( anti - slosh - noise baffles 400 and 404 , valve 402 ) to the parison is done , the mold cavities are moved backwards and the support 202 is withdrawn from between the mold cavities . the support 202 is able to support more than one accessory or component , such that several accessories or components can be inserted into the parison . in this case , independent supports as in fig7 - 9 can be avoided . | 1 |
in the present application , the term “ proximal ” refers to a direction that is generally towards a physician during a medical procedure , while the term “ distal ” refers to a direction that is generally away from the medical professional and / or towards a target site within a patient &# 39 ; s anatomy during a medical procedure . referring now to fig1 to 2 , an embodiment of a medical device 20 is depicted for forming an anastomosis , such as during an endoscopic procedure . as will be discussed herein , the medical device 20 serves to clamp the tissue surrounding an anastomosis , hold it open , as well as facilitate enlargement of the anastomosis . the medical device 20 generally includes a first clamp 30 and a second clamp 40 defining a lateral axis 70 and a longitudinal axis 72 , positioned opposite each other along the lateral axis 70 , i . e ., opposite each other relative to the longitudinal axis 72 . the first clamp 30 has a first exterior clamp member 32 and a first interior clamp member 34 . the first exterior and interior clamp members 32 and 34 connect to each other via intermediate portions 22 . the second clamp 40 has a second exterior clamp member 42 and a second interior clamp member 44 , and the second exterior clamp member 42 connects to the second interior clamp member 44 via the intermediate portions 22 . as depicted , the exterior and interior clamp members have a general u - shape , although they could be v - shaped , semi - rectangular in shape , or any other semi - annular shape . as depicted , the interior clamp members are located concentrically within the exterior clamp members along the lateral axis 70 . as depicted in fig1 , the medical device 20 is in a deployed state wherein the exterior clamp members 32 and 42 and the interior clamp members 34 and 44 of the first clamp 30 and the second clamp 40 are coplanar . coplanar as used herein means perfectly planar and +/− 30 degrees away from perfectly planar . fig2 depicts the medical device 20 in the delivery state wherein the exterior and interior clamp members 32 , 42 , 34 , and 44 have rotated out of plane toward the longitudinal axis 72 so that the first exterior clamp member 32 is adjacent to the second exterior clamp member 42 and the first interior clamp member 34 is adjacent to the second interior clamp member 44 . the clamp members typically will rotate about 60 ° to about 110 ° degrees away from the lateral axis 70 . in the embodiment shown in fig1 and 2 , the clamp members are biased toward forming the deployed state as depicted in fig1 . the medical device 20 is shown as being formed of a flat metal — preferably nitinol — having a round or rectangular ( flat ) cross - sectional shape , although other constructions may be employed ( e . g ., a round wire ). preferably , the metal has a thickness in the range of about 0 . 001 to about 0 . 1 inches , and more preferably from about 0 . 008 to about 0 . 028 inches . for example , the medical device 20 , or the clamp members individually , may be comprised of other metals , metal alloys , plastics , or other materials that have suitable resiliency , whereby the clamp members can move according to the natural or imposed shape - memory characteristics of the clamp members . the medical device 20 , or the clamp members individually , may also be comprised of resorbable or degradable materials , but preferably the material would not substantially degrade or lose structural integrity until formation of the anastomosis was complete . as used herein , resorbable refers to the ability of a material to be absorbed into a tissue and / or bodily fluid upon contact with the tissue and / or bodily fluid . a number of resorbable materials are known in the art , and any suitable resorbable material may be used . examples include resorbable homopolymers , copolymers , or blends of resorbable polymers . as used herein , degradable refers to the ability of a material to dissipate upon implantation within a body within a clinically reasonable amount of time , independent of the mechanisms by which dissipation can occur , such as dissolution , degradation , absorption and excretion . a number of degradable materials are known in the art , and any suitable degradable material may be used . examples include polyethylene , polypropylene and polyoxypropylene glycolic sugars , as well as polylactic sugars . in addition , the medical device 20 is shown as comprising one solid piece of metal . in alternative embodiments , the intermediate portions 22 may be fastening devices known in the art , such as hinges , springs , or other rotatable couplings known in the art . in these embodiments , the clamp members need not have shape - memory characteristics . moreover , while the first and second clamps 30 and 40 make up one unitary device as depicted in fig1 and 2 , the medical device 20 may comprise two separate clamp members ( not shown ), or it may comprise four separate clamp members ( not shown ). referring again to fig1 , an interior space 74 exists between the exterior clamp members and the interior clamp members . the distance s between the exterior clamp members and the interior clamp members may range from about 0 to about 8 mm . a second interior space 76 exists between the first and second interior clamp members 34 and 44 . the horizontal distance d between the two intermediate portions 22 may range from about 0 to about 25 mm , and the lateral distance l from the first interior clamp member 34 to the second interior clamp member 44 may range from about 5 mm to about 50 mm . a medical apparatus 66 for forming an anastomosis will now be described with reference to fig3 a to 5 . the medical apparatus 66 includes a medical device for forming , creating , and maintaining an anastomosis , an elongate member for delivering the medical device , and , optionally , a tubular cap for retaining the medical device on or near the elongate member . according to one embodiment shown in fig3 a , the medical device 20 is shown loaded within a tubular cap 64 and adjacent to a distal end 62 of an elongate member , in this case an endoscope 60 . the endoscope 60 may be any type of scope known in the art , or may alternatively be any flexible elongate member suitable for being inserted into the body for therapeutic purposes . the medical device 20 is held in the delivery configuration by the tubular cap 64 . in this embodiment , a control wire 61 is passed through an accessory channel 65 and is connected to a pusher 63 . the control wire 61 in combination with the pusher 63 is used to move the exterior clamp members 32 and 42 distally beyond the distal end 67 of the tubular cap 64 so that the exterior clamp members 32 and 42 may be released into their deployed states . the control wire 61 and pusher 63 are then further extended to deploy the interior clamp members 34 and 44 . alternatively , the medical device 20 could be loaded into the endoscope 60 itself , and the endoscope 60 would maintain the medical device 20 in the delivery configuration . referring now to fig4 , the medical device 20 has been inserted distally through a first stoma 52 in a first bodily wall 50 ( e . g ., the stomach ) and through a second stoma 58 in a second bodily wall 56 ( e . g ., the small intestine , and typically , the jejunum ) to rest within the interior 57 of the second bodily wall 56 . in this embodiment of the apparatus , the control wire 61 and pusher 63 have been advanced by the clinician in the distal direction , thereby moving the exterior clamp members 32 and 42 beyond the distal end 67 of the tubular cap 64 and allowing the exterior clamp members 32 and 42 to move to their deployed states . releasing the exterior clamp members 32 and 42 into their deployed states causes the exterior clamp members 32 and 42 to exert pressure on the interior surface of the second bodily wall 56 . referring now to fig5 , the apparatus 66 has been retracted so that the second bodily wall 56 is brought proximate to the first bodily wall 50 , and the interior clamp members 34 and 44 are located proximal to the first bodily wall 50 . the control wire 61 and pusher 63 are further extended , thereby releasing the interior clamp members 34 and 44 into their deployed states , causing the interior clamp members 34 and 44 to exert pressure on the interior surface of the first bodily wall 50 . alternatively , or in conjunction with the control wire 61 , the whole apparatus 66 can be pulled proximally and the tension of the exterior clamp members 32 , 42 on the second bodily wall 56 can pull the interior clamp members 34 , 44 out of the tubular cap 64 by overcoming the friction therebetween . the medical device 20 could also be loaded such that interior clamp members 34 and 44 are located distal to the exterior clamp members 32 and 42 such that the interior clamp members 34 and 44 are deployed within the interior 57 of the second bodily wall 56 , and the exterior clamp members 32 and 42 are deployed within an interior 51 of the first bodily wall 50 ( not shown ). there are alternative ways to facilitate the deployment of the medical device 20 within the two stomas 52 and 58 . one embodiment is depicted in fig3 b . in this embodiment , a tether is used to move the medical device 20 distally out from the tubular cap 64 . the tether may be a suture or strap or other material known in the art , and may be affixed to the medical device 20 via knots , catches , enlargements , by tying it , or through other means known in the art , or may merely be located adjacent to and engaged by friction between the medical device 20 and the tubular cap 64 . in the embodiment depicted in fig3 b , the tether is a suture 69 tied to the medical device 20 . when the clinician pulls the suture 69 proximally , the medical device 20 is moved distally so that exterior clamp members 32 and 42 are no longer constrained by the tubular cap 64 , thereby allowing them to move to their deployed states . pulling further proximally on the suture 69 causes the interior clamp members 34 and 44 to move to their deployed states once they are no longer constrained by the tubular cap 64 . the suture may then be excised by the clinician via a cutting device advanced through a working lumen ( not shown ) in the endoscope 60 . referring now to fig6 - 9 , alternative embodiments of the medical device and the tubular cap are shown . fig6 depicts an alternative embodiment of the medical device 20 ′. in medical device 20 ′, the exterior and interior clamp members 32 ′, 42 ′, 34 ′, and 44 ′ rotate at locations further away laterally from the intermediate portion 22 ′ than the exterior and interior clamp members 32 , 42 , 34 , and 44 do from intermediate portion 22 in medical device 20 . this difference in rotation allows the medical device 20 ′ to better fit within the retractable cap 73 depicted in fig7 and the tubular cap 83 depicted in fig9 . fig7 depicts an embodiment of the tubular cap 64 wherein the tubular cap 64 is a retractable cap 73 . the retractable cap 73 is comprised of a fixed end portion 75 and a retractable hood 77 that is slidably mounted on the exterior of the fixed end portion 75 . the retractable hood 77 contains two control wings 86 opposite each other that maintain the exterior clamp members 32 ′ and 42 ′ in their delivery configurations . the retractable cap 73 may be placed on an endoscope 60 , or it may be placed on a separate elongate member , such as a catheter , that runs alongside the endoscope 60 either freely or on a wire guide ( not shown ). two external drive wires 79 are attached to the retractable hood 77 . referring now to fig7 - 8 , a clinician may pull proximally on the drive wires 79 , which will move the retractable hood 77 proximally , and will release and deploy the exterior clamp members 32 and 42 . the interior clamp members 34 and 44 may be released and deployed either by pushing the medical device 20 in the distal direction , for example by using a control wire 61 and pusher 63 as discussed above , or by pulling the endoscope 60 away in the proximate direction . referring now to fig9 , another embodiment of the tubular cap 64 is shown . fig9 depicts a tubular cap 83 with grooves 81 contained on the interior of two control wings 86 ′. the control wings 86 ′ maintain the exterior clamp members 32 ′ and 42 ′ in the delivery configuration . the grooves 81 better allow a tether to be used in conjunction with the tubular cap 83 by holding the tether in place . alternatively , a perfectly cylindrical cap may be used as depicted in fig3 a - 5 . other shapes and designs may be used and will be known to those of skill in the art . a medical method for creating an anastomosis will now be described with reference to fig3 a - 5 , and 11 - 12 . before fully deploying the medical device 20 to create an anastomosis , stomas must be created in the desired viscera , and the stomas must be brought within proximity of each other . one way to achieve this goal would be to load the medical device 20 within a tubular cap 64 at the distal end 62 of an endoscope 60 as depicted in fig3 a - 5 , and then advance the endoscope to the first viscera . a cutting device ( not shown ) could be advanced through a working lumen of the endoscope 60 and could be used to create the first stoma 52 in the first bodily wall 50 of the first viscera . the endoscope 60 could be further advanced to the second viscera , and the cutting device could be used to create the second stoma 58 in the second bodily wall 56 . the exterior clamp members 32 and 42 could be deployed as described above , and then the medical device 20 , endoscope 60 and tubular cap 64 , and the second bodily wall 56 could be retracted toward the first stoma 52 in the first bodily wall 50 . once the medical device 20 is properly positioned such that the interior clamp members 34 and 44 are located proximal to the first bodily wall 50 , the interior clamp members 34 and 44 could be released as described above and the anastomosis would be created . the stomas may also be created and brought into proximity with one another prior to insertion of the medical device 20 . there are numerous ways of achieving this that are known in the art , some of which are described in u . s . nonprovisional application ser . no . 12 / 025 , 985 , filed feb . 5 , 2008 , which is incorporated by reference herein in its entirety . laparoscopic surgery or open surgery and devices used in those types of surgeries may also be employed to create the stomas and to hold them in place proximal to each other to prepare for the insertion of the medical device 20 . once the stomas have been created and the medical device 20 has been deployed via the elongate member as described above and depicted in fig3 a - 5 , the force exerted by the interior clamp members 34 and 44 against the first bodily wall 50 and the force exerted by the exterior clamp members 32 and 42 against the second bodily wall 56 compress the two bodily walls and hold them proximate to each other . the compression exerted on the bodily walls by the exterior and interior clamp members will result in necrosis of the tissues of the two viscera that are contained between the clamp members , thus resulting in an even larger anastomosis after a few days or a week , depending on the thickness of the tissues and the strength of the material used for the clamp members . if a larger anastomosis is immediately desired , a knife or other cutting device may be used to excise the tissue from the two bodily walls by cutting from the interior 80 laterally toward the apex of the first interior clamp member 34 to create a larger opening 82 as depicted in fig1 . additionally , an incision may be extended laterally from the interior 80 to the apex of the second interior clamp member 44 to form a second larger opening 84 , so that one large , continuous anastomosis is now formed . an alternate method for creating an anastomosis will now be described with reference to fig4 - 5 , 10 and 13 . in this method , a gastronomy would be created as described above , and then two screw retractors 110 attached to torque cables 112 would be advanced through the first stoma 52 of the first bodily wall 50 and anchored to the proximal side of the second bodily wall 56 on either side of the second stoma 58 as depicted in fig1 . the clinician would then remove the endoscope 60 , leaving the anchored screw retractors 110 and torque cables 112 extending proximally and exiting the patient &# 39 ; s mouth . the medical device 90 , which as depicted in fig1 is substantially identical to medical device 20 except that it has been modified to include two large holes 100 to fit over the torque cables 112 , would then be constrained in a delivery state similar to the delivery states of medical device 20 depicted in fig2 and medical device 20 ′ depicted in fig6 . the length l ′ between first interior clamp member 98 and second interior clamp member 94 ranges from about 5 mm to about 50 mm , and the horizontal distance d ′ ranges from about 0 mm to about 25 mm . as depicted in fig1 , a suture 114 is advanced through holes 102 to keep the interior clamp members 98 and 94 adjacent to each other in the delivery state , and another suture 116 would be advanced through holes 104 in first exterior clamp member 96 and second exterior clamp member 92 to hold them adjacent to each other in the delivery state and located distally to the interior clamp members 98 and 94 . it would be known by those of skill in the art that rings , bands , or other materials may be used in place of the sutures 114 and 116 . the medical device 90 in the delivery state is loaded on to the torque cables 112 by inserting the proximal end of the torque cables 112 through the large holes 100 in the medical device 90 . referring still to fig1 , the medical device 90 would then be advanced over the torque cables 112 through the first stoma 52 until the exterior clamp members 96 and 92 have advanced through the second stoma 58 . the clinician may optionally pull proximally on the torque cables 112 in order to pull the tissue of the second bodily wall 56 proximate to the exterior clamp members 96 and 92 . the clinician will then release the exterior clamp members 96 and 92 by pulling on or excising the suture 116 , thereby causing the exterior clamp members 96 and 92 to deploy and exert pressure on the interior surface of the second bodily wall 56 . the clinician will then pull proximally on the torque cables 112 until the second stoma 58 is adjacent to the first stoma 52 and the interior clamp members 98 and 94 are proximate to the first stoma 52 . the clinician will then release the interior clamp members 98 and 94 to their deployed states in the same manner in which the exterior clamp members 96 and 92 were released , causing the interior clamp members 98 and 94 to exert pressure on the interior surface of the first bodily wall 50 . the clinician then removes the screw retractors 110 and the torque cables 112 by pulling them proximally away from the newly formed gastronomy . removal of the medical device 20 , medical device 20 ′, or medical device 90 may be completed through natural means . the pressure exerted on the bodily walls 50 and 56 will cause necrosis over a number of days , thereby forming an anastomosis that is slightly larger than interior 80 or interior 80 and openings 82 and 84 combined . after a certain amount of necrosis occurs , the medical devices 20 , 20 ′, and 90 will dislodge and pass through the body naturally . or , the medical devices 20 , 20 ′, and 90 may be made of degradable or resorbable materials so that it will be naturally broken down by the body . it will be recognized by those skilled in the art that during these anastomosis formation procedures , the area of compression of the bodily walls 50 and 56 provides a barrier that guards against leakage of the gi contents or other bodily fluids depending on the viscera involved . likewise , the anastomosis is formed with surety before the patient leaves the medical facility , eliminating the need for a follow - up procedure . moreover , because interior clamp members 34 and 44 maintain the size of the anastomosis , there is no need for a second procedure to insert a stent to maintain the opening . while various embodiments of the invention have been described , the invention is not to be restricted except in light of the attached claims and their equivalents . moreover , the advantages described herein are not necessarily the only advantages of the invention and it is not necessarily expected that every embodiment of the invention will achieve all of the advantages described . | 0 |
the first embodiment of the invention is a method of detecting meibomian glands , making use of the family of two - dimensional ( 2d ) gabor functions . it is known to use a gabor function as a receptive field function of a cell , to model the spatial summation properties of simple cells [ 1 ]. a modified parametrization of gabor functions is used to take into account restrictions found in the experimental data [ 2 , 3 ]. suppose there is a light impulse at a point ( x , y ) on a 2 - dimensional visual field ω ( that is ( x , y )∈ ω ⊃ r 2 ). the gabor function is denoted by g λ , θ , ψ ( x , y ) which is a real valued number ( i . e . g λ , θ , ψ ( x , y )∈ r ). the gabor function is given by [ 2 ]: and g λ , θ , ψ dc is dc term due to cosine function . the dc term without loss of generality , it is assumed in the embodiment that gabor function is centered at the coordinate plane of the receptive field . thus , x 0 and y 0 are not used to index a receptive field function . the parameters σ , γ , λ , θ and ψ are explained below . the size of the receptive field is determined by the standard deviation σ of the gaussian factor . the parameter γ is in the range 0 . 23 to 0 . 92 ( i . e . γ ∈( 0 . 23 . 0 . 92 )) [ 2 ] and is called the spatial aspect ratio . it determines the ellipticity of the receptive field . the value γ = 0 . 5 is used in the experimental results below , and , since this value is constant , the parameter γ is not used to index a receptive field function . the parameter λ is the wavelength and 1 / λ is the spatial frequency of the cosine factor . the ratio σ / λ determines the spatial frequency bandwidth , and , therefore , the number of parallel excitatory and inhibitory stripe zones which can be observed in the receptive field as shown in fig2 ( as explained below ). the half - response spatial frequency bandwidth b ∈[ 0 . 5 . 2 . 5 ] ( in octaves ) [ 2 ] of a linear filter with an impulse response according to eqn . ( 1 ) is the following function of the ratio σ / λ [ 2 ]: the value b = 1 . 0 is used in the embodiment and , since this value is constant , the parameter σ , which can be computed according to eqn . ( 4 ) for a given λ , is not used to index a receptive field function . the angle parameter θ ∈|[ 0 , π ) determines the preferred orientation from the x - axis in counterclockwise direction . the parameter ψ ∈(− π , π ] is a phase offset that determines the symmetry of g λ , θ , ψ ( x , y ) with respect to the origin : for ψ = 0 and ψ = π it is symmetric ( or even ), and for ψ = π / 2 and ψ = π / 2 it is antisymmetric ( or odd ); all other cases are asymmetric mixtures . fig2 is an intensity map of gabor functions with parameters θ = π / 4 , ψ = 0 . 0 and ( a ) λ = 10 pixels ; ( b ) λ = 20 pixels ; ( c ) λ = 30 pixels ; ( d ) λ = 40 pixels ; ( e ) λ = 50 pixels and ( f ) λ = 60 pixels on 256 × 256 pixels grid , which model the receptive field profile of a simple cell . gray levels which are lighter and darker than the background indicate zones in which the function takes positive and negative values , respectively . the bright ellipse { tilde over ( x )} 2 +( γ { tilde over ( y )})= 4σ 2 specifies the boundary of the ( classical ) receptive field outside which the function takes negligibly small values . using the above parametrization for gabor function , one can compute the response i λ , θ , ψ to an input 2d image i as where * denotes 2d convolution . eqn . ( 5 ) can be efficiently computed using the fourier transform ( f ), i . e ., i λ , θ , ψ = f − 1 ( f ( i ) f ( g λ , θ , ψ )) where f − 1 is the inverse fourier transform . realizations of gabor functions shown in fig2 can be used to model the local structure of a gland which is surrounded by non - gland regions . that is , the main lobe in the middle represents the gland , and the side lobes on both sides of main lobe represent non - gland regions . the parameter λ can be used as an estimate for the spatial width , and the parameter θ can be used as an estimate to local orientation of sub - gland structure . the value ψ = 0 . 0 is used . without loss of generality , the parameter ψ is not used as index unless otherwise stated . the parameter λ takes discrete integer values from a finite set { λ i } and can be estimated according to expected spatial width of the consecutive gland and non - gland regions . meanwhile , it is expected that sub - gland structure can have any orientation in between [ 0 , π ). however , it impossible to test every possible orientation . thus , the parameter θ is discretized according to : where n θ is the total number of discrete orientations . for a rough estimate of correct λ and θ for each pixel , the gabor filter response is positive over gland region , but it is negative over non - gland regions . in order to demonstrate this , a sub - region of ir image from fig1 ( a ) is used , and shown in fig3 ( a ). below we will explain the steps of using fig3 ( a ), and values λ = 40 pixels and n θ = 180 to derive a binarized filter response shown in fig3 ( f ). fig3 ( b ) is a contrast enhanced ir image in which the boundary pixels of the regions of fig3 ( f ) are overlayed , and four pixel locations are labelled as a , b , c , d . pixels a and b are on gland regions , and pixel c is on a non - gland region . pixel d is is on the border of a gland region and a non - gland region . fig3 ( c ) shows the gabor filter responses of the four pixels shown in fig3 ( b ). the gabor filter responses for different pixel locations falling into regions of gland and non - gland areas are reported in fig3 ( c ) plotted against the variable θ . the maxima of absolute valued gabor filter responses of pixels a and b are realized when the sign of gabor filter response is + 1 , meanwhile , the sign of the maximum value of absolute valued gabor filter response is − 1 for pixel c . thus , for a pixel over gland region which is surrounded by non - gland regions , there is a high difference between magnitudes of positive maximum and negative minimum . similarly , for a pixel over a non - gland region which is surrounded by gland regions , there is a high difference between magnitudes of negative minimum and positive maximum . however , when the pixel resides on a region which has very close proximity between gland and non - gland regions , e . g ., pixel d on fig3 ( b ), the difference between magnitudes of positive maximum and negative minimum is small , as shown in fig3 ( c ). it is also clear that the sign of average gabor response is + 1 over gland regions , and is − 1 over non - gland regions . for a given λ , the mean gabor response î λ is computed as follows : in fig3 ( d ) the average gabor filter response î λ = 40 of the input image fig3 ( a ) computed according to eqn . ( 8 ) is shown for λ = 40 pixels and n θ = 180 . the corresponding surface plot is given in fig3 ( e ). it is clear from fig3 ( d ) and 3 ( e ) that the filter gives high positive responses on gland regions , while it produces low negative responses on non - gland regions . thus using this observation , one can easily segment out gland regions from non - gland regions using the sign of filter response , i . e ., { circumflex over ( b )} λ ( x , y )= h ( î λ ( x , y )) ( 9 ) in fig3 ( f ) the binarized gabor filter response { circumflex over ( b )} λ according to eqn . ( 9 ) is shown . overall , the segmentation result looks satisfactory . however , it can be observed that at pixel d two glands regions are merged together where the separation between two glands is distinct in the surface plot shown in fig3 ( e ). this can be due to two reasons : 1 ) the value of λ is too large to resolve the signal separation ; and / or 2 ) the pixel d falls into an uncertain region where there is not enough information to separate two regions or the region belongs to some other parts of the ocular surface . in latter case , further analysis is required . however , the former case can be resolved by analysing the image at different values of λ . for example in fig4 , the same input image shown in fig3 ( a ) is analysed using λ = 20 pixels and n θ = 180 . fig4 ( a ) is is the same as fig3 ( a ), and each other part of fig4 corresponds to a respective image in fig3 . it is clear that the pixel d is segmented correctly at the expense of incorrect segmentations in other regions . corresponding results for λ = 30 pixels and n θ = 180 are shown in fig5 , in which each image corresponds to the respective image in fig3 . the results obtained by exploiting different values of λ show various trade - offs yielded between spatial - detail preservation and noise reduction . in particular , images with a lower value of λ are more subject to noise interference , while preserving more details of image content . on the contrary , images with a higher value of λ are less susceptible to noise interference , but sacrificing more degradations on image details . the average gabor filter responses for each distinct value of λ ∈{ λ i } is used in vector representation f x , y for each pixel ( x , y ) of input image as where n λ is the cardinality of the set { λ i } is a positive integer ( i . e . i ∈ z + ), and the denominator in eqn . ( 12 ) is used to compensate the fluctuations due to illumination differences over different parts of the image . in fig6 , gabor filter responses according to eqn . ( 12 ) are shown for n λ = 16 and n θ = 180 . fig6 ( a ) is the same as fig3 ( a ), 4 ( a ) and 5 ( a ). below we will explain the steps of using fig6 ( a ) to derive a binarized filter response shown in fig6 ( f ). fig6 ( b ) is a contrast enhanced ir image in which the boundary pixels of the regions of fig6 ( f ) are overlayed , and the four pixel locations are labelled as a , b , c , d are as in fig3 to 5 . fig6 ( c ) shows the gabor filter responses of the four pixels shown in fig6 ( b ) according to eqn ( 12 ). the gabor filter responses for different pixel locations falling into regions of gland and non - gland areas are plotted in fig6 ( c ). from the feature vectors shown in fig6 ( c ), the feature vectors are positive on gland regions , and negative in non - gland regions . however , they fluctuate between negative and positive values for pixel d . the average feature { circumflex over ( f )} is computed as which is depicted in fig6 ( d ) and ( e ) where the discrimination between gland and non - gland regions are clear . using eqn . ( 13 ), the final binary image is computed according to { circumflex over ( b )} ( x , y )= h ( { circumflex over ( f )} ( x , y )). ( 14 ) where h (·) is defined in eqn . ( 10 ). the result of binarization according eqn . ( 14 ) is shown in fig6 ( f ) and the boundaries are overlayed onto input image in fig6 ( b ). it is clear that merging information from different values of λ improves the discrimination between gland and non - gland regions . thus , the steps of the first embodiment are as shown in fig1 . in step 1 the value of λ is initialised ( i . e . i is set to first value , so as to set λ i ). in step 2 , θ is initialised . in step 3 , the values of λ and θ are used to perform a gabor filter transform . this step is repeated for each of the possible values of θ , and the result is used in step 4 to form the value of i λ 0 for this value of λ . the result is iterated over the possible values of λ , and the result is used to form { circumflex over ( b )} in step 5 using eqns . ( 13 ) and ( 14 ). the second embodiment aims to provide a way of grading a subject , i . e . alloting him into one of at least two categories , such as “ healthy ”, “ unhealthy ” or “ intermediate ”. the overall method of the second embodiment is illustrated in fig1 . a single occular image is used to obtain one or more numerical parameters (“ features ”) indicative of whether the image is healthy or not . note that not all the numerical parameters described below may be collected in realisations of the embodiment , but preferably more than one parameter is collected , and in this case the numerical parameters are combined by an adaptive learning system ( such as a support vector machine ( svm ) which has been subject to supervised learning ), to generate an output indicative of whether the image is healthy or not . the original images have poor contrast . to improve contrast , we applied a standard technique called histogram equalization . the original image is shown in fig7 ( a ) and the image with improved contrast is shown in fig7 ( b ) for comparison . the operations in the second embodiment are performed on the images after histogram equalization . the second embodiment employs a feature called the scale - space - shannon entropy feature to distinguish a healthy from an unhealthy image . this concept is adapted from a well - known method called scale invariant feature transform ( sift ) described in [ 4 ]. in short , in step 20 of fig1 , the embodiment locates keypoints on an image , called scale - space points . each scale - space point is represented by a vector with 3 elements ( x , y , s ) ( note that by contrast the sift transform uses a further 129 elements which are not employed in the embodiment ). x and y are the cartesian coordinates of the scale - space point on the image , s is called its scale the scale - space points are found by the following “ scale - space transform ”: convolving the ( x , y ) ocular image with gaussian filters at different distance scales s ; seeking maxima ( x , y , s ) of the difference between subsequent pairs of the images with different s to form candidate keypoints ; and rejecting candidate keypoints which for which the contrast with next - neighbour points is below a threshold . fig8 shows how the scale - space points look on two images : a healthy image ( fig8 ( a )) and an unhealthy image ( fig8 ( b )). each scale - space point is represented as a circle , and the horizontal bar of the circle ( i . e . the radius ) indicates its scale s . the embodiment employs the observation that , as shown in fig8 , within a local region ( shown by the boxes ), the circles of healthy images are of similar sizes , whereas the circles of unhealthy images are of very different sizes . this is because in healthy images , there are evenly - spaced strips of similar thickness ( i . e . the glands ), and the scale - space transform picks up this pattern . unhealthy images , on the other hand , do not have this pattern ( i . e . no glands ), and the sizes of the circles are therefore of very different magnitudes . in step 21 of fig1 , the embodiment generates a numerical measure of the disparity of the sizes of the circles , and the embodiment makes use of the fact that the local distribution of scales is uniform for a healthy image and non - uniform for an unhealthy one to distinguish between the two classes . one mathematical function which can measure this uniformity is the well - known shannon entropy , which we will now discuss . where p i is the probability of event i . the p i &# 39 ; s must be normalized , i . e . σ i = 1 n p i = 1 . one important property of the shannon entropy that we use is that it is maximized if and only if p i is a uniform distribution , i . e . p i =√ n . for the proof , refer to [ 5 ]. the scale of the sift points can be related to the probability distribution in the following way . first , choose a scale - space point and consider its n nearest neighboring scale - space points . we define the ‘ probability ’ of the i - th nearest neighbor with respect to this ‘ central ’ scale - space point as where i = 1 , . . . , n labels the n nearest - neighbouring scale - space points and s i is the scale of the i - th scale - space point . the denominator in eqn . ( 16 ) ensures that 0 & lt ; p i & lt ; 1 , and that the distribution is normalized . the meaning of p i is the ratio of the area of the circle of the ith neighbor to the total area of all the neighbors . referring back to fig8 , we see that for the box in fig8 ( a ), all the circles are roughly the same size , so p i will also be roughly the same , and hence the entropy computed within that blue box should be close to maximal . for fig8 ( b ), on the other hand , because the circles are very non - uniform , p i computed according to eq . ( 16 ) is also very non - uniform , and so the entropy computed within that blue box will be low compared to ( a ). to compare the entropies of two different images , we need to compute the shannon entropy for an entire image . the algorithm to do this is as follows . 1 . obtain all the scale - space points for an image ( using standard techniques ). say the total number of scale - space points is m . denote a scale - space point as α , where α = 1 , . . . , m . 2 . for an α , identify its n nearest neighbors ( usually n = 20 ). ( in cases in which the n nearest neighbours are not unambiguously defined ( e . g . because there are 3 scale - space points exactly the same distance away and 19 scale - space points closer ; or to put this more generally , if for the smallest distance d such that there are at least n points no further than d from α , the number of scale - space points no further than d from α is m which is greater than n ), the algorithm can randomly take n of these m points , or alternatively use all m of these points ) 3 . if { s 1 α , . . . , s n α } are the scales of these n nearest neighbours , let s α = σ i = 1 n ( s i α ) 2 , and let p i α =( s i α ) 2 / s α . 4 . compute the entropy for α : s α =− σ i = 1 n p i α in p i α 5 . repeat steps 1 to 3 for all scale - space points , i . e . α = 1 , . . . , m . 6 . the shannon entropy for the entire image is the average to see whether the scale - space - shannon entropy feature can distinguish between healthy and unhealthy meibography images , we manually graded some healthy and unhealthy images , and computed their entropy s . the results are shown in fig9 . each image is represented as a point . the horizontal axis represents entropy s . the vertical axis isr included only for ease of visualisation . healthy images are plotted as lighter dots , and unhealthy images as respective darker dots . the result shows that the healthy cluster is quite well separated from the unhealthy cluster along the shannon entropy dimension . the embodiment uses a further method to extract other features , which we call line features , from the images . as explained , the most salient characteristic of a healthy image are the vertical gland patterns , shown in the top left panel of fig1 . the embodiment obtains clusters of pixels indicative of these glands , as shown in the two bottom panels of fig1 . the procedure can be summarized as follows . 1 . extracting pixels that lie along the bright and dark line regions ( i . e . gland patterns ). this is step 22 of fig1 . 2 . grouping the pixels into ‘ primitive ’ clusters that resemble line patterns . this is step 23 of fig1 . 3 . morphological operations on each cluster to form a line from the cluster . this is step 24 of fig1 . 4 . obtaining numerical properties of the lines ( e . g . their length and / or curvature ) as features for classification . this is step 25 of fig1 . to extract the local minima , we first smooth the entire image ( implemented using the cvsmooth algorithm from the well - known opencv library of programming functions ) so that the values of the intensity change smoothly from one pixel to another . then , using the intensity as a kind of ‘ potential energy surface ’, we can seek minima of the surface . one way to do this is to perform gradient descent to reach the minima of the surface . specifically , the procedure is as follows . 1 . consider a horizontal cross section of the image , i . e . one row . denote the intensity at the ith pixel as i [ i ]. 2 . consider a ‘ particle ’ located at the ith pixel . 3 . compute the ‘ force ’ on it as ( which is just a simplified version of the gradient formula −∂ v / θx .) if f [ i ]& gt ; 0 , move the particle to i + 1 ; if f [ i ]& lt ; 0 , move it to i − 1 ; if f [ i ]= 0 , then it stays at i . note that since intensities are generally quoted in integer values ( e . g . integers in the range 0 to 255 ) one would expect f [ i ]= 0 at minima . 4 . repeat step 3 , until the particle stops moving , i . e . f = 0 . denote the location of the particle as i *. 5 . repeat steps 2 and 3 , starting the particle from every pixel along the row , obtaining an i * for each starting pixel i . the set of all i *&# 39 ; s are the minima for the row . 6 . proceed to the next row and repeat steps 2 to 5 . to obtain the maxima , one simply repeats the above but using − i instead of i for the pixel intensity . an alternative algorithm is to scan along the row , and make a list of those points / pixels i that satisfy the following conditions : for maxima : i [ i − 1 ]& lt ; i [ i ]& gt ; i [ i + 1 ]; for minima : i [ i − 1 ]& gt ; i [ i ]& lt ; i [ i + 1 ]″. after obtaining all the minima and maxima points , we need to cluster them so that , to a first approximation , each cluster has a line - like shape . this will facilitate the next stage of converting the cluster into a contiguous line . to do our clustering , we use a well - known algorithm called first in first out ( fifo ). for specificity , we use the threshold of 10 pixels , which means that only pixels within less than 10 pixels of some other pixels in a cluster are grouped together . after this procedure , the minima ( maxima ) are grouped as shown in the bottom two panels of fig1 . each of these cluster are then transformed into a contiguous curve using the method described in the next section . at this stage , each cluster resembles a line , but it is still not useful because it may be broken , and it is not one pixel thick . here , we present an algorithm , based on well - known methods , to transform a cluster into a curve . while each of the methods used by the embodiment is known as unrelated method , the embodiment combine these methods to achieve the purpose of converting a cluster of pixels into a contiguous curve . the sub - steps of step 24 in fig1 are illustrated in fig1 , and are described below . 1 . choose one cluster and put it into an image . specifically , we set all the pixels belonging to that cluster as foreground ( black in fig1 ), and all other pixels as background ( i . e . white ). this is shown in the first panel of fig1 . 2 . next , we apply cvdilate ( which is another algorithm available in opencv ) to thicken the cluster by one pixel . the purpose is to merge all the pixels into one connected piece . after one application of cvdilate , we check to see if the cluster now consists of a single connected component . if yes , we proceed to the next step , otherwise , we apply cvdilate again until one single connected component is obtained . 3 . the previous step may produce a connected component containing ‘ islands ’ of background , highlighted by the circle in the second panel of fig1 . these islands must be eliminated because they will give rise to ‘ loops ’ in the contiguous line in the later steps . to eliminate all them , we use cvfloodfill ( which is another algorithm available in opencv ) to fill out the background first , revealing the locations of these islands as the remaining white pixels . we then go back to the pre - cvfloodfill image and set these islands to foreground ( i . e . black ). this produces a connected component which does not contain these problematic islands . 4 . we then use a standard thinning algorithm [ 6 ] to thin the component until one pixel thick . 5 . the connected component is now a ‘ tree ’ with many branches . the embodiment prunes away all the side branches . to do this , we first locate and count the number of terminal points ( i . e . end points ) on the tree . we then use a standard pruning algorithm [ 7 ] to prune away all side branches with pruning factor 1 , i . e . branches which are 1 pixel long are eliminated . we then count the number of end points again , and if it is not 2 , we increase the pruning factor by 1 and prune again . the procedure is repeated until only two end points are left , meaning that the tree has no more branches left . 6 . this completes the procedure for transforming a cluster into a contiguous line . we then go repeat steps 1 to 5 for another cluster . we now present features ( i . e . numerical parameters ) derived in step 25 of fig1 from the lines obtained to help us distinguish between the healthy and unhealthy images . the features are : no . of lines vs total length as the first two features , we choose the ‘ number of lines ’ and ‘ total length of the lines ’. the idea is explained graphically in fig1 . for a healthy image , there are fewer lines , and all the lines are long ; for an unhealthy image , there are more lines , and the lines are short . if we plot these two features , the healthy and unhealthy images can be separated , as shown in the bottom panels of fig1 . potential energy the next feature is called ‘ potential energy ’. we first find the nearest neighbor of a minimum ( maximum ) point . we then compute its potential energy . the potential energy is zero everywhere except at the distance of around 50 pixels (= spacing between strips ) where it becomes negative . hence , for healthy images , we expect the total potential energy of an image to be negative , whereas for unhealthy images we expect it to be close to zero . left - right distance the next feature is called left - right distance . we start off from a point , and move in the two directions perpendicular to the tangent at that point . for each direction , we compute the distance where the embodiment first encounters another point ( d 1 and d 2 in the figure ). the distribution of points on the d 1 - d 2 plane can be used to construct a histogram . the first two components of the histogram are good features to separate healthy and unhealthy images . twistedness our last feature is called twistedness , and it is based on the observation that the lines for healthy images are less twisted than those for unhealthy images . to quantify twistedness , we define it as the ratio of the distance between the ends of the line (“ straight length ”) and the length of the line (“ arc length ”). for each image , a histogram can be computed for the distribution of twistedness of its lines . we then further coarse grain the histogram into two bins , and use these as the feature space . the features discussed above are not the only features which can be derived in step 25 from the lines obtained in step 24 . two further possible features are the average of the length of all the lines in an image , and the standard deviation of length of the lines . fig1 shows the scatter plot of the images based on these two features . each point represents an image . the circle - shaped and diamond - shaped points represent the healthy and unhealthy images respectively . it is clear that using standard techniques like support vector machines , the two classes of images can be classified . this method has been reported in our recent publication in journal of biomedical optics 17 ( 8 ) 0860008 , ( 2012 ). furthermore , many variations are possible in the technique used to obtain the lines , and improvements can be made . although the algorithm presented above for extracting line features from the image is effective for classification of the extreme cases of healthy and unhealthy images , it may be less effective to assess the intermediate stages , and it is valuable to minimise noise . noise here means spurious lines that are extracted by the algorithm of fig1 but are not due to meibomian glands . the majority of these lines are due to eye lashes or dark shadows at the periphery of the images . these are removed in order to remove noise from the subsequent statistics that we will compute from the lines . an example is shown in fig1 ( a ). lines extracted by the method of fig1 are marked . lines marked x are due to the meibomian glands , but the lines marked y near the edge are spurious and due to inhomogeneity in the pixel intensity , and are preferably excluded before step 25 is performed , i . e . excluded from subsequent calculation of statistics based on the lines . in the following , we describe an algorithm for automatically detecting the spurious lines y . the spurious lines y have two important properties . they are much shorter than the majority of the lines , and they are close to the edges . however , it would not be appropriate to exclude all lines which are short because they are characteristic of unhealthy and intermediate images , as shown in fig1 ( b ). we see that due to the breaking up of the gland patterns in the center , there are many short broken lines in the center of the image . these must be be retained . there are two stages to remove the spurious lines . in the first stage , we process each individual line in the following way . ( 1 ) label the top , bottom , left , and right edges of the images ( as , for instance , 1 , 2 , 3 , 4 respectively ). for every pixel of a line , check which side the pixel is closest to , and determine the distance of the pixel to this closest side . call this number d . ( 2 ) for each line , get the pixel with the smallest and largest d . call them d_min and d_max respectively . ( 3 ) compute the d_min and d_max for all the lines on the images . plot each line as a point in a two dimensional space where the x - axis is d_max - d_min , and the y - axis is d_max . the resulting scatter plot is shown in fig1 . all the lines fall into one of three sectors in the 2 - d plot . the lines which correspond to gland lines will lie in the top - right hand region . this is because they usually contain a pixel which is close to an edge , and hence a small d_min , but also contain a pixel which is near the center , and hence a large d_max . as a result , lines associated with glands will have large d_max - d_min and d_max . a second category of lines belong to those which fall in the top left hand region . these are remnants of broken - up gland lines . they are short and lie near the center . as they lie near the center of an image , their d_max is large . but because they are short and near the center , the pixel with d_min is usually also in the proximity to the pixel with d_max , and d_min is approximately equal to d_max , giving a small d_max - d_min . this explains why they lie in the top left hand corner . these lines should also be included when step 25 is performed . the spurious lines y are those that lie close to the origin of the scatter plot . they are short and hence every pixel along the line will be close to the edge , hence d_max will be small , and so will d_max - d_min . to select the spurious lines , we use a thresholding procedure . any line that has d_max - d_min & lt ; 50 and d_max & lt ; 50 will be classified as spurious and hence removed before step 25 is performed . fig1 showed that healthy and unhealthy images can be well - distinguished using the average of the length of all the lines in an image and the standard deviation of the lines . this , and the other experimental results given above , imply that the second embodiment can used as a successful tool for identifying subjects in these categories , even using a single ocular images . the subjects found to have unhealthy eyes can be subjected to further examination , or treated . it is known to treat patients with meibomian gland dysfunction with a warm compress with a hot towel , an eyemask , or a specialised heating device called blephasteam . in addition , anti - inflammatory medications such as doxycyclines , azithromycin and cyclosporin may be helpful . in addition , patients may be started on antibiotic steroid ointments topically . off the counter lubricants , especially those containing lipids may be given to replenish the tear lipids , since there may be abnormal tear lipid layer in patients with this condition . recent advances in this condition include mechanical probing of meibomian glands with or without intraglandular injection of steroids , as well as the in - office thermopulsation treatment called lipiflow . as many of these treatments may be prone to poor compliance , or involve complications , or are expensive , it is helpful to have an objective means of diagnosing and evaluating meibomian gland dysfunction . fig1 , which uses the same two features as fig1 but also includes points for intermediate images shows that for these two features the intermediate grades overlap significantly with the healthy and unhealthy grades . thus , it is desirable to use other features , such as the ones described above , to help distinguish the intermediate images . for example , it is intended to use the classifier described above for separating the healthy and unhealthy images to first give a preliminary classification of images into two classes ( i ) healthy / intermediate images or ( ii ) unhealthy / intermediate images . specific features that distinguish between healthy / intermediate images can then be used to further separate the healthy from the intermediate class in the healthy / intermediate category . similarly for the unhealthy / intermediate category . [ 1 ] j . g . daugman , “ uncertainty relation for resolution in space , spatial frequency , and orientation optimized by two - dimensional visual cortical filters ,” j . opt . soc . am . a , vol . 2 , no . 7 , pp . 1160 - 1169 , july 1985 . [ 2 ] n . petkov and p . kruizinga , “ computational models of visual neurons specialised in the detection of periodic and aperiodic oriented visual stimuli : bar and grating cells ,” biological cybernetics , vol . 76 , pp . 83 - 96 , 1997 . [ 3 ] p . kruizinga and n . petkov , “ nonlinear operator for oriented texture ,” ieee transactions on image processing , vol . 8 , no . 10 , pp . 1395 - 1407 , october 1999 . [ 4 ] d . g . lowe , “ object recognition from local scale - invariant features ,” the proceedings of the seventh ieee international conference on computer vision , vol . 2 , pp . 1150 - 1157 , 1999 . [ 5 ] a . i . khinchin , mathematical foundations of information theory . dover publications , 1957 . [ 6 ] l . lam , s . lee , and c . suen , “ thinning methodologies — a comprehensive survey ,” ieee transactions on pattern analysis and machine intelligence , vol . 14 , pp . 869 - 885 , 1992 . [ 7 ] a . niemisto , v . dunmire , o . yii - harja , w . zhang , and i . shmulevich , “ robust quantification of in vitro angiogenesis through image analysis .” ieee transactions on medical imaging , vol . 24 , no . 4 , pp . 549 - 553 , 2005 . [ 8 ] k . k . nichols , g . n . foulks , a . j . bron , b . j . glasgow , m . dogru , k . tsubota , m . a . lemp , and d . a . sullivan , the international workshop on meibomian gland dysfunction : executive summary , ophthalmol . vis . sci . mar . 30 , 2011 vol . 52 so no . 4 1922 - 1929 . | 6 |
a prior art power amplifier is shown at 10 in fig1 . amplifier 10 includes an attenuator 11 having variable resistors 12 , 13 and 14 . amplifier 10 has an input lead 15 and an output lead 16 . variable resistor 12 is connected from input lead 15 to a junction 17 . variable resistor 14 is connected from junction 17 to ground . a thirty decibel amplifier is provided at 18 having a power input on a lead 19 of p dc . variable resistor 13 is connected from junction 17 to the input of amplifier 18 over a lead 20 . amplifier 18 has an output lead 21 which is connected to output lead 16 of amplifier 10 . as can be seen in fig1 the attenuator 11 takes considerable power from the incoming signal over lead 15 and thus reduces the efficiency of amplifier 10 . in accordance with the present invention , a high efficiency variable gain amplifier is shown at 22 in fig2 . amplifier 22 includes 19 amplifiers a1 , a2 , a3 , a4 , a5 , a6 , a7 , a8 , a9 , a10 , a11 , a12 , a13 , a14 , a15 , a16 , a17 , a18 and a19 . the amplifiers a1 to a19 have respective gains as follows in decibels of : 9 , 8 , 6 , 8 , 11 , 10 , 5 , 10 , 8 , 10 , 3 , 8 , 10 , 6 , 8 , 10 , 9 , 6 and 3 . a switch module s1 is provided including switches s1a , s1b and s1c . a gain selection circuit is provided at 23 connected to amplifiers a1 , a2 , a3 , a4 , and a5 , and switches s1a , s1b and s1c . amplifier 22 has an input lead 24 on which an incoming signal of power of 0 . 01 watt may be provided , for example . lead 24 is connected to a junction 25 . amplifiers a1 , a3 and a5 have inputs connected from junction 25 . switch module s1 has an output junction 26 . switches s1a , s1b and s1c are all connected to junction 26 . further , switches s1a , s1b and s1c are respectively connected from the outputs of amplifiers a2 , a4 and a5 , respectively . the output of amplifier a1 is connected to the input of the amplifier a2 . the output of amplifier a3 is connected to the input of the amplifier a4 . junction 26 is connected to the input of amplifier a19 . the output of amplifier a6 is connected to the input of amplifier a7 . the output of amplifier a8 is connected to the input of amplifier a9 . the output of amplifier a10 is connected to the input of amplifier a11 . the output of amplifier a11 is connected to the input of amplifier a12 . the output of amplifier a13 is connected to the input of amplifier a14 . the output of amplifier a14 is connected to the input of amplifier a15 . the output of amplifier a16 is connected to the input of amplifier a17 . the output of amplifier a17 is connected to the input of amplifier a18 . gain selection circuit 23 has an output lead 27 connected to a junction 29 . a lead 28 is connected from junction 29 to the gain control inputs of amplifiers a1 and a2 . the gain of all amplifiers a1 to a19 may be controlled in a known manner . for example , the gain of an amplifier is either full or zero . alternatively , when zero gain is desired , power to the amplifier is turned off . in a manner similar to the manner in which gains of amplifiers a1 and a2 are controlled , the gains of the amplifier a3 and a4 are controlled over a lead 30 . these gains are controlled by gain selection circuit 23 , as before . the gain of amplifier a5 is controlled over lead 31 by gain selection circuit 23 . gain selection circuit 23 also determines the open or closed state of switches s1a , s1b and s1c . gain selection circuit 23 may be conventional and may be operated manually , if desired . gain selection circuit 23 controls the closure of switches s1a , s1b and s1c . typical operation of gain selection circuit 23 is shown in fig3 . only amplifier a5 is shown to simplify the circuit . amplifier a5 and switch s1c are both shown in fig3 . as indicated , switch s1c is an electronic switch . it is turned on or off simultaneously with the gain of amplifier a5 . that is , when switch s1c is closed , the gain of amplifier a5 is 11 decibels . when switch s1c is open , the gain of amplifier a5 is zero . all of this is determined by the state of a switch 32 shown as a single pole , double throw switch having contacts 33 and 34 . when the pole is in the position shown , no power is applied to the amplifier a5 , its gain is zero and in addition switch s1c is held open . when the pole is in its alternate position , power (+ v ) is applied to the ampliifer a5 , its gain is 11 db , and the switch s1c is closed . the switch 32 thus symbolically illustrates the function of the gain selection circuit 23 . junctions 46 and 47 in fig2 are connected to a junction 40 . junction 46 is connected to the inputs of amplifiers a6 and a8 . junction 40 is connected to the input of amplifier a10 . junction 47 is connected to the inputs of amplifiers a13 and a16 . an enable gate 48 is provided which may , if desired , be identical , except for the number of its functions , to gain selection circuit 23 . it may , therefore , operate in the manner similar to that described in connection with fig3 . amplifiers a6 and a7 have their gains turned on and off by enable gate 48 . similarly , so do amplifiers a8 and a9 ; a10 , a11 and a12 ; a13 , a14 and a15 ; and a16 , a17 and a18 . the outputs of amplifiers a7 , a9 , a12 , a15 and a18 are respectively connected to junction 41 via switches a , b , c , d , e and f in switch module s3 . fine gain adjustment circuit 38 may be as shown in fig4 if desired , to adjust the gain of amplifier a19 . in the operation of the high efficiency variable gain amplifier 22 shown in fig2 fine gain adjustment circuit 38 may be fixed or may be variable with time . the same is true of gain selection circuit 23 and enable gate 48 . if amplifier a5 is turned on , its output will be , for example , 0 . 05 watt . if amplifier a4 is turned on , the output thereof will be 0 . 1 watt . if amplifier a2 is turned on , the output thereof will be 0 . 2 watt . this all assumes an input power of 0 . 01 watt . the inputs to each of the amplifiers a6 , a8 , a10 , a13 and a16 may , for example , be 0 . 01 watt . if so , the outputs of amplifiers a7 , a9 , a12 , a15 and a18 are essentially binary coded with the values shown in fig2 . note that if the output of amplifier a7 , when turned on is 0 . 322 watt , the output of amplifier a9 would be 0 . 645 watt , the output of amplifier a12 would be 1 . 29 watt , the output of amplifier a15 would be 2 . 58 watts , and the output of amplifier a18 would be 5 . 16 watts . a high efficiency variable gain amplifier 49 constructed in accordance with the present invention is also shown in fig5 including a fet amplifier chip combination 49 . combination 49 has an input lead 50 and an output lead 51 . input lead 50 is connected , and the power of the input signal divided among six fet switches 52 to 57 . sets of matching networks 64 and 65 are provided , both of which may be the same or similar networks . set 64 includes networks 58 to 63 . networks 58 to 63 are respectively connected from switches 52 to 57 . a fet amplifier chip is provided at 66 . chip 66 includes fet &# 39 ; s 67 to 72 . these are respectively connected from the outputs of networks 58 to 63 . fet &# 39 ; s 67 to 72 have outputs connected from their leads 73 , 74 , 75 , 76 , 77 and 78 , respectively . leads 73 to 78 are respectively connected to junctions 79 to 84 . fet &# 39 ; s 85 , 86 , 87 , 88 , 89 and 90 are connected from a programmer 91 to act as switches for the fet &# 39 ; s 67 to 72 in chip 66 . fet &# 39 ; s 85 to 90 have sources connected to junctions 79 to 84 , respectively , via leads 92 to 97 , respectively , and inductors 98 to 103 , respectively . output matching networks 65 all may be identical or may be different . they all also may have circuit conponents with the same or different component values . for this reason , only the network 65 connected from junction 79 will be described in detail . this network is network 108 , including a capacitor 104 , an inductor 105 , and an inductor 107 connected in series from junction 79 through a junction 109 , and a fet 110 to an output junction 111 from which lead 51 is connected . fet &# 39 ; s are provided also at 112 to 116 . fet 110 and fet &# 39 ; s 112 to 116 are controlled by programmer 91 which may or may not be identical to gain selection circuit 23 or enable gate 48 shown in fig2 . percent efficiency e may be defined as follows : ## equ1 ## where p o is rf power out , the amplifier of the present invention uses several parallel connected amplifiers whose power outputs vary in a binary scheme . power attenuation is achieved by gating off successive parallel amplifiers . in this way the gain is adjusted in binary step maintaining high efficiency at low power levels . a block diagram of the proposed variable gain amplifier appears in fig2 . the amplifier produces 10 watts output with a gain continuously variable from 0 to 30 decibels . two clusters of amplifiers are used for control . amplifiers a6 through a18 is the output amplifier cluster providing up to 10 watts output with 0 . 05 w input ( 27 db gain ). the power level is adjustable down from 10 watts in 0 . 322 watt steps . the input power is split into 5 paths symmetrically feeding a buffer amplifier in each channel . the individual channels are turned on by enable gate 48 which activates the drain voltages for fet &# 39 ; s , ( collector voltages for transistors ). in addition , the output of each active channel is simultaneously connected to the amplifier output through a low loss series switch ( s 3 ). the switch isolates the sum output from the unused amplifier output and prevents loading and mismatching . the phase through each channel must be matched for proper summing to occur without degradation . a lumped element combining network is used as part of s 3 . amplifier cluster a1 through a5 similarly varies the power level from 0 . 05 w to 0 . 35 watts in 0 . 05 w steps . a variable gain stage a19 consists of a continuously adjustable pad , electronically tunable over 0 to 3 db range to fine tune the output power . the same technique is applicable in combining the cells of fet to obtain highly efficient gain variation . fig5 illustrates the technique in a 6 - cell fet stage . 1 . programmable gain of power output for phased array radar elemental transceivers . | 7 |
fig1 is a schematic illustration of a wellbore 10 that can be cased or in open hole . there are perforations 12 into a formation 14 . a string 16 is shown in part if fig1 to the extent it spans a production interval defined between seals or packers 18 and 20 . these seal locations can be polished bores in a cased hole or any type of packer . the two barriers 18 and 20 define a production interval 22 . while only one interval is shown the string 16 can pass through multiple intervals that preferably have similar equipment so that access to them can occur in any desired order and access can be to one interval at a time or multiple intervals together . the string 16 for the interval 22 that is illustrated has a frac valve 24 that is preferably a sliding sleeve shown in the closed position in fig1 for run in . valve 24 regulates opening or openings 25 and is used in two positions . the closed position is shown in fig1 and the wide open position is shown in fig2 . in the fig2 position , gravel slurry can be squeezed into the formation 14 leaving the gravel 28 in the annular interval 22 just outside the proppant screen or shroud 29 . shroud 29 is sealed on opposite ends 30 and 32 and in between defines an annular flow area 34 . while the shroud 29 is shown as one continuous unit , it can also be segmented with discrete or interconnected segments . the proppant 28 stays in the interval 22 and the carrier fluid is pumped into the formation 14 to complete the fracturing operation . at that point the valve 24 is closed and excess proppant 28 that is still in the string 16 can be circulated out to the surface using , for example , coiled tubing 36 . at this point the production valve 26 which is preferably a sliding sleeve with a screen material 38 in or over its ports is brought into alignment with ports 40 and production from the formation 14 begins . alternatively , the screen material 38 can be fixed to either side of the string 16 . in short , the open position of production valve 26 results in the production flow being screened regardless of screen position and screen type . flow can take a path of less resistance through the flow area 34 to reach the port 40 . while such flow avoids most of the gravel pack 28 by design , the presence of passage 34 allows a greater flow to reach the ports 40 so as not to impede production . the presence of a screen material 38 at ports 40 serves to exclude solids that may have gotten into passage 34 through the coarse openings in shroud 29 . the screen material 38 can be of a variety of designs such as a weave , conjoined spheres , porous sintered metal or equivalent designs that perform the function of a screen to keep gravel 28 out of the flow passage through string 16 . it should be noted that while only a single port 25 and 40 are shown that there can be multiple ports that are respectively exposed by operation of valves 24 and 26 . while valves 24 and 26 are preferably longitudinally shiftable sliding sleeves that can be operated with a shifting tool , hydraulic or pneumatic pressure or a variety of motor drivers , other styles of valves can be used . for example , the valves can be a sleeve that rotates rather than shifts axially . while a single valve assembly in an interval between barriers 18 and 20 is illustrated for valves 24 and 26 and their associated ports , multiple assemblies can be used with either discrete sleeves for a given row of associated openings or longer sleeves that can service multiple rows of associated openings that are axially displaced . fig4 - 6 correspond to fig1 - 3 with the only difference being the shroud 29 having an end 32 that is past the openings 40 so that the passage 34 goes directly to the ports 40 . here , as opposed to fig1 - 3 , once the flow from the formation 14 passes through the shroud 29 it doesn &# 39 ; t have to pass through that shroud 29 a second time . in all other respects the method is the same . in fig4 the valves 24 and 26 are closed for run in . when the string 16 is in position and the barriers 18 and 20 are activated , the valve 24 is opened , as shown in fig5 , and proppant slurry 28 is delivered through ports 25 . there is no crossover needed . when the proper amount of proppant is deposited in the interval 22 , the valve 24 is closed and valve 26 is opened to place the screen material 38 over openings 40 to let production begin . as before , with the design of fig1 - 3 and the variations described for those figs ., the same options are available to the alternative design of fig4 - 6 . one advantage of the design in fig4 - 6 is that there is less resistance to flow in passage 34 because of the avoidance of going through the shroud 29 a second time to get to the ports 40 . on the other hand , one of the advantages of the design of fig1 - 3 is that the inside dimension of the string 16 in the region close to valve 26 can be larger because the shroud 29 terminates at end 32 well below the ports 40 . in both designs the length of shroud 29 can span many pipe joints and can exceed hundreds if not thousands of feet depending on the length of the interval 22 . those skilled in the art will appreciate that short jumper sections can be used to cover the connections after assembly so that the passage 34 winds up being continuous . fig7 - 9 work similarly to fig1 - 3 with the only design difference being that the shroud 29 is not used because the application for this design is for rather short intervals where a bypass passage such as 34 around a shroud 29 is not necessary to get the desired production flow rates . instead valve 26 has a plurality of screen sections 38 that can be aligned with axially spaced arrays of openings 40 . in this case as with the other designs , the valves 24 and 26 can be located within or outside the tubular string 16 . in all other ways , the operation of the embodiment of fig7 - 9 is the same as fig1 - 3 . in fig7 for run in the valves 24 and 26 are closed . the string 16 is placed in position and barriers 18 and 20 define the producing zone 22 . in fig8 , the valve 24 is opened and the gravel slurry 28 is squeezed into the formation 14 leaving the gravel in the interval 22 outside of openings 40 . in fig9 the gravel packing and frac is completed and the valve 24 is closed . then valve 26 is opened placing screen material 38 in front of openings 40 and production can begin . in essence , valve 26 with its screen sections 38 and openings 40 act as a screen that is blocked for run in and gravel deposition and frac and then functions as a screen for production . again multiple assemblies of valves 24 and 26 can be used so that if one fails to operate another can be used as a backup . in the same manner if one set of screen sections 38 clog up , another section can be placed in service to continue production . fig1 illustrates a valve 50 that uses as sliding sleeve 52 to selectively cover ports 54 . the ports 54 are closed in fig1 and open in fig1 . a latch profile 56 is provided adjacent each sleeve 52 . an array of valves 50 and associated ports 54 is envisioned . the configuration of the latch profile 56 is preferably unique so as to accept a specific screen assembly 58 , one of which is shown in fig1 . each screen assembly has a latch 60 that is uniquely matched to a profile 56 . fig1 shows a screen assembly 58 that has a latch 60 engaged in its mating profile 56 . in that position a screen 62 has end seals 64 and 66 that straddle ports 54 with sleeve 52 disposed to uncover the ports 54 . one or more such assemblies are envisioned in an interval 22 between isolators 18 and 20 in the manner described before . in operation , the ports 54 are closed for run in as shown in fig1 . after getting the string 16 into position and setting the barriers ( not shown in fig1 ) to define an interval 22 , as before , the ports 54 are exposed and gravel slurry is forced into the formation as the formation is fractured . at this time the screen assembly 58 is not in string 16 . when that step is done and the excess slurry is circulated out , the valves 50 to be used in production are opened . a screen assembly 58 with a latch 60 that matches the valve or valves 50 just opened is delivered into the string 16 and secured to its associated profile 56 . in this manner , the ports 54 that are now open each receive a screen assembly 58 and production can begin . any order of producing multiple intervals can be established . the screen sections 58 can be dropped in or lowered in on wireline or other means . they are designed to release with an upward pull so if they clog during production they can be released from latch 56 and removed and replaced to allow production to resume . the screen assemblies can have a fishing neck 68 to be used with known fishing tools to retrieve the screen section 58 to the surface . one screen section can cover one array of ports 54 or multiple arrays , depending on its length and the spacing between seals 64 and 66 . optionally , the shroud 29 of from the other embodiments can be combined into the fig1 - 13 embodiment and it can be positioned to come just short of ports 54 or to straddle them as previously described and for the same reasons . the above description is illustrative of the preferred embodiment and many modifications may be made by those skilled in the art without departing from the invention whose scope is to be determined from the literal and equivalent scope of the claims below . | 4 |
the embodiment of fig1 and 3 includes a memory 201 capable of storing 65 , 536 ( 64k ) digital words each comprising twenty - six binary digits . each twenty - six digit word consists of twenty - four information digitals and two error check digits . in the present embodiment each error check digit is a parity digit over a portion of the twenty - four information digits . memory 201 consists of twenty - six memory units of which memory units 202 , 203 , and 204 are shown in fig2 . when a word is read from memory 201 , one of its digits is transmitted from each of the twenty - six memory units . each of the memory units 202 through 204 consists of sixteen memory circuits as shown in the detailed drawing of memory unit 202 . the uppermost two memory circuits of memory unit 202 have been numbered memory circuits 205 and 206 . the memory circuits of the present embodiment may , for example , be the texas instruments type tms 4050 - 4096 bit dynamic random access memories . a single digit is read from or written into a given memory circuit , when it receives a twelve - bit address portion , a designation of whether a read or write operation is to occur and a chip enable signal . sixty - four memory cells of each memory circuit can be simultaneously refreshed by providing the memory circuit with a read indication , a six - bit row address and a chip enable signal . all access to the memory 201 is obtained by address and control information placed in a seventeen - bit memory address register 207 ( fig2 ). one bit position of memory address register 207 , denoted r , is a logical &# 34 ; 1 &# 34 ; if a read operation is to be performed and a logical &# 34 ; 0 &# 34 ; if a write operation is to be performed . bit positions 0 through 2 of memory address register 207 define two memory circuits within each memory unit which are to be accessed . bit positions 3 through 8 define which row of the selected memory circuits contains the bit of interest . bit positions 9 through 14 define which column of the selected memory circuits includes the bit of interest and storage position 15 defines which of the two selected memory circuits per memory unit is to provide ( or store ) the information digit . the address information contained in storage locations 3 through 14 is directly connected via a bus 208 to the appropriate input terminals of the memory circuits of each of the memory units 202 through 204 in accordance with principles well known in the art . in the description which follows , the operations performed within memory unit 202 are described in detail . however , identical operations are being performed in response to the same information in all of the memory units 202 through 204 , each being used , as previously stated , to supply one bit of the resulting twenty - six bit word . the information in bit positions 0 through 2 of memory address register 207 is connected to an enable decoder 209 in each memory unit over bus 208 . enable decoder 209 is also connected to receive the output signals of an or gate 210 . as will be described in greater detail later herein , or gate 210 receives as inputs all chip enable signals generated by the control circuitry of the present memory system whether generated as a part of a refresh operation or as part of a normal memory access . the chip enable signals are transmitted through or gate 210 to the enable decoder 209 of each memory unit . enable decoder 209 responds to the contents of bit positions 0 through 2 of memory address register 207 by gating the received chip enable signal to two memory circuits defined by those three bit positions . for example , if the contents of bit positions 0 , 1 , and 2 are all logical &# 34 ; 0s &# 34 ; enable decoder 209 transmits the chip enable pulse to memory circuits 205 and 206 over a conductor 211 uniquely associated with those two memory circuits . upon receipt of the chip enable signal , the function defined by bit position r of memory address register 207 will be performed on the particular bit defined by storage positions 3 through 14 of memory address register 207 . when a read operation is performed the information from a single defined storage position in both enabled memory circuits 205 and 206 is transmitted to a respective one of and gates 212 and 213 . the binary state of bit position 15 of memory address register 207 is transmitted directly to and gate 212 and via an inverter to and gate 213 . accordingly , if bit position 15 of memory address register 207 stores a logical &# 34 ; 1 ,&# 34 ; the accessed bit from memory circuit 205 will be gated by and gate 212 to an or gate 214 . on the other hand , if bit position 15 of memory address register 207 is a logical &# 34 ; 0 ,&# 34 ; the accessed digit from memory circuit 206 will be gated by and gate 213 to or gate 214 . the output of or gate 214 of memory unit 202 is directly connected to a uniquely associated bit position in an output register 215 . each of the memory units 202 through 204 is uniquely associated with one of the twenty - six bit positions of output register 215 and simultaneously operates in response to the contents of memory address register 207 to transmit a single digit to that register . two sources of addresses are available to supply the contents for memory address register 207 . one source , which is utilized when a memory access is desired by the central processor , is a register 102 . the second source , and the one described in greater detail immediately herein , is a counter circuit 216 . counter circuit 216 comprises a sixteen bit position binary counter which is initialized to a value of 0 and adds a 1 to its stored contents in response to each input signal incr . when a signal incr is received by counter circuit 216 while it is in the all &# 34 ; 1s &# 34 ; state , its contents become all &# 34 ; 0s &# 34 ; and the cycle repeats . bit positions 0 through 8 of counter circuit 216 define a group of 128 digital words to be refreshed while bit positions 9 through 15 define which word of that refreshed group is to be read from memory . associated with counter circuit 216 is a read designator 229 which is a permanent logical &# 34 ; 1 &# 34 ; and is transmitted to bit position r of memory address register 207 whenever the contents of counter circuit 216 are so transmitted . three basic arrangements are provided for initiating refresh cycles . the memory system of the present invention normally operates in response to synchronizing pulses transmitted from a central processing circuit ( not shown ) on a conductor 101 . when no memory access is requested by the central processor , refresh cycles start in response to the synchronizing pulses from the central processor . when a memory access request from the central processor is present , arrangements are provided so that the refresh operation is hidden from central processor functions , i . e ., refresh will not delay central processor access . additionally , in the case that communications with the central processor cease , a system of timers is employed to activate the refresh cycles independently of the synchronizing signals from the central processor . the following description relates to the operations during a given refresh cycle . a more detailed description of the commencement of a refresh cycle is given later herein . a refresh operation is commenced when a logical &# 34 ; 1 &# 34 ; is applied as an input to flip - flop 217 via a conductor 218 . flip - flop 217 responds to the logical &# 34 ; 1 &# 34 ; at its input terminal by transmitting a logical &# 34 ; 1 &# 34 ; via conductor 219 to a refresh controller 220 . fig4 is a timing diagram showing the timing and control signals generated to enable a refresh operation including certain signals generated by the refresh controller 220 . it should be noted that each refresh operation is performed within one 700 nanosecond time period which , as will be described later herein , is a basic functional time period for the memory system . the logical &# 34 ; 1 &# 34 ; output of flip - flop 217 is also applied to an and gate 221 . and gate 221 is shown as a single and gate ; however , it actually comprises seventeen and gates , each uniquely associated with a particular bit position of counter circuit 216 or with the read designator 229 . the contents of counter circuit 216 and the read designator 229 are transmitted via and gate 221 and or gate 222 to memory address register 207 . refresh controller 220 responds to the logical &# 34 ; 1 &# 34 ; from flip - flop 217 by generating the chip enable signal ( fig4 ) which is transmitted via or gate 210 to enable decoder 209 in each of the memory units 202 through 204 . as previously described , this chip enable signal is transmitted to the two memory circuits selected by the enable decoder in each memory unit . refresh controller 220 further generates a trap signal tp which is applied to an and gate 223 . and gate 223 also receives as inputs both portions of the address presently stored by counter circuit 216 and the &# 34 ; 0 &# 34 ; output of a flip - flop 224 . in the manner previously described , one bit from each of the memory units is transmitted to an associated bit position of output register 215 . the contents of output register 215 are applied directly to a parity check circuit 225 . parity check circuit 225 computes the parity of the twenty - four information digits in output register 215 and compares that with the two - digit error check code accessed from memory . if the two are identical , it takes no further action . if the two do not match , a logical &# 34 ; 1 &# 34 ; is applied to an and gate 227 via a conductor 226 . it is the function of and gates 223 and 227 and flip - flop 224 to generate an error indication in response to a parity failure during a refresh operation and to retain the address contained by counter circuit 216 in trap register 228 in response to the first parity failure detected by parity check circuit 225 . flip - flop 224 is normally in the logical &# 34 ; 0 &# 34 ; state which results in the transmission of a logical &# 34 ; 1 &# 34 ; to and gate 223 via conductor 230 . accordingly , whenever a trap signal tp is generated by the refresh controller 220 , the then current contents of counter circuit 216 are placed in trap register 228 . it should be mentioned that the inputs to trap register 228 are the type referred to as double rail , meaning that no reset pulse is necessary to clear the contents of the trap register . as long as flip - flop 224 continues to store a logical &# 34 ; 0 ,&# 34 ; the contents of the counter circuit 216 will be transmitted to trap register 228 during each refresh operation . if the parity check circuit 225 detects a parity failure , a logical &# 34 ; 1 &# 34 ; is applied as one input to and gate 227 . if flip flop 224 is in the &# 34 ; 0 &# 34 ; state , conductor 230 further applies a logical &# 34 ; 1 &# 34 ; as another input to and gate 227 . when the signal strobe ( fig4 ) is generated by refresh controller 220 , it is further applied as an input to and gate 227 . this input signal condition of and gate 227 causes it to transmit a logical &# 34 ; 1 &# 34 ; output to the toggle input of flip - flop 224 in response to which flip - flop 224 changes state to the logical &# 34 ; 1 &# 34 ; state . the logical &# 34 ; 1 &# 34 ; output of flip - flop 224 is a parity failure signal . the logical &# 34 ; 1 &# 34 ; state of flip - flop 224 results in a logical &# 34 ; 0 &# 34 ; being transmitted on conductor 230 which inhibits and gate 223 from gating any further information from counter circuit 216 to the trap register 228 . that is , the contents of counter circuit 216 at the time the parity check failure was detected are stored in trap register 228 and will not be changed until the state of flip - flop 224 is changed . the logical &# 34 ; 0 &# 34 ; on conductor 230 is also returned to inhibit and gate 227 from transmitting any further logical &# 34 ; 1s &# 34 ; to the toggle input of flip - flop 224 . accordingly , the state of flip - flop 224 will not be changed until a clear signal is applied to its clear input . this clear signal will be applied either by the central processor during diagnostic and fault recovery routines or by an individual who is attempting to diagnose the malfunction in the memory system . it should be noted that each address generated by counter circuit 216 is temporarily placed in trap register 228 . this is purely transitory in nature and no address is considered to be stored in trap register 228 until the change of state of flip - flop 224 in response to a parity failure indication from parity check circuit 225 . near the end of each refresh operation refresh controller 220 generates the signal incr ( fig4 ) which is transmitted to counter circuit 216 . counter circuit 216 , in response to this signal increments its contents in preparation for the next refresh operation . refresh controller 220 also generates a clear signal which is transmitted to a clear input terminal of flip - flop 217 which responds thereto by storing a logical &# 34 ; 0 ,&# 34 ; thus terminating the refresh operation . the above description of a single refresh operation provides the basis from which the overall refresh cycle is produced . during each refresh operation , a group of 128 digital words is refreshed . the particular group refreshed being defined by the address portion comprising bits 0 through 8 of counter circuit 216 . by the advantageous operation of counter circuit 216 and its connection to memory address register 207 , the entire memory is refreshed after 512 refresh operations . when each refresh operation requires approximately 2 . 8 microseconds , a total refresh cycle can be completed in approximately 1 . 43 milliseconds . during each refresh operation , a given memory word , defined by the second address portion defined by bit positions 9 through 15 of counter circuit 216 , will be read from the memory and applied to parity check circuit 225 . after each refresh cycle , comprising 512 refresh operations , counter circuit 216 adds one to second address portion of counter circuit 216 , causing the parity check circuit to receive a new set of digital words from the memory during the next 512 refresh operations . when operating in accordance with this description , a new set of digital words will be read from the memory during each 512 refresh operation - refresh cycle . after 128 times through the entire refresh cycle , every digital word stored by the memory system will have been applied to parity check circuit 225 . if any parity failures have occurred , the address of the first failing digital word is stored in trap register 228 . if no parity failures have occurred , then it is known that the system contains only good data . as above described , a refresh operation is commenced three different ways . one of these ways comprises the performance of a refresh operation in conjunction with a memory request from the central processor in such a manner that the central processor request is not delayed by a refresh operation . whenever the central processor requires access to memory , it transmits the desired address ( and data when a memory write is to be performed ) to the memory system just prior to a memory sync pulse on conductor 101 . the information transmitted by the central processor to the memory system includes a control portion which defines whether a read or a write operation is to be performed and a gate pulse which gates the address , data and control portion into register 102 . in the present embodiment the control portion comprises two mutually exclusive digits designated r and w in fig1 . when a read operation is to be performed the digit r = 1 and the digit w = 0 . conversely , if a write operation is to be performed the digit w = 1 and the digit r = 0 . the r and w digits are transmitted from register 102 as inputs to an or gate 103 the output of which is connected as an input to an and gate 104 . accordingly , whenever a memory access is requested by the central processor or gate 103 will transmit a logical &# 34 ; 1 &# 34 ; to one input of and gate 104 . the other input of and gate 104 is connected to conductor 101 which receives the sync pulses from the central processor . at the next occurring sync pulse after an access request has been received by register 102 , and gate 104 generates a logical &# 34 ; 1 &# 34 ; output which is transmitted to the toggle input of a flip - flop 105 . flip - flop 105 responds to the logical &# 34 ; 1 &# 34 ; input by assuming the logical &# 34 ; 1 &# 34 ; state and transmitting a logical &# 34 ; 1 &# 34 ; on an output conductor 106 to a memory access control circuit 107 which responds thereto by generating certain gating signals shown in fig5 . the contents of register 102 excluding the digit w , are transmitted as inputs to an and gate 108 . and gate 108 is in actuality a plurality of and gates , one corresponding to each of the storage positions of register 102 except the w storage position . however , for the sake of simplicity , it is shown in fig1 as a single gate . when enabled , memory access control circuit 107 generates a logical &# 34 ; 1 &# 34 ; memory address gating signal ( mag ; fig5 ) which is transmitted to and gate 108 . signal mag enables and gate 108 to transmit the address portion and the r digit from register 102 to memory address register 207 via or gate 222 . enabling and gate 108 also transmits the data portion of register 102 to a data register 231 . after a sufficient period of time has passed so that the information transmitted to memory address register 207 and data register 231 is known to be stable , memory access control circuit 107 transmits a memory chip enable signal ( mce ; fig5 ) on conductor 109 . signal mce is transmitted via or gate 210 to all of the memory units 202 through 204 . memory units 202 through 204 respond to the input address and the memory chip enable signal from memory access control circuit 107 by performing the read or write operation requested , as defined by the status of the r bit . either read or write operations are completed within 700 nanoseconds of the sync pulse from the central processor . however , by design memory access requests are transmitted from the central processor only once every 1400 nanoseconds . all of the storage cells of memory 201 can be refreshed within the required time period if refresh cycles are commenced at approximately every fourth sync pulse from the central processor ( 2 . 8 microseconds ). a state counter 110 counts the incoming sync pulses from central processor on conductor 101 to define when a refresh operation is desirable . state counter 110 has four states numbered 0 , 0 through 1 , 1 which change in recurring binary sequence in response to the sync pulses from the central processor . accordingly , if state counter 110 is in state 0 , 0 at a given time , then three sync pulses later it will be in state 1 , 1 . state counter 110 will be in a given state every four sync pulses which occurs approximately every 2 . 8 microseconds . control is exercised by state counter 110 by generating a logical &# 34 ; 1 &# 34 ; on an output conductor 11 while in the 1 , 1 state and a logical &# 34 ; 1 &# 34 ; on a conductor 00 while in the 0 , 0 state . under normal operation , a refresh operation will be commenced during the state 1 , 1 unless a memory access request from the central processor began during that state . if such a request has begun , the refresh operation is put off until state 0 , 0 at which time the memory will be available for refresh . availability is certain since all memory requests are completed in less than 700 nanoseconds while the next request will not arrive for an additional 700 nanoseconds . whenever state counter 110 is in the 1 , 1 state , a logical &# 34 ; 1 &# 34 ; is applied as an input to an and gate 111 . and gate 111 also receives as an input a delayed representation of the sync pulses from central processor ( delay sync ; fig5 ). the output of an or gate 112 is the third input to and gate 111 . or gate 112 receives as inputs an inverted representation of the signals on conductor 106 and a signal from memory access control circuit 107 denoted 700 plus ( fig5 ). the signal 700 plus becomes a logical &# 34 ; 1 &# 34 ; during the second 700 nanosecond memory cycle after flip - flop 105 has been enabled . accordingly , the memory will be available for access during any cycle in which the 700 plus signal is a logical &# 34 ; 1 &# 34 ;. when , during state 1 , 1 , flip - flop 105 stores a logical &# 34 ; 0 &# 34 ; indicating that no memory access has been requested during this or the preceding cycle , a logical &# 34 ; 1 &# 34 ; is transmitted from or gate 112 to and gate 111 due to the inverted output of flip - flop 105 . this logical &# 34 ; 1 &# 34 ; in combination with the logical &# 34 ; 1 &# 34 ; indication of state 1 , 1 and the logical &# 34 ; 1 &# 34 ; of the delay sync signal causes and gate 111 to generate a logical &# 34 ; 1 &# 34 ; output which is transmitted to or gate 113 . receipt of a logical &# 34 ; 1 &# 34 ; by or gate 113 causes it to transmit a logical &# 34 ; 1 &# 34 ; on conductor 218 , thus initiating a refresh cycle in the manner described above . on the other hand , when the flip - flop 105 is generating a logical &# 34 ; 1 &# 34 ; during state 1 , 1 , a logical &# 34 ; 0 &# 34 ; is applied as the input to or gate 112 representing the inverted output of flip - flop 105 . if this is the first 700 nanosecond period of a memory access request , the 700 plus signal is also a logical &# 34 ; 0 .&# 34 ; accordingly , and gate 111 will not be enabled to start a refresh cycle . the 700 plus signal will be a logical &# 34 ; 1 &# 34 ; during the following state 0 , 0 . the output signals of state counter 110 on conductor 00 and the 700 plus signal from memory access controller 107 are applied as inputs to an and gate 114 . the combination of state 0 , 0 and the logical &# 34 ; 1 &# 34 ; 700 plus signal enables an and gate 114 to transmit a logical &# 34 ; 1 &# 34 ; to or gate 113 thereby enabling a refresh operation during state 0 , 0 . further , when the logical &# 34 ; 0 &# 34 ; input to or gate 112 from flip - flop 105 is received during a state 1 , 1 , which is occurring more than 700 nanoseconds after flip - flop 105 was enabled , a logical &# 34 ; 1 &# 34 ; 700 plus signal is transmitted via or gate 112 to and gate 111 . the combination of the delay sync signal , state 1 , 1 and the logical &# 34 ; 1 &# 34 ; from or gate 112 will enable and gate 111 which in turn starts refresh circuitry during state 1 , 1 . when operating as above described , a refresh operation will be commenced during every state 1 , 1 if no central processor memory access requests occur . when such requests do occur , a refresh operation is commenced during either state 1 , 1 or 0 , 0 , depending on the time those requests are received . it is also essential to provide a system which will operate when the sync pulses from central processor no longer occur . to this end the present embodiment includes a two - microsecond timer 115 which counts the time intervals between sync pulses from the central processor . if no sync pulse is received for two microseconds , timer 115 enables a 2 . 8 microsecond pulse circuit 116 . pulse circuit 116 generates a logical &# 34 ; 1 &# 34 ; pulse every 2 . 8 microseconds each of which is transmitted via or gate 113 to flip - flop 217 to continually enable the refresh function . if the central processor sync signals are again resumed the two - microsecond timer 115 disables the 2 . 8 microsecond pulse circuit 116 and the refresh operations are again controlled from the central processor sync signals . the preceding description concerns a system having specific characteristics . the principles of the invention , however , can be applied to any dynamic memory system in which the digital words stored thereby are refreshed in groups of n digital words and the memory system stores m such groups of memory words . a first group defining address generator having m possible output states is utilized to control the refresh of all groups of digital words in sequence . a second address generator , having n possible output states , is also employed to select a word from each group refreshed to have its parity checked . the state of the second counter should be incremented after each complete cycle of m group refreshes to provide a new set of digital words for parity check during each successive total memory refresh . when operating as described above , the complete memory will be refreshed after m refresh operations and the parity of the digital words stored will be checked after m × n refresh operations . | 6 |
as illustrated in fig1 a door lever assembly 10 for use in single or double door applications requiring breakaway lever action includes a lever handle 12 rotatably coupled by a bushing sleeve 86 to a trim housing 16 . the trim housing 16 is formed from a stamped , non - machined metal , and has a pair of weld studs 44 electrically welded at opposite ends to the trim housing 16 . as best seen by consideration of fig1 and 2 , several components are fixed within the trim housing 16 , including a pair of guide rods 80 held by a front block 88 and an end block 82 . the guide rods 80 are of cylindrically shaped metal construction , and are dimensioned to snugly fit longitudinally within the trim housing 16 , with each end adjacent to an edge of the trim housing 16 . as will be appreciated from consideration of the figures , the guide rods 80 retain and properly position other components of the door lever assembly 10 , including a plate 40 with its door lock apertures 38 and integrally defined turned edge that forms stop plate 34 . extending respectively through the front block 88 and end block 82 are mounting studs 14 . each mounting stud 14 engages either the front block 88 or end block 82 to hold the blocks 88 or 82 a predetermined distance apart from the trim housing 16 . in addition , each mounting stud is knurled to provide a space to conformably accommodate the guide rods 80 . the blocks 88 and 82 are also respectively provided with key hole slots 92 that hold the blocks in position in the trim housing by engagement with the weld studs 44 . in contrast to the foregoing fixed components , the door lever assembly 10 includes a number of interconnected linearly movable or rotatable components . for example , when unlocked , turning a lever handle 12 of conventional design results in rotation of an eccentrically configured cam 42 , which in turn linearly moves a slider 30 and its connected lift arm 24 to retract door latches 61 . the lift arm 24 moves components of a door latch assembly 60 ( see fig1 and 6 ), including connected vertical rods 62 that operate retraction or extension of door latches 61 . the door lever assembly 10 controls the lock / unlocked position of the door latch assembly 60 using a conventional key cylinder 46 that extends through the trim housing 16 to engage a conventional blocking slide 45 of the door latch assembly 60 . the blocking slide 45 is moved upward or downward by rotation of the key cylinder 46 . when the blocking slide 45 is positioned in an unlocked , upward position ( position not indicated in the figures ), linear movement upward of the lift arm 24 is not impeded . however , when the blocking slide 45 is positioned in a downward , locked position , linear movement of the lift arm 24 is impeded . as those skilled in the art will appreciate , construction of the lift arm 24 can be varied to accommodate various embodiments of the invention . however , the lift arm 24 will typically be constructed from a single integral piece of metal to have a flat lock engaging portion 26 , a spring engaging portion 28 immediately adjacent to an outwardly extending lobe 27 , and a pivot engaging portion 25 rotatably attached by a pivot pin 29 to the slider 30 . the lock engaging portion 26 engages the blocking slide 45 of the door latch assembly 60 when the blocking slide 45 is positioned in its locked position . the lift arm 24 is not connected to the slider 30 solely by the pivot pin 29 . in addition , the spring engaging portion 28 of the lift arm is attached to the linearly movable slider 30 by an over - ride assembly 18 that includes an over - ride spring 20 . the over - ride spring 20 includes first and second coils 21 and 22 held in compressive engagement with the slider 30 . the coils 21 and 22 are connected by a connector 23 that engages the spring engaging portion 28 of the lift arm 26 . the over - ride spring 20 is typically configured to have a high spring constant , and under normal operating torque is preloaded with sufficient force to be essentially inelastic . however , when sufficiently high forces are exerted the preload force will be overcome and the over - ride spring 20 will begin to compress in response to relative movement of the lift arm and slider . as will be appreciated by those skilled in the art , the exact spring material and configuration can be varied , and it is even possible to use elastomeric materials in place of coiled springs as necessary . the slider 30 is a generally flat plate constrained for movement along the guide rods 80 , and in normal operation is vertically movable within the trim housing 16 . vertical movement of the slider is indirectly promoted by rotational movement of the eccentrically configured cam 42 , which causes an integrally defined cam wing 43 to rotate counterclockwise , upwardly pushing the slider 30 in a direction indicated by arrow 31 , and in turn upwardly impelling the lift arm 24 . opposing upward movement of the slider 30 are dual lift springs 32 fitted over the guide rods 80 to lie between the slider 30 and plate 40 . the lift springs 32 are biased to normally push the slider 30 downward , away from the plate 40 . this downward impulse acts to rotate the cam 42 clockwise . this rotation of the lever 10 will also propel the slider 30 in the direction indicated by the arrow 31 . in normal operation , the cam 42 is rigidly coupled to rotate in response to rotation of the lever handle 12 by the combination of a shaft 48 , shear pin 49 , plunger 54 , and reset spring 55 . as best seen in fig4 and 5 , the shear pin 50 is fitted into a shear pin connection groove 51 defined by the shear pin 49 . a rectangular , flat edged portion 50 of the shear pin 49 extends perpendicularly outward from the hollow shaft 48 to engage flat edged walls 52 defined in the cam 42 . the shear pin 49 is held in place by a plunger 54 that has a hemispherical head capable of extending longitudinally outward from the shaft 48 . the shear pin 49 is also supported by a reset spring 55 connecting the shear pin and lever handle 12 . the shear pin 49 consequently &# 34 ; floats &# 34 ; within the shaft 48 , being longitudinally movable within the shaft in response to force applied to the hemispherical head of the plunger 54 . normally , the reset spring 55 is biased to ensure that the shear pin is engaged with the flat edge walls 52 of the cam 42 , so that rotation of the shear pin necessarily rotates the cam 42 . however , if the reset spring 55 is depressed as a result of depression of the plunger 54 , the shear pin 49 will drop out of contact with the flat edged walls 52 of the cam 42 , disengaging the rotating the lever handle 12 from the cam 42 . as illustrated in fig1 when the key cylinder 46 is turned the blocking slide 45 is downwardly forced to capture the lock engaging portion 26 of the lift arm 24 . this effectively locks the door lever assembly 10 , and ordinarily would prevent movement of the lever handle 12 under application of normal handle turning force . however , if abnormally high turning forces are applied to the lever handle 12 , the cam 42 will rotate , forcing the slider 30 upward toward the plate 40 . as best seen in fig3 the movement of slider 30 causes the lift arm 24 to pivot about its connection to the slider 30 ( pivot pin 29 ), against the resistance over - ride spring 20 . continued rotation of the lever handle 12 further compresses the over - ride spring 20 , and also causes lobe 27 of the lift arm 24 to depress a leaf spring 33 . eventually , continued movement of the slider 30 causes the lobe 27 of the lift arm 24 to slip off the leaf spring 33 , snapping the lobe 27 toward the cam 42 , where the lobe 27 strikes the plunger 54 . when the plunger 54 is struck by the lobe 27 of the lift arm 24 , the plunger 54 moves into the hollow shaft 48 , displacing and driving the shear pin 49 out of its connection with the shaft 48 . this effectively disengages the combined lever and shaft from the cam 42 , preventing damage to the door lever assembly 10 . however , resetting the shear pin 49 to its original position merely requires returning the lever handle 12 back to its original position , which permits the reset spring 55 to force the shear pin 49 back into position in the cam 42 . advantageously , the present invention allows the normal operation and use of a door lever assembly that is substantially identical to conventional door lever assemblies when normal forces are exerted . however , when excessive forces are exerted against the door lever handle , such as applied in attempts to force a door lock or vandalize , in a locked position the present mechanism disengages the lever from the cam by retraction of the shear pin into the shaft to prevent damage to the door lever assembly . there will be typically no need to rely on shear pin failure to prevent damage to the locked door lever assembly . as compared to conventional devices , the improved shear pin design and placement make shear pin failure both easier to rely upon and easier to replace . while the present invention has been described in connection with specific embodiments , it will be apparent to those skilled in the art that various changes may be made therein without departing from the spirit or scope of the invention . | 8 |
fig2 depicts a pedestal disposed between two printed circuit boards 101 , 102 according to a preferred embodiment of the present invention . in a preferred embodiment , pedestal 202 is disposed between pcb 1 201 and pcb 2 203 with these and other layers held in place by bolts 207 and compression plate 204 . of course , means of attachment other than bolts including , clips , clamps , screws , and pins may be employed , and all such variations are included within the scope of the present invention . conductive or resistive mechanisms are preferably disposed at the interfaces between pcb 1 201 and the pedestal 202 and between the pedestal 202 and pcb 2 203 . standard asic socket 206 is shown providing a conductive interface between pcb 1 201 and pedestal 202 , while a ball grid array attachment 205 is shown at the interface between pedestal 202 and pcb 2 203 . it will be appreciated that a range of different conductive mechanisms or conductive or resistive interfaces or interposers may be employed at either of the two pcb - pedestal interface locations and all such variations are included within the scope of the present invention . conductive mechanisms which may be employed include but are not limited to : metallized polymer interposer , ball grid arrays , land grid arrays coupled with an appropriate connection mechanism , and spring loaded pogo pins which couple with corresponding contacts . in a preferred embodiment , the thickness of pedestal 202 is such that pcb 1 201 and pcb 2 203 are spaced far enough apart that surface components ( not shown ) on the two boards do not make contact when pedestal 202 is properly in place between the two pcbs . the other dimensions of pedestal 202 are preferably flexible depending upon the application . the availability of real estate on the printed circuit boards 201 and 203 , the number of electrical connections which will be made through pedestal 202 , and the amount of dielectric employed to protect the conductive paths within pedestal 202 may all be factors in determining the width and length of pedestal 202 . in a preferred embodiment , the structure of pedestal 202 is substantially that of a special purpose printed circuit board . generally , pedestal 202 is provided with a rectangular footprint and may be fabricated employing materials which are the same or similar to those employed in the manufacture of general purpose pcbs , such as , for instance , fr4 , teflon ®, polyimide , gore - tex ®, epoxy impregnated expanded ptfe ( teflon ®), getek ®, ru - duroid ®, and fiberglass - epoxy . although pedestal 202 may generally be provided with a rectangular layout ( footprint ), the inventive pedestal may assume any shape and remain within the scope of the present invention . electrical transmission through pedestal 202 may also be provided in a manner similar to that provided in general purpose printed circuit boards . for example , conductive landings may be provided on the upper and lower surfaces of pedestal 202 which are coupled to vias for providing electrical conductance between the two surfaces of pedestal 202 . vias may be provided in various forms within pedestal 202 including but not limited to : through - hole vias , blind vias , and buried vias . moreover , parts , including but not limited to electronic components , may be disposed within vias of any of the above - listed varieties of vias . in a preferred embodiment , the thickness of pedestal 202 is such as to enable ample insulation of the conductive paths connecting the two surfaces of pedestal 202 , and thereby the two pcbs connected to pedestal 202 . the conductive paths are thereby preferably able to provide a high level of signal integrity for electrical communication transmitted through pedestal 202 . the thickness of pedestal 202 also preferably allows for room to permit a number of signal layers within pedestal 202 , thereby providing for considerably greater signal density , or bandwidth , than was available with prior art approaches . preferably , one by - product of the improvement in signal quality or integrity through pedestal 202 , is that circuit sub - systems which previously had to be located on a single pcb because the loss of signal integrity when employing connectors between two pcbs may located on two or more pcbs when these pcbs are connected employing one or more inventive pedestals . the pedestal 202 may thereby operate to remove a burdensome design constraint , reduce design time , and remove the burdensome need to incorporate an entire circuit sub - system on a single chip . it will be appreciated that two general purpose pcbs are shown joined by one pedestal in the embodiment depicted in fig2 such pcbs may be joined by any number of pedestals , and all such variations are included in the scope of the present invention . in a preferred embodiment , pedestal 202 forms a permanent attachment with one pcb and is joined with the other employing a more easily removable connection to another . alternatively , both connections could be permanent , or both easily removable , and all such variations are included within the scope of the present invention . in fig2 ball grid array connection 205 between pedestal 202 and pcb 2 203 generally serves as a permanent ( low inductance ) connection , while a socket connection 205 , which is preferably a metalized polymer socket interposer is shown at the interface between pedestal 202 and pcb 1 201 . an optional additional step which may be performed to add stability to the soldered connection between pedestal 202 and pcb 2 is to add non - conductive epoxy to the soldered connection to lend strength to this connection to prevent breakage or deformation of the solder under compression . fig3 depicts an asic 303 and a pedestal 202 disposed opposite one another on the same printed circuit board 201 according to a preferred embodiment of the present invention . the embodiment of fig3 adds an asic to the embodiment shown in fig2 . asic 303 is preferably connected to pcb 1 201 opposite pedestal 202 . substantial economy of effort and synergy may be effected by connecting asic 303 and pedestal 202 in this manner . preferably , matching lgas ( land grid arrays ) 302 are employed to connect pedestal 202 and asic 303 , respectively , to pcb 1 201 . preferably , the use of matching lgas in this manner enables the same lga artwork to be used for both lgas , thereby providing conservation of design time . in a preferred embodiment , the area on pcb 1 201 to which asic 303 would be attached would generally be configured with provision for high density electrical signal connections . accordingly , connecting pedestal 202 directly opposite asic 303 on pcb 1 201 operates to efficiently employ the high density connection area on pcb 1 201 for attachment of two devices instead of one , thereby providing added efficiency . such proximate attachment of asic 303 to pedestal 202 also preferably beneficially reduces signal path length and associated disruptions in signal integrity for signals traveling to and from asic 303 through pedestal 202 . as in fig2 pedestal 202 is shown connected to compression plate 204 employing a solder ball grid array 205 . however , it will be appreciated than any of the connections between pcb 2 203 and pedestal 202 , between pcb 1 201 and pedestal 202 , and pcb 1 201 and asic 303 may be established employing a range of connection mechanisms including but not limited ball grid arrays , land grid arrays , metalized polymer interface interposer , and pogo pins or other spring metallic contacts . connection 205 is shown employing a ball grid array because generally the pedestal is substantially permanently attached to one of the pcbs , which in the embodiment of fig3 is pcb 2 203 . alternatively however , pedestal 202 could be permanently attached to both pcbs , or to neither pcb , and all such variations are included in the scope of the present invention . fig4 depicts a top view 400 of the inventive pedestal 202 according to a preferred embodiment of the present invention . pedestal 202 preferably boasts a footprint ( two dimensional shape in the view of fig4 ) substantially matching that of a typical asic 303 which may be attached to any of the general purpose printed circuit boards employed in a computer assembly . preferably , pad array 403 is suitable for connection to a land grid array or other conductive mechanism for insertion in between pedestal 202 and one of the general purpose printed circuit boards 201 and 203 . holes 401 and 402 are preferably employed to properly align pedestal 202 with a printed circuit board to which it is being attached . ears 404 and 405 are also optionally provided to aid in properly aligning pedestal 202 . it will be appreciated that ears 404 and 405 as well as holes 401 and 402 are both optional in the design of pedestal 202 . fig5 is a cross - sectional view 500 of a pedestal including through hole vias 501 according to a preferred embodiment of the present invention . preferably , a typical conductive path for signals traveling through pedestal 202 would be from pcb 2 203 through solder connection 503 , to conductive landing 502 , along through - hole via 501 onto a lower landing 504 through another solder connection 505 and on to pcb 1 201 . it will be appreciated that a range of conductive or resistive connection mechanisms could be employed in place of solder connections 502 and 504 , as discussed elsewhere in this application , and all such variations are included within the scope of the present invention . other via configurations may be employed as well as shown in fig6 . fig6 is a cross - sectional view 600 of a pedestal 202 including blind and buried vias according to a preferred embodiment of the present invention . the embodiment of fig6 augments the embodiment depicted in fig5 by including both blind vias and buried vias as well as through - hole vias as parts of a conductive path through pedestal 202 . one possible conductive path between pcb 2 203 and pcb 1 201 proceeds through solder connection 503 to conductive landing 603 , along blind via 601 , then along conductive layer 604 to buried via 602 , along second conductive pad 605 , along blind via 606 , to conductive landing 604 , through solder connection 505 , and onto pcb 1 201 . it will be appreciated that numerous conductive connections could be made in place of solder connections 503 and 505 , as discussed elsewhere in this application , and that all such variations are included in the scope of the present invention . moreover , the sequence of vias depicted in fig6 is exemplary . numerous combinations and sequences of vias of various kinds including through - hole vias , blind vias , and buried vias may be employed in combination with various conductive or resistive layers and landings , in configurations varying from those depicted in fig6 and all such variations are included in the scope of the present invention . in an alternative embodiment , the inventive pedestal is not limited to being a substantially flat specialized pcb with a rectangular footprint which interfaces general purpose pcbs which are aligned parallel to each other . alternative designs could include pedestals which connect printed circuit boards at various distances and relative orientations with respect to each other . for example , a pedestal could be configured in the shape of an angle bracket which connects two pcbs oriented ninety degrees apart . the angle bracket shaped pedestal could form electrical connections either through the side of each pcb , or as in the preferred embodiment , employing an interface on one or more surfaces of the pcb . preferably , other relative orientations of pcbs could be accommodated by the inventive pedestal . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 7 |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.