text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
fig1 shows a block diagram of a communication network , which includes a transmission chain 100 . transmission chain 100 may be comprised of a boarder router 110 , a qos enforcer 120 , one or more data processors 130 a to 130 n , an encapsulation function or an encapsulation device 140 , and a modulator 150 . furthermore , as transmission chain 100 may be a part of a communication network , fig1 also shows a network controller 160 and a front end unit 190 . boarder router 110 may be configured to allow only selected traffic to enter the transmission chain , such as traffic destined to one or more receiving parties at the other end of the transmission channel . qos enforcer 120 may be configured to at least provide flow control functionality by limiting the total data rate sent towards data processors 130 a to 130 n and thereafter towards encapsulation function 140 . in some embodiments , qos enforcer 120 may be replaced by a traffic engineering device or a traffic shaping device , which perform similar flow control functions . one or more data processors 130 a to 130 n may be configured to receive user data and process it using one or more methods and / or algorithms , including but not limited to encryption algorithms , compression algorithms , acceleration methods and any other method which may be applicable for optimizing user traffic over the transmission link . furthermore , data processors 130 a to 130 n may be configured to send the processed data towards encapsulating device 140 , e . g . over an ip protocol . in some embodiments , one or more tcp and / or udp tunnels may be used by each data processor in order to transfer different types of data ( e . g . real - time information , multicast streams , non - real - time data , etc ). encapsulation device 140 may be configured to at least receive user data information ( e . g . over an ip protocol using one or more tcp and / or udp tunnels ), encapsulate it over an applicable transport stream ( e . g . baseband frames for a dvb - s2 carrier in a satellite communication system ) and provide the transport stream to modulator 150 . modulator 150 may be configured to at least modulate the transport stream using the applicable modulation technique and to output a modulated signal . though fig1 shows encapsulation device 140 and modulator 150 as two different entities or devices , in some embodiments the encapsulation function may be integrated with the modulator in a single device . both types of embodiments are consistent with the aspects of this invention . furthermore , in some embodiments , where no processing of the user data prior to transmission is required , data processors 130 a to 130 n may be either bypassed or absent from the transmission chain . in such embodiments , user data may be sent from qos enforcer 120 directly to encapsulation device 140 . this type of embodiments is also consistent with the aspects of this invention . in yet further embodiments , the output of modulator 150 may be fed into a front - end 190 , which may be configured to do any one or more of amplifying the modulated signal , changing the signal &# 39 ; s carrier frequency , converting the signal to a different form ( e . g . form electric form to electro - magnetic form or to optic form ) and any other function which may be required in order to actually have the signal transmitted over the designated media . in some communication systems , modulator 150 and encapsulation device 140 may be configured to use one or more adaptive transmission techniques ( e . g . dvb - s2 in satellite communication systems ), whereby the spectral efficiency of the modulated signal may be modified on a frame - by - frame basis . if a receiving station has good reception conditions ( i . e . the transmitted signal is received at high c / n ratio ), modulator 150 may be indicated to modulate the data destined to that station using a modulation technique , which maps more bits into each transmitted symbol . furthermore , encapsulation device 140 may be indicated in such a case to encode said data using weaker forward error correction ( fec ) codes for at least the purpose of decreasing the number of transmitted bits used for fec . on the other hand , if a receiving station has medium or poor reception conditions ( i . e . the transmitted signal is received at low or minimal c / n ratio respectively ), modulator 150 may be indicated to modulate the data destined to that station using a modulation technique , which maps less bits into each transmitted symbol . furthermore , encapsulation device 140 may be indicated in such a case to use stronger fec codes , which may impose higher overhead but also increase the probability of recovering the transmitted data at the receiving side . in some embodiments , a network controller ( e . g . network controller 160 ) may be configured to send and data processors 130 a to 130 n may be configured to receive information regarding a most efficient modcod combination that may be supported by a receiving party . data processors 130 a to 130 n may be further configured to attach modcod information received from the network controller to every data packet sent towards encapsulation device 140 , wherein said modulation and coding ( modcod ) information relates to the receiving party which the data included in the transmitted packet is destined for . in yet further embodiments , where data processors are not used , modcod information may be sent from the network controller to encapsulation device 140 , which may be further configured to use the appropriate modcod information based on destination analysis . each modcod combination , as described above , may be characterized by a different spectral efficiency figure , i . e . different number of user bits per transmitted symbol . since modcod adaptability may be implemented on a frame - by - frame basis and since modulator 150 , in most cases , may be configured to transmit at a constant preconfigured symbol rate , the channel &# 39 ; s throughput depends on the number of frames transmitted using each modcod combination . throughput may be higher as more frames are transmitted using more efficient modcod combinations , or lower as more frames are transmitted using more robust and less efficient modcod combinations . in one aspect of this invention , encapsulation device 140 may be configured to calculate an average spectral efficiency figure for the transmission channel and thereafter use this average spectral efficiency figure for calculating the available user data throughput or bit rate . encapsulation device 140 may be configured to measure the actual user data throughput , e . g . by counting and / or calculating the number of user traffic bits or bytes being transmitted over a period of time . encapsulation device 140 may be further configured to gather information on the current blend of modcod combinations , which may be used for transmitting the same user data traffic over the same period of time . as previously described , modcod information may be attached to each data packet arriving from the data processors or internally generated by encapsulation device 140 based on information received from a network controller . using this modcod information , encapsulation device 140 may calculate the number of user traffic bits or bytes that were transmitted using each modcod combination . having measured the actual user throughput and determining how many user traffic bits or bytes have been transmitted using each modcod combination , encapsulation device 140 may calculate the average spectral efficiency for the transmitted data . furthermore , knowing the preconfigured channel ( symbol ) rate , encapsulation device 140 may be configured to calculate the number of unused symbols ( which may be filled either by modulator 150 with dummy frames or by encapsulation device 140 with null packets ). knowing the number of unused symbols per the measurement interval , encapsulation device 140 may further be configured to calculate the user traffic bit rate or throughput that may be accommodated by these unused symbols assuming the average spectral efficiency previously calculated is applicable to these symbols as well . the above mechanism may be further described using the following example . considering the following traffic being transmitted : port # 1 of encapsulation device 140 may receive user traffic at a rate of 250 kbytes per second ( 2 mbps ), out of which 100 kbytes per second are transmitted using a qpsk 5 / 6 modcod combination and the remaining 150 kbytes per second are transmitted using an 8psk 2 / 3 modcod option . port # 2 of encapsulation device 140 may receive user traffic at a rate of 250 kbytes per second ( 2 mbps ), all of which is transmitted using an 8psk 2 / 3 modcod option . encapsulation device 140 generates 1 mbps worth of null packets , which are transmitted using a qpsk1 / 4 modcod combination . considering only the user traffic on ports # 1 and # 2 , and given that the spectral efficiency figures for qpsk 5 / 6 is 1 . 654663 and that of 8psk 2 / 3 is 1 . 980636 , the average spectral efficiency may be calculated as follows : in addition , given a spectral efficiency figure of 0 . 490243 for the qpsk1 / 4 modcod combination and the average spectral efficiency for user traffic as calculated above , the available bandwidth represented by the null packets may be calculated as follows : in another aspect of this invention , a feedback path may exist between encapsulation device 140 and qos enforcer 120 . encapsulation device 140 may be configured to use this feedback path for at least the purpose of sending the calculated available bit rate to qos enforcer 120 . though there might be many appropriate methods for sending the available bit rate information to qos enforcer 120 , in some preferred embodiments this information may be encapsulated into an snmp trap packet , which may be transmitted over a local lan to which both devices may be connected . furthermore , qos enforcer 120 may be configured to receive available bit rate information over a feedback channel and to reconfigure any of its internal software and / or hardware modules for at least the purpose of regulating its output bit rate according to the received available bit rate information . in some embodiments , qos enforcer 120 may first serve preconfigured service level agreements ( sla ) and high priority applications and only then allocate the remaining throughput to other applications , streams and / or traffic types . thus , changes in the transmission channel &# 39 ; s throughput may affect low priority traffic while sla and high priority applications may continue to receive high quality of service ( i . e . their required throughput ). as will be appreciated by one of skill in the art upon reading the following disclosure , various aspects described herein may be embodied as methods , systems , apparatus ( e . g ., components of a satellite communication network ), and / or computer program product . accordingly , those aspects may take the form of an entirely hardware embodiment , an entirely software embodiment or an embodiment combining software and hardware aspects . furthermore , such aspects may take the form of a computer program product stored by one or more computer - readable storage media having computer - readable program code , or instructions , embodied in or on the storage media . any suitable computer readable storage media may be utilized , including hard disks , cd - roms , optical storage devices , magnetic storage devices , and / or any combination thereof . in addition , various signals representing data or events as described herein may be transferred between a source and a destination in the form of electromagnetic waves traveling through signal - conducting media such as metal wires , optical fibers , and / or wireless transmission media ( e . g ., air and / or space ). while illustrative systems and methods as described herein embodying various aspects of the present invention are shown , it will be understood by those skilled in the art , that the invention is not limited to these embodiments . modifications may be made by those skilled in the art , particularly in light of the foregoing teachings . for example , each of the elements of the aforementioned embodiments may be utilized alone or in combination or sub - combination with elements of the other embodiments . it will also be appreciated and understood that modifications may be made without departing from the true spirit and scope of the present invention . the description is thus to be regarded as illustrative instead of restrictive on the present invention . | 7 |
reference will now be made in detail to the present invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . methods and systems consistent with the principles of some embodiments of the present invention enhance a consumer &# 39 ; s personal shopping experience by providing a personal shopping device to a consumer in a retail shopping environment and enabling the consumer , utilizing a consumer interface , to access information . further systems and methods consistent with principles of some embodiments of the present invention enable a user , through an application server , to manage information delivered to the personal shopping device . further systems and methods consistent with principles of some embodiments of the present invention enable a retailer to manage inventory , location of products within a shopping establishment and / or study and maximize product layouts in order to maximize sales . further systems and methods consistent with principles of some embodiments of the present invention provide a user with a loyalty card , personal key fob , etc . that interacts with the personal shopping device to customize the shopping experience . further systems and methods consistent with principles of some embodiments of the present invention provide for the efficient exchange of content between a personal shopping device and an application server . further methods and systems consistent with principles of some embodiments of the present invention enable manufacturers to schedule and send information to the personal shopping device . further methods and systems consistent with principles of some embodiments of the present invention enable customers to place orders for counter services . further methods and systems consistent with principles of some embodiments of the present invention enable efficient management of company information , shopping establishment information and customer information within the system . further methods and systems consistent with principles of some embodiments of the present invention enable a customer to generate and maintain a list of products for purchase . it may be appreciated by one of ordinary skill in the art , that the systems and methods discussed herein may be implemented in a variety of shopping environments . for exemplary purposes , systems and methods consistent with principles of the present invention will be discussed herein in a retail grocery shopping environment . the terms personal shopping device and personal computing device are used interchangeably herein . fig1 is an exemplary diagram of a system environment 100 for implementing the principles of the present invention . the components of system 100 may be implemented through any suitable combinations of hardware , software , and / or firmware . as shown in fig1 , system 100 includes a plurality of stores 1 02 , 104 . store 102 includes store server 110 that is maintained by the grocery store . store 102 further includes a plurality of servers 106 , 108 that may interact with a plurality of application servers 120 , 122 through network 116 . alternatively , servers 106 , 108 may be implemented as one server . store 102 may further include a buffer server 107 that is communicably linked to both store server 110 and one or both of application servers 106 , 108 . buffer server 107 may store information that may be shared between application server 106 , 108 and store server 110 . the buffer server 107 may serve to protect information stored at the respective servers , so that all information stores at the respective servers may be secure . alternatively , one of both of application servers 106 , 108 may be communicably linked to store server 1 10 . a plurality of personal shopping devices 112 , 114 physically located within or near store 102 may interact with servers 106 , 108 , using known technology , including wireless communication . a consumer may access the personal shopping device 112 to access and manage information to enhance their shopping experience . each personal shopping device 112 , 114 may be associated with a unique identifier . the consumer may access the personal shopping device 112 with a personalized key fob 140 . system 100 may further include operator server 124 wherein a user at server 124 may manage information that is provided to application servers 120 , 122 , servers 106 , 108 and / or personal shopping device 112 , 114 through network 116 . manufacturer 126 , 128 may further reside on within system 100 wherein manufacturer 126 , 128 may access application servers 120 , 122 to request and / or schedule information related to their products to be downloaded to personal shopping device 112 , 114 . system 100 may further include client computers 130 , 132 , which may be communicably linked to application servers 120 , 122 , wherein a consumer may enter information for access by the personal shopping device 112 , 114 . for example , the consumer may access application servers 120 , 122 and enter information , i . e ., a shopping list , for access at the grocery store by the personal shopping device 112 , 114 . finally , system 100 may include merchant servers 136 , 134 . merchant servers 134 , 136 may be accessed by application servers 120 , 122 and / or personal shopping devices 112 , 114 to obtain content for viewing by the consumer at the personal shopping device 112 , 114 . it may be appreciated by one of ordinary skill in the art that while only one or two devices , client computers , and / or servers may be depicted , that many devices , client computers , and / or servers may reside within system 100 . while network 116 may be implemented as the internet , network 116 may be any local or wide area network , either public or private . fig2 depicts an exemplary block diagram of components included in personal shopping device 112 , 114 . personal shopping device 112 , 114 may be implemented as a computing device that may be made a part of a shopping cart . personal shopping device 112 , 114 may include central processing unit 202 , a touch display screen 204 , application software 206 , memory 208 , secondary storage 210 , and input / output devices 212 . personal shopping device 112 , 114 may be communicably linked to servers 106 , 108 . further , personal shopping device 112 , 114 may be communicably linked to merchant server 134 , 136 through servers 106 , 108 . a customer may access network 116 through sever 106 , 108 using application software 206 wherein the application software may include a conventional browser including conventional browser applications available from microsoft or netscape . application software 206 may further include a user interface that enhances a consumer &# 39 ; s shopping experience by providing a plurality of features as discussed herein . input / output devices 212 may include , for example , a bar code reader , a usb port for receiving key fob 140 , an interface to receive a variety of external devices , including , but not limited to , a smart card , a floppy disk , an external memory device , i . e ., compact flash card , memory stick , etc ., and a touch screen display for displaying information to the consumer and receiving information from the customer through input at the touch screen , etc . fig3 depicts an exemplary block diagram of the components that may reside on key fob 140 consistent with principles of some embodiments of the present invention . as depicted in fig3 , identification information may be stored . upon issuance of the key fob 140 to the consumer , the system associates unique identification information 304 with the consumer . this unique identification information 304 identifying the consumer may be stored on key fob 140 . upon insertion of the key fob 140 into personal shopping device 112 , 114 , a verification algorithm 302 , stored on key fob 140 may be performed to verify the authenticity of key fob 140 . upon proper verification , the consumer may access the information available at the personal shopping device 112 , 114 . further , a session may be created and managed utilizing session management information 308 , stored at key fob 140 . as such , in the event of a personal shopping device failure , as the device stores all interaction between the customer and the personal shopping device , the consumer &# 39 ; s session may be fully restored using the information stored at session management information 308 . fig4 depicts an exemplary diagram of application servers 106 , 108 , 120 , 122 that may be implemented in system environment 100 , consistent with the principles of some embodiments of the present invention . as shown in fig4 , application servers 106 , 108 , 120 , 122 include a cpu 402 , application software 404 , memory 406 , secondary storage 408 , network interface application 410 , and input / output devices 412 . input / output devices 212 may include , for example , a keyboard , a mouse , a video cam , a display , a storage device , a printer , etc . application software 404 may include software applications that facilitate the scheduling and sending of smart content as discussed herein to personal shopping devices 112 , 114 . application software 404 may further include software applications that facilitate the tracking of personal shopping devices within and around the retail shopping environment , and , based upon the tracking information , facilitate determining certain information as discussed herein . application software 404 may further facilitate the functionality in accordance with the personal shopping devices 112 , 114 discussed herein . it may be appreciated that the configuration of operator server 124 , manufacture server 126 , 128 , client computer 130 , 132 and merchant server 134 , 136 may be similarly configured to the application servers as depicted in fig4 wherein the application software may differ in accordance with the functionality of the individual computers as discussed herein . using conventional applications , the system may track the present location of each of the plurality of personal shopping devices located in or near the shopping environment . in addition to tracking each of the plurality of personal shopping devices , for each personal shopping device , the system may store the position of the personal shopping device at predetermined intervals , i . e ., every five seconds . this information may then be used to determine the actual location of the personal shopping device with respect to certain products , either part of or the total path of the personal shopping device as it travels through the shopping environment , etc . this information may be used for several purposes . first , using this information , the system may determine where , within the shopping environment , the personal shopping device is located . certain flags or conditions may be set within the system such that upon the determination of a personal shopping device being within a certain distance of a particular location , directed advertising may be employed . this directed advertising may or may not take into consideration the consumer &# 39 ; s shopping history . the user , at operating server 124 or at application servers 120 , 122 , may create and modify these flags or conditions thus establishing an event - driving process . for example , if it is determined , based upon the location of the personal shopping device , the consumer is located in the juice section , a computer - generated discount may be offered to the consumer . these computer - generated discounts may be offered to some or all of the consumers when they are within a predetermined location of the juice section . alternatively , if it is determined that the consumer has spent $ 20 in juice in the past 2 weeks , based upon a consumer &# 39 ; s stored shopping history , a computer - generated discount may be offered to the consumer based upon the consumer &# 39 ; s shopping history . these computer - generated discounts may be offered by displaying the discount to the consumer on the display of the personal shopping device 112 , 114 . similarly , advertising , surveys , etc ., may selectively be displayed to the consumer based upon personal shopping device location and / or the consumer &# 39 ; s shopping history . second , using the set of determined positions obtained using the personal shopping device location application , a part of or the total path of the personal shopping device through the shopping establishment may be determined . this may be useful to identify how frequently each aisle , area , zone , etc ., of the store is visited . by identifying which areas of the shopping establishment are most frequently visited , the shopping establishment owner may optimize this space by placing certain products within the area that the shopping establishment owner would like to sell quickly , heavily advertise , place special deals , etc . further , by identifying those areas of the store that are least frequently visited , the shopping establishment owner may re - arrange the products within the store to generate more traffic in those less - traveled areas . further , it may provide information indicating that the layout of the shopping establishment is confusing to the consumer ; not laid out properly , etc . third , the system may store information relating to the date , duration , etc . of a customer &# 39 ; s shopping experience . using the information obtained , the shopping establishment owner may be able to compare the speed of shopping at one store with the speed of shopping at another store . fourth , the personal shopping device position information may be used to support the self - healing planogram discussed below . a user may schedule content to be downloaded and displayed to a consumer at the personal shopping device using an application at operator server 124 , and / or application servers 120 , 122 . alternatively , a user at application servers 106 , 108 or buffer server 107 may schedule content to be downloaded and displayed at the personal shopping device . using the content scheduling application , a user may enter the content to be displayed , the start and end date / time , which shopping establishments and / or personal shopping devices the content should be downloaded to ( either by designating the individual personal shopping devices , or the individual consumers ), the commands to be performed by the personal shopping device before and / or after the content is to be displayed , etc . this content may be directed , active , and / or passive advertising and may be in the form of text , images , etc ., commands to be performed by the cpu of the personal shopping device , updates for software applications , etc . alternatively , the manufacturer , using a similar content scheduling application , may access application server 120 , 122 to request scheduling of content by inputting similar information . this request may be reviewed prior to the scheduling of the content , or may be automatically scheduled . alternatively , the content may simply be stored either at application server 106 , 108 , buffer server 107 , or personal shopping device 112 , 114 where the content is pushed to the personal shopping device and played in a list order , randomly , etc . information may be updated at the personal shopping device when the personal shopping device is recharging . a determination may be made to ensure sufficient power remains at the personal shopping device for the duration of the download and installation , if the personal shopping device is not plugged in . for example , upon a determination that the personal shopping device is not recharging , and that a predetermined power level is maintained , the personal shopping device may generate a message to application server 106 , 108 , advising the application server 106 , 108 that the personal shopping device is ready to download content . upon receipt of the message , application server 106 . 108 , prepares a response to the personal shopping device providing the personal shopping device with a public key and advises the personal shopping device that updates are ready for downloading . using the updating content application , the personal shopping device retrieves a private key from its storage and submits a request with the private key for updated content data . this ensures that only the proper personal shopping devices may download content from application server 106 , 108 . upon receipt of the request , application server 106 , 108 transmits the updated content to the personal shopping device . this exchange of transmissions between the personal shopping device and application server 106 , 108 , may be facilitated with microsoft &# 39 ; s message queuing center ( msmq ) wherein the header of the messages are modified to include security information , i . e ., an rsa key , to ensure secure transactions . it may be appreciated by one skilled in the art that the power level determination may not be performed if the personal shopping device is recharging . information relating to the plurality of shopping establishments , the companies that own the shopping establishments and the customers shopping within the shopping establishments may be stored in a manner that enables real - time access to accurate current and historical data . fig4 a depicts exemplary data tables consistent with the principles of some embodiments of the present invention . it may be appreciated that the data tables depicted in the figures may include additional information that is not discussed herein . further , it may be appreciated that additional tables may be stored including additional information relating to the companies , the shopping establishments , and / or the customers . for example , additional information may be stored relating to the customer &# 39 ; s shopping experience , including shopping lists , items , price , and quantity of items purchased , click - throughs of the user interface , customer demographic data as discussed above , path of the customer through the store , advertisements that were presented to the customer , coupons used by the customer , etc . as depicted in fig4 a , a plurality of data tables are provided . data tables may be implemented using an excel spreadsheet application by microsoft corporation , macromedia flash application by adobe systems incorporated , a dynamic html application etc . the data tables may include company information 421 , hierarchy information 423 , level information 425 , location information 427 , and grouping details 429 . fig4 a depicts the association between the data tables . exemplary details of the data tables depicted in fig4 a are set forth in fig4 b - 4c . company information 421 stores information related to the company , including the company id , as a primary key , and further includes the date the company record was created in the data table , and the name , street , state , zip code , country , telephone and fax number of the company . hierarchy information 423 stores information relating to the hierarchy definitions and includes company id and hierarchy as the primary keys , and further includes the date the record was created and the name of the hierarchy . location information 427 stores information relating to the individual locations of each of the shopping establishments of the companies stored in company information 421 and includes company id , hierarchy id , member id and time zone id as primary keys and further includes the date the record was created , the member name , level id , street , city , state , country , zip code , phone and fax number of the shopping establishment . location information 427 establishes which individual shopping establishments belong to which levels . level information 425 stores information relating to the level definitions and includes company id , hierarchy id , and level id as primary keys and further includes the date the record was created in the data table and the level name . grouping details 429 stores information relating to the groupings , or roll - ups of the shopping establishments and includes company id , hierarchy id , and group id as primary keys and further includes the date the record was created and the member id . grouping details 429 associates individual shopping establishments to certain groups . each of the data tables further stores information relating to whether the records included therein are active or inactive . for example , if a store moves locations , then a new record may be created within location information 427 maintaining the member id but updating all of the other stored data in the new record . the old record of the closed store will be saved in the data table , however the record may be indicated as being inactive . by storing the information in this manner , as companies and individual shopping establishments change locations , a simple update to the tables discussed herein , while maintaining the historic data provides for real - time data access to the current and historic data . for example , if member id 1001 moves location to zone - california south , a new record is created in location information 427 listing member id 1001 , the new time zone id , the date the new record was created , the member name , and the new level id associated with the new location . in addition , the old record is marked as inactive and the date the record was marked inactive is stored . none of the other tables need to be updated . the new information is maintained as current information , and the historic information is maintained for data mining purposes . as such , any time any of the values represented in the tables need to be updated , only those tables that store the value to be changed need to be updated . by establishing and maintaining the tables in this manner , real - time current and historic data may be data mined . for example , as the active / inactive status of records and the date records are created and the date records go inactive are stored , while still maintaining the data after records go inactive , by clarifying at least one of company id , hierarchy id , member id , level id , group id , time period , or any other information stored in the tables , accurate real - time current and historic data may be obtained . it may be appreciated that records may be established in order to enable a company to select certain shopping establishments for targeted advertising , without being limited to the previously established levels in the table . for example , a new record may be established in level information 425 with a level id 99999 . company 1 may wish to provide an advertisement for tide detergent only to store member id nos . 1001 , 10001 , and 10002 . by adding new records in the grouping details 429 , where store member id no . 1001 , 10001 , and 10002 have group id no . 99999 ( in addition to group id nos . already assigned , i . e ., 10001 , 1000000 , and 1000000 , respectively ) the company can designate the tide detergent ad be displayed to customers associated with group id no . 99999 . this provides added functionality because company id 1 is not limited to sending the advertising to all of the stores within the levels that may already be defined within level information 425 . company id 1 may , in a simple manner , target advertising to specific stores , regardless of predefined levels . it may be appreciated that this may save the companies money in advertising costs , administrative costs , etc . it may further be appreciated that , in addition to selecting stores to target advertising , a company may similarly select among the demographic customer information , customer &# 39 ; s shopping history , etc ., to target advertising . it may further be appreciated that by establishing such a 99999 record , information regarding the predefined levels are not affected . as such , data mining for the predefined levels remains the same , while providing the added functionality of defining levels for targeted advertising . it may be appreciated that similar functionality may result by adding new hierarchy ids in the hierarchy information table . it may be appreciated that additional tables may be provided for maintaining customer information . for example , a customer information table may be provided including primary key customer id , and storing demographic information of the customer including age , age range , gender , date of creation of customer record , number of members in the household , number of children , age and gender of the children in the household , household income , etc . further a shopping transaction table may be provided including primary keys for customer id , transaction id and location id , and further including date , type , quantity , price , etc ., of products purchased , click - though data , advertisements viewed , date , time and cart path of shopping trip , entry time and exit time of each zone during each shopping trip , etc . it may be appreciated that additional information may be stored in these tables to expand data mining results . it may be appreciated that all of the tables discussed herein may by stored at application server 106 , 108 , 122 , 124 , and / or database 142 , 144 . for each store , application servers 120 , 122 , 106 , 108 may store in memory the store &# 39 ; s planogram , i . e ., a design that shows where specific products are laid out on retail shelves or displays . fig5 depicts an exemplary planogram consistent with principles of some embodiments of the present invention . as depicted in fig5 , the store includes aisles 502 , 504 , 504 , end caps 508 , 510 , and 512 , produce displays 514 , 516 , 518 , 520 , dairy display 522 , meat and seafood display 524 , wine display 526 , 528 , hot food / salad bar display 532 , 534 , and bread display 530 . for example , the store may be broken down into a plurality of zones and each product in the store may be designated as being located within a particular zone . as shown in fig5 , dairy display 522 may be identified as zone 1 536 , and produce displays 514 , 516 , 518 may be designated as zone 2 540 . it may be appreciated that the data relating to each store &# 39 ; s planogram may be stored in data tables with similar structure discussed above with regard to the information management hierarchy . information may be stored relating to the location of products within the shopping establishment . for example , for each of the plurality of zones depicted in fig5 , information may be stored identifying the metes and bounds of each of the plurality of zones and information relating to the location and descriptive information associated with the products located within each zone . fig6 depicts exemplary tables that may be utilized in storing information within the shopping establishment . as shown in fig6 , table a 600 stores the boundaries of each of the plurality of zones , i . e ., the metes and bounds of each of the plurality of zones , in the shopping establishment . col . 602 identifies each zone , col . 604 identifies the minimum coordinates of each of the zones and col . 606 identifies the maximum coordinates of each of the zones . it may be appreciated that alternatively methods may be utilized in identifying the metes and bounds of each of the plurality of zones . col . 611 identifies the location identification of the shopping establishment . further table b 608 may store information about each of the products included in the shopping establishment , including a specific location of the product within the zone , descriptive information relating to the product , etc . for example , table b 608 includes a sku #, a unique identification number that uniquely identifies a particular product , a zone id , representing the zone that the product is located in , and a product number . it may be appreciated by one skilled in the art that additional information may be stored in these tables . one of ordinary skill in the art may appreciate that alternatives to zones may be implemented in storing information relating to the positioning of products within the shopping establishment , i . e ., the store may be broken down into smaller or larger areas ; etc . the planogram discussed herein may be self - healing , in that there does not need to be any user interaction to update the product location information stored in the tables , for example , in the event that the product display has been relocated within the shopping establishment . as noted above , the tables store information identifying the location of each of the products located in the shopping establishment . when a consumer scans an item and places the item in his shopping cart , the personal shopping device receives the bar code information . this information may be uploaded to application servers 106 , 108 . this information may further be associated with the position information of the personal shopping device . the system may assume that the consumer placed the item in the cart at approximately the same location where the consumer took the item from the shelf / display . the location information may be compared with the location information stored in the tables . if the information is different , the system may flag the item and , if a predetermined number of consumers are placing the same item in the their carts at the new location , the system may automatically set the entry of the item in the tables as “ inactive ”, and create a new entry in table b identifying new position or zone of the item . thus , the planogram does not necessarily need to be manually updated . it may be self - healing in that , as consumers shop within the shopping establishment , the tables may be automatically updated . when a consumer performs a search for a product , as discussed below , these tables may be searched to identify the location of the product within the shopping establishment . further , the consumer may use the information in these tables to access the location , direction and distance to the product based upon the current personal shopping device location . further , data mining may be performed to determine where a product sells the best . by viewing data relating to where the item was located and how many customers purchased the item , the shopping establishment may determine where to place an item achieving optimum sales . consistent with some embodiments of the present invention , the user interface of the personal shopping device may be generated based on stored customer information . this customer information may be collected at the time the consumer signs up for a loyalty card / key fob , etc . the information may be stored at store server 110 , application servers 106 , 108 , application servers 120 , 122 , and / or databases 142 , 144 . the user interface may alternatively be generated based on stored customer information that is collected based on a customer &# 39 ; s past shopping experience and / or may be generated based on a combination of the customer information collected at the time the consumer signs up for the loyalty card / key fob , etc ., and the shopping history information . when registering for a loyalty card , key fob , etc ., the customer may be asked for personal information . for example the customer may be asked for age , sex , address , zip code , number of family members in the household , number of children , age of children , household income , etc . all of the information provided by the customer may be stored as indicated above . additionally , information may be stored regarding the date of the last shopping trip of the customer , the duration of the last shopping trip , etc . different display attributes may be stored in memory and associated with the different categories of customer information . certain display attributes may be associated with gender , age and / or age group , race , address , marital status , number of children , sex of children , etc . for example , if the customer is female , then the display may have a certain color background that may be more appealing to females ; if the customer is spanish and the customer &# 39 ; s first language is spanish , then the text displayed on the display may be in the spanish language ; if the customer &# 39 ; s eyesight is poor , this information may be associated with a large font size , etc . information may further be stored relating to a customer &# 39 ; s past shopping experience . for example , each time the customer touches the personal shopping device , the buttons selected by the customer may be stored . this data may be accessed in order to determine how frequently the customer selected each of the menu options on the personal device . if the system determines that the customer uses the shopping list feature the more frequently , then the actuatable button representing the shopping list function may be more prominently displayed on the user interface , i . e ., at the beginning of the list of actuatable buttons , displayed as a larger button than the other actuatable buttons , etc . the next most frequently used feature may be displayed second in the list , as the second largest button , etc . the content to be displayed on the personal shopping device may be stored and associated with the different categories of customer information . the content displayed on the personal shopping device may be displayed based on the stored customer information . for example , if the customer is spanish , the recipes offered to the customer may be from the spanish culture , i . e ., paella , beans and rice , etc . in addition , the weekly flyer may be generated dynamically based on customer information . the advertisements eligible for the weekly flyer may be associated with different categories of customer information ; the advertisements eligible for the weekly flyer may be associated with particular types of products , etc . for example , if the customer has a newborn baby , the weekly flyer may include an advertisement for diapers . alternatively , based upon access of the customer &# 39 ; s shopping history and past purchases , the system may determine that canned corn is frequently purchased . based upon this determination , the weekly flyer may include an advertisement for canned beans , based upon the association of the canned beans with canned vegetables . for another example , an advertisement eligible for the weekly flyer for chips may be associated with soft drinks . these associations may be determined by a store employee , the advertiser , the manufacturer , etc . in addition to the advertising included in the weekly flyer , additional advertising may be displayed on the personal shopping device based on the customer information during the customer &# 39 ; s shopping experience . this additional advertising may be associated with particular products . the system may store information regarding the particular items , quantity , etc . a customer purchased in the past . the additional advertising may be selected and displayed on the personal shopping device based on , for example , the most frequently purchased items . for example , the application server 106 may access the customer &# 39 ; s shopping history and determine the top , for example , eight , products the customer purchases most frequently . advertisements associated with the eight most purchased products may be displayed to the customer throughout the shopping trip randomly ; may be displayed based on the position of the personal shopping device within a predetermined distance of the product , etc . consistent with some embodiments of the present invention , the use of the personal shopping device provides certain functionality to the consumer to enhance his shopping experience . some examples of this functionality include personalized offers , as discussed above , storage of shopping history , item search / locator , price check and / or suggestions of alternative products , access to recipe information , an interactive shopping list , self - scanning , etc . upon access to the personal shopping device , as noted above , the consumer may view an exemplary screen shot as depicted in each of fig7 a - 7d . as shown in fig7 a , a featured recipe is advertised . if the consumer wishes to view the recipe and the ingredients of the recipe , the consumer may select the “ view this recipe ” button 704 . upon selecting button 704 , the recipe may be displayed together with a shopping list of the ingredients that are needed to make the dish . in addition to the featured recipe , the shopping establishment &# 39 ; s top specials 706 may be displayed . further , menu items 708 are provided wherein the consumer may select any of the menu items . for example , the user may select home 708 wherein the consumer may be directed to the home page of the application . the consumer may further select 710 in order to access additional daily specials . these daily specials may be specials offered to all consumers within the shopping establishment or may be special offers made to the consumer based upon the consumer &# 39 ; s shopping history . the consumer may further select 712 in order to access the product directory to , i . e ., search for a product in the store . the consumer may select 714 to access the consumer &# 39 ; s personal shopping list . the consumer may select 716 to access recipes . the consumer may select 718 to access an electronic calculator , a calculation application that allows the consumer to perform basic math computations . the consumer may select 720 to access a help application that explains how to use the personal shopping device . additionally , section 722 presents passive advertising to the consumer , similar to banner advertising . fig7 b depicts an alternative exemplary screen shot that may be displayed to a consumer upon access to the application on the personal shopping device . alternatively , as depicted in fig7 b , the user may select fun stuff 724 to access entertainment information . for example , if the consumer was shopping with a child , the consumer may access appropriate entertaining videos to occupy the child while the consumer was shopping . alternatively , the consumer may access music information for the consumer to listen to while shopping . alternatively , the consumer may purchase this information and store it on the consumer &# 39 ; s personal key fob 140 . this information may subsequently be transferred to a device at the consumer &# 39 ; s home . fig7 c - 7d depicts alternative exemplary screen shots that may be displayed to a consumer upon access to the application on the personal shopping device . it may be appreciated by one skilled in the art that the display of the personal shopping device may be flipped , rotated , etc ., so that a person sitting in the cart may properly view the information appearing on the display of the personal shopping device . it may further be appreciated that the personal shopping device may include speakers , an earphone assembly , microphone ( to enable the consumer to interact with the personal shopping device through voice ), etc . as the customer uses the personal shopping device , information regarding the customer &# 39 ; s interaction with the personal shopping device is stored , including products scanned ( type of product , price , quantity , time of scan , etc . ), advertisements displayed , time advertisements were displayed , click - throughs , products searched , cart path , counter services ordered ( including the details of the order ), shopping list information , date of shopping trip , start and end time of shopping trip , etc . the information may be stored at the personal shopping device during the customer &# 39 ; s shopping experience . the information begins being compiled at the personal shopping device when the customer logs on . during the customer &# 39 ; s shopping experience , the information regarding the customer &# 39 ; s interaction may be stored , for example in a flat file , at the personal shopping device . the flat file may include a customer id , a shopping establishment location id , start date , start time , stop date , stop time , advertisement id representing advertisements displayed , time of advertisement display , time spent is different zones within the shopping establishment , start and stop time entering and leaving zones within the shopping establishment , products scanned , click - throughs , etc . after the customer logs off the device , the personal shopping device may filter the flat file and transmit the filtered flat file to store server 110 , and / or application server 106 , 108 . store server i 10 and / or application server 106 , 108 may update the appropriate data tables with the information stored in the filtered flat file and / or may transmit the filtered flat file to application server 120 , 122 for processing and storage of the data in database 142 , 144 . it may be appreciated that alternatively , the personal shopping device may trigger interaction with other devices within the shopping establishment . for example , kiosks , displays , and other computing devices , may be situated throughout the shopping establishment that may provide additional and / or enhanced services to the customer . based on the customer &# 39 ; s position in the shopping establishment , the system may determine that a customer is physically close to another computing device . the system may instruct the other computing device to active and play content engaging the customer to use the other device and offer the enhanced and / or additional services . some examples of services that may be provides at the displays / kiosks may include printing of coupons , printing , access , and / or searching of recipes , printing of pictures ordered using the photograph counter services application , recording of media on a removable storage device , customized searching on the internet based on the stored customer information , purchasing of lottery tickets , obtaining funds from an automatic teller machine where the kiosk is communicably linked to the customer &# 39 ; s banking company , validating parking and alternatively , validating parking were the parking fee is added to the customer &# 39 ; s shopping check - out total , media rentals including video tapes , dvds , etc ., postal service kiosks wherein the customer may mail a package , and alternatively , the customer &# 39 ; s cost for mailing the package may be added to the customer &# 39 ; s shopping check - out total , providing fast food or snack food services wherein the cost of the food may be added to the customer &# 39 ; s shopping check - out total , providing personalized audio / video directed to the customer , provide games to the customer , provide advanced input features to enable the customer to provide comments or responses to surveys regarding the customer &# 39 ; s shopping experience , providing instructions videos to the customer or members of the customer &# 39 ; s family , printing customized books , i . e ., coloring books , story books , etc ., wherein the book is customized to the customer or members of the customer &# 39 ; s family , enable searching for and provide event tickets , purchase mobile / cellular telephone cards and / or replenish mobile cellular telephone minutes , enable searching for and provide airline tickets , suggest products for purchase based on stored customer information , i . e ., where the product is physically located near the kiosk / display , the product may be suggested based on age , gender , etc ., offering voice - over - ip services where the kiosk is communicably linked to the internet , etc . advertisements may be dynamically generated based on customer information stored within the system . a manufacturer may identify an ad template that may incorporate static components of the ad . additionally , the manufacturer may further identify dynamic components of the ad that may be associated with certain categories of customer information . the dynamic components may have a priority associated with them for example , the manufacturer may provide a template that indicates that tide detergent is on sale . the price of the detergent and the graphic of the price may be incorporated as the static component of the ad . further , a dynamic component including a graphic of a mother with a child may be associated with the family category having a young child . still further , a dynamic component of a graphic of an older woman may be associated with an age range of 55 - 65 . when the system determines that a certain customer is to receive the tide advertisement , the system accesses the customer information . based on the associated priority information and / or the customer information , a customer of 60 years of age will view the tide advertisement having the static components and the dynamic component of the graphic of the older woman . as such , the advertisement may be dynamically generated and presented to all customers where the advertisement will appeal to the particular customer that is viewing the advertisement , as the dynamic components may be tailored to specific customer that is viewing the advertisement . given the real - time capabilities of the system , the return on investment based on the advertising may be realized . as the personal shopping device and / or the system is storing information regarding the advertising that is being viewed by the customer , the items that are being scanned for purchase , and when the items are being scanned , the system may determine the effectiveness of the advertising in real time . the system may process and store information relating to how may customers scanned the advertised product . if the number is low , then the advertisement may be deemed to be ineffective . this information may be reported back to the manufacturer and the manufacturer may decide to update the static and / or dynamic components of the advertising . alternatively , a manufacturer may be able to set thresholds and modify the advertising based on the effectiveness of the advertising . for example , the manufacturer , user , etc ., may be able establish that an advertisement needs to be 30 % effective ; that out of 100 customers viewing the advertisement , 30 customers must purchase the advertised item . if this effectiveness is not achieved , system may automatically i . e ., modify the advertising graphics , expand the target audience of the advertising , generate a message to the manufacturer advising of the ineffectiveness of the advertisement , etc . alternatively , the system may automatically generate reports to the manufacturer at predetermined time ( s ) advising of the effectiveness of the advertisement ( s ). alternatively , payment for the advertising by the manufacturer may be dynamic based upon the effectiveness of the advertisement . for example , the manufacturer may be billed a lesser amount if only a few customers purchased the product after viewing the advertisement , and may be billed a higher amount if many customers purchased the product after viewing the advertisement . alternatively , after viewing the effectiveness of the advertising , the manufacturer may determine that certain dynamic components are more effective than other dynamic components and may decide to modify the priority or the categories of customer information that may be used in generating the advertisement . further , the utilizing the data stored in the data tables , a company may be able to determine if a customer is traveling to purchase products . for example , if a customer with one zip code is shopping at a shopping establishment in a different zip code and purchasing products that the customer is not purchasing at a shopping establishment located in the customer &# 39 ; s zip code , the company may be able to determine that there is a need for a particular product in the customer &# 39 ; s zip code . the company may then provide the needed product at the customer &# 39 ; s shopping establishment , making the customer &# 39 ; s shopping experience more productive and increasing sales . it may be appreciated that other types of dynamic advertising may be displayed to the customer based on the customer &# 39 ; s stored information . for example , if the customer previously paid for their purchases with a bank of new york bank card , the system may store information that the customer holds an account at the bank of new york . during the customer &# 39 ; s shopping experience , a bank of new york advertisement may be displayed promoting the bank &# 39 ; s services . the consumer may further access his personal shopping list using his personal shopping device . for example , the consumer may generate his shopping list at his home computer and download the shopping list to his key fob 140 . after the consumer puts the key fob 140 into the personal shopping device and after the consumer is verified , the shopping list may be retrieved from the key fob 140 . alternatively , the consumer may access an application at application sever 120 , 122 and enter his shopping list using his home computer . this shopping list may be downloaded to the personal shopping device after the consumer is verified . once the shopping list is retrieved , the consumer has the opportunity to add , remove or edit items on the shopping list . alternatively , the system may retrieve the shopping history of the consumer to identify those items that the consumer purchases on a regular basis . for example , the system may determine that the consumer purchases ½ gallon of milk each time the consumer shops . once the consumer is verified , the system may access the shopping history of the consumer and compare the regularly purchased items with the items on the consumer &# 39 ; s shopping list . if there is an item that the consumer normally purchases that is not located on the shopping list , the system may prompt the consumer asking if the item should be placed on the shopping list . this may help to ensure the consumer &# 39 ; s shopping list is complete . further it helps to generate sales for the shopping establishment . in addition , the consumer has the ability to enter budgeting information . upon receipt of the budgeting information , the personal shopping device may analyze the interactive shopping list and the budgeting information and search the information stored in table b to suggest a list of proposed products that will ensure the consumer stays within budget . as the system stores both shopping list information and information relating to the items purchased by the customer , the system may generate reports that show the purchasing trends of the customer . for example , the system may determine what products the customer intended to purchase from the shopping list information , and what products the customer did and did not purchase . further , the system may determine the effectiveness of advertising based on the items intended to purchase on the shopping list , the advertisements that were displayed to the customer , and the actual products purchased . alternatively , the system may generate the shopping list for the next visit to the supermarket based on the actual purchases of the customer during the current visit to the supermarket . this list may be modified by the customer at the customer &# 39 ; s home using the network application at application server 120 , 122 , and / or at the supermarket during the customer &# 39 ; s next visit . the shopping list may be updated as the customer is shopping . each item for purchase by the customer is scanned , for example , using a bar code reader at the personal shopping device . the personal shopping device may send the scanned information to store server 110 or application server 106 , 108 to obtain the associated product information . additionally , the product attribute information may further be accessed . the product information and the product attribute information may be transmitted to the personal shopping device . the customer &# 39 ; s shopping list may then be processed to determine if the scanned product or an associated product is on the list . if the product is on the list , the product is checked off as selected for purchase . if the product is not on the list , the product may be added to the list . at the end of the customer &# 39 ; s shopping trip , all of the items in the shopping cart may be included on the customer &# 39 ; s shopping list . this list may be stored locally on the personal shopping cart and / or stored at application server 106 , 108 120 , 122 . as noted above , personal shopping device may include a bar code reader . the consumer may scan a product to perform a price check . if the consumer wishes to discern the cost of a product , the consumer may scan , i . e ., the bar code , of the product . the bar code information is received at the personal shopping device . the price information may be stored at the personal shopping device , may be stored at the application servers 106 , 108 , or may be stored at buffer server 107 . if the price information is stored at the application servers 106 , 108 , or buffer server 107 , the personal shopping device may transmit the price check request to the server storing the price information , i . e ., application servers 106 , 108 or buffer server 107 . the request is received at the appropriate server , the memory queried , and a response may be transmitted back to the personal shopping device . the response may then be displayed to the consumer . each of the products for sale in the store may be stored at store server 110 , application server 106 , 108 , application server 120 , 122 , and / or database 142 , 144 . associated with each of the products may be keywords that help identify the product . for example , tide detergent may be stored and key words associated with tide detergent may be laundry , soap , detergent , etc . the consumer may query the system attempting to locate a particular item . the item may be located based on the product , or the key words associated with the product . for example , if the customer is searching for tide detergent , the customer may enter in “ laundry soap .” based on the key words associated with tide detergent , including “ laundry ” and “ soap ”, tide detergent may appear as a response to the customer &# 39 ; s query . for another example , the consumer may submit a request seeking to find the location of light bulbs . upon submission of the request , the personal shopping device either searches its own memory , if the information is stored locally , or prepares and submits a query to the application servers 106 , 108 or buffer server 107 , if the information is stored at one of these servers . upon receipt of the query , the appropriate server searches its memory and identifies the location of the product within the shopping establishment . the server then prepares a response to the query and transmits the response to the personal shopping device . the personal shopping device then displays the location of the product on the display of the personal shopping device . alternatively , the personal shopping device or the server may calculate a set of directions based upon the current position of the personal shopping device wherein the directions may be provided to the consumer . this information may be provided to the consumer in a number of ways , including merely identifying the aisle the product is located in , directions , in the form of text , to direct the consumer to the searched product , a map being displayed on the display providing the consumer with a marked path to the product , etc . alternatively , in addition to ads , a manufacturer may purchase certain key words that may only be associated with the products stored in the system . for example , the tide detergent manufacturer may purchase “ laundry ” as a key word associated with tide detergent . no other manufacturer may have the word “ laundry ” associated with their product . each time a customer searches for a product using the key word “ laundry ”, only tide detergent will appear on the list . this may provide an added benefit to the manufacturer as only their product is identified on the search result list , thus reducing competition . alternatively , manufactures may identify certain stores where their key words are associated with certain products . these selected stores may be based on location . alternatively , when a customer searches for a product , and an advertisement is associated with one of the products on the search result list , the customer may be presented with an advertisement that corresponds to a product on the search list . alternatively , after the system determines what product the customer is searching for , the inventory database , discussed below , may be queried to determine if there is stock on the sought after item . if there is no stock left , the system may suggest a substitute product . alternatively , the substitute product may be offered with an advertisement and / or coupon as an incentive for the customer to purchase the alternative item . still alternatively , the customer may be provided a “ rain check ” that may be stored within the system , on the customer &# 39 ; s loyalty card , key fob , etc . further if the item is a sale item , the sale price may further be stored and applied during a later shopping trip . the consumer may scan a product when the product is placed in the cart for purchase . upon the scanning of the item , the personal shopping device may store the information indicating that the consumer wishes to purchase the scanned product . at any time , the consumer may review the list of items placed within the cart . this may be beneficial if the cart is particularly full and the consumer is not sure if a particular item on the shopping list was picked up . upon scanning the item , the interactive shopping list may be searched to determine if the scanned item is on the shopping list . if the scanned item is on the interactive shopping list , the interactive shopping list may be automatically updated and an indication may be made in the interactive shopping list that the item has been picked up for purchase . upon check out , the information identifying the products that have been scanned into the personal shopping device and placed in the cart may be transferred to a checkout device . this may reduce the amount of time the consumer spends checking out . after a consumer checks out , the information identifying the products purchased may be transmitted , through application server 106 , 108 to application servers 120 , 122 , for storage in databases 142 , 144 . alternatively , application servers 106 , 108 may include databases that store the information locally . this stored shopping history may be used for many purposes as discussed herein . alternatively , certain products within the shopping establishment may include a rf id tag . the rf id tag may be active or passive . a product on a shelf with the tag may be active . when the customer registers the product with the personal shopping device and being intended for purchase , the personal shopping device may change the rf id tag to passive . at the time of checkout , the customer &# 39 ; s cart may be scanned to determine if there are any active tags in the shopping cart . an active tag in the customer &# 39 ; s shopping cart indicates that the customer did not properly scan the product for purchase . the consumer may scan a product and search for a similar or cheaper product . for example , the consumer may scan an item that is 64 ozs . and costs $ 8 . 00 . however , maybe the consumer may only need 6 ozs . of the product or maybe the consumer does not wish to pay $ 8 . 00 . the consumer may select a certain application within the consumer interface at the personal shopping device wherein the product directory may be searched to locate a similar product that is smaller and / or does not cost as much . alternatively , the consumer may scan a particular product , i . e ., mr . clean , a cleaning product . the system may identify a similar product that is on sale , or has a computer - generated discount available , and display the alternative to the consumer . the consumer may then take advantage of the information offered to the consumer . for example , the consumer may receive information from the system identifying a computer - generated discount for lysol cleaner . the consumer may decide to use the computer - generated discount and purchase lysol instead of mr . clean . upon scanning the lysol , the system may take note of the use of the computer - generated discount so that , upon checkout , the consumer may receive the discount without having to “ clip coupons ”, produce any paper notification of the discount , etc . in addition to the recipes discussed above , the consumer may search memory located in the personal shopping device and / or application servers 106 , 108 , 120 , 122 , for recipes . the recipes may alternatively be provided by a manufacturer through manufacture server 126 . upon selection of a recipe , the ingredients of the recipe may be placed on the consumer &# 39 ; s interactive shopping list . the consumer may make an indication through the consumer interface to remove the item from the interactive shopping list . further , the consumer may store the recipe on the key fob 140 for downloading at the consumer &# 39 ; s home personal computer . alternatively , the consumer , through personal shopping device 102 , 104 , may e - mail the recipe to himself for viewing at , for example , home , or the consumer may direct the recipe be printed out at a printer located , for example , at the shopping establishment . it may be appreciated by one skilled in the art that the personal shopping device may provide the consumer the capability to browse and access servers 134 , 136 on the internet to access information including recipes . store server 110 , application servers 106 , 108 and / or application servers 120 , 122 may store information relating to recipes . these servers may further store , or have access to data associating the ingredients of the recipes with certain products in order to assist the customer during the shopping experience . these products that are associated with the ingredients may be store brand products , name brand products , etc . the customer may be provided with an option of selecting whether the products associated with the ingredients for the recipe are store brand products or name brand products . for example , if the customer was shopping at safeway supermarket , safeway may want to promote their store brand products . when a customer selects a recipe to view , additional information may be displayed identifying safeway brand products that should be purchased in order for the customer to make the recipe . alternatively , the customer may have the option to select certain recipes based on characteristics of the dishes produced by the recipe . for example , the customer may select a recipe and may further select a low sodium version of the recipe , a diabetic friendly version of the recipe , a low fat version of the recipe , etc . additionally , the system may allow the customer to select how many people are being served and modify the recipe accordingly . for example , if the recipe serves 4 people , and the customer is serving 8 people , the system may automatically double the recipe . further , the products associated with the recipe , taking into account that the recipe has been doubled , may be provided to the customer and / or added to the customer &# 39 ; s shopping list . further , the customer may request a recipe based on other characteristics , including cost of products , number of calories per serving , amount of fat per serving , kosher ingredients , etc . further , the system may enable the customer to select a weekend meal plan , week meal plan , etc ., wherein the customer may select several recipes to serve over the weekend , week , etc . upon selection of the recipes , the associated products may be added to the customer &# 39 ; s shopping list , and the meal plan and / or recipes may be stored on the customer &# 39 ; s key fob or loyalty card , e - mailed to the customer , etc . the customer may be able to remove those items from the shopping list that the customer has at home . alternatively , the system may monitor the selected meal plan to ensure the selected meal plan conforms to a customer &# 39 ; s diet . for example , if the customer is on a weight watcher &# 39 ; s diet , the system may count the points per serving of the recipes selected by the customer and notify the customer of the point count , as a running total , as a final total count , etc . still further , the system may store information relating to wines that may be associated with recipes . if a customer has selected a certain recipe , the system may further recommend a wine that may go well with the selected recipe . by storing information relating to the products that the consumer has placed in the cart , additional features may be realized . for example , the ingredients of the recipes stored in memory may be search and associated with scanned items in the consumer &# 39 ; s shopping cart . for example , if the system determines that the consumer has purchased avocado , onion , and tomato , the personal shopping device , at the direction of application server 106 , 108 , 120 , or 122 , may prompt the consumer to purchase lemon and may further provide a recipe for guacamole . further , directed offers , i . e ., computer - generated discounts , may be made to the consumer . for example , if the consumer has selected $ 75 total merchandise for purchase , the personal shopping device may display an offer to the consumer to access a particular website to receive some incentive ; if the consumer has purchased 3 bags of chips , the consumer may be offered a computer - generated discount to receive a free can of salsa etc . alternatively , the system may offer information to the consumer that is associated with particular products being purchased . for example , if the consumer scans mr . clean into the personal shopping device , the system may search its memory and offer cleaning tips to the consumer . in addition to the information discussed herein , inventory information may be maintained at store server 110 , application server 106 , 108 , application server 120 , 122 and / or database 142 , 144 . this inventory information may be updated in real time as the consumers purchase the products within the shopping establishment . for example , when a consumer scans bounty paper towels at the personal shopping device , an inventory database that may be stored at store server 110 , buffer server 107 , application servers 106 , 108 , application server 120 , 122 , and / or database 142 , 144 may be updated . predetermined thresholds may be established so that when a particular product &# 39 ; s inventory level drops to the predetermined threshold , the system may prompt a user at application server 106 , 108 , store server 110 , and / or application server 120 , 122 to order more of that product . alternatively , the system may automatically generate an order that may be sent through application server 120 , 122 to manufacture sever 126 for more of that product . similarly , the system may provide for predetermined thresholds to identify when there is an overstock of a particular item . if the system determines there is an overstock , the system may automatically generate a computer - generated discount or advertisement that provides incentive for the consumer to purchase the item in order to reduce the overstock situation . these computer - generated discounts may be offered consumers using the plurality of methods discussed herein . alternatively , the manufacturer may predefine a price where products may be offered to customers at the predefined price when an overstock situation occurs . this reduced price may be offered to the customers for a period of time , until the inventory reaches a normal or predefined level , etc . it may be appreciated by one skilled in the art that applying the principles discussed herein , the shopping establishment owner may determine purchasing trends , anticipate further purchases and product arrays and quantities to be ordered upstream , etc . the system may further have the ability to monitor the power level of each of the plurality of personal shopping devices within or near the shopping establishment . each personal shopping device may have a battery charge of a particular time period . each personal shopping device may monitor its own power levels and may communicate the power levels periodically , or upon request , to application servers 106 , 108 . alternatively , the system may be configured so that when the personal shopping device power drops to a predetermined level , an alert may be generated and send to application servers 106 , 108 . the power levels may further be provided to a consumer so that , should a consumer access a personal shopping device , and should the power level be low , the consumer may select a different personal shopping device to access . further , upon receipt of notification that a personal shopping device is low on power , shopping establishment personnel may remove the personal shopping device from use and plug the device in to recharge . using the input device provided in the personal shopping device , the consumer may insert an external memory card , i . e ., compact flash , memory stick , thumb drive , etc . to download image data . using the consumer interface provided at the personal shopping device , the consumer may select the photo processing services the consumer wishes for the downloaded image data . the consumer may then submit the image data to the photo processing service of the shopping establishment . as key fob 140 may be associated with the identification of the consumer , the time taken to order prints of the image data may be reduced . as such , the consumer may shop within the shopping establishment while the image data is being processed . this reduces the need for the consumer to stand in line to request the image processing service and further , reduces the amount of information the consumer may need to input to request the image processing service . it may be appreciated that similar services may be requested using the personal shopping device . for example , the consumer may request from the flower arrangement services that a particular arrangement be prepared . thus , the consumer may shop while the arrangement is being prepared , thus speeding up the consumer &# 39 ; s shopping experience . alternatively , the consumer may request a certain cut of meat from the butcher using the personal shopping device and thus , the consumer can pick up his request without having to wait on line . similarly , the consumer may request movie rental services , coffee orders , seafood or deli orders , hot food orders , etc . in addition to the film processing application , the personal shopping device may enable the customer to select and transmit an order to a bakery section and / or a delicatessen section of the shopping establishment . the customer may be able to access the bakery counter services application , select item ( s ) for purchase , i . e ., a birthday cake , identify the size of cake , the type of cake , the decoration of the cake , the writing on the cake , etc . once the customer enters all of the bakery order information , the bakery order is transmitted from the personal shopping device through the store server 110 or application server 106 , 108 , to a computing device physically located at the bakery section of the shopping establishment . the customer &# 39 ; s order may appear on a display to a worker in the bakery section . the worker may then fulfill the customer &# 39 ; s order . once the worker has completed the order , the worker may transmit a message to the customer &# 39 ; s personal computing device indicating that the order is ready for pick up . if the customer has already left the shopping establishment , the customer may be notified by e - mail , telephone , etc ., that the bakery order is complete . the personal shopping device may enable the customer to select and transmit an order to a delicatessen section of the shopping establishment . the customer may be able to access the delicatessen counter services application , select item ( s ) for purchase , i . e ., a party platter , identify the size of platter , the contents of the platter , the theme of the platter , etc . once the customer enters all of the delicatessen order information , the order is transmitted from the personal shopping device through the store server 110 or application server 106 , 108 , to a computing device physically located at the delicatessen section of the shopping establishment . the customer &# 39 ; s order may appear on a display to a worker in the delicatessen section . the worker may then fulfill the customer &# 39 ; s order . once the worker has completed the order , the worker may transmit a message to the customer &# 39 ; s personal computing device indicating that the order is ready for pick up . if the customer has already left the shopping establishment , the customer may be notified by e - mail , telephone , etc ., that the delicatessen order is complete . alternatively , the personal shopping device may enable a customer to select and purchase media . for example , the personal shopping device may provide the customer with a list of songs for purchase . the songs may be selected by the customer and downloaded on the customer &# 39 ; s key fob , transmitted to the customer by e - mail , burned on a portable storage medium within the shopping establishment , etc . alternatively , the personal shopping device may enable a customer to refill a prescription at the pharmacy section of the shopping establishment . upon selecting this option , the customer may be required to enter the prescription number and details regarding the order . the order is transmitted from the personal shopping device through the store server 110 or application server 106 , 108 , to a computing device physically located at the pharmacy section of the shopping establishment . the customer &# 39 ; s order may appear on a display to a worker in the pharmacy section . the worker may then fulfill the customer &# 39 ; s order . once the worker has completed the order , the worker may transmit a message to the customer &# 39 ; s personal computing device indicating that the order is ready for pick up . if the customer has already left the shopping establishment , the customer may be notified by e - mail , telephone , etc ., that the pharmacy order is complete . the personal shopping device may further provide narrow - casting information to a consumer . for example , if the shopping establishment was a hardware store , and the consumer was purchasing a particular tool , the system may offer information to the consumer , i . e ., a how - to video providing instruction on how to use the tool . this information may be viewed using the personal shopping device , may be downloaded on the consumer &# 39 ; s key fob 140 , or may be e - mailed to the consumer &# 39 ; s e - mail account for home viewing . it may be appreciated that security features may be implemented within the personal shopping device and / or the shopping cart to ensure that all items placed in the shopping cart for purchase are properly scanned . for example , the personal shopping device , and / or the shopping cart may incorporate a camera whereby when the camera , analyzing images taken by the camera determines that the field of view of the top of the shopping cart has been broken , the personal shopping device determines if an item was scanned within a preset period of time . if there was no item scanned , but the field of view was broken , then an alert may be generated at the personal shopping device requesting the customer properly scan the item for purchase . if the item is again not scanned within a predetermined amount of time , an alert may be generated and forwarded to store server 110 or application server 106 , 108 so that a user of the server may examine the customer &# 39 ; s shopping cart at check out to ensure all items are properly scanned . alternatively , the personal shopping device and / or shopping cart may incorporate a three - dimensional scanner that scans the cart , and the items included therein . the scan may then be processed to determine whether all items in the cart were properly scanned . if then items were not all properly scanned , alerts may be generated to the customer and the user as noted above . in addition to the reporting capabilities discussed above , it may be appreciated that based upon the type of data stored within the system and the structures of the data tables discussed herein , real - time current and historic data mining may be realized . further , a company &# 39 ; s return on investment may be accurately determined . for example , assume customers may be categorized in four categories , i . e ., shops little / buys little , shops little / buys a lot , shops a lot / buys little , and shops a lot / buys a lot . these categories may be based upon predetermined thresholds based on the number of times a customer shops , and how much money is spent during each shopping trip . as the customer shopping information discussed above is obtained at the personal shopping device and stored within the system , reports may be generated to determine if customers are moving from one category to another as time progresses , the company may realize a return on investment . as historic data is maintained in addition to current data , accurate return on investment values may be calculated . return on investment may be determined based on an individual store , a predefined group of stores , a demographic group , etc . the return on investment value may be customized for each company , as each company may establish their own predetermined thresholds for each category . modifications and adaptations of the present invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . the foregoing description of an implementation of the invention has been presented for purposes of illustration and description . it is not exhaustive and does not limit the invention to the precise form disclosed . modifications and variations are possible in light of the above teachings or may be acquired from the practicing of the invention . for example , the described implementation includes software , but systems and methods consistent with the present invention may be implemented as a combination of hardware and software or hardware alone . additionally , although aspects of the present invention are described for being stored in memory , one skilled in the art will appreciate that these aspects can also be stored on other types of computer - readable media , such as secondary storage devices , for example , hard disks , floppy disks , or cd - rom ; the internet or other propagation medium ; or other forms of ram or rom . attached to this disclosure as appendix a are ( 1 ) twenty - six ( 26 ) sheets of exemplary displays that may be presented to the consumer consistent with principles of the present invention ; ( 2 ) systems and methods for enabling information management incorporating a personal computing deice : user interface / application design ; ( 3 ) systems and methods for enabling information management incorporating a personal computing device : hardware application design ; ( 4 ) systems and methods for enabling information management incorporating a personal computing device : hardware design ; ( 5 ) two ( 2 ) information sheets including features consistent with some embodiments of the present invention ; all of these 5 documents are incorporated herein by reference in their entirety . | 6 |
fig1 illustrates an exemplary environment for implementation of a system 10 for monitoring rso 2 of a patient . the system 10 has a spectrophotometric apparatus 18 connected to a sensor 16 through an electrical cable 24 . the electrical cable 24 may include a signal amplifier 26 . the spectrophotometric apparatus 18 is a computer or other processor - based computing device 20 and a monitor or other visual display device 22 . the computing device 20 includes customary memory devices that store data and algorithm instructions and a processor that executes algorithm instructions . the sensor 16 takes spectrophotometric readings of the monitored region and generates corresponding representative electrical signals , which are conveyed to the computing device 20 . the computing device 20 processes the signals and causes data to be displayed on the monitor 22 . periodically , the computing device 20 calculates an rso 2 value from the electrical signals . the calculated real time rso 2 value is numerically displayed on the monitor 22 . additionally , a certain number of historical real time rso 2 values are graphically plotted to generate a line graph of the historical real time rso 2 values over time . from these two displays , a caregiver can observe the current rso 2 level of the patient , as well as the historical rso 2 levels . further , computing device 20 calculates a trend statistic of the real time rso 2 values . one such trend statistic is a trailing average of the real time rso 2 values . a person of ordinary skill in the art understands how to calculate a trailing average value from a group of rso 2 values . in general , an average of all of the non - zero rso 2 values calculated for a particular period of time , e . g ., the last 60 minutes , is calculated each time a new real time rso 2 value is calculated . each calculated average value is plotted to generate a line graph of average rso 2 values over time , which is displayed on the monitor 22 concurrently with the numerical representation of the current real time rso 2 value and the line graph of the historical real time rso 2 values . other known trend statistics may be used instead of a trailing average value , such as a trailing median value , and they may be displayed in various ways other than a line graph . the object is to calculate and display a trend statistic that provides a caregiver with information from which the trend of the real time rso 2 values can be assessed . fig2 illustrates an exemplary display on a monitor 22 showing the real time rso 2 values and the statistical trend data for two different channels . references 100 a and 100 b are directed to the numerical representation of the current real time rso 2 value for the first and second channels , respectively ; lines 104 a and 104 b are the graphical representations of the historical real time rso 2 values , plotted over time , for the first and second channels , respectively ; line 102 a and 102 b are the graphical representations of statistical trend data , e . g ., the trailing average values , plotted over time for the first and second channels , respectively . other configurations and arrangements of the illustrated regions on the monitor 22 are contemplated and within the scope of invention . the exemplary embodiment described herein has several advantages over known blood oxygen saturation monitoring systems . for example , a trend statistic , such as a trailing average or median , can alert a caregiver to slowly progressive changes that presage impending events , including catastrophic biologic changes . this is counterintuitive since it would seem more appropriate to watch the real time measurements than to look at a trend statistic . however , where the perfusion distribution of the patient , such as a neonate , is highly variable , progressive average change of the data can be obscured by the erratic nature of the real time values . displaying a trend statistic assists the caregiver in identifying such progressive average changes . on the other hand , it remains useful to display the real time values as well . the real time values allow the caregiver to determine if the trend statistic represents mostly signal dropout coupled with consistently low readings or if it is just the normal wide variation giving the same low average blood oxygen saturation values . the combined use of real time rso 2 values and trend statistics is beneficial as illustrated by the following examples . an rso 2 profile of mostly rso 2 of 15 - 20 mmhg with intermittent periods of 35 - 45 mmhg can evidence a different clinical condition from prolonged periods of mostly 20 - 25 mmhg with no periods higher . but both could present the same trend statistic ( e . g ., a trailing average ) while the real time data would highlight the difference . conversely , presenting the data as a rolling average in combination with the real time data is critical so that if there is a sudden catastrophic change it will not be obliterated by the average graph . this is exemplified in a situation where paco 2 suddenly drops due to over ventilation causing a dramatic drop in the cerebral blood flow 1 . 1 paco 2 is the partial pressure of carbon dioxide in arterial blood , measured by analyzing an arterial blood sample on a blood gas machine . normal range is 35 - 45 mmhg and increases in paco 2 selectively raise cerebral blood flow by about 2 - 3 % per mmhg and vice versa . an exemplary application of the above - described embodiment is directed to detecting necrotizing entercolitis (“ nec ”) in neonates . nec in neonates may be predicted by caregivers based on the degree of variability of rso 2 in the gut of a neonate . in addition to display of averaged values , an exemplary approach is described where a measure of variance is ascribed to the averaged data epoch . this measure of variance could be the actual statistical variance , the standard deviation , the confidence interval , standard error or some other measure of variability of the data , hereinafter “ index of variability .” variability over short ( 0 - 60 seconds ) and medium ( 1 - 30 minutes ) time frames is inherent to physiological systems and can indicate the robustness of those systems . the index of variability can be used to track both short - and medium - term variability depending on the length of the averaging epochs and the method used to calculate the index . because different areas of the body exhibit differing blood flow rates , the time frames , epoch lengths , and methods used to calculate the variability index can be adjusted based on expected flow in various organs or body areas . this adjustment can be user selectable or can be automatically invoked based on the label assigned to a specific channel indicating its sensor location or typical flow rates . variability in certain physiological systems can change based on factors other than the patient &# 39 ; s well - being . for example , variations of the hemodynamics of the splanchnic circulation can change significantly during pre - and post - prandial conditions . likewise , variations in cerebral blood flow can increase significantly if cerebral perfusion pressure falls to a level close to or below the lower limit of autoregulation . premature infants exhibit very high levels of variability in some organ beds such as the splanchnic bed during the first weeks of life . therefore , the patient monitor disclosed herein can change the method of calculation , the length of data epochs , or the thresholds used for alerting caregivers based on demographics , gestational age , location of the measurement , feeding status or other measures or parameters to allow the system to adjust to varying conditions and demographics . the index of variability can be displayed in several unique ways . for example , in one exemplary implementation , dotted lines above and below the trend line of the average value can indicate variance above and below the mean value . the areas above and below the mean may be filled in with a transparent color such that objects below are still visible . further , a series of whiskers or error bars may be added to the averaged trend to indicate the magnitude of variability above and below the mean . changes in the index of variability can be tracked over time to indicate basic changes in the well - being of the patient . as variability decreases , in most cases the overall well - being of the patient is declining . likewise , as variability increases , well - being is usually improving . therefore , changes in variability beyond a fixed or user - adjustable threshold can be used to alert caregivers to changes that may reflect changes in patient condition . additionally , real time values that remain significantly outside the limits of variability for a preset or adjustable time period may also trigger an alert or message to indicate a major change in the patient &# 39 ; s condition . indication of significant changes in the index of variability can be indicated on the trend through color changes , drawing the user &# 39 ; s attention to the change as it occurs . alternately , changes in variability can trigger a message on the screen or can be used to activate an audible alert to warn the user that a change is occurring . while the index of variability can extract information on significant changes to the magnitude of variations , another implementation can process data in a way that extracts information on the frequency of variations . by observing data in the frequency domain , significant changes in the power and frequency of variability can be observed in real time . the patient monitor described herein is configured to convert epochs of data to the frequency domain using a method such as fourier transformation where the power of variability is plotted against the frequency of that variation . using this technique , significant changes in either power or dominant frequency of variations can be tracked and changes greater than a threshold can be used to trigger an alert as described previously . with regard to the processes , systems , methods , heuristics , etc . described herein , it should be understood that , although the steps of such processes , etc . have been described as occurring according to a certain ordered sequence , such processes could be practiced with the described steps performed in an order other than the order described herein . it further should be understood that certain steps could be performed simultaneously , that other steps could be added , or that certain steps described herein could be omitted . in other words , the descriptions of processes herein are provided for the purpose of illustrating certain embodiments , and should in no way be construed so as to limit the claimed invention . accordingly , it is to be understood that the above description is intended to be illustrative and not restrictive . many embodiments and applications other than the examples provided would be apparent upon reading the above description . the scope of the invention should be determined , not with reference to the above description , but should instead be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled . it is anticipated and intended that future developments will occur in the technologies discussed herein , and that the disclosed systems and methods will be incorporated into such future embodiments . in sum , it should be understood that the invention is capable of modification and variation . all terms used in the claims are intended to be given their broadest reasonable constructions and their ordinary meanings as understood by those knowledgeable in the technologies described herein unless an explicit indication to the contrary in made herein . in particular , use of the singular articles such as “ a ,” “ the ,” “ said ,” etc . should be read to recite one or more of the indicated elements unless a claim recites an explicit limitation to the contrary . | 0 |
fig1 shows a system 2 which system comprises a flow duct 4 in which a first transducer 6 and a second transducer 8 are transmitting acoustic waves 10 across the duct 4 . both transducers 6 , 8 are connected to a switch 12 by which switching for receiving and transmission is effected . the transmitter receiver switch 12 is connected to a transmitter circuit 14 and to a receiver circuit 16 . the receiver circuit 16 comprises a band pass filter 18 which is connected to a microcontroller 20 , and the microcontroller 20 is connected to a digital converter 22 . the microcontroller 20 further comprises a digital filter 38 , an amplitude function 42 and a phase detection function 44 . the microcontroller 20 further comprises a digital constant fraction discriminator 46 . additionally , a voltage follower 50 is shown in the microcontroller 20 . the microcontroller 20 is also connected to the transmitter circuit 14 which comprises a band pass amplifier 48 . in operation , flow will be measured between the transducers 6 , 8 , and in one situation , the transducer 6 acts as transmitter and the transducer 8 acts as receiver , and in the next situation , the transmission occurs in the opposite direction with the transducer 6 acting as the receiver and the transducer 8 as the transmitter . on the basis of these signals , and by the means provided inside the microcontroller 20 , the system can calculate the flow in a highly efficient manner . fig2 & amp ; 3 show that the received and band pass amplified signal is analog to digital converted by a built - in analog to digital converter and is stored in memory . the measurements of transit times and time difference are solely performed by the microcontroller 120 based on these stored values . after transmission in either direction , a number of samples are stored in the memory . the sampling starts after a time determined by an internal timer in the microcontroller 120 such that the received pulse is sampled from the beginning . the time for the first sample is stored in the memory as one value for transmission against the flow and another value for transmission with the flow . a vector of samples is stored for each direction of transmission . each vector contains an appropriate number n of samples , in the actual embodiment the vector 130 contains 512 samples , but less may work well . the first step in the signal processing is to multiply each value in the frames with a complex number with the magnitude one and a phase corresponding to the transmitted signal : y n = x n · e jω · t s · n = x n ·( cos ( ω · t s · n )+ j sin ( ω · t s · n )) 164 where x n is the stored value at the n th location , jω the angular frequency of the transmitted signal , t s the sampling time interval and n is the sample number . 0 ≦ n & lt ; n the complex result y n is filtered by two low pass filters , one for the real part a n and one for the imaginary part b n . after low pass filtering , 116 im , 116 re is the result is a complex sequence ( a n + jb n ) with n ={ 0 , 1 , . . . n - 1 , n }. the amplitude 142 of the received signal can , sample for sample , be found as the square root of the sum of squares . a n =√{ square root over ( a n 2 + b n 2 )} 142 fig4 shows a possible embodiment for an amplitude signal that is used to determine the arrival times t up and t dwn by means of a digital constant fraction discriminator cfd 146 . the output from the cfd 146 is used to place the sampling frame so that it starts where the pulse would have been if there has been no dead delay . the dead delay is the delay due to cables , solid parts of transducers and delay in the band pass filter . the start of the sampling frame ideally equals the transmission time in the fluid t up and t dwn . the frequency of the timer clock limits the resolution , but the precision is sufficient for the t up and t dwn values in the denominator , but not sufficient for the difference δt since it requires more resolution than the sampling frames are adjusted with . the purpose of the phase detection 144 is to increase the resolution of the time difference t up − t dwn = δt . the output from the low pass filters 116 im , 116 re represents the phase difference between the frame with its reference sequence and the received signal . the filtered output can be further filtered to decrease the standard deviation on the phase measurements . the phase is the argument to the last complex number ( a n - 1 + jb n - 1 ) in the vector 130 where the amplitude and phase are stable . if the signal from the upstream measurement is ( a n - 1 + jb n - 1 ) and from the downstream measurement is ( c n - 1 + jd n - 1 ), then the phase difference is : since the angle is small if the frame is adjusted with steps much smaller than the sample time the arctan is easily calculated by the series : the actual length of the series depends on the required accuracy and the range of values of x , but the shown length will normally suffice . if noise is present , the cfd signal 146 may fluctuate with a few samples and the nominal value of the division may be larger than the range of the arc tan function , but a few numbers out of range can be discarded without offsetting the mean value of measurements since the deviations are expected to be symmetrical . practical measurements have shown a three to five times decrease in standard deviation with the above method compared to the deviations obtained from a zero crossing detection on the same signal . the band pass amplifier is necessary to limit the bandwidth of the transmission burst from the microcontroller . a square wave like the burst from the microcontroller has too a high slew rate which will bring the operational amplifier in the t / r switch 112 into slew rate limit and ruin the essential reciprocity of the t / r switch 112 . the transducer amplifiers can be coupled as voltage followers 150 or as current generators . a main difference from common practice is that the transducer is connected to a node in the circuit without switches , the input of the transmission signal to another and the received signal appears on a third . the transducer is connected to the same node in the circuit both during transmission and reception , and thus , is always loaded with the same impedance . as a result , it obeys the “ reciprocity theorem ” making the time delay difference ( difference in transmission time with or against the flow ) unchanged by transducer changes due to temperature , contamination or aging . fig5 shows a possible embodiment for an amplifier circuit for connoting the transducers 206 , 208 . the voltage on the positive input terminal of one of the operational amplifiers 214 , 216 is followed by the negative input terminal , and if a signal appears on the negative terminal , it is amplified and inverted on the output of the amplifier 214 , 216 . when the amplifier 214 , 216 is used for transmitting a signal , the amplifier 214 , 216 is a “ power amplifier ” of a large signal , and when receiving , the amplifier acts as a preamplifier of a small signal . the anti - parallel diodes 260 , 262 serve as low impedance during transmission and as high impedance during receive mode preventing the amplifier 214 , 216 from going into saturation under transmission of a large signal . under reception of small signals they act virtually as disconnections compared to the resistor they are parallel to . the reciprocity theorem requires the transmitting transducer to be driven with the same impedance as the transducer used as receiver . in fig5 , the impedances are virtually zero , but any impedance can be used . the circuit in fig6 has virtually infinite impedances as a current generator , both as power amplifier and as preamplifier . in principle , the t / r switch 312 of fig7 can look like in fig5 . but in most cases , it is too simple . in practice , a more elaborate scheme must be followed to avoid over coupling of the transmission signal via the off capacitance of the switch 312 . an example of minimizing the influence of the off capacitance in the switch is shown in fig7 . an extra switch 314 , 316 is provided enable a capacitive coupling to ground 318 , 320 instead of to the transmission signal from the other channel . this is especially important in air transducers where the received signal is normally 60 db lower than the transmitted signal and the transmitting transducer continues “ ringing ” long time after the excitation . fig8 shows a band pass amplifier 402 with agc . the signal 404 from the front end is for air transducers in the range of few millivolts and hence too small to be analog to digital converted by the built - in analog to digital converters in standard microcontrollers . at the same time , the sampling rate with present technology of low cost microcontrollers is in the range of 1 to 2 million samples per second . in order to avoid aliasing , all frequencies above half the sampling frequency must be removed before digitizing . the frequencies used in air flow meters are up to 250 khz , and if 500 khz shall be damped to say 60 db , it requires a low pass filter with a very sharp cutoff or a more than 10 th order filter . alternatively and much better , is a band - pass filter . the required bandwidth is 5 to 10 khz depending of the transducer used . sallen - key or multiple feedback active filters are appropriate , but other filter types , such as passive lc filters , switched capacitor filters or even mechanical filters can be used . due to fabrication tolerances and temperature variation , the signal amplitude will change from transducer to transducer and during operation . in order to minimize the digitizing noise , the analog to digital converter will utilize the full dynamic range , so that the controller will be able to adjust the amplification . in order to keep the dynamic range of the analog to digital converter utilized , the amplification must be changed in appropriate small steps , preferably in a converter , within certain limits , the agc will work in a way that gives the same percentage gain increase per step . depending on the gain variation , the necessary number of steps and the size of each step will be chosen . a simple 1 of 8 multiplexer 4051 type number can do the task by selecting feedback resistance 406 in an amplifier as shown fig8 if larger gain variation is necessary due to the same electronic unit be used for many different tube diameters , or if there exists a possibility for contamination that may dampen the signal , a digital resistor 406 with 1024 steps may be preferred . since the steps are linear in most commercial versions , a scheme like the one shown in fig9 may be used . this circuit gives a total gain variation of nearly 30 db distributed over the 1024 steps as shown hereunder : fig1 shows a graph that indicates the correlation between the gain and the binary digits . as can be seen from the curvature , increasing binary numbers will achieve a much better gain . by using an analog signal from either a digital to analog output or a filtered pulse width or rate modulated signal from the processor analog variable gain amplifiers or circuits with diodes or voltage dependent resistors can be used . also , use of ptc resistor circuits or the like that thermally changes attenuation on high signal amplitude may be used . fig1 discloses the preferred transducers which are common piezoelectric transducers with a piezoelectric element 604 exited at the lowest radial resonance frequency and approximately a quarter wavelength silicon rubber disk 606 as impedance alignment is glued to the front surface of the piezoelectric element 604 . alternatively , transducers used for parking sensors in cars can be used . these normally work at 40 khz and have a wide angle transmission pattern . if these are used only direct transmission between transducer are used , due to the risk of direct transmission of a spurious signal during the transmission of the reflected signal . fig1 shows a possible embodiment for a transducer and transducer housing with the following characteristics , for example . while the embodiment is shown in fig1 is preferred , other forms either preformed or molded in pace may be used . since the sound more readily goes through solids than through air , the transducer must be isolated acoustically from the duct 4 , 104 , otherwise some sound would be transmitted through the tube wall and arrive at the receiving transducer 6 , 8 , 106 , 108 , and interfere with the flow signal and create nonlinearity . the isolation can be performed with a silicon rubber foam parts 610 , 604 and 612 in the fig1 . the material of the the impedance alignment disk can be various other materials with low acoustic impedances and loss , e . g ., resin filled with hollow glass spheres or hard foams . fig1 shows a flow duct 704 with a reflection 710 whereby the two transducers 706 , 708 become placed on same side next to each other . the distance between the transducers is the same for all tube diameters ; as a result , the time difference δt for the same flow and temperature becomes the same for all sizes . let c be the sound velocity , d the tube diameter , and lx the distance between the transducers . transducers alternately transmit ultrasonic pulses and alternately receive said transmitted pulses . thus , the transmission goes with the flow and against it alternately . ( c · t up ) 2 =( 2 + d ) 2 +( lx + v · t up ) 2 and ( c · t dwn ) 2 =( 2 + d ) 2 +( lx − v · t dwn ) 2 first , solve both equations for c and set the results equal to each other and solve for v : where δt is equal to t up - t dwn and is found with high precision due to the coherent detection principle . the flow meter will be inserted in tubes with nominal bore according to standards . thus , from t up and t dwn it can be determined which standard diameter the flow meter is inserted in and the appropriate calibration constant can be selected from a table stored in memory . since sound traverses the diameter twice in opposite directions , secondary flow orthogonal to tube axis is partially canceled , so that some common flow disturbances have limited influence . the flow profile due to laminar and turbulent flow does have influence , but since the fluid always is air , the reynold number influence can be compensated for by a calculation based on t up and t dwn . the shift from laminar to turbulent flow creates a known shift in flow profile and the shift appears when the reynolds number is : where p is the pressure in pascal , r = 287 . 05 j /( kg · k ) the specific gas constant and t the temperature in kelvin . ( the density for this purpose can be assumed to be 1 . 2 kg / m 3 ), d h is the hydraulic diameter of the pipe and v is the kinematic viscosity of air . the necessary correction will be determined for each dimension by flow tests , but there exists theoretical / empirical formulas for corrections . by these measures it is possible to minimize deviations to a few percent even with flow disturbances as close as a few diameters from the inlet . for two reflections , two parabolic mirrors will be used and for three reflections two parabolic and one flat mirror preferably will be used . normal direct transmission with one or more tracks is possible and will be used as an alternative . the calibration constants of this are found by standard well proven principles . | 6 |
referring to fig1 , well 10 is shown drilled with a horizontal segment in reservoir 12 . casing 16 has been placed in the wellbore and cement 14 pumped into the well to seal the annulus between casing and the wall of the wellbore . perforations 18 have then been formed sequentially during the completion process of the well , usually using a well - known process ( often called “ perf and plug ”) that involves sequential formation of clusters of perforations 18 beginning from the distal end ( toe ) of the well . one set of perforations is formed , a fracturing treatment is performed through that set of perforations , then a bridge plug is set in the wellbore above the perforations and another set of perforations is formed . a fracturing treatment is then performed in the well through the second set of perforations . this process may be repeated for dozens of times in long horizontal wells . the plugs are removed from the well after all fracturing treatments are performed and the well is placed on production . after the “ perf - and - plug ” method of hydraulic fracturing is used , the plugs are removed and the well is produced , the wellbore condition is as depicted in fig1 . the casing in the well contains a large number of perforations , spaced apart over a distance of hundreds or thousands of feet . the production rate of wells completed and fractured as described typically declines at a rapid rate . it is not unusual for the production rate to decline to less than half its initial value within one year . there is then a need to increase production rate from these previously fractured wells . the process to accomplish that is commonly called “ re - stimulation ” or “ re - fracing .” re - stimulating an existing well by fracturing , however , is more difficult than fracturing during initial completion . to fracture a formation effectively , fluids must be pumped downhole under high pressure , through perforations and into the surrounding formation . on a new well , a single stage is perforated and fractured at a time beginning at the toe , as described above . in a re - stimulation process , the casing already contains many perforations spread over a large interval . unless perforations can be isolated or plugged during the treatment , pressure applied during the fracturing process is distributed across the entire perforated segment of the well , which results in practically no new fracturing activity during injection of fracturing fluids . the key to re - fracturing a producing well is to close off most of the perforations at a time when a treatment is to be performed , which reduces the surface area of the exposed formation and increases the pressure on the open areas . the method disclosed herewith employs buoyant or floating ball sealers or ball sealers having a specific gravity very near that of the injection fluid used to treat a well . batches of these ball sealers that may have different rates of degradation under conditions in the wellbore are injected . some ball sealers may have a very slow rate of degradation , degrading in the well over many hours or even days . other ball sealer may degrade at wellbore conditions within a few hours . degradable ball sealers are commercially available with a broad range of degradation times over a range of wellbore temperatures . in preparation for the process described herein , system 13 ( fig1 ) is preferably installed to monitor the fracturing process in the well being re - stimulated . system 13 may be a microseismic system , which is commercially available from pinnacle ( a halliburton company ), microseismic inc . or others , or an imaging system called eem that is commercially available from deep imaging technologies of tomball , tex ., or any other system to monitor the real - time formation of a hydraulic fracture around well 10 . detectors may be installed in well 10 , in an offset well or at the surface around well 10 . in preparation for the fracture treatment , degradable ball sealers may be injected into a well using commonly available ball injection apparatus . the ball sealers are pumped downhole with the conveying fluids at pressures that fracture at least one interval in the well . they follow the path of the conveying fluid and may get lodged in the first perforations they come to where fluid is flowing through the perforations — blocking the flow through those perforations , or they may seat in perforations farther down the well . it is usually not possible to predict a priori where the ball sealers will seat . fig2 illustrates ball sealers 11 a , having the longest degradation time under wellbore conditions of all ball sealers to be injected , arriving at the first cluster of perforations and beginning to seal perforations in that interval . the ball sealers may not seat on the first perforations , but are much more likely to seat on the first perforations where fluid is flowing through perforations and fracturing the adjoining rock . although fig2 illustrates ball sealers seating in the first cluster of perforations , it should be understood that the location of the perforations where ball first seat may be anywhere along the wellbore . during the pumping of fluid and first fracturing , monitoring system 13 is preferably used to determine which interval of the well is being fractured . alternatively , calculations of pressure drops through perforations may be used to analyze the fracturing process , using methods well known in industry . there are multiple scenarios relating to the use of the combination of both “ time and temperature buoyant degrading ball sealers ” and “ non - degrading balls which lose their buoyancy ” in the re - stimulation process . the term “ buoyant ball sealers ” or “ floating balls ” is used to designate ball sealers having a specific gravity within a selected range of the specific gravity of the fluid carrying the ball sealers down the wellbore . balls may be selected with different ranges of specific gravity differences by allowing balls to segregate in a fluid having a selected specific gravity . a range of differences of 0 . 2 , 0 . 1 0 . 05 and 0 . 02 may be selected for batches of buoyant or floating balls , for example . a range of degradation - time of balls can be pumped at fracturing rate to achieve a near ballout . this will allow for treatment of a specific interval with a large stage fracture treatment . at the end of the treatment a sufficient number of the non - degradable floating balls can be used to plug off the section treated until the entire lateral is stimulated . when the shortest degradation set of balls has degraded , another fracturing stage will be initiated and pumped to completion followed by non - degradable floating balls to seal off the second stage . this process may be repeated until the entire section is treated . for various reasons it is possible that the degradable balls will break down earlier than anticipated and more time - degradable balls will be required to temporarily shut - off the section of the lateral prior to stimulation . any breakdown can be observed using microseismic and or eem . where microseismic and eem are not available , the process can be conducted utilizing well - known calculations of perforation friction . this process without surface observation or monitoring , although not optimum , is expected to be superior to diversion techniques using fiber or particulate material . the process disclosed herein will be very dynamic , since it is unknown what intervals were actually treated in the initial fracturing of a well . therefore , multiple iterations of ball drops with various degradation levels may be required in the present process . after fracturing subsides or ceases in the first interval after ball sealers have stopped flow into that interval , pumping is continued to begin fracturing in another interval , which is monitored by monitoring system 13 . each round of ball sealers injected may be selected to degrade in progressively shorter time duration after they block perforations . alternatively , each round of ball sealers injected may be selected to degrade in progressively longer time duration after they block perforations . if the nearest open perforations are blocked with each subsequent round of ball sealers , the sealers closest to the toe may break down the fastest or break down first . ball sealer injection may continue until the well is “ balled out ,” meaning that the maximum rate of fluid injection is very low , for example , less than 5 barrels per minute or even 1 barrel per minute . with microseismic , an electromagnetic imaging system or good information on friction pressure losses in pipe and perforations , it may be desirable to initiate the first fracturing treatment through perforations that have not received ball sealers . after this first treatment , non - degradable balls are dropped , degradable balls are dropped and time for degradation of degradable balls is allowed before the next treatment is started . fig3 illustrates that ball sealers 11 a , 11 b and 11 c , having progressively shorter or progressively longer degradation times , have sealed three sets of perforations at increasing distance from the heel of the well . the last cluster of perforations , nearest the toe of the well , may have been sealed by ball sealers 11 d , having the shortest degradation time of all ball sealers injected , but sealers 11 d are not shown because if they were injected they have degraded . the perforations in that segment may have been opened by the degradation of ball sealers that were originally in that interval . alternatively , injection of balls may have been stopped before blocking that interval . fig4 illustrates a fracturing treatment being pumped through the farthest set of the perforations , or those nearest the toe of the well . fracture - affected volume 15 a in reservoir 12 has been formed as a result of the first stage of the re - fracturing treatment . microseismic data may be collected at the surface or in offset wells or in the well being re - fractured to provide better understanding of where each re - fracturing treatment is occurring . data may also be obtained by electrical or magnetic or any other technique used to detect fracturing in the earth . fig5 illustrates the placement of non - degradable or slowly degradable ball sealers 11 e into the newly fractured perforations . “ slowly degradable ” means that the balls are expected to degrade in a time greater than the total treatment time of all the intervals in a well . after this step the well is prepared for the next fracturing treatment after ball sealers 11 c have degraded . fig6 illustrates that the ball sealers 11 c have degraded in another cluster of perforations , displaced from the distal set of perforations and a second fracturing treatment may be performed in this interval , forming fracture - affected volume 15 b . fig7 illustrates that another batch of non - degradable or slowly degradable ball sealers is injected to close off the second re - fractured interval . the process may be repeated until all intervals have been fractured . of course , it should be realized that , although the invention has been described herein as having fracturing treatments proceed from the toe ( distal end ) or deepest interval of a well successively toward the heel or shallowest segment of a well , the degradation times of ball sealers may be selected such that the most rapidly degrading ball sealers are pumped first and the first fracturing treatment is pumped into the zone where these ball sealers have seated , the nearest interval . then this interval may be isolated by long - life or slowly degradable ball sealers and the next interval be fractured . in most wells this procedure would require longer degradation times of the different stages and , therefore , it would not be the preferred procedure . the non - degradable or slowly degradable ball sealers will eventually degrade in the perforations or wellbore , leaving open fractures with greatly increased productivity , or they may be produced back to surface and collected using conventional ball - catching equipment . the degradation time of a ball sealer in perforations may be determined by placing the ball sealer in a real or simulated perforation in pipe with water or brine immersing the ball sealer and with pressure in the water to seat the ball , bringing the water and pipe to a temperature expected in a well and observing the pressure behavior of water in the pipe . other well - known similar techniques may be used to simulate conditions in a well after ball sealers are injected . the ball sealer is considered to have degraded when the flow resistance through the perforation is less than double the resistance in the absence of a ball sealer . although the present invention has been described with respect to specific details , it is not intended that such details should be regarded as limitations on the scope of the invention , except to the extent that they are included in the accompanying claims . | 4 |
reference will now be made in detail to specific embodiments or features , examples of which are illustrated in the accompanying drawings . generally , corresponding or similar reference numbers will be used , when possible , throughout the drawings to refer to the same or corresponding parts . fig1 - 8 illustrate an exemplary embodiment of an energy harvester 10 in accordance with various aspects of the disclosure . according to some aspects , as shown in fig1 , an exemplary energy harvester 10 may include a housing 14 and a coupling arrangement 56 for coupling the housing 14 to a host structure 15 . referring to fig2 , the energy harvester 10 may further include a single degree of freedom resonator 12 , a pin 16 ( described in more detail below ), electro - mechanical transducers 18 , and electronic circuitry 20 . in an exemplary embodiment , the electromechanical transducers 18 are piezoelectric elements . referring now to fig3 , in an exemplary embodiment the resonator 12 may be a monolithic single degree of freedom resonator . the resonator 12 may include a beam - spring 21 , a proof - mass 24 , and a backplane 26 . the backplane 26 is relatively rigid in comparison with the beam - spring 21 to support the monolithic construction of the resonator , preferable methods of fabrication include removal of material from regions of a single piece of material or an extrusion that provides the proper geometry . both methods provide a two dimensional structure that can be further shaped to the proper geometry with additional fabrication methods . for example , the material removal can be achieved using electric discharge machining ( edm ), water jet cutting , laser cutting , or manual machining . in order to maximize power density of the resonator , a thin cutout in a rectangular c - shaped pattern , as shown by the dashed - dotted region a ( fig3 ), forms the resonator &# 39 ; s profile . during fabrication , channels 28 , 28 ′, 28 ″ are removed from a monolithic block of material 15 . for example , as shown in fig3 , three separate channels 28 , 28 ′, 28 ″ may be removed from the monolithic block 15 . these channels 28 , 28 ′, 28 ″ run completely through the block of material and separate the elements of the resonator 12 . the channels 28 , 28 ′, 28 ″ define a body 124 of the proof mass 24 , the rigid backplane 26 , the beam - springs 21 , and a plurality of flexures 30 , 32 . holes 34 can be created into the proof mass body 124 as mass receptacles . the holes 34 may be cylindrical , rectangular , or any other desired shape . the holes 34 can run completely or partially through the proof mass body 124 . in some aspects , the proof mass body 124 may account for a majority of the proof mass 24 . other holes ( not shown ) can be added to the mounting base 14 to reduce its weight since it is a parasitic mass in the power density calculation . in some aspects , the holes 34 may be filled with additional mass ( either greater than or less than the removed mass ). in some aspects , additional mass may be fixedly coupled to the proof mass body 124 instead of or in addition to the holes 34 . thus , the number and size of holes 34 and / or the additional mass in the holes or secured to the proof mass body 124 may allow tunability of the resonator 12 . according to various aspects of the disclosure , an exemplary preferred sized of the harvester 10 may be 1 to 100 cubic centimeters in volume . the length to height aspect ratio and / or the width to height aspect ratio can range from 1 to 10 . the material of the mounting base 14 may comprise , for example , a metal , a plastic , or a composite material . according to various aspects , it may be preferable that the base 14 comprise a material with low damping such as , for example , brass , steel , titanium , or aluminum or other metals . referring now to fig4 , in an exemplary embodiment of the single - degree of freedom resonator 12 , the beam - springs 21 comprise a pair of cantilevered beams 22 having a first end 23 and a second opposite end 25 . the beams 22 are supported at the first end 23 by the rigid backplane 26 and are connected to the proof mass 24 at the second end 25 by a flexure 30 . when the proof mass 24 causes the beam 22 to deflect in a direction parallel to the backplane 26 as shown by the arrows c , a spring return force is generated , which causes the beam 22 to return to the rest position . referring now to fig5 , in the current exemplary embodiment , flexures 30 , 32 are used to connect various elements of the resonator 12 . the flexures 30 , 32 may perform similarly to hinge or pin joints with no slop and work to define the resonator &# 39 ; s degree of freedom . the flexures 32 have a first end 27 and a second end 29 . the first end 27 is connected to the proof mass 24 and the second end 29 is connected to the rigid backplane 26 . these flexures 32 are anchored to the rigid backplane 26 and thus serve to restrict the proof mass 24 from moving in a direction parallel to the surface of the beam 22 , as shown by arrows d . such restricted motion would otherwise place the flexures 32 in compression or tension . referring now to fig6 , which shows only half of the resonator 12 and one flexure 32 for clarity , since a cross - sectional dimension of the flexure 32 , as shown by the lines e , is small relative to the average cross - section of the beam 22 , shown by the lines f , the flexure 32 bends easily and offers little resistance to motion of the proof mass in a direction that is normal to the surface of the beam 22 , as shown by the arrows c . hence , the stiffness of the flexures 32 is relatively low , adding only small amounts of stiffness to the beam - spring system 21 . similarly , flexures 30 ( fig3 ) connect the proof mass 24 to the beam 22 at second end 25 where force and moment are only transmitted from the proof mass 24 to the open second end 25 of the cantilevered beam 22 in a direction normal to the surface of the beam 22 , as shown by arrows c . with this setup , the stiffness of the resonator 12 in the direction normal to the surface of the beam 22 , as shown by arrows c , is maximized while the stiffness of the resonator 12 in a direction parallel to the length of the beam 22 , as shown by arrows d , is tailored to define the linearity of the spring stiffness . referring to fig7 , which shows just the beam - spring system 21 for clarity , the cross - section f ( fig6 ) of the beam 22 in an exemplary embodiment of the resonator 12 is varied from a minimum value at the second end 25 to a maximum value at the opposite first end 23 . the first end 23 is attached to the rigid backplane 26 so that as the proof mass 24 bends the beam 22 , the surface strain distribution along the length g of the beam 22 is constant . the thickness of the beam 22 can be tapered according to the particular strain distribution and basic harvester geometry . the beam - spring system 21 is designed such that strain discontinuities from the piezoelectric element 18 are located where the beam 22 is immobilized . the piezoelectric transducer 18 is positioned at the cantilevered first end 23 of the beam 22 such that the end 40 of the transducer 18 is on the rigid back plane side of channel 28 , as shown by lines h . thus , the end 40 of the peizoelectic element 18 nearest the back plane 26 is over a section of material having a cross - sectional dimension i , which is much larger than the cross - sectional dimension k of the beam 22 at the cantilevered first end 23 and is effectively immobilized . at the open second end 25 of the cantilevered beam 22 , the flexure 30 and the beam 22 are connected via a tapered section 42 of material . thus , the end 44 of the piezoelectric element 18 nearest the open second end 25 of the beam 22 is over a section of material with a cross - sectional dimension j , which is larger than the beams cross - sectional dimension l and is effectively immobilized . this geometry minimizes stress concentrations that can lead to fatigue cracks and , for the case in which a piezoelectric transducer 18 is used , it provides a substantially uniform strain distribution on the transducer 18 , which can be relatively fragile . for typical linear resonate systems , linear stiffness may be used to maximize the mechanical quality factor of the resonator 12 . this linearity requires that the proof mass amplitude grows proportionally with increasing input vibration amplitude . in the case of high input vibration amplitudes , damage can occur due to excessive beam - spring deflection or impact of the proof mass with device mechanical packaging . aspects of the disclosure overcome this because the boundary conditions of the beams 22 are designed such that the mode of deflection of the beams 22 changes from a pure bending mode for small displacements m to a combination of a bending and stretching mode for large displacements n . ( the displacements m and n are illustrative only and not necessarily to scale .) the aforementioned transition occurs when the deflection of the beam is sufficiently high that tensile stress in the beam provides the primary restoring force rather than bending stress . for smaller displacements m , the beam - spring system operates similarly to a typical linear resonant system . for higher displacements n , the linear stiffness of the beam - spring system increases . this increased stiffness variation reduces the resonator &# 39 ; s quality factor ( q ) and alters the frequency of the transmissibility maxima . this behavior may be advantageous for many industrial applications where a high level of sensitivity is required for low vibration levels ( i . e ., a high q system for low vibration ) and mechanical robustness is desired for shock and high vibration levels ( i . e ., a low q system for high vibration ). in an exemplary embodiment , as shown in fig8 , the proof mass 24 includes holes 34 as a mechanism for tuning the resonance frequency of the resonator 12 after manufacturing . resonance frequency tuning may be particularly important in manufacturing where it may be undesirable to adhere to tight tolerances and specific fabrication methods which are required for achieving a precise resonance frequency . for an energy harvester 10 with a typical quality factor of 50 and a resonance frequency of 360 hz , the power output will be half of the peak power , if there is a frequency mismatch of 3 . 6 hz . a reasonable 1 . 0 hz frequency tolerance translates to an approximate 3 . 6 micrometer tolerance for the thickness dimension on the 0 . 5 mm thick beam , assuming that all other dimensions are held perfectly to the specification . this level of precision increases the cost of the harvester and decreases its applicability in many markets . the holes 34 in the proof mass 24 are receptacles for discrete masses of different sizes and densities which change the resonance frequency of the resonator 12 . resonance modes of the mounting base 14 and proof mass 24 can adversely influence the performance of the resonator 12 if they lie in the frequency range for which the resonator 12 is designed to operate . the mounting base 14 is therefore designed such that resonance modes dictated primarily by its structure will be much higher than that of the resonator &# 39 ; s spring - proof mass resonance frequency . to achieve this , the mounting base 14 may be designed to be stiff relative to its mass . the mounting base 14 may be constructed with a thick cross - section , shown by the lines marked o , to maximize its first moment of area which in turn defines its flexural stiffness . the base 14 can be constructed from the same material as the single - degree - of - freedom resonator 12 or can be a different material . the preferred materials are ones that have low intrinsic damping and high fatigue resistance . for example , steel generally exhibits a good combination of these two characteristics . as described above , the material of the mounting base 14 may comprise , for example , a metal , a plastic , or a composite material . according to various aspects , it may be preferable that the base 14 comprise a material with low damping such as , for example , brass , steel , titanium , or aluminum or other metals . according to some aspects , the mounting base 14 and the resonator 12 are separately constructed components . one end surface of the resonator 12 includes an arch 48 . an end surface of the mounting base 14 includes an arch 50 opposing the arch 48 , thereby forming a substantially circular hole 46 . a pin 16 ( fig2 ) may be inserted into a hole 46 formed by the arches 48 , 50 to create a compression fitting to hold the resonator 12 together with the base 14 . another arch 52 may be formed at the opposite end of the resonator 12 relative to the arch 48 , and the base 14 may include a notched - out arch 52 . the arch 52 formed on the resonator may fit into the complementary notched - out arch in the base 54 for a compression fitting at the end of the resonator opposite the insertion point ( i . e ., hole 46 ) of the pin 16 . in an exemplary embodiment , a threaded fastener 56 ( fig1 and 2 ) may be used to attach the base 14 to host structure 15 . the fastener 56 may preferably be located below the center of mass of the energy harvester 10 and be oriented parallel to the idealized straight line motion of the proof mass 24 . in some aspects , the fastener size may preferably be a 10 - 32 or ¼ - 28 fastener . the proof mass 24 is designed such that its structural resonance modes are well above the resonance frequency of the resonator &# 39 ; s spring - proof mass resonance frequency . thus , the proof mass 24 is relatively rigid . the proof mass 24 accounts for a majority of the energy harvester &# 39 ; s volume . thus parasitic mass may be reduced and the power output of the resonator 12 increased . the channels 28 , 28 ′, 28 ″ provide clearance around the perimeter of the proof mass 24 so that the proof mass 24 does not impact the surrounding structure . the clearance between the proof mass 24 and the surrounding structure may typically be on the order of 0 . 1 - 5 mm . the beam 22 has a substantially flat surface facing the piezoelectric element 18 so that a thin piezoelectric element 18 can be bonded to the beam 22 . it should be appreciate that the piezoelectric element 18 may preferably be attached to the beam 22 using an adhesive or solder bond , but any suitable means may be used . the flexing of the beam 22 creates a strain in the piezoelectric transducers . based on the properties of the piezoelectric material , the strain induces an electric charge at the transducers electrodes ( not shown ). the electrodes can be connected to electronic circuitry 20 ( fig2 ) allowing the charge to be extracted and placed across an electronic load ( not shown ). in an exemplary embodiment , the energy harvester 10 uses a piezoelectric material with electrodes that are perpendicular to the primary direction of strain experience by the beam 22 . since the electric field generated in the piezoelectric material is proportional to the strain , the voltage at the electrodes is minimized by using thin layers of material . in this configuration , the d31 piezoelectric constant defines the relationship between strain and electric field . since thin layers are also required in this configuration , the piezoelectric material is attached directly to the surface of the beam . piezoelectric elements are generally diced into thin elements that have a uniform cross - section and flat mounting surfaces . in another embodiment for the piezoelectric transducer 18 , piezo fiber composites are used instead of bulk piezoelectric elements . in these composites , piezoelectric fibers are embedded in a plastic laminated package . the laminated package has arrays of electrodes on its surfaces . the piezo fiber composites can be bonded to the beam in a similar way to the bulk piezoelectric elements . this configuration uses the d33 coupling because the piezoelectric material can be poled in parallel with the fibers . in yet another embodiment of the piezoelectric transducers 18 , one or more piezoelectric element ( s ) can be attached to either or both sides of the beams 22 . the piezoelectric elements can be wired in series or parallel to adjust the voltage and current that delivered to the circuit . the piezoelectric element ( s ) preferably have either a pmn - pt composition or a pzt composition . soft piezoelectric materials such as pzt - 5h are used for low frequency applications where maximizing charge density per strain is important . hard piezoelectric such as pzt - 5a is used for higher frequency applications where intrinsic losses in the material &# 39 ; s electromechanical transduction are minimized . the use of piezoelectric transducers to convert mechanical energy to electrical energy is well known in the art and will not be discussed further . in an exemplary embodiment of the energy harvester circuitry 20 , shown in fig9 , energy is harvested from the electromechanical transducer using an electrical circuit 900 that includes an input voltage protection 902 such as a diode bridge , a power conditioner 904 such as a dc - dc converter , an energy storage element 906 , a voltage regulator 908 , and an output switch 910 . input voltage protection and overvoltage protection for the storage element are also included in the circuit 900 . the input voltage protection 902 ( e . g ., a diode bridge ) provides rectification of the voltage waveform from the energy harvester transducer . the uni - polar rectified waveform is fed to one or more input capacitors that act as a voltage filter so that a steady dc voltage is available for the power conditioner 904 ( e . g ., dc - dc converter ). the power conditioner 904 optimally transfers energy from the input capacitor ( s ) which are at variable voltages to a much large size energy storage element that is typically used within a narrow voltage range . the energy storage element 906 provides an energy reservoir so that the load can draw power that is much higher than that supplied by the harvester for short durations . this is needed because the electrical load is generally determined by its specific application and it is often much higher than that which is available directly from the energy transducer . however , these loads are typically required for a brief period of time , which allows for a duty cycle operation that balances the harvester - load energy budget . the load can either be connected directly with the energy reservoir or an additional voltage regulator can be used between the reservoir and the load . this is necessary for many applications because the energy reservoir voltage often fluctuates with the amount of energy stored while the load requires an input voltage that is fixed . in addition to the regulator , a hysteretic power supply switch is required that provides conductivity from the energy storage element or voltage regulator to the load . the hysteresis is provided by a comparator circuit and is based on the energy stored at the storage element . energy stored is typically related to the voltage , particularly in the typical case of a battery or capacitor . one exemplary implementation of the bridge may be an array of low voltage schottky diodes in a full or half bridge arrangement . the input capacitor ( s ) are ceramic . the exemplary dc - dc converter uses a non - synchronous buck boost or non - synchronous boost style topology . the exemplary energy storage element 906 is a capacitor or rechargeable battery . various types of capacitors including tantalum , electrolytic , ultra - capacitors , and ceramic capacitors can be used in this application . the output voltage regulator 908 is preferably a regulated switching power supply . the circuit is preferably located in a region that is remote to the load path between the host structure 15 and the proof mass 24 . the electrical connection is preferably in the form of a sealed detachable connector or a wire with a strain relief . referring to fig1 , another exemplary embodiment of the monolithic single degree of freedom resonator 58 is shown . in this embodiment , the electromechanical transducers 60 are placed between the proof mass 62 and the rigid backplane 64 and are mounted to both . as the proof mass 62 is excited and moves in a direction parallel to the rigid backplane 26 , as indicated by p , the piezoelectric transducers experience a shear force which induces an electrical charge between the terminals ( not shown ) of the transducers 60 . several flexures 66 are once again used to connect the proof mass 62 , beam - springs 68 and rigid backplane 64 to each other . the flexures are again used to define the stiffness and linearity of the resonator . holes 70 in the proof mass for resonance frequency tuning are also included . fig1 represents another exemplary embodiment of the energy harvester . here multiple resonators 72 are constructed from the monolithic building block . two resonators are shown but more may be included . this allows the energy harvester to produce peak power over a larger vibration bandwidth . fig1 shows a typical single resonator embodiments power output where the maximum power output is associated with the resonators single resonance frequency . by changing the resonance frequency , the peak power output can be move in the frequency band as shown by arrows q . however , fig1 shows the inventions power band when two resonators are included in the same housing each tuned to a separate resonance frequency thus allowing the energy harvester to be designed to have more than one vibration frequency in which peak power is generated . in this case a wider power band can be generated , as shown by arrows r . the power band can be configured by choosing and / or adjusting the difference between the two resonance frequencies f 1 , f 2 . referring now to fig1 , another exemplary embodiment of the resonator 76 is shown in which the proof mass 78 is attached to the center of a beam spring 80 which is supported by the rigid structure 82 at both ends 84 , 86 . flexures 90 are again used to connect the elements and define the resonators degree of freedom . two levers 92 are incorporated for frequency tuning and holes 94 in the rigid base structure 82 are used to reduce the parasitic mass of the resonator . referring now to fig1 , two levers can be included as an additional frequency tuning mechanism to induce curvature in the beam . the curvature can be induced in parallel or normal to the axis of curvature of the beam &# 39 ; s resonance mode . in the parallel case 96 , the curvature induced in the beam 80 causes the beam to experience higher membrane stresses for a given vibration level which in turn increases its effective stiffness . for the normal case 98 , bending increases the beam &# 39 ; s 100 cross - sectional first moment of area , which increases the beam stiffness . practical implementation of this tuning method is straightforward because movement of the two levers 92 relative to one another as shown by lines can be achieved with a simple fastener that stretches between the levers . the fastener pulls the ends of the two levers together or pushes them apart . referring now to fig1 , another exemplary embodiment of the invention , an electromagnetic device 102 is used to extract energy from the moving mass or beam . the electromagnetic transducer consists of a permanent magnet 104 or magnetic device and a wire coil 108 . movement of the magnet relative to the 108 coil causes variation in the magnetic field in the proximity of the coil 108 . this in turn induces current flow through the coil 108 according to maxwell &# 39 ; s equations . the wire coil 108 can include a magnetically permeable core 106 to enhance the electromagnetic coupling in the coil 108 . the coil 108 may be mounted on the proof mass 110 and the magnet 104 on the mounting base 112 . alternatively , the coil 108 may be mounted on the mounting base 112 and the magnet 104 mounted on the proof mass 110 . from the foregoing , it will be appreciated that , although specific embodiments have been described herein for purposes of illustration , various modifications or variations may be made without deviating from the spirit or scope of inventive features claimed herein . other embodiments will be apparent to those skilled in the art from consideration of the specification and figures and practice of the arrangements disclosed herein . it is intended that the specification and disclosed examples be considered as exemplary only , with a true inventive scope and spirit being indicated by the following claims and their equivalents . | 7 |
the disclosure is illustrated by way of example and not by way of limitation in the figures of the accompanying drawings in which like references indicate similar elements . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references mean “ at least one .” fig1 shows an enclosure supporter 10 according to one embodiment . the enclosure supporter 10 is used for supporting an enclosure 30 . the enclosure 30 includes a bottom panel 31 . the bottom panel 31 defines two engaging holes 311 . fig2 and 3 show that the enclosure supporter 10 includes a mounting member 11 and two sliding members 13 . the mounting member 11 includes a panel body 111 and two engaging portions 113 , extending from an upper side 1110 of the panel body 111 . the mounting member 11 includes two engaging tabs 115 extending from a lower side 1112 of the panel body 111 . the upper side 1110 is substantially parallel to the lower side 1112 . the panel body 111 defines a recess portion 1111 . the mounting member 11 further includes a rotating shaft 1113 extending from the bottom portion of the recess portion 1111 . the panel body 111 defines two sliding slots 1115 recessed from the lower side 1112 . each sliding slot 1115 communicates with the recess portion 1111 via a connecting opening 1117 . each sliding slot 1115 communicates with a positioning opening 1119 . the panel body 111 further defines two mounting slots 117 in the lower side 1112 . each mounting slot 117 defines a wide part 1171 , a first narrow part 1173 communicating with the wide part 1171 , and , a second narrow part 1175 communicating with the wide part 1171 . the first narrow part 1173 and the second narrow part 1175 are located on opposite sides of the wide part 1171 . the first narrow part 1173 and the second narrow part 1175 pass through the upper side 1110 and the lower side 1112 . a separating portion 1114 is located on the upper side 1110 corresponding to the wide part 1171 . the mounting member 11 further includes a gear 119 pivotally mounted to the rotating shaft 1113 . each sliding member 13 includes a main body 131 and a first sliding portion 133 , a second sliding portion 135 , and a rack 137 for engaging with the gear 119 . the first sliding portion 133 , the second sliding portion 135 , and the rack 137 extend from the main body 131 . the extending direction of the rack 137 is substantially parallel to the extending direction of the first narrow part 1173 . the main body 131 includes a wide portion 1311 and a narrow portion 1313 extending from the wide portion 1311 . the main body 131 is l - shaped . the rack 137 is mounted to the main body 131 . the first sliding portion 133 includes a first neck portion 1331 , extending from the wide portion 1311 of the main body 131 , and a first head portion 1333 , extending from the first neck portion 1331 . the second sliding portion 135 includes a second neck portion 1351 , extending from the narrow portion 1313 of the main body 131 , and a second head portion 1353 , extending from the second neck portion 1351 . the main body 131 defines two engaging openings 1315 corresponding to the engaging tabs 115 . fig4 and 5 show that in assembly of the enclosure supporter 10 , the rack 137 of one of the sliding members 13 is mounted in the sliding slot 1115 of the mounting member 11 , to pass through the positioning opening 1119 . the first sliding portion 133 and the second sliding portion 135 are placed in the two wide parts 1171 of the two mounting slots 117 . the first sliding portion 133 moves a distance to be positioned in the first narrow part 1173 , to enable the main body 131 to contact the mounting member 11 . the first sliding portion 133 is positioned in the first narrow part 1173 to contact an edge of the separating portion 1114 . at this time , the second sliding portion 135 is positioned in the second narrow part 1175 of another mounting slot 117 . a part of the rack 137 is received in recess portion 1111 via the connecting opening 1117 . another sliding member 13 is mounted to the mounting member 11 according to the above steps . at this time , the two racks 137 are substantially parallel to each other . the two engaging tabs 115 engage in the engaging openings 1315 . the gear 119 is pivotally mounted to the rotating shaft 1113 to engage the two racks 137 . fig7 shows that the two engaging portions 113 , of the enclosure supporter 10 , correspond to the engaging holes 311 of the enclosure 30 . the enclosure supporter 10 moves to the bottom panel 31 of the enclosure 30 to enable the two engaging portions 113 to engage in the two engaging holes 311 , thereby securing the enclosure supporter 10 to the enclosure 30 . fig6 and 8 show that in use , one of the sliding members 13 is pulled outwards along a first direction . the first sliding portion 133 of the sliding member 13 1 slides in the first narrow part 1173 of the mounting slot 117 . the second sliding portion 135 slides in the second narrow part 1175 of another mounting slot 117 . the rack 137 of the sliding member 13 drives the gear 119 to rotate , thereby driving another sliding member 13 to move outward along a second direction substantially opposite to the first direction . the enclosure supporter 10 is thus unfolded to support the enclosure 30 . at this time , the two engaging tabs 115 engage in the engaging openings 1315 . it is to be understood , however , that even though numerous characteristics and advantages of the embodiments have been set forth in the foregoing description , together with details of the structure and function of the embodiments , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the present disclosure to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . | 5 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . a digital cable broadcast under an open cable and a cable ready standards observes an atsc standard . therefore , the caption_service_descriptor the eit or the pmt within the psip , included in the digital cable broadcast signal is prescribed by the atsc standard ( a65 , program and system information protocol for terrestrial broadcast and cable ). fig2 is a view showing a syntax of the caption_service_descriptor under the open cable and the cable ready standards according to the present invention . “ descriptor_tag ”, which is a parameter for checking a type of a descriptor , is described by 8 bits . “ descriptor_length ”, which is a parameter representing a length of the whole structure , is described by 8 bits . “ number_of_services ” represents a number of provided caption services and is described by 5 bits . “ language ” represents language information of a relevant caption , such as english for a service 1 and spanish for a service 2 , and is a 3 - byte language code under iso 639 . 2 / b , each letter of which is coded with 8 bits and inserted into a 24 - bit field . “ cc_type ” represents a kind of caption . if cc_type == 1 , it is a digital caption ( advanced caption ) and if cc_type == 0 , it is an analog caption ( analog caption under the eia 708 or the scte 20 ( dvs 157 )). the “ cc_type ” is described by 1 bit . “ analog_cc_type ” represents a kind of an analog caption . if analog_cc_type == 1 , it means caption data transmitted through a line 21 of the vbi under the eia 708 , and if analog_cc_type == 0 , it means caption data transmitted through other line except the line 21 of the vbi according to the scte 20 or the dvs 157 . “ line_offset ” represents a number of the vbi line including the caption data in case caption data under the scte 20 or the dvs 157 is transmitted , namely , in case the analog_cc_type == 0 , and is described by 5 bits . “ line_field ” represents whether the caption data is included in an even field or an odd field . that is , if line_field == 0 , it means the caption data is included in an odd field and if line_field == 1 , it means the caption data is included in an even field . “ caption_service_number ” represents 1 - 63 caption service numbers in case it is a digital caption , namely , in case cc_type == 1 . and is described by 6 bits . “ easy_reader ” is a flag representing whether it is a caption easily read by a user or not . “ wide_aspect_ratio ” is related to a screen ratio , and more particularly , is a flag representing whether a received caption data is intended for a 16 : 9 screen or not . if cc_type == 0 , a received caption is an analog caption . as described above , for the analog caption there exist an analog caption under the eia 708 standard , and an analog caption under the scte 20 or the dvs 157 standard . however , since the analog caption under the eia 608 standard is a pure analog caption , not a closed caption for a digital tv mentioned in the present invention , the analog caption under the eia 608 standard is excluded . therefore , an analog caption for the case cc_type == 0 , is either an analog caption under the eia 708 standard or an analog caption under the scte 20 or the dvs 157 standard . “ analog_cc_type ” represents whether a received caption is an analog caption under the eia 708 standard or an analog caption under the scte 20 or the dvs 157 standard . if analog_cc_type == 0 , it means that the relevant caption is included in a video data region in form of user data under the scte 20 or the dvs 157 , which are standards on the digital cable broadcast . in that case , since to which line of the vbi the received caption is assigned , is not known in view of characteristics of the cable broadcast , the line_offset describes to which line of the vbi the received caption is included . if analog_cc_type == 1 , it means that an analog caption under the eia 708 standard is included in a video data region in form of user data . in that case , since the caption is assigned to a 21 st line of the vbi , a line_offset value is not required . therefore , 5 bits assigned to the line_offset becomes a reserved bit and 1 bit is assigned to the line_field representing whether a caption is a caption included in an even field or a caption included in an odd field . if line_field == 0 , it means a caption is included in an odd field and if line_field == 1 , it means a caption is included in an even field . as described above , whether a caption included in the digital cable broadcast is an analog caption or a digital caption is judged on the basis of information included in the caption_service_descriptor . further , if the received caption is an analog caption , whether the caption is an analog caption under the eia 708 standard or a caption for a cable broadcast under the scte 20 or the dvs 157 standard , is judged . if the received caption is a caption under the scte 20 or the dvs 157 standard , in which line of the vbi the caption data is included , is judged . if the received caption is a digital caption , information as to which service the caption includes among sixty - three services , is checked . a broadcast station generates caption information including the above described various information and adds the caption information to a broadcast signal . a broadcast receiver detects caption information included in a broadcast signal provided from the broadcast station , and judges various characteristics of the received caption data on the basis of parameter values included in the detected caption information . fig3 is a block diagram illustrating a construction of a digital broadcast receiver according to the present invention . referring to fig3 , a mpeg demultiplexer 501 receives a mpeg - 2 transport stream from a cable and decodes the transport stream so as to extract video data , audio data , and supplementary information . further , the mpeg demultiplexer 501 detects an eit and a pmt included in the supplementary information . the detected pmt is stored in a pmt buffer 502 and the detected eit is stored in an eit buffer 503 . here , the detected pmt or eit includes caption information , namely , a caption_service_descriptor . a controller 504 receives caption information from the pmt buffer 502 or the eit buffer 503 and detects caption data included in the transport stream on the basis of the caption information . a video parser 505 receives video data decoded by the demultiplexer 501 and separates the video data into user_data and mpeg - 2 video data . an analog caption decoder 506 receives user_data from the video parser 505 and detects analog caption data from the user_data on the basis of a signal outputted from the controller 504 . a digital caption decoder 507 receives the user_data from the video parser 505 and detects digital caption data from the user_data on the basis of a signal outputted from the controller 504 . a mpeg - 2 video decoder 508 decodes mpeg - 2 video data generated by the video parser 505 . a graphic block 510 outputs a signal for generating a gui ( graphic user interface ) such as an osd ( on screen display ) menu including information provided from the controller 504 . the graphic block 510 displays , on a screen , various characteristics of the received caption data , for example , a number of caption services , a national language of a caption , a type and a standard of the received caption data , vbi line information and field information that correspond to the caption data , a difficulty level of the caption , a picture ratio of the caption . a video combiner 509 receives analog caption data from the analog caption decoder 506 or receives digital caption data from the digital caption decoder 507 . further , the video combiner 509 receives video data from the mpeg - 2 video decoder 508 and receives a signal outputted from the graphic block 510 . the video combiner 509 combines the received signals so as to generate data that will be possibly displayed . a video reconstructor 511 encodes an analog caption data decoded by the analog caption decoder 506 , at a 21 st line of the vbi . operation of the digital broadcast receiver as described above according to the present invention will now be described . fig4 illustrates a method for processing a caption according to the present invention . if a mpeg - 2 transport stream transmitted through a cable is received , the mpeg demultiplexer 501 divides the received transport stream into video data , and audio data , supplementary information . the supplementary information includes a psip defining electronic program guide ( epg ) and system information ( si ). the psip includes a plurality of tables including information for transmitting / receiving a / v ( audio / video ) data made in a mpeg - 2 video and ac - 3 ( audio coding - 3 ) audio formats , and information regarding channels of each broadcast station and information regarding each program of channel . among them , information regarding the pmt and information regarding the eit are stored in the pmt buffer 502 and the eit buffer 503 , respectively . under the atsc standard , the digital cable broadcast signal must include a caption_service_descriptor in its pmt or eit . the controller 504 reads a caption - related option stored in a memory ( not shown ) and determines a caption - related option selected by a user ( s 11 ). for example , the caption - related option includes various options such as “ caption off ”, “ caption service selection ( cc1 , cc2 , cc3 , . . . )”, “ english caption display ”, “ korean caption display ”, “ size of caption ”, “ color of caption ”. if a user selects “ caption off ”, the controller 504 does not display the received caption . if a user selects “ english caption display ”, the controller 504 controls the caption decoders 506 and 507 so that only the caption written in english may be displayed on a screen . further , the controller 504 controls the caption decoders 506 and 507 so that the received caption data may be processed according to a set size and a set color of a caption . the controller 504 receives the caption information and judges characteristics of the received caption data on the basis of parameter values included in the caption information ( s 12 ). the controller 504 judges a number of caption services on the basis of the caption information . for example , the controller 504 judges whether a synchronous caption , an asynchronous caption service , a letter information service are provided . the controller 504 judges a language of the received caption on the basis of the caption information . for example , the controller 504 judges whether the received caption is english , japanese , or korean . the controller 504 judges a type of the received caption data on the basis of the caption information . for example , the controller 504 judges whether the received caption data is digital caption data or analog caption data ( s 13 ). the controller 504 determines a standard of the received caption data on the basis of the caption information . for example , if the received caption data is analog caption data , the controller 504 judges whether the received caption data is caption data under the eia 708 standard or the scte 20 or the dvs 157 standard . further , the controller 504 judges a vbi line number and a field including the received caption , a difficulty level of the received caption , and a picture ratio of the received caption on the basis of the caption information . to judge whether the received caption data is digital caption data in the step of s 13 , the controller 504 judges whether the digital caption data is included in the video data on the basis of the caption information . if digital caption data under the eia 708 is included in the video data ( if cc_type == 1 ), the controller 504 detects a service id that corresponds to the caption data from the caption information ( s 14 ) and transmits the detected service id to the digital caption decoder 507 . the service id can be known from a capto_service_number included in the caption information . the digital caption decoder 507 extracts and decodes caption data that corresponds to the service id from user_data of a picture header transmitted from the video parser 505 ( s 15 ). subsequently , the extracted caption data is transmitted to the video combiner 509 . the video combiner 509 combines the extracted caption data , video data outputted from the mpeg - 2 video decoder 508 , and signals outputted from the graphic block 510 . if analog caption data is included in the video data ( if cc_type == 0 ), the controller 504 judges whether the received caption data is analog caption data ( analog_cc_type == 1 ) under the eia 708 standard or analog caption data ( analog_cc_type == 0 ) under the scte 20 or dvs 157 standard ( s 16 ). at this point , the controller 504 determines a standard of the received analog caption data on the basis of the caption information . if the received caption data is analog caption data under the scte 20 or the dvs 157 , the controller 504 checks vbi line information described in 5 bits by a line_offset included in the caption information . the vbi line information represents a position of the caption data . further , the controller 504 judges a field where the caption data exists on the basis of line_field information included in the caption information . if line_field == 0 , the caption data exists in an odd field and if line_field == 1 , the caption data exists in an even field . after that , the controller 504 transmits the above checked vbi line information and the line field information to the analog caption decoder 506 . if the received caption data is analog caption data , user_data outputted from the video parser 505 is not processed by the digital caption decoder 507 . the analog caption decoder 506 finds out ( s 18 ) analog caption data made in the scte 20 or the dvs 157 standard from user_data inputted from the video parser 505 on the basis of the vbi line information and the line field information , and decodes the analog caption data ( s 19 ). the analog caption data found by the analog caption decoder 506 is transmitted to the video combiner 509 . the video combiner 509 combines the analog caption data , video data outputted from the mpeg - 2 video decoder 508 , and signals outputted from the graphic block 510 . signals outputted from the video combiner 509 are transmitted to the video reconstructor 511 . the video reconstructor 511 reconstructs a caption by encoding analog caption data outputted from the analog caption decoder 506 , at a vbi 21 st line . the reconstruction of a caption is to prevent analog caption data from being an open caption in case of storing , data , as it is , outputted from the video combiner 509 in a storage medium such as a vcr ( video cassette recorder ). if the received caption data is analog caption data under the eia 708 standard ( if analog_cc_type == 1 ), the controller 504 transmits line_field information included in the caption information to the analog caption decoder 506 . since analog caption data under the eia 708 standard is positioned at a vbi 21 st line , a line_offset value is not required . at this point , the digital caption decoder 507 extracts a 2 - byte analog data in user_data including digital caption data from the video parser 505 and transmits the analog data to the analog caption decoder 506 . subsequently , the analog caption decoder 506 finds out ( s 17 ) analog caption data present in a vbi 21 st line from the 2 - byte analog data on the basis of the line_field information and decodes the analog caption data ( s 19 ). the found analog caption data is combined with video data from the mpeg - 2 video decoder 508 and signals from the graphic block 510 by the video combiner 509 . the video reconstructor 511 reconstructs a caption by encoding analog caption data from the analog caption decoder 506 at a vbi 21 st line . if analog caption data under the eia 708 and analog caption data under the scte 20 and the dvs 157 are all present in the user_data , the analog caption data under the eia 708 is processed . further , if digital caption data under the eia 708 and analog caption data under the eia 708 are all present in the user_data , the digital caption data is processed . as described above , the present invention judges a type of caption data on the basis of caption information included in the received broadcast signal and automatically processes the caption data according to the type , thereby providing convenience to a user . further , the present invention judges various characteristics of the received caption data such as a standard of caption data , a number of caption services being received and provides the characteristics to a user . furthermore , the present invention can store caption - related options selected by a user and display the caption being received according to the caption - related options . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . | 7 |
fig1 is a plan view of a perforated label assembly 10 in accordance with one embodiment of the present invention . the label assembly 10 includes a backing 1000 and two label members 100 . each label member 100 is configured and dimensioned to be applied to a portion of an electrical apparatus ( as depicted in fig2 - 4 ). each label member 100 includes a primary label portion 110 and severable label portion 120 . each label member 100 also includes an alignment strip 200 including alignment strip portions 201 which are delineated from the label 100 via perforation 220 , and from each other via secondary perforation 230 . the alignment strip 200 depicted in fig1 is configured in an “ l ” shaped configuration which corresponds with structuring structural features of the surface to which the label 100 will be applied , as described below . it will be understood that the alignment strip 200 may comprise a variety of dimensions and configurations . each alignment strip portion 201 includes a tabbed end 210 which protrudes beyond the boundary of the label member 100 . as such , the tabbed end 210 facilitates removal of the alignment strip portion 201 by providing a surface which is easily graspable by a user , once the label member 100 is applied to the desired surface . as such , the label member 100 is configured to be removed from the backing 1000 as a single member . fig2 depicts a detail of the area of fig1 indicated as 2 . therein , further details of the perforation 220 may be seen . accordingly , the perforation 220 comprises a plurality of apertures 223 and webs 222 disposed along the perforation 220 . as such , when it is desired to remove the alignment strip portion 201 , the perforation 220 facilitates an orderly removal by concentrating stresses at each web 222 , thereby allowing the alignment strip channel 201 to be torn substantially along the perforation 220 . fig3 is a section view taken along line 3 - 3 of fig2 . therein , it can be seen that the apertures 223 extend through the thickness of the alignment strip portion 201 . it will be appreciated that in alternative embodiments the apertures 223 may only extend partially through the alignment strip portion 201 and in yet further embodiments the apertures 223 may extend into the backing 1000 , depending at least in part upon manufacturing processes used . it may also be seen that an adhesive coating 130 is applied to the label 100 , which is then disposed onto the backing 1000 at an interface 1010 . in at least one embodiment , the aperture size , aperture depth , web size , adhesive composition , and backing composition are cooperatively selected such that a force placed on the web 222 during removal of the label 100 from the backing 1000 is less than a force required to tear the webs 222 . stated another way , at least some of the above referenced characteristics are selected such that a failure stress of the webs 223 is larger than the actual stress experienced by the webs 223 during removal of the label 100 from the backing 1000 . one way to accomplish such a relation may be to optimize the perforations 220 , such as optimizing the dimensional relationships between apertures 223 and webs 222 . alternatively , one method might focus on reducing an adhesion strength between the adhesive layer 120 and backing 1000 at the interface 1010 . however , it will be appreciated that other dimensional and compositional relationships may also accomplish the goals of the present invention . in an additional embodiment , the adhesion strength between the adhesive coating 130 and the electrical apparatus is larger than the adhesion strength at the interface 1010 . indeed , the adhesion strength between the adhesive coating 130 and the electrical apparatus may be larger than the perforation strength such that , after application of the label member 100 to the electrical apparatus , the alignment strip 200 may be removed by simply peeling it away from the electrical apparatus , tearing the perforation 220 , and leaving the desired primary label portion 110 and severable label portion 120 of the label member 100 adhered to the electrical apparatus . fig4 is a plan view of one embodiment of a label member 100 of the present invention affixed to an electrical apparatus 2010 . as can be seen , the label member 100 has been removed from the backing 1000 ( depicted in fig1 ) and affixed to the electrical apparatus 2010 as a single member , with alignment strip 200 connected to the primary label portion 110 and severable label portion 120 . fig5 is a plan view of one embodiment of a label member 100 of the present invention affixed to an electrical apparatus 2010 and having an alignment strip portion 201 removed . in at least one embodiment , the alignment strip portion 201 may be removed by grasping the tabbed portion 210 and pulling , thereby separating the alignment strip portion 201 from the label member 100 at the perforations 220 . additionally , as the depicted alignment strip is “ l ” shaped , a secondary perforation 230 may be disposed at an angled or radiused portion 231 therof so as to avoid unintentional tearing of the alignment strip portion 201 as it is removed . one feature of the present invention is the provision of an alignment spacing 300 due to removal of the alignment strip 200 . as can be seen , the electrical apparatus 2000 includes a primary portion 2010 and a secondary portion 2020 , which interconnect via an interface 2030 . the alignment strip 200 is correspondingly disposed and dimensioned to overlie the interface 2030 and provide a desired positioning of the primary label portion 110 and severable label portion 120 relative to the interface . as such , once the alignment strip 200 is removed , an alignment spacing 300 is provided such that the label member 100 does not interfere with operation or separation of the electrical apparatus 2000 . fig6 is a plan view of one embodiment of a label member 100 affixed to an electrical apparatus 2000 and having alignment strip portions removed . as such , no portion of the label member 100 occupies the alignment spacing 300 , and the severable portion 2020 of the electrical apparatus 2000 may be severed and / or replaced without interference from the label member 100 of the present invention . additionally , the primary label portion 110 and severable label portion 120 maintain a predetermined distance relative to both the interface 2030 and the outer boundary of the electrical apparatus 2000 . such an orientation is facilitated by the single - member application of the label member 100 , as opposed to individually applying the primary label portion 110 and severable label portion 120 . as such , a precise and aesthetically pleasing arrangement of the label member 100 may be achieved via a substantially centered disposition of the single - member label member 100 on the electrical apparatus 2000 , as well as a provision of a predetermined alignment spacing 300 of a predetermined distance , created from removal of the alignment strip 200 . fig7 and 8 depict alternative embodiments of the present invention comprising different dimensional relationships relative to each other , as well as the embodiment depicted in fig1 . as such , the present invention may be easily adapted to fit a variety of electrical apparatus . for example , where the label 100 of fig1 comprises a substantially rounded square shape of approximately 2 . 5 inches on a side , the label 100 ′ of fig7 may comprise a dimension of 2 . 125 inches on a side , and the label 100 ″ of fig8 may comprise a dimension of 1 . 75 inches on a side . it will be appreciated that the dimensions of the alignment strip 200 , 200 ′, 200 ″, such as width and length , may be accordingly adjusted to maintain a proportional relationship to the label 100 , 100 ′, 100 ″ size and / or corresponding placement relative to an interface of the electrical apparatus . since many modifications , variations and changes in detail can be made to the described preferred embodiment of the invention , it is intended that all matters in the foregoing description and shown in the accompanying drawings be interpreted as illustrative and not in a limiting sense . thus , the scope of the invention should be determined by the appended claims and their legal equivalents . | 6 |
the process sequence within an installation 1 shown in the exemplary embodiment according to fig1 is part of an overall process in a power plant ( not shown in detail ). the installation 1 comprises a pump a 1 connected in a steam line 2 , with an upstream steam valve a 2 and a blow - off regulating valve a 3 connected in a branch line 4 . a throughflow sensor 6 is provided between the pump a 1 and the steam valve a 2 , being used to detect the quantity of steam flowing through the steam line 2 per unit of time . a pressure sensor 8 is also provided on the pressure side of the pump a 1 . the pump a 1 is provided with a speed sensor 10 . the steam valve a 2 and the blow - off regulating valve a 3 each have a control and message element 12 and 14 . the pump a 1 and the steam valve a 2 as well as the blow - off regulating valve a 3 are referred to below as installation components a 1 to a 3 . measurement values mw detected by the sensors 6 , 8 and 10 and message signals ms emitted by the message elements 12 and 14 are supplied to an automation system 20 . the measurement values mw and message signals ms are preprocessed into process signals ps in the automation units of the automation system 20 . in some instances control signals si are emitted to the installation components a 1 to a 3 of the installation 1 . the power plant with its installation components a 1 to a 3 is controlled and monitored automatically by the processes operating within the automation system 20 . the process signals ps generated in the automation units of the automation system 20 from measurement values mw and / or message signals ms detected online are then supplied to a central monitoring system 30 , for example a control system or a process control system . the monitoring system 30 can in particular be a suitable data processing unit . the monitoring system 30 here is used in particular in the manner of a central process system for process management and monitoring . in the event of a failure or some other abnormal status of the monitored process or one of the installation components a 1 to a 3 , the process signals ps generated for this failure from measurement values mw or message signals ms detected online are supplied to a control unit 34 of the monitoring system 30 . if a fault in an installation part ( not shown ) connected in the steam line 2 causes the pressure to rise in the steam line 2 , the speed of the pump a 1 drops and the blow - off regulating valve a 3 opens . the automation system 20 then closes the steam valve a 2 by means of a control signal si , so that the speed of the pump a 1 normalizes and the blow - off regulating valve a 3 closes again . when the steam valve a 2 is then reopened by the automation system 20 , the pressure within the steam line 2 rises again and the process is repeated until the fault is eliminated . measurement values mw describing this process , e . g . the quantity of steam detected by the throughflow sensor 6 and the steam pressure detected by the pressure sensor 8 and the pump speed detected by the speed sensor 10 , are supplied to the automation system 20 . the control signals si for the opening or closing of the valves a 2 and a 3 are output by the automation system 20 of the installation 1 in response to the measurement values mw received in the automation system 20 . process signals ps are produced from the measurement values mw and the control signals si for analysis purposes . to inform the operator and in some instances to allow manual intervention in the process sequences , in the event of such abnormal situations or failures the control unit 34 generates or supplies status messages , which can be displayed on an assigned display unit 36 in the form of message windows . in order to allow the information to be displayed in a manner that is particularly appropriate for the respective situation and requirements and therefore to allow the operator to intervene in a particularly focused manner , provision is made for appropriate prefiltering of the available information when generating the status message . to this end the information content or individual messages to be used to form the status message is / are selected as a function of the situation and as a function of the context . the status messages here are output in the form of so - called message windows 40 , 42 , 44 on the display unit 36 , as shown for example in the screen shots according to fig2 and 3 . context - related selection of the individual messages or information items to be taken into account here means the following in particular : messages from the functions shown in a process image : process images represent the process engineering view of the process and are used for process observation and process operation . pictograms for example are integrated in the process images . messages from an automation level ( overview , area or individual level ): the automation level represents the control - related view . messages from an individual automation function are shown in process images or in an automation level . the automation function comprises a pump , a valve or a regulator for example . during the preparation and preprocessing of the information it is possible for example to click on the pump a 1 in a pictogram of a process image , whereupon all the messages relating to the pump a 1 appear in an assigned message window on actuation of the right mouse button . a corresponding information assignment can likewise be provided for other constellations or contexts . clicking on a software module or a ( graphic ) object , which represents a defined function in the power plant , in the corresponding view on the display unit 36 causes relevant messages relating to this object or module to be displayed in response to such an operator request . the messages to be displayed in a message window are determined automatically using the information from a data model , which contains relationships between message sources and contexts . the search criterion here results from the context , from which the message window is opened . specifically for example the screenshot in fig3 contains a diagrammatic representation of interlinked installation components in a major technical installation with assigned process and status parameters within a basic window . this is a specific segment from a larger process image ( process engineering view ). the individual installation components are shown in the manner of pictograms in the form of graphic objects . in the event of failures or particular operating situations , which are detected and identified automatically by suitable measurement sensors and monitoring routines within the installation , the components or units affected or the associated status parameters are automatically highlighted in color , for example in the signal color red , in the screen display by the installation controller . an operator alerted in this manner can click on a free area of the basic window with a mouse input device or the like and use the right mouse button to call up the message window 42 , in which a number of status reports of relevance to the selected segment of the process image , i . e . the context thus defined , are displayed . in particular the message window 42 can contain a tabular list , in the manner of a brief summary , of status reports from all the installation components displayed on the image segment of the basic window . the individual messages bundled in this manner can each contain for example a serial number , identification code , type designation or group assignment , error description , date and time stamp , associated parameters and optionally further status information . the operator can also click on the individual graphic objects , which represent the installation components — in particular the graphic objects highlighted in color , which represent the faulty or “ conspicuous ” installation components having particular operating statuses — and call up or bring to the foreground , for example by actuating the right mouse button , a message window 44 specifically for the respective component containing ( preferably exclusively ) component - specific individual messages . since such context - specific message windows are preferably only shown further to a corresponding operator request , the operator is spared a multitude of automatically overlaid “ popup ” windows . the same function mechanism is shown in fig2 for a screenshot which represents a corresponding control - related , i . e . higher order or comprehensive and abstract , view of the technical installation to be monitored and its control sequences . corresponding message windows 40 can be called up as required here too , providing context - related content . | 6 |
the repeated processing of a chromatography column generally will typically cause the further compaction of the previously packed media . this compaction can be significant . for example , in one trial , using media , repeated separation of a milieu of e . coli proteins was performed . during the first separation process , the bed height was measured to be 56 cm . after the fortieth separation , the bed height had been compacted to a height of only 48 cm . this compaction led to a breach between the top surface of the media bed and the top bed support and decreased efficiency . there is also a second issue associated with the bed height . the support matrices of the resins used in the media can change in volume . each matrix possesses its own swelling behavior , with dextran - based and cellulosic resins being most suspectible to swelling when subjected to ph changes . ionic strength also has a significant impact on the swelling of cellulosic , agarosic and dextran - based chromatography media such as ion exchangers . generally , this swelling is most pronounced during the elution , regeneration , and most particularly the cleaning phases of a chromatographic separation cycle . therefore , the column must be capable of adapting to swelling - induced changes in the media bed to prevent over - pressurization of the column , or overstressing of the media . fig3 illustrates the preferred embodiment of the present invention . before use , chromatography column 110 is filled with media slurry in a manner known to those skilled in the art . the adjustable bed support 112 , which forms a tight seal along the walls of column 110 , is then moved down inside the column tube 110 . typically , the adjustable bed support has a cross - sectional configuration that matches that of the column . preferably , the bed support also has a gasket , or other sealing means along its perimeter to ensure the tightness of the seal . this allows the buffer within the column 110 to flow out the bottom flow port 113 . generally one bed support is fixed in place while the other is free to move . alternatively , both supports can move if desired . in the embodiment as shown the bottom bed support 114 is fixed in place to the column . during this packing process , a media bed 120 forms and is contacted by the adjustable bed support as it continues to apply force to the bed 120 . thus , when the bed 120 is fully compacted , it exerts a force on adjustable bed support 112 . adjustable bed support 112 is coupled to a shaft 130 , which is preferably threaded . shaft 130 passes through an opening 141 in yoke 140 , which opening is also preferably threaded . yoke 140 is held in position by stanchions 150 , which are mounted to a base 160 , on which the column 110 preferably rests . in the preferred embodiment , the stanchions 150 are held in contact with the base through the use of fasteners 161 , such as bolts , which extend through openings 164 in the base and engage with the stanchion via slots 151 bored into the stanchion , which are also threaded . the fastener has a shaft 162 , which is preferably threaded , of a given diameter , and a head 163 having a diameter larger than that of the shaft . the openings 164 in the base 160 are preferably larger than the diameter of the fastener &# 39 ; s shaft 162 , but smaller than the diameter of the fastener &# 39 ; s head 163 , to allow the fastener &# 39 ; s shaft to move freely through the opening 164 . the fastener 161 is inserted from the underside of the base 160 , through the opening 164 such that the fastener &# 39 ; s shaft 162 engages with the slot 151 in the stanchion 150 . yoke 140 is affixed to a plurality of stanchions 150 . two stanchions typically provide the needed structural stability for smaller diameter columns , while additional stanchions may be used for large diameter columns . these stanchions 150 are preferably placed equidistant from one another around the circumference of a circle that is concentric to , but larger than column 110 . the stanchions 150 have a height equal to , or preferably greater than , that of the column 110 . in one embodiment , yoke 140 is connected to the two or more stanchions and it spans the width and centerline of the column 110 . the yoke 140 is retained to the stanchions 150 by means such as slot 152 , a ring or other device that can affirmatively hold the yoke 140 in place . the yoke 40 may be permanently attached to the stanchions 150 or more preferably , it may be removably connected to the stanchions 150 by bolts , clevis pins , cotter pins , clamps and the like . in one preferred embodiment , the yoke 40 is attached to one stanchion 50 by a bolt , and the other stanchion by a clevis pin so that when adjustable bed support 112 is withdrawn from the column , the yoke 140 can be pivoted vertically about stanchion 150 containing the bolt and moved up and out of the way of the column to allow easy access to the column interior . fig4 shows that embodiment in the pivoted position . in another embodiment , the yoke 140 can also rotate in a horizontal circular motion away from the mouth of the column 110 . atop the yoke 140 is an actuator 170 adapted to move the shaft in the vertical direction , independent of the yoke 140 . this actuator can be pneumatically , electrically or hydraulically controlled . in the preferred embodiment , a motor , preferably electrically powered , is equipped with a gear that contacts the threaded shaft 130 . the movement of the motor causes the rotation of the gear , which in turn causes rotation of the threaded shaft 130 . the resulting rotation of the threaded shaft 130 , through the threaded opening 141 in yoke 140 causes the shaft 130 to move relative to the yoke 140 in the vertical direction . the adjustable bed support 112 , shaft 130 , and actuator 170 comprise the adjuster assembly . these components operate in unison to adjust the position of the adjustable bed support 112 inside the column 110 , thereby also controlling the pressure exerted on the media bed . the yoke 140 and the stanchions 150 comprise a support structure 155 . this structure is rigidly coupled and is affixed to the shaft 130 and the base 160 , such that any force exerted on adjustable bed support 112 is transferred through shaft 130 , through support structure 155 , to the connection point between the support structure 155 and the base 160 . while this embodiment comprises a preferred embodiment in which a single shaft with 2 stanchions is used , the invention is not so limited . those skilled in the art will appreciate that it is within the scope of the present invention to use multiple shafts and a greater number of stanchions . for example , a very large diameter column may require a greater number of shafts and stanchions in order to insure that the adjustable bed support descends uniformly and evenly onto the media bed . alternatively , other structures can be utilized . chromatography columns are formed of three basic components ; a column tube , a bottom fixed end and a top , movable end . see u . s . pat . no . 4 , 350 , 595 and u . s . pat . no . 6 , 139 , 732 . the top end moves relative to the tube so as to be capable of removal for introduction and removal of chromatography media in the tube and to be capable of longitudinal travel into the tube to compress the media for use . this top end however needs to be fixed at some point to the column in order to move relative to the column . a first means for accomplishing this is to form a tube of high strength materials , including metals such as stainless steel or rigid structural plastics , such as acrylics or polymethylpentenes such as tpx ® plastic available from mitsui petrochemical industries ltd corporation of japan . the tube has a flange at the upper end to which a top plate is attached to the column and a flange at the lower end to which a fixed bottom end is attached . the top , movable end is then attached to this top plate and travels relative to it in and out of the tube . in one embodiment , shown in fig1 , the tube 2 has a bottom plate 4 fixed in place by bolts 6 attached to a flange 8 of the tube 2 . a top plate 10 is fixed to a top flange 12 of the tube 2 by setscrews 13 . a movable end 14 is centrally located in the top plate 10 and is capable , by movement of rod 16 , of moving into or out of the tube 2 . as the end 14 moves into the tube 2 to compress the media bed 18 for use , longitudinal forces are carried from the end 14 to the rod 16 to the top plate 10 and then to the tube 2 itself . another alternative is shown in fig2 . it uses a series of rods 20 or screws closely aligned around the outside of the tube 24 to carry the longitudinal forces rather than the wall of the tube itself . this allows one to use less structurally rigid materials , such as glass or plastics , preferably acrylic or styrene , and to also use thinner walled tubes . all of this reduces the weight and cost of the device . most of the elements of that tube 24 of fig2 are similar to those of fig1 . one has a movable top end plate 22 , a bottom plate 26 , attached to a fixed bottom end 27 , flanges 28 , either as part of the tube 24 or in this example as separate pieces to secure the fixed top plate 30 and bottom plate 26 to the tube 22 . a rod 32 extends through the plate 30 and is connected to the movable end 22 by a handle 34 . a bed of chromatography media 36 is compressed by the movement of the end 22 . also shown in fig2 are a series of guide rods 38 , which are used , in larger columns to keep the end 22 horizontal during movement . plate 30 is normally affixed on flange 33 and attached by numerous mechanical fasteners 31 . in the preferred embodiment , a load cell 180 is located between the head 163 of the fastening device and the underside of base 160 . however , the load cell 180 can be positioned in any location where it can measure the force exerted on the media bed . for example , the load cell can be positioned between bolt 6 and bottom plate 4 in fig1 . similarly , the load cell can be located between mechanical fastener 31 and plate 30 or between mechanical fastener 31 and bottom plate 26 in fig2 . a load cell is a device that translates the load exerted on it into an analog electrical output , such as voltage or current . the relationship between the exerted load and the electrical output is well established and tightly controlled , such that the exact load experienced by the load cell can be determined by monitoring its electrical output . the term load cell is used herein to include any device that carries out this function . returning to fig3 , the load cell 180 is preferably circular , with a concentric opening in the middle , such that the diameter of the opening is large enough to allow shaft 162 to be slid through the opening . however , the diameter of the opening is preferably smaller than the diameter of the head 163 of the fastener , such that the head cannot pass through the opening , thereby causing the load cell to interconnect with the fastener in a similar manner as a traditional washer . thus , the fastener is inserted through the concentric opening in the load cell 180 , through the opening in the base 160 , and into the slot of stanchion 150 . preferably , one load cell is used , regardless of the number of stanchions , however multiple load cells , or one load cell for each stanchion , are also envisioned as an embodiment of the present invention . one skilled in the art will appreciate that although the preferred embodiment comprises an adjustable top bed support , and a fixed lower bed support , the invention is not so limited . the apparatus can also be constructed such that the top support is fixed , and the lower bed support is adjustable . in the preferred embodiment , the fluid to be processed by the column 110 travels in a conduit through a hollow cavity within shaft 130 to adjustable bed support 112 . alternatively , the fluid may also travel in a conduit parallel to the shaft and then enter the adjustable bed support under a hollow arch formed at the base of the shaft . adjustable bed support 112 also comprises a flow cell , which equally distributes the fluid such that it enters the media bed uniformly . the processed fluid then exits the column through bottom flow port 113 . those skilled in the art will appreciate that the direction of the fluid &# 39 ; s travel is not limited to top to bottom ; the fluid can also be forced into the bottom of the column and drawn out of the top surface . similarly , it is not required that the fluid entry and the movable support be located in the same end of the column . the pressure of the fluid entering the column is monitored . there are a number of methods known in the art for performing this monitoring . for example , a bubble trap can be inserted between the source of the fluid and the entrance to the shaft 130 . a pressure sensor associated with the bubble trap can be used to supply the measured fluid pressure . in the preferred embodiment , a pressure sensor 190 , preferably a transducer , is in communication with the fluid flow through the use of a t connection in close proximity to the shaft 130 . a pressure transducer is used to convert a pressure measurement into either an analog or digital electrical signal , such as voltage or current . in this scenario , the transducer 190 measures the pressure of the fluid being forced through the conduit and into the column 110 . having defined the components of the present invention , the operation now will be described . first , the media in the column is compressed to form a media bed . this process can be accomplished in a variety of ways well known to those skilled in the art , and the present invention is not limited to a specific packing methodology . once the column has been packed , the adjustable bed support 112 will be in direct contact with the top of the bed 120 , holding it under some amount of sufficient force to insure that it remains compacted . the media bed 120 exerts a counterforce onto the adjustable bed support 112 . since the adjustable bed support 112 is rigidly affixed to the shaft 130 , which is rigidly affixed to the yoke 140 , which is in turn rigidly affixed to the stanchions 150 , this exerted force is transferred directly to the fastener 161 which is securing the stanchion 150 to the base 160 . thus , the force exerted by the media bed 120 is measurable by load cell 180 , located between fastener 161 and the underside of the base 160 . in the preferred embodiment , a single load cell is utilized , thus this load cell will experience only a fraction of the total force exerted by the media bed . that fraction is defined as 1 /(# of stanchions ) . thus , if two stanchions are utilized , the load cell will experience ½ of the total force exerted by the media bed 120 . alternatively , load cells can be placed in association with each stanchion . in this case , the total force would be defined as the sum of the forces experienced by each load cell . similarly , if load cells are arranged on only a portion of the stanchions , the total load can be expressed as : the outputs from the pressure sensor 190 and the load cell 180 are in communication with controller 100 . controller 100 also generates outputs to the actuator 170 directing it to alter the position of the adjustable bed support . by using the output from the load cell 180 in conjunction with controller 100 , it is then possible to create a control system , whereby the load experienced by the load cell is used by the controller 100 to adjust the position of the shaft 130 , using actuator 170 . one skilled in the art will appreciate that the controller can be of various types , including , but not limited to proportional , proportional - derivative ( pd ), proportional integral ( pi ) or proportional - integral - derivative ( pid ), and that the invention is not limited by the choice of the controller . similarly , the output from the controller 100 to the actuator 170 can be in various forms , including but not limited to analog voltage , current , digital signals , or pulses . the optimal force to be applied to the media bed 120 can be determined using a number of different methods , such as but not limited to empirical measurements as the column is packed , or fixed values based on the amount and type of media being used . once the optimal force required to create the proper compression on the media bed 120 is determined , the control system comprising the load cell 180 , actuator 170 and controller 100 operate to maintain this force . the method of determining this optimal force is independent of the present invention , and therefore any method of determining this value is suitable . having established the proper compression for the media bed 120 , the column is then ready to accept fluid . the fluid that enters the column will also be under pressure , and this pressure will also be exerted on the adjustable bed support . therefore , the total force exerted on the adjustable bed support can be given by : f total = p fluid * area adjustable bed support + f media compression . since the total force can be measured via the load cell , and the fluid pressure can be measured via the pressure sensor 190 , it is possible to determine the amount of force being applied to the media bed . f media compression = f total − p fluid * area adjustable bed support . this computed f media compression is then compared to the optimal compression force . by adjusting the position of shaft 130 based on the measurement from the load cell 180 and the pressure sensor 170 , it is possible to maintain a constant optimal pressure on the media bed 120 . for example , as the media bed compresses , it will exert less force on the adjustable bed support 112 . this reduction will be measured by the load cell as a decrease in total force ( assuming a constant fluid pressure ). the controller will detect this reduced force , and will determine that the force being exerted on the media bed has decreased . to compensate for this , the controller will actuate the actuator 170 to adjust the shaft 130 to further compress the column , until the media compression force returns to the optimal value . conversely , if the media bed expands , the controller detects an increase in total force and will actuate the actuator 170 to retract the shaft 130 in a direction out of the column , until the media compression force returns to the optimal value . the control system of the present invention can be utilized in a number of different ways . in a first embodiment , the control system is used only between separation cycles to correct for any changes in the height of the media bed 120 that occurred during the previous cycle . in this embodiment , the position of the adjustable bed support within the cylinder is held constant throughout the separation cycle , and then its height is adjusted after the completion of the cycle . in a second embodiment , the control system is continuously operational , thereby constantly adjusting the pressure exerted on the media bed by changing the position of the adjustable bed support within the cylinder . due to the precision required , this embodiment preferably utilizes a pid controller . one skilled in the art will recognize that a continuous control system can be approximated through the use of a sampled system , whereby the load cell and pressure transducers are sampled at periodic intervals and adjustments to the vertical position of the adjustable bed support are made in response to these sampled measurements . | 6 |
in the following description , various embodiments of the present invention will be described . for purposes of explanation , specific configurations and details are set forth in order to provide a thorough understanding of the embodiments . however , it will also be apparent to one skilled in the art that the present invention may be practiced without the specific details . furthermore , well - known features may be omitted or simplified in order not to obscure the embodiment being described . as shown in fig1 a , the braking system of in accordance with embodiments is shown operating in an improved portable multi - stage lift 28 to be now described having a mobile base assembly 30 . the lift 28 has a front carriage section 31 which can carry a load support 32 . at the rear ( fig1 b ) the lift 28 has a winch 34 which may be manually operated or can be a motor driven unit . the winch 34 is mounted on the rear of a back stationary mast stage 35 . for purposes of example , two extensible mast stages 36 , 37 have been illustrated between the back stage 35 and the carriage 31 , but one or more than two could be provided . the mast stages 35 , 36 , 37 and carriage 31 are preferably identical in cross - section and comprise a length of extruded aluminum bar stock whose cross - section is shown in fig2 . it will be seen that each mast stage has a central hollow column 38 of generally rectangular cross - section having front and back walls 40 , 41 and a pair of right and left side walls 42 , 43 extending there between . at the rear of the column 38 the side walls 42 , 43 continue rearwardly at 42 a , 43 a and join back laterally extending flanges 44 , 45 . at the front of the column the side walls 42 , 43 continue forwardly at 42 b , 43 b and join right and left inturned front channels 46 , 47 comprising outwardly extending central flanges 46 a , 47 a , outside sections 46 b , 47 b , and inturned front flanges 46 c , 47 c . it will be noted that the central flanges 46 a , 47 a together with the walls 42 , 43 and back flanges 44 , 45 define right and left outwardly facing back channels 52 , 53 . directing attention to fig6 , the described mast stage configuration enables the front inturned channels 46 , 47 of one mast stage to interfit with the back out - turned channels 52 , 53 of a second mast stage with the back flanges 44 , 45 of the front stage facing the front of the central flanges 46 a , 47 a of the back stage , and the front flanges 46 c , 47 c of the back stage facing the rear of the central flanges 46 a , 47 a of the front stage . when mast stages 35 , 37 are interfitted as described , a plurality of side - to - side glide blocks 350 located at the top and bottom of each column track on the right and left side of each adjacent mast stage preventing excess slop and maintaining vertical alignment of each mast stage . front to back alignment of the mast stages is provided by bottom front - to - back pairs of rollers 202 ( e . g ., fig5 ) on mast stages 35 , 36 and 37 , and top front - to - back pairs of rollers 203 on stages 35 - 36 . cutouts are provided at the bottom of the back flanges 44 , 45 of the mast stages , and a central bottom cutout 65 ( fig4 ) is provided in the back wall 41 of the mast stages . these cutouts 65 provide operating space for the rear portion of the bottom rollers 202 and access to washers and nuts 66 on the bolt shafts for these rollers passing through the right and left walls 42 , 43 . space for the front portion of the top rollers 203 is provided by top cutouts 300 ( fig1 ) in the front flanges 46 c , 47 c . the shaft bolts 69 for the top rollers 203 pass outwardly through the outside sections 46 b , 47 b to receive washers and nuts 70 . with the described arrangement of front - to - back rollers , the bottom rollers 202 track on the rear face of the front inturned flanges 46 c , 47 c or the front face of the intermediate flanges 46 a , 47 a of the rear mast stage of interfitting mast stages . similarly , the top front - to - back rollers 203 track on the front face of the rear out - turned flanges 44 , 45 or the back face of the intermediate flanges 46 a , 47 a of the front stage of interfitting mast stages . the carriage 31 has front - to - back rollers 202 adjacent its four corners . many features of the mast system in the current embodiment are known in the prior art . for example , the reeving systems described in the background section of this disclosure are known , and a similar system is used in the current lift . however , to aid the reader , fig3 shows a prior art mast system , many similar parts of which are used in the present lift . referring to fig3 , each of the extensible mast stages 36 - 37 has a top pulley 71 and a bottom pulley 72 adjacent its ends for receiving a cable 73 , from the winch 34 . each top pulley 71 extends through a cutout 74 in the front wall 40 of the respective mast stage , and each bottom pulley 72 extends through a cutout 75 in the back wall 41 of the respective mast stage . the rear stationary mast stage 35 has a single upper pulley 76 journal - mounted on an angle bracket 77 mounted on its front wall and extending through registering cutouts 78 in the front and back walls thereof . the carriage 31 has a pulley 80 extending through a cutout in its back wall . the two upper pulleys 71 are tilted such as to extend rearward into the right portion of a center passage of the respective mast stage . the two lower pulleys 72 and the carriage pulley 80 , on the other hand , angle rearward from the right portion of the central passage 85 to the left passage 55 which is next to the rear . this positions the pulleys such that the cable 73 extends from the upper end of the front mast stage 37 , and is reeved on the pulleys by traveling under the carriage pulley 80 , then over the top pulley 71 and under the bottom pulley 72 of the extensible mast stages 37 , 36 progressing from front to back , then travelling over the top pulley 76 on the back stationary mast stage 35 and down to the winch 34 . in embodiments , the pulleys 71 , 72 , 76 and 80 are provided with guards 90 ( fig1 and 14 ). one of these guards 90 is discussed more below . from the foregoing description it is seen that the carriage 31 and the extensible mast sections 36 - 37 are roller guided front - to - back and glide block guided for side - to - side motion for smooth up and down travel . when cable is taken up on the winch 34 , first the carriage 31 travels up the mast stage 37 . then the front extensible stage 37 is raised following which the next stage 36 is raised . it will be apparent that additional extensible mast sections can be added which duplicate stage 36 . the braking system in accordance with embodiments is adapted to stop downward travel of the carriage 31 and extensible mast stages 36 , 37 in case of a lift failure such , for example , as a failure of the cable 73 . as further described below , the braking system includes a spring loaded lower cable pulley mount 84 ( fig1 and 14 ) that moves mechanical linkages 450 and 200 and knurled toothed cams 201 from engaged ( fig9 ) to disengaged ( fig8 ) braking positions depending on cable tension at the lower pulleys . in embodiments , the cams may be formed of any material that is capable of high friction ( to stop movement of the adjacent mast sections ) and that is hard enough to “ bite ” into the mast column ( e . g ., not just wear away or bend as a result of engagement ). as an example , if the mast sections are formed of aluminum , then the cams may be formed of an aluminum alloy that is harder than the aluminum mast sections , but a brass , plated steel or stainless steel cam could also work . the fasteners 400 ( only one shown in fig1 ) that mount the spring loaded lower pulley - mount 84 are connected through bushings 350 ( fig1 ) that are seated in slotted holes 402 ( top one best shown in fig1 , and bottom one covered by flat washer 460 in fig1 ) on the lift stage . the fasteners 400 are directly connected to the pulley mount 84 , and the fasteners and the lower pulley mount 84 are fixed together to the linkage 450 . the bushings 350 are formed of a material , such as bronze , that may easily slide in the slotted holes 402 without excessive wear . these bushings are taller than the adjacent metal on the mast stage section so that the fasteners 400 may be tightened with the washers 460 seating against the bushings , but not against the mast stage surface . thus , even after tightened in place , the bushings 350 , the flat washer 460 , pulley mount 84 are still free to move up and down in the slotted holes 402 , which permits vertical movement of the lower pulley - mount 84 and the pulley . another fastener 72 a ( fig1 ) connects the pulley 72 to the pulley mount 84 , while sandwiching the pulley guard 90 in place . the pulley - mounts 84 are spring biased so they biased downward ( fig1 and 12 ). when no cable tension is present at the lower cable pulley the pulley mounts 84 move downward , until positioned in a lowermost position . otherwise , the pulley mounts 84 are pulled by the cable , against the tension of the spring bias , to an upper position . thus , the lower pulleys 72 and pulley mounts 84 are positioned downward when the cable is not in tension , and upward when cable tension is present . each pulley mount 84 is connected to an upper mechanical linkage 450 ( fig1 and 13 ). this linkage 450 is connected by small connecting rods to a lower linkage 200 . the knurled cams 201 are fixed at ends of the lower linkage 200 . the lower linkage 200 is fixed in position , and is loosely mounted for free rotation in the respective mast section . the small connecting rods are connected eccentrically to the lower linkage . thus , when the upper linkage 450 moves upward and downward with the pulley mount 84 , the small connecting rods push and pull on the eccentric mounting of the lower linkage 200 , rotating the lower linkage and the knurled cams 201 . when the upper linkage advances downward , due to tension not being present , the upper linkage and lower linkage rotate the knurled cams 201 to the braking position ( fig9 ). in this position , the cams 201 , which are mounted adjacent the rollers 202 in the right and left outwardly facing back channels 52 , 53 , are positioned to engage the front inturned flanges 46 c , 47 c of the adjacent channels , preventing sliding of adjacent mast sections . thus , once cable tension is removed , i . e . the cable 73 breaks , the spring loaded pulley - mounts 84 move the upper mechanical linkage 450 and lower linkage 200 , rotating the knurled cams 201 into a wedging position between adjacent mast stages , stopping or severely braking downward movement of all mast stages . when cable tension is present , the pulleys move to the upward deactivated position , rotating the knurled cam 201 to the non - braking position . in this position , the cam is no longer in contact with the adjacent mast section , and the two sections are free to slide relative to each other . other variations are within the spirit of the present invention . thus , while the invention is susceptible to various modifications and alternative constructions , certain illustrated embodiments thereof are shown in the drawings and have been described above in detail . it should be understood , however , that there is no intention to limit the invention to the specific form or forms disclosed , but on the contrary , the intention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention , as defined in the appended claims . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . the term “ connected ” is to be construed as partly or wholly contained within , attached to , or joined together , even if there is something intervening . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate embodiments of the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . | 1 |
the present invention is part of a document processing system , such as an inserting machine , comprising a plurality of stations situated successively along a paper path for processing documents conveyed along the path . with reference to fig1 - 7 , a document registration apparatus , generally shown as 10 , is used in conjunction with a document transport system , generally designated 11 . as shown in fig3 registration apparatus 10 cooperates with transport system 11 in transporting a document 12 along a path 13 in an upstream to downstream direction , designated as arrow d . there is a document registration position 16 where document 12 is stopped in its path by registration unit 10 and is held or &# 34 ; queued &# 34 ; until the next successive station in the processing system is ready to process document 12 . the apparatus 10 simultaneously stops and aligns the document 12 conveyed by transport system 11 . document registration apparatus 10 aligns document 12 relative to path 13 , or , if desired , some other document raceway in the system . although fig3 shows a single document 12 , it is to be understood that the present invention is applicable to situations where document 12 is a stack of documents . document registration apparatus 10 is suitable for use in a queuing station or in an inserting station of an inserting machine wherein document 12 must be stopped and aligned before further processing . apparatus 10 is suitably mounted to the frame ( not shown ) of the inserting machine . for example , apparatus 10 can be pivotally mounted at the upstream end to provide easy access for document jams . a more detailed description of such an arrangement is provided in u . s . application ser . no . 808 , 863 , noted previously herein . referring now to fig2 and 4 , apparatus 10 comprises a document registration unit 20 pivotally mounted to a top plate 18 . document registration unit 20 preferably comprises a one piece document registration unit holder 45 to which a one piece frame member 20b is attached . frame member 20b includes four registration stops 21 , 22 , 23 and 24 on the downstream end thereof and two urge rollers 25 and 26 on urge roller arms 25a - b and 26a - b , respectively , on the upstream end of unit 20 . urge rollers 25 and 26 are spaced at lateral positions between the lateral positions o registration stops 21 and 22 on the one hand , and the lateral positions of registration stops 23 and 24 on the other hand , respectively . frame member 20b pivots vertically around pivot axis 31 . a rotary solenoid 27 is linked to a pivoting arm 14 by a pin 28 which rides in a slot 15 of pivoting arm 14 . pin 28 moves along a circular path on each actuation of solenoid 27 and reciprocates in slot 15 , thereby rocking pivot arm 14 . as pivot arm 14 rocks , frame member 20b of document registration unit 20 pivots vertically around pivot axis 31 . the combination of registration stops 21 - 24 and urge rollers 25 and 26 are used to stop and align document 12 at document registration position 16 , and then to release it for further processing . the stopped document 12 is aligned at this position so that it can subsequently be processed with minimal skew relative to path 13 or , if desired , some other document raceway as discussed above . for example , if document 12 is an envelope to which enclosures will be inserted , then registration stops 21 - 24 ensure that the envelope will be aligned relative to the enclosures . this insertion process can take place at document registration position 16 ( where the envelope will be held open by an envelope opening claw ) or , if desired , at a subsequent location along path 13 . similarly , if document 12 is an enclosure which will be subsequently inserted into an envelope , then registration stops 21 - 24 ensure that the enclosure will be aligned relative to the envelope . finally , if document 12 is a sheet or stack of sheets which will subsequently be folded , then registration stops 21 - 24 ensure that the document is aligned so that the folder can make a square fold of the document . the registration units shown in fig1 and 2 are comprised of different lengths with each being suitable for a particular use . for example , the longer apparatus in fig2 may be more suitable for use with a sheet feeder that can feed sheets of different lengths . the shorter apparatus in fig1 may be more suitable at an insertion station or at an enclosure feeder where the length of the document being fed is less than full size sheets . in order to stop document 12 at document registration position 16 , registration stops 21 - 24 are urged clockwise to position a ( fig3 ) by actuating solenoid 27 . in position a , registration stops 21 - 24 extend into document path 13 and preferably project below the plane of transport system 11 , so as to block document 12 from being transported further downstream by transport system 11 . in the preferred embodiment , transport system 11 includes two transport belts 11a and 11b ( fig1 and 7 ) which move in synchronization . preferably , transport belts 11a and 11b are each approximately 0 . 5 inch wide . laterally spaced on each side of each transport belt 11a and 11b are registration stops 21 , 22 and 23 , 24 , respectively . the projection of stops 21 - 24 below the plane of transport system 11 assures that document 12 cannot slip through . registration stops 21 - 24 are laterally - spaced along document registration unit 20 so that when document 12 is stopped at document registration position 16 , the downstream edge 49 ( see fig3 and 7 ) of document 12 is aligned with respect to document path 13 or , if desired , another path with which it is desired to align document 12 , for example , one orthogonal to path 13 . the continued travel of transport system 11 while document 12 is stopped assures that document 12 registers completely against stops 21 - 24 . when it is time to release document 12 , solenoid 27 is actuated to pivot registration stops 21 - 24 to position b ( fig3 ) wherein urge rollers 25 and 26 urge document 12 against transport belts 11a and 11b , thus increasing the frictional force between document 12 and transport system il . the increased frictional force is enough to stop the slippage between document 12 and transport system 11 and moves document 12 downstream for further processing . as document 12 moves in the downstream direction , it encounters exit pinch rollers 32 and 33 which are mounted on independent sets of support arms 34a , 34b and 35a , 35b , corresponding to exit pinch rollers 32 and 33 , respectively , and which also pivot about pivoting axis 31 . arms 34a , 34b and 35a , 35b and thus rollers 32 and 33 , are respectively spring biased by separate torsion springs ( not shown ) to urge rollers 32 and 33 against transport belts 11a and 11b . rollers 32 and 33 move away from belts 11a and 11b when document 12 is released , but move back into engagement with transport system 11 as soon as document 12 is conveyed beyond rollers 32 and 33 . the released document is thus urged against transport system 11 and driven while the next document is held . the mounting of pinch rollers 32 and 33 on separate support arms 34a , 34b and 35a , 35b results in minimal &# 34 ; shingling &# 34 ; of documents when a stack of documents exit the document registration apparatus . this is because rollers 32 and 33 and sets of arms 34a , 34b and 35a , 35b can move away from transport system 11 as required by the thickness of document 12 to allow document 12 to pass , without lifting the remainder of unit 20 . as shown in fig3 and 4 , document registration unit 20 is preferably formed from one - piece document registration unit holder 45 , to which a one piece frame 20b is pivotally attached . frame 20b comprises stops 21 - 24 and arms 25a - b and 26a - b . because document registration frame 20b is formed from a one - piece member , it is less subject to mechanical failure than registration devices formed from multiple interconnected parts . furthermore , because registration stops 21 - 24 are rigidly and pivotally linked to urge rollers 25 and 26 , it is not necessary to align registration stops 21 - 24 relative to urge rollers 25 and 26 in order for the overall document registration apparatus to be properly aligned . registration stops 21 - 24 are inherently aligned with urge rollers 25 and 26 because urge rollers arms 25a , 25b , 26a and 26b are part of the same one - piece member as registration stops 21 - 24 . top plate 18 , which is suitably mounted to the frame of the inserting machine ( not shown ), supports document registration unit 20 which is mounted to the underside of plate 18 ( fig1 and 4 ). top plate 18 includes a longitudinal slot 56 which guides a slide member 60 as it moves back and forth on top of plate 18 . slide member 60 comprises a rectangular tang 62 molded to its upstream end and a pin clamping section at its downstream end ( fig6 ). tang 62 fits through a close fitting rectangular aperture 64 at slot 56 in top plate 18 . by inserting tang 62 into aperture 64 and then sliding slide member 60 to the rear of plate 18 , tang 62 is trapped under top plate 18 , whereby slide member can be positioned on plate 18 along slot 56 . a u - shaped bracket 70 is suitably mounted to the top side of document registration unit 20 . in the preferred embodiment of the present invention each leg 72 and 74 of bracket 70 includes a flange member 76 and 78 which is secured to registration unit 20 by screws . solenoid 27 is fixedly mounted to one leg 76 of bracket 70 . the top portion of bracket 70 includes a pin 80 in the middle of the downstream side of bracket 70 , and a tab 82 in the middle of the upstream side . shaft 90 has a groove 100 at one end and a knurled surface at the other end . there is a threaded section 102 adjacent groove 100 . slide 60 includes a mating thread molded into it to accept threaded section 102 of shaft 90 . bracket 70 is assembled to top plate 18 in the following manner . bracket 70 is lifted up against the underside of plate 18 with pin 80 and tab 82 protruding through slot 56 . slide 60 includes a slotted clamp member 84 with a cutout portion 86 for retaining pin 80 and an aperture 94 through which tab 82 extends when bracket 70 is assembled to top plate 18 . slide 60 is positioned over slot 56 with clamp member 84 adjacent pin 80 . slide 60 is then slid forward causing pin 80 to be locked in place at cutout 86 of slotted clamp member 84 and tab 82 to be locked in place on groove 100 . thus registration unit 20 is slidably mounted to top plate 18 . the pivotal adjustment about pin 80 is implemented by shaft 90 . as best shown in fig7 when shaft 90 is rotated clockwise , it is threaded into slide 60 causing groove 100 to move towards the rear of the machine . tab 82 moves with groove 100 causing the pivotal rotation of the registration unit 20 around pin 80 in a clockwise direction . this causes the stops 21 , 22 , 23 and 24 and rollers 32 and 33 to rotate accordingly . it will be understood that rotating shaft 90 counter - clockwise has the opposite effect . slide 60 includes a pointer member 96 which indicates how much skew is introduced and the direction of the skew at registration apparatus 10 . slide 60 further includes a molded pointer 98 which indicate .. s the length of insert the registration apparatus 10 has be adjusted to handle . further details regarding the basic document registration apparatus 10 may be obtained from the above noted u . s . patent application ser . no . 808 , 863 . thus it is seen that the present invention provides skew adjustment means to a document registration apparatus that has a design that does not result in frequent mechanical failure , that has minimum number of mechanical parts , that is not difficult to align , that can simultaneously align a stack of documents without shingling , and which allows easy access to jammed documents . one skilled in the art will appreciate that the present invention can be practiced by other than the described embodiments , which are presented for purposes of illustration and not of limitation , and the present invention is limited only by the claims which follow . | 1 |
exemplary embodiments of the present invention will be described below with reference to the drawings . fig1 is a functional block diagram showing the configuration of a keyword extractor 10 according to an embodiment of an information processing apparatus according to the invention . the keyword extractor 10 is implemented by an information instrument such as a tablet - type pda or pc which will be described later , a projector system which can detect a position designated on a screen by a user , etc . the keyword extractor 10 according to the embodiment is constituted by a tablet - type pda . the keyword extractor 10 is provided with an overall controller 11 , a touch region controller 20 , a pen region controller 21 , an enlarged region controller 22 , and a character recognition controller 23 , which consist of a computer ( cpu ). these respective controllers 11 , 20 , 21 , 22 and 23 control operations of respective units in accordance with an apparatus control program pr stored in a not - shown memory such as a hard disk or an rom . the apparatus control program pr is started up in accordance with an input signal from an input device 13 of a transparent touch panel , which is , for example , provided on top of a screen of a backlighted color liquid crystal display device 12 . the input device 13 is a double - layered touch panel in which an electromagnetic induction type touch panel as a first touch panel and an electrostatic capacitance type touch panel as a second touch panel are provided on a display screen of the display device 12 . the electromagnetic induction type touch panel detects an operation performed by a special pen generating a magnetic field on the display screen of the display device 12 based on an electromagnetic induction system . the electrostatic capacitance type touch panel detects an operation performed by a finger on the display screen of the display device 12 based on an electrostatic capacitance system . a keyword extraction process program pr 1 for extracting a keyword from a region designated in accordance with a touch operation performed by a finger , a touch operation performed by a pen or an enlargement touch operation on a presentation screen ( image ) displayed on the display device 12 , a keyword recording program pr 2 for editing and recording the extracted keyword on a predetermined keyword recording form fk , a presentation material creation process program pr 3 for creating new presentation materials based on the recorded keyword , etc . are stored as the apparatus control program pr in addition to the system program for controlling the whole of the apparatus . the keyword extractor 10 is provided with a presentation material storage unit 14 , an operation information storage unit 15 , a touch operation region data storage unit 16 , a pen operation region data storage unit 17 , an enlarged operation region data storage unit 18 and a keyword data storage unit 19 , whose storage regions are allocated in a not - shown memory such as a hard disk or an ram . a presentation material screen ( presentation screen ) 14 g which is created in advance or which is created in accordance with the presentation material creation process program pr 3 is stored in the presentation material storage unit 14 . fig2 is a view showing an example of the presentation screen 14 g stored in the presentation material storage unit 14 of the keyword extractor 10 . information about a position or a region on the presentation screen 14 g in accordance with a touch operation performed by a user in the input device ( touch panel ) 13 is stored in the operation information storage unit 15 in accordance with the control of the overall controller 11 . fig3 is a view showing user operation information stored in the operation information storage unit 15 of the keyword extractor 10 . a touch operation information address 15 t , an enlargement operation information address 15 z and a pen operation information address 15 p are allocated in the operation information storage unit 15 . coordinates ( x , y ) 15 t 1 , 15 t 2 or the like of touch positions 1 , 2 or the like designated by touch operation on the presentation screen 14 g with a finger by the user are stored in the touch operation information address 15 t . in addition , coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of enlarged regions 1 , 2 or the like enlarged by multitouch - operation on the same presentation screen 14 g with fingers by the user are stored in the enlargement operation information address 15 z . in addition , coordinates ( x , y ) 15 p 1 , 15 p 2 or the like of pen touch positions 1 , 2 or the like designated by touch operation on the same presentation screen 14 g with a pen by the user are stored in the pen operation information address 15 p . in the input device ( touch panel ) 13 , a touch operation performed by a finger is detected by the electrostatic capacitance type touch panel and a touch operation performed by a pen is detected by the electromagnetic induction type touch panel . incidentally , when the input device ( touch panel ) 13 consists of one layer of the electrostatic capacitance type touch panel , detection of a touch operation performed by a finger or detection of a touch operation performed by a pen may be determined based on whether the center ( x , y ) of the touch position is detected with a spread not smaller than a threshold or not ( or detected as a pin point or not ). fig4 is a view showing touch operation region data stored in the touch operation region data storage unit 16 of the keyword extractor 10 . coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like indicating regions 1 , 2 or the like of rectangular sizes set in advance correspondingly to the coordinates ( x , y ) 15 t 1 , 15 t 2 or the like of the positions 1 , 2 or the like designated by the touch operation with the finger by the user in accordance with the control of the overall controller 11 and the touch region controller 20 are stored in the touch operation region data storage unit 16 . coordinates ( x , y , sx , sy ) indicating regions 1 , 2 or the like of rectangular sizes set in advance correspondingly to the coordinates ( x , y ) 15 p 1 , 15 p 2 , . . . of the positions 1 , 2 or the like designated by the touch operation with the pen by the user in accordance with the control of the overall controller 11 and the pen region controller 21 are stored in the pen operation region data storage unit 17 in the same manner as the touch operation region data ( 16 ). the coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of the enlarged regions 1 , 2 or the like enlarged by the multi - touch operation of the user in accordance with the control of the overall controller 11 and the enlarged region controller 22 are transferred to and stored in the enlargement operation region data storage unit 18 as they are with the same contents as those stored in the enlargement operation information address 15 z ( see fig3 ). characters in an image extracted from the presentation screen 14 g in accordance with the coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like of the touch operation regions 1 , 2 or the like stored in the touch operation region data storage unit 16 , or the coordinates ( x , y , sx , sy ) of the pen touch operation regions 1 , 2 or the like stored in the pen operation region data storage unit 17 , or the coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of the enlarged regions 1 , 2 or the like stored in the enlargement operation region data storage unit 18 are recognized in accordance with the control of the character recognition controller 23 . a character string consisting of the recognized characters is stored as a keyword in the keyword data storage unit 19 . on this occasion , assume that a user using his / her finger or fingers to perform a touch operation or an enlargement operation on the presentation screen 14 g displayed on the display device 12 is regarded as a presenting side user ( for example , a “ salesclerk ”) and a user using the pen to perform a touch operation on the same presentation screen 14 g is regarded as a presented side user ( for example , a “ client ”) in the embodiment . therefore , for example , as shown in fig5 , character recognition results of images extracted from the presentation screen 14 g in accordance with the coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like of the touch operation regions 1 , 2 or the like performed by the finger and character recognition results of images extracted from the presentation screen 14 g in accordance with the coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of the enlarged regions 1 , 2 or the like , are stored as presenting side ( salesclerk ) keywords 19 s 1 , 19 s 2 or the like in the keyword data storage unit 19 . in addition , character recognition results of images extracted from the presentation screen 14 g in accordance with the coordinates ( x , y , sx , sy ) of the touch operation regions 1 , 2 or the like performed by the pen is stored as presented side ( client ) keywords 19 c 1 , 19 c 2 or the like in the keyword data storage unit 19 . fig5 is a view showing keyword data stored in the keyword data storage unit 19 of the keyword extractor 10 . the respective controllers ( cpu ) 11 , 20 , 21 , 22 and 23 control operations of respective units in accordance with commands described in the respective programs pr 1 , pr 2 and pr 3 so that software and hardware can operate in cooperation with each other . in this manner , the keyword extractor 10 configured thus implements functions which will be described in the following operation description . next , operation of the keyword extractor 10 having the aforementioned configuration will be described . fig6 is a flow chart showing a keyword extraction process ( first part ) executed in accordance with the keyword extraction process program pr 1 of the keyword extractor 10 . fig7 is a flow chart showing the keyword extraction process ( second part ) executed in accordance with the keyword extraction process program pr 1 of the keyword extractor 10 . fig8 is a flow chart showing the keyword extraction process ( third part ) executed in accordance with the keyword extraction process program pr 1 of the keyword extractor 10 . for example , in a presentation operation mode set in response to a touch operation performed on the input device ( touch panel ) 13 by the presenting side user , an operation information recording ( keyword extraction process ) is started ( step s 1 ). when a desired presentation screen 14 g stored in the presentation material storage unit 14 is selected in accordance with an operation of the user , the selected presentation screen 14 g is displayed on the display device 12 ( step s 2 ). when the user performs a touch operation on the input device 13 in the presentation screen 14 g displayed on the display device 12 , it may be determined that the operation is a touch operation performed with a finger ( step s 4 ( touch )). in this case , coordinates ( x , y ) 15 t 1 , 15 t 2 or the like of the position the finger touches are recorded in the touch operation information address 15 t of the operation information storage unit 15 every time the touch operation is determined ( step s 5 t ). further , it may be determined that the operation is a touch operation performed with a pen ( step 4 ( pen )). in this case , coordinates ( x , y ) 15 p 1 , 15 p 2 or the like of the position the pen touches are recorded in the pen operation information address 15 p of the operation information storage unit 15 every time the touch operation is determined ( step s 5 p ). on the other hand , it may be determined that the operation is an enlargement operation performed by multi - touch ( step s 4 ( enlarge )). in this case , coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of a region subjected to the enlargement operation are recorded in the enlargement operation information address 15 z of the operation information storage unit 15 every time the enlargement operation is determined ( step s 5 z ). in this manner , in accordance with the touch operations using the input device ( touch panel ) 13 on the presentation screen 14 g displayed on the display device 12 , the coordinates ( x , y ) 15 t 1 , 15 t 2 or the like designated by the touch operation with the finger on the presenting side and the coordinates ( x , y , sx , zy ) 15 z 1 , 15 z 2 or the like of the region subjected to the enlargement operation are recorded in the touch operation information address 15 t and the enlargement operation information address 15 z of the operation information storage unit 15 respectively , and the coordinates ( x , y ) 15 p 1 , 15 p 2 or the like designated by the touch operation with a pen on the presented side are recorded in the pen operation information address 15 p of the same operation information storage unit 15 . when it is then determined that an operation to terminate the presentation has been performed (“ yes ” in step s 3 ), it is determined whether the touch operation information of the finger has been recorded in the touch operation information address 15 t of the operation information storage unit 15 or not ( step s 6 ). here , when it is determined that the touch operation information of the finger has been recorded in the touch operation information address 15 t of the operation information storage unit 15 (“ yes ” in step s 6 ), the coordinates ( x , y ) 15 t 1 , 15 t 2 or the like which are the touch operation information of the finger are acquired ( step s 7 ). a region surrounded by a rectangular size of ± 50 dots in both an x direction and a y direction with respect to the coordinates ( x , y ) 15 t 1 , 15 t 2 or the like acquired from the touch operation information address 15 t in accordance with the coordinates ( x , y ) is created as coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like indicating a touch operation region 1 , 2 or the like and stored in the touch operation region data storage unit 16 ( steps s 8 to s 11 ). on this occasion , it is determined whether a touch operation region ( 16 tm ) located on the same presentation screen 14 g and already stored in the touch operation region data storage unit 16 has an overlapping region or not with a touch operation region ( 16 tn ) created this time ( step s 9 ). when it is determined that the touch operation region ( 16 tm ) has no overlapping region (“ no ” in step s 9 ), the coordinates ( x , y , sx , sy ) 16 tn of the touch operation region 1 , 2 or the like created this time are additionally stored in the touch operation region data storage unit 16 ( step s 10 ). on the other hand , when it is determined that the touch operation region ( 16 tm ) has an overlapping region (“ yes ” in step s 9 ), coordinates ( 16 tm + tn ) of an expanded region obtained by adding the touch operation region ( 16 tn ) created this time to the touch operation region ( 16 tm ) which has been already stored and which is determined to have the overlapping region are stored for update in the touch operation region data storage unit 16 ( step s 11 ). when it is determined that next touch operation information ( 15 tn ) has been recorded in the touch operation information address 15 t of the operation information storage unit 15 , the same process of creating and storing touch operation region information ( 16 tn ) is repeated ( steps s 6 to s 11 ). then , it is determined whether touch operation information of the pen has been recorded in the pen operation information address 15 p of the operation information storage unit 15 or not ( step s 12 ). here , when it is determined that the touch operation information of the pen has been recorded in the pen operation information address 15 p of the operation information storage unit 15 (“ yes ” in step s 12 ), coordinates ( x , y ) 15 p 1 , 15 p 2 or the like which are the touch operation information of the pen are acquired ( step s 13 ). a region surrounded by a rectangular size of ± 50 dots in both the x direction and the y direction with respect to the coordinates ( x , y ) 15 p 1 , 15 p 2 or the like acquired from the pen operation information address 15 p in accordance with the coordinates ( x , y ) are created as coordinates ( x , y , sx , sy ) indicating the pen operation region 1 , 2 or the like and stored in the pen operation region data storage unit 17 ( step s 14 ). on this occasion , it is determined whether a pen operation region located on the same presentation screen 14 g and already stored in the pen operation region data storage unit 17 has an overlapping region or not with the pen operation region created this time ( step s 15 ). when it is determined that the pen operation region has no overlapping region (“ no ” in step s 15 ), the coordinates ( x , y , sx , sy ) of the pen operation region 1 , 2 or the like created this time are additionally stored in the pen operation region data storage unit 17 ( step s 16 ). on the other hand , when it is determined that the pen operation region has an overlapping region (“ yes ” in step s 15 ), coordinates of an expanded region obtained by adding the pen operation region created this time to the pen operation region which is determined to have the overlapping region and which has already been stored are stored for update in the pen operation region data storage unit 17 ( step s 17 ). when it is determined that next pen operation information has been recorded in the pen operation information address 15 p of the operation information storage unit 15 , the same process of creating and storing pen operation region information is repeated ( step s 12 to s 17 ). next , it is determined whether touch operation region information have been stored in the touch operation region data storage unit 16 or not ( step s 18 ). here , when it is determined that touch operation region information have been recorded in the touch operation region data storage unit 16 (“ yes ” in step s 18 ), the coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like which are the touch operation region information are acquired ( step s 19 ). then , in accordance with the coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like of each of the touch operation regions acquired thus , characters are recognized in an image extracted from the presentation screen 14 g correspondingly to the coordinates ( x , y , sx , sy ) of the region by the character recognition controller 23 ( step s 20 ). strings of characters recognized thus are registered as presenting side keywords 19 s 1 , 19 s 2 or the like in the keyword data storage unit 19 ( see fig5 ) ( step s 21 ). next , it is determined whether pen operation region information have been stored in the pen operation region data storage unit 17 or not ( step s 22 ). here , when it is determined that the pen operation region information have been recorded in the pen operation region data storage unit 17 ( yes in step s 22 ), coordinates ( x , y , sx , sy ) or the like which are the pen operation region information are acquired ( step s 23 ). then , in accordance with the coordinates ( x , y , sx , sy ) or the like of each of the pen operation regions acquired thus , characters are recognized in an image extracted from the presentation screen 14 g correspondingly to the coordinates ( x , y , sx , sy ) of the region by the character recognition controller 23 ( step s 24 ). strings of characters recognized thus are registered as presented side ( client ) keywords 19 c 1 , 19 c 2 or the like in the keyword data storage unit 19 ( see fig5 ) ( step s 25 ). then , it is determined whether enlargement operation region information have been stored in the enlargement operation region data storage unit 18 or not ( step s 26 ). here , when it is determined that the enlargement operation region information have been recorded in the enlargement operation region data storage unit 18 ( yes in step s 26 ), coordinates ( x , y , sx , sy ) or the like which are the enlargement operation region information are acquired ( step s 27 ). then , in accordance with the coordinates ( x , y , sx , sy ) or the like of each of the enlargement operation regions acquired thus , characters are recognized in an image extracted from the presentation screen 14 g correspondingly to the coordinates ( x , y , sx , sy ) of the region by the character recognition controller 23 ( step s 28 ). strings of characters recognized thus are registered as presenting side keywords 19 s 1 , 19 s 2 or the like in the keyword data storage unit 19 ( see fig5 ) ( step 29 ). fig9 a and 9b are views showing a specific display operation on the presentation screen 14 g in accordance with a keyword extraction process of the keyword extractor 10 . fig9 a is a view showing touch operation positions t 1 to t 3 touched by a finger , a touch operation position p 1 touched by a pen and an enlargement operation region z 1 on the presentation screen 14 g displayed on the display device 12 . fig9 b is a view showing an enlarged display screen 14 g z of the enlargement operation region z 1 . fig1 is a view showing a specific example in which touch operation information are obtained on the presentation screen 14 g in fig9 a and 9b in accordance with the keyword extraction process of the keyword extractor 10 . fig1 is a view showing a specific example in which touch operation region information are created correspondingly to the touch operation information in fig1 respectively in accordance with the keyword extraction process of the keyword extractor 10 while expanded region information is created when the regions of the touch operation region information overlap with each other . when , for example , the presenting side touches three desired points t 1 to t 3 with a finger on the presentation screen 14 g displayed on the display device 12 as shown in fig9 a ( steps s 1 and s 2 ), xy coordinates ( x = 50 , y = 200 ) 15 t 1 corresponding to the touch operation position t 1 , xy coordinates ( x = 100 , y = 220 ) 15 t 2 corresponding to the touch operation position t 2 and xy coordinates ( x = 80 , y = 170 ) 15 t 3 corresponding to the touch operation position t 3 are recorded in the touch operation information address 15 t of the operation information storage unit 15 as shown in fig1 ( steps s 4 and s 5 t ). in addition , when , for example , the presenting side touches a region z 1 to be enlarged , coordinates ( x = 200 , y = 250 , sx = 150 , sy = 100 ) 15 z 1 corresponding to the upper left of the enlargement operation region z 1 and a range extending therefrom in the x direction and the y direction are recorded in the enlargement operation information address 15 z of the operation information storage unit 15 as shown in fig1 ( steps s 4 and s 5 z ). further , when , for example , the presented side ( client ) touches one desired point p 1 with the pen , xy coordinates ( x = 200 , y = 220 ) 15 p 1 corresponding to the pen operation position p 1 are recorded in the pen operation information address 15 p of the operation information storage unit 15 as shown in fig1 ( steps s 4 and s 5 p ). when an operation to terminate the presentation is performed ( yes in step s 3 ), the coordinates ( x = 50 , y = 200 ) 15 t 1 corresponding to the first touch operation position t 1 are first acquired from the touch operation information address 15 t of the operation information storage unit 15 so that coordinates ( x = 0 , y = 150 , sx = 100 , sy = 100 ) 16 t 1 of a touch operation region surrounded by a rectangular size of ± 50 dots in both the x direction and the y direction are created as shown in ( a ) of fig1 ( steps s 6 to t 8 ). in this case , there is no other touch operation region overlapping with the first touch operation region ( x = 0 , y = 150 , sx = 100 , sy = 100 ) 16 t 1 . accordingly , the touch operation region 16 t 1 is stored in the touch operation region data storage unit 16 as it is ( steps s 9 and s 10 ). then , the coordinates ( x = 100 , y = 220 ) 15 t 2 corresponding to the second touch operation position t 2 are acquired from the touch operation information address 15 t of the operation information storage unit 15 so that coordinates ( x = 50 , y = 170 , sx = 100 , sy = 100 ) 16 t 2 of a touch operation region surrounded by a rectangular size of ± 50 dots in both the x direction and the y direction are created as shown in ( b ) of fig1 ( steps s 6 to s 8 ). in this case , a region overlapping with the second touch operation region ( x = 50 , y = 170 , sx = 100 , sy = 100 ) 16 t 2 created this time corresponds to the first touch operation region ( x = 0 , y = 150 , sx = 100 , sy = 100 ) 16 t 1 which has been already stored in the touch operation region data storage unit 16 . accordingly , coordinates ( 0 , 150 , 150 , 120 ) 16 t 1 + t 2 of an expanded touch operation region obtained by adding the second touch operation region 16 t 2 to the existing and overlapping touch operation region 16 t 1 are stored for update in the touch operation region data storage unit 16 ( step s 11 ). then , the coordinates ( x = 80 , y = 170 ) 15 t 3 corresponding to the third touch operation position t 3 are acquired from the touch operation information address 15 t of the operation information storage unit 15 so that coordinates ( x = 30 , y = 120 , sx = 100 , sy = 100 ) 16 t 3 of a touch operation region surrounded by a rectangular size of ± 50 dots in both the x direction and the y direction are created as shown in ( c ) of fig1 ( steps s 6 to s 8 ). in this case , a region overlapping with the third touch operation region ( x = 30 , y = 120 , sx = 100 , sy = 100 ) 16 t 3 created this time corresponds to the expanded touch operation region ( 0 , 150 , 150 , 120 ) 16 t 1 + t 2 which has been already stored in the touch operation region data storage unit 16 . accordingly , coordinates ( 0 , 120 , 150 , 150 ) 16 t 1 + t 2 + t 3 of an expanded touch operation region obtained by adding the third touch operation region 16 t 3 to the existing and overlapping touch operation region 16 t 1 + t 2 are stored for update in the touch operation region data storage unit 16 ( step s 11 ). also as for the coordinates ( 200 , 220 ) 15 p 1 ( see fig1 ) corresponding to the pen operation position p 1 which has been stored in the pen operation information address 15 p of the operation information storage unit 15 , a pen operation region corresponding to the pen operation position p 1 is created in the same manner as in the process of creating and storing the touch operation region 16 tn corresponding to the touch operation position 15 tn , and stored in the pen operation region data storage unit 17 ( steps s 12 to s 17 ). fig1 is a view showing a specific example of a touch region image gt extracted from a touch operation region 16 tn on the presentation screen 14 g in accordance with the keyword extraction process of the keyword extractor 10 . fig1 is a view showing a specific example of an enlarged region image gz extracted from an enlarged operation region 16 zn on the presentation screen 14 g in accordance with the keyword extraction process of the keyword extractor 10 . fig1 is a view showing specific examples of respective keywords extracted from respective operation regions on the presentation screen 14 g in accordance with the keyword extraction process of the keyword extractor 10 and registered in the keyword data storage unit 19 . when the coordinates ( 0 , 120 , 150 , 150 ) 16 t 1 + t 2 + t 3 of the touch operation region stored in the touch operation region data storage unit 16 are acquired as shown in fig1 ( steps s 18 and s 19 ), a touch region image gt corresponding to the touch operation region 16 t 1 + t 2 + t 3 is extracted from the presentation image 14 g ( see fig9 a ) as shown in fig1 so that characters can be recognized in the touch region image gt by the character recognition controller 23 ( step s 20 ). then , a character string “ acquisition of more clients at abc • def ” consisting of the characters recognized thus from the touch region image gt is registered as a presenting side ( t ) keyword 19 s 1 in the keyword data storage unit 19 as shown in fig1 ( step s 21 ). when a pen operation region which has been stored in the pen operation region data storage unit 17 is acquired ( steps s 22 and s 23 ), a pen region image corresponding to the pen operation region is extracted from the presentation image 14 g so that characters can be recognized in the pen region image by the character recognition controller 23 ( step s 24 ). then , a character string consisting of the characters recognized thus from the pen region image is registered as a presented side ( client ) ( p ) keyword 19 c 1 in the keyword data storage unit 19 ( step s 25 ). when coordinates ( 200 , 250 , 150 , 100 ) 15 z 1 of an enlargement operation region which has been stored in the enlargement operation region data storage unit 18 are acquired ( steps s 26 and s 27 ), an enlarged region image gz corresponding to the enlargement operation region 15 z 1 is extracted from the presentation image 14 g ( see fig9 a and 9b ) as shown in fig1 so that characters can be recognized in the enlarged region image gz by the character recognition controller 23 ( step s 28 ). then , a character string “ support for various electronic moneys ” consisting of the characters recognized thus from the enlarged region image gz is registered as a presenting side ( z ) keyword 19 s 2 in the keyword data storage unit 19 as shown in fig1 ( step s 29 ). fig1 is a flow chart showing a keyword recording for editing and recording keywords which have been registered in the keyword data storage unit 19 by the keyword extraction process of the keyword extractor 10 . fig1 is a view showing a keyword recording form fk used in the keyword recording of the keyword extractor 10 . when a keyword corresponding to each operation region of the user ( the presenting side ( salesclerk )/ the presented side ( client )) on the presentation screen 14 g is extracted and registered in the keyword data storage unit 19 in accordance with the keyword extraction process ( see fig6 to 14 ), the keyword recording in fig1 is executed . when the keyword recording is started up , the keyword recording form fk ( see fig1 ) corresponding to the presentation this time and stored in the keyword data storage unit 19 is read ( step a 1 ) so that it can be determined whether presented side ( client ) keywords ( p ) have been registered in the same keyword data storage unit 19 ( see fig1 ) or not ( step a 2 ). here , when it is determined that presented side ( client ) keywords ( p ) 19 c 1 to 19 cn have been registered ( yes in step a 2 ), the keywords ( p ) 19 c 1 to 19 cn are acquired sequentially ( step a 3 ) and added and recorded sequentially in a client keyword region kc in the keyword recording form fk ( step a 4 ). when it is determined that there is no presented side ( client ) keyword ( p ) which should be acquired from the keyword data storage unit 19 (“ no ” in step a 2 ), it is then determined whether presenting side ( salesclerk ) keywords ( t ) and ( z ) have been registered in the same keyword data storage unit 19 ( see fig1 ) or not ( step a 5 ). here , when it is determined that presenting side ( salesclerk ) keywords ( t ) 19 s 1 and ( z ) 19 s 2 have been registered (“ yes ” in step a 5 ), the keywords ( t ) 19 s 1 and ( z ) 19 s 2 are acquired sequentially ( step s 6 ) and added and recorded sequentially in a salesclerk keyword region ks in the keyword recording form fk ( step a 7 ). when it is determined that there is no presenting side ( salesclerk ) keyword ( t ) or ( z ) which should be acquired from the keyword data storage unit 19 (“ no ” in step a 5 ), the keyword recording form fk in which the presented side ( client ) keyword ( p ) 19 c 1 is classified and recorded into the client keyword region kc and the presenting side ( salesclerk ) keywords ( t ) 19 s 1 and ( z ) 19 s 2 are classified and recorded into the salesclerk keyword region ks is registered in the keyword data storage unit 19 . fig1 is a flow chart showing a presentation material creation process for creating a new presentation material based on a keyword recording form fk which has been recorded by the keyword recording of the keyword extractor 10 . fig1 is a view showing a presentation material form fp used in a presentation material creation process of the keyword extractor 10 . when a presentation material creation process in fig1 is started up in response to an operation of a user ( step b 1 ) after a keyword recording form fk in which presented side ( client ) keywords ( p ) are classified into a client keyword region kc and presenting side ( salesclerk ) keywords ( t ) and ( z ) are classified into a salesclerk keyword region ks has been created in accordance with the keyword recording ( fig1 and 16 ), a message encouraging the user to display a list of keywords which have been recorded in the keyword recording form fk or to terminate the process is displayed ( step b 2 ). here , when the message to display the list of keywords is selected (“ yes ” in step b 3 ), it is determined whether there are or not any keywords which have been recorded in the client keyword region kc or the salesclerk keyword region ks of the keyword recording form fk ( step b 4 ). when it is first determined that presented side ( client ) keywords ( p ) 19 c 1 to 19 cn have been recorded in the client keyword region kc of the keyword recording form fk ( yes in both steps b 4 and b 5 ), all the presented side ( client ) keywords ( p ) 19 c 1 to 19 cn which have been recorded are read out and added onto a pen keyword list screen lk displayed in a window on the display device 12 as shown in fig1 ( step b 6 ). when it is then determined that presenting side ( salesclerk ) keywords ( t ) and ( z ) 19 s 1 to 19 sn have been recorded in the salesclerk keyword region ks of the keyword recording form fk (“ yes ” in step b 7 ), all the presenting side ( salesclerk ) keywords ( t ) and ( z ) 19 s 1 to 195 n which have been recorded are read out and added onto a touch keyword list screen mk displayed in a window on the display device 12 ( step b 8 ) as shown in fig1 . then , the pen keyword list screen lk and the touch keyword list screen mk are compared with each other so that keywords which are coincident between a list on the pen keyword list screen lk and a list on the touch keyword list screen mk are highlighted and displayed in the lists . in this manner , all the presented side ( client ) keywords ( p ) 19 c 1 to 19 cn and the presenting side ( salesclerk ) keywords ( t ) and ( z ) 19 s 1 to 195 n which have been classified and recorded in the keyword recording form fk are classified and displayed in the respective lists on the pen keyword list screen lk and the touch keyword list screen mk which are displayed in the respective windows on the display device 12 . accordingly , the contents which drew client &# 39 ; s attention and the contents which were emphasized by the salesclerk when the presentation was made by means of the presentation screen 14 g can be compared with each other . in addition , the coincident keywords are highlighted so that consistent points and different points between the client &# 39 ; s thought and the salesclerk &# 39 ; s thought can be made clear . thus , keywords regarded as highly important for future presentation can be known . then , when a keyword desired to be used as a new presentation material is selected from the respective keywords displayed in the lists on the pen keyword list screen lk and the touch keyword list screen mk (“ yes ” in both steps b 9 and b 10 ), the selected keyword is inputted into and displayed on a presentation material form fp which is displayed adjacently to the pen keyword list screen lk and the touch keyword list screen mk ( step b 11 ). in this manner , keywords selected desirably from the keyword list screen lk in which keywords regarded as important are listed and displayed sequentially in order of importance are inputted into and displayed on the presentation material form fp as they are . thus , new and suitable presentation materials can be created easily without any omission of the important keywords . accordingly , according to the keyword extraction function of the keyword extractor 10 having the aforementioned configuration , the presentation screen 14 g is displayed on the display device 12 provided with the touch panel type input device 13 . the presenting side ( salesclerk ) performs a touch operation or an enlargement operation with a finger or fingers on the presentation screen 14 g , or the presented side ( client ) performs a touch operation with the pen likewise . in the touch operation with the finger or the touch operation with the pen , characters are recognized from an image of a region in a fixed range corresponding to coordinates of the touch position in the touch operation , and a keyword of a character string consisting of the recognized characters is extracted . in the enlargement operation , characters are recognized from an image of an enlarged region designated by the enlargement operation , and a keyword of a character string consisting of the recognized characters is extracted . the keyword extracted in accordance with the presenting side ( salesclerk ) operation region and the keyword extracted in accordance with the presented side ( client ) operation region are classified and stored in a keyword recording form fk having a client keyword region kc and a salesclerk keyword region ks respectively . therefore , information which drew attention in a presentation can be recorded in a form which can serve for making materials for a future presentation . regions corresponding to touch operation positions designated with a finger on the presentation screen 14 g may overlap with one another , or regions corresponding to touch operation positions designated with a pen likewise may overlap with one another . in this case , according to the keyword extraction function of the keyword extractor 10 having the aforementioned configuration , the region corresponding to the touch operation performed this time is added to the region corresponding to the touch operation performed last time so that a keyword consisting of characters recognized from an image of the operation region expanded thus can be extracted . therefore , it is possible to eliminate such a disadvantage that characters of one and the same keyword are recognized and extracted severally from an image of a portion where regions corresponding to a plurality of touch operations overlap with each other . in addition , in each of the embodiments , the extracted keywords are used for a new presentation material form . the invention is not limited thereto . when one is selected from the extracted keywords , a keyword in the presentation screen 14 g coincident with the selected keyword may be highlighted . in this case , a keyword extracted in response to a touch operation may be highlighted and displayed in another way than a keyword extracted in response to a pen operation . in this manner , keywords in which lots of clients are interested , keywords which have to be explained , etc . for a next presentation can be known so that the quality of the presentation can be improved . even when another salesclerk performs operation , the quality of presentation can be maintained . incidentally , in each of the embodiments , keywords are extracted from one presentation . the invention is not limited thereto . keywords which have been extracted a large number of times may be displayed in a list whenever presentation is made several times . in this case , keywords are extracted whenever a presentation is terminated . when there is a keyword coincident with one of the extracted keywords , a counter of the keyword is counted up . thus , keywords which has been extracted a larger number of times can be displayed . incidentally , each of the techniques of the respective processes performed by the keyword extractor 10 described in the aforementioned embodiments , that is , each of the techniques of the keyword extraction process shown in the flow charts of fig6 to 8 , the keyword recording shown in the flow chart of fig1 , the presentation material creation process shown in the flow chart of fig1 , etc . may be distributed as a program which is stored in a medium of an external storage device such as a memory card ( an rom card , an ram card , etc . ), a magnetic disk ( a floppy disk , a hard disk , etc . ), an optical disk ( a cd - rom , a dvd , etc . ), or a semiconductor memory so that the program can be executed by a computer . in a computer ( control device ) of an electronic instrument provided with a display device 12 , the program stored in the medium of the external storage device is read into a storage device so that operation of the electronic instrument can be controlled by the read program . in this manner , the keyword extraction function , the keyword recording function and the presentation material creation function in response to presentation operations described in the embodiments can be implemented so that the same processes based on the aforementioned techniques can be executed . incidentally , in the embodiments , keywords are extracted based on touched places . however , information to be extracted is not limited thereto . images may be extracted or data associated with the touched places may be extracted . in addition , data of the program for implementing each of the techniques may be transmitted as a form of program codes on a communication network . the data of the program can be imported into the computer ( control device ) of the electronic instrument provided with the display device 12 from a computer apparatus ( program server ) connected to the communication network and stored into the storage device so that the keyword extraction function , the keyword recording function and the presentation material creation function in response to presentation operations can be implemented . while the present invention has been shown and described with reference to certain exemplary embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . it is aimed , therefore , to cover in the appended claim all such changes and modifications as fall within the true spirit and scope of the present invention . | 6 |
referring to fig1 a , 2 represents an electrically - actuated hammer , which may be a conventional electric demolition hammer such as sold by milwaukee electric tools and others , and fitted with an impact rod 3 . different impact plates 4 and 4 a ( fig1 b and 1c ) may be applied for hard and soft surfaces respectively . the stroke rate of such a hammer may be varied substantially linearly by varying the supply voltage , over a range , for example , of 20 - 80 hz . the energy content of each impact does not depend on the input voltage , being typically about 20 j ( depending on the power of the hammer ). the voltage input to the hammer in line c is controlled by a controller 2 according to signals on line b from a computer 7 , the controller 1 receiving electrical power on a line from a generator 8 or other power source . the controller receives an enable signal on line d from a switch on the hammer 2 , after positioning of the hammer using a handle , to initiate an impact sequence and then controls the repetition frequency of the impacts by causing the control circuit to sweep the potential applied to the hammer on line c over a period equal to the length of the desired impact sequence , which should be at least 100 impacts and will typically contain 500 impacts or more . the hammer is coupled to the rock or other material to be investigated by pressing an impact plate against it through the rod 3 , and is readily moved to successive application points in that it is a hand - held tool . signals from the site being mapped are picked up by a receiver transducer 6 and passed on line f to the controller 1 whence they may be passed by a radio link g or a landline h to a receiver 6 ( see fig1 e ) which forwards the signals to a seismograph 10 including a computer which processes the signals and either displays and saves the processed signals or passes them to an optional processing computer 11 for display and storage . the computer 7 is optional and its functions in determining the impact sequence generated by the controller 1 may be built into the latter , with external controls provided for setting up a desired sequence . referring to fig2 the hammer unit of this embodiment is again based on a conventional electrical demolition hammer 20 , modified by substituting a spherically terminated impact rod 30 in place of the conventional chisel , the spherical termination being fitted with an impact plate 40 . this may have a plane sole as shown for engagement with hard surfaces , or protuberances as shown in fig1 c to improve engagement with soft surfaces . the presently preferred hammer is type us 427 / 1800 w manufactured by bosch , although other similar hammers may be used . the spherical termination allows the plate 40 to articulate so as to improve engagement with the surface of the test site , typically through about 35 degrees relative to the axis of the impact rod . depending on soil characteristics such as hardness and slope , the impact plate 40 may have different characteristics designed to obtain proper acoustic coupling to the surface , which coupling should be as tight as possible to prevent secondary shocks due to recoil of the hammer . for the same reason , a seating plate 43 may be used to secure the impact plate 40 to the rod 30 . modified articulated positioning systems , including weight compensation and / or recoil attenuation devices , can be used for applications requiring the shocks to be applied at an angle to the impact rod axis . further details of the impact plate and associated parts are shown in fig3 . the actuator of the hammer 20 is pressed into impact rod 30 , the spherical end of which is held in a socket of the impact plate 40 by the plate 43 secured by bolts 46 through a rubber washer 45 having a minimum hardness of 70 shore . a trigger device 50 is mounted into the impact plate 40 , through an elastic mounting designed to attenuate shocks transmitted from the plate during operation . the shock rate of the hammer 20 may be varied linearly , over a range of about 15 - 30 hz , by varying the supply voltage ; the available range may vary for different hammer types . the energy content of each impact does not depend on input voltage ; a typical hand held electric demolition hammer delivers about 20 j per impact . the generated frequency range extends well beyond 2 khz . referring to fig2 a controller 110 provides a controlled supply voltage to the hammer 20 on line d . the controller is powered via line a from a power generator 80 or alternative electric power source . an impact coding function is generated by a programmable computer 70 on line b and it is either used as such or it is stored in the memory of the controller 100 to be used later . using the computer 70 provides greater versatility because virtually any sweep function may be programmed whereas only linear saw - tooth functions are readily set up by the control panel , which allows for the selection of sweep time , voltage gain determining the ratio of minimum to maximum impact rate , and offset voltage determining the minimum impact rate . in either case the controller 110 must receive an enable signal from the operator of the hammer 20 to start the sweep . the operator positions the plate 40 against the surface of the test site and presses a switch 124 on a handle of the hammer which sends a signal on line e to the controller to initiate a sequence of impacts . according to the setting of the switch sw 1 , the controller generates the sequence either according to its own programming or programming received from computer 70 on line b in response to a signal transmitted on line c . the response of the site is sensed by a prepositioned chain of seismic signal receivers ( accelerometers , geophones or hydrophones ) r 1 , r 2 , . . . r n and transmitted to a seismograph 100 via a long geophysical cable l . recording of response signals is triggered by rectangular pulses generated by the controller 110 and fed to the seismograph 100 on line h . the trigger sensor 60 is a small piezoelectric sensor or geophone incorporated in the trigger device 50 , which sensor picks up mechanical shocks corresponding to the impacts for transmission to controller 110 on line f formed by an armored geophysical or coaxial cable . the controller 110 includes a trigger module ( see fig4 ), a firing module ( see fig5 ), and a power supply . referring to fig4 a differential input stage 111 receives the signal on line f from transducer 60 . this signal is fed after optional filtering and shaping by a low pass filter 112 and / or a schmitt trigger 113 to an optical isolation stage 114 . the differential input stage rejects common mode noise and permits input sensitivity to be adjusted to avoid clipping of the signal , yet provide adequate amplitude to be detected by the seismograph which receives the output of stage 114 on line h . the optical isolation protects the seismograph 100 from spikes and transients , while the filtering and shaping reject noise and convert the transducer output into a single rectangular pulse with a fast rising edge which provides a steady timing reference for recording signals from cable l . the rectangular trigger signals may alternatively be modulated and transmitted by a radio transmitter 115 to provide a radio link g ( see fig2 ) to the radio receiver 90 and thence the seismograph 100 . the transmitter may be incorporated in the controller 110 as shown or be a separate unit . in either case the seismograph is electrically isolated from the controller so as to reject spikes and noise present on the controller power supply and permitting the seismograph to be independently powered . the seismograph 100 processes the receiver signals on line l , and either displays or saves them , or passes them to an optional processing computer 130 for further processing and storage . referring to fig5 the switch sw 1 selects either a local signal from the controller or a remote signal from the programming computer 70 . in the first case a saw tooth generator 116 programmed on the controller panel is enabled on receipt of the signal from switch 124 , and the gain and offset of this signal are adjusted by amplifiers 118 and 119 . the generator 116 also generates an enable signal applied to the seismograph 100 throughout the sweep via an opto - isolator 117 . a remote signal from the computer 70 is amplified by a differential input amplifier 125 , filtered by a band - pass filter 126 to remove spikes and high frequency noise , and passed to switch sw 1 through an opto - isolator 123 . the signal selected by switch sw 1 is amplified by amplifier 121 and applied to a phase angle controller 122 , which modulates the supply potential of the power delivered to the hammer . the power supply provides power to the various circuits , and includes an isolated dc / dc converter to power those circuits in direct connection with the seismograph 100 or the computer 70 . in fig6 the electric demolition hammer is replaced by a piezo - electric hammer 208 , and the control unit 1 incorporates a generator 210 of high voltage ( e . g ., 8000 volt ) pulses connected to electrodes between piezo - electric elements 212 secured in a stack between loading blocks 214 and 216 . one of the loading blocks 214 is coupled to a casing 218 of the unit , and the other 210 is coupled to the walls of a borehole to be investigated either through perforations 222 in the wall of the casing , or by a known motor driven wedge system ( not shown ). this embodiment is suitable for use in boreholes , and the hammer may be moved through the borehole between successive locations , after releasing the wedge system , if necessary , by means of a cable attached to an eye 21 on the casing . in fig7 the electric demolition hammer of fig2 is replaced by a hammer formed by stack of piezoelectric transducer plates 140 secured between two loading blocks 150 and 160 . the loading block 150 is coupled to the casing 170 of the unit , while the loading block 160 is coupled to the wall of a borehole in which the unit is inserted by an axial to radial converter 180 . a trigger sensor and local preamplifier are associated with the hammer , conveniently in a housing 500 ( see fig8 ) connected above the hammer by a cable 400 and couplings 190 . the housing 500 also accommodates a pulse generating system described in more detail with reference to fig1 . a sequence of high voltage pulses ( up to 7 kv ) from this generator is applied in parallel to the plates of the stack so that the elongations of the plates produced by the pulses are summed to produce an axial elongation of the stack which is transmitted to the converter 180 and thence to the wall 310 of the borehole 320 . two forms of converter 180 are exemplified . in the embodiment of fig9 and 10 , the impacts are transmitted through a series of perforations in the converter casing , using water filling the borehole as a transmission medium , while in the embodiment of fig1 transmission is through a motor driven wedge system . in both cases the loading block 160 provides an inertial mass . the stack typically comprises at least 45 piezoelectric plates 140 clamped by a rod 141 between end blocks 142 , 143 and 144 within a tube 146 within the casing 170 . the rod 141 acts as a spring compressing the stack , which on receiving a pulse expands with a force equal to that developed by each plate in the stack , through a stroke equal to the sum of the expansions of the plates . the loading and damping provided by the loading block 150 and a damping element 147 are selected so that maximum displacement occurs downwardly ( as seen in the drawings ) and reflections in the opposing direction are largely absorbed by the element 147 . in the water coupled converter shown in fig8 and 10 , water is compressed between plates of a stack of alternating metal plates 181 and 182 ( see fig1 ), the plates 181 of which receive the impacts of the hammer through a rod 184 connected to the block 144 , while the plates 182 are stacked , through circular peripheral flanges forming a converter casing and defining openings 185 , on the loading block 160 . the impacts result in water trapped between facing surfaces 186 and 187 being ejected radially through the openings 185 and impacting on the wall 310 . the plates 181 are secured on the rod 184 between nuts 188 and collars 189 , while an extension of the rod through the loading block 160 supports the latter through an energy absorbing block 161 and washers 162 , the block in this example being of polyurethane with a shore hardness of at least 92 . a further block 163 of similar material is located between the topmost plate 182 and the block 144 . initial clearance between the surfaces 186 and 187 is typically in the range 1 . 35 - 2 . 2 mm for borehole diameters of 33 to 100 mm diameter , while the outer diameter of the converter 180 should be about 2 - 4 mm less than that of the borehole 320 . the length of the converter 180 should be about half the wavelength in the converter of the resonant frequency of the piezoelectric hammer , which may for example be about 2100 hz . this wavelength may be adjusted by suitably selecting the length of the collars 189 and the number of pairs of plates 181 and 182 , typically 10 - 15 . in the embodiment of fig1 , the converter is mechanical , energy developed by the hammer being transferred radially to the wall of the borehole through wedges 171 located in slots in an extension 172 of the casing 170 and engaging guide slots 173 in a coned surface of the block 144 . typically there are three wedges with 120 degree spacing . the piezoelectric hammer 150 is longitudinally movable within the casing 170 so as either to force the wedges against the wall 310 at a test site or to release them so that the apparatus may be moved longitudinally within the bore 320 . a geared motor 190 drives a nut 192 through a coupling 191 , the nut in turn driving a screw 193 supporting the hammer 150 within the casing . the motor is reversible and the current it draws is sensed so that when torque rises as the wedges engage the bore wall 310 or the screw is fully retracted , it shuts off . the controller 110 is functionally somewhat similar to that of fig2 but differs in its manner of controlling the repetition frequency of the hammer and delivering power to the latter , as shown in fig1 . in this embodiment the power supply voltage is constant . as well as driving the motor 190 through a motor driver 194 ( only for the embodiment of fig1 , in which it also provides a clamp - unclamp signal controlling the direction of the motor ), it charges a capacitor 195 through a rectifier 199 , preferably of the voltage doubler type , which capacitor is discharged at a repetition frequency which is programmed as previously described by closing an electronic switch 196 , typically a thyristor , and opening electronic switch 197 to isolate the supply . the capacitor discharges through the primary of a transformer 198 to generate a high voltage pulse across the transducers 140 . advantageously the discharge circuit is tuned to the resonant frequency ( e . g . about 2100 hz ) of the transducer stack to increase efficiency the switches 196 and 197 are controlled by a timer and logic circuit 189 which also generates trigger signals at each discharge for application to line h to control the seismograph 100 . utilization of such tools to provide sist data is discussed further below : r c ( t )= ψ ( t )* s ( t )+ n ( t ) ( 1 ) where ψ ( t ) is the controlled impact sequence , s ( t ) is the source signature , e ( t ) is the earth impulse response and n ( t ) is the noise . following park ( park et al , 1996 ), a “ normal ” seismic record can be obtained by cross - correlating the controlled impact sequence ψ ( t ) and the coded record r c ( t ): r d ( t )= ψ ( t ){ circle over (×)} r c ( t )= acf { ψ ( t )}* s ( t )+ ψ ( t )* n ( t ) ( 2 ) a key assumption in equation ( 2 ) is that the auto - correlation function acf { ψ ( t )}≅ 0 everywhere except at zero - lag . in practice , the degree of compliance with this condition will provide a way to evaluate the performance of various coding schemes . several time functions were studied and compared with the linear frequency scheme . in particular , an inversely linear frequency ( linear period ) was found to be effective . a 15 - 30 hz ., 30 s , 675 - pulses linear frequency sweep was tested . it was noticed during the study that with the linear - period scheme the band could be narrowed to 18 - 30 hz without an apparent loss of quality . this was done primarily for practical purposes , as a narrow bandwidth simplifies the mechanical construction of the source . in spite of the narrower band , the linear - period sweep led to a more effective cancellation of the correlation noise . a source signature with a frequency band of 800 - 1800 hz has been used with modeling , corresponding to the experimentally - determined spectrum of several small - scale sist sources . in theory , the high limit of the impact frequency band should be as low as possible , to reduce correlation noise . in practice , it turns out that there are considerable benefits in increasing the impact frequency as much as possible , up to 180 or even 200 hz . in borehole investigations , provided that the quality of the decoded signal does not decrease noticeably . two sweep ranges were tested , one of 18 - 30 hz and the other of 90 - 150 hz . the sweep duration of the former was 30 s , the latter only 6 s which , if signal quality can be maintained , represents a significant improvement of performance . since production of a tomographic section of a site being investigated requires thousands of measurements which have to be recorded , inspected for quality assurance , and decoded , the time needed for all these operations depends on the sweep length . in fact , the time - domain - signal decoded from the 6 s sweep looked as clean , or arguably cleaner , than the 30 s signal . the characteristics of the noise were the same in both cases . the sweeps were contaminated with 60 - 2000 hz uniform random noise and noise bursts with bands of 50 - 200 hz and 600 - 1350 hz . the random noise was twice the amplitude of the source signals . the burst amplitudes were 10 times higher and the mean rate is 6 / second and 10 / second , respectively . these noise levels , however extreme they may seem , represent realistic conditions , e . g ., in a production area of a mine . as in equation ( 2 ) ψ ( t )= 1 at the moments of impact and ψ ( t )= 0 at any other time , the cross - correlation can be replaced by summing to provide simple “ shift - and - stack ” averaging . for purely random noise , the s / n of the sum signal will decrease by the square root of the number of impacts . however , in real life , the straight sum may not be the most efficient way to increase the s / n ratio . as shown below , sist techniques based on more elaborate procedures than the shift - and - stack average , possess an even higher capability to suppress noise . three techniques were tested for processing the signals obtained : average , median and alpha - trimmed median . the noise was the same combination of uniform random and bursts as described above . the signal was initially invisible in the unprocessed signals . the time - domain signals obtained by all techniques for the power spectrum of the signal somewhat resembled that of the applied impact , with median techniques providing better results than simple averaging . investigations were carried out at the grimsel test site in switzerland to compare known techniques with those of the invention . the rocks at the grimsel test site ( gts ) are paleozoic granite and granodiorite that have been heavily deformed and altered during the alpine orogeny . consequently , the seismic transparency of the rock at gts is very low , corresponding to a q factor of 10 to 20 . earlier studies regarding the performance of various seismic sources suggested that a suitable combination of high frequency and high energy for mapping the site could be reached only by explosive sources . the fact that explosives are able to produce both high energy and frequency in a burst is because the high energy results from the high speed of the particles during the detonation rather than from the movement of a large mass . the low seismic transparency of the gts rocks was overcome by using the sist concept in accordance with the invention . measurements were performed in a rock block positioned between two gently down - going boreholes , 120 m apart , 150 m and 190 deep ( bous 85 . 003 and adus 96 . 001 ) and a tunnel wt , perpendicular to the boreholes . the measurements performed included tunnel - to - hole and crosshole measurements . the maximum source - receiver distance was around 200 m . a first measuring campaign was carried out with single - pulse sources . 30 - component accelerometers were clamped in one of the holes and the sources were fired in the other hole and in the tunnel . a piezo - electric and an electromechanical source , both single - pulse , were used . the conclusion from this campaign was that single - pulse sources are not suitable for high resolution surveys because , on one hand , increasing the source power to increase s / n ratio narrows the frequency band of the seismic pulse , and on the other hand , increasing the total energy by on - line stacking takes too long , for routine operations . a first attempt at using standard construction site equipment to build a sist source used a modified 1 kw electric hammer drill . a 20 - 80 hz impact frequency band was generated by varying the input voltage . it is important to note that the amplitude of the pulse does not depend on the input voltage and it was found that the impact frequency varied linearly with the voltage . these characteristics make electromechanical sources computer - controllable , by adjusting the voltage as a function of time . various impact frequency schemes can thus be generated . several models of surface and tunnel - wall electromechanical sist sources have been tested . a typical held - held 1 . 5 kw electric demolition hammer delivers 20 j per impact , at a mean impact rate of 25 / second . the energy delivered in a 20 s sweep is 10 kj , which compares with a midsize drop - weight . the signal frequency , though , goes well beyond 1 khz , while a drop weight of comparable energy , used in similar conditions , remains in the low hundreds of hz . gts tunnel - to - hole surveys carried out with a sist source as shown in fig1 applied to the tunnel wall and an array of down - the - hole accelerometers in the boreholes , produced spectra in which frequencies above 1 khz tend to be lost in steps , corresponding to zones of fractured and altered rock crossed by the seismic signal . however , frequencies of up to 2 khz can be observed all the way to a depth of 110 m , which corresponds to a source - receiver distance of approximately 140 m . the frequency content at the receiver end was higher than obtained , with single - pulse sources . it was also higher than reported by earlier seismic investigation programmes carried out at the same site ( bühnemann , 1998 ). piezo - electric sist sources ( see fig2 ) for investigation depths up to 1 km and for borehole diameters from 46 to 100 mm were built based on an existing single - pulse piezo - electric impact generator ( hammer ) model ph52 from vibrometric . the seismic signals are produced by applying controlled sequences of high voltage pulses to the stack of piezo - electric ceramic elements . the frequency band produced is 500 - 2500 hz and could be adjusted . the source is clamped to the borehole wall by a motor - driven wedge mechanism , or by coupling of the source through the borehole water , as shown in fig2 . this latter arrangement is preferred since the delays in operating the clamping mechanism otherwise severely limit the rate at which impact sequences can be performed , and discount the advantages of the invention . the technique of the invention proved capable of characterizing a rock mass at the test site , providing a level of detail necessary for the construction of tomographic images , despite the fact that fracturing and extensive lamprofyre dikes brought the average q - factor of the rock as low as 10 . the proof of the ability of high - resolution seismic techniques to detect and characterize rock discontinuities was made by characterizing a rock block delimited by two parallel , gently dipping boreholes and a tunnel perpendicular to them . the rockmass characterization included the determination of the 3 - d positions and orientations of rock features by multi - offset vsp and crosshole imaging and the tomographic mapping of seismic velocities . the structural model was constructed by joint analysis of reflection and transmission data . the main groups of reflectors were located and their existence and position confirmed in borehole and tunnel profiles . one of the main sets strikes roughly perpendicularly to the tunnel dipping approximately 60 °. this set is abundantly represented in the tunnel as lamprofyre dikes . another set dipping 60 ° strikes nearly parallel to the tunnel and consists of zones of dense fracturing . the presence of this set was confirmed by observations in the tunnel and boreholes . the third main orientation is semi - horizontal and was confirmed mainly by borehole observations . besides the reflectors following these main orientations , some isolated features were associated with a high - velocity feature found by tomographic analysis . in spite of the low q factor of the rock , the acquisition system including sist sources provided the level of detail needed for tomography and migration , while data of acceptable quality could not be obtained with single - pulse sources . | 6 |
the present invention is directed to method and system for utilizing polarization reuse in wireless communications . although the invention is described with respect to specific embodiments , the principles of the invention , as defined by the claims appended herein , can obviously be applied beyond the embodiments of the description described specifically herein . moreover , certain details have been left out in order to not obscure the inventive aspects of the invention . the specific details not described in the present application are within the knowledge of a person of ordinary skill in the art . the drawings in the present application and their accompanying detailed description are directed to merely example embodiments of the invention . to maintain brevity , other embodiments of the invention that use the principles of the present invention are not specifically described in the present application and are not specifically illustrated by the present drawings . the word “ exemplary ” is used exclusively herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . [ 0014 ] fig1 illustrates an exemplary wireless communication system in accordance with one embodiment . exemplary wireless communication system 100 shown in fig1 can comprise , for example , part of a code division multiple access (“ cdma ”) communication system . alternatively , system 100 can be a frequency division multiple access (“ fdma ”) system , a time division multiple access (“ tdma ”) system , a wideband code division multiple access (“ wcdma ”), a high data rate (“ hdr ”) system , or in general any wireless communication system employing a combination of cdma , tdma , and / or fdma techniques . by way of a specific example , the present invention is discussed in relation to a cdma communication system . however , it is understood that the invention can be used in other communications systems as stated above . the general principles of cdma communication systems , and in particular the general principles for generation of spread spectrum signals for transmission over a communication channel is described in u . s . pat . no . 4 , 901 , 307 entitled “ spread spectrum multiple access communication system using satellite or terrestrial repeaters ” and assigned to the assignee of the present invention . the disclosure in that parent , i . e . u . s . pat . no . 4 , 901 , 307 , is hereby fully incorporated by reference into the present application . moreover , u . s . pat . no . 5 , 103 , 459 entitled “ system and method for generating signal waveforms in a cdma cellular telephone system ” and assigned to the assignee of the present invention , discloses principles related to pn spreading , walsh covering , and techniques to generate cdma spread spectrum communication signals . the disclosure in that patent , i . e . u . s . pat . no . 5 , 103 , 459 , is also hereby fully incorporated by reference into the present application . further , the present invention utilizes time multiplexing of data and various principles related to “ high data rate ” communication systems , and the present invention can be used in “ high data rate ” communication systems , such as that disclosed in u . s . patent application entitled “ method and apparatus for high rate packet data transmission ” ser . no . 08 / 963 , 386 filed on nov . 3 , 1997 , and assigned to the assignee of the present invention . the disclosure in that patent application is also hereby fully incorporated by reference into the present application . continuing with fig1 exemplary wireless communication system 100 , which can be a cdma communication system , comprises components typically found in wireless communication systems , including a wireless access terminal such as wireless modem 110 , base transceiver station (“ bts ”) 134 , base station controller (“ bsc ”) 136 , mobile switching center (“ msc ”) 138 , public switched telephone network (“ pstn ”) 140 , and internet service provider (“ isp ”) 142 . in wireless communication system 100 , bts 134 , which is also referred to as a “ base station ” in the present application , serves as a radio link between the wireless access terminal , e . g . wireless modem 110 , and the rest of the system . as illustrated in fig1 bts 134 comprises vertically polarized bts antenna 130 , which is configured to transmit and receive vertically polarized radio signals , and horizontally polarized bts antenna 132 , which is configured to transmit and receive horizontally polarized radio signals . by way of background , a vertically polarized antenna , such as vertically polarized bts antenna 130 , has an electric field perpendicular to the earth &# 39 ; s surface while a horizontally polarized antenna , such as horizontally polarized bts antenna 132 , has an electric field parallel to the earth &# 39 ; s surface . in a different embodiment , bts 134 can comprise a right hand circular polarized antenna and a left hand circular polarized antenna configured to transmit and receive circular polarized radio signals . by way of background , in a circular polarized antenna , the plane of polarization rotates in a circle , making one complete revolution during one period of the radio wave . if the rotation is clockwise looking in the direction of propagation , the sense is called right hand circular . if the rotation is counterclockwise , the sense is called left hand circular . referring back to fig1 connections between bts 134 , bsc 136 , msc 138 , pstn 140 , and isp 142 can be wired , wireless , or both . wireless modem 110 in fig1 includes , among other components which are not shown in fig1 central processing unit (“ cpu ”) 112 , read only memory module (“ rom ”) 114 , flash memory module 116 , random access memory module (“ ram ”) 118 , and transmitter and receiver 120 . as shown in fig1 bus 122 couples cpu 112 , rom 114 , flash memory module 116 , ram 118 , and transmitter and receiver 120 . in accordance with one embodiment , wireless modem 110 comprises vertically polarized modem antenna 124 and horizontally polarized modem antenna 126 . vertically polarized modem antenna 124 is configured to receive and transmit vertically polarized radio signals , and horizontally polarized modem antenna 126 is configured to receive and transmit horizontally polarized radio signals . in a different embodiment , wireless modem 110 can comprise a right hand circular polarized antenna and a left hand circular polarized antenna configured to receive and transmit circular polarized radio signals . it is noted that wireless modem 110 is also referred to as a “ polarized reception system ” in the present application . in accordance with the present embodiment , communication between wireless modem 110 and bts 134 is achieved by the transmission and reception of polarized radio signals . for example , bts 134 can communicate with wireless modem 110 by using vertically polarized bts antenna 130 to transmit vertically polarized radio signals that are received by vertically polarized modem antenna 124 . similarly , communication between wireless modem 110 and bts 134 could involve horizontally polarized bts antenna 132 transmitting a horizontally polarized radio signal that is received by horizontally polarized modem antenna 126 . continuing with fig1 pstn 140 refers to a conventional wireline telephone network , and isp 142 refers to services providing access to the internet . data and voice information provided by isp 142 and pstn 140 can be communicated to wireless modem 110 by being routed through msc 138 , bsc 136 , and bts 134 . msc 138 functions generally as a switch between the wireless network and pstn 140 and isp 142 , while the role of bsc 136 , among others , is to manage the signal transmission power of bts 134 . for example , internet data can be communicated to wireless modem 110 by being routed from isp 142 through msc 138 , bsc 136 , and to bts 134 in order for bts 134 to transmit the data to wireless modem 110 as radio frequency signals on both vertically polarized bts antenna 130 and horizontally polarized bts antenna 132 in a manner known in the art . bts 134 can , for example , transmit radio frequency signals as vertically polarized radio signals transmitted by vertically polarized bts antenna 130 that are generally received by vertically polarized modem antenna 124 . the radio frequency signals are demodulated by transmitter and receiver 120 and the information extracted at wireless modem 110 . communication between isp 142 and wireless modem 110 is thereby completed . thus , fig1 shows a block diagram of an exemplary wireless communication system in which communication between a base transceiver station and a wireless modem is accomplished by means of polarized radio signals . [ 0022 ] fig2 illustrates a two cell array in a wireless communication system in accordance with one embodiment . cell array 200 shown in fig2 comprises a geographical region in a wireless communication system , which can be , for example , a cdma communication system . cell array 200 comprises cell 210 and cell 240 which are defined by solid lines and shown as hexagons in fig2 . in the present embodiment , cell 210 is divided into six sectors , which are sector 214 , sector 216 , sector 218 , sector 220 , sector 222 , and sector 224 . sectors 214 , 216 , 218 , 220 , 222 , and 224 are defined by dashed lines in fig2 . similarly , cell 240 comprises six sectors , which are sectors 244 , 246 , 248 , 250 , 252 , and 254 which are also defined by dashed lines . it is noted that an article entitled “ smart antennas for broadband wireless access networks ,” authored by khurram sheikh , david gesbert , dhananjay gore , and arogyaswami paulraj , published in the november 1999 issue of ieee communications magazine , pages 100 through 105 , discusses vertically polarized and horizontally polarized signals in adjacent sectors of a cell . however , the article does not disclose or suggest how an access terminal may take advantage of such differently polarized signals in adjacent sectors . referring again to fig2 cell 210 of cell array 200 comprises base transceiver station (“ bts ”) 230 positioned at the center of cell 210 . in accordance with the present embodiment , bts 230 is equipped with vertically polarized bts antenna 232 and horizontally polarized bts antenna 234 . vertically polarized bts antenna 232 is configured to transmit and receive vertically polarized radio signals , and horizontally polarized bts antenna 234 is configured to transmit and receive horizontally polarized radio signals . utilizing vertically polarized bts antenna 232 and horizontally polarized bts antenna 234 , bts 230 can communicate with wireless access terminals in cell array 200 using polarized radio signals . wireless access terminals are not shown in fig2 but can be , for example , a wireless modem such as wireless modem 110 shown in fig1 . in accordance with one embodiment , bts 230 is a sectorized base transceiver station . bts 230 continuously broadcasts a pilot signal in each sector of cell 210 on the polarization designated for that particular sector . bts 230 utilizes vertically polarized bts antenna 232 to transmit vertically polarized pilot signals to sectors 216 , 220 and 224 and utilizes horizontally polarized bts antenna 234 to transmit horizontally polarized pilot signals to sectors 214 , 218 and 222 . by way of background , data from bts 230 is transmitted in frames where each data frame contains an initial pilot sequence as well as a subsequent message data sequence . as an example , the initial pilot sequence may take up approximately 5 % of the entire data frame . the pilot sequence is generally a known data sequence recognizable to a receiving wireless access terminal . a receiving wireless access terminal can use the data sequence contained in a pilot signal to identify the particular sector and base transceiver station transmitting the particular pilot signal . a wireless access terminal such as wireless modem 110 in fig1 equipped with both vertically and horizontally polarized antennas would have the capability to receive both vertically and horizontally polarized pilot signals transmitted by bts 230 . continuing with fig2 cell 240 is organized similarly to cell 210 . base transceiver station 260 (“ bts 260 ”) is situated at the center of cell 210 and comprises vertically polarized bts antenna 262 and horizontally polarized bts antenna 264 which are configured to transmit and receive , respectively , vertically and horizontally polarized radio signals . bts 260 is a sectorized base transceiver station which continuously broadcasts a pilot signal to each sector of cell 240 on the polarization assigned to that sector . bts 260 utilizes vertically polarized bts antenna 262 to transmit vertically polarized pilot signals to sectors 244 , 248 and 252 and utilizes horizontally polarized bts antenna 264 to transmit horizontally polarized pilot signals to sectors 246 , 250 and 254 . the pilot signals transmitted by bts 260 can be received by wireless access terminals in cell array 200 equipped with vertically and horizontally polarized antennas . a wireless access terminal can use , for example , the unique data sequence contained in the pilot signals it receives to identify a particular sector and base transceiver station transmitting a particular pilot signal . it is noted that even though cells 210 and 240 and their sectors have been shown in fig2 as discretely defined areas , a person skilled in the art would appreciate that the radio frequency coverage area for a cell or sector commonly overlaps into adjacent cells and / or sectors . therefore , a wireless access terminal , particularly one situated near the boundaries between adjacent cells and / or sectors , may receive signals from different cells and sectors . fig2 thus illustrates a two cell array in an exemplary communication system wherein base transceiver stations situated at the center of the cells are equipped with polarized antennas to transmit polarized pilot signals in each sector . in one embodiment , the pilot signals are received by wireless access terminals which utilize a unique data sequence contained in the pilot signals in order to identify the particular sector and base transceiver station transmitting the pilot signal . referring to fig3 flow chart 300 illustrates an example method for selecting a pilot signal having a highest signal to interference ratio in accordance with one embodiment . the signal to interference ratio is a quantification of the power of the desired signal to interference signals . the signal to interference ratio therefore indicates the signal quality of the received data signal . the process illustrated in flow chart 300 in fig3 describes the process as performed by a wireless access terminal in a wireless communication system , which can be , for example , a cdma communication system . for illustrative purposes , the process shown in flow chart 300 is described in the context of wireless modem 110 in fig1 and exemplary cell array 200 in fig2 . as such , it is manifest that the process illustrated in flow chart 300 can be practiced by an access terminal other than wireless modem 110 and in a wireless environment other than cell array 200 . flow chart 300 illustrates the process of selecting a pilot signal having a highest signal to interference ratio beginning at step 302 . the process continues at step 304 where a wireless access terminal using a vertically polarized antenna receives vertically polarized pilot signals transmitted by base transceiver stations situated throughout the wireless communication system . for example , wireless modem 110 can use vertically polarized modem antenna 124 to receive vertically polarized pilot signals transmitted by vertically polarized bts antenna 232 and vertically polarized bts antenna 262 . as discussed above , because signals in one sector or cell commonly overlap into nearby cells and sectors , vertically polarized modem antenna 124 may receive vertically polarized pilot signals transmitted throughout cell array 200 , i . e . vertically polarized pilot signals transmitted by both vertically polarized bts antenna 232 and vertically polarized bts antenna 262 . at the same time , vertically polarized modem antenna 124 may not receive all of the vertically polarized pilot signals transmitted by vertically polarized bts antenna 232 and vertically polarized bts antenna 262 , depending on , for example , the power of the transmission , as well as the distance and terrain between vertically polarized modem antenna 124 and vertically polarized bts antennas 232 and 262 . as is known in the art , radio signals lose their power over distance and can also be reflected by obstacles such as hills , buildings , and trees in their paths . thus , when the radio signals containing the pilot signals reach vertically polarized modem antenna 124 , some of the pilot signals may be too weak to be received . furthermore , because the various pilot signals travel different paths to reach wireless modem 110 , vertically polarized modem antenna 124 receives the various pilot signals at different reception power or signal to interference ratios . once the pilot signals are received by wireless modem 110 , they can be demodulated by a receiver module in transmitter and receiver 120 in order to extract the information in the pilot signals . the information signal can comprise , for example , a data sequence which identifies the base transceiver station and the sector transmitting the pilot signals . the steps involved in the demodulation of radio signals is generally known in the art . at step 306 , the vertically polarized pilot signals received by vertically polarized modem antenna 124 at wireless modem 110 are ranked by their signal to interference ratios . ranking of vertically polarized pilot signals by their signal to interference ratios involves measuring the signal quality of each pilot signal received , comparing the signal quality of the pilot signals to one another , and ordering the pilot signals by their signal to interference ratios . ranking of vertically polarized pilot signals by their signal to interference ratio can be performed , for example , by software running on cpu 112 . the ranking can be stored , for example , in flash memory 116 . continuing with flow chart 300 , at step 308 , wireless modem 110 switches from vertically polarized modem antenna 124 to horizontally polarized modem antenna 126 in order to receive horizontally polarized pilot signals . the horizontally polarized pilot signals are transmitted continuously by horizontally polarized bts antennas 234 and 264 in cell array 200 . and because radio signals can overlap into nearby cells and sectors , as discussed above , horizontally polarized modem antenna 126 may receive horizontally polarized pilot signals form throughout cell array 200 . the horizontally polarized pilot signals are received by horizontally polarized modem antenna 126 at different signal to interference ratios , depending on , for example , the distance and type of terrain between horizontally polarized modem antenna 126 and the horizontally polarized bts antennas transmitting the pilot signals . at step 310 , the horizontally polarized pilot signals received by horizontally polarized modem antenna 126 are ranked by their signal to interference ratios . as with ranking of vertically polarized pilot signals at step 306 , the ranking of horizontally polarized pilot signals can involve , for example , measuring the signal quality of each pilot signal , comparing the signal quality of the pilot signals , and ordering the pilot signals in sequence of their signal to interference ratios . ranking horizontally polarized pilot signals by their signal to interference ratio can be performed , for example , by software running on cpu 112 . the ranking can be stored , for example , in flash memory 116 . at step 312 , the ranking of vertically polarized pilot signals is compared to the ranking of horizontally polarized pilot signals . by comparing the two groups of rankings , the pilot signal having the highest signal to interference ratio overall can be selected . the signal to interference ratio for a pilot signal indicates the signal quality of the initial pilot sequence in a data frame as well as the signal quality of the message data sequence in the data frame received from the base transceiver station on the particular sector transmitting the pilot signal . the operation for selecting a pilot signal having the highest signal to interference ratio then ends at step 314 . after the pilot signal having the highest signal to interference ratio has been selected , wireless modem 110 uses the information contained in the pilot signal to identify and select the sector and base transceiver station transmitting the pilot signal . wireless modem 110 sends an identification signal (“ id signal ”) to the base transceiver station transmitting the pilot signal . the id signal can be , for example , an electronic serial number unique to wireless modem 110 which identifies wireless modem 110 to the base transceiver station . the id signal informs the particular base transceiver station that wireless modem 110 has selected to communicate with that station on the particular sector which wireless modem 110 has determined to have the highest signal quality . it is noted that the id signal is also referred to as a “ sector identification ” in the present application . communications between wireless modem 110 and the selected base transceiver station on the selected sector are then performed using the same polarization as the polarization of the pilot signal having the highest signal to interference ratio . thus , flow chart 300 in fig3 illustrates a process for selecting a pilot signal having the highest signal to interference ratio and communicating with the sector and base transceiver station transmitting the pilot signal having the highest signal to interference ratio so as to improve signal reception quality in accordance with one embodiment . the steps shown in flow chart 300 to receive and rank pilot signals , and thereafter communicate with a selected base station on a sector having the highest quality signal are repeated periodically , such as every few days . the reason is that due to terrain changes , for example changes in the configuration of obstacles such as buildings and trees in the signal path , it is necessary to periodically determine whether a different base transceiver station and / or a different sector should be used for communication with wireless modem 110 . it is noted that although the present example uses the signal to interference ratio as the signal quality measurement for ranking and selecting pilot signals , it is manifest that other signal quality measurements can be used . for example , a signal to noise ratio measurement can also be used . it is also noted that although the present application was discussed in relation to vertically polarized and horizontally polarized signals , the invention can also be used with right hand circular polarized and left hand circular polarized signals . in another embodiment which is not illustrated in any of the figures in the present application , a wireless access terminal , such as wireless modem 110 , utilizes the process set forth in fig3 to receive and select a polarized pilot signal having a highest signal to interference ratio . subsequently , the wireless access terminal communicates with a number of sectors corresponding to one or more base transceiver stations on the same polarization as the polarization of the pilot signal providing the highest signal to interference ratio . each of the sectors of the one or more base transceiver stations would be configured to transmit on the same polarization as the polarization of the pilot signal . for example , if the pilot signal having the highest signal to interference ratio is received on a vertically polarized antenna , the wireless access terminal would communicate with a number of “ vertically polarized sectors ” in one or more base transceiver stations by means of vertically polarized radio signals . in this embodiment , the vertically polarized signals from the base transceiver stations are received and then combined to generate diversity . in its various embodiments , the present invention is a system and method for “ polarization reuse .” as discussed in the present application , polarization reuse involves allocating orthogonal polarizations to adjacent sectors , rather than allocating different frequencies to adjacent sectors . using the polarization reuse system and method described above , interference between various sectors is reduced because their signals are polarized perpendicularly to one another . one advantage of polarization reuse described above is that it increases the overall system capacity without requiring the allocation of more frequencies . those of skill in the art would understand that information and signals may be represented using any of a variety of different technologies and techniques . for example , data , instructions , commands , information , signals , bits , symbols , and chips that may be referenced throughout the above description may be represented by voltages , currents , electromagnetic waves , magnetic fields or particles , optical fields or particles , or any combination thereof . those of skill would further appreciate that the various illustrative logical blocks , modules , circuits , and algorithm steps described in connection with the embodiments disclosed herein may be implemented as electronic hardware , computer software , or combinations of both . to clearly illustrate this interchangeability of hardware and software , various illustrative components , blocks , modules , circuits , and steps have been described above generally in terms of their functionality . whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system . skilled artisans may implement the described functionality in varying ways for each particular application , but such implementation decisions should not be interpreted as causing a departure from the scope of the present invention . the various illustrative logical blocks , modules , and circuits described in connection with the embodiments disclosed herein may be implemented or performed with a general purpose processor , a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ) or other programmable logic device , discrete gate or transistor logic , discrete hardware components , or any combination thereof designed to perform the functions described herein . a general purpose processor may be a microprocessor , but in the alternative , the processor may be any conventional processor , controller , microcontroller , or state machine . a processor may also be implemented as a combination of computing devices , e . g ., a combination of a dsp and a microprocessor , a plurality of microprocessors , one or more microprocessors in conjunction with a dsp core , or any other such configuration . the steps of a method or algorithm described in connection with the embodiments disclosed herein may be embodied directly in hardware , in a software module executed by a processor , or in a combination of the two . a software module may reside in ram memory , flash memory , rom memory , eprom memory , eeprom memory , registers , hard disk , a removable disk , a cd - rom , or any other form of storage medium known in the art . an exemplary storage medium is coupled to the processor such that the processor can read information from , and write information to , the storage medium . in the alternative , the storage medium may be integral to the processor . the processor and the storage medium may reside in an application specific integrated circuit (“ asic ”). the asic may reside in a wireless modem . in the alternative , the processor and the storage medium may reside as discrete components in the wireless modem . the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . for example , in the embodiment of the invention described above , the access terminal , i . e . wireless modem 110 , has a single receiver . in this embodiment , a single receiver within transmitter and receiver module 120 must be switched between the different wireless modem antennas , such as vertically polarized antenna 124 and horizontally polarized antenna 126 , so that wireless modem 110 can receive and rank the highest signal to interference ratio as described above . in an alternative embodiment , the access terminal would have a dedicated receiver for each antenna . in that embodiment , the dedicated receivers are not switched between the various antennas of the access terminal . it is noted that in one embodiment , the polarization reuse technique of the present invention can be employed in addition to the conventional frequency reuse . it is also noted that the invention can be used in a mimo (“ multiple input multiple output ”) system where multiple transmit antennas and multiple receive antennas are used by the communication channel to carry multiple streams of user data . therefore , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . thus , method and system for utilizing polarization reuse in wireless communications have been described . | 7 |
as used herein in the specification and claims , the terms &# 34 ; hydrogel &# 34 ; and &# 34 ; polymer hydrogel &# 34 ; are each intended to refer to a shaped hydrophilic polymer , e . g . a hydrophilic polymer lens , which contains imbibed water in an amount ranging generally from less than one percent to 90 percent by weight of the shaped polyer . however , it is well recognized that to be completely comfortable to the eye , soft contact lenses for practical application normally contain at least about 25 percent , preferably about 30 percent water , and still more preferably about 35 percent water , by weight . accordingly , polymer hydrogels employed herein in preferred embodiments of the process of this invention are those containing at least about 25 percent water , by weight . in general , any polymer hydrogel which contains a polar functional group capable of reacting with an appropriate functional group of the modifying compound as defined hereinafter may be successfully treated in accordance with this invention . however , the acrylic hydrogels which contain polar functional ester groups currently enjoy the most widespread commercial acceptance . accordingly , in the description of the invention which follows , specific reference will be made paticularly to acrylic ester hydrogels . the preparation of methanol - insoluble acrylic ester hydrophilic polymers by copolymerizing , for example , hydroxyethyl methacrylate and ethylene glycol dimethacrylate has long been known , being described in the aforementioned u . s . pat nos . 2 , 976 , 576 and 3 , 220 , 960 . the later patents directed to various modifications of the foregoing basic copolymers include among others , copolymers of the hydroxyalkyl methacrylates with vinyl pyrrolidone as described , for example , in a series of u . s . patents beginning with u . s . pat . no . 3 , 503 , 942 to seiderman . it is to be understood , however , that while many hydrophilic polymers adapted for the preparation of soft contact lenses contain suitable polar functional groups and thus may be successfully treated in accordance with this invention , neither said hydrophilic polymers per se nor their preparation and / or fabrication into lenses constitute a part of this invention . to effect the desired structural modification of the polymer hydrogel , a compound having at least one , and preferably two appropriate functional groups is employed . suitable such compounds include , for example , mono - and poly - ureas and their corresponding thiourea analogs , diepoxides , aldehydes and dialdehydes , aminoalcohols , aliphatic diols and dithiols , arylene mono - and dihalides , and aliphatic amines , as well as other functional compounds which will be easily recognized as suitable for use herein by those skilled in the art . in treating acrylic ester hydrogels , aminoalcohols as well as the amines are presently preferred because of the comparatively stable modifying linkages formed between polymer and amine functional groups . amines which are suitable may be either monoamines or polyamines wherein the organic moiety contains 2 - 12 carbon atoms . preferably , these compounds have no other functional group . particular polyamines suitable herein are those of the ethyleneamine series , e . g ., ethylenediamine , diethylenetriamine , tri - ethylenetetramine , tetraethylenepentamine or pentaethylenehexamine ; and commercially available higher homolors of the aforesaid ethyleneamines such as propylenediamine ( or 1 , 2 - tropanediamine ), 1 , 3 - diaminopropane , tetramethylenediamine , hexamethylenediamine and the like . because of its bifunctionality and comparatively high reactivity , ethylenediamine is presently preferred for use herein . for this reason and also for purposes of convenience , specific reference will be made hereinafter to ethylenediamine . such specific reference , however , is not to be construed in any way as limiting the invention to the use of only this particular amine . aminoalcohols which are suitable are monoamine derivatives of c 2 - c 6 aliphatic alcohols with boiling points above 100 ° c . specific aminoalcohol compounds are 2 - aminoethanol ; 3 - amino - 1 - propanol ; 4 - amino - 1 - butanol ; and 6 - amino - 1 - hexanol , with 2 - aminoethanol ( also designated as ethanolamine ) presently preferred . in general , from 0 . 001 to 0 . 5 weight percent of aminoalcohol will be incorporated in the process , by weight of the polymer . as described previously , the process of this invention comprises contacting a polymer hydrogel with any one of the aforesaid modifying compounds , e . g . an amine , for a sufficient period of time to effect the desired modification of the polymer . as indicated earlier , it is preferable to employ a hydrogel which contains at least about 25 percent water , by weight . it is nevertheless possible to effect the modifying treatment satisfactorily employing a hydrogel with a water content substantially less than 25 percent , by weight , i . e . about 10 percent , by weight . however , since the hydrogel inherently becomes significantly embrittled during treatment due to water loss , use of such a slightly hydrated polymer may not consistently provide a strong , coherent , uncrazed modified lens material . to carry out the process , the soft contact lens material is simply immersed and maintained in the selected compound at a temperature ranging generally from room temperature to about 100 ° c . for a time period ranging from about 5 minutes to about 3 hours . it is to be understood , of course , that for any particular modifying treatment , the most satisfactory reaction time generally will be inversely proportional to the temperature , i . e ., the time required to effect the desired degree of modification typically will be shorter as the reaction temperature is increased . particularly satisfactory results are obtained employing reaction temperatures of 40 ° - 70 ° c . for 1 - 3 hours . when using ethylenediamine , optimum results presently are obtained employing a temperature of 60 ° c . for a time period of about 2 hours . in preferred embodiments of this invention employing amines as modifiers , the proportion of amine used to polymer material is not especially critical . use of excessive amine is advantageous , however , to ensure the desired reaction in the shortest possible time . likewise , it is preferred to employ undiluted amine , although aqueous solutions which contain at least about 15 parts , by volume , of aine per part of water may optionally be used . while we do not wish to be bound by any particular theory , polymer modification presently is believed to be effected in the process of this invention by the attachment of functional groups supplied by the modifying compound onto the polymeric chains . in particular , when an acrylic ester hydrogel is treated with an amine under the prescribed reaction conditions , it is believed that preferentially an ester - amine interchange reaction occurs , forming covalent c - n linkages in the polymer structure . this belief is derived from studies of the treated polymers which indicate that the polymer has been modified permanently in the reaction , as through such stable linkages . modification alternatively through hydrogen bonding , on the other hand , would provide primarily unstable linkages and no permanent modification of the polymer . upon completion of the modification reaction herein , the treated polymer lens material is removed from the modifying compound , e . g . an amine , and rinsed well with water , one percent ( physiological ) saline solution or the like . it is then normally equilibrated for at least 12 hours in the saline solution ( ph - 7 . 4 ), whereupon the polymer material typically regains any flexibility lost during the modifying treatment . when employing amines as modifying chemicals , the equilibrated polymer finally is soaked in a suitable medium , e . g ., water or simulated human tear solution ( at physiological ph ), until no more detectable amine is leached therefrom . it can readily be understood that the aforesaid lens leaching process is necessary to remove therefrom any unreacted or residual amine which may be irritating or damaging to the eye . that the process of this invention does indeed modify the surface of the lens material is substantiated by leaching studies of polymer materials treated with radioactive amines , as shown hereinafter by specific examples . the improved ability of the modified polymer to inhibit the diffusion of e . g . proteins and bacteria compared to untreated lens materials likewise may be indicated by protein diffusion studies carried out by prolonged soaking of treated lenses in simulated human tear solution or other suitable media containing labeled enzymes and / or proteins . by significantly inhibiting the transmission of opacifying and / or discoloring substances into soft contact lens materials , the process of this invention provides lens products which are greatly improved over those presently available . the treated products of this invention remain clear , transparent , and optically beneficial to the wearer for a longer period of time than is possible with presently used lenses and , accordingly , need be replaced much less often . likewise , the modified lens products of this invention appear to retain water during use more efficiently than presently used lenses , thereby being extremely resistant to shrinkage or other dimensional change and providing optimum optical acuity to the wearer . for a fuller understanding of the nature and objects of this invention , the following specific examples are given . these examples are intended merely to illustrate the invention and are not to be construed in a limiting sense . all percentages , proportions and quantities given in these examples are by weight , unless otherwise indicated . an acrylic ester polymer hydrogel is prepared by first mixing together in 15 ml ethylene glycol as solvent , 15 ml of a monomer mixture containing , by weight , 95 % hydroxyethyl methacrylate ( hema ) and 5 % ethylene glycol dimethacrylate , with 0 . 05 ml of a 6 % aqueous solution of ammonium persulfate and 0 . 05 ml of a 12 % aqueous sodium meta - bisulfite . the resulting mixture is placed in a glass plate to a height of 0 . 009 cm . the plate is sealed with another plate and placed in a vacuum oven wherein copolymerization is conducted at approximately 70 ° c . for 12 hours . upon cooling , the resulting hema polymer film is removed , weighed and then soaked in physiological saline solution for 15 hours . reweighing of the surface - dried film determines that it has absorbed 36 . 0 % water , comparable to the percentage of water absorbed by a commercially available hema polymer soft contact lens similarly tested . radioactive ethylenediamine is prepared by dissolving 300μ ci 14 c - ethylenediamine in 50 ml of non - labeled ethylenediamine . the hema hydrogel lens material prepared in example 1 is cut into samples , 1 . 27 cm square , which are then immersed in 50 ml of the radioactive ethylenediamine solution for 2 hours at room temperature . the clear , transparent treated lens samples are removed and washed in distilled water for 30 minutes , after which they are equilibrated in 1 % saline solution for approximately 15 hours . comparatively brittle after the ethylenediamine treatment , the lens samples become flexible again upon equilibration . the equilibrated samples are placed in scintillation fluid for counting of labeled ethylenediamine . an average of 831 disintegrations per minute ( dpm ) corrected for background and quenching efficiency is obtained , indicating that some reaction has taken place and the diamine has been incorporated within the polymer . this example illustrates that diamine has been chemically bound in the polymer lens material by the process of the invention . a simulated human tear solution ( physiological ph ) is prepared with contains the following ingredients for each 100 ml of aqueous solution : the equilibrated lens samples are individually placed in separate vials each containing 2 . 5 ml of the tear solution . the vials are then positioned and maintained on a shaker apparatus in a water bath for 24 hours at 37 ° c . at the end of this time period , the lens samples are removed from the sample vials , and successively cleaned in commercial lens cleaning solution and sterilized with boiling in saline solution for 20 minutes in the manner normally performed daily by a contact lens wearer . some of these sterilized samples are placed in scintillation fluid and counted for labeled carbon content . the remaining sterilized lens samples are placed in fresh 2 . 5 ml portions of the tear solution and the aforedescribed storage procedure at 37 ° c . for 24 hours is repeated , followed by cleaning and sterilization of the lens samples and labeled carbon counts of some of these . this same procedure is carried out for at least 40 days , employing fresh tear solution in each leaching cycle , while cleaning and sterilizing the lens samples after each cycle . using this procedure , remaining 14 c - ethylenediamine in the lens samples is counted with the following results : table 1______________________________________no . of days in average . sup . 14 carbon counttear solution in lens sample ( dpm )* ______________________________________1 2252 1503 784 625 5410 5115 3720 3540 36______________________________________ * dpm = disintegrations per minute the above results indicate that a major portion of unreacted free diamine is removed from the lens samples with soaking in saline solution for up to 48 hours . thereafter , any remaining extractable amine is removed slowly by leaching the lens material over a period of 12 - 13 days . after a total of 15 days leaching , the average 14 c - ethylenediamine content of the lens samples is 35 dpm / lens , which count then remains constant with continued leaching for 24 additional days . this count represents the amount of diamine permanently bound in the lens material . a lightly cross - linked hydrophilic hema polymer is prepared in a series of experiments conducted as outlined generally in example 1 above . in these reactions , however , the monomer mixture used contains 15 ml of 99 % hydroxyethyl methacrylate and 1 . 5 ml of ethylene glycol dimethacrylate . the redox initiator requirement in each instance is supplied by 0 . 2 ml each of the ammonium persulfate and sodium metabisulfite solutions described in example 1 . each copolymerization reaction is conducted for 7 hours at 65 °- 75 ° c . after being successively dried for 2 hours at 45 ° c ., tared and then equilibrated in saline solution for 15 hours , the prepared hydrophilic polymer converts to a polymer hydrogel , absorbing 35 . 9 % water . a commercial soft contact lens ( soflens , a hema - type polymer lens manufactured by bausch and lomb , inc .) is similarly dried , tared and equilibrated in saline solution to determine the amount of water incorporated in the commercial soft contact lens . this lens material is found to absorb 37 . 3 % water , similar to the amount absorbed by the polymer hydrogel of this example . following the general procedures as outlined in example 2 above , samples of the hema polymer hydrogels of example 4 are immersed in the radioactive ethylenediamine solution for varying times at different temperatures . after treatment , 14 c - ethylenediamine counts are determined for samples of the treated lens materials after being equilibrated and boiled in saline solution for 2 hours . results obtained are as follows : table 2______________________________________ . sup . 14 c - amine treatment average . sup . 14 carbon counttemperature time ( min .) in lens sample ( dpm )* ______________________________________40 30 20 , 338 60 31 , 019 120 56 , 08260 30 40 , 810 60 52 , 316 120 70 , 76070 30 42 , 432 120 29 , 394______________________________________ * as described previously the treated lens samples are then subjected to extended leaching in simulated tear solution as described in example 3 . throughout the leaching period , aliquots of the tear solution are counted daily along with periodic counting of the lens material . after 15 days leaching , 14 c - ethylenediamine counts on the lens materials are as follows : table 3______________________________________ . sup . 14 c - amine treatment average . sup . 14 carbon counttemperature time ( min .) in leached lens sample ( dpm ) ______________________________________40 30 50 60 68 120 6860 30 88 60 71 120 15070 30 140 120 34______________________________________ the foregoing results indicate that the polymer truly becomes modified by the amine treatment , and further , that the greatest degree of modification appears effected with amine treatment at 60 ° c . for approximately 2 hours . an acrylic ester hydrogel lens material is cut into samples , 1 . 27 cm square . these are immersed for 3 hours in labeled 2 - aminoethanol ( ethanolamine ) maintained at 60 ° c . at the end of this time period , the films , which are somewhat brittle , are rinsed with distilled water and equilibrated in physiological saline solution for 4 hours . replicate equilibrated samples are placed in scintillation fluid for counting of the 14 c - ethanolamine . the average count obtained is 267 , 780 dpm corrected for background and quenching efficiency , employing counts of replicate untreated lens samples as controls . the remaining equilibrated lens specimens are individually placed in separate vials , each containing 2 . 5 ml . of the simulated tear solution described in example 3 . the vials are then positioned and maintained at 37 ° c . on a shaker apparatus in a water bath for 20 days . at the end of each 24 hour storage period , the samples are removed , boiled in saline solution , and placed in fresh tear solution . after 20 days leaching , the average 14 carbon count in the lens sample is 101 dpm , equivalent to 0 . 00095 weight percent of incorporated 2 - aminoethanol , by weight of the polymer . samples of acrylic ester hydrogel a ( containing 35 . 0 % water , by weight ) are immersed in separate containers which contain 50 ml . of 4 - amino - 1 - butanol or 6 - amino - 1 - hexanol . other hydrogel samples which have been heated at 60 ° c . for 40 minutes and contain less than 25 % water , by weight , ( hydrogel b ) are likewise immersed in separate containers of the specified aminoalcohols . all of the sample containers are then maintained at 60 ° c . for 120 minutes . after treatment , the lens samples are removed , washed in distilled water for 30 minutes , and then equilibrated by immersion in physiological saline solution for approximately 15 hours . they are then sterilized in boiling saline solution for 20 minutes . untreated lens samples are likewise sterilized as a control . the sterilized treated samples and the untreated controls are stored in fresh tear solution , being removed daily and successively cleaned in commercial lens cleaning solution and sterilized in boiling saline solution for 20 minutes in the manner normally performed by a contact lens wearer . after being thus leached for 25 days , the treated lens samples are immersed in labeled fluorescein dye for 2 minutes , then washed with distilled water , and finally placed in scintillation fluid and counted for labeled dye content , as a measure of dye absorption by the lenses . results are as follows : table 4______________________________________ labeled dye dpm . sup . 1modifying compound hydrogel a hydrogel b______________________________________untreated lens . sup . 2 2324 22854 - amino - 1 - butanol 1105 11156 - amino - 1 - hexanol 1099 1285______________________________________ . sup . 1 disintegrations per minute ( average of at least 3 replicate . sup . 2 untreated lens immersed in dye and counted after storage in saline solution for 24 hours the above results indicate that the aminoalcohols tested significantly modify the polymer structure of the lens materials and increase their resistance to the absorption of clouding and / or coloring substances , by comparison to the untreated lenses . also , the lens materials with a higher degree of hydration appear to be somewhat more efficiently modified in the treatment than those with the lower degree of hydration . | 1 |
double bond - containing rubbers should , however , also be understood to mean rubbers which are m - rubbers in accordance with din / iso 1629 and , in addition to the saturated main chain , exhibit double bonds in side chains . these include , for example , epdm . crosslinked rubber particles ( b ), also called rubber gels or microgels , are described , for example , in u . s . ser . no . 5 , 124 , 408 , u . s . ser . no . 5 , 395 , 891 , de - a 19 726 729 and in the german patent application 19 701 487 . 9 . rubbers gels with functional groups with acidic hydrogen which react with alkoxysilanes or with isocyanates are preferred . preferred functional groups are hydroxyl groups , carboxyl groups , amino groups or amido groups . br —, nr —, nbr —, cr — and / or sbr - gels , which are optionally equipped with groups located on the surface of the gels and which are capable of reacting with the isocyanatosilanes , in particular , may be used . such groups are , for example , the above - mentioned functional groups . a rubber gel which is hydroxyl - modified may be used particularly advantageously , the acrylates and methacrylates of hydroxyethanol , hydroxypropanol and hydroxybutanol being used for the hydroxyl modification . the quantity of hydroxylation agent is 0 . 1 to 50 phr based on the unmodified rubber gel . 0 . 5 to 20 phr are particularly preferred . hydroxybutylacrylate in quantities of 0 . 5 to 20 phr is preferably used for the hydroxyl modification . the microgels have particle diameters of 5 to 1 , 000 nm , preferably 20 to 600 nm ( dvn value to din 53206 ). the diameters d 10 , d 50 and d 80 denote characteristic diameters in which 10 , 50 and 80 percent by weight of the respective sample have a diameter which is smaller than the corresponding characteristic diameter . owing to their crosslinking , the rubber gels are insoluble and can be swollen in suitable swelling agents such as toluene . the gel content of the rubber gels is ≧ 80 wt . % the swelling indices of the microgels ( si ) in toluene are 1 to 50 , preferably 1 to 20 . gel content and swelling index ( si ) of the rubber gels are determined by extracting the sample with toluene at ambient temperature . the gel content indicates the percentage by weight of the content which is deposited and can be separated in toluene with centrifugation at 20 , 000 rpm . the swelling index is calculated from the weight of the solvent - containing gel ( after centrifugation at 20 , 000 rpm ) and the weight of the dry gel : s i = weight of the sample swollen with toluene ( wet weight ) weight of the toluene - free sample ( dry weight ) 250 mg of gel are allowed to swell in 25 ml of toluene for 24 hours with shaking in order to determine the gel content and swelling index . the gel is centrifuged off and weighed and subsequently dried at 70 ° c . to constant weight and weighed again . the glass transition temperature ( tg ) of the rubber gels is between − 70 ° c . and + 10 ° c . it is determined by dsc ( differential scanning calorimetry ) ( for example pyris dsc - 7 calorimeter produced by perkin - elmer ). 11 . 6 + 0 . 3 mg of substance in normal capsules are used to determine tg . two heating operations of − 100 ° c . to + 150 ° c . in each case are carried out at a heating rate of 20 k / min and a cooling rate of 320 k / min while purging with nitrogen . the glass transition temperatures are determined during the second dsc heating operation . r 1 , r 2 and r 3 which may be the same or different represent alkoxy groups with 1 to 12 carbon atoms , preferably 1 to 8 carbon atoms and q represents a spacer group with structural elements based on aliphatic , heteroaliphatic , aromatic and heteroaromatic carbon chains . r 1 , r 2 and r 3 preferably represent methoxy , ethoxy , propoxy and butoxy groups and q preferably represents methyl , ethyl , propyl , butyl , pentyl and hexyl groups . this product is commercially available from witco , for example , under the name silquest ® a - 1310 silanes . the rubber mixtures according to the invention can also contain further components such as fillers . particularly suitable fillers for producing the rubber mixtures and vulcanisates according to the invention are : carbon blacks . the carbon blacks to be used in this case are produced by the lampblack , furnace or gas black processes and have bet surface areas of 20to 200 m 2 g , such as saf - isaf -, iisaf -, haf -, fef - or gpf - carbon blacks . highly dispersed silica , produced , for example , by precipitation of silicate solutions or flame hydrolysis of silicon halides with specific surface areas of 5 to 1 , 000 , preferably 20 to 400 m 2 / g ( bet surface area ) and primary particle sizes of 5 to 400 nm . the silicas can optionally also be mixed oxides with other metal oxides , such as al , mg , ca , ba , zn and ti oxides . synthetic silicates , such as aluminium silicate , alkaline earth silicate , such as magnesium silicate or calcium silicate with bet surface areas of 20 to 400 m 2 / g and primary particle diameters of 5 to 400 nm . thermoplastics with high melting point , such as trans - 1 , 4 - polybutadiene , syndiotactic 1 , 2 - polybutadiene , polybutylene and polyethylene terephthalate or syndiotactic polystyrene . thermoplastics with high glass transition temperature , such as polyamides , polyphenylene sulphide or polycarbonates . rubber gels based on cr , br , sbr or any other above - described gel particles which have a high degree of crosslinking and particle sizes of 5 to 1 , 000 nm . the above - mentioned fillers can be used alone or in a mixture . the quantity of fillers is normally 5 to 200 parts by weight , based on 100 parts by weight of rubber . in a particularly preferred embodiment of the process , 10 to 100 parts by weight of rubber gel ( b ) together with 0 . 1 to 100 parts by weight of carbon black and / or 0 . 1 to 100 parts by weight of light fillers , in each case based on 100 parts by weight of uncrosslinked rubber , are used . if a mixture of carbon black and light fillers is used the overall quantity is 100 parts by weight maximum . the rubber mixtures according to the invention can contain additional rubber auxiliary agents , such as crosslinking agents , reaction accelerators , antioxidants , heat stabilisers , light stabilisers , anti - ozonants , processing aids , plasticizers , tackifiers , blowing agents , dyes , pigments , wax , extenders , organic acids , retarders , metal oxides and filler activators , such as triethanolamine , polyethylene glycol , hexanetriol , bis -( triethoxysilylpropyl )- tetrasulphide or other auxiliary agents which are known in the rubber industry . the above - mentioned rubber auxiliary agents are used in conventional quantities which depend inter alia on the application . conventional quantities are , for example , quantities of 0 . 1 to 50 wt . %, based on quantities of rubber ( a ) used . crosslinking agents such as sulphur , sulphur donors , peroxides or crosslinking agents such as diisopropenylbenzene , divinylbenzene , divinylether , divinylsulphone , diallylphthalate , triallylcyanurate , triallylisocyanurate , 1 , 2 - polybutadiene , n , n ′- m - phenylene - maleimide and / or triallyltrimellitate can be used as additional auxiliary agents . the acrylates and methacrylates of polyhydric , preferably dihydric to tetrahydric c 2 to c 10 alcohols , such as ethylene glycol , propanediol - 1 , 2 - butanediol , hexanediol , polyethylene glycol with 2 to 20 , preferably 2 to 8 oxyethylene units , neopentylglycol , bisphenol a , glycerol , trimethylpropane , pentaerythritol , sorbitol with unsaturated polyesters of aliphatic di - and polyols and maleic acid , fumaric acid and / or itaconic acid are also considered . the quantity of crosslinking agent is generally 1 to 30 parts by weight , based on 100 parts by weight of the monomers . the rubber mixtures according to the invention can also contain vulcanisation accelerators . examples of suitable vulcanisation accelerators are , for example , mercaptobenzothiazoles , mercaptosulphenamides , guanidines , thiurams , dithiocarbamates , thioureas and thiocarbonates . the vulcanisation accelerators , crosslinking agents or additional crosslinking agents , such as dimeric 2 , 4 - toluylidene - di - isocyanate (= demodur tt ) or 1 , 4 - bis -( 2 - hydroxyethoxy ) benzene (= crosslinking agent 30 / 10 from rheinchemie ) are used in quantities of approximately 0 . 1 to 40 percent by weight , preferably 0 . 1 to 10 percent by weight , based on the total quantity of rubber . the rubber mixtures according to the invention can be vulcanised at temperatures of 100 to 250 ° c ., preferably 130 to 180 ° c ., optionally under pressure of 10 to 200 bar . the mixtures according to the invention can be produced in various ways . on the one hand it is of course possible to mix the solid individual components . mixing units suitable for this purpose are , for example , rollers , closed mixers or mixing extruders . mixing by combining the latices of the uncrosslinked or of the crosslinked rubbers is , however , also possible . the mixture according to the invention produced in this way can be isolated in a conventional manner by evaporation , precipitation or freezing coagulation ( cf . u . s . ser . no . 2 , 187 , 146 ). by mixing fillers into the latex mixture and subsequent working up , the mixtures according to the invention can be obtained directly as rubber / filler formulation . further mixing components are added to the rubber mixture consisting of double bond - containing rubber ( a ), rubber gel ( b ) and isocyanatosilane ( c ), such as additional fillers and optionally rubber auxiliary agents in conventional mixing units , rollers , closed mixers or mixing extruders . the mixing temperatures are approximately 50 to 180 ° c . the rubber mixtures according to the invention are suitable for producing vulcanised moulded articles , for example for producing cable sheaths , hoses , driving belts , conveyor belts , roller coverings , shoe soles , ring seals , cushioning elements or diaphragms and for various tire components , such as tire treads , sub - tread mixtures , carcasses or side wall inserts for tires with emergency running properties . gel 2 : production is as described in german patent application no . 19919459 . 9 , gel name i , wherein 1 . 5 phr dicumylperoxide is used for crosslinking ( see 1a ) “ crosslinking of the rubbers present in latex form ”). grafting with hydroxyethylmethacrylate is as described in 1b ) “ grafting of the rubbers present in latex form ”. stabilisation and working up of the hydroxyl - modified microgel is as described under item 1c ) “ stabilisation and working up of the hydroxyl - modified microgels ”. gel 3 : polymerisation of the br starting latex is as described in u . s . pat . no . 5 , 395 , 891 . crosslinking with dcp , grafting with hema and working up are described in the above - mentioned german application . gel 4 : gel 4 is produced in a similar way to gel 3 , hydroxybutylacrylate ( hba ) being used for the hydroxyl modification instead of hydroxyethylmethacrylate ( hema ). the effect according to the invention in an unmodified br gel ( gel 1 ) and in a hema - modified sbr rubber gel ( gel 2 ) is demonstrated in the first mixing run : for this purpose , the mixing components are mixed on the roller in the specified sequence and in accordance with the following formulations : the vulcanisation behaviour of the mixtures is investigated in the rheometer at 160 ° c . to din 53 529 . in this way characteristic data such as f a , f max , f max . − f a ., t 10 , t 80 and t 90 is determined : result : it is shown in the first mixing run that an improvement in the mechanical properties ( s 300 × d ) is achieved owing to the use of γ - isocyanatopropyltriethoxysilane both in a non - hydroxyl - modified br gel ( gel 1 ) and in a hydroxyl - modified sbr gel ( gel 2 ). the effect according to the invention in two hydroxyl group - containing br rubber gels is demonstrated in the second mixing run , gel 3 being modified with hema and gel 4 with hba . for this purpose , the mixing components are mixed on the roller in the specified sequence and in accordance with the following formulations : the vulcanisation behaviour of the mixtures is investigated in the rheometer at 160 ° c . characteristic data such as f min , f max . − f min ., t 10 , t 80 and t 90 is determined in this way : the improvement in the mechanical properties ( s 300 × d ) owing to the use of γ - isocyanatopropyltriethoxysilane with two hydroxyl group - containing br rubber gels is demonstrated in the second mixing run , greater effects being achieved with the hydroxybutylacrylate -( hba )- modified br gel 4 than with the hydroxyethylmethacrylate -( hema )- modified br gel 3 . | 2 |
certain preferred embodiments of the present invention will be described below in greater detail with reference to the accompanying drawings . in this embodiment , foundation fabrics may be formed by weaving , however , they may be formed by knitting instead of weaving . fig1 illustrates a portion of a double cloth composed of a first foundation fabric 10 and a second foundation fabric 20 , partly omitted , each of which forms one part of the present invention . the illustrated double cloth is a narrow tape - like woven fabric woven on a needle loom having a small width . the first and second foundation fabrics 10 and 20 each have a weft thread 14 , 24 laid in double picks in such a manner as to form a two - ply thread . the first foundation fabric 10 is a part which corresponds to a conventional surface - type fastener having female interlocking elements . in the illustrated embodiment , the first foundation fabric 10 has a plurality of pile threads 11 composed of multifilaments and forming a number of female or looped interlocking elements 13 on a front surface of the first foundation fabric 10 . each of the pile threads 11 extends over two adjacent foundation warp threads 12 to form a raised loop , then is interwoven with the weft threads 14 , subsequently extends again over the same two foundation warp threads 12 to form a next raised loop , and thereafter repeats the foregoing weaving pattern with the result that a large number of raised female or looped interlocking elements 13 arranged in rows and tiers at predetermined intervals or pitches are formed . although the first foundation fabric 10 has a base woven structure composed of a plain weave , two adjacent warp threads 12a laid next to eight consecutive foundation warp threads 12 are so woven as to form a leno fabric . in general , the warp threads 12 and the weft threads 14 are composed of multifilaments , however , either or both of these threads 12 , 14 may be composed of monofilaments . the monofilaments and the multifilaments are composed of a filament formed by spinning from a synthetic resin material such as polyester , polyamide , polyacryl or polypropylene . fibrous materials eligible for the foundation fabrics may include a variety of semisynthetic or natural fibers other than the synthetic resin materials specified above . the second foundation fabric 20 is woven integrally with the first foundation fabric 10 by means of a plurality of connecting threads 21 . although the base woven structure of the second foundation fabric 20 is a plain weave , a warp thread laid next to twelve consecutive foundation warp threads 22 is used as one of the connecting threads 21 . as shown in fig1 and 2 , the connecting threads 21 are also interwoven in the first foundation fabric 10 simultaneously with weaving of the first foundation fabric 10 , so that the first and second foundation fabrics 10 , 20 are integrally connected by the connecting threads 21 . the connecting threads 21 and the foundation warp threads 22 of the second foundation fabric 20 are both composed of multifilaments , however , a variety of spun yarns and monofilaments may be used according to the usage of the surface - type fastener . in the illustrated embodiment , the weft threads 24 of the second foundation fabric 20 are composed of monofilaments made from any one of the materials specified above , for the purpose of not only stabilizing the form and configuration of a final product , but also facilitating roll - up operation of an elongated continuous surface - type fastener , thus insuring the stability in shape and configuration of the final product during storage . in general , the second foundation fabric 20 of the foregoing construction is so designed as to have a weaving density lower or coarser than that of the first foundation fabric 10 , and the connecting threads 21 and the warp threads 22 used therein are each composed of a thread having a larger count of yarn than the warp threads 12 of the first foundation fabric 10 . the weaving density and the yarn count value may obviously be varied according to the usage of the surface - type fastener . however , in consideration of the permeability of synthetic resin described later , an extremely high weaving density is not preferable . the connecting threads 21 and the warp threads 22 may be composed of monofilaments or yarns made from any one of the synthetic resin fibers , semisynthetic fibers and natural fibers described above . fig3 illustrates another structural example of the foundation fabric 10 having on its front surface a number of male interlocking elements 15 each provided on its upper end with a hook 15a . the interlocking elements 15 are composed of monofilaments made from a synthetic resin material , such as polyester , polyamide , polyacryl or polypropylene , which is the same as the monofilament used in the first foundation fabric 10 described above . according to the woven structure of the first foundation fabric 10 shown in fig3 the male interlocking elements 15 are formed in such a manner that the monofilaments are interwoven in the first foundation fabric 10 so as to form a pile having a mass of raised uncut loops on the first foundation fabric 10 in the same manner as the female interlocking elements 13 of fig2 and subsequently the loops on the pile are cut at one side to form hooks 15a in the usual manner using a known comb - like cutting tool . the shape of a top end of the male interlocking elements 15 should by no means be limited to the hooks 15a described above . alternatively , it is possible to cut away or remove a round head portion of each loop on the first foundation pile fabric 10 , and subsequently a cut end of the loop is shaped into a radially outwardly swelled mushroom - like head 15b such as shown in fig4 either by forcing the cut end of the loop against a hot plate having a number of hemispherical recesses or by bringing a heat source close to the cut end of the loop . the double cloth which is composed of the aforesaid first and second woven foundation fabrics 10 and 20 integrally connected together by the connecting threads 21 is then impregnated with a synthetic resin . the impregnating synthetic resin should preferably be a material having a good adhesive property relative to the first and second foundation fabrics 10 , 20 . eligible materials for the impregnating synthetic resin may include polyester resin , polyamide resin , polyacryl resin , polyurethane resin , and various synthetic rubbers . to achieve the impregnation , the second foundation fabric 20 is coated on its back surface with a solvent solution of any one of the synthetic resin specified above or a melt of the synthetic resin of the same synthetic resin , which has been added with an extender , a surface - active agent , a curing agent and the like . then , a pressure is applied from a suitable means to the coated back surface of the second foundation fabric 20 whereupon the synthetic resin solution or melt is forced to flow successively into the second foundation fabric 20 and the first foundation fabric 10 until the first and second foundation fabrics 10 , 20 are fully impregnated with the synthetic resin . the thus impregnated first and second foundation fabrics 10 , 20 are then heated to cure the impregnating synthetic resin . in this instance , since the second foundation fabric 20 has a lower weaving density than the first foundation fabric 10 and hence has a sufficient degree of permeability of synthetic resin , the impregnating synthetic resin is readily able to reach the inside of the first foundation fabric 10 in a short time . fig2 - 4 show in cross section typical different examples of the surface - type fastener having a thick foundation fabric produced according to the present invention . as shown in these figures , there is a synthetic resin layer 30 which is interposed between the first and second foundation fabrics 10 and 20 and which fills up the inside of the first and second foundation fabrics 10 , 20 . thus , and first and second foundation fabrics 10 , 20 and the synthetic resin layer 30 are firmly united together . the thickness of a portion of the synthetic layer 30 lying between the first and second foundation fabrics 10 and 20 can be determined by adjusting the distance between respective joined portions of the first and second foundation fabrics 10 , 20 which are interconnected by the connecting threads 21 when the double cloth is woven . as will be understood from fig3 and 4 , the stiffness of the first foundation fabric 10 can be varied by changing the thickness or diameter of the connecting threads 21 . in the illustrated embodiments , the front surface of the surface - type fastener is provided with a number of raised interlocking elements 13 , 15 having the same shape and configuration . however , it is also possible according to the present invention to arrange the female interlocking elements 13 and the male interlocking elements 15 in combination on the front surface of a single surface - type fastener . to this end , during weaving of a double cloth , a plurality of pile threads 11 ( fig2 ) composed of multifilaments for forming female or looped interlocking elements 13 and a plurality of monofilaments 16 ( fig3 ) for forming male interlocking elements 15 are arranged alternately in the widthwise direction of the double cloth being woven . after the weaving , loops of the monofilaments 16 projecting from the first foundation fabric 10 are cut at one side to form hooks 15a ( fig3 ). as an alternative , the pile threads 11 composed of the multifilaments described above and the monofilaments 16 for forming the male interlocking elements may be arranged alternately and interwoven in the first foundation fabric 10 to form a double cloth ( surface - type fastener ) in such a manner that a portion of the surface - type fastener extending over a predetermined length of the surface - type fastener is provided solely with loops of the pile threads 11 , and an adjacent portion of the surface - type fastener extending over the predetermined length of the surface - type fastener is provided solely with loops of the monofilaments 16 which are subsequently cut to form hooks . the thus formed surface - type fastener has areas of female interlocking elements and areas of male interlocking elements arranged alternately in the lengthwise direction of the surface - type fastener and each having the predetermined length . fig5 exemplifies a binding device 40 which includes a female surface - type fastener 41 having female interlocking elements 13 of the present invention used in combination with a male surface - type fastener 42 having male interlocking elements 15 of the present invention . one end of the female surface - type fastener 41 having a predetermined length is threaded through a ring member 43 of metal or synthetic resin , then folded back , and finally attached to the female surface - type fastener body by means of a fastening device 44 . the opposite end of the female surface - type fastener 41 is held in abutment with one end of the male surface - type fastener 42 and firmly attached to the latter by means of a similar fastening device 44 , so that the binding device 40 is formed . when the binding device 40 is used for binding a plurality of articles , the binding device 40 is first wound around the articles with the female and male interlocking elements 13 and 15 faced outwardly , and then the free end of the male surface - type fastener 42 is threaded through the ring member 43 to tightly bind the articles . the free end of the male surface - type fastener 42 is subsequently turned or folded back about a portion of the ring member 43 , and finally pressed against the female surface - type fastener 41 so that the male interlocking elements 15 on the free end of the male surface - type fastener 42 are engaged with the female interlocking elements 13 on a portion of the female surface - type fastener 41 . in the embodiment shown in fig5 the female surface - type fastener 41 and the male surface - type fastener 42 are connected end to end by the fastening device 44 . however , the fastening device 44 used for connecting the female and male surface - type fasteners 41 and 42 can be omitted when the female and male interlocking elements 13 , 15 are formed in combination on one surface of a single woven surface - type fastener , or when a female surface - type fastener 41 and a male surface - type fastener 42 are continuously woven one after another . thus , the binding device 40 can be produced using a single surface - type fastener . it is apparent from the foregoing description that the surface - type fastener of this invention includes a first foundation fabric 10 having on its front surface a number of raised interlocking elements 13 , 15 , and a second foundation fabric 20 integrally woven or knitted with the first foundation fabric by means of connecting threads 21 . the first and second foundation fabrics 10 , 20 are impregnated with a synthetic resin so that confronting inside surfaces of the first and second foundation fabrics 10 , 20 are firmly connected together . with this construction , the surface - type fastener excels in productivity and is able to prevent the first and second foundation fabrics 10 , 20 from separating under severe conditions of use . furthermore , by using a first foundation fabric 10 having a woven or knitted structure similar to that of the conventional surface - type fastener , and by properly selecting the count of yarn for the threads forming the second foundation fabric 20 , a surface - type fastener having a desired thickness can be produced without affecting the bonding strength between , and the stability in shape and configuration of , the first and second foundation fabrics 10 , 20 . in the case where weft threads 24 of the second foundation fabric are composed of monofilaments , a final product ( surface - type fastener ) can be readily rolled up on a reel and hence is convenient for storage . since the second foundation fabric 20 is coarser in weaving or knitting density than the first foundation fabric 10 , the impregnating synthetic resin can readily penetrate the second foundation fabric 20 and subsequently flows into the first foundation fabric 20 . the first foundation fabric 20 can , therefore , be fully impregnated with the synthetic resin . furthermore , the first and second foundation fabrics 10 . 20 woven or knitted integrally can be readily matched with each other in terms of the dimensions and color , making it possible to obviate the need for a complicated inventory management . obviously , various minor changes and modifications of the present invention are possible in the light of the above teaching . it is therefore to be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described . | 8 |
preferred embodiments will be described in detail with reference to the accompanying drawings . to simplify the description , the same elements have been given the same reference numerals throughout the figures . fig1 is a cross - sectional side view of a first embodiment of a projection television according to the present invention . referring to fig1 an upper casing 2 is mounted on a fixed lower casing 11 . the casing 2 is securely connected to the shaft 3 so that when the shaft is rotated , the tiltable casing 2 is tilted . the casing 2 can be rotated about a shaft 3 that extends horizontally and parallel with a screen 4 fixed to the upper casing 2 . the upper casing 2 may be driven to tilt relative to the lower casing 11 by an appropriate drive mechanism 14 that incorporates a power source , for example , a motor . the drive power is transmitted through a gear train , not shown , from the motor 14 to the shaft 3 . for precise , smooth tilting of the casing 2 , the gear train is required to have as large a reduction ratio as possible . in particular , the final gear should have a large reduction ratio . a chain - drive type transmission mechanism having a chain and a sprocket wheel may be used in place of the gear train . still alternatively , the casing 2 may be driven manually through an appropriate mechanism . a reflecting mirror 5 is disposed behind the screen 4 in the upper casing 2 , and a projector 6 disposed at a lower part in the casing 2 . a circuit 7 is disposed in the lower casing 11 and supplies image signals to the projector 6 . the circuit 7 is located at a place where the circuit 7 does not interfere with the upper casing 2 when the upper casing 2 is rotated about the shaft 3 . for example , the projection television has a screen 4 having an axis of image 9 such that when a viewer 8 stands in front of the screen 4 , the line of sight of the viewer 8 is in line with the axis of image 9 . in this specification , the axis of image 9 is used to cover an axis that is normal to the screen 4 and passes through the center of the screen 4 . when the upper casing 2 is at the dotted line position , the screen 4 is vertical and substantially in the same plane as the front of the lower casing 11 , and the axis of image 9 extends horizontally . when the viewer 8 views the image sitting on a chair , the upper casing 2 can be rotated about the shaft 3 by a predetermined angle θ to incline downward to the solid line position . consequently , the axis of image 9 is tilted downward by the angle θ , so that the line of sight of the viewer sitting on the chair coincides with the axis of image 9 . this ensures that the viewer 8 views the projected image having a maximum luminance . the aforementioned tiltable casing 2 allows the viewer to view images having a maximum luminance even if the eyes of the viewer are not exactly on the axis of image 9 . the first embodiment has been described with respect to a projection television in which the projector 6 and the electrical circuit 7 are separate components . however , the invention is also applicable to an apparatus such as a crt video projector , a liquid crystal video projector , a dlp projector , and a slide projector in which the projector 6 and the electrical circuit 7 are integrated in a single assembly . fig2 is a cross - sectional side view of a second embodiment , illustrating the positional relationship among the projector and the surroundings . referring to fig2 the screen 4 and reflecting mirror 5 are housed in a casing 2 a and the projector 6 is housed in a casing 2 b . the casings 2 a and 2 b are separate casings but are pivotal about the shafts 3 laterally projecting from the reflecting mirror 5 . the casings 2 a and 2 b are pivoted drivingly in opposite directions to each other . the casings 2 a and 2 b may be driven to tilt by an appropriate drive mechanism 14 incorporating a power source , for example , a motor . the drive power is transmitted in a similar manner to the first embodiment . alternatively , the casings 2 a and 2 b may be manually driven to tilt . when the screen 4 and the projector 6 are at their dotted line positions and the viewer &# 39 ; s eyes are below the axis 9 a , then the casings 2 a and 2 b are tilted toward each together by an angle θ so that the casings 2 a and 2 b are at the solid line positions and the viewer &# 39 ; s eyes are on the axis of image 9 b . when the screen 4 and the projector 6 are at their solid line positions and the viewer &# 39 ; s eyes are above the axis 9 b , then the casings 2 a and 2 b are tilted away from each together by an angle θ so that the casings 2 a and 2 b are at the solid line positions and the viewer &# 39 ; s eyes are on the axis of image 9 a . fig3 a is a sectional side view of a third embodiment , showing the positional relationship among the projector and the surroundings . the screen 4 and the reflecting mirror 5 are tiltable while the projector 6 is fixed . the screen 4 and reflecting mirror are drivingly tilted by the drive mechanism 14 shown in fig3 b . alternatively , the casing 2 a and 2 b may be manually driven to tilt . the screen 4 is rotated by an angle θ about the shaft 3 and the reflecting mirror 5 is rotated by an angle θ / 2 about the shaft 3 in the same direction as the screen 4 . consequently , the direction of the axis of image 9 is tilted in a vertical plane by the angle θ . in order to prevent the images on the screen 4 from being disturbed , the reflecting mirror 5 and the screen 4 have to be tilted simultaneously , i . e ., the reflecting mirror 5 is tilted at an angular speed half that of the screen 4 . a fourth embodiment is a modification of the first embodiment . the fourth embodiment is characterized in that the casing can be rotated so that the axis of image 9 is tiltable not only in the vertical plane but also in the horizontal plane . fig4 a is a top view of a projection television according to the fourth embodiment . fig4 b is a perspective view of a projection television according to the fourth embodiment . referring to fig4 a and 4b , the casing 12 is mounted on a casing 12 a . the casing 12 a is mounted in the stationary lower casing and can be swiveled about a shaft 13 in horizontal directions shown by arrows c and d . other structural elements such as the projector 6 are fixedly disposed in the casing 12 . the casing 12 can be driven to swivel in the horizontal plane by a drive mechanism . the screen 4 , the reflecting mirror 5 , and projector 6 are fixedly disposed in the casing 12 as in the first embodiment . by controllably driving the casing 12 a to swivel , the casing 12 a can be swiveled by a predetermined angle θ about the rotation axis 13 . rotating the casing 12 in a horizontal plane enables the viewer to view the image with a maximum possible luminance even when the viewer is not exactly in front of the projection television but on the right or left side of the television , toward the front . the fourth embodiment allows the axis of image 9 to be varied both in the vertical direction and in the horizontal direction . therefore , the screen can be oriented so that the viewer who is not directly in front of the projection television can view the image with a maximum luminance . the fourth embodiment may also be applicable to the second and third embodiments if the screen 4 , the reflecting mirror 5 , and projector 6 are mounted on a single casing that can be horizontally swiveled . fig5 illustrates an apparatus according to a fifth embodiment . referring to fig5 the projection television incorporates a receiver 16 that receives controlling signals from a wireless remote controller 15 . the receiver 16 converts the controlling signals into drive signals that drive the motor 14 , thereby controlling the orientation of the projection television . the use of the remote controller 15 enables the viewer to adjust the orientation of the projection television in the vertical direction from a place remote from the projection television , so that the viewer can view the image having a maximum luminance . a sixth embodiment is directed to the construction in which heat radiated by or voice uttered by the viewer is detected to find where the viewer is relative to the projection television , and the screen is oriented toward the viewer . fig6 shows an example of a projection television with a sensor 17 disposed 9 on the front panel of the stationary casing 11 . the sensor 17 detects the heat radiated by or voice uttered by the viewer 8 and the detection output of the sensor 17 is converted into a drive signal that drives the motor 14 . the motor 14 is controlled to orient the screen 4 toward the viewer 8 so that the viewer 8 can view the image having a maximum luminance . one way of detecting the viewer &# 39 ; s position is to use a heat detector that detects a temperature higher than a predetermined threshold temperature such as the viewer &# 39 ; s body temperature , or detects temperatures within a predetermined range . as an alternative , a sound sensor may be used for sensing sounds having sound pressures higher than a predetermined sound pressure or within a predetermined sound pressure range , or for detecting sounds having frequencies higher than a predetermined frequency or within a predetermined frequency range . the use of such a sensor enables to automatically adjust the orientation of the screen 4 so that the viewer is able to view the image having a maximum luminance . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art intended to be included within the scope of the following claims . | 7 |
as indicated above , the aryl groups in the present invention may be substituted or unsubstituted . although in principle all available hydrogen atoms in the aryl groups may be replaced with other groups , it is preferable to use an unsubstituted phenyl group or a mono - or disubstituted aryl group , especially an ortho - and / or para - substituted group . compounds substituted in the para - position are less sensitive to radical reactions in said position as a result of a steric hindrance and are relatively easy to prepare . examples of especially suitable substituents in the aryl groups are alkyl groups having 1 to 4 carbon atoms , aryl groups , fluorine , chlorine , bromine and iodine atoms , acyl groups , aroyl groups , esterified or unesterified carboxyl groups ,, alkoxy groups , aryloxy groups , amino groups , in which the hydrogen atoms are substituted or not with other groups , nitro groups , alkyl or aryl sulfonyl groups or alkyl or aryl sulfinyl groups . suitable substituents in the x , y , c and d groups in the formula of fig2 on the formula sheet are all those groups that have no unfavorable influence on the formation of radicals or on the properties of the chemical products in the radical reactions . suitable substituents are , for example , fluorine , chlorine , bromine or iodine , alkyl , aryl , alkoxy , alkylthio , carboxyl ester and cyano groups . functional groups , such as hydroxyl , -- nh 2 and / or -- cooh , may also be present , so that the respective groups or radical initiator or decomposition products thereof can also be incorporated into the chemical product formed . even an -- so 3 h group may be present , so that the radical initiator can be emulsified in the reaction mixture to be initiated . one skilled in the art can easily choose for each special application for the most favorable groups and the appropriate substituents . it will , in general , be aimed at obtaining a maximally homogeneous distribution both of the radical initiators in the reaction mixture and of the decomposition products of the initiator in the final reaction product . if the reaction mixture contains substances with free hydroxyl groups or amino groups , the groups x and / or y may be chlorine . under properly chosen reaction conditions that radical initiator will be chemically bound to one or more of the components of the reaction mixture to be initiated . it is also possible to make use of ethylenically unsaturated groups in x or y which can also be chemically bound to the reaction product under the influence or the radicals formed in the reaction . this is especially of importance if the present radical initiators are used for the polymerization of ethylenically unsaturated monomers , such as styrene , α - methyl styrene , methyl methacrylate , acrylamide , acrylonitrile , methacrylonitrile , ethylene vinyl chloride , vinylidene chloride , vinyl acetate , divinyl benzene , n - vinyl pyrrolidone , butadiene , isoprene , chloroprene , dialkyl phthalate , diallyl carbonate , diallyl fumarate , et cetera , or mixtures of the aforementioned compounds . as is the case with the previously known 1 , 2 - diaryl - 1 , 2 - dicyano - ethane compounds , the compounds according to the present invention are insensitive to oxygen . although the present compounds are generally active at a lower temperature than the known 1 , 2 - diaryl - 1 , 2 - dicyano - ethane compounds , the present compounds can also be kept in a reaction mixture at room temperature without premature reaction taking place . the reaction can be made to start at any moment by heating the mixture . this feature may be taken advantage of in polymerization processes and in the paint and lacquers industry . particularly attractive fields of application are the preparation of high - polymers and unsaturated polyester resins . compositions of the present radical initiators and polymerizable compounds , such as monomers , prepolymers , or polymers which still contain unsaturated compounds or functionl groups which react with functional groups in the radical initiators , can be given a particular desired form and be cured by heating . curing is used as meaning polymerizatiion in a broad sense , i . e ., not necessarily attended with the formation of cross - links . giving the compositions of radical initiators a particular form may consist in , for example , applying them as coatings , pouring them into molds , applying the compositions to glass fiber structures , impregnating all kinds of materials , injection molding , extrusion , film casting , vacuum forming , or some other forming technique . for instance , a monomer may be mixed with the radical initiators according to the invention and polymerization may be started by heating . the polymerization process may be interrupted by decreasing the temperature . at such a stage one has a mixture of monomer and polymer ( also referred to herein as a prepolymer ), which can be further polymerized after it has been given a particular form . if desired , cross - linking agents may , of course , be added prior to further polymerization . the polymerization reactions with the novel radical initiators according to the invention can be carried out by using any known technique . for instance , the monomer , or the monomer mixture , can be made to polymerize as such . the polymerization also may be made to take place in a solution , a suspension , or an emulsion . those skilled in the art are well versed in such techniques . if desired , various additives may also be used . the radical initiators are employed in units of , for instance , 0 . 01 to 5 % by weight , calculated on the amount of compounds to be reacted . the reaction temperature is generally in the range of 40 ° to 200 ° c . with respect to the process for making the present initiators , in one embodiment of the present invention the radical initiators are prepared in the monomer known to be used for making corresponding compounds . the oxidative coupling reaction utilized in the present process is well - known . such a reaction may be carried out using an oxidizing agent such as manganese dioxide , lead dioxide , potassium permangante , potassium ferricyanide , hydrogen peroxide , nitric acid , iodine , organic peroxides such as di - tert - butyl peroxide , or by electrochemical oxidation . in practice it is often preferred that use should be made of silver oxide or oxygen in combination with a copper amine catalyst . a large number of copper amine catalysts are described in the british pat . no . 982 , 471 . the temperature used is generally in the range of - 40 ° to + 130 ° c . and is dependent on the type of compound . although in the preparation of the novel radical initiator according to the present invention the reaction with the reaction product of sodium hydride may be carried out with one of a great many organic solvents which are inert under the reaction conditions , it has been found that very favorable results are obtained if dioxane or dimethoxyethane is employed as the solvent . when a metal alcoholate is used , the organic solvent is preferably benzene or toluene . it has been found that the best results are obtained if as metal alcoholate there is used a sodium alcoholate having a lower alcoholate group , such as sodium methylate . in the case where a and b respectively represent sulfur or oxygen and x and y respectively represent a substituted or an unsubstituted phenyl group , it is preferred to use a somewhat modified method of preparation . such a method , can , of course , also be used if x and / or y does not have the meaning of a phenyl group , but has one of the other meanings indicated above . in the modified process , the reaction product of sodium hydride or a metal alcoholate and a compound of the formula ar -- ch 2 -- cn , which is utilized in the basic process , is replaced with the reaction product of an alkali solution in dimethylsulfoxide ( dmso ) and a compound of the formula ar -- ch 2 -- cn . the remainder of the basic process is unchanged . it has been found that very favorable results are obtained if as organic solvent dioxan or dimethoxyethane is used . in an alternative process for preparing the present initiators , a solution of a compound of the formula ## str5 ## wherein the terms are as above - defined , a compound of the formula ar -- ch 2 -- cn , wherein ar has the above - defined meaning , and an organic quaternary ammonium compound in a water - immiscible or practically water - immiscible organic solution are intimately contacted with a solution of alkali in water . after completion of the reaction , the reaction mixture is acidified and the isolated organic phase washed until neutral . the resultant monomeric product is then isolated , if desired , subjected to any known oxidative coupling reaction , and the desired product is isolated . the amount of solution of alkali in water which is utilized may vary between wide limits . use is often made of a concentrated alkali solution of , for example , 50 % by weight naoh in water . the alkyl groups in the tetraalkyl ammonium salt used may be straight - or branch - chained ; they generally contain 1 to 20 carbon atoms . an example of a suitable tetraalkyl ammonium salt is the tetra - n - butyl ammonium salt . very good results were obtained with the triethyl benzyl ammonium salt . use may be made of various organic solvents , which are not , or hardly , miscible with water and are inert to the reaction components used . it has been found that use may be made of halogenated organic solvents , and more particularly of methylene chloride . especially with the use of the triethyl benzyl ammonium salt , these solvents may lead to very high yields . other solvents which also give favorable results include carbon tetrachloride , 1 , 1 , 1 - trichloroethane and tri - and perchloroethylene . for the acidification in either of the two abovementioned methods of preparation , favorable results are obtained with the use of acetic acid or an inorganic acid such as hydrochloric acid . the invention will be further described in the following examples which are of course given by way of illustration only and should not be interpreted as limitative of the present invention . 148 g . ( 0 . 8 moles ) of cyanuric chloride at 30 ° c . were added to a suspension of 134 g . ( 1 . 6 moles ) of sodium bicarbonate in a mixture of 400 ml . of methanol and 40 ml . of water . after reaction for seven hours the reaction mixture was extracted with methylene chloride , followed by washing with water until neutral , drying with mgso 4 and evaporating the solvent . after recrystallization from petroleum ether ( boiling point 40 ° to 60 ° c .) 126 g . of 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine were obtained with a melting point between 74 . 2 ° and 76 . 2 ° c . subsequently , a suspension was prepared of 1 . 2 g . ( 0 . 05 mol ) of sodium hydroxide in 20 ml . of dimethoxyethane . to this suspension were added , with stirring , 3 . 28 g . ( 0 . 025 mole ) of p - xylylcyanide in 20 ml . of dimethoxyethane . after 15 minutes 4 . 4 g . ( 0 . 25 mole ) of 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine in 10 ml . of dioxane were added dropwise to the reaction mixture . after 16 hours of stirring , the reaction mixture was poured into ice water , acidified with acetic acid , and extracted with chloroform . the extract was successively washed with water , saturated sodium carbonate solution and water , until neutral , dried with magnesium sulfate and the solvent evaporated . next , the residue was dissolved in methanol and shaken with oxygen in the presence of cu 2 cl 2 / n , n , n , n - tetramethyl ethylene diamine as catalyst . when no more oxygen was taken up , the reaction mixture was poured into a 1 % by weight solution of hcl in water and extracted with methylene chloride . the extract was washed with water until neutral , dried with magnesium sulfate , and the solvent evaporated . recrystallization from methanol gave 2 . 8 g . of α , α ,&# 39 ;- bis -( p - methylphenyl ) α , α &# 39 ;- bis ( 2 , 4 - dimethoxy - 1 , 3 , 5 - triazine ) succinonitrile in 21 % yield . the melting point of the compound was in the range of 220 ° to 221 . 7 ° c . the 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine was prepared in the same manner as described in example i . subsequently , a solution was prepared of 3 . 6 g . ( 0 . 028 mole ) of p - xylyl cyanide , 3 ml . of 50 % by weight naoh in water and 20 ml . of dmso . a solution of 4 . 7 g ( 0 . 027 mole ) of 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine in 15 ml . of dioxane was added dropwise over a period of 15 minutes . after one hour stirring the reaction mixture was poured into water , acidified with hydrochloric acid and extracted with methylene chloride . the extract was washed with water until neutral and dried with magnesium sulfate . the residue was subsequently treated in the same manner as described in example i . recrystallization from methanol gave 3 . 72 g . of α , α &# 39 ;- bis ( p - methylphenyl ) α , α &# 39 ;- bis ( 2 , 4 - dimethoxy - 1 , 3 , 5 - triazine ) succinonitrile in 25 . 8 % yield . the melting point was the same as mentioned in example i . 20 ml . of water at - 5 ° c . were added to a suspension of 14 . 7 g . ( 0 . 175 mole ) of sodium bicarbonate in a solution of 15 . 8 g . ( 0 . 086 mole ) of cyanuric chloride in 70 ml . of acetone . at a temperature of 0 ° c . 8 . 4 g . ( 0 . 175 mole ) of methyl mercaptan were added to the suspension . the reaction time was nine hours and the temperature rose to 20 ° c . after being poured into water , the reaction mixture was extracted with ether . following washing with water , drying with na 2 so 4 and evaporating the solvent , the crude product was purified by recrystallization from petroleum ether ( boiling point 40 °- 60 ° c .). in this way 12 . 2 g . of 2 , 4 - dimethylthio - 6 - chloro - 1 , 3 , 5 - triazine were obtained in 69 % yield . the melting point was in the range of 83 . 6 ° to 84 . 4 ° c . of the product thus prepared , 2 g . ( 0 . 0096 mole ) were , as indicated in example i for 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine , reacted with 1 . 27 g . ( 0 . 0096 mole ) of p - xylyl cyanide and 2 . 5 g . ( 0 . 01 mole ) of sodium hydride . purification and recrystallization from methanol gave 1 . 76 g . of ( 2 , 4 - dimethylthio - s - triazinyl - 6 -)( tolyl - 4 ) methyl cyanide in 60 . 5 % yield . the melting point was in the range of 101 . 2 ° to 102 . 6 ° c . of the compound thus prepared 1 . 51 g . were dissolved in a suspension of 1 . 75 g . of silver oxide in 50 ml . of benzene . the resulting mixture was boiled under reflux for 60 hours , followed by adding 300 ml . of chloroform and 2 spatulas of active carbon . after another two hours boiling under reflux , the mixture was filtrated and the filtrate concentrated by evaporation . there were obtained 1 . 04 g . ( in 68 . 8 % yield ) of white crystalline α , α &# 39 ;- bis ( p - tolyl ) α , α &# 39 ;- bis ( 2 , 4 - dimethylthio - 1 , 3 , 5 - triazine ) succinonitrile having a melting point of 220 . 8 ° to 221 . 0 ° c . to a suspension of 2 . 5 g . ( 0 . 1 mole ) of sodium hydride in 20 ml . of dimethoxyethane there was added a solution of 3 . 68 g . ( 0 . 025 mole ) of p - methoxybenzyl cyanide in 30 ml . of dimethoxyethane . after 15 minutes a solution of 4 . 4 g . ( 0 . 025 mole ) of 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine in 15 ml . of dimethoxyethane and 20 ml . of dioxane was added to the reaction mixture . subsequently , the mixture was boiled under reflux for 60 hours , after which it was poured into a dilute ( 4 n ) hydrochloric acid solution at 0 ° c . the acid solution was extracted with methylene chloride . next , the extract was washed with a saturated sodium bicarbonate solution and with water until neutral , followed by drying with magnesium sulfate and concentrating by evaporation . the residue was isolated chromatographically on a silica gel column ( silica gel 60 ( 70 - 230 mesh ) astm ; eluent : dimethoxyethane / hexane = 7 / 3 ). there were obtained 4 . 86 g . ( in 74 % yield ) of 2 , 4 - dimethoxy - s - triazinyl - 6 -) ( anisyl - 4 ) methyl cyanide . in the same manner as described in example iii , 2 . 36 g . of the compound thus prepared were dissolved in a suspension of 2 . 5 g . of silver oxide in 50 ml . of benzene . after 45 hours &# 39 ; boiling under reflux , 300 ml . of methylene chloride and two spatulas of active carbon were added . after another two hours boiling under reflux , the mixture was filtrated and concentrated by evaporation . there were obtained 1 . 07 g . ( in 45 . 3 % yield ) of white crystalline α , α &# 39 ;- bis ( p - methoxyphenyl ) α , α &# 39 ;- bis ( 2 , 4 - dimethoxy - 1 , 3 , 5 - triazine ) succinonitrile having a melting point in the range of 234 . 0 ° to 234 . 2 ° c . 9 . 0 g . ( 0 . 225 mole ) of powdered sodium hydroxide at a reaction temperature of 32 ° to 37 ° c . were added to a solution of 18 . 4 g . ( 0 . 1 mole ) of cyanuric chloride and 51 . 2 g . ( 0 . 2 mole ) of stearyl alcohol in 200 ml . of dioxane over a period of 20 minutes . after seven hours the reaction mixture was poured into 500 ml . of petroleum ether ( boiling point 60 ° c .). the solution thus obtained was washed with water , dried with mgso 4 , and concentrated by evaporation . 10 g . ( 0 . 016 mole ) of the resulting product and 3 . 64 g . ( 0 . 016 mole ) of triethyl benzyl ammonium chloride and 2 . 09 g . ( 0 . 016 mole ) of p - xylyl cyanide were dissolved in 400 ml . of methylene chloride . with a supertorax stirrer , the solution obtained was vigorously stirred for three hours in the presence of 50 ml . of 50 % by weight -- sodium hydroxide . after completion of the reaction , the reaction mixture was poured into 400 ml . of 4 n hcl , followed by washing the isolated organic phase with water until neutral , drying with mgso 4 , and concentrating by evaporation . the ( 2 , 4 - distearoxy - s - triazinyl - 6 -) ( tolyl - 4 ) methyl cyanide was purified by recrystallization from methanol . there were obtained 11 . 1 g . of product in 87 % yield . starting from 3 . 8 g . the coupling reaction was carried out by using the same procedure as described in example i using oxygen in the presence of cu 2 cl 2 / n , n , n , n - tetramethyl ethylene diamine as catalyst , with the exception that it was performed in a mixture of equal parts by volume of methanol and methylene chloride . recrystallization from acetone gave 3 . 14 g . ( in 83 % yield ) of white crystalline α , α &# 39 ;- bis ( p - tolyl ) α , α &# 39 ;- bis ( 2 , 4 - distearoxy - 1 , 3 , 5 - triazine ) succinonitrile having a melting point in the range of 75 . 0 ° to 82 . 3 ° c . at a reaction temperature of 15 ° to 20 ° c . a solution of 19 . 0 g . ( 0 . 2 mole ) of phenol and 8 . 0 g . ( 0 . 2 mole ) of sodium hydroxide in 75 ml . of water was added dropwise to a solution of 18 . 4 g . ( 0 . 1 mole ) of cyanuric chloride in 90 ml . of acetone . after 41 / 2 hours the precipitate formed was removed by suction , washed with water and dried ( with mgso 4 ). purification by recrystallization from n - heptane gave 24 . 7 g . of 2 , 4 - diphenoxy - 6 - chloro - 1 , 3 , 5 - triazine in 82 % yield . the melting point was 119 °- 121 ° c . in the same manner as described in example v , 3 . 23 g . of this product were coupled to 1 . 41 g . of p - xylyl cyanide by way of a phase - transfer catalyzed two - phase reaction . purification of the reaction product : ( 2 , 4 - diphenoxy - s - triazine - 6 -) ( tolyl - 4 ) methyl cyanide by recrystallization from ethyl acetate gave 3 . 6 g . of the title product in 85 % yield . the compound ( 2 , 4 - dipiperidino - s - triazinyl - 6 ) ( tolyl - 4 ) methyl cyanide was obtained by boiling the above - mentioned reaction product with two molar equivalents of piperidine for 16 hours in chloroform under reflux . after the solvent had been evaporated , the residue was sublimated , with phenol escaping from the reaction mixture . after the residue had been boiled in an ether / chloroform mixture , the solid matter was filtered off , dissolved in methylene chloride , and the solution washed with water . following drying with mgso 4 the solvent was evaporated and the resulting solid matter boiled in ether . subsequently , the solid matter was filtered off and dried . the coupling reaction was carried out in the same manner as described in example iii , using silver oxide in boiling toluene . the product was obtained in 49 % yield . the melting point was in the range of 257 . 0 ° to 258 . 0 ° c . in the preparation of this compound , the same procedure was used as described in example iv , with the exception that it was started from 3 . 79 g . ( 0 . 025 mole ) of p - chlorobenzyl cyanide . further , the period over which the reaction mixture was boiled under reflux was only one hour instead of 60 hours . further treatment resulted in a residue which after recrystallization from a mixture of ethanol and ethyl acetate gave 5 . 05 g . of the title product in 74 . 3 % yield . the melting point was in the range of 238 . 4 ° and 241 . 4 ° c . in these examples the reactivities are determined of the radical initiators and polymerization initiators according to the invention and some known radical initiators . the reactivity is indicated with the polymerization constant kp . the latter is very much dependent on the temperature and occurs in the formula rp = kp ( m ) ( i ) 1 / 2 where rp is the polymerization speed , ( m ) the concentration of the monomer and ( i ) the concentration of the radical initiator ( see &# 34 ; die makromolekulare chemie &# 34 ; 157 ( 1972 ), p . 279 ff ). in all determinations 50 ml . of the monomer were mixed with the radial initiators listed in the following table and transferred to a dilatometer . the dilatometer was cooled to - 80 ° c ., filled with nitrogen , followed by applying vacuum to it ; the last two treatments were repeated three times . then the dilatometer was placed in a thermostated bath which had been set to the polymerization temperature mentioned in the table below . the concentration values were determined in accordance with the standard dilatometric technique ( see &# 34 ; angewandte chemie &# 34 ; 59 ( 1947 ), p90 ). from the values obtained the conversion and the kp - values were successively determined . the table below gives the values obtained for the compounds are prepared in the examples i through vii . for comparison also the kp - values of some known radical initiators , namely , α , α &# 39 ;- bis ( methoxycarbo ) α , α &# 39 ;- bis ( p - methylphenyl ) succinonitrile ( dl ) ( ix ), dilauroyl peroxide ( x ), di - t - butyl perpivalate ( xi ) and tert . butyl peroxypivalate ( xii ) are listed in the table . because of the poor solubility of some of the radical initiators prepared in the preceding examples , the determination of the kp - value was started from 0 . 05 % by weight , whereas normally 0 . 2 % by weight is included in the monomer to be polymerized . the kp - values of other radical initiators in styrene are listed in the tables 2 and 3 on page 283 of the aforementioned article in &# 34 ; die makromolekulare chemie &# 34 ;. table i______________________________________ kp - value × 10 . sup . 4 methylmethacrylate styreneradical initiator temperature ° c . temperature ° c . of example 50 60 70 80 90______________________________________i + ii 3 . 85 7 . 5 x xiii 2 . 85 5 . 92 x xiv 1 . 1 2 . 7 x xv 2 . 32 4 . 48 3 . 05 7 . 86vi no polymerization 1 . 60 3 . 56vii 2 . 10 5 . 52 6 . 10 5 . 70ix 1 . 3 3 . 4x 2 . 4 5 . 8xi 4 . 2 10 . 1xii 3 . 0______________________________________ x : although at these temperatures polymerization took place , the conversiontime curves were nonlinear . the difference in behaviour between the compound of example v and that of i through iv , is probably due to a far better compatibility of the compound of example v in styrene and in polystyrene . | 2 |
the present invention provides a method for preparing a whole soybean milk , comprising the steps of : 1 ) roasting and dehulling soybeans to obtain dehulled soybeans ; 2 ) cooking the dehulled soybeans to obtain cooked soybeans ; 3 ) coarsely grinding the cooked soybeans to obtain a coarsely ground soybean liquid ; 4 ) finely grinding particles of the coarsely ground soybean liquid in a cutting manner by using a grinding device to obtain a whole soybean liquid ; and 5 ) micro homogenizing the whole soybean liquid . the term “ whole soybean milk ” in the present invention refers to a soybean milk prepared to contain entire nutrients of soybeans without removing the useful components which were discarded as soybean milk residue in pre - existing methods for preparing a soybean milk from whole soybeans or dehulled soybeans . the present invention allows preparation of a whole soybean milk which has small particle diameters and shows almost no change in viscosity even when stored for a long time , by the following process : cooking dehulled soybeans which went through a roasting step for an appropriate time and at a proper temperature , then finely grinding them using a mechanical grinding device which finely grinds particles in a cutting manner , such as comitrol , and micro homogenizing them by applying homogeneous pressure . specifically , a process of the present invention may be carried out through the following steps described below . foreign materials ( e . g ., iron pieces , stones , wood , or grains , etc .) are removed from whole soybeans using a stone picker or careful selector . in the present invention , soybeans are roasted to add savory taste to a whole soybean milk , inactivate an agent which causes beany flavour characteristic of beans beforehand , and improve the particle diameters of the whole soybean liquid to be finally prepared . the roasting step may be carried out in any one of the fashions commonly known in the art , such as hot air fashion , semi - hot air fashion , flame fashion , or far - infrared fashion , etc . a roaster used in the roasting step may be appropriately selected in accordance with the above fashions . for example , a drum roaster can be used in case of a flame fashion . in a roasting step according to the flame fashion of the present invention , the inside temperature of the drum roaster , rotational speed of the drum and roasting time can influence the extent of roasting of soybeans and the particle diameters , viscosity , and sensory property of finally prepared soybean liquid . in order to obtain a whole soybean milk with a favorable taste , it is recommended that the inside temperature of the drum roaster range from 150 to 240 ° c ., the rotational speed of the drum range from 20 to 40 rpm , the roasting time range from 4 to 12 minutes , and input and output amounts of the soybeans range from 40 to 50 kg per minute . as an example of the present invention , in case of a drum roaster , tastes can be diversified by adjusting the roasting time while the inside temperature and rotational speed of the drum are fixed . for example , if the inside temperature of the drum just before the soybean input , and the rotational speed of the drum are fixed at about 220 ° c . and at about 27 rpm , respectively , fresh taste can be obtained by roasting the soybeans for a short time of 4 to 8 minutes , while nutty taste be obtained by roasting them for a long time of 9 to 12 minutes . according to one embodiment of the present invention , the roasting step can be carried out by roasting the carefully selected whole soybeans for 4 to 12 minutes in a drum roaster in which its temperature and rotational speed are fixed at 220 ° c . and at 27 rpm , respectively . in addition , a roasting step according to the hot air fashion of the present invention is preferably carried out with the roasting temperature of 150 to 200 ° c ., the soybean input speed of 30 to 70 %, the soybean output rate of 60 to 95 %, and the roasting time of 40 to 120 seconds , while a roasting step according to the infra - red fashion is preferably carried out with the roasting temperature of 180 to 230 ° c ., and the roasting time of 4 to 14 minutes . it is recommended that skin of soybeans should be removed as it can increase the viscosity of the whole soybean milk product to be finally prepared afterwards and may cause residual taste ( bitter and astringent taste ) characteristic of soybean skin . accordingly , soybeans which went through the roasting step are rapidly cooled to 40 ° c . or lower , preferably 20 to 30 ° c ., sorted according to size using a particle diameter sorter , followed by removing their skin using a dehuller , and diving the dehulled soybeans in half . half - divided dehulled soybeans which went through the dehulling step are cooked in hot water with a temperature of 91 to 99 ° c ., preferably 95 to 99 ° c . ( e . g ., 98 ° c .) for 3 to 10 minutes ( e . g ., 4 minutes ). such cooking steps can not only effectively improve the sensory property of a whole soybean liquid by inactivating an agent causing beany flavour characteristic of beans , but also help improve the particle diameters of the whole soybean liquid by softening the soybean structure and thus easing the grinding in a coarse grinding step to be carried out afterward , but also can take a role in adding deep taste to the whole soybean liquid to be finally prepared . in addition , the productivity can be increased since , owing to the cooking step , a long soaking process of about 8 to 15 hours and an enzyme - inactivation process ( carried out for 5 minutes at 98 ° c .) can be omitted , which have been carried out in pre - existing methods for the preparation of whole soybean milk . the cooked soybeans may be coarsely ground using a grinder such as crusher . in this step , cooked soybeans can be treated with 2 . 4 to 10 - fold by weight of water and coarsely ground . the higher the solid content of the whole soybean liquid obtained from the coarse grinding process is , the more difficult it becomes to attain desired particle diameters in the fine grinding process afterwards , and thus it is recommended that the solid content of the soybean liquid obtained from the coarse grinding step be 5 to 15 %. one example of devices that can be used in the coarse grinding step of the present invention is crusher in which the size of its passage net is 1 to 4 φ , for example , 1 . 5 φ . soybean particles can be micronized by finely grinding the coarsely ground soybean liquid obtained from the coarse grinding step , using comitrol , a mechanical grinding device which finely grinds particles in a cutting manner . the comitrol used in the present invention is the main device which finely cuts particles and is composed of a circular head and an impeller located at the center of the head and equipped with blade rotating at a high speed . types of circular head in comitrol are cutting head assembly , microcut head assembly , slicing head assembly , etc . ; and microcut head assembly can be preferably used . main components of microcut head assembly are multiple blades , circular upper and under blade holding rings to which multiple blades are attached . the principle of comitrol &# 39 ; s cutting and micronization of particles is as follows . an impeller equipped with blade cuts particles while rotating at a high speed , and centrifugal force and strong compressive force between the gap between microcut head assembly and the impeller rotating at a high speed , etc . are generated , which make particles collide with the cutting surfaces of the blades attached to microcut head assembly , resulting in cutting and micronization of particles . among such micronized particles , only those which are smaller than the openings between the blades can pass , while those too large to pass get micronized repeatedly . the microcut head assembly can adjust particle diameters according to the number of blades attached ( i . e ., the more blades are attached , the narrower the openings between the blades get , which allows only the more micronized particles to pass ). in addition , as the shape of the microcut head assembly is circular , blades attached to the upper and lower blade holding rings do not align with the adjacent blades in a straight line , and differences in depth of cut are generated , which can maximize the efficiency of particle cutting . specifically , a fine grinding step of the present invention comprises first and second micronization steps of the coarsely ground soybean liquid using comitrol . the comitrol may have 50 to 222 blades in which the distance between blades ranges from 0 . 001 to 0 . 2214 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto ranges from 0 . 0012 to 0 . 0237 inch . according to a specific embodiment of the present invention , comitrol having 212 blades in which the distance between blades is 0 . 005 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto is 0 . 0013 inch ( e . g ., comitrol processor model 1700 , urschel lab ., inc .) can be used in the first micronization step ; and comitrol having 222 blades in which the distance between blades is 0 . 001 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto is 0 . 0012 inch ( e . g ., comitrol processor model 1500 , urschel lab ., inc .) can be used in the second micronization step . the mean particle diameter of soybean particles obtained from the first and second micronization steps ranges from about 80 to 100 μm , and from about 60 to 70 μm , respectively . meanwhile , to process a large amount of coarsely ground whole soybean liquid in the fine grinding step of the present invention or to prepare a whole soybean liquid having a smaller particle diameter , the first and second micronization steps can be carried out using other models of comitrol ( e . g ., comitrol processor model 9300 with feeder , urschel lab ., inc .). in such comitrols , 172 to 241 blades are included , the distance between blades ranges from 0 . 00043 to 0 . 606 inch , and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto ranges from 0 . 0001 to 0 . 042 . a grinding step in the conventional methods for preparing a whole soybean milk micronizes particles using ultramizer and a reactor in a way of crushing particles by a milling stone method , and a resulting mean particle diameter of soybean particles ranges from about 130 to 150 μm . on the other hand , in the present invention , a whole soybean milk with a mean particle diameter ( about 60 to 70 μm ) smaller than the conventional methods can be obtained by micronizing particles in a way of cutting them with blades using comitrol . according to a method of the present invention , soybean milk residue components with a large particle size decrease dramatically , enabling the hydration of soybean milk residue components to take place sufficiently during the process , and thus additional hydration of them does not take place over time . accordingly , the viscosity of a whole soybean milk to be finally prepared gets stabilized , which can contribute to its storage stability . moreover , the process can be simplified by not using additional processing devices such as ultramizer and a reactor . the micro homogenization step of the present invention comprises first micro homogenizing the whole soybean liquid prepared in the grinding step at a homogeneous pressure of 200 to 300 bar ( e . g ., 300 bar ); pasteurizing , cooling and sterilizing the whole soybean liquid obtained ; and second micro homogenizing the sterilized whole soybean liquid at a homogeneous pressure of 150 to 300 bar ( e . g ., 300 bar ). the homogeneous pressure at the first micro homogenization step should be preferably 300 bar or less , since homogenous pressure exceeding 300 bar in the first micro homogenization step can cause unfavorable texture on tasting due to increased viscosity , and impose loads to a mechanical facility resulting in reduced life span of the facility or noise in the working area . the mean particle diameter of the whole soybean liquid obtained from the first micro homogenization step ranges from 45 to 55 μm . next , the whole soybean liquid obtained from the first micro homogenization step is pasteurized in a heat exchanger ( e . g ., plate - type heat exchanger ) at 95 to 99 ° c . ( e . g ., about 98 ° c .) for 30 seconds to 60 seconds ( e . g ., about 30 seconds ), followed by cooling to 10 ° c . or lower ( e . g ., about 5 ° c .) in a cooler . then , it may be transported to a sterilizer and sterilized by a heat exchanger ( e . g ., a heat exchanger with a steam infusion method ) at 135 to 151 ° c . ( e . g ., 150 ° c .) for 3 seconds to 200 seconds ( e . g ., 5 seconds ). the second micro homogenization of the sterilized whole soybean liquid obtained from the above process is carried out at a homogeneous pressure of 150 to 300 bar ( e . g ., 300 bar ). the mean particle diameter of the whole soybean liquid obtained from the second micro homogenization process ranges from 25 to 35 μm . in addition , the present invention provides a whole soybean milk prepared by the preparation method above . physical properties of the whole soybean milk according to the present invention include a particle diameter of about 25 to 35 and viscosity of 34 to 55 cp . the whole soybean milk has excellent storage stability due to almost no viscosity change over time , and is characterized by its small viscosity increase of less than 12 cp even after 22 months when stored in the form of a commercialized product at room temperature ( about 1 to 35 ° c .). for the distribution of the prepared whole soybean milk in a liquid phase at room temperature , a whole soybean milk product can be prepared by blending and mixing the whole soybean milk with a sitologically acceptable food and a small amount of additives , followed by a conventional process of packaging soybean milk products . accordingly , the present invention provides a method for preparing a whole soybean milk product comprising the steps of blending and mixing a whole soybean milk with a sitologically acceptable food and a small amount of additives , and then stabilizing , filling , sterilizing , and cooling the resulting mixture in a conventional way . when preparing the soybean milk product , scent or taste of the final soybean milk product can be improved by adding flavoring agents to a whole soybean milk , and available flavoring agents can be , for example , fruit , fruit puree , juice , concentrate , powder , and a mixture thereof . in addition , to promote health , a whole soybean milk product can be prepared with the addition of an appropriate amount of extracts or powders , etc . of milk calcium or various natural foods , for example , sesame seeds , black sesame seeds , carrots , spinach , green tea , black tea , mulberry , arrowroot , herbs , ginseng , red ginseng , chinese bellflower , etc . a feeling of repulsion starts to arise upon sensory evaluation if the viscosity of whole soybean milk exceeds 80 cp . a whole soybean milk product prepared according to a conventional process with a water - soaking method ( korean patent no . 822 , 165 ) shows gradual increase in its viscosity over time , exceeding 80 cp after about 80 days , and exceeding 100 cp after about 180 days . however , the whole soybean milk prepared according to the method of the present invention showed almost no viscosity increase even 9 months after the preparation , and even showed about 5 to 18 cp decrease from the viscosity at the time of preparation . in addition , even until 22 months after the preparation , the viscosity increase was at maximum about 11 . 5 cp , which implies that there is almost no change in viscosity . therefore , a longer shelf life can be achieved for the whole soybean milk product prepared according to the method of the present invention than that prepared according to the conventional process with water - soaking method . hereinafter , the present invention will be described in more detail with the following examples . the following examples are provided to illustrate the present invention , but the scope of the present invention is not limited thereto . after carefully selecting soybeans and removing foreign materials from them , the soybeans were roasted in a flame fashion for 10 minutes using a roaster ( drum roaster available from korea energy technology ) with the inside temperature of the drum just before the soybean input and the rotational speed of the drum fixed at about 220 ° c . and at about 27 rpm , respectively . the roasted soybeans were cooled quickly to about 30 ° c ., were sorted according to the size using a particle diameter sorter , and were half - divided after their hull was removed using a dehuller . the dehulled half - divided soybeans were cooked by bean cooker by passing them in hot water of 98 ° c ., for about 4 minutes . 7 . 45 - fold by weight of water was added to the cooked soybeans obtained and the resulting was coarsely ground by passing it through crusher ( seikensha co ., ltd ., japan ) which has a passage net of 1 . 5 φ . in order to finely grind the coarsely ground soybean liquid obtained , a first micronization was carried out by cutting it with comitrol ( comitrol processor model 1700 , urschel lab ., inc .) having 212 blades in which the distance between blades is 0 . 005 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto is 0 . 0013 inch . the mean particle diameter of the soybean liquid obtained from the first micronization process was measured using a particle diameter analyzer ( microtrac s - 3000 , microtrac inc ., usa ), which was shown to be 80 . 99 μm ( fig2 and table 1 ). then , a second micronization of the soybean liquid obtained from the first micronization process was carried out by cutting it with comitrol ( comitrol processor model 1500 , urschel lab ., inc .) having 222 blades in which the distance between blades is 0 . 001 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto is 0 . 0012 inch . the mean particle diameter of the soybean liquid obtained from the second micronization process was measured by the same method as above , which was confirmed to be 63 . 23 μm ( fig3 and table 2 ). a first micro homogenization of the whole soybean liquid obtained from the above micronization processes was carried out using a homogenizer ( homogenizer , donga homogenizer , china ) at a pressure of 300 bar . the mean particle diameter of the whole soybean liquid obtained was measured by the same method as above , which was confirmed to be 47 . 54 μm ( fig4 and table 3 ). then , the whole soybean liquid obtained from the first micro homogenization was pasteurized using a plate - type heat exchanger at about 98 ° c . for 30 seconds , followed by cooling down to about 5 ° c . using a plate - type heat exchanger . then , it was transported to a sterilizer and sterilized by a heat exchanger with a steam infusion method at 150 ° c . for 5 seconds . a second micro homogenization of the sterilized whole soybean liquid obtained from the above process was carried out at a pressure of 300 bar . the mean particle diameter of the whole soybean liquid obtained from the second micro homogenization was confirmed to be 29 . 52 μm ( fig5 and table 4 ). specifically , after carefully selecting soybeans and removing foreign materials , 330 kg of the soybeans were soaked in water of 18 ° c . for about 10 hours . first grinding of the soaked soybeans was carried out using a grinder ( crusher , seikensha co ., ltd ., japan ) while adding purified water thereto . after the grinding , outer skins of soybeans or foreign materials contained in the ground liquid were removed three times using a refiner ( bertuzzi , italy ). then , second grinding was carried out using a fine grinder ( ultramizer ). the mean particle diameter of the whole soybean liquid obtained from the second grinding process was confirmed to be 450 μm . then , the ground liquid was maintained at 90 ° c . for 2 minutes to inactivate enzymes , and was micronized using a circulating grinding device ( hansung pulverizing machinery co ., ltd .) equipped with a mechanical grinding device such as colloid mill , etc ., and a recirculating device , to prepare a whole soybean liquid . the mean particle diameter of the whole soybean liquid was confirmed to be about 130 μm . two consecutive homogenizations of the prepared whole soybean liquid were carried out using a ultra - high pressure homogenizer ( homogenizer , donga homogenizer , china ) at a pressure of 400 bar each , and the whole soybean liquid was cooled to 4 ° c . the obtained liquid was subjected to a third homogenization at a pressure of 400 bar and then sterilization at 150 ° c . for 3 seconds , to prepare a whole soybean liquid . the final mean particle diameter of the prepared whole soybean liquid was 77 . 42 μm ( fig6 and table 5 ). particle diameters and viscosity of the example 1 and comparative example 1 , and commercially available soybean milk products a and b were measured using a particle diameter analyzer ( microtrac s - 3000 , microtrac inc ., usa ) and a viscosity analyzer ( brookfield viscometer lvdve230e5871 , spindle no . 1 ( s61 ), and spindle rotational speed : 20 rpm ). the results are shown in table 6 below . in addition , the results of particle diameter analysis of comparative example 1 , and commercially available soybean milk products a and b are shown , respectively , in fig6 to 8 ( tables 5 , 7 , and 8 ). whole soybean milks prepared in example 1 and comparative example 1 were sterilized at 150 ° c . for 3 to 5 seconds , and were commercialized by packaging them using a sterile automatic packaging machine ( combibloc - filling machine cfa112 - 32 , sig combibloc ). in order to measure the viscosity changes according to storage time , products of example 1 and comparative example 1 were stored at room temperature and the viscosity increase over storage time was measured by the same method as experimental example 1 . results are shown in tables 9 and 10 below , and fig9 and 10 . as shown in tables 9 and 10 , and fig9 and 10 , the whole soybean milk of example 1 showed no viscosity increase at 9 months after the preparation , but rather showed about 5 to 18 cp decrease from the viscosity at the time of preparation . in addition , even until 22 months after the preparation , the viscosity increase was at maximum about 11 . 5 cp , which implies that there was almost no change in viscosity . on the other hand , the whole soybean milk of comparative example 1 showed gradual increase in its viscosity over time , exceeding 80 cp after about 80 days , and exceeding 100 cp after about 180 days . a feeling of repulsion starts to arise upon sensory evaluation if the viscosity of a whole soybean milk exceeds 80 cp . these results indicate that products using a whole soybean milk of example 1 can be stored for a longer period without change in taste than those using a whole soybean milk of comparative example 1 . | 0 |
the present invention will now be further described by way of example and with reference to the figures which show : fig1 : antibody response of common carp against different isolates of a . hydrophila determined by elisa expressed as an absorbance at 450 nm . all sera were diluted 1 : 512 . fig2 : western blot analysis of different whole cell preparations of a . hydrophila against pooled serum from common carp infected with 6 different a . hydrophila isolates . lanes : ( 1 ) standard marker ; ( 2 ) t4 ; ( 3 ) 98141 ; ( 4 ) hh ; ( 5 ) vds ; ( 6 ) catla ; ( 7 ) c241i ; ( 8 ) 2d 2 o ; ( 9 ) 3d14 ; ( 10 ) 2n14 ; ( 11 ) 98140 ; ( 12 ) 98139 ; ( 13 ) b2 / 12 ; ( 14 ) f1d75 ; ( 15 ) calf . fig3 : western blot analysis of different preparations of 6 a . hydrophila isolates screened with serum raised against corresponding a . hydrophila isolates in common carp . ( a ) t4 , ( b ) 98141 , ( c ) hh , ( d ) vds , ( e ) catla , ( f ) c241i . lanes : ( 1 ) standard marker ; ( 2 ) wc in vitro ; ( 3 ) wc in vivo 25 kda ; ( 4 ) wc in vivo 100 kda ; ( 5 ) omp in vitro ; ( 6 ) omp in vivo 25 kda ; ( 7 ) omp in vivo 100 kda ; ( 8 ) ecp in vitro ; ( 9 ) ecp in vivo 25 kda ; ( 10 ) ecp in vivo 100 kda . fig4 : 2d western blot analysis of whole cell preparation of a . hydrophila t4 isolate screened with antibody from common carp infected with a . hydrophila t4 isolate . fig5 : cumulative percentage of goldfish mortality in preliminary vaccination trial fig6 : maldi - tof ms spectrum showing the peptide profiles of 50 kda band fig7 : nucleic and amino acid sequences of a . hydrophila s - layer protein signal peptide sequences are highlighted ( nucleic acid in green and amino acid in yellow ). fig8 : genomic sequences of a . hydrophila isolate t4 bases different to that genome reported for the s - layer protein of a . hydrophila isolate tf7 by thomas and trust ( 1995a ) have been highlighted . fig9 : amplification of the s - layer gene of a . hydrophila isolate t4 shown on a 1 % agarose gel . lanes : ( 1 ) standard marker ; ( 2 ) s - layer protein gene ; ( 3 ) purified s - layer protein gene ; ( 4 ) pqe60 vector carrying s - layer protein gene . fig1 : expression of s - layer protein of a . hydrophila with e . coli wc protein . ( a ) 12 % sds - page stained with coomassie blue , ( b ) western blot of protein using an anti - histidine tag antibodies . lanes : ( 1 ) standard protein marker ; ( 2 ) wc preparation of recombinant e . coli without iptg induction ; ( 3 ) wc preparation of recombinant e . coli with iptg induction showing s - layer protein . fig1 : cumulative percentage mortality of carp vaccinated with recombinant s - layer protein and challenged with a . hydrophila isolates . ( a ) t4 , ( b ) hh , ( c ) 98140 , ( d ) 98141 , ( e ) vds , ( f ) b2 / 12 . four virulent strains ; t4 , 98141 , hh , vds and two avirulent strains ; catla and c241i of a . hydrophila were used ( table 1 ). common carp ( average weight 30 g ) were maintained in 6 separate glass tanks . the fish were anesthetized and injected intraperitoneally ( ip ) with 0 . 1 ml pbs containing 1 × 10 6 viable a . hydrophila . each strain was injected into 24 fish and an additional 24 fish were injected with phosphate buffered saline ( pbs ) as controls . after injection , the fish were supplied with re - circulating water that had been passed through a sedimentation tank , drum filter , biofilter and ultraviolet ( uv ) radiation . the temperature of the tank water was maintained at 20 ± 1 ° c . blood samples were taken 3 , 9 , 12 and 21 days post - injection and pre - injection bleeds were taken from six fish . blood was stored overnight at 4 ° c . and the serum collected by centrifuging at 2000 × g for 5 min . the serum was stored at − 20 ° c . until further analysis . western blot analysis was performed using fish anti - sera as per the method outlined by wiens et al . ( 1990 : with modifications ). western blot analysis was carried out for the 14 a . hydrophila isolates shown in table 1 using pooled common carp serum raised against six isolates of a . hydrophila strains ( t4 , 98141 , hh , vds , catla and c241i ). different preparations of the bacterium ( i . e . whole cell ( wc ), outer membrane protein ( omp ) and extracellular products ( ecp )) prepared from these 6 isolates of a . hydrophila grown either in vitro or in vivo were screened by western blot with each of the 6 anti - sera raised against different isolates of a . hydrophila . the bacterial preparations described above were subjected to 12 % sds - page and the resolved antigens transferred to nitrocellulose membranes (@ 60 v for 1 h ). the nitrocellulose membranes were blocked using 2 % ( w / v ) casein for 1 h at 20 - 22 ° c . the membranes were washed three times ( tris buffered saline containing 0 . 1 % ( v / v ) tween - 20 : ttbs / 5 min per wash ) and then incubated overnight in the common carp anti - serum diluted 1 / 10 in tris buffered saline ( tbs ). membranes were again washed and incubated with an anti - carp igm monoclonal antibody ( aquatic diagnostics ltd , stirling , uk ) for 2 h . the membranes were washed and incubated with anti - mouse igg - hrp ( sigma , missouri , usa ) for 1 h . the blots were developed by adding chromogen and substrate solution ( 2 ml of 4 - chloro - naphthol solution with 10 mls of pbs and 10 μl of h 2 o 2 ) until bands were observed . the antigenic profile of wc preparation of isolate t4 grown in vitro was screened using 2d sds - page and western blotting with anti - serum ( raised for t4 isolate ) from common carp . assessing the levels of protection of a 50 kda protein in goldfish against a . hydrophila challenge : preparation of the antigen . volumes ( 100 μl ) of sample were subjected to 12 % sds page . the gels were run for between 5 - 6 h at 250 v / 130 ma . on completion the 50 kda band was cut from the gel and finely chopped . these were placed in tubes containing 300 μl sds - page reservoir buffer a blotting paper disk and a porous polyethylene plug . the tip of the tube was cut and placed into a 1 . 5 ml centrifuge tube containing 300 μl of 4 × sds - page reservoir buffer . the tubes were then placed into an electroluter and subjected to 50 v at 0 . 5 ma and a reverse run at 50 v for 5 sec at the end . the eluted protein was collected and the reservoir buffer removed using a 10 , 000 mw cut - off spin concentrator . the concentration of protein was determined . the presence of the 50 kda protein was confirmed by sds - page and western blot . for preliminary vaccination , four goldfish weighing around 30 - 40 g were injected ip with 200 μl of suspension having 12 . 3 μg of 50 kda protein in 60 μl of pbs and 140 μl of montanide adjuvant . another four fish were also injected with pbs to serve as controls . all the fish were challenged with a . hydrophila 31 days post - vaccination and sacrificed 21 days after challenge as described above . samples were taken from their kidneys . the relative percentage survival ( rps ) was calculated using the following formula ( ellis , 1988 ). in addition , two goldfish weighing 30 - 40 g were injected ip with 200 μl , of antigen ( i . e . 12 . 3 μg 50 kda protein ) emulsified with freund &# 39 ; s complete adjuvant ( fca ). thirty four days later , both fish were re - vaccinated with the same suspension as described above except freund &# 39 ; s incomplete adjuvant was used in place of fca . seventeen days after the booster injection , blood was collected from one fish and the anti - serum collected . three goldfish weighing between 30 - 40 g were immunised by ip injection with 0 . 1 ml of goldfish sera raised against the 50 kda protein electro - eluted from a . hydrophila , and 3 fish were injected with control serum collected from non - vaccinated goldfish . after 24 h all the fish were challenged with 0 . 1 ml of 2 . 5 × 10 7 ml − 1 a . hydrophila t4 isolate in pbs by ip injection , but on the opposite side to the site where they had been injected with the antiserum ( lafrentz , 2003 ). kidney samples from fish which died during the experiment and surviving fish at day 21 post - challenge were streaked on tsa to confirm specific mortality . sequencing and identification of the 50 kda protein of a . hydrophila a whole cell preparation of a . hydrophila t4 isolate in sds - page sample buffer was prepared for sequencing and analysis of the 50 kda protein by maldi - tof ms . samples were in - gel reductively alkylated prior to staining with colloidal coomassie blue , then digested in 0 . 1 % of n - octyl glucoside / 20 mm ammonium bicarbonate plus 12 . 5 μg ml − 1 trypsin , and the sample ( 1 . 5 μl ) was spotted from the extract ( 30 μl ) after adding an equal volume of acetonitrile for performing maldi - tof ms analysis . recombinant protein was produced in order to have a sufficient quantity of protein for a large scale vaccination trial . all the recombinant protein work was conducted at the genomic laboratory , tokyo university of marine sciences and technology , japan . polymerase chain reaction ( pcr ) of a . hydrophila 50 kda protein gene specific primers were designed to amplify the full length of the 50 kda protein gene based on the sequence data for the s - layer gene of a . hydrophila published by thomas and trust ( 1995a : see fig8 ). restriction sites nco i and bgl ii were added to the forward and reverse primers respectively to assist its cloning into the expression vector pqe60 . the pcr was run for 32 cycles ( 95 ′ c / 5 min ; denaturation for 95 ° c ./ 30 sec ; annealing at 55 ° c ./ 30 sec ; elongation at 72 ° c ./ 1 min and a final elongation step at 72 ° c ./ 5 min ). the primers used were as follows : forward : acatgggagttaatctggacactggtgc ; reverse : gacttgtggtacttgcgtaagtctaga the pcr products were resolved by 1 % agarose gel electrophoresis and the dna was extracted using a dna purification kit . digestion of the pcr products and the pqe 60 vector ( qiagen ) were carried out overnight at 37 ° c . both pqe 60 vectors and pcr products were purified after the digestion process and ligated by mixing 2 μl of vector with 8 μl of pcr products and adding 10 μl ligation high ( cosmo bio co ltd , tokyo ) before incubating it overnight at 16 ° c . transformation of vectors carrying 50 kda protein gene into e . coli escherichia coli , m15 ( quiagen , tokyo , japan ) was transformed with pqe 60 vectors carrying the amplified 50 kda protein gene of a . hydrophila . expression of the recombinant 50 kda protein in e . coli the clones containing the 50 kda protein gene insert identified by pcr , were inoculated into lb broth containing ampicillin ( 100 μg ml − 1 ) and kanamycin ( 25 μg ml − 1 ), and incubated overnight at 37 ° c . recombinant protein expression was induced by addition of 1 mm isopropyl - β - thiogalactoside ( iptg ) for 4 h . for large scale production , positive clones were cultured in 50 ml of antibiotic supplemented lb broth overnight at 37 ° c . with vigorous shaking . this culture was transferred to 1 l fresh lb broth and cultured at 37 ° c . with vigorous shaking . recombinant protein expression was induced by adding 1 mm iptg . sequencing of the a . hydrophila t4 isolate 50 kda protein gene the whole 50 kda protein gene of a . hydrophila isolate t4 was sequenced at the genomic laboratory , tokyo university of marine sciences and technology . recombinant 50 kda protein of a . hydrophila diluted in pbs was mixed with montanide adjuvant at a ratio of 30 : 70 ( v / v ) to a final antigen concentration of 300 μg ml − 1 . buffer ( pbs ) mixed with the adjuvant was also prepared at the same ratio as the antigen to serve as a negative control . one hundred and fifty common carp ( 30 - 40 g ) were vaccinated by ip injection with 0 . 1 ml of the vaccine preparation , and another 150 fish were injected with the pbs adjuvant mixture . all the fish were maintained for 35 days in 1 × 1m ( diameter × depth ) tanks with recirculating water before challenging with six different isolates of a . hydrophila . each of the six virulent isolates described above were used to challenge vaccinated fish . twenty vaccinated and 20 control fish were injected ip with each strain . the concentrations of the bacteria used in the challenge were 1 × 10 8 , 2 × 10 7 , 2 × 10 7 , 5 × 10 7 , 7 . 5 × 10 6 and 2 × 10 7 bacteria ml − 1 for t4 , 98140 , 98141 , hh , b2 / 12 and vds respectively . all 40 fish within each group were placed in separate glass tank ( 90 cm length × 47 cm height × 40 cm depth ) with aeration and recirculating water . the fish were maintained for 16 days post - challenge and dead fish were removed 3 times a day . samples from the kidney of dead fish and also from surviving fish at the end of the experiment on day 16 post - challenge were streaked onto tsa . the results obtained were statically analysed using chi - square test for survival , comparing the mortality of vaccinated fish with the control group fish after challenging with bacteria . antibody response of common carp infected with different isolates of a . hydrophila the antibody levels increased after day 9 and a positive response was observed on day 12 post - infection with all the isolates , except for isolate 98141 . by day 21 post - infection , this response had increased for all the isolates , with the highest antibody response recorded against isolate t4 ( fig1 ). the wc preparations of a . hydrophila isolates grown in vitro , screened by western blot with the anti - sera from infected common carp , exhibited a distribution of bands between 20 and 160 kda ( fig2 ). carp antibodies bound to antigens ranging from 30 - 50 kda for 3 of the virulent isolates , t4 , hh and b2 / 12 . except for isolate 2d20 , one band was observed at approximately 50 kda . the antibody response against wc , omp and ecp preparations of a . hydrophila grown in vitro and in vivo , showed similar profiles among isolates t4 , 98141 and hh ( fig3 ). with all the virulent isolates ( t4 , hh , 98141 and vds ), a band was evident at around 50 kda in wc and omp preparations . this band was also present in ecp preparations from in vitro cultured bacteria . the omp preparations from isolate vds grown in vitro showed 6 bands between 25 and 50 kda . a band at 50 kda was observed in wc and omp preparations of isolate catla grown in vitro . a band at around 50 kda was seen in both wc and omp preparations from isolate c241i grown in vitro and in vivo . six bands were seen between 35 and 100 kda with ecp preparations from bacteria grown in mw cut - off tubes but the bands were weakly stained in the case of bacteria grown in the 100 mw cut off tube . the 2d western blot for a . hydrophila t4 isolate using the antibody raised against the isolate in common carp expressed three spots at approximately 50 kda with pi values between 5 and 5 . 7 ( fig4 ). vaccination and passive immunisation of goldfish with an electro - eluted 50 kda protein from a . hydrophila in the vaccination experiment , two control and one vaccinated fish died due to unknown causes before challenging them with a . hydrophila isolate t4 . the two fish remaining in the control group died on day one and day 4 post - challenge ( fig6 ). one fish from the vaccinated group was also sacrificed one week post - challenge as it was suffering from a severe lesion and a . hydrophila was isolated from swabs taken from the lesion and kidney of the sacrificed fish . the remaining two fish in the vaccinated group were healthy and sacrificed at the end of the experiment , at 21 days post - challenge . all kidney swabs taken from dead fish were positive for a . hydrophila while the samples taken from two vaccinated fish at the end of experiment were negative . though the numbers of fish used in the experiment were low , the rps value was 66 . 7 %. the fish serum raised against the 50 kda protein of a . hydrophila used to passively immunise fish , had a titre of 1 / 16 . in the trial , one fish from the control group died two days post - infection and the presence of a . hydrophila in its kidney was confirmed using an api 20e strip . no other fish died and no kidneys were positive for the bacteria when remaining fish were sampled at the end of the trial on day 21 . maldi - tof sequence of the 50 kda protein from a . hydrophila after maldi - tof analysis and sequencing , the 50 kda protein of a . hydrophila isolate t4 was identified as a 47 . 6 kda s - layer protein ( fig7 and fig9 ). six bases were found to be different in the whole s - layer genome of a . hydrophila t4 isolate ( fig9 ) compared with the s - layer genome sequence of isolate tf7 reported by thomas and trust ( 1995a : fig8 ). the amino acid sequence shown in fig8 was obtained from the ncbi database . production of a recombinant protein for the s - layer of a . hydrophila isolate t4 bands at 1353 by on the 1 % ( w / v ) agrose gel verified that the amplification of s - layer genomic dna was successful ( fig1 ). after transformation of vectors into e . coli cells , the presence of the s - layer genome in e . coli was confirmed by pcr ( fig1 a ) and western blot ( fig1 b ). all six strains t4 , 98140 , 98141 , hh , b2 / 12 and vds were passaged twice through common carp and the bacteria were successfully recovered from both passages . during the first passage , no mortalities occurred in any of the groups of fish , while most fish died upon passaging the bacterium a second time with all strains except t4 . the values obtained in the preliminary challenge experiment in which the ld 50 dose for each strain was determined are given in table 2 . in fish challenged with isolate t4 , 75 % of control and 10 % of vaccinated fish died . a high percentage of mortalities were recorded in control fish challenged with isolate t4 compared with fish challenged with the other isolates of a . hydrophila . fifteen percent of the control group died by the first day post - challenge and 25 % had died by day 2 post - challenge . the levels of mortality decreased to 10 % by day 3 post - challenge and thereafter it varied between 5 and 10 % until the mortalities stopped by day 8 post - challenge . the mortality in the vaccinated group was 5 % on day 1 post - challenge and another 5 % had died by day 5 ( fig1 a ). a relatively high percentage survival ( rps ) value ( 87 %) was found with isolate t4 compared with other isolates ( table 3 ). mortality of 5 % was noted in the control group challenged with isolate hh on day 1 post - challenge . however , the mortality increased to 20 % by day 2 , 15 % occurred on day 5 and 10 % on day 6 . the remainder of mortalities ( i . e . 15 %) were distributed over the period after day 7 . in the vaccinated group , 5 % of mortalities were recorded on the first and third day post - challenge ( fig1 b ). the second highest rps value ( 85 %) in the trial was observed with this isolate . fifty - percentage mortality was seen with the control group challenged with isolate 98140 . thirty percent died in the control group during the first two days post - challenge and remainder died over the course of the experiment ( 16 days post - challenge ). five percent mortality was recorded in the vaccinated group during the first two days post - challenge , and no further mortalities occurred in this group leading to an 80 % rps value for this isolate ( fig1 c ). in the control group challenged with isolate 98141 , 25 % of mortality occurred over the first two days of the experiment and thereafter 15 % mortalities occurred . the mortality with the vaccinated group was similar to that of the mortality recorded with vaccinated group challenged with isolate 98140 ( fig1 d ). an rps value of 75 % was recorded with this isolate . the control group challenged with isolate vds experienced a 10 % mortality on day 1 , day 2 and day 5 post - challenge , while 5 % mortalities occurred on the third and sixth day post - challenge ( fig1 e ). a total of 15 % mortality occurred in the vaccinated group distributed over day 2 , 3 and 5 post - challenge . the rps value with this isolate was 62 . 5 %. percentage mortality in the control group rose to 30 % during the first two days after challenging the fish with isolate b2 / 12 . another 15 % mortality occurred in this group over the remainder of the experiment . the highest percentage mortality amongst vaccinated fish was recorded in the group challenged with b2 / 12 . ten percent mortality was observed in this group on the next day post - challenge and 5 % of mortality occurred on the second day and the third day post - challenge ( fig1 f ). the rps value was low ( 56 %) with this isolate compared to other isolates . all the fish that died during the experiment showed the presence of a . hydrophila in their kidneys . in contrast , a . hydrophila was not cultured from kidney swabs taken from the surviving fish except very few colonies from one fish in the vaccinated group challenged with isolate 98140 and one fish in the control group challenged with isolate 98141 . statistical analysis revealed that survival against isolates t4 , 98140 , 98141 and hh were significant in vaccinated fish compared to control fish , while levels of survival were not statistically significant for isolates b2 / 12 and vds ( table 3 ). in this study , common carp were infected with a . hydrophila and the anti - sera produced were used to identify immunogenic components of the bacterium . the different a . hydrophila isolates examined elicited a variety of responses in common carp , as determined by elisa . an increase in antibody response against a . hydrophila was seen after day 9 post - infection for all the isolates except one ( 98141 ). antibody response peaked on day 12 post - infection for two isolates ( hh and catla ) and on day 21 post - infection for three isolates ( t4 , vds and c241i ). the antibody response of common carp did not show any differentiation between virulent and avirulent isolates of a . hydrophila . this may be due to differences in the ability of the immune system of the host to respond to foreign agents . western blot analysis using the anti - sera produced on day 21 post - infection , against different strains of a . hydrophila , showed differences in the profiles between the isolates . however , when pooled sera ( from common carp infected with 6 different isolates ) were used to examine the response against the 14 isolates of a . hydrophila ( described in table 1 ), a band at around 50 kda was observed in all the isolates grown in vitro , except for isolate 2d 2 o . moreover , bands from 30 - 50 kda were stained in the profiles of 3 of the virulent isolates , t4 , hh and b2 / 12 grown in vitro . a band at around 50 kda was seen with all the preparations ( wc , omp , ecp ) from the virulent isolates grown both in vitro and in vivo compared with avirulent isolates , with the exception of the ecp from bacteria grown in vivo . the 2d western blot analysis of a . hydrophila ( t4 isolate ) wc revealed 3 spots at approximately 50 kda between 5 and 5 . 7 μl range when serum raised against t4 isolates was used . the results of the 1d and 2d western blot analysis suggest that a molecule at approximately 50 kda ( ranging between 47 and 51 kda ) might be one of the major immunogenic components of a . hydrophila . the 50 kda protein of a . hydrophila was considered to be the most immunogenic and most homogenous protein , recognised on each of the a . hydrophila isolates examined . the 50 kda protein conferred protection in goldfish against a . hydrophila in the direct immunisation trial . after maldi - tof ms sequencing , six bases were found to be different in the whole s - layer genome of a . hydrophila t4 isolate ( fig9 ) compared with the s - layer genome sequence of isolate tf7 reported by thomas and trust ( 1995a : fig8 ). this in turn could result with changes in 4 amino acids in the s - layer protein of a . hydrophila isolate t4 compared with s - layer amino acid sequence reported for isolate tf7 . a recombinant s - layer protein of a . hydrophila was produced to confirm the protection efficacy of this protein in common carp against different isolates of a . hydrophila . the recombinant s - layer protein proved reactive in western blot analysis against anti - a . hydrophila t4 common carp serum and it was used to vaccinate a number of fish . these fish were then challenged with a range of different a . hydrophila isolates . high mortality rate was observed both in the vaccinated and control group within two days post - challenge compared with the mortality from day 3 post - challenge as described in fig4 . 8 . the protection elicited by the s - layer protein in vaccinated fish indicates a potential role for this protein in the virulence of a . hydrophila . the s - layer protein antigen of a . hydrophila appears to have conferred protection against the different isolates of a . hydrophila tested , although the rps values of carp did vary between the different challenge isolates . no mortalities occurred in any of the groups of fish after day 11 post - challenge in the vaccination trial described in this chapter . moreover , no colonies of a . hydrophila grew from the kidney swabs taken from surviving fish at the end of experiment except for two fish . this suggests that most of the surviving fish in the control group had cleared the bacterium through their own immune response , as fish can produce an antibody response against different components of bacterium and clear the bacteria in blood circulatory system within seven days post - infection ( leung and stevenson , 1988b ; chandran et al ., 2002b ). asha a ., nayak d . k ., shankar k . m . and mohan c . v . ( 2004 ) antigen expression in biofilm cells of aeromonas hydrophila employed in oral vaccination of fish . fish & amp ; shellfish immunology 16 , 429 - 436 . azad i . s ., shankar k . m ., mohan c . v . and kalita b . ( 1999 ) biofilm vaccine of aeromonas hydrophila - standardization of dose and duration for oral vaccination of carps . fish & amp ; shellfish immunology 9 , 519 - 528 . azad i . s ., shankar k . m ., mohan c . v . and kalita b . ( 2000a ) uptake and processing of biofilm and free - cell vaccines of aeromonas hydrophila in indian major carps and common carp following oral vaccination - antigen localization by a monoclonal antibody . diseases of aquatic organisms 43 , 103 - 108 . baba t ., imamura j ., izawa k . and ikeda k . ( 1988a ) cell - mediated protection in carp , cyprinus carpio l ., against aeromonas hydrophila . journal of fish diseases 11 , 171 - 178 . baba t ., imamura j ., izawa k . and ikeda k . ( 1988b ) immune protection in carp , cyprinus carpio l ., after immunization with aeromonas hydrophila crude lipopolysaccharide . journal of fish diseases 11 , 237 - 244 . chandran m . r ., aruna b . v ., logambal s . m . and dinakaran m . r . ( 2002b ) immunisation of indian major carps against aeromonas hydrophila by intraperitoneal injection . fish & amp ; shellfish immunology 13 , 1 - 9 . chandran m . r ., aruna b . v ., logambal s . m . and michael r . d . ( 2002a ) field immunization of indian major carps against aeromonas hydrophila by dooley j . s . g ., lallier r . and trust t . j . ( 1986 ) surface antigens of virulent strains of aeromonas hydrophila . veterinary immunology and immunopathology 12 , 339 - 344 . ellis a . e . ( 1988 ) general principles of fish vaccination . in : fish vaccination ( ed . by ellis a . e . ), academic press , london , pp . 2031 . esteve c ., amaro c ., garay e ., santos y . and toranzo a . e . ( 1995 ) pathogenicity of live bacteria and extracellular products of motile aeromonas isolated from eels . journal of applied bacteriology 78 , 555 - 562 . fang h . m ., ge r . and sin y . m . ( 2004 ) cloning , characterisation and expression of aeromonas hydrophila major adhesin . fish & amp ; shellfish immunology 16 , 645 - 658 . janda j . m ., guthertz l . s ., kokka r . p . and shimada t . ( 1994b ) aeromonas species in septicemia : laboratory characteristics and clinical observations . clinical infectious diseases 19 , 77 - 83 . khashe s ., hill w . and janda j . m . ( 1996 ) characterization of aeromonas hydrophila strains of clinical , animal , and environmental origin expressing the o : 34 antigen . current microbiology 33 , 104 - 108 . kusuda r ., chen c . and kawai k . ( 1987 ) changes in the agglutinating antibody titre and serum protein composition of colored carp after immunization with aeromonas hydrophila . fish pathology 22 , 141 - 146 . lafrentz b . r ., lapatra s . e ., jones g . r . and cain k . d . ( 2003 ) passive immunisation of rainbow trout , oncorhynchus mykiss ( walbaum ), aganist flavobacterium psychrophilum , the causative agent of bacterial coldwater disease and rainbow trout fry syndrome . journal of fish diseases 26 , 377 - 384 . lamers c . h . j ., de haas m . j . h . and van muiswinkel w . b . ( 1985 ) the reaction of the immune system of fish to vaccination : development of immunological memory in carp , cyprinus carpio l ., following direct immersion in aeromonas hydrophila bacterin . journal of fish diseases 8 , 253 - 262 . leung k . y . and stevenson r . m . w . ( 1988b ) tn5 - induced protease - deficient strains of aeromonas hydrophila with reduced virulence for fish . infection and immunity 56 , 2639 - 2644 . leung k . y ., wong l . s ., low k . w . and sin y . m . ( 1997 ) mini - tn5 induced growth - and protease - deficient mutants of aeromonas hydrophila as live vaccines for blue gourami , trichogaster trichopterus ( pallas ). aquaculture 158 , 11 - 22 . leung k . y ., yeap l v ., lam t . j . and sin y . m . ( 1995 ) serum resistance as a good indicator for virulence in aeromonas hydrophila strains isolated from diseased fish in south - east asia . journal of fish diseases 18 , 511 - 518 . loghothetis p . n . and austin b . ( 1994 ) immune response of rainbow trout ( oncorhynchus mykiss , walbaum ) to aeromonas hydrophila . fish & amp ; shellfish immunology 4 , 239 - 254 . loghothetis p . n . and austin b . ( 1996b ) antibody responses of rainbow trout ( oncorhynchus mykiss , walbaum ) to live aeromonas hydrophila as assessed by various antigen preparations . fish & amp ; shellfish immunology 6 , 455 - 464 . majumdar t ., ghosh d ., datta s ., sahoo c ., pal j . and mazumder s . ( 2006 ) an attenuated plasmid - cured strain of aeromonas hydrophila elicits protective immunity in clarias batrachus l . fish & amp ; shellfish immunology in press . moral c . h ., del castillo e . f ., fierro p . l ., cortes a . v ., castillo j . a ., soriano a . c ., salazar m . s ., peralta b . r . and carrasco g . n . ( 1998 ) molecular characterization of the aeromonas hydrophila aroa gene and potential use of an auxotrophic aroa mutant as a live attenuated vaccine . infection and immunity 66 , 1813 - 1821 . munn c . b . ( 1994 ) the use of recombinant dna technology in the development of fish vaccines . fish & amp ; shellfish immunology 4 , 459 - 473 . nayak d . k ., asha a ., shankar k . m . and mohan c . v . ( 2004b ) evaluation of biofilm of aeromonas hydrophila for oral vaccination of clarias batrachus - a carnivore model . fish & amp ; shellfish immunology 16 , 613 - 619 . newman s . g . ( 1993 ) bacterial vaccines for fish . annual review of fish diseases 3 , 145 - 185 . olivier , g ., lallier , r . and lariviere , s . ( 1981 ) a toxigenic profile of aeromonas hydrophila and aeromonas sobria isolated from fish . canadian journal of microbiology 27 , 330 - 333 . rahman m . h . and kawai k . ( 2000 ) outer membrane proteins of aeromonas hydrophila induce protective immunity in goldfish . fish & amp ; shellfish immunology 10 , 379 - 382 . sakazaki r . and shimada t . ( 1984 ) o - serogrouping scheme for mesophilic aeromonas strains . japanese journal of medical science and biology 37 , 247 - 255 . shotts e . b ., gaines j . l ., martin l . and prestwood a . k . ( 1972 ) aeromonas - induced deaths among fish and reptiles in an eutrophic inlands lake . journal of the american veterinary medical association 161 , 603 - 607 . stevenson r . m . w . ( 1988 ) vaccination against aeromonas hydrophila . in : fish vaccination ( ed . by ellis a . e . ), academic press , new york , pp . 112 - 123 . thomas s . r . and trust t . j . ( 1995a ) tyrosine phosphorylation of the tetragonal paracrystalline array of aeromonas hydrophila : molecular cloning and high - level expression of the s - layer protein gene . journal of molecular biology 245 , 568 - 581 . vivas j ., riano j ., carracedo b ., razquin b . e ., lopez - fierro p ., naharro g . and villena a . j . ( 2004b ) the auxotrophic aroa mutant of aeromonas hydrophila as a live attenuated vaccine against a . salmonicida infections in rainbow trout ( oncorhynchus mykiss ). fish & amp ; shellfish immunology 16 , 193 - 206 . vivas j ., carracedo b ., riano j ., razquin b . e ., lopez - fierro p ., acosta f ., naharro g . and villena a . j . ( 2004c ) behavior of an aeromonas hydrophila aroa live vaccine in water microcosms . applied and environmental microbiology 70 , 2702 - 2708 . vivas j ., razquin b ., lopez - fierro p . and villena a . j . ( 2005 ) modulation of the immune response to an aeromonas hydrophila aroa live vaccine in rainbow trout : effect of culture media on the humoral immune response and complement consumption . fish & amp ; shellfish immunology 18 , 223 - 233 . | 2 |
fig1 shows a network 1 with communication nodes 2 , 3 , 4 and 5 . communication node 5 is a clock generator node which provides the reference time base for synchronization of the time bases in the other nodes of network 1 . the reference clock pulse generator time base of communication node 5 is generated by a timer 6 which , by timing with a local clock of communication node 5 , constantly counts from 0 to n − 1 . the communication node 5 is used to create a data telegram 7 for node 2 . the data telegram 7 contains the desired value of the time base of node 2 at the point at which the data telegram is received . the time base of node 2 is realized by a timer 8 , which basically has the same structure as the timer 6 of the communication node 5 . the timer 8 has its own local clock for timing of the counter of the timer which is independent of the clock of the communication node 5 . when node 2 is switched on timer 8 is thus asynchronous with timer 6 . after an initial synchronization an ongoing adjustment is necessary since the clock frequencies of the different clocks of the time bases are never exactly identical . for synchronization of the time base of node 2 , i . e . of its timer 8 , communication node 5 generates data telegram 7 . the data telegram 7 is sent from port h of communication node 5 to port a of communication node 2 via the corresponding network connection in network 1 . in this way communication node 2 obtains the necessary desired value for adjusting its time base . accordingly communication nodes 3 and 4 also receive data telegrams 7 from communication node 5 for adjusting the corresponding timers 9 and 10 . after the synchronization of the time base in the individual nodes 2 , 3 and 4 of the network 1 the communication cycles of point - to - point connections of the network 1 are asynchronous to each other . for example the communication node 2 can send one or more data telegrams to the communication node 3 during a communication cycle by using a point - to - point connection between port b of the communication node 2 and port c of the communication node 3 . accordingly , data telegrams can also be received during the synchronized communication cycle from port c of communication node 3 to port b of communication node 2 . the same applies correspondingly to communication between two different communication nodes which are linked to each other by a network connection of network 1 . when such a direct network connection does not exist a telecommunication connection it will be established via a switching matrix in the communication node . if for example the communication node 4 would like to send a data telegram to the communication node 2 , this will be done so that communication node 4 initially sends the data telegram from its port e to the port d of communication node 3 , from where it is forwarded via the switching matrix of communication node 3 to the port c , to be transmitted from there via the direct network connection point - to - point to the port b of communication node 2 . this process requires , especially for real - time capable packet data transmission in a deterministic communication system , as needed particularly for the purposes of automation technology , a synchronization of the communication cycles of the individual point - to - point connections in the network 1 . fig2 shows a block diagram of communication node 2 of fig1 . timer 8 of communication node 2 has a counter 11 which constantly counts from 0 to the threshold value n − 1 in the threshold value register 12 . the counter 11 is clocked by a local oscillator 13 , that is by a clock . the contents of the threshold value register 12 , i . e . the parameter n , can be selected by a user . selecting the parameter n defines the length of a communication cycle . the counter 11 has a register 14 with the actual value of the counter . furthermore the counter 11 has a register 15 and a register 16 , each for storing a parameter s 1 and s 2 of the manipulated variables for adjusting counter 11 to synchronize the time base of the communication cycle . when the threshold value specified by the contents of threshold value register 12 is reached , counter 11 issues a cycle signal which starts a transmission cycle . this cycle signal is issued for example to port b of communication node 2 . port b contains a send list 17 and a receive list 18 . during a communication cycle both the send list 17 and also the receive list 18 are processed . the communication node 2 also has a program 19 . the program 19 has a program module 24 for entering the actual counter value of counter 11 and the desired counter value . furthermore program 19 has a program module 21 for determining a system deviation by comparing the actual timer value and the desired timer value . furthermore program 19 has program modules 22 and 23 each with an adjustment rule for creating a manipulated variable for controlling or adjusting the time base in accordance with the system deviation . the program module 22 is used here for controlling an initialization phase and program module 23 for adjustment during operation . both program modules 22 and 23 generate the parameters s 1 and s 2 of the manipulated variable for the adjustment of the time base , i . e . of the timer 11 of timer 8 . at this input the program 19 receives the contents of register 14 , i . e . the actual count of value and in addition it receives via a communication connection between communication node 2 and communication node 5 ( cf . fig1 ) the data telegram 7 ( cf . likewise fig1 ) via the port a of communication node 2 . during the initialization phase of node 2 , i . e . during of the initial synchronization of the timer 11 which is running asynchronously the communication node 2 receives the data telegram 7 with the current desired timer value . this data telegram 7 will be received by the communication node 5 , i . e . its port h at port a of communication node 2 and forwarded from there to program 19 . likewise in program 19 the actual counter value from register 14 is entered . from program module 20 the corresponding actual timer and threshold values are then forwarded to program module 21 to determine the system deviation . to do this program module 21 accesses program module 22 during the initialization phase . this then generates the manipulated variable , i . e . the parameters s 1 and s 2 of the manipulated variable . these parameters will be written by program 19 into registers 15 or 16 . this adjustment is preferably not effective until the cycle signal has been issued , i . e . for the subsequent communication cycle . parameter s 1 specifies for such a subsequent communication cycle which of the clocks is to be influenced by the adjustment in the communication cycle . in this case for example this can involve a second , third or mth clock . parameter s 2 in register 16 by contrast specifies how to proceed with the clocks to be influenced . preferably the contents of register 16 are either 0 or 2 , i . e . an extension of the cycle is achieved by the timer 11 not being incremented for the clock concerned or a shortening of the cycle is achieved by the timer 11 being incremented by 2 at the clock concerned . it is not however mandatory for the adjustment by means of the parameters s 1 and s 2 to be undertaken in the very next communication cycle , it can also be undertaken in subsequent communication cycles . after the initialization phase , i . e . after the initial synchronization of the timer 11 which is initially running fully asynchronously , the program module 21 selects program module 23 for the adjustment which then creates the parameters s 1 and s 2 in accordance with the adjustment rules applicable for the operating phase . by this method of adjustment the extension or shortening of the communications cycle are distributed uniformly over the clocks during a communication cycle . in accordance with an alternative preferred embodiment the synchronization is undertaken during the initialization phase of the node not by adjustment , in which ( as in operation ) the number of clocks to be adjusted are uniformly distributed within the cycle . with the aid of a first synchronization telegram in the initialization phase the synchronization slave is by contrast first set “ rigidly ” to the value of the synchronization master . this is advantageous , in order , with a max . adjustment difference of a half isochronous cycle , not to obtain any unnecessarily long synchronization times . this is especially necessary for networks with a number of nodes , since otherwise oscillation effects can occur in the network under some circumstances , which may possibly not allow any adjustment at all and thereby no synchronization . fig3 shows a flowchart of an embodiment of the method in accordance with the invention . in step 30 a desired value of the time base of the relevant communication node is received from a clock pulse generator of the communication system . in step 32 a system deviation is determined from the difference between desired value and the actual timer value of the time base of the relevant communication node . in step 34 a manipulated variable for adjusting the time base , that is the duration of a communication cycle , is determined by means of an adjustment rule from the system deviation . the manipulated variable is determined in such a way here that the adjustment of the duration of the subsequent communication cycle is distributed as uniformly as possible over the clocks of the communication cycle . the actual adjustment of the communication cycle is undertaken in step 36 by activating the corresponding manipulated variables in the timer of the communications node concerned after issuing the cycle signal , i . e . at the beginning of the subsequent communication cycle . fig4 shows an example for the use of the adjustment method in accordance with the invention . a signal 24 of the synchronization master , i . e . the clock of the clock pulse generator node , is subdivided into cycles 25 . in each cycle 25 the timer of the clock pulse generator node counts from 0 to 9 , i . e . 10 clocks 26 are generated per cycle 25 . this provides the clock pulse generator time base for the synchronization of the communication cycles in the communication system . the signal 27 belongs to a synchronization slave , i . e . one of the communication nodes of the communication system , for which the time base is to be adjusted for synchronization of its communication cycles . the synchronization slave initially has a system deviation from the cycle of the synchronization master of two clocks . a corresponding manipulated variable is determined from this system deviation . the manipulated variable specifies whether within the next communication cycle this communication cycle must be extended or shortened and by how much the next communication cycle must be changed if necessary . in the example case considered here the subsequent communication cycle is to be extended by four clocks . this is to be done by repeating every second clock . the corresponding parameters s 1 and s 2 ( cf . fig2 ) are then s 1 = 2 and s 2 = 0 . it is particularly advantageous here that the additional four clocks are not simply appended to this cycle to extend it but are uniformly distributed within the cycle so that the subordinate cycle clock 28 varies at most by +/− one clock . this avoids cycle clock 28 of the communication cycle being extended disproportionately at the end of the communication cycle compared to other communication cycles . the outcome of this is that the subordinate higher frequency cycle clock 28 merely features a jitter of one timer clock within the communication cycle . the present invention is particularly advantageous in that it allows a distributed software / hardware control of the communication cycle , i . e . of what is referred to as the isochronous cycle , in real time capable network components , particularly ethernet switches . this makes it possible to dynamically adapt the control algorithms depending on the network characteristics or area of application in the field . in this case the adjustment in the initialization or startup phase of the communication system can be distinguished from the adjustment during operation . furthermore , because of the uniform distribution of the manipulated variable and the associated adjustment of the time base during a communication cycle subordinate cycles can also be adjusted . | 7 |
examples of the phenolic compounds of the previously described formula ( i ) employed as the color developers in the present invention are as follows : ______________________________________compoundno . structural formula______________________________________ ( 1 ) ## str4 ## ( 2 ) ## str5 ## ( 3 ) ## str6 ## ( 4 ) ## str7 ## ( 5 ) ## str8 ## ( 6 ) ## str9 ##( 7 ) ## str10 ## ( 8 ) ## str11 ## ( 9 ) ## str12 ## ( 10 ) ## str13 ## ( 11 ) ## str14 ## ______________________________________ the above phenolic compounds can be used in combination with conventional phenolic materials when necessary . the colorless or light - colored leuco dyes to be used in combination with the above phenolic compounds are , for example , as follows : examples of the fluoran compounds of the general formula ( ii ) are as follows : the above leuco dyes can be used alone or in combination . it is preferable that the phenolic materials of the formula ( i ) for use in the present invention be employed in an amount of 1 to 6 times the amount of the leuco dye . in the thermosensitive coloring layer of a thermosensitive recording material according to the present invention , the following binder agents can be employed : water - soluble organic polymers such as polyvinyl alcohol , methoxy cellulose , hydroxyethyl cellulose , carboxymethyl cellulose , polyvinyl pyrrolidone , polyacrylamide , polyacrylic acid , starch and gelatin ; and water emulsions of polystyrene , copolymer of vinyl chloride and vinyl acetate , and polybutyl methacrylate . furthermore , in the thermosensitive coloring layer , the following additives can be contained in the form of fine powder to obtain clear images : calcium carbonate , silica , barium sulfate and aluminum stearate . in order to increase the thermal sensitivity of the recording material , a variety of conventional thermo - fusible materials can also be employed . as the thermo - fusible materials , organic low - molecular - weight compounds , oligomers and polymers having appropriate melting or softening points can be employed . specific examples of such organic materials are animal waxes , vegetable waxes , mineral waxes , petroleum waxes and other synthesized waxes such as higher fatty acids , higher fatty amine , higher fatty acid amides , phenyl benzoate derivatives , crystalline alkylnaphthalenes , crystalline alkyldiphenyl derivatives and alkylphenyl derivatives . the thermosensitive recording material according to the present invention can be prepared with a variety of structures , including all the conventional structures in which the coloring reaction between a leuco dye and a color developer is employed . for instance , in the thermosensitive recording material according to the present invention , a leuco dye and the color developer can be supported on the same support material or they can be supported separately on two different support materials . in the case where a leuco dye and a color developer are supported on the same support material , a thermosensitive coloring layer comprising the leuco dye and the color developer is formed on the support material , with addition of a binder agent thereto , or a thermosensitive coloring layer comprising two layers , with the leuco dye contained in one layer , and the color developer contained in the other layer . in the case where a leuco dye and the color developer are separately supported on the support materials , those support materials are superimposed on each other in such a manner that the surface of one support material which bears the leuco dye and the surface of the other support material which bears the color developer come into contact with each other when thermal printing is performed . thereafter , the two support materials are separated , whereby color images are obtained in one support material . in other words , the present invention can be applied to any conventional thermosensitive recording materials which utilize the coloring reaction between a leuco dye and a color developer . the thermosensitive recording according to the present invention can also be used as a thermal - image - transfer - type thermosensitive recording material which comprises an image transfer sheet consisting of a support material and an image transfer layer formed on the support material , containing a leuco dye , and an image acceptor sheet consisting of a support material and an image acceptor layer formed on the support material , containing the color developer . in the case of the thermal - image - transfer - type recording material , the image transfer sheet is superimposed on the image acceptor sheet in such a manner that the image acceptor layer comes into contact with the image transfer layer of the image transfer sheet , so that thermal printing is performed on the front side or back side of the superimposed sheets , whereby the desired developed images are formed on the image acceptor layer of the acceptor sheet . the thermosensitive recording material according to the present invention can be prepared , for example , by application of a thermosensitive coloring layer formation liquid containing the above described components to a support material , for example , paper , synthetic paper or a plastic film , and by drying the same . when the leuco dye and the color developer are supported on two separate support materials , a leuco dye dispersion or solution and a color developer dispersion or solution are applied to each support material . the thermosensitive recording material according to the present invention can be employed in a wide variety of fields , particularly advantageously in the fields of thermosensitive recording label sheets and thermosensitive recording type magnetic tickets , utilizing the excellent stability of the developed images . when the thermosensitive recording material is employed as the thermosensitive recording label sheet , there is formed a thermosensitive coloring layer comprising one of the previously mentioned leuco dyes and one of the phenolic materials on one side of a support material , and on the other side of the support material , there is formed an adhesive layer , and a disposable backing sheet is attached to the adhesive layer . when the thermosensitive recording material is employed as the thermosensitive recording type magnetic ticket , the disposable backing sheet in the label sheet is replaced with a magnetic recording layer comprising as the main components a ferromagnetic material and a binder agent . the phenolic compounds of the previously described general formula ( i ) can be prepared without difficulty . for example , the compound no . 3 of the following formula was prepared as follows : ## str15 ## 6 . 4 g of sodium hydroxide was dissolved in 22 g of methanol . to this solution , 20 . 2 g of p - hydroxybenzenethiol was added . further , 9 . 42 g of 2 - hydroxy - 1 , 3 - dichloropropane was added dropwise to this mixture at room temperature . after the addition of the 2 - hydroxy - 1 , 3 - dichloropropane , the reaction mixture was heated for 2 hours under the condition that the methanol contained in the reaction mixture was refluxed . after this , the reaction mixture was cooled and freed of the methanol under reduced pressure . to the residue was added 500 ml of water . crystals were separated , which were filtered off , sufficiently washed with water and dried . the thus obtained crystals were recrystallized from a mixed solvent of toluene and ethyl acetate , so that 15 . 5 g of 1 , 3 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 - hydroxypropane ( compound no . 3 ) was obtained in the form of white crystals ( m . p . 108 °- 109 ° c .). the results of the elemental analysis of the product , 1 , 3 - di ( 4 - hydroxyphenylthio )- 2 - hydroxypropane , were as follows : ______________________________________ % c % h % s______________________________________found 58 . 51 5 . 18 20 . 68calculated 58 . 42 5 . 23 20 . 79______________________________________ embodiments of the thermosensitive recording material according to the present invention will now be explained by referring to the following examples . a dispersion a - 1 , a dispersion b - 1 and a dispersion c - 1 were separately prepared by grinding and dispersing the following respective components in a ceramic bowl for 2 days : ______________________________________ parts by weight______________________________________dispersion a - 13 -( n -- cyclohexyl - n -- methylamino )- 206 - methyl - 7 - anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60dispersion b - 11 , 3 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 - hydroxy - 20propane ( compound no . 3 ) 10 % aqueous solution of hydroxyethyl 20cellulosewater 60dispersion c - 1calcium carbonate 205 % aqueous solution of methyl cellulose 20water 60______________________________________ 10 parts by weight of the dispersion a - 1 , 30 parts by weight of the dispersion b - 1 , 30 parts by weight of the dispersion c - 1 and 10 parts by weight of a 20 % aqueous alkali solution of isobutylene -- maleic anhydride were mixed to prepare a thermosensitive coloring layer formation liquid . this thermosensitive coloring layer formation liquid was applied to the surface of a sheet of commercially available high quality paper ( 50 g / m 2 ) by a wire bar and was then dried , whereby a thermosensitive coloring layer was formed thereon . the deposition of the thermosensitive coloring layer on the sheet was in the range of 4 to 5 g / m 2 when dried . the thus prepared thermosensitive recording material was subjected to calendering , so that surface of the thermosensitive coloring layer was made smooth to the degree ranging from 500 to 600 sec in terms of bekk &# 39 ; s smoothness , whereby a thermosensitive recording material no . 1 according to the present invention was prepared . example 1 was repeated except that the dispersion b - 1 employed in example 1 was replaced by a dispersion b - 2 with the following formulation , whereby a thermosensitive recording material no . 2 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion b - 21 , 6 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 , 4 - 20dihydroxyhexane ( compound no . 10 ) 10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 1 was repeated except that the dispersion b - 1 employed in example 1 was replaced by a dispersion b - 3 with the following formulation , whereby a thermosensitive recording material no . 3 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion b - 31 , 4 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 , 3 - 20dihydroxybutane ( compound no . 8 ) 10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 1 was repeated except that the dispersion b - 1 employed in example 1 was replaced by a comparative dispersion cb - 1 with the following formulation , whereby a comparative thermosensitive recording material no . 1 was prepared . ______________________________________ parts by weight______________________________________comparative dispersion cb - 1bisphenol a 2010 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 1 was repeated except that the dispersion b - 1 employed in example 1 was replaced by a comparative dispersion cb - 2 with the following formulation , whereby comparative thermosensitive recording material no . 2 was prepared . ______________________________________ parts by weight______________________________________comparative dispersion cb - 2p - hydroxybenzoic acid benzyl ester 2010 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ the thus prepared thermosensitive recording materials no . 1 through 3 according to the present invention and the comparative thermosensitive recording materials no . 1 and no . 2 were subjected to thermal printing by use of a thermal printing test apparatus including thermal head ( made by matsushita electronic components co ., ltd .) under the conditions that the power applied to the head was 0 . 45 w / dot , the recording time per line was 20 msec , the scanning line density was 8 × 3 . 85 dots / mm , with the pulse width applied thereto changed to 3 steps of 1 . 6 msec , 2 . 0 msec , and 2 . 4 msec . the density of the developed images was measured by macbeth densitometer rd - 514 with a filter w - 106 . the results are shown in the following table 1 . table 1______________________________________ developed thermosensitive image density back - recording pulse width ( msec ) ground material 1 . 6 2 . 0 2 . 4 density______________________________________example 1 no . 1 0 . 94 1 . 25 1 . 28 0 . 10example 2 no . 2 0 . 92 1 . 22 1 . 27 0 . 09example 3 no . 3 0 . 92 1 . 23 1 . 27 0 . 10comparative no . 1 0 . 40 0 . 74 1 . 05 0 . 09example 1comparative no . 2 0 . 90 1 . 21 1 . 27 0 . 08example 2______________________________________ the thermosensitive recording materials with images printed thereon under the condition of the pulse width being 2 . 4 msec were allowed to stand at room temperature for one week and the image densities were measured again by the macbeth densitometer rd - 514 and were visually checked whether or not crystals ( or powder ) of the phenolic material were separated on the surface of the recording materials . the results are shown in table 2 . table 2______________________________________ thermosensitive separation of recording image density phenolic material after 1 week material______________________________________example 1 no . 1 1 . 29 noneexample 2 no . 2 1 . 28 noneexample 3 no . 3 1 . 29 nonecomparative no . 1 1 . 03 noneexample 1comparative no . 2 0 . 95 observedexample 2______________________________________ the thermal recording materials no . 1 through no . 3 according to the present invention and the comparative thermal recording materials no . 1 and no . 2 were subjected to thermal printing tests by use of a heat gradient test apparatus ( made by toyo seiki co ., ltd .) at 150 ° c . with a pressure of 2 kg / cm 2 and with a heat application time of 1 second , so that printed images were formed on each of the thermosensitive recording materials . to the printed images on the thermosensitive recording materials , there was applied cotton seed oil , and the recording materials were then allowed to stand for 24 hours to see whether or not the images were discolored or caused to disappear by the oil . the results are shown in the following table 3 . table 3______________________________________ thermosensitive discoloration recording or disappearance of material images______________________________________example 1 no . 1 substantially no discolorationexample 2 no . 2 substantially no discolorationexample 3 no . 3 substantially no discolorationcomparative no . 1 disappearedexample 1comparative no . 2 disappearedexample 2______________________________________ as can be seen from the above results , the thermosensitive recording materials according to the present invention are excellent in development performance in high - speed recording and provided images free from the white crystallization of the phenolic materials and discoloration by the oil and stabler in quality as compared with the comparative thermosensitive recording material examples . a dispersion a - 2 , a dispersion b - 1 and a dispersion c - 1 were separately prepared by grinding and dispersing the following respective components in a ceramic bowl for 2 days : ______________________________________ parts by weight______________________________________dispersion a - 23 - diethylamino - 6 - methyl - 207 - anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60dispersion b - 11 , 3 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 - hydroxy - 20propane ( compound no . 3 ) 10 % aqueous solution of hydroxyethyl 20cellulosewater 60dispersion c - 1calcium carbonate 205 % aqueous solution of methyl cellulose 20water 60______________________________________ 10 parts by weight of the dispersion a - 2 , 30 parts by weight of the dispersion b - 1 , 30 parts by weight of the dispersion c - 1 and 10 parts by weight of a 20 % aqueous alkali solution of isobutylene -- maleic anhydride were mixed to prepare a thermosensitive coloring layer formation liquid . this thermosensitive coloring layer formation liquid was applied to the surface of a sheet of commercially available high quality paper ( 50 g / m 2 ) by a wire bar and was then dried , whereby a thermosensitive coloring layer was formed thereon . the deposition of the thermosensitive coloring layer on the sheet was in the range of 4 to 5 g / m 2 when dried . the thus prepared thermosensitive recording material was subjected to calendering , so that surface of the thermosensitive coloring layer was made smooth to the degree ranging from 500 to 600 sec . in terms of bekk &# 39 ; s smoothness , whereby a thermosensitive recording material no . 4 according to the present invention was prepared . example 4 was repeated except that the dispersion a - 2 employed in example 4 was replaced by a dispersion a - 3 with the following formulation , whereby a thermosensitive recording material no . 5 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion a - 33 -( n -- ethyl - n -- isoamylamino )- 6 - methyl - 207 - anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 4 was repeated except that the dispersion a - 2 employed in example 4 was replaced by a dispersion a - 4 with the following formulation , whereby a thermosensitive recording material no . 6 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion a - 43 ( n -- methyl - n -- n - hexylamino )- 6 - methyl - 207 - anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 4 was repeated except that the dispersion a - 2 employed in example 4 was replaced by a dispersion a - 5 with the following formulation , whereby a thermosensitive recording material no . 7 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion a - 53 - di - n - butylamino - 7 -( o - chloroanilino )- 20fluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 4 was repeated except that the dispersion a - 2 employed in example 4 was replaced by a dispersion a - 6 with the following formulation , whereby a thermosensitive recording material no . 8 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion a - 63 -( n -- ethyl - n -- p - toluidino )- 6 - methyl - 7 - 20anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 4 was repeated except that the dispersion b - 1 employed in example 4 was replaced by a comparative dispersion cb - 1 with the following formulation , whereby a comparative thermosensitive recording material no . 3 was prepared . ______________________________________ parts by weight______________________________________comparative dispersion cb - 1bisphenol a 2010 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ the thus prepared thermosensitive recording materials no . 4 through 8 according to the present invention and the comparative thermosensitive recording material no . 3 were subjected to thermal printing tests by use of the heat gradient test apparatus ( made by toyo seiki co ., ltd .) at 150 ° c . with a pressure of 2 kg / cm 2 and with a heat application time of 1 second , so that printed images were formed on each of the thermosensitive recording materials . to the printed - images - bearing thermosensitive recording materials , there was applied cotton seed oil , and the recording materials were then allowed to stand for 24 hours to see whether or not the images and the background thereof were discolored or caused to disappear by the oil . the results were that in the thermosensitive recording materials no . 4 through no . 8 , the image areas were not discolored , and the background areas were not colored . in contrast to this , in the comparative thermosensitive recording material no . 3 , the background areas were not colored , but the image areas faded . the thermosensitive recording materials no . 4 through no . 8 according to the present invention and the comparative recording material no . 3 were subjected to thermal printing by use of a thermal printing test apparatus including a thermal head ( made by matsushita electronic components co ., ltd .) under the conditions that the power applied to the head was 0 . 45 w / dot , the recording time per line was 20 msec , the scanning line density was 8 × 3 . 85 dots / mm , with the pulse width applied thereto being 2 . 4 msec . the density of the developed images was measured by a macbeth densitometer rd - 514 . samples of the above thermosensitive recording materials with a size of 4 cm 2 were made so as to include image areas in the central portion thereof and were laid on a polyvinyl chloride film ( poly wrapper v - 300 made by the shin - etsu chemical industry co ., ltd .) with a load of 500 g / m 2 applied at room temperature for 24 hours . thereafter , the densities of the image areas of those samples was measured by a macbeth densitometer rd - 514 , so that the image densities of the samples before the above polyvinyl chloride film test and after the test were compared . the results were as shown in the following table 4 . table 4______________________________________ thermo - sensitive polyvinyl chloride film test recording image density image density material before test after test______________________________________example 4 no . 4 1 . 35 1 . 21example 5 no . 5 1 . 35 1 . 12example 6 no . 6 1 . 36 1 . 14example 7 no . 7 1 . 29 0 . 41example 8 no . 8 1 . 35 0 . 49comparative no . 3 1 . 29 0 . 30example 3______________________________________ in the thermosensitive recording materials no . 4 through no . 6 in examples 4 to 6 , as the leuco dyes , the fluoran compounds of the previously described formula ( ii ) were employed , while in the thermosensitive recording materials no . 7 and no . 8 , other fluoran compounds which were not covered by the formula ( ii ) were employed . from the above results , it can be seen that the thermosensitive recording materials employing the fluoran compounds of the formula ( ii ) yielded images which were more resistant to the polyvinyl chloride film than the images provided by the thermosensitive recording materials containing other fluoran compounds . according to the present invention , by use of the above described phenolic materials , thermosensitive recording materials with the following advantages over the conventional thermosensitive recording materials can be obtained : ( 1 ) high thermal sensitivity ( i . e . high thermal response ) is obtained , since no sensitizers or melting - point reducing agents are employed . due to the high thermal response , images can be recorded with high density and clearness in high speed recording . ( 2 ) since no sensitizers or melting - point reducing agents are employed , printed images do not substantially discolor with time , and high image contrast can be maintained . in other words , the quality of printed images is very stable . ( 3 ) since no sensitizers or melting point reducing agents are employed , no components come out from the thermosensitive recording material and accumulate on or adhere to a thermal head during thermal printing by use of a thermal printer with a thermal head , and no troubles such as trailing of images and ghost images take place , thereby attaining high recording performance . ( 4 ) by use of the phenolic compounds of the previously described formula ( i ), no fogging of the developed images takes place at room temperature , and there is no problem of an unpleasant phenolic odor as in other conventional phenolic compounds . thus , the recording materials according to the present invention are useful in practice . ( 5 ) the phenolic materials employed in the present invention as the color developer are readily available since they can be synthesized with higher yield and higher purity and at a comparatively lower cost , as compared with the conventional color developers . ( 6 ) by use of the phenolic compounds of the previously described formula ( i ), it does not occur that printed images discolor with time and components contained in the thermosensitive recording material separated out in the form of white crystals on the surface thereof during storage . thus , the printed images are very stable in quality . ( 7 ) by use of the phenolic compounds of the previously described formula ( i ), the printed images are resistant to finger prints , oils and plasticizers contained , for instance , in polyvinyl chloride film , thereby yielding thermosensitive recording materials with excellent and stable image quality . ( 8 ) by applying a thermosensitive coloring layer formation liquid prepared in accordance with the present invention to a sheet of thin base paper or to a film , an excellent thermosensitive copy sheet for use with an infrared lamp or a storobo flash can be prepared . ( 9 ) since the coating amount of the thermosensitive coloring layer formation liquid can be reduced , in comparison with the conventional thermosensitive recording materials , the manufacturing efficiency of the thermosensitive recording materials according to the present invention can be significantly increased as compared with the manufacturing efficiency of the conventional thermosensitive recording materials . | 1 |
the final extruded snack products of the invention are of expanded cellular construction and are characterized by a plurality of cell - defining walls . as indicated , the walls are made up of material including at least about 5 % by weight meat , and more preferably from about 7 . 5 - 15 % by weight meat . particularly preferred snack products have about 10 % by weight meat . the meat products can be selected from a variety of sources , but for reasons of costs and processability , the meat is selected from the group consisting of beef , pork and poultry . particularly preferred are the mechanically deboned poultry products . such extruded products are further characterized as having a moisture content of from about 1 - 10 % by weight , more preferably from about 2 - 6 % by weight , a specific gravity of from about 0 . 08 to 0 . 15 , and a bulk density of from about 5 - 9 pounds per cubic foot . moreover , they exhibit an instron compressibility rating of from about 1 . 0 - 5 . 0 kilograms force , as measured in a warner - bratzler shear cell , and have a water activity of less than 0 . 65 and preferably from about 0 . 2 - 0 . 4 . finally , the products of the invention have a protein content of from about 5 - 25 % by weight , more preferably from about 10 - 15 % by weight , and an as - extruded fat content ( i . e ., as the product exists after extrusion but before application of any topical flavorings or the like ) of from about 0 - 20 % by weight , more preferably up to about 4 % by weight , and most preferably below 3 % by weight by weight . the topical flavorings on the snack products of the invention are normally applied by spraying , and the quantity used typically ranges from about 0 . 1 to 0 . 5 % by weight of the total product . after such flavor coating , the products may be toasted using an impingement oven or similar device , in order to brown the surface of the snack pieces and enhance the crispness thereof . the snacks may assume virtually any desired shape which can be obtained via extrusion processing . for example , the products may be in the form of rods or cubes , and typically have a length of at least about 1 / 8 inch . alternately , the products may be in the form of rings or tubes . the extrusion process for fabricating the snack products of the invention involves first forming a mixture including at least about 15 % by weight meat ( such fraction including the normal moisture content of the meat being employed ), and more preferably from about 20 - 40 % by weight meat , and most preferably about 25 % by weight meat . the starting mixture also includes at least about 50 % by weight wheat flour , and more preferably from about 60 - 80 % by weight thereof . no additional moisture is required to be added to the starting mixture , if use is made of mdpm as a meat source . advantageously , the starting ingredients may be mixed in a preconditioner , without steam or water addition ; and the residence time in the preconditioner is preferably from about 60 - 180 seconds . in any event , the total moisture content of the mixture fed to the extruder should be from about 15 - 40 % by weight , and more preferably from about 20 - 30 % by weight . optional ingredients which may be added to the starting mixture include salt , surfactant , dextrose , fiber , antioxidants and sodium tripolyphosphate . these are normally present in very minor amounts of less than 5 % by weight . this mixture is then fed to the inlet of an extruder , most advantageously a twin screw extruder of the type commercialized by wenger manufacturing , inc . of sabetha , kans . as described previously , the starting ingredients for the mixture may be fed to a preconditioner apparatus to insure homogeneity of the final mixture , with the latter then being directed to the extruder inlet . during passage through the extruder , the mixture is subjected to elevated temperatures and pressures in order to cook and denature the meat protein of the mixture , and to form a final product . the maximum temperature of the mixture in the extruder barrel should be up to about 280 ° f ., more preferably from about 180 °- 250 ° f ., and most preferably from about 210 °- 240 ° f . the maximum pressure achieved in the extruder barrel should be up to about 2500 psig , and more preferably from about 500 - 1500 psig . the residence time of the mixture in the extruder barrel should be from about 10 - 60 seconds , and more preferably from about 15 - 45 seconds . as the material emerges from the endmost extruder die , it is normally cut via a rotating knife , with the knife speed determining product length . thereafter , the cut extrudate is directed to a dryer for drying the product down to essentially the final product moisture . a conventional multiple - stage dryer may be used to good effect for this purpose , with drying conditions being variable . after drying , the product may be flavored by the topical application of liquid or solid flavoring such as described previously . thereafter , if desired , the product may be subjected to a toasting process . the products of the invention exhibit a number of important properties making them eminently suited as desirable snacks . for example , they are relatively high in protein and low in fat , and are therefore nutritionally advantageous . moreover , because of the low moisture and water activity inherent in the products , there is virtually no possibility of microbial growth . as a consequence , the products of the invention , when properly packaged , should remain completely edible for many months . finally , when use is made of low cost ( at present prices about 17 cents per pound ) mdpm as a meat source , a high quality meat snack is provided which can be flavored to meet the dictates of consumer preference while still giving enhance nutritional benefits . these advantages are present in the invention largely because of the relatively high wheat flour content of the product , coupled with the relatively low fat content thereof . the following examples set forth a series of extrusion runs for the fabrication of snack products in accordance with the invention . it is to be understood that these examples are provided by way of illustration only , and nothing therein should be taken as a limitation upon the overall scope of the invention . in this series of tests , two starting mixtures were employed , namely a wheat flour based mixture having 97 % by weight wisdom wheat flour , 1 % by weight salt , 0 . 5 % by weight dimodan p . v . surfactant and 1 . 5 % by weight dextrose ; and a meat mixture including 93 . 98 % by weight mechanically deboned chicken product ( surimi ), 5 % by weight carboxymethyl cellulose ( fiber ), 0 . 5 % by weight sodium tripolyphosphate , 0 . 5 % by weight chicken flavoring , and 0 . 02 % by weight bht antioxidant . in extrusion mixture no . 1 , 75 % by weight of the wheat mixture was added to 25 % by weight of the meat mixture ; in extrusion mixture no . 2 , 73 . 16 % by weight of the wheat mixture was added to 26 . 34 % by weight of the meat mixture , and an additional 0 . 50 % by weight of chicken flavoring was added . in runs 1 and 2 , the respective extrusion mixtures were fed first to a conventional preconditioner ( mixing cylinder ) and then into the inlet of a wenger model tx - 52 twin screw extruder commercialized by wenger manufacturing , inc . of sabetha , kans . in run 3 , no preconditioner was used , and the material as fed directly to the tx - 52 . this type of extruder is described in u . s . pat . no . 4 , 875 , 847 , which is incorporated by reference herein . the tx - 52 extruder was equipped with a total of six heads , with heads 2 - 6 being jacketed for the introduction of heat exchange media in order to indirectly heat or cool the material passing through the extruder . the media included water ( w ), warm water ( w / temp ), or hot oil ( ho / temp ). the outlet end of the extruder was provided with a die spacer and a final apertured die . the internal screw of the extruder was equipped with two sets of spaced shearlock elements and a final , triple flighted conical screw adjacent the die . the specific die employed consisted of a wenger model no . 74010 - 271 backup die plate , together with a wenger model no . 55372 - 101 final die insert holder equipped with a pair of wenger model no . 74010 - 466 stainless steel die inserts . the backup die plate has two sets of circularly arranged apertures ( 8 per set , 5 / 32 &# 34 ; diameter ) respectively oriented in alignment with each of the extruder screws . the insert holder includes a pair of insert - receiving openings , while each insert includes a conical passage leading to a final die opening having a 5 / 32 &# 34 ; diameter . this die arrangement is typically used for breading products . the extrusion conditions recorded for this series of runs are set forth below : ______________________________________extruder : tx - 52 run # 1 run # 2 run # 3______________________________________extruder screw speed - rpm 406 403 403temp / control 2nd head w w wtemp / control 3rd head w w w / 63 ° f . temp / control 4th head ho ho ho / 87 ° f . temp / control 5th head ho ho ho / 128 ° f . temp / control 6th head w / w / w / 154 ° f . 149 ° f . 152 ° f . water to extruder 25 25 25 ( brooks ) extruder % load 25 % 25 % 30 % feeder rpm 11 11 13mixing cyl rpm 305 305pressure head # 5 psig 100 100 100extruder stability good good goodproduct stability good good goodformula no . 1 1 2______________________________________ in another series of runs , the extrusion mixture no . 1 described above was used , except that after drying , the extruded products were spray - coated with external flavorings , namely pork ( runs 1 and 2 ), chicken ( run 3 ) and beef ( run 4 ). the starting extrusion mixtures were fed to a preconditioner and then into the inlet of a model tx - 52 twin screw extruder , and in this instance having a total of nine heads , of which nos . 2 - 9 were jacketed for introduction of heat exchange media . the internal screw included a conical terminal screw section and was configured for a bread stick - type product . the final die was identical to that described in connection with example i . the data derived from this series of runs is set forth below . __________________________________________________________________________ run # 1 run # 2 run # 3 run # 4__________________________________________________________________________raw material rate pph 120 . 00 120 . 00 120 . 00 120 . 00feed screw speed rpm 11 11 11 11mixing cylinder rpm 300 300 300 298speedmoisture entering mcwb 20 . 70 23 . 44 23 . 21extruderextruder shaft speed rpm 400 397 396 398motor load % 40 30 25 31water flow to extruder ppm 0 . 090 0 . 500 0 . 400 0 . 350control / temperature ° f . w / 84 w / 86 w / 84 w / 862nd headcontrol / temperature ° f . w / 84 w / 86 w / 84 w / 863rd headcontrol / temperature ° f . ho / 106 ho / 118 ho / 127 ho / 1364th headcontrol / temperature ° f . ho / 111 ho / 126 ho / 133 ho / 1425th headcontrol / temperature ° f . ho / 108 ho / 86 ho / 176 ho / 866th headcontrol / temperature ° f . w / 70 w / 75 w / 70 w / 727th headcontrol / temperature ° f . w / 70 w / 75 w / 70 w / 728th headcontrol / temperature ° f . w / 158 w / 147 w / 140 w / 1449th headhead / pressure psig 8 / 550 8 / 300 8 / 250 8 / 300head / pressure psig 9 / 900 9 / 600 9 / 500 9 / 600knife drive speed rpm 6 7 7 7extrudate moisture mcwb 16 . 48 26 . 74 32 . 01 23 . 50final product pork pork chicken beefdescription stick stick stick stick__________________________________________________________________________ the extrudate from these runs was flavor - coated and then dried in a multiple pass dryer using an air temperature of 280 ° f ., with a retention time , first pass , of 7 . 5 minutes ; a retention time , second pass , of 7 . 5 minutes ; and a cooler retention time of 3 . 8 minutes . the moisture analyses of run 1 indicated that the product exiting the preconditioner had a moisture content of 20 . 7 % by weight mcwb ( moisture content , wet basis ); the extrudate prior to coating had a moisture content of 16 . 8 % by weight mcwb ; and the product after coating had a moisture content of 3 . 85 % by weight mcwb . in the case of run 2 , the extrudate had a moisture content of 26 . 74 % by weight mcwb and a moisture content after coating of 12 . 21 % by weight mcwb . in run 3 , the material from the preconditioner had a moisture content of 23 . 44 % by weight mcwb , the extrudate had a moisture content of 32 . 01 % by weight mcwb , and the product after coating had a moisture content of 11 . 33 % by weight mcwb . finally , in the case of run 4 , the moisture contents recorded after preconditioning , extrusion and coating were respectively 23 . 23 %, 23 . 50 % and 8 . 71 % by weight mcwb . the run 1 product exhibited a very large cell structure and was cut into 2 . 5 inch pieces as it emerged from the die . the run 2 product exhibited an excessively hard bite , indicating the need for changing the moisture content of the material in the barrel . runs 3 and 4 exhibited only minimal expansion . in a final series of tests , a formula identical with extrusion mixture no . 1 described above and using chicken flavoring was used , with various types of wheat being employed . the purpose of these tests was to determine which wheat variety gave the most optimum snack product . it was determined that soft white winter wheat gave the best product , although all wheats tested gave an acceptable snack . the most preferred run from this series of tests was conducted using a nine head wenger tx - 52 twin screw extruder and a wenger model mdl 1 dc preconditioner configured for relatively long retention time . the drawing figure is a schematic representation of the preferred dual screw configuration used in the tx - 52 . as shown , each screw 10 includes a series of axially interconnected screw sections with a number of spaced shearlock element sets 12 . a cut flight screw section 14 is also included , together with a high shear cone nose screw section 16 . the die assembly was a wenger back - up assembly , including a model 55361 - 001 back - up die plate and 55372 - 113 final die insert holder . a loop die ( 3 / 4 &# 34 ; diameter insert presenting an annular opening having an outer diameter of 5 . 75 mm , a pin diameter of 3 . 15 mm and an open area of 18 . 17 sq . mm ) formed a part of the die assembly giving an annular product . the extrusion and drying conditions recorded for this preferred run are set forth below : ______________________________________moisture 25 . 0raw material rate pph 128 . 00feed screw speed rpm 15 . 0mixing cylinder speed rpm 221steam flow to mixing cylinder ppm 0 . 0water flow to mixing cylinder ppm 0 . 0discharge temp . ° f . ambientdischarge moisture % 25 . 0shaft speed rpm 407motor load % 33zone temperature 2nd head ° f . w / 104zone temperature 3rd head ° f . w / 104zone temperature 4th head ° f . ho / 221zone temperature 5th head ° f . ho / 230zone temperature 6th head ° f . ho / 230zone temperature 7th head ° f . w / 122zone temperature 8th head ° f . w / 122zone temperature 9th head ° f . w / 189pressure - 9th head psig 700pressure - die psig 900knife drive speed rpm 6extrudate moisture % 17 . 9product rate lbs / hr 115 . 0dryer temperature ° c . 154retention time - top flight minutes 3 . 7retention time - bottom flight minutes 6retention time - cooling flight minutes 5 . 1______________________________________ the dried extrudate was then coated with various flavorings , including taco and cheese flavorings . this was accomplished by simply spraying a conventional coating mixture on the outer surface of the dried extrudate at levels of from about 0 . 1 to 0 . 5 % by weight . portions of these sprayed products were then subjected to toasting in an ordinary kitchen toaster oven ( temperature of about 250 ° f .) in order to crisp the surface of the products . the dried , flavored , and toasted extrudate products were then tested and determined to have a moisture content of 4 . 4 % by weight , and ash content of about 2 . 4 % by weight , a protein content of about 17 . 7 % by weight , and a fat content of about 0 . 5 % by weight . in addition , chicken flavored products made as outlined in this example were tested by a sensory panel for crispness , mouth feel and acceptability ; and were subjected to a tba ( thiobarburic acid ) rancidity test . the dried product had a crispness rating of 7 . 0 , a mouth feel rating of 7 . 5 , an acceptability rating of 7 . 5 , and tba results of 0 . 236 . the toasted product had a crispness rating of 8 . 0 , a mouth feel of 7 . 8 , an acceptability of 7 . 9 and tba results of 0 . 298 . the standard error of the means in all cases was 0 . 1 . in this example , 15 extruded samples of the type described in the foregoing operative example iii were analyzed for physical properties , namely , sectional , longitudinal and volumetric expansion , bulk density , specific gravity and instron compressibility . an additional 7 representative samples were tested for compressibility . section , longitudinal and volumetric expansion indices developed by alvarez - martinez , et al . ( j . food sci . 53 : 609 ) were used to characterize expansion of the products obtained in this study . sectional expansion index ( sei ) is a measure of radial expansion of the extrudate and is the ratio of the cross - sectional area of the extrudate to the cross - sectional area of the die . longitudinal expansion index ( lei ) is a measure of expansion in the axial direction and is described by the following equation : ## equ1 ## where a d is the open area of the die in square meters , l se is the specific length of the extrudate in m / kg , ρ d is the density of the dough behind the die ( assumed to be constant and equal to 1 , 200 kg / m 3 , and mc d and mc e are the moisture contents of the dough and extrudate , respectively . volumetric expansion index ( vei ) takes into account sei and lei to describe the expansion on a volumetric basis ( vei = sei × lei ). fifteen pieces from each treatment were measured for the expansion indices and the results are shown in the table below . bulk density was determined by filling a one liter volume container to level full capacity with product and weighing it in grams and converting it to lbs / ft 3 ( factor : 0 . 0624 ). bulk specific gravity is defined as the weight of a given volume of product relative to the weight of an equal volume of water at 4 ° c . thus , the gram / liter bulk density of the product was divided by 1 , 000 grams / liter bulk density of water to yield specific gravity . the results are shown in the table below . instron compressibility was determined with a warner - bratzler shear cell according to the method of faubion and hoseney ( cereal chemistry 59 : 529 , 1982 ). the warner - bratzler shear cell is attached to the instron universal testing machine and used to shear across the extruded tube perpendicular to its long axis ( or perpendicular to the axial direction of extrusion ). the cross - head speed was set at 5 cm / min . and the results expressed as the maximum force in kg required to shear through the piece . ______________________________________ bulk instron com - sample density specific pressibility # sei lei vei lb / cu . ft gravity kg force______________________________________ 1 11 . 30 0 . 49 5 . 54 7 . 67 0 . 12 3 . 85 2 4 . 22 0 . 45 1 . 92 7 . 33 0 . 12 3 . 60 3 7 . 96 0 . 54 4 . 27 7 . 21 0 . 12 1 . 25 4 9 . 22 0 . 56 5 . 19 7 . 32 0 . 12 4 . 00 5 10 . 31 0 . 56 5 . 77 7 . 30 0 . 12 2 . 80 6 10 . 50 0 . 47 4 . 98 7 . 02 0 . 11 4 . 05 7 10 . 05 0 . 43 4 . 35 6 . 99 0 . 11 3 . 95 8 8 . 64 0 . 53 4 . 60 6 . 72 0 . 11 4 . 15 9 13 . 25 0 . 56 7 . 38 6 . 77 0 . 11 2 . 2010 10 . 74 0 . 55 5 . 90 6 . 53 0 . 10 4 . 3511 8 . 48 0 . 53 4 . 54 6 . 76 0 . 11 1 . 8512 10 . 93 0 . 55 5 . 99 6 . 74 0 . 11 1 . 5013 8 . 45 0 . 48 4 . 07 6 . 66 0 . 11 2 . 0514 9 . 91 0 . 55 5 . 43 6 . 62 0 . 11 3 . 2515 10 . 75 0 . 46 4 . 98 6 . 55 0 . 10 1 . 9016 1 . 3017 2 . 0518 1 . 7519 1 . 7520 1 . 6021 0 . 9522 4 . 45______________________________________ accordingly , it was determined that products in accordance with the invention should have a sectional expansion index of from about 3 - 15 , and more preferably from about 7 - 13 ; a longitudinal expansion index of from about 0 . 3 - 0 . 7 , and more preferably from about 0 . 4 - 0 . 6 ; and a volumetric expansion index of from about 1 . 5 - 9 , and more preferably from about 4 - 7 . 5 . | 0 |
as depicted in fig1 , publisher 1 has a database 11 , and a dgg 12 . database 11 holds the content 5 . dgg 12 is a hardware that allows the publisher 1 to encrypt / decrypt data . the encryption mechanism of 12 has two layers , the inner layer lock 121 and the outer layer lock 122 . publisher 1 always uses the pocket lock 6 and pocket key 7 for encryption / decryption when sending or receiving messages through the internet . the network manager is a network service center that supports a database 21 containing an isbn table 211 and a device serial number table 212 . the network service center 2 assigns an isbn lock when presented with a novel isbn by the publisher and keep the record in table 211 . the pubnetmanager 2 also obtains the device lock 31 and key 311 from the device manufacturer and keeps the record in table 212 . the pubnetmanager 2 also uses pocket lock 6 and pocket key 7 for encryption / decryption when sending or receiving messages from the internet . digibookstore , dgb 3 is a specialty server designed for bookstores . it can store encrypted digital contents 5 from the publisher 1 for sale to consumers . when a consumer buys a digital content 5 , dgb can relay the isbn and device serial numbers , provided by the buyer , to the pubnetmanager 2 and request the isbn key 1221 and the device lock 31 . dgb always uses pocket lock 6 and key 7 for encryption / decryption to protect transmitted files when using the internet to communicate . upon receipt of the isbn key 1221 and device lock 31 , dgb will release the isbn lock and replace the encryption with device lock 31 for the content 5 . content 5 , thus encrypted , are ready for download by the consumer . digireader , dgr 4 is a device built for the consumer to decrypt the encrypted content 5 and display the information . dgr 4 has a flash memory 41 and a decryption chip 42 . the flash memory is for the storage of content 5 downloaded from the dgb 3 and the decryption chip 42 contains a specific device key 311 and the publisher key 1211 for device lock 31 and publisher lock 121 . fig1 a illustrates the interactive flow between the publisher and the pubnetmanager . publisher 1 , when publishing a content 5 , produces digital content 100 and assigns an isbn number 101 , and stores the information in a content database 102 . the publisher encrypts in a pocket lock 103 and dispatch the file through the internet to the pubnetmanager 104 . pubnetmanager 2 will decrypt the pocket lock with her pocket key 200 to obtain the isbn number and assign an isbn lock 201 to the number , and store the information in the isbn table 202 . the pubnetmanager 2 will also encrypt a copy of the isbn lock in a pocket lock 203 and dispatch the file to the publisher via the internet 204 . upon receipt of the package from the pubnetmanager the publisherwill open the pocket lock 105 , and install the isbn lock into dgg 106 . dgg 12 has a two layer structure ; the inner layer , the publisher lock 121 , comes preinstalled by the manufacturer and the outer layer is the isbn lock 122 . fig1 b illustrates the interactive flow between the publisher 1 and the digibookstore . before sending the digital content 5 to the bookstore 3 , publisher 1 will secure the content with the dgg 12 encryption facility and , after the input of the isbn number and payment information 110 , protect the file with a pocket lock encryption 111 and then will dispatch the file to the dgbvia internet 112 . upon receipt of the file , bookstore 3 will release the pocket lock 300 and store the content file in dgb for purchase by consumer 301 . fig1 c illustrates the interactive flow between bookstore and consumer . buying content 5 , consumer will provide the isbn number of the content and the serial number of his dgr to the dgb 320 . dgb will secure the information with a pocket lock encryption 321 and request , via internet 322 , the pubnetmanager 2 for the isbn key and the device lock 323 . pubnetmanager 2 , upon receipt of the file , will release the pocket lock with pocket key 220 and search the isbn table for the corresponding isbn key and the device lock 221 . retrieving both , pubnetmanager 2 will secure the information with a pocket lock encryption 222 and send the file , via internet , to the dgb 223 . dgb 3 , upon receipt of the file , will release the pocket lock with a pocket key 324 , and obtain the isbn key and device lock 325 . with the isbn key , dgb will release the isbn lock 326 and replace the outer layer with the device lock 327 . the resulting encrypted content is ready for downloading into the flash memory of the consumer 328 . ( flash memory 41 can be either replaceable or embedded .) fig1 d illustrates the flow when buyer uses dgr to access the content . consumer places his flash memory 41 into the device , dgr 4 , for access to the content 400 using the embedded chip for decryption 401 . the content 5 , encrypted with the inner publisher lock 121 and the outer device lock 122 , is released of its device lock 402 and , then , of its publisher lock 403 and becomes available to the consumer 404 . other devices 4 or computers cannot access nor copy the content . fig2 illustrates a digireader , a device 4 with a core processor and a decryption chip . the device shall contain , in the minimum ; a cradle for flash memory 411 , using a proprietary interface , digipub , for access to the content in the flash memory ; a decryption chip 42 with a two layer structure , the inner key being publisher key and the outer layer being the device key . the decryption uses matryoshka architecture , a layered structure ; a core processor 43 , capable of processing the digital content codes into image , sound , video , and , after decryption , for display ; control buttons 44 ; allow users to choose the functions of device 4 ; a flat panel display 45 , for the display of decrypted content ; and fig3 illustrates the digibookstore 3 , a specialty server built for bookstores capable of storing encrypted digital content . the server contains , in the minimum ; database memory 311 , with a database containing the encrypted digital content from publishers ; a core processor 312 , processing the receiving and storing of the digital content and other information from publishers ; a pocket lock / key mechanism , for the automatic encryption / decryption of files when using the internet ; a flash memory cradle 314 , using a proprietary dg pub interface , for the downloading of digital contents into flash memories equipped with the same interface ; a second flash memory cradle 315 , using the proprietary dg pub interface , for the downloading / deletion of digital content files in the flash memory in the secondary market ; a cache memory region 316 , for the temporary storage of digital contents in the secondary market ; a flat panel display 318 , for the display of input and / or received information . fig4 illustrates the network service center operating pubnetmanager 2 . the service center can manage the information concerning the devices and the content isbn numbers . the center contains , in the minimum ; a network manager database 21 , storing the isbn number table 211 and the device serial number table 212 ; a core processor 22 , for the processing of the data concerning the device and the content isbn ; a pocket lock / key mechanism 23 , for the encryption / decryption of files transmitted through the internet ; an input keyboard 24 , for the operators to input information ; and a monitor 25 , for the display of received / input information . fig5 illustrates digiguard , a hardware device for the publishers to encrypt / decrypt . the device contains , in minimum ; an encryption mechanism 120 , which uses matryoshka ( one inside another ) type encryption method , with the publisher key 121 being the inner key ; a core processor 123 , for the processing of information including the requesting of isbn lock 122 to be the outer layer lock and the encryption of digital content : a pocket lock / key mechanism 124 , for encryption / decryption of files to be transmitted through the internet ; and an input keyboard 126 , that allow the operators to input commands . if there are seller and buyer , the transaction in the secondary market can be carried out with digibookstore 3 . during the transaction , the seller &# 39 ; s device lock on the digital content needs to be replaced with the buyer &# 39 ; s device lock to allow access to the digital content 5 by the buyer . the following describes the process : seller 91 of digital content 5 places the flash memory 912 of his device 911 onto the specific cradle of dgb 3 and input the serial number of his device and the isbn number of the content 5 into the cache memory region of dgb 3 . dgb 3 will relay the information to the network service center and request for the device key 9131 of the seller and the buyer &# 39 ; s device lock 923 , as well as the price and other information . the file will be secured with a pocket lock 6 before transmission over the internet . upon receipt of the file , pubnetmanager 2 will release the pocket lock 6 with her pocket key 7 and obtain the isbn number and device number , with which to search for the price and other information corresponding to the isbn number from the isbn table 211 , and for the seller &# 39 ; s device key 8131 and buyer &# 39 ; s device lock 923 from the device serial number table 212 . pubnetmanager 2 will secure the price and other information and seller &# 39 ; s device key 9131 and buyer &# 39 ; s device lock 923 with a pocket lock and dispatch the file to the dgb 3 via internet . upon receipt of the file , dgb 3 will release the pocket lock 6 with pocket key 7 and obtain the seller &# 39 ; s device key 9131 and buyer &# 39 ; s device lock 923 . dgb will , then use seller &# 39 ; s device key 9131 to release seller &# 39 ; s device lock 913 and replace it with buyer &# 39 ; s device lock 923 . the digital content can , then , be downloaded into the flash memory 922 of the device 921 of the buyer 92 . buyer 92 can now display the content with his device 921 . the decryption chip of his device will release the buyer &# 39 ; s device lock 923 and the publisher lock 924 to make available digital content 5 , which he bought from the secondary market . ( seller and buyer &# 39 ; s publisher keys are identical and needs no replacement .) if bookstore 3 is interested in a transaction even if seller 91 cannot find a buyer 92 temporarily , the bookstore can transplant the content into one of its own device with the aforementioned mechanism . when a buyer 92 is found , the same mechanism can be used to transplant the content into buyer &# 39 ; s device 921 . many changes and modifications in the above described embodiment of the invention can , of course , be carried out without departing from the scope thereof . accordingly , to promote the progress in science and the useful arts , the invention is disclosed and is intended to be limited only by the scope of the appended claims . | 6 |
we describe an attachment method for a heat sink , according to an embodiment of the present invention . as will be shown , the present embodiment changes the mechanical boundary conditions of the heat sink to allow slowly varying relative motion while still providing mechanical support for shock inputs . this is accomplished by changing the method of heat sink attachment , such that mechanical motion is limited under shock but provides compliance for thermal expansion . as such this will reduce the heat sink / package mechanical interaction due to the mismatch of the coefficients of thermal expansion ( cte ) for those materials . a cte mismatch occurs when the heat sink material experiences thermal expansion at a different rate than that of the frame . this is one of the main causes of package deformation . referring now in specific detail to the drawings , and particularly fig3 a there is shown a side view of a chip package assembly 300 with attached heat sink 302 . according to an embodiment of the present invention , pads 312 and 314 are fabricated from a highly damped elastomeric material such as those commercially available as c - 1105 from ear specialty composites . these materials are also viscoelastic in that they exhibit both the properties of a viscous liquid which “ flows ” at slow deformation speeds and an elastic solid at higher speeds . these materials have a frequency dependent elastic modulus which increases at higher frequencies , thus becoming stiffer if the load changes quickly . fig3 b shows a top view of the chip package assembly 300 . the elastomeric material is used in the x and y pads 314 and 318 at the corner mounts of the heat sink 302 to control motion of the heat sink 302 in the x and y directions as well as the z pads 312 at the bottom side of the heat sink 302 corners to control motion in the z direction . as shown in fig3 b the x and y pads 314 and 318 are disposed at the corner mounts , positioned between the heat sink 302 and the horizontal limit stops 316 . pads 312 are also positioned between the heat sink 302 and the vertical stops 308 . the viscoelastic material is sufficiently rigid that it limits mechanical motion in the presence of shocks ; yet it provides compliance sufficient to handle the thermal expansion mismatch of the heat sink / package 300 . the positioning of the pads will reduce the effects of shock from x , y , and z forces exerted on the heat sink 302 . positioning the pads 314 at the bottom only will limit the effects from a z force shock only . the key advantages of employing the pads 312 , 314 , 318 at the corner mounts and the bottom of the heat sink 302 are : 1 ) they allow mechanical motion from thermal expansion ; and 2 ) they restrict mechanical motion due to shock . the key aspects of the pads are the viscoelastic properties of the material used and the positioning of the pads with respect to the heat sink 302 . fig3 c presents a detailed view of one corner of the the chip assembly package 300 of fig3 a and 3 b . this view shows the corner of the heat sink 302 which is abutted by pads 314 and 318 which may be , for example , attached to the limit stop 316 and the heat sink 302 with an adhesive glue . when a force f 2 is applied to the heat sink 302 , pad 318 is compressed . however , as the elastic modulus of the pad 318 is frequency dependent , the restoring force would depend upon the frequency of the applied force . for slowly varying forces such as would occur with thermal expansion , pad 318 would be soft , but for higher frequency forces the pad 318 would be very stiff . this allows the heat sink 302 to expand due to temperature changes , but provides constraint of the heat sink 302 for high frequency forces . note that pad 314 experiences a shear force during the applied force f 2 and allows movement of the heat sink 302 both for thermal and high frequency forces . for a force f ( 320 ) in the x , y plane the pad 314 would experience a force f 1 = f cos ( θ ) and pad 318 would experience a force f 2 = f sin ( θ ). each pad would respond as described above . as the package may experience a force in any arbitrary direction , the heat sink 302 can experience a force which has components in the x , y and z planes . as shown in the three - dimensional ( 3d ) view of fig4 , the pads in the z direction will compress when a force has a downward z component . the clamp 304 holds the center of the heat sink 302 in the z direction and applies a downward bias force on the pads 312 which prevents the heat sink from lifting off the chip 320 when there is an upward z component . to minimize the deflection of the pad 312 to the bias force a higher modulus elastomer may be deployed or the pad thickness may be reduced . in one example the dimension of the pads may measure 5 mm by 5 mm and have a thickness of 1 mm . another embodiment is shown in fig5 a in which ball bearings 504 allow the heat sink 502 to move in a horizontal direction while limiting motion in the vertical direction . fig5 b illustrates how the horizontal motion is impeded by pads 514 secured to horizontal stops 516 . the pads 514 are viscoelastic as shown in fig4 . the ball bearings 504 are secured by braces 506 attached to the horizontal stops 516 . note that these bearings 504 are only at the bottom , not the sides . fig6 shows a close - up view of one of the ball bearings 504 . the arrows encircling the ball bearing 504 indicate how the ball bearing 504 can rotate , or spin , while remaining in a fixed position . the heat sink 502 is in contact with the top portion of the ball bearing 504 . a slight horizontal motion of the heat sink 502 will produce a swiveling of the ball bearing 504 . the horizontal stops 516 with the pads 514 attached will constrain the heat sink 502 from excessive movement . it should be understood that what has been discussed and illustrated serves to provide examples of the possible embodiments within the spirit and scope of the invention ; they should not be construed to limit the invention . one with knowledge in the art , after following the discussion and diagrams herein , can employ any viscoelastic material having the same properties as c - 1105 bearings from ear , or flexures properly positioned at the corner mounts as discussed above to provide the advantages of a reduction in package deformation while allowing for limited mechanical motion due to thermal expansion . another approach to limit mechanical motion in the presence of shocks and / or vibrations while allowing for slow thermal expansion is to deploy active servo control of the heat sink . h . newton , newton &# 39 ; s telecom dictionary , 22 nd edition , copyright © 2006 harry newton , defines a servo as : “ servo : short for servomechanism . devices which constantly detect a variable , and adjust a mechanism to response to changes .” another embodiment of the present invention is shown in fig7 wherein active servo control is employed to constrain the movement and / or expansion of a heat sink 702 . voice coil motors are used to actuate the heat sink 702 . fig7 shows one example of a voice coil motor 728 which controls the x motion of one corner of the heat sink 702 . each voice coil motor includes : a voice coil 726 mounted onto the heat sink 702 and a magnetic circuit consisting of permanently affixed magnets 720 and 722 , with flux return paths and mechanical assembly to hold the magnets in place 724 . the servo method of heat sink constraint differs from the previously described embodiments in that there may be no actual contact made between the heat sink 702 and the board 744 . this is indicated in fig7 by the gaps 799 . fig8 shows a top view of the assembly of fig7 with z direction voice coil motors 710 and 712 . fig8 also shows the voice coils for the x and y directions , 724 , 726 and 734 and 736 , in opposite corners , which are part of the voice coil motor assembly . for example 726 is the voice coil for voice coil motor 728 as shown in fig7 . gap sensors 735 , 737 , 725 , 727 measure the location of the heat sink 702 edge to a fixed frame in the x and y directions . similarly , gap sensors 704 and 706 measure the location of the heat sink 702 to the frame 744 in the z direction . one example of gap sensors may include proximity sensors using well known capacitance or eddy current measurement methods . the capacitance between two plates is proportional to 1 / d , where d is the gap between the plates , thereby the gap can be measured by measuring c and computing 1 / c . the voice coil motor and gap sensors are used in a servo loop to control the location of the heat sink 702 relative to the frame 744 . as shown in fig8 two vertical axis voice coil motors 710 and 712 are disposed in opposite corners of the top frame 744 to maintain the z height of the heat sink 702 relative to the frame 744 . for example , a z position signal z gap 704 is compared to a z gap target and the difference between the z gap target and z gap 704 will create an error signal as shown in fig1 which is input to the servo controller gc which produces a signal to control the current to the physical plant gp which includes z voice coil motors 710 and heat sink 702 . the current applied to z voice coil motor 710 will produce a force on the heat sink 702 to actuate it in the + z or − z direction until the z gap value is equal to the target value . similarly a second servo loop using z gap 706 would be running in parallel , which for example may have a z gap target 706 equal to the z gap 704 target 704 , to maintain the heat sink 702 parallel to the frame 744 . to maintain the x and y position of the heat sink 702 , horizontal axis voice coils 724 , 726 are deployed in one corner of the heat sink 702 and voice coils 734 and 736 are deployed in the opposite corner of the heat sink 702 . these voice coils are part of a voice coil motor assembly , an example of which is shown in fig7 as 728 . a position signal from the difference of gap x = xgap 735 − xgap 725 can be generated by measuring the gap in the x direction using xgap sensors 735 and 725 and taking the difference between the two signals . similarly , by monitoring the gap in the y direction using y gap sensors 737 and 727 a position signal can be generated from the difference of gap y = ygap 737 − ygap 727 . these signals are input to the servo control system as shown in fig1 . for example , gapx would be compared to a gapx target , which for example may have a value of zero such as would occur when xgap 735 is equal to x gap 725 and the heat sink 702 is centered with respect to the center of the frame 744 . the difference between the gapx and gap x target will create an error signal as shown in fig1 which is input to the servo controller , gc , which produces a signal to control the current to gp , the physical plant , which includes the voice coil motor and heat sink 702 . the current applied to the voice coils 726 , 736 to produces a force on the heat sink 702 to actuate it in the + x or − x direction until the gapx value is equal to the gap x target value . referring to fig9 there is shown an exploded top view of voice coil motor ( vcm ) 728 located in the right quadrant of fig8 . this vcm produces a motion of the heat sink 702 in the x direction when a current is applied to the voice coil 726 . the vcm is comprised of permanent magnets 720 and 722 , each of which is made of two magnets with reverse polarity . the magnets 720 and 722 and flux return plates 721 , 723 are held in place by a non - magnetic mechanical fixture 724 . when a current passes through the coil 726 , the coil experiences a force in the + x or − x direction dependent on the direction of the current and transfers that force to the heat sink . similarly a current passing through voice coil 736 applies a force in the x direction on the opposite corner of the heat sink 702 . the coils 726 and 736 are attached to the heat sink 702 and using the servo control system the heat sink 702 will remain centered with respect to the frame 744 in the x direction as previously described while allowing thermal expansion of the heat sink 702 . similarly , when using the servo control system with voice coils 724 and 734 , the same control of the heat sink 702 in the y direction can be achieved . in the z direction , the gap 799 between the heat sink 702 and the frame 744 will be held to a predetermined target value , such that the heat sink 702 remains parallel to the frame 744 . therefore , while there have been described what are presently considered to be the preferred embodiments , it will be understood by those skilled in the art that other modifications can be made within the spirit of the invention . solutions which combine elements of the described solutions including using mechanical and servo control systems are also possible . | 8 |
with continued reference to the drawing figures , the coating solution supply assembly 10 of the present invention is shown mounted to a standard or other support 11 adjacent to a conventional sugar pan unit 12 . the sugar pan unit includes a base 13 to which is rotatable mounted a somewhat cylindrical pan 14 which is inclined such that the inner chamber 15 defined thereby is angled upwardly relative to the vertical such that product “ p ” is contained beneath an opening 16 and within the chamber of the pan . the pan 14 is a conventional coating pan of the type which may enable processing of anywhere up to several hundred pounds of product . the pan is mounted on a rotating shaft 18 , fig2 driven by a motor ( not shown ) mounted within the base 13 . to harden the solution which is introduced into the pan 14 , a drying air duct 20 is provided having a nozzle portion which extends into the chamber 15 , as shown generally in fig5 and 6 . the configuration of the drying duct and nozzle may be varied depending upon the coating process . each duct is connected to a central source of either hot or cold drying air . in the drawing figures , the coating solution supply assembly is shown as being mounted to a fixed standard 11 . it should be noted that the assembly may also be mounted to moveable supports so that each assembly may be moved from one pan to another , as may be required , or so that the relationship between assemblies may be altered depending upon the environment in which the coating process is taking place . each coating solution supply assembly includes a coating solution supply container 24 in which a coating solution “ s ” is retained . the container may include appropriate markings to indicate the volume content of solution . the solution is withdrawn from the container 24 and pumped through a distribution header 25 which extends inwardly of the chamber 15 of the coating pan 14 . the distribution header may include a plurality of spray or drip nozzles 26 which , in some embodiments , may include adjustable control valves 28 . the metering and supply of the solution is controlled by a pan pump 30 which is mounted to the standard 11 . the pan pump 30 is a double piston metering pump including a metering chamber or cylinder 32 and a pumping or coating solution supply chamber or cylinder 34 . a first metering piston 35 is mounted within the metering chamber 32 in such a manner that it may be adjustable relative to an elongated piston rod 36 . in the drawing figures , the piston 35 is shown as being threadingly engaged with a threaded portion 37 of the piston rod 36 such that rotation of the piston rod relative to the piston will vary the effective stroke length of the piston 35 within the chamber 32 . in this manner , the effective stroke length of a second piston 38 mounted within a pumping or coating solution supply chamber 34 is adjusted . the piston 38 is mounted to the upper end of the piston rod 36 such that the piston 38 and the piston 35 move simultaneously with one another . the piston rod extends through an elongated seal 39 which extends between the cylinders 32 and 34 so as to prevent contamination of the cylinder chamber 34 . the movement of the metering piston 35 is controlled by a pair of pneumatic lines 40 and 42 which extend through openings 43 and 44 , respectively , into the chamber 32 . each of the pneumatic lines are connected to a solenoid valve 45 which controls an air supply to the lines . the valve is electrically connected to a controller 50 which is connected to an appropriate on - off switch 48 . the controller 50 may be used to control the effective stroke and thus the quantity of solution which is to be pumped into the chamber 15 of the pan 14 during each pumping cycle of the pan pump 30 as well as to control the supply of drying air . as shown in drawing fig4 and 5 , a fluid inlet line 52 extends within the solution supply container 24 and is connected to an inlet 54 into the chamber 34 through a first one - way check valve 55 . when the piston 38 is moved away from the inlet 54 , a partial vacuum is created within the chamber 34 thus drawing the coating solution “ s ” from the container 24 and into the chamber 34 . the stroke is effectively controlled by the metering piston 35 and its movement within the chamber 32 . in fig5 the piston 34 is being driven downwardly by a pneumatic source such as air supplied through pneumatic line 42 . air below the piston is bled from the lower portion of the chamber through pneumatic line 40 which functions as an exhaust line until the effective downward stroke of the piston 35 is achieved . at this point in time , the valve 45 is reversed thus driving air through the pneumatic line 40 and moving the piston 35 upwardly and thus moving the piston 38 upwardly so as to discharge solution “ s ” from within the coating solution supply chamber 34 . the solution is prevented from entering the container 24 because of the one way check valve 55 . the discharging fluid passes through a second one - way check valve 56 and into the distribution header 25 wherein the solution is introduced within the chamber 15 by way of the nozzles 26 . as previously discussed , the effective amount of coating solution can be controlled not only by predetermining the position of the piston 35 within the chamber 32 but also by varying the effective stroke length of the piston 35 by way of air supplied to the metering chamber 32 . pumping of the solution from the chamber 34 is illustrated in drawing fig6 . also shown in fig5 and 6 is a source of lubricant and cleansing agent which is introduced in a cyclic manner into the lower portion of the solution pumping chamber 34 . the solution is contained within an enclosed container 60 which is connected by supply line 62 through an inlet opening 64 in the side wall of the chamber 34 . the fluid may be a vegetable oil type fluid which is utilized to provide both a lubricant source within the pumping chamber as well as a cleansing source . it should be noted that as opposed to applying a single outlet 54 from the pumping chamber 34 , a separate inlet may be provided for drawing solution “ s ” from the container 24 through check valve 55 into the chamber 34 and a separate outlet may be provided to which the check valve 56 is connected so that fluid is discharged through the separate outlet to the distribution header 25 . utilizing the apparatus of the present invention , the controller 50 is utilized as a timer . an initial determination is made to set the position of the metering piston 35 relative to the piston rod 36 . the controller 50 also includes a connection to a drying air controller 70 . whenever solution is being introduced into the chamber 15 of the pan 14 , the dryer is normally deactivated so as to allow a predetermined residence or distribution time of the solution within the product “ p ” prior to drying air being introduced to affect drying . utilizing the pan pump 30 of the present invention , no contamination of the coating solution is possible as the metering is effectively accomplished in the lower portion of the pan pump with the metering piston 35 operating within the metering chamber 32 . therefore , the sterility of the coating solution is maintained throughout the coating process . utilizing the present invention , uniform quantities of solution are introduced into the pans 14 and the distribution time of the solution within the product and the drying time is accurately assured thereby insuring uniformity of the coated product from one pan to another . the foregoing description of the preferred embodiment of the invention has been presented to illustrate the principles of the invention and not to limit the invention to the particular embodiment illustrated . it is intended that the scope of the invention be defined by all of the embodiments encompassed within the following claims and their equivalents . | 5 |
the multiplier in the present invention is hardware implemented on an asic ( application - specific integrated circuit ) or fpga ( field - programmable gate array ) and operates on a b - bit data bus . a number of bits b is qualified hereafter by the term “ machine word ”. the bus size is often a power of 2 . the numbering base r is defined as being equal to 2 b . the modulus is an odd number saved as t n machine words . and finally , r is defined as a power of the numbering base , where r is greater than the modulus n . a number x can be broken down in the base r as t + 1 digits x i as follows : x = x 0 + x 1 . r + x 2 . r 2 + . . . + x t . r t , where each digit x i is the size of a machine word . the multiplier in the present invention uses two numbers x and y to calculate x . y . r − 1 mod n + e . n , where e is a value dependent on x and y , and between 0 and r / 2 . the operation x . y . r − 1 mod n is the montgomery modular multiplication . the multiplier thus performs a montgomery modular multiplication and an additive masking of the result of this multiplication . as the value e depends on x and y , when the input values x and y are already masked by a random value before being used by the multiplier , the result is itself also masked by a random value . the multiplier thus propagates the masking of the input data . according to an implementation variant , the value e depends on a random variable independent of x and y . before performing multiplications , a value , designated n ′, is precalculated : n ′=− n − 1 mod r . the multiplication result is designated s . the digits of a number n in the base r are designated n i . the montgomery modular multiplication with additive masking of the result is calculated through the following process : i . s ← x 0 . y ii . for i ranging from 0 to t n − 1 , do : a . m i ← s 0 . n ′ mod r b . s ← x i . y +( m i . n + s )/ r iii . m tn ← s 0 . n ′ mod r iv . z ← x 0 xor x 1 xor . . . xor x tn xor y 0 xor y 1 xor . . . xor y tn v . s ← z . n +( m tn . n + s )/ r where the values m i are the intermediate coefficients of the calculation . the role of the fourth stage ( iv ) is to provide a pseudo - random value z dependent on x and y . the process for calculating this pseudo - random value z given in the above example may be changed to combine the numbers x and y differently . the fifth stage ( v ) includes the uncertainty generated during the previous stage , in the multiplication result . as the number added ( z . n ) is a multiple of n , the modified result is congruous with the result as it would have been generated by a conventional process . the stage ( ii . b .) ( s ← x i . y +( m i . n + s )/ r ) is the most costly in terms of calculation time . it can be performed by a sequence of two multiplication - addition operations , the first multiplication - addition being s ←( m i . n + s )/ r , and the second multiplication - addition being s ← x i . y + s . each multiplication - addition is performed by a loop , and the first multiplication - addition differs from the second by a division by r . according to an implementation method , the loop performed by the second multiplication - addition is as follows : c = 0 for j ranging from 0 to t n , do : p ← p i q j + v j + c s j ← lsb ( p ) c ← msb ( p ) where s designates the multiplication - addition result p i . q + v , and c is a carry variable . during the modular multiplication stage ( ii . b . ), the value p i is replaced by x i , the value q is replaced by y and the value v is replaced by s . the basic operation p ← p i q j + v j + c is performed with p i , q j , v j , where c ranges from 0 to r − 1 . the intermediate result p is thus between 0 and r 2 − 1 , and is expressed as two digits . the expression lsb ( p ) designates the low order digit , and msb ( p ) the high order digit of the number p . unlike a multiplication - addition operating on unmasked numbers , where q n is equal to 1 or less , the multiplication - addition implemented by the device in the present invention performs an operation on a digitn of between 0 and r / 2 in the last iteration of the loop ( when j = t n ),. the value s n + 1 can thus be greater than 2 . the first multiplication - addition s ←( m i . n + s )/ r is performed similarly to the second multiplication - addition but also shifts the result by b bits towards the lower order bit . this shift is equivalent to a division by r . the multiplication - addition with a shift is performed as follows : c = 0 for j ranging from 0 to t n , do : p ← p i q j + v j + c s j − 1 ← lsb ( p ) c ← msb ( p ) during the modular multiplication stage ( ii . b . ), the value p i is replaced by m i , the value q is replaced by n and the value v is replaced by s . thus , for the iteration j = t n , n j = 0 by definition of t n , and thus p ≦ 2 ( r − 1 ), implying msb ( p )≦ 1 . the loop is thus , give or take an index shift , close to the loop corresponding to the second multiplication - addition , allowing the implementing of a component able to perform two loops to be considered . a multiplier can notably break the operation p i q j + v j + c down into ( p i q j + v j )+ c , by pipelining the multiplication - addition operation ( p i q j + v j ) and adding the variable c as the results are obtained . fig1 is an example of the multiplication - addition cell used in the masked modular multiplication in the present invention . the cell calculates the two multiplication - addition operations described above . it is pipelined to improve its performance . the pipeline involves adding register barriers between the logic phases to reduce the critical path , and thus increase the maximum operating frequency ( theoretically that of a base r adder ). the pipeline depth of an elementary component is defined by its number of internal registers . the output register is not counted . the example given in fig1 assumes the availability of a pipelined multiplier - adder 1 , of depth p . it notably includes a set of logic - register pairs ( ii , ri ). the number p of these pairs is notably chosen to ensure that the maximum frequency f 1 max of the pipelined multiplier - adder is not less than the adder &# 39 ; s maximum frequency f 2 max , the values of these two frequencies being as similar as possible . the maximum operating frequency of the multiplier - adder is given by the inverse of the run time of the multiplication - addition operation , whereas the maximum operating frequency of the pipelined multiplier - adder is given by the inverse of the execution time of only one of the p stages . for optimum operation , the adder &# 39 ; s maximum frequency is determined , which gives the adder &# 39 ; s run time and the multiplier - adder is broken down into p stages with a throughput time not exceeding , but as close as possible to , the adder &# 39 ; s run time . the inputs of the multiplier - adder 1 correspond to three digits : p i , q j and v j and the output is a pair of digits corresponding to lsb ( p i q j + v j ) and msb ( p i q j + v j ). the output is two digits long . the multiplier - adder results are sent to a three - input adder , referenced 2 : digit + digit + carry ← digit + carry , operating over 1 cycle ( pipeline 0 ) at a frequency of f 2 max . the register temp corresponds to the storing of c required for the following calculation : add c to the next lsb and the previous carry . the data ( digits of p × q + v ) are thus output in series at each cycle , with the low order digit first , in the same direction as the carry propagation . the operation s n = c + v n + 1 can be performed by an adder , not shown in the figure , using b − 1 bits + 1 bit = b bits and not 2 bits + 1 bits = 3 bits , as in a conventional device , since v n + 1 may be greater than 2 . the other stages in the montgomery modular multiplication process with additive masking of the result can be implemented using conventional registers and multiplexers . a multiplier performing a modular multiplication as per the montgomery method is described in the patent request published under the number wo2006103288 . the stages in the masking process in the present invention can be readily implemented in a device including a multiplication - addition cell as described above . the pseudo - random number can be generated by a logic component with two inputs and one output , with the first input receiving the first operand x to be multiplied , the second input receiving the second operand y to be multiplied , and the output producing a combination of x and y , such as a number equal to x xor y , for example , where xor designates the binary exclusive or operation . the pseudo - random number z obtained from this logic component can then be combined with n in a multiplier to provide a multiple pseudo - random of n , equal to z . n . fig2 is a schematic diagram of the use of a multiplier implementing the masking process in the present invention by an algorithm making use of the modular multiplication operation . during the algorithm execution , all the multiplications performed operate on numbers , all obtained from a few fixed initial values . by way of example , four initial values designated h , x , d and s are used to generate all the other values used in the algorithms . in an initial first stage 21 , an additive masking is implemented on these initial values h , x , d and s . the masked values h m , x m , d m , and s m are obtained as follows : hm = h + e h . n ; x m = e x . n ; d m = e d . n ; s m = e s . n ; where e h , e x , e d , e s , are random values between 0 and 2 p . in practice , the value p should preferably at least be equal to 63 for the additive masking to be effective . in a second stage 22 , the algorithm is executed by making use of the multiplier in the present invention , as many times as necessary . no change to the algorithm is required , and all the results produced by the multiplier in the present invention are masked , allowing the algorithm to process the masked data only . after the algorithm is executed , a “ unmasking ” operation is applied , in a third stage 23 , to the masked values 231 to find the results which would have been obtained without masking . this operation can , for example , be implemented by the multiplier in the present invention by choosing specific input values . the use of the device illustrated in fig2 shows that the values used in the calculations are uncorrelated from the initial values . as a consequence , an attacker analyzing physical magnitudes during the algorithm execution can thus no longer , through a judicious choice of input variables , locate the secret data used during the calculation . in a conventional device , for example , an attacker can choose an input variable including a large number of ‘ 0 ’ or a large number of ‘ 1 ’, and then analyze the electrical consumption to determine a relationship between the input variables and the consumption and / or deduce the type of operations performed by the algorithm . through the use of additive masking , these long initial sequences of ‘ 0 ’ or ‘ 1 ’ are eliminated in the operands used by the algorithm , thus reducing any assumptions that the attacker may have been able to make as regards any input variables selected by the attacker himself . the extra overhead in terms of calculation time and , in the case of a hardware integration , circuit surface area , is very low . the multiplier block advantageously allows algorithms to be executed on numbers of any size without changing the hardware implementation . a multiplier synthesized in fpga or asic and implemented in the present invention performs multiplications on any modules 128 , 256 , 512 , 1024 , and 2048 bits in size , for example . one of the advantages of the process in the present invention is that it can be implemented in a cryptographic calculation component existing transparently as far as the component architecture is concerned . indeed , the conventional modular multiplication calculation operator only has to be replaced by an operator implementing the process in the present invention . the replacement of this elementary operation then globally improves the component protection , since the functions used by security mechanisms such as encryption or authentication make use of the operator in the present invention . it will be readily seen by one of ordinary skill in the art that the present invention fulfils all of the objects set forth above . after reading the foregoing specification , one of ordinary skill in the art will be able to affect various changes , substitutions of equivalents and various aspects of the invention as broadly disclosed herein . it is therefore intended that the protection granted hereon be limited only by definition contained in the appended claims and equivalents thereof . | 6 |
fig1 shows an exemplary substantially rectangular shaped web having substantially parallel top and bottom edges , 100 a and 100 b that can be used in the present invention . other starting web configurations can be used . the web can be made from paper or polymeric films . suitable polymeric films include , but not limited to , polyethylene terephthalate , polypropylene , and polyethylene , and copolymers thereof . in one embodiment , the thickness of the web is less than about 0 . 2 mm . the web can be light transmissive , meaning that it will allow at least a portion of incident light through , or it can be opaque . furthermore , the web can be colored . the web material should be able to adhere to the adhesive used on the substrate . fig2 shows a top plan view of the web of fig1 after a portion of the web has been excised and perforated . a perforated web 110 has an overall length l and an overall width w . the web includes a plurality of open sections or cutouts 112 interposed between a plurality of retained sections 114 connected to carrier sections 116 . the carrier sections of the perforated web include substantially parallel top and bottom edges 110 a and 110 b that correspond to the top and bottom edges of the predecessor web 100 of fig1 , namely edges 100 a and 100 b . in this particular embodiment , the perforated web 110 has an upper carrier section that includes the top edge 110 a to the perforation 118 lying closest to the top edge and the lower carrier section that includes the bottom edge 110 b to the perforation 118 lying closest to the bottom edge . the retained sections have substantially the same geometry , each in the form of substantially an “ x ”. while fig2 shows perforations 118 disposed on the retained sections , they can also be disposed between the carrier section and the retained section , or on the carrier section . the perforations span from one open section to the next adjacent open section . the perforations typically include slits on the web lying between ties . the perforation design should be selected so that the separation of the carrier section does not dislodge the retained sections from the adhesive . in one embodiment , the perforated web based on the design of fig2 has a first width , w 1 , of about 4 inch ( 10 . 2 cm ), a second width , w 2 , of about 2 . 5 inch ( 6 . 4 cm ), and a third width , w 3 , of about 0 . 2 inch ( 5 mm ). the third width denotes the distance from an inner surface of the carrier , 116 a , to the perforation . the web 110 also has a length l 1 of about 2 . 5 inch and a length l 2 , which denotes one dimension of the retained section , of about 0 . 27 inch ( 6 . 9 mm ). in this particular embodiment , the perforation includes two ties , each of 0 . 010 inch ( 0 . 25 mm ) in length disposed between three slits . the three slits consist of a long slit , a short slit , and a long slit , with the long slit being 0 . 078 inch ( 2 . 0 mm ) in length and the short slit being 0 . 0321 inch ( 0 . 82 mm ) in length . thus , from one open section to the next , the perforation on the retained section can be described as a long slit , a tie , a short slit , a tie , and a long slit . while the foregoing description of the perforation of fig2 is useful , other designs can be used . for example , another perforation design includes a short slit , a tie , a long slit , a tie , and a short slit . furthermore , three or more ties can be used along with long and or short slits therebetween . fig3 shows a bottom plan view of an exemplary substantially rectangular shaped substrate having opposing first ( not shown ) and second 202 surfaces and top and bottom edges , 200 a and 200 b . adhesive 204 is disposed on the second surface proximate to the top edge . in this particular embodiment , the adhesive is in generally in the form of a stripe having substantially parallel upper and lower edges , 204 a and 204 b respectively . in one exemplary embodiment , the substrate is a sheet of easel paper . in some embodiments , the width of the adhesive stripe varies from 7 . 6 to 0 . 32 cm . in other embodiments , the width of the adhesive stripe varies from 7 . 6 to 2 . 5 cm . in one embodiment , the thickness of the substrate is less than about 0 . 5 mm . any type of adhesive can be used for the substrate and the adhesive can cover any portion of the substrate . in one embodiment , the adhesive is a microsphere - based repositionable pressure sensitive adhesive . the repositionable adhesive can be solvent based , water based , or can be a solventless , hot melt adhesive . suitable repositionable adhesives includes those disclosed in the following u . s . pat . no . 3 , 691 , 140 ( silver ); u . s . pat . no . 3 , 857 , 731 ( merrill et al . ); u . s . pat . no . 4 , 166 , 152 ( baker et al . ); u . s . pat . no . 4 , 495 , 318 ( howard ); u . s . pat . no . 5 , 045 , 569 ( delgado ); u . s . pat . no . 5 , 073 , 457 ( blackwell ); u . s . pat . no . 5 , 571 , 617 ( cooprider et al . ); u . s . pat . no . 5 , 663 , 241 ( takamatsu et al . ); u . s . pat . no . 5 , 714 , 327 ( cooprider et al . ); u . s . pat . re no . 37 , 563 ( cooprider et al . ); u . s . pat . no . 5 , 756 , 625 ( crandall et al . ); u . s . pat . no . 5 , 824 , 748 ( kesti et al . ); and u . s . pat . no . 5 , 877 , 252 ( tsujimoto et al .). in another embodiment , the repositionable pressure sensitive adhesive is polyacrylate - based microsphere adhesive . fig4 shows a bottom plan view of the substrate of fig3 with the perforated web 110 of fig2 disposed on the adhesive region of the substrate . in one exemplary method , the web 110 is aligned with the adhesive 204 of the substrate such that the perforations 118 on the perforated web substantially coincides with at least one of the upper and lower edges of the adhesive . fig4 a shows a bottom plan view of a substrate 400 , similar that of substrate 200 of fig3 , laminated to a perforated web 310 . the substrate has a stripe of adhesive 404 on its second side 402 . the web includes a plurality of open sections or cutouts 312 interposed between a plurality of retained sections 314 connected to upper and lower carrier sections 316 . the retained sections have substantially the same geometry , each in the form of substantially a rectangle . perforations 318 are disposed between the carrier section , the retained sections . the perforations span from one open section to the next adjacent open section and align with the top and bottom edges of the adhesive stripe of the substrate . specifically , the patterned and perforated web of this figure includes substantially rectangular open sections , each having dimensions of 2 . 5 by 2 . 0 inch ( 6 . 4 by 5 . 1 cm ). the distance between one open section to the next adjacent open section is 0 . 25 inch ( 6 . 4 mm ). the corners of the open section are rounded to a 0 . 25 inch radius . and , the distance between a top and a bottom perforation is about 2 . 1 inch ( 5 . 3 cm ). the design of the perforations is very similar to that described in fig2 . thus , a wide variety of designs can be used for the perforated web . fig5 shows a cross - sectional view of the embodiment of fig4 taken along line 5 - 5 showing substrate 200 having opposing first and second surfaces , 201 and 202 . disposed on the second surface of the substrate is adhesive 204 having top and bottom edges 204 a and 204 b . the patterned and perforated web includes retained section 114 attached to carrier section 116 . interposed between the retained sections are open sections 112 . this cross - sectional view better shows that the retained portion 114 has a certain thickness , denoted as s 1 , which function to space or separate an exposed surface 204 c of adhesive 204 from contacting an adjacent surface . thus sheet 200 can be handled and moved across the adjacent surface without adhering thereto by adhesive 204 . examplary adjacent surfaces include , but are not limited to , another sheet , a desktop , or a wall . in this way , the retained sections , which are non - adhesive forms a part of a securing mechanism , allowing the sheet to exhibit adhesion on demand . fig6 shows the embodiment of fig4 where the upper and lower carrier sections are being removed at the perforation . typically the carriers are discarded after they have been removed . in one method , after the perforated web 110 has been attached to the adhesive 204 of the substrate , such a composite is laminated together using pressure and or heat to adhere more securely the web 110 to the adhesive . upon removal of the carrier , the retained sections , which now have been effectively laminated to the adhesive , will not lift off when the carrier section is being removed . fig7 shows the embodiment of fig6 with both carrier sections removed leaving retained sections 115 ( also referred to herein as “ non - adhesive sections ”) with portions spanning substantially from the upper edge 204 a to the lower edge 204 b of the adhesive as well as substantially the entire length of the adhesive stripe . this figure shows that the retained sections are in the form of a plurality of discrete “ x ”. here , both legs of the “ x ” shaped retained section span from the top edge 204 a of the adhesive to the bottom edge 204 b of the adhesive . furthermore , the retained sections span nearly the entire length of the adhesive portion . other configurations can be used . for example , the retained sections can be in the form of geometric shapes that are substantially circles , squares , rectangles , other polygons , and combinations thereof . furthermore , the line can be a continuous line a broken line , meaning that adhesive is exposed in between breaks in the line . fig8 shows another exemplary perforated web 510 having a plurality of open sections 512 interposed between a plurality of retained sections 514 connected to carrier sections 516 . the perforated web includes an upper carrier section that includes a top edge 510 a and a lower carrier section that includes a bottom edge 510 b . this particular design of the perforated web 510 facilitates the carrier section removal step . in one embodiment , a plurality of substrates such as that of fig7 is assembled together to form a pad of substrates as shown in fig9 . such a construction is typical of an easel pad 700 , typically having 25 to 50 sheets of the substrate 720 stacked and bound together at one end 701 , usually near the end of the adhesive region . the presence of the discrete sections disposed on the adhesive allows the sheets to be stacked without one sheet becoming substantially adhesively attached to the next subsequent sheet and thus the removal of a sheet can be done under substantially lower peel force . furthermore , as a plurality of these sheets is used , e . g ., for transcribing notes of a meeting , they are typically removed and displayed on a wall . at the end of the meeting , one participant usually collects the used sheets , stack them together , and optionally roll the sheets into a cylindrical tube for easy transport . the stacked sheets will typically not adhere to one another , unless a threshold force has been applied to the adhesive region . this adhesive on demand property provides the consumer with an added ease of use feature . a rotary die cutting apparatus available from webtron corp ., ft . lauderdale , fla ., equipped with a vacuum trim removal system was used to make a 4 . 0 inch ( 10 . 2 cm ) wide and a 0 . 002 inch ( 0 . 05 mm ) thick general purpose polyethylene terephthalate available from grafix plastics , cleveland , ohio perforated web having the pattern shown in fig2 having open sections and retained sections attached to a carrier . in this example , the excising of the web and the perforation of the web occurred using the same rotary die and done in one step . the perforated web was contacted to an adhesive stripe of a sheet of post - it ® self - stick easel pad , product no . 559 , commercially available from 3m company , st . paul , minn . the perforated web was attached to the sheet of easel paper such that the perforations substantially nearly coincided with a top and a bottom edge of the adhesive stripe . thereafter , the carrier of the patterned and perforated web was manually separated , collected , and discarded leaving the discrete retained sections behind with the sheet of easel paper . a patterned and perforated web was made as in example 1 , except that the resulting web had a design substantially similar to web 310 shown in fig4 a . the patterned and perforated web was laminated to a sheet of post - it ® self - stick easel pad , product no . 559 as in example 1 and the carrier of the web was separated leaving discrete retained sections behind with the sheet of easel paper . although specific embodiments of the present invention have been shown and described , it is understood that these embodiments are merely illustrative of the many possible specific arrangements that can be devised in application of the principles of the invention . numerous and varied other arrangements can be devised in accordance with these principles by those of ordinary skill in the art without departing from the spirit and scope of the invention . thus , the scope of the present invention should not be limited to the structures described in this application , but only by the structures described by the language of the claims and the equivalents of those structures . | 2 |
in the following , exemplary embodiments of the present invention will be described in detail . it is to be understood that the following description is given only for the purpose of illustrating the principles of the invention and is not be taken in a limiting sense . rather , the scope of the invention is defined only by the appended claims and not intended to be limited by the exemplary embodiments hereinafter . it is to be understood that the features of the various exemplary embodiments described herein may be combined with each other unless specifically noted otherwise . fig1 shows schematically a device 10 which may be connected to a server 50 via a network 30 . a connection 20 between the device 10 and the network 30 may be a wireless connection , for example a gsm , umts , gprs or bluetooth connection . however , connection 20 may be any other kind of wireless or wired connection . connection 40 between the network 30 and the server 50 may be also any kind of wireless or wired connection . the device 10 may be any kind of mobile or stationary or non - portable device , for example a mobile phone , a mobile audio reproduction device , an mp3 player , a mobile navigation system , a notebook , a laptop , or a stationary personal computer . in the following , it will be assumed that the device 10 is a mobile device , e . g . a mobile phone . the device 10 comprises a radio frequency transceiver 11 , a user interface 12 , a processing unit 13 , a memory 14 , and a head phone connector 15 . instead or additionally to the head phone connector 15 , the device 10 may provide one or more loudspeakers . additionally , the device 10 may comprise additional components , for example a display , a keypad , a loudspeaker , a microphone , and so on , but these components are not shown in fig1 to simplify matters . the processing unit 13 is connected to the radio frequency transceiver 11 , the user interface , the memory 14 , and the head phone connector 15 . the radio frequency transceiver 11 may utilize a data communication between the processing unit 13 and the server 50 via a wireless connection 20 and the data communication network 30 . the memory may be used to store a plurality of audio files which may be played back by the processing unit as audio data which may be output via the head phone connector 15 . additionally , the processing unit 13 may be adapted to download or stream audio data from the server 50 and to play back the downloaded or streamed audio data via the head phone connector 15 . for downloading or streaming music from the server 50 , a user of the device 10 may be prompted in advance via the user interface 12 for allowing access to the server 50 . operation of the processing unit 13 will now be described in more detail in connection with fig1 and 2 . assuming a user of the device 10 wants to set up a list of audio files , a so - called playlist , the user selects via the user interface 12 a menu 200 as indicated in fig2 . the menu 200 shows a list of artists of the audio files which are stored in memory 14 or which may be accessible by the processing unit 13 via the network 30 at the server 50 . as shown in fig2 , the list of artists comprises five artists 201 - 205 . in case more artists are present , an additional ( not shown ) scroll bar may be used to extend the list of artists . for each artist a selection box 211 - 215 is provided . with appropriate input means , for example a mouse or a stylus and a touch screen , the user can select for each artist the number or quantity of titles or tracks to be added to the playlist from this artist by adjusting the number of titles in the corresponding selection box 211 - 215 . in the example shown in fig2 , the user selects six titles to be played from “ the beatles ”, two titles to be played from “ bon jovi ”, and four titles to be played from “ linkin park ”. according to this user selection , the processing unit 13 selects automatically the respective quantity of titles from the audio files stored in memory 14 . as shown in the exemplary embodiment of fig2 , six titles from “ the beatles ”, two titles from “ bon jovi ” and four titles from “ linkin park ” are selected from the audio files stored in memory 14 . if for example more than six titles from “ the beatles ” are present in the memory 14 , the processing unit may for example select six audio files randomly from the more than six beatles audio files . however , the selection may also be based on user - preferred audio files , for example , the processing unit 13 may select those files from the beatles audio files to which the user was listening in the past most frequently . after the user has selected for each of the artists 201 - 205 a desired number of tracks or titles , a new playlist is set up . the titles within the playlist may be mixed randomly or may be re - arranged by the user before the audio files of the playlist are played back by the device 10 . another embodiment of the present invention will be described below in connection with fig1 and 3 . fig3 shows a menu 300 displaying a user a list of artists 301 - 305 . selection boxes 311 to 315 assigned to the artists 301 - 305 enable the user to select how many minutes of music from the respective artist shall be added to a playlist . in the exemplary embodiment shown in fig3 , the user has selected ten minutes for “ the beatles ”, five minutes for “ bon jovi ”, and ten minutes for “ linkin park ”. upon the user selection the processing unit 13 selects from the audio files stored in memory 14 or accessible via the network 30 at the server 50 , one or more tracks from the respective artist such that the required playing time is approximately met . for enabling this , each track or each audio file of memory 14 or server 50 provides a playing time information indicating a time duration which is required for playing back the audio file . in the example shown in fig3 , the processing unit 13 selects the following three tracks of “ the beatles ”: a first track “ hey jude ” with a playing time of 3 minutes and 24 seconds , a second track “ get back ” with a playing time of 4 minutes and 29 seconds , and a third track “ in my life ” with a playing time of 2 minutes and 57 seconds . thus , a total playing time for “ the beatles ” of 10 minutes and 50 seconds is reached . in the same way two tracks of “ bon jovi ” are selected having together a total playing time of approximately 5 minutes and another three tracks of “ linkin park ” are selected having together a total playing time of approximately 10 minutes . the selected tracks are added by the processing unit 13 to the playing list which may be displayed to the user for rearranging the selected tracks into a desired order . furthermore , the tracks may be added to the playlist in a randomized order . in case a lot of tracks of one artist , for example “ the beatles ”, are stored in memory 14 or at the server 50 , the processing unit 13 may find several combinations of tracks of this artist , wherein each of these combinations has a total playing time of approximately the desired duration , for example 10 minutes . in this case , the processing unit 13 may select a combination of tracks which fits best to the desired total playing time or the processing unit 13 may select a combination comprising tracks the user prefers . in the examples shown above in connection with fig2 and 3 , the selection criteria in the menus 200 and 300 is the artist of the audio files . however , instead of the artist a name of an album or a music genre may be used . in case of an album , the user may select the number of tracks of an album which shall be added to the playlist or a total playing time of tracks of an album which shall be added to the playlist . likewise , the user may set up a playlist based on the genre of the audio files , for example by selecting a number of audio files of a first genre , for example pop music , to be added to the playlist , and by selecting a number of audio files of a second genre , for example jazz music , which shall be selected and added to the playlist . while exemplary embodiments have been described above , various modifications may be implemented in other embodiments . for example , the characteristic upon which a number or quantity of audio files or a total playing time is selected by the user , may be an album name , a name of an artist or interpreter , or a genre of the audio files , and may further comprise a year when the songs was published , or a quality of the audio file , for example a sampling rate . finally , it is to be understood that all the embodiments described above are considered to be comprised by the present invention as it is defined by the appended claims . | 6 |
fig3 and fig4 show waveform diagrams of a ( load ) current or voltage before compensation . referring to fig3 and fig4 , an input capacitor cin impacts the dc voltage vdc such that the dc voltage vdc has ripples . furthermore , the dc voltage vdc having ripple components varies an average current or average voltage on a load . as shown in fig3 , an operation period of the load current or voltage of a pulse is d 1 , the average load current of voltage is avg 1 , a maximum peak value of the pulse is p 1 , and a waveform of the varied pulse is illustrated in fig4 . the operation period of the ( load ) current or voltage of the pulse as shown in fig4 is changed to d 2 or d 3 . the possible conditions may be one of the following : d 2 = d 1 − d 3 or d 2 = d 1 + d 3 . however , the maximum peak value at this time is not changed , and the values of average ( load ) current / voltage is changed to avg 2 , therefore , it is possible to get a situation of avg 2 & lt ; avg 1 or a situation of avg 2 & gt ; avg 1 . as a result , the value of average current or voltage will be varied . fig5 shows a flowchart of an automatic brightness compensation in an led illuminant driving circuit according to an embodiment of the present invention . referring to fig5 , the automatic brightness compensation method may be applied to the led illuminant driving circuit of an illuminant device in order to solve an unstableness of the illuminant device caused by voltage ripples and variations of illuminant brightness . the automatic brightness compensation method includes the following steps . first , in step s 510 , a target value is provided , and the target value may be utilized as a setting value of the average current or the average voltage to drive the led illuminant . next , in step s 520 , an operation period of a pulse output from the led illuminant driving circuit is detected . then , in step s 530 , a peak value according to the target value and the operation period is decided . furthermore , in step s 540 , a peak level of the pulse is set according to the peak value . fig6 shows a flowchart of an automatic brightness compensation in an led illuminant driving circuit according to another embodiment of fig5 . referring to fig6 , when the above - described automatic brightness compensation method of fig5 is proceeded in step s 520 , the step may further includes the following steps : in step s 522 , a turn - on period and a cut - off period of the pulse output from the led illuminant driving circuit are counted ; next , in step s 524 , the operation period is calculated according to the turn - on period and the cut - off period . then , when the above - described automatic brightness compensation method of fig5 proceeds in step s 530 , step s 532 may be processed to generate a control signal for setting the peak level of the pulse output from the led illuminant driving circuit . fig7 shows a block diagram of an led illuminant device according to one embodiment of the present invention . referring to fig7 , the led illuminant device 700 may include an electronic transformer 100 , a rectifier circuit 100 , an input capacitor cin , an led illuminant driving circuit 710 , and an led illuminant 730 . in this embodiment , the led illuminant driving circuit 710 includes a driver unit 720 and an automatic brightness compensation unit 740 . a power input terminal vin of the driver unit 720 receives the dc voltage vdc having ripples components , in order to output a pulse to drive the led illuminant 730 . the automatic brightness compensation circuit 740 is coupled to the driver unit 720 to detect an operation period of the pulse , and then decides a peak value according to a target value and the operation period , and controls the driver unit 720 according to the peak value such that the driver unit 720 then sets a peak level of the pulse according to the peak value . in order to stabilize the average current or the average voltage of the led illuminant 730 , the automatic brightness compensation circuit 740 is used to generate a feedback control signal ref to the driver unit 720 . the driver unit 720 is able to stably maintain the average current or the average voltage of the led illuminant 730 according to the feedback control signal ref . fig8 shows a waveform diagram of a ( load ) current or voltage after compensation according to one embodiment of the present invention . please refer to fig8 in accordance with fig4 and fig3 . the working principle of the automatic brightness compensation circuit 740 is as the following : before compensation , the output pulse of the driver unit 720 as shown in fig4 has the operation period of the pulse as d 2 ; after compensation , the operation period of the output pulse of the driver unit 720 is not changed but the peak value of the output pulse of the driver unit 720 is set as p 2 for a result of compensation . therefore , a situation of p 2 & gt ; p 1 or a situation of p 2 & lt ; p 1 is obtained . and setting of p 2 may be embodied as follows : for example , if the target value of the average current is avg 1 , then p 2 is set as the value of avg 1 divided by d 2 . it means at last the average current or the average voltage values avg 3 of the output pulse of the driver unit 720 is equal to the target value avg 1 . this means that the average load current or the average load voltage values of the led illuminant 730 is not changed , and hence , a functionality of the automatic brightness compensation of the led illuminant may be obtained to make a stable and uniform emitting light brightness of the led illuminant . fig9 shows a block diagram of an led illuminant device of another embodiment of the present invention . referring to fig9 , the power input terminal vin of the driver unit 720 receives a dc voltage vdc as shown in fig7 , and the automatic brightness compensation circuit 900 is coupled to the driver unit 720 and the led illuminant 730 . the automatic brightness compensation circuit 900 may include a turn - on counter 910 , a cut - off counter 920 , an operation period calculation circuit 930 , an average load setting circuit 940 , and a feedback compensation circuit 960 . fig1 shows a waveform of the pulse output from the driver unit 720 . referring to fig1 , the pulse output from the driver unit 720 is similar to a square wave , and the turn - on period and the cut - off of each operation period is t 1 and t 2 respectively . referring to fig9 , the main purpose of the turn - on counter 910 is to count the turn - on period t 1 of the pulse output from the driver unit 720 , and the cut - off counter 920 is used for counting the cut - off period t 2 of the pulse output from the driver unit 720 . surely , the turn - on counter 910 can be used to count the turn - on period t 1 of current or voltage on the led illuminant 730 instead of the pulse , and the cut - off counter 920 to count the cut - off period t 2 of current or voltage on the led illuminant 730 instead of the pulse . these changes belong to the scope of the present invention . next , the operation period calculation circuit 930 is utilized to generate current operation period d 2 according to counting results from the turn - on counter 910 and the cut - off counter 920 to generate . in this embodiment , d 2 = t 1 /( t 1 + t 2 ). the average load setting circuit 940 is connected to an output terminal of the operation period calculation circuit 930 , and together with a variable resistor 950 to form a setting unit for setting the target value avg 1 of the average current or the average voltage output from the driver unit 720 or for setting the target value avg 1 of the average current or the average voltage conducting through the led illuminant 730 . the feedback compensation circuit 960 is connected to the output end of the average load setting circuit 940 for obtaining the target value avg 1 and the operation period d 2 of the average current or the average voltage of the led illuminant 730 . the first compensation is mentioned previously as illustrated in the fig3 and fig4 . then , after processed by the feedback compensation circuit 960 , where the way of process does not change the operation period d 2 of the average current or the average voltage and sets the peak value of the output pulse to p 2 , or alternatively , the way of processing may also set the maximum peak value of the load current or the load voltage to p 2 as a result of compensation so as to achieve a situation of p 2 & gt ; p 1 or a situation of p 2 & lt ; p 1 . the above - described feedback compensation circuit 960 may operate as the followings . for example , the target value of the average current is avg 1 , and then p 2 is equal to the value of avg 1 divided by d 2 . the feedback compensation circuit 960 generates a feedback control signal ref after processing . the control signal ref is transferred to the driver unit 720 . the driver unit 720 compensates the average current or the average voltage of the led illuminant 730 according to the feedback control signal ref . the embodiment detects the variations of the operation period to compensate the average current or the average voltage so as to maintain them such that the automatic brightness compensation of the led illuminant is achieved . fig1 shows another embodiment of the automatic brightness compensation circuit 900 . in this embodiment , the average load setting circuit 940 may be implemented with an analog - to - digital converter ( adc ), and the feedback compensation circuit 960 may be implemented with an arithmetic logic unit ( alu ), where the alu receives the target value avg 1 and the operation period d 2 and generates the feedback control signal ref after computation of p 2 ( equal to the value of avg 1 divided by d 2 ). it is noted that in the above - described embodiments , the illuminant device 700 may be an mr16 lamp , but surely may be an e26 lamp or an e27 lamp . it is understood by people skilled in the field that embodiments of the present invention are not limited to the embodiments disclosed above , embodiments may be varied according to design requirements , so long as realizations , which detect the operation period of the pulse output from the led illuminant driving circuit and use the operation period and the target value to set the peak level of the pulse , fall within domains of the present invention . in summary , the embodiments of the present invention have at least the following advantages : ( 1 ) having an automatic brightness compensation mechanism to provide stable average current / voltage to the led illuminant ( load ) so as to avoid variations of illuminant brightness ; ( 2 ) may applies to the led illuminant ( load ) requiring stable average current or average voltage to make brightness of emitting light uniform and in turn enhances convenience of applications , for example , the led illuminant may be applied to an mr16 lamp , an e26 lamp or an e27 lamp . though the present invention has been disclosed above by the preferred embodiments , they are not intended to limit the present invention . anybody skilled in the art can make some modifications and variations without departing from the spirit and scope of the present invention . therefore , the protecting range of the present invention falls in the appended claims . | 7 |
fig1 is a schematic diagram of an embodiment of the invention . first , the digitized image is subsampled using a reduction factor of two to increase the speed of the computational process . this function is included in preprocessing unit 100 of the invention . thus , an input image ( 95 ) of 525 × 637 will be reduced to an output image ( 150 ) of 267 × 319 after preprocessing . fig2 is a digital chest portrait image of size 525 × 637 . fig3 is a digital chest landscape image of size 525 × 637 . a flow chart of a preferred method for image subsampling is shown in fig4 . there , oi ( original image ) refers to the digital chest image . the i denotes the width of the original image in pixels , and j denotes the height of the original image in pixels . next is unit 200 , the fuzzy clustering unit . according to a preferred embodiment of the invention , in this unit , a gaussian clustering method ( gcm ) is employed . fuzzy clustering is an unsupervised learning technique by which a group of objects is split up into some subgroups based on a measure function . gcm is one of the most commonly used clustering methods . it has a complete gaussian membership function derived by using a maximum - fuzzy - entropy interpretation . fig5 shows an exemplary flow chart of this method . in fig5 , u ik = exp [ - x k - v i 2 / 2 σ 2 ] / ∑ j = 1 c exp [ - x k - v j 2 / 2 σ 2 ] , and v i = ∑ k = 1 n u ik x k / ∑ k = 1 n u ik . here , x k represents the k - th input , i . e ., k - th pixel , v i represents the center vector of cluster i . u ik represents membership assignment , that is the degree to which the input k belongs to cluster i . σ is a real constant greater than zero , which represents the “ fuzziness ” of classification . t represents the maximum number of iterations , ε is a small positive number that determines the termination criterion of the algorithm . n and c represent the number of inputs and number of clusters , respectively . note that in fig5 , the superscripts denote iteration number . after about ten iterations , both of the center vectors and membership function will converge . this method is further described in li , r . p . and mukaidono , m ., “ gaussian clustering method based on maximum - fuzzy entropy interpretation ”, journal of fuzzy sets and systems , 102 ( 1999 ), pp . 253 - 258 , which is incorporated herein by reference . in the present invention , c is 2 , which means that the image after clustering is a binary image . note that a defuzzification process is necessary and is performed by using the following formula : u ik = max i = l i = c { u ik ] ∀ k , u ik = { 1 if i = i 0 otherwise fig6 is the rough image of fig2 obtained through preprocessing unit 100 and fuzzy clustering unit 200 . the rough image is a binary image . pixels in the rough image have two possible gray values , i . e ., white or black . such a binary image roughly presents lung regions ( most of the area of black cluster ) of the original chest image by contrasting with white cluster area . the third unit ( 300 ) serves to identify the orientation of a pa chest image . according to the method of the invention , this task is designed to find the orientation of the “ spinal ” area of a pa chest image . preferably , the inventive orientation identification method is based on the rough image instead of the original image . obviously , the difference between portrait and landscape images is that for a portrait image there is a rectangle located in the middle section of the horizontal direction and oriented in the vertical direction , whereas , for a landscape image such a rectangle is located in middle section of the vertical direction and oriented in the horizontal direction . in this rectangle almost all the pixels are of the white gray value . the length of the long side of the rectangle is close to the image &# 39 ; s height for the portrait case or close to the image &# 39 ; s width for the landscape case . fig7 shows a portrait case , while fig8 shows a landscape case . the method of identifying orientation of a chest image based on the rough image is simple but effective . the default assumption for the method is that the image is landscape . to judge whether an image is in portrait orientation or not , two conjunctive conditions are used . first , in a portrait image , there is a rectangle as defined above that is located in the middle section of the horizontal direction and oriented in the vertical direction . further , in a portrait image , gray level value must be black at point ( width / 4 , height / 2 ) and point ( 3width / 4 , height / 2 ). here , “ width ” represents image width in pixels , and “ height ” represents image height in pixels . if an image is portrait , it can be passed to post - processing unit ( 400 ) directly . otherwise , a landscape image would be rotated to become a portrait image first , and then passed to the next processing unit . as will be noted below , according to an embodiment of the method of the invention , this rectangle can be used in determining the central zone of a pa chest image . fig9 is a schematic diagram of an embodiment of post - processing unit 400 of fig1 . in this unit , there are five ( 5 ) functions , as follows : 1 ) isolated - point assimilation ( 1350 ), 2 ) landmark point search ( 2350 ), 3 ) top - down edge trimming ( 3350 ), 4 ) bottom - up edge trimming ( 4350 ), and 5 ) region extension and / or region shrink ( 5350 ). according to an embodiment of the inventive method , the purpose of the isolated - point assimilation part 1350 is to assimilate isolated white points in a black cluster and isolated black points in a white cluster . fig7 is the input ( 350 ) of isolated - point assimilation part 1350 , and fig1 is the corresponding output ( 1450 ) of isolated - point assimilation part 1350 . comparing fig1 to fig7 , after this block , isolated points are almost all assimilated . to segment lung regions based on a rough image , the first step is to locate landmark points . landmark points here include top lung edge points and bottom lung edge points . to determine top lung edge points , rough images are classified into two types . type 1 images are those in which the boundary of the top lung is clearly separated , as shown in fig7 and fig8 . type 2 images are otherwise rough images , as shown in fig1 . for type 1 , as shown in fig1 , the method is straightforward . considering the right lung , the search region , in the x - direction is from the right side of the rectangular central zone to x = width / 4 , and in the y direction is from y = 15 to y = height / 3 ; note that the point ( x , y )=( 0 , 0 ) is located at the upper left corner of the image . the first pixel encountered that has “ black ” gray - value is called inner point of top lung ( itl ). the final left pixel that has “ black ” gray - value is called outer point of top lung ( otl ). in an exemplary embodiment , the maximum length of top lung edge is set to be 20 pixels . if the top lung edge cannot be found through this process , the rough image is considered to be type 2 . a corresponding process may be carried out for the left lung , as well . the search process for the top lung edge for type 2 images is divided into four ( 4 ) steps , which will be described in terms of the right lung ( i . e ., the left side of fig1 ); corresponding steps may be used to search for the top lung edge of a left lung in a type 2 image . step 1 is to find the intermediate y coordinate ( y ), which is the location of the first pixel whose gray - value is “ black ” when y decreases to zero from y = height / 4 while x = 10 ( i . e ., the value of x is chosen to be close to , but not quite , zero , where zero represents the outer edge of the right lung image ). step 2 is to locate the starting coordinate ( x 1 , y 1 ), which must have a gray - value of black and be the nearest such pixel to the left side of the rectangular central zone in the x - direction in the search region y = 0 to y ′ and x ranging from the left side of the rectangular central zone ( i . e ., the innermost border of the right lung image ) to 0 . step 3 is to locate the ending coordinate ( x 2 , y 2 ), which must have a gray - value of “ black ” and be the nearest such pixel to the left side of the rectangular central zone in the x - direction in the search region y = y 1 to height / 2 and x ranging from the left side of the rectangular central zone to x = width / 4 . step 4 is to find the itl , which must have a gray - value of white and be the furthest such pixel from the left side of the rectangular central zone in the x - direction within the search region y = y 1 to y 2 and x ranging from the left side of the rectangular central zone to x = width / 4 . fig1 shows the top lung edge point of a type 2 image . for this type , the position of otl is the same as that of itl . similarly , for determination of bottom lung edge points , rough images are classified into two ( 2 ) cases . case 1 refers to those in which the boundary of bottom lung is clearly separated as shown in fig7 and fig8 . case 2 are those images that are otherwise rough as shown in fig1 . the search region , for the right lung , is from y = height / 3 to y = height in the y direction and from x = width / 3 to x = 0 in the x direction ( a corresponding region and process may be applied to the left lung ). a common necessary condition of being a bottom lung edge point is that such a point must be an edge point between a “ black ” region and a “ white ” region . let an edge point &# 39 ; s coordinates be ( x , y ). for case 1 , a sufficient condition for being a bottom edge point is : 1 ) gray - value ( gv ) of pixel ( x - 1 , y ) must be “ white ”, 2 ) gv of pixel ( x - 2 , y - 1 ) must be “ white ”, and 3 ) gv of pixel ( x − 1 , y + 1 ) must be “ white ”. in fig1 and fig1 , the outer point of bottom lung ( obl ) belongs to case 1 . for case 2 , sufficient condition of being bottom edge point is : 1 ) gray - value ( gv ) of pixel ( x - 1 , y ) must be “ white ”, 2 ) gv of pixel ( x - 1 , y - 1 ) must be “ white ”, and 3 ) gv of pixel ( x − 1 , y + 1 ) must be “ black ”. in fig1 , obl belongs to case 2 . therefore , if the input of landmark point search part ( 2350 ) of postprocessing unit ( 400 ) in fig9 is an image similar to fig1 , then the output will be similar to fig1 . top - down trimming part ( 3350 ) of the post - processing unit ( 400 ) in fig9 , according to an embodiment of the invention , takes an input image like that shown in fig1 , and uses a heuristic rule to trim the boundary of the lung and remove noise . a heuristic rule employed here states that the width of the lung region should continually increase as it moves from top to bottom . let ( x t , y t ) represent the detected outer edge point of the right lung when y = y t at evolution time t , and let the successive edge points be ( x t + 1 , y t + 1 ), ( x t + 2 , y t + 2 ), and so on . according to an embodiment of the invention , if x t + 1 & gt ; x t , then x t + 1 is not changed . otherwise , x t + 1 reduces 3 pixels every 3 evolution times . the trimming region is from top lung edge point to bottom lung edge point . fig1 shows the result after trimming the right lung shown in fig1 . comparing fig1 with fig1 , after top - down trimming , despite the recovery of misclassified bottom lung area and the removal of noise , the boundary of the top lung area is not complete . according to an embodiment of the invention , the bottom - up trimming part ( 4350 ) of post - processing unit ( 400 ) in fig9 is designed to trim the boundary of the top lung area using the following heuristic rule . like above discussion , let ( x t , y t ) represent the detected outer edge point of the right lung when y = y t at evolution time t , and let the successive edge points be ( x t + 1 , y t + 1 ), ( x t + 2 , y t + 2 ), and so on . if x t + 1 & lt ; x t , then x t + 1 is not changed . otherwise , x t + 1 increases 1 pixel every evolution time . the trimming region is from bottom lung edge point to top lung edge point . fig1 shows the result after bottom - up trimming of the right lung shown in fig1 . similarly , top - down trimming and bottom - up trimming techniques may also be applied to the left lung . thus , after bottom - up trimming , an initial mask image is obtained as , shown in fig1 . extension / shrink fitting part ( 5350 ) of the post - processing unit ( 400 ) in fig9 , according to an embodiment of the invention , is designed to adjust the segmented lung region to get the best fit to a real lung . after extension / shrink processing 5350 is completed , a mask that shows five ( 5 ) different zones is obtained , as shown in fig1 . fig1 shows the chest image ( portrait image ) of fig2 overlaying boundaries of the zone mask image of fig1 . fig1 shows a chest image ( landscape image ) of fig3 overlaying boundaries of a corresponding zone mask image . the five zones cover the following anatomic regions : lung zone : left lung and right lung ; central zone : superior mediastinum , heart , and part of subdiaphragm ; special zone : part of lung , part of heart , and part of subdiaphragm ; bottom zone :. most of subdiaphragm ; uninteresting zone : background , base of neck , and axilla . table 1 illustrates the chest image orientation identification performance of the method for 3459 images . of them , 519 images were landscape . images , and the rest were portrait images . it should be noted that , as in any ill - defined problem , the evaluation criterion used here is very subjective . the “ quit ” case indicates that the method as embodied for these trials was unable to deal with a given image . the same concept has been expanded to lung segmentation in a ct image . fig2 - 21 demonstrate the performance of applying the invention to a ct image . obviously , numerous modifications to and variations of the present invention are possible in light of the above technique . it is , therefore , to be understood that within the scope of the appended claims , the invention may be implemented in situations other than as specifically described herein . although the present application is focused on chest image and ct image , the concept can be expanded to other medical images and other object segmentation problems , such as mri , brain and vessel segmentation , and the like . the invention is thus of broad application and not limited to the specifically disclosed embodiment . | 6 |
a display rack 10 in accordance with the present invention is shown in fig1 to include two component supports 12 and it will be appreciated with the description following that any number of component supports could be incorporated into the display rack . when assembled as shown in fig1 , the two component supports define a completed rack with two display shelves 14 for inanimate objects 16 such as golf balls . the display rack shown in fig1 has an uppermost support component 12 u and a bottommost support component 12 b even though as seen in fig2 , for example , an intermediate support component 12 i could be positioned between the uppermost and bottommost components to add a third display shelf 14 . referencing fig3 , the three component supports 12 shown in fig2 are separated . the intermediate support component 12 i can be seen to include a plate - like back 18 that has a horizontal groove 20 routed or otherwise formed in a front face thereof near the bottom edge of the back plate . a relatively thin display shelf 14 has its rear most edge inserted into the groove and is retained therein either frictionally , with adhesive or with other suitable means . the shelf itself is provided with a plurality of indentations 22 formed in a top surface thereof at equally spaced locations with the indentations being provided to releasably retain inanimate objects 16 to be displayed in the rack at the predetermined locations . for example , in the embodiment shown in fig1 - 6 , the indentations 22 form a segment of a sphere so that a golf ball or other spherical object could be placed or seated in an indentation to keep the ball from rolling off the shelf . immediately below the shelf 14 on the front face of the support component 12 , a tongue - and - groove connector 24 is formed so that a forwardly projecting tongue 26 is defined by a rearwardly projecting groove 28 immediately thereabove and a lower edge 30 of the back plate 18 . the tongue and the groove are defined by substantially horizontal surfaces 32 and substantially vertical surfaces 34 but as is probably best appreciated by reference to fig4 , the substantially horizontal surfaces are in reality sloped slightly downwardly and rearwardly from the front face of the back plate toward the rear of the back plate . the substantially vertical surfaces are similarly slightly inclined upwardly and rearwardly from the front face of the back plate toward the rear face . it will therefore be appreciated a front lip 36 is defined at the upper front edge of the tongue 26 and an inner corner 38 in the bottom rear edge of the groove 28 . the lip is positioned higher than the inner corner for a reason to be explained hereafter . a similar tongue - and groove connection 24 is formed near the top edge of the back plate in its rear surface so that the tongue 26 overlies the groove 28 but again the substantially horizontal surfaces 32 are inclined slightly rearwardly and downwardly while the substantially vertical surfaces 34 are inclined slightly rearwardly and upwardly identically to those in the front face of the back plate . the tongue - and - groove connection in the top of the back plate is therefore complimentary to the tongue - and - groove connection in the bottom of the back plate so that , while not illustrated , the tongue - and - groove at the top of one intermediate support component 12 i can be received in the tongue - and - groove connection of a next adjacent upper identical intermediate support component 12 i such that the back plates of both intermediate support components are co - planer . as will be appreciated , any number of intermediate support components can therefore be interconnected and suspended from each other with the rearwardly and downwardly inclined surfaces in the tongue and the groove of each connector encouraging a positive interconnection by gravity . further , if one were to try to horizontally remove an intermediate component from an interconnected intermediate component , it could not be easily separated unless the lowermost component was pulled upwardly and forwardly which is restricted by the display shelves 14 . this is due to the fact that the above - defined lip of the tongue 26 is higher than the inner corner of the groove 28 . if the support components are made of a soft wood or plastic they can be snapped together or apart but typically the support components are interconnected or supported by sliding one component longitudinally of the other . looking again at fig3 , an uppermost component 12 h of the display rack 10 is shown to be very similar to an intermediate component 12 i in that it has a lower tongue - and - groove connector 24 along the lower edge of the back plate 18 and in the front face thereof and the connector is immediately beneath a shelf 14 mounted on the back plate as described above with the shelf having a plurality of indentations 22 . the top edge of the back plate in the uppermost support component , however , does not include a tongue - and - groove connector as in the intermediate components . a horizontal overhang plate or flange 40 , however is secured to the top edge of the back plate of the uppermost component along its rear edge for decorative purposes so that the overhang plate or flange 40 overlies the shelf 14 on the uppermost support component of the display rack . similarly , the bottommost component 12 b of the display rack 10 has a tongue - and - groove connector 24 formed along its top edge in the rear face thereof but no tongue - and - groove connector along the bottom edge . a bottom wall or flange 42 of the bottommost support component , however , is connected to the bottom edge of the back plate 18 of the bottommost component so that the bottom wall or flange projects forwardly and horizontally from the lower edge of the back plate . rather than having a shelf in the bottommost component , the bottom wall or flange 42 serves as a shelf in the display rack and has a plurality of aligned indentations 22 formed therein . it will be appreciated from the above that the display rack 10 will preferably include an uppermost support component 12 u , a bottommost support component 12 b and one or more intermediate support components 12 i that are interconnected with each other and / or to an uppermost support component or a bottommost component depending upon the number of components desired for the display rack . as mentioned above , the tongue - and - groove connectors 24 on the support components cooperate with each other in supporting and interconnecting the support components so they can best be separated by sliding one component longitudinally of the other . it will also be appreciated that any number of intermediate support components 12 i can be provided as by adding or subtracting from an existing display rack . further , as shown in fig1 , there does not need to be an intermediate support component , but rather the bottommost component 12 b can be connected directly to the uppermost component 12 u if a two - shelf display rack were desired . as will be appreciated , a display rack 10 with multiple components is vertically suspendable from a vertical surface such as a wall . when suspending the display rack from a vertical support surface , one or more notches 44 ( fig6 ) could be formed in the rear of the uppermost component 12 u to receive a nail or other fastener projecting from the vertical support surface . if the recess was of the type illustrated in fig6 where it included a relatively large circular opening 46 near its bottom to receive the head of , for example , a screw and a relatively thin neck 48 projecting upwardly therefrom smaller than the head of the screw , a very positive interconnection of the display rack with the vertical support surface can be obtained . while the embodiment shown in fig1 - 6 illustrates one form and use of the display rack in accordance with the present invention , the systems incorporated into the display rack for releasably but positively positioning objects being displayed could be varied . for example , in fig7 , the uppermost component 12 u of the display rack 10 , which is shown as being taller than the intermediate 12 i and bottommost 12 b components , also includes a plurality of horizontally disposed cylindrical pins 50 projecting forwardly from the back plate 18 on which objects such as spools of thread , or the like could be displayed . also , on the top surface of the shelf 14 of the uppermost component , a pair of rectangular embossments or raised areas 52 are provided which might cooperate , for example , with a recess in the bottom of a figurine that might be displayed on the shelf . on the shelf of the intermediate component 12 i , a plurality of holes 54 are formed through the shelf through which other inanimate objects such as might have a larger upper body than a lower body might be positioned so that the lower body could be dropped through the hole but the larger upper body would be supported above the shelf . on the bottom wall 42 of the bottommost support component 12 b , a plurality of upstanding pins 56 are provided which again , for example , might be used to support spools of thread , yarn or the like or other similar objects for display . it will be appreciated from the above , that while several embodiments of the invention have been illustrated , it will be evident to those skilled in the art that other variations could be made to the shelves , the bottom wall , or the back plates for displaying objects of different configurations and the invention is not intended to be limited to those few possibilities illustrated . further , while one particular tongue - and - groove system for interconnecting adjacent support components has been illustrated and has been felt to work very well , other systems might also work for interconnecting the support components in co - planer relationship in any manner so that they are not easily separated . although the present invention has been described with a certain degree of particularity , it is understood the disclosure has been made by way of example , and changes in detail or structure may be made without departing from the spirit of the invention as defined in the appended claims . | 0 |
referring to fig1 the preferred embodiment generally includes a creel 10 for yarn supply packages 12 , a plurality of yarn tensioning bars generally designated 14 , a finish applicator 16 comprised of a rotatable finish roll 18 emersed in a pan 20 filled with a liquid finish 22 a pair of grooved roller guides 24 , 26 are located between the finish applicator 16 and a turbo stapler 28 ( manufactured by the turbo machine co ., lansdale , pa .). the turbo - stapler includes a pair of driven nip rolls 30 , 32 which firmly grip the tow band 34 that has been consolidated from the indvidual yarns in guide 29 . the nip rolls 30 , 32 feed tow band 34 at a constant rate to a pair of front rolls 36 , 38 which also grip the tow band 34 and withdraw it from breaker bars 39 and feed it as a sliver to a condensing guide 40 from which the sliver is fed to a windup ( not shown ) for packaging . in operation , glass or carbon yarn 13 from individual packages 12 is fed from creel 10 over finish roll 18 where it is coated with finish 22 . the yarns are consolidated in guide 29 , tensioned between rolls 30 , 32 and front rolls 36 , 38 , then randomly broken by sharply deflecting them laterally by the breaker bars 39 . the coating of finish on the yarn in the sliver is sufficient to enable the sliver to be pulled through guide 40 to the windup without disassociation of the fibers in the sliver . while the continuous process illustrated in fig1 is preferred , the application of finish to continuous filament carbon or glass fibers and the stretch - breaking of the coated filaments can be carried out in two steps ; i . e ., separate finish application and stretch - breaking processes , according to fig2 and 3 and as described subsequently in example 1 . more particularly , in fig2 glass or carbon yarn 13 from package 12 is fed over yarn tensioning bars 14 &# 39 ; over finish roll 18 where it is coated with finish 22 and wound onto a bobbin 12 &# 39 ; and allowed to dry . the yarn from bobbins 12 &# 39 ; is then stretch - broken by breaker bars 39 ( fig3 ) in the turbo - stapler as described above in connection with fig1 . the finish used in this invention is a material that causes an interfilament viscous drag sufficiently high to permit the handling required to make a composite , such as winding and unwinding from a package . more particularly , the finish used for the carbon fiber application is a mixture of a one part of a suitable antistat and two parts of a non - tacky viscous lubricant of a consistency to impart to the chopped sliver adequate cohesiveness ( minimum of 0 . 01 grams per denier ) without tackiness or without compromising the fiber - matrix adhesion in the final composite . the antistat portion of the mixture could be reduced or even eliminated if the reinforcing fiber is electrically conductive ( e . g ., carbon fibers ). a suitable viscous lubricant is polyethylene glycol ( 400 mol . wt ) monolaurate and a lauric amide while a suitable antistat is mixed mono and di - phosphate esters of c8 - c12 fatty alcohols neutralized with diethanol amine . preferably , the percent finish on fiber is in the range of from about 0 . 3 % to about 0 . 5 %. formable planar and shaped non - planar composites are contemplated by the present invention . for the formable composites , that is , those composites that can be formed into shaped non - planar three - dimensional structures at elevated temperatures ( where necessary ), matrix resins of the thermoplastic variety or of the not fully cured thermoset type may be employed . in the latter case the thermosettable resin is cured after the composite has been shaped . suitable thermoplastic resins include polyesters ( including copolyesters ), e . g ., polyethylene terephthalate , kodar ® petg copolyester 6763 ( eastman kodak ); polyamides , e . g ., nylon 6 , 6 ; polyolefins , e . g ., polypropylene ; also included are the high temperature resins such as an amorphous polyamide copolymer based upon bis ( para - aminocyclohexyl ) methane , a semi - crystalline polyamide homopolymer also based on bis ( para - aminocyclohexyl ) methane , and polyetheretherketone . thermosetting resins that are useful include phenolic resins , epoxy resins and vinyl ester resins . the ratio of reinforcement to matrix can vary , but preferably is between 40 % to 75 % by volume . the average fiber lengths also may vary but preferably range from about 1 / 2 to about 6 inches in length with a random overlap distribution . about 85 percent of the fibers are aligned within ± 10 degrees , preferably ± 5 degrees of the axial direction . the composite may be made by a variety of procedures . thus , a stretch broken sliver may be wound on a frame covered with a film of thermoplastic resin to form a warp . the warp of stretch - broken sliver , however , can be made by any technique known to those skilled in the art , e . g ., by creeling or beaming . a preform is obtained when another film of thermoplastic resin is placed over the warp to form a sandwich which is heated in a vacuum bag and then removed from the frame . several of such preforms may be stacked while offset to provide multi - directionality and then the stack may be heated under pressure to form a composite structure . other techniques for applying matrix polymer include sprinkling of powdered resin on the sliver warp followed by heating to melt the resin , flowing liquid resin over the sliver warp , intermingling thermoplastic fiber with the sliver warp and then heating to melt the thermoplastic fiber thereby forming the matrix resin , calendering the warp between layers of matrix film , etc . the composite tensile tests followed the general procedure described in astm test d 3039 - 76 entitled &# 34 ; standard test method for tensile properties of fiber -- resin composites .&# 34 ; the short beam shear tests followed the general procedure described in astm method d 2344 - 76 entitled , &# 34 ; standard test method for apparent interlaminar shear strength of parallel fiber composites by short beam method &# 34 ; with the following exception , the loading nose was 1 / 16 inch radius instead of 1 / 8 inch . the yarn to be tested for sliver cohesion was placed in the clamps of an instron tensile testing machine set to a gauge length of 17 inches , a crosshead speed of 10 inches per minute and a chart speed of 12 inches per minute . the crosshead was started to apply tension to the sample and the maximum force in grams indicated on the chart was recorded and divided by the sliver denier to give the sliver cohesion . finish on yarn is determined in a method wherein weighed specimens are extracted gravimetrically with prescribed solvent ( s ) at room temperature , the solvent containing dissolved finish and any other materials which may wash off the specimens , is transferred to a preweighed container and evaporated . the extractable residue is weighed . percentage extractables based on extractable - free specimen weight is calculated . aerothane ® ( 1 , 1 , 1 - trichloroethane ) is used as the solvent for all finish materials except glycerine and methanol is used as the solvent for that material . the sample to be tested was placed in the clamps of an instron tensile testing machine set to a particular gauge length and a crosshead speed depending on the sample . a thermocouple was attached the surface of the sample midway between the clamps and an 8 inch long electrically heated cylindrical oven was placed around the sample leaving a one inch space between the bottom of the oven and the lower clamp . the open ends of the oven were plugged with insulation material to prevent convective heat loss and heating of the clamps . the oven was turned on and the sample heated to reduce its viscosity to permit drawing ( temperature determined by the viscosity , time , temperature data of the matrix material . samples made with thermosetting matrix resins must be tested in their uncured state .). the sample was held at this temperature for 15 minutes to insure thermal equilibrium . the crosshead was then started and allowed to run until the heated section of the sample was drawn 50 %. the oven was removed and the sample inspected to determine whether it had broken . a photomicrograph of the surface of the composite ( enlarged 240x ) was prepared . the angle between each fiber axis and the axial direction of the composite was measured with a protractor on the photomicrograph and tabulated . the percentage of fibers with an angle within ± 5 degrees of the axial direction was reported . four bobbins of 2000 denier continuous filament carbon fiber ( 3k as - 4 from hercules inc .) were prepared for stretch - breaking by applying a finish composed of two parts of a lubricant ( polyethylene glycol monolaurate and a lauric amide ) and one part of an antistat ( mixed mono and diphosphate esters of c8 - c12 fatty alcohols neutralized with diethanol amine ). the finish was applied by running the continuous filament carbon fiber , one bobbin at a time , at 75 yards / minute over a finish roll which was wet with a 4 % aqueous emulsion of the lubricant - antistat mixture ( fig2 ). the four bobbins were allowed to stand overnight to evaporate the water . finish level after drying was 0 . 33 %. the four bobbins of carbon fiber were stretch - broken on a turbo - stapler ( turbo machine co ., lansdale , pa ) as shown in fig3 . the surface speed of the rolls ( 30 , 32 ) was 35 . 4 yards / minute and the surface speed of the front rolls ( 36 , 38 ) was 110 yards / minute . the tip speed of the breaker bars ( 39 ) was 71 yards / minute . the resulting sliver was 2422 denier and had a cohesion value of 0 . 18 grams / denier which was sufficient to allow winding without twist on a cylindrical paper tube using a leesona type 959 winder . the average fiber length of fifty measurements of this sliver was 3 . 2 inches ( shortest 0 . 7 inch , longest 5 . 6 inches ). a warp was prepared from this sliver by winding it from the paper tube , 25 ends to the inch on a 16 inch square metal plate . a 2 . 0 mil thick film of thermoplastic resin ( an amorphous polyamide copolymer based on bis ( para - aminocyclohexyl ) methane ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sandwich was vacuum bagged at 280 ° c . for 15 minutes after which time it was cut from the plate . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . twelve of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 305 ° c . at 500 pounds per square inch for 35 minutes to make a well - consolidated plate 93 mils thick and fiber volume fraction of 55 %. short beam shear tests conducted on 0 . 5 inch wide strips cut from this plate gave a value of 13 , 700 pounds per square inch . it was concluded that the presence of the finish did not adversely affect the adhesion of the fiber to the matrix polymer . a second plate was made from ten of these preforms by stacking them so that the direction of the stretch - broken fibers were offset by 45 degrees in a clockwise direction in successive layers . the bottom plane of the fifth layer was considered a reflecting plane and the next five layers were stacked so that the warp directions of the stretch - broken sliver were mirror images of the top five layers with respect to that plane . this sandwich was molded as above to make a well consolidated plate with a fiber volume fraction of 55 %. this plate was heated to 322 ° c . and molded into a hemisphere with a radius of 3 inches . the plate conformed very well to the shape of the mold and it was concluded that the product was deep drawable without wrinkles . a sliver of stretch - broken glass fiber was prepared by the method in example 1 except that 6700 denier continuous filament glass fiber was used ( t - 30 p353b from owens - corning fiberglass ) and the finish was applied by spraying a 10 % aqueous emulsion on the fiber . the emulsion was pumped to the spray nozzle at 5 cc . per minute and the air pressure used was 3 psi . the yarn was pulled past the spray head at 55 yards per minute by a pair of nip rolls and wound on a cylindrical paper tube . after drying , the finish level was 0 . 35 %. stretch - broken sliver was prepared from two finish treated continuous filament bobbins and had a cohesion of 0 . 09 grams per denier which was adequate for winding as in example 1 . further , the finish controlled static generation in the stretch - breaking process to an acceptable level . the average fiber length of fifty measurements of this sliver was 3 . 4 inches ( shortest 1 . 0 inch , longest 10 . 2 inches ). a unidirectional plate was made from this sliver and petg film ( kodar ® petg copolyester 6763 , eastman kodak ) by the method of example 1 except that the sliver spacing was 26 ends per inch , the film thickness was 3 . 0 mils and 8 layers of preform were used to 55 % fiber volume fraction . short beam shear tests on 0 . 5 inch wide strips cut from this plate gave a result of 5 , 400 pounds per square inch . it was concluded that the presence of the finish did not affect the adhesion of the fiber to the matrix polymer . a sample of carbon fiber sliver was prepared using the stretch - breaking process of example 1 except that finish was not pre - applied to the continuous fiber and two bobbins were used instead of four . the two ends of carbon fiber were contacted by a felt pad saturated with glycerine which was placed between the tension guide and the infeed roll . glycerine level on the sliver was 0 . 5 %. the average fiber length of fifty measurements of this sliver was 3 . 2 inches ( shortest 0 . 6 inch , longest 7 . 9 inch ). cohesion was measured as a function of time vs . the sliver from example 1 with the following results . ______________________________________ cohesion , grams per denierdays glycerine example 1______________________________________ 1 . 58 . 15 9 . 79 . 2416 . 02 . 2522 . 02 . 2530 . 02 . 21______________________________________ glycerine treated sliver from example 3 was made into a warp , preforms and a unidirectional plate by the method of example 1 . the end count was 12 per inch , the film was 3 . 0 mil thick petg ( kodar ® petg copolyester 6763 from eastman kodak ) and 6 preforms were stacked to make the plate which was 40 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch guage length with the following results : it was concluded that the product had very high strength and modulus . the uniformity of orientation of the fibers on the surface of this plate were measured from a photomicrograph and it was found that 85 % of the fibers were within ± 5 degrees of the axial direction . continuous filament 2000 denier carbon fiber was made into a warp , preforms and a unidirectional plate . the end count was 12 per inch , the film was 3 . 0 mil thick petg ( kodar ® petg copolyester 6763 from eastman kodak ) and 16 preforms were stacked to make the plate which was 40 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch guage length with the following results : it was concluded that the product of example 4 exhibited the strength and stiffness expected of continuous filament carbon fiber . the product of example 4 , although made of stretch - broken discontinuous staple fiber , came within 90 % of the strength and stiffness of the continuous filament product . this excellent performance is believed due to the high degree of order of the stretch - broken fibers . stretch broken glass sliver was prepared by the method of example 2 except that finish was not pre - applied to the continuous fiber . instead , the fiber being supplied to the turbo - stapler was sprayed periodically with jif - job antistatic spray ( schafco , lancaster , pa ). the roll and breaker bar speeds were one - half the values in example 2 . the average fiber length of fifty measurements of this sliver was 3 . 1 inches ( shortest 1 . 0 inch , longest 5 . 8 inch ). this sliver was made into a warp , preforms and a unidirectional plate by the method of example 1 . the end count was 21 per inch , the film was 3 . 0 mil thick petg ( kodar ® petg copolyester 6763 from eastman kodak ) and 5 preforms were stacked to make the plate which was 40 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch guage length with the following results : it was concluded that the product had very high strength and modulus . continuous filament 6700 denier glass fiber was made into a warp , preforms and a unidirectional plate . the end count was 13 per inch , the film was 3 . 0 mils thick petg ( kodar ® petg copolyester 6763 from eastman kodak ) and 5 preforms were stacked to make the plate which was 40 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch guage length with the following results : it was concluded that the product of example 6 exhibited the strength and stiffness expected of continuous filament glass fiber . the product of example 6 , although made of discontinuous staple fiber , came within 90 % of the strength and stiffness of the continuous filament product . a preform of stretch broken carbon fiber sliver in an epoxy resin ( hercules 3501 - 6 ) was made by the following procedure : ( 1 ) the frozen resin was thawed at room temperature , then heated to 180 ° f . for 15 minutes . ( 2 ) a film of resin was cast onto release paper then chilled to 40 ° f . to stop the polymerization reaction and the exposed surface was covered with polyester film for protection . ( 3 ) the paper - resin - film sandwich was wound on a 7 - foot diameter drum and the polyester film removed . ( 4 ) 2300 denier graphite sliver made by the process of example 1 was wound on the exposed resin at 9 ends per inch for a total width of 10 . 5 inches . the average fiber length of fifty measurements of this sliver was 3 . 2 inches ( shortest 0 . 7 inch , longest 5 . 6 inches ). ( 5 ) the polyester film was removed from a second paper - resin - film sandwich and wound over the graphite layer on the drum to make a paper - resin - graphite - resin - paper sandwich . ( 6 ) the sandwich was unwound from the drum and vacuum bagged flat at 140 ° f . for 10 minutes to force the resin into the graphite layer , then frozen for later use . the thickness of the resin - graphite part of this sandwich was 7 mils . a unidirectional composite strip made by stacking together ten layers of 3 / 4 - inch wide and 14 - inch long strips ( fiber direction parallel to the 14 - inch dimension ) of the graphite - resin preform was vacuum bagged for two minutes . one inch on either end of the strip was partially cured by heating it to 120 ° c . for two hours while keeping the middle 12 inches of the strip cold with dry ice . at a guage length of 11 inches and a crosshead speed of 5 inches per minute , a high temperature tensile drawing test was conducted at 124 ° c . on the 14 inch long by 0 . 75 inch wide strip which showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . a composite plate was made from 10 layers of the sandwich from step 6 above by removing the release paper , cutting the graphite - resin preform into sheets and stacking them so that the direction of the stretch - broken fibers were offset by 45 degrees in a clockwise direction in successive layers . the bottom plane of the fifth layer was considered a reflecting plane and the next five layers were stacked so that the warp directions of the stretch - broken sliver were mirror images of the top five layers with respect to that plane . this sandwich was vacuum - bagged at ambient temperature for 2 minutes to stick the layers together . this plate was molded into a hemisphere with a radius of 3 inches and cured in the mold at 175 ° c . for 2 hours . the plate conformed very well to the shape of the mold and it was concluded that the product was formable . four bobbins of 2000 denier continuous filament carbon fiber ( 3k as - 4 from hercules inc .) were stretch - broken on a turbo - stapler ( turbo machine co ., lansdale , pa ) set up as shown in fig1 . a 10 % aqueous solution of the finish described in example 1 was applied with a wetted roll . the surface speed of the intermediate rolls was 17 . 7 yards / minute and the surface speed of the front rolls was 55 yards / minute . the tip speed of the breaker bars was 35 . 5 yards / minute . the resulting sliver was 2250 denier . the average fiber length of fifty measurements of this sliver was 3 . 3 inches ( shortest 0 . 8 inch , longest 5 . 5 inches ). a warp was prepared from this sliver by winding it , 27 ends to the inch on a 18 inch square metal plate . a 3 . 0 mil thick film of thermoplastic resin ( petg copolyester ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sanwich was vacuum bagged at 220 ° c . for 15 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 200 ° c . at 400 pounds per square inch for 30 minutes to make a well - consolidated plate 82 mils thick and fiber volume fraction of 50 %. high temperature tensile drawing tests at a guage length of 10 inches and crosshead speed of 10 inches per minute conducted at 262 ° c . on 12 inch long by 0 . 75 inch wide strips cut from this plate with the fiber direction parallel to the 12 inch dimension showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . two bobbins of 6700 denier continuous filament glass fiber ( t - 30 p353b from owens - corning fiberglass ) were stretch - broken on a turbo - stapler ( turbo machine co ., lansdale , pa ) set up as shown in fig1 . a 10 % aqueous solution of the finish described in example 1 was applied with a wetted roll . the surface speed of the intermediate rolls was 17 . 7 yards / minute and the surface speed of the front rolls was 55 yards / minute . the tip speed of the breaker bars was 35 . 5 yards / minute . the resulting sliver was 4100 denier . the average fiber length of fifty measurements of this sliver was 3 . 4 inches ( shortest 0 . 9 inch , longest 8 . 7 inches ). a warp was prepared from this sliver by winding it , 22 ends to the inch on a 18 inch square metal plate . a 3 . 0 mil thick film of thermoplastic resin ( petg copolyester ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sandwich was vacuum bagged at 220 ° c . for 15 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 200 ° c . at 400 pounds per square inch for 30 minutes to make a well - consolidated plate 82 mils thick and fiber volume fraction of 50 %. high temperature tensile drawing tests at a guage length of 10 inches and crosshead speed of 10 inches per minute conducted at 262 ° c . on 12 inch long by 0 . 75 inch wide strips cut from this plate with the fiber direction parallel to the 12 inch dimension showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . sliver from example 10 was re - broken to reduce the fiber length by passing it through two sets of elastomer coated nip rolls with a separation of 2 . 50 inches between the nips . the surface speed of the second set of rolls was 10 yards per minute and the surface speed of the first set of rolls was 7 . 1 yards per minute giving a draft of 1 . 4 . denier of this re - broken sliver was 5371 and the average fiber length of fifty measurements of this sliver was 1 . 57 inches ( shortest 0 . 5 inch , longest 3 . 6 inches ). a ` warp ` was prepared from this sliver by winding it , 17 ends to the inch on a 18 inch square metal plate . a 3 . 0 mil thick film of thermoplastic resin ( petg copolyester ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sanwich was vacuum bagged at 220 ° c . for 15 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 200 ° c . at 400 pounds per square inch for 30 minutes to make a well - consolidated plate 80 mils thick and fiber volume fraction of 50 %. high temperature tensile drawing tests at a guage length of 10 inches and crosshead speed of 10 inches per minute conducted at 262 ° c . on 12 inch long by 0 . 75 inch wide strips cut from this plate with the fiber direction parallel to the 12 inch dimension showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . sliver from example 9 was re - broken to reduce the fiber length by passing it through two sets of elastomer coated nip rolls with a separation of 2 . 50 inches between the nips . the surface speed of the second set of rolls was 10 yards per minute and the surface speed of the first set of rolls was 7 . 1 yards per minute giving a draft of 1 . 4 . denier of this re - broken sliver was 4623 and the average fiber length of fifty measurements of this sliver was 1 . 33 inches ( shortest 0 . 6 inch , longest 3 . 1 inches ). a warp was prepared from this sliver by winding it , 13 ends to the inch on an 18 inch square metal plate . a 3 . 0 mil thick film of thermoplastic resin ( petg copolyester ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sandwich was vacuum bagged at 220 ° c . for 15 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 200 ° c . at 400 pounds per square inch for 30 minutes to make a well - consolidated plate 80 mils thick and fiber volume fraction of 50 %. high temperature tensile drawing tests , at a guage length of 10 inches and a crosshead speed of 10 inches per minute , conducted , at 262 ° c ., on 12 inch long by 0 . 75 inch wide strips cut from this plate with the fiber direction parallel to the 12 inch dimension showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . a pre - laminate was prepared from glass fiber from example 2 by a continuous process as follows : 46 ends of sliver were fed from a creel into a 6 inch wide warp which was sandwiched between two 1 . 0 mil pet poly ( ethylene terephthalate ) films to give a pre - laminate of 55 % fiber volume fraction . a release film of ` kapton ` polyimide was placed on each side of this sandwich to prevent sticking of molten pet to hot surfaces . this sandwich was then passed at 10 feet per minute through the nip of two steel rolls heated to 278 ° c . to tack the assembly together . a composite plate was made from this pre - laminate by removing the release film , trimming the excess pet from the edges and placing strips of pre - laminate in layers in a 16 inch square mold . each layer was made up of side - by side strips of pre - laminate to reach the required 16 inch width . a plate was made from 10 layers of pre - laminate by arranging them so that the direction of the stretch - broken fibers were offset by 45 degrees in a clockwise direction in successive layers . the bottom plane of the fifth layer was considered a reflecting plane and the next five layers were stacked so that the warp directions of the stretch - broken sliver were mirror images of the top five layers with respect to that plane . this sandwich was molded as in example 2 to make a well - consolidated composite plate with a fiber volume fraction of 55 %. this plate was heated to 280 ° c . and molded into a hemisphere with a radius of 3 inches . the plate conformed very well to the shape of the mold and it was concluded that the product was formable . a plate was made from 10 layers of pre - forms made by the method of example 11 by arranging them in a 16 inch square mold so that the direction of the stretch - broken fibers were offset by 45 degrees in a clockwise direction in successive layers . the bottom plane of the fifth layer was considered a reflecting plane and the next five layers were stacked so that the warp directions of the stretch - broken sliver were mirror images of the top five layers with respect to that plane . this sandwich was molded as in example 2 to make a well - consolidated composite plate with a fiber volume fraction of 55 %. this plate was heated to 280 ° c . and molded into a hemisphere with a radius of 3 inches . the plate conformed very well to the shape of the mold and it was concluded that the product was formable . continuous filament 2000 denier carbon fiber was made into a warp , preforms and a unidirectional plate by the method of example 1 . the end count was 25 per inch , the film was 2 . 0 mil thick film of thermoplastic resin ( an amorphous polyamide copolymer based on bis ( para - aminocyclohexl ) methane ). seven preforms were stacked to make the plate which was 55 mils thick and 55 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch gauge length with the following results : it was concluded that the product had very high strength and modulus . a warp was prepared from sliver from example 9 by winding it , 21 ends to the inch on a 18 inch square metal plate . a 2 . 0 mil thick film of thermoplastic resin ( an amorphous polyamide copolymer based on bis ( para - aminocyclohexl ) methane ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sandwich was vacuum bagged at 280 ° c . for 20 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 305 ° c . at 600 pounds per square inch for 40 minutes to make a well - consolidated plate 58 mils thick and fiber volume fraction of 55 %. one half inch strips cut from this plate were subjected to tensile tests at 8 inch gauge length with the following results : the uniformity of orientation of the fibers on the surface of this plate were measured from a photomicrograph and it was found that 92 % of the fibers were within ± 5 degrees of the axial direction . the product of this example , although made of discontinuous staple fiber , was equivalent to the strength and modulus of continuous filament fiber ( example 15 ). continuous filament 6700 denier glass fiber was made into a warp , preforms and a unidirectional plate by the method of example 1 . the end count was 15 . 5 per inch , the film was 3 . 0 mil thick pet ( poly ( ethylene terephthalate )) and 5 preforms were stacked to make the plate which was 55 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch gauge length with the following results : it was concluded that the product of example 17 exhibited the strength and stiffness expected of continuous filament glass fiber . a unidirectional plate was made from pre - laminate from example 13 by stacking 5 layers in a mold with all slivers in the same direction and heating in a press as in the reference example to give a final thickness of 103 mils . one - half inch strips cut from this plate were subjected to tensile tests at 8 inch gauge length with the following results : it was concluded that strength and modulus of the product of this example , although not as high as those from continuous filament glass ( example 17 ) were far superior to those of randomly oriented glass composites of equivalent fiber volume fraction reported in the literature ( ref . b . d . agarwal , l . j . broutman , &# 34 ; analysis and performance of fiber composites &# 34 ; p . 92 ) which are : | 8 |
turning now to the drawings , and beginning with fig1 and 2 , indicated generally at 10 in fig1 , in block / schematic form , is an illustration of both the preferred methodology , and the preferred general structural organization , of the system and practice of the present invention . from the description which now follows , when read in conjunction with these and the other two drawing figures , those generally skilled in the relevant art will know clearly how to implement and practice the invention . included in system and methodology 10 ( reference hereinafter will be made more specifically to methodology ), as shown in fig1 , are two diamond - shaped blocks 12 , 14 , and four rectangular blocks 16 , 18 , 20 , 22 . appropriately shown interconnecting these several blocks are arrow - headed lines which generally picture the operational flow that is implemented by methodology 10 . block 12 , marked “ toner - save ?”, asks , as on a user - interface display screen , a question of a user preparing to call for printing of a pdl color image ( object ). this question asks whether that user wishes ( yes / no ) to call for toner - save color rendering of an image selected for printing . the ( yes / no ) paths out of block 20 are clearly illustrated in fig1 , with the “ yes ” path leading to block 16 , marked “ image category ”, and the “ no ” path leading to block 20 , marked “ regular rendering ”. block 12 thus represents an opportunity for a user of the methodology of this invention to make a specific “ yes / no ” selection regarding implementation or non - implementation of toner - save color - image rendering . if a “ no ” selection is made , whatever the image is is simply treated in block 20 to regular , conventional rendering , and is then passed along from block 20 to block 22 which is labeled “ to printing ”. if the answer posed to the question presented in accordance with block 12 is “ yes ”, then control effectively passes to block 16 which obtains information ( see arrow 24 in fig1 ) from the relevant imaging system ( not part of this invention ) which describes the nature , or category , of pdl image , or object , that has been selected for toner - save rendering . in this context , there are three high - level general categories of imagery ( objects ) which are specifically addressed by the present invention . these three categories include ( a ) text imagery , ( b ) graphics imagery , ( c ) and raster imagery . thus , in block 16 , after a “ yes ” toner - save decision has occurred , the first image - related determination which takes place by operation of the invention is the category of the image respecting which toner - save rendering is to take place . previously mentioned arrow 24 , which points toward the right side of block 16 in fig1 , represents the presentation of image - category information from the relevant pdl imaging - system interpreter regarding the specific category of imagery just mentioned . from block 16 , control is handed to block 14 , labeled “ ts rendering ?”. this block essentially asks the next question , which is whether or not the categorically specific image that has been identified by block 16 , possesses certain predetermined imagery characteristics ( a threshold ) which make it suitable for tone - save rendering . in other words , because of this thresholding consideration , not necessarily are all images actually subjected to toner - save rendering . rather , and in order that the system and methodology of this invention will operate most efficiently and effectively , a further image - specific determination is made in order to confirm whether or not toner - save rendering is actually to take place . this thresholding practices separates images with regard to which toner - save rendering is unnecessary and / or inappropriate . with regard to text imagery , font size is employed as a threshold determiner regarding whether or not a particular text image is to be presented for toner - save rendering . clearly , and as will be recognized by those generally skilled in the relevant art , what this toner size specifically is is a matter of user / system - designer choice . in the preferred implementation of methodology 10 now being described herein , the font - size threshold level which has been selected is font - size - 12 . with regard to graphics imagery , the threshold determiner involves an assessment of both image pixel height and image pixel width . while these two pixel dimensions may be different in number if desired , in most instances it has been found to be preferable to employ like size numbers for both of these dimensions . in the preferred embodiment of the invention now being described , the pixel height and pixel width numbers are the same , and are set at the level of 8 - pixels . with respect to a raster image , that categorical determination alone is employed , without any additional threshold questioning , to determine that such an image is indeed appropriate for toner - save rendering . a point which should be made here regarding what occurs when the question presented by block 12 is answered in the affirmative is that the related imaging system is placed in a condition for performing any actually implemented toner - save rendering in a bi - tonal mode of operation . those skilled in the art will immediately recognize the significance of this selection , and also how it may be implemented . with respect to the operation of block 14 , if a particular image which has been reviewed has characteristics that lead to a “ yes ” answer emerging from block 14 , control passes to block 18 , labeled “ toner - save rendering ”. block 18 performs toner - save rendering , as will shortly be described , and passes rendered imagery data to block 22 for ultimate printing . if an image being reviewed for toner - save rendering results in a “ no ” answer emerging from block 14 , that image is passed directly to block 20 for regular rendering , after which , such rendered image data is passed to block 22 for printing . turning attention now more specifically to fig2 , this fragmentary block / schematic diagram presents a somewhat more detailed picture of previously described toner - save rendering block 18 shown in fig1 . in accordance with practice of the present invention , toner - save rendering fundamentally involves two steps which are represented in fig2 by two blocks , 26 , 28 . the step represented by block 26 , labeled “ preserve edge density ”, involves a decision not to make any change in current pixel edge density ( a preserving pixel edge density modality ). thus , for all of the categories of imagery which are to be subjected to toner - save printing , all will be treated in exactly this fashion with respect to the preservation of edge density in the region of an object &# 39 ; s edge . the other step is represented by block 28 , labeled “ maximize dot gain ”. this step of the invention relates to pixel content in the region within an image &# 39 ; s bounding edge . fundamentally what is implemented here is the rendering of an image so as to create , within the image &# 39 ; s edge , or boundary , a pixel distribution which is checkerboard - like in nature , and which , when implemented appropriately , results in the inside region of an image displaying what is known in the art as maximum pixel dot gain . this concept of maximum pixel dot gain is well known to those skilled in the art , and needs no elaboration here . this rendering practice is referred to herein as a checkerboarding dot - gain maximizing modality . completion of the activities represented by blocks 26 , 28 in fig2 effects the desired and requested color - image toner - save rendering in accordance with practice of the invention . before turning specific attention to fig4 in the drawings which presents a representative image that has been toner - save rendered , let us turn attention for a moment to fig3 which , effectively , illustrates in greater detail that which is shown in fig1 and 2 . included in the illustration presented in fig3 are three diamond - shaped blocks 30 , 32 , 34 , and twelve rectangular blocks 36 - 58 ( even numbers only ), inclusive . a comparative viewing of fig1 and 3 will make readily apparent to those skilled in the art how the components shown in fig3 relate to those which are pictured in fig1 and 2 . as illustrated in fig3 , block 36 represents the start of an implementation of the methodology of the invention , and block 30 represents , essentially , the same as that which is represented by block 12 in fig1 . if a user elects to use toner - save rendering , control passes to block 38 , and if not , control passes to block 40 . block 38 effectively places the relevant imaging system in a condition ready for bi - tonal modal operation with respect to any implemented toner - save rendering . next , blocks 42 , 44 , 46 ( which combinedly are represented by single block 16 in fig1 ), assess the category , among the three mentioned earlier , of color imagery which is to be rendered . if control , instead of being handed to block 38 , goes to block 40 , then conventional , regular rendering of a particular image takes place , and the rendered result is sent to block 58 which is the same , effectively , as block 22 in fig1 . diamond blocks 32 , 34 are referred to herein as thresholding blocks , and represent the determinations which are performed , as earlier mentioned , with respect to assessing threshold characteristics of text and graphics images , respectively . the functionalities of these blocks are represented collectively in fig1 within block 14 . no such diamond - shape thresholding block is employed on the downstream side of block 46 , inasmuch as the categorical determination that a raster image is to be rendered is all that needs to occur in order for toner - save rendering to be implemented for such an image . with regard to a text image , if the threshold font size characteristic is appropriate , toner - save rendering is implemented in block 48 , and the rendered result is passed to block 58 . if the text font size threshold is not met , the image is passed for rendering in a regular fashion within block 50 , and from this block , rendered data is passed to print block 58 . with respect to a graphics image , a “ yes ” answer with respect to image characteristics related to pixel height and pixel width dimensions causes control to pass through block 52 for toner - save rendering , and thence to print block 58 . if either the height or the width threshold level is not met by a particular reviewed graphics image , rendering is performed in a normal , non - toner - save manner within block 54 , with the “ normally ” rendered image data then being passed to print block 58 . a raster image is simply automatically toner - save rendered as illustrated by block 56 in fig3 . this toner - save rendered raster image is then passed along to print block 58 . it should be apparent that blocks 40 , 50 and 54 in fig3 are represented by singular block 20 in fig1 . similarly , it should be apparent that blocks 48 , 52 , 56 in fig3 are represented by singular block 18 in fig1 . with respect to the activities which are effected by toner - save rendering blocks 48 , 52 , 56 in fig3 , these activities are implemented in blocks 26 , 28 in fig2 . turning attention now to fig4 in the drawings , illustrated in this figure , in a row - and - column fashion at 60 , is a representative image which is has been toner - save rendered in accordance with practice of the present invention . image 60 is employed herein to illustrate practice of the invention with respect to each of the three categories of pdl images mentioned earlier , namely , text images , graphics images , and raster images . it will be assumed for the purpose of this description that image 60 , with respect to its representation of a text image , is characterized with a font size of at least 12 . with respect to thinking of image 60 as relating to a graphic image , one can see that the image shown here in fig4 has a pixel height of 8 - pixels as well as a pixel width of 8 - pixels . thus , what is shown in fig4 meets the minimum threshold requirements for the implementation of toner - save rendering for both text and graphics images . thinking about image 60 as representing a raster image , that determination alone is sufficient to determine that toner - save rendering is appropriate . image 60 , as mentioned above , is shown in a toner - save rendered condition . what will be noticed , therefore , about this thus - rendered image , is that edge density , shown generally at 62 , has been preserved to form a continuous , bounding pixel edge 62 . within this preserved - density , bounding edge is a central pattern 64 which is checkerboarded in nature , and which very specifically , is checkerboarded in a manner which produces maximum pixel dot gain . the invention thus proposes a unique , quite simply implemented , and very effective toner - save method which may be employed with regard to pdl text , graphics and raster color images , or objects . where toner - save rendering is selected to be employed , once an image to be considered for toner - save rendering has been determined to pass all of the thresholding tests necessary , that image is toner - save rendered in a manner whereby pixel edge - region density is preserved , and central regions of the image are prepared with a maximized dot gain checkerboard pattern . accordingly , while a preferred embodiment and manner of practicing the invention have been described herein , it is appreciated that variations and modifications may be made therein without departing from the spirit of the invention , and it is intended that all claims to invention herein will cover such variations and modifications . | 6 |
referring to the accompanying drawings , and , more particularly , to fig1 - 3 , it can be seen that the present invention represents an outgrowth of my prior invention , described in u . s . pat . no . 4 , 013 , 265 , the disclosure of which is to be considered incorporated in this disclosure . in fig1 - 3 is shown a deflation valve 10 for a blood pressure measuring device . this valve consists essentially of a valve housing 11 with an axial main bore 14 ( fig3 ) leading through the housing and through a forwardly extending connecting nipple 13 and a rearwardly extending connecting tube 12 . to the former is normally attached a flexible air hose whose other end is connected to the measuring cuff of the device ( not shown ), to the latter is attached an inflation bulb ( likewise not shown ). inside the valve housing 11 , in line with the valve plunger 15 , of which only the upper portion is shown , is further arranged a cross bore which leads from the main bore 14 to a tapered valve seat surrounding the valve plunger on the upper side of the housing 11 . inside the cross bore is further arranged a plunger return spring which urges the valve plunger 15 outwardly , into a closed position against the valve seat . the cross bore , valve seat , valve plunger , and plunger return spring may be part of a subassembly which is mounted inside a removable valve insert . the valve plunger 15 controls an air outlet through which the pressure in the measuring cuff can be gradually reduced , as required for the determination of the two blood pressure values . the complete depression of the valve plunger 15 opens up additional air passages , for the rapid release or &# 34 ; dumping &# 34 ; of the residual air pressure from the measuring cuff . the opening position of the valve plunger 15 is controlled by means of an actuating lever 16 which is pivotably attached to the valve housing 11 by means of a pivot pin 22 . the latter is an integral part of the actuating lever 16 , being snappable into a suitable pin lodgement of the valve housing 11 , as a result of a clamping slot 23 which renders a portion of the valve housing flexible . the actuating lever 16 has the shape of an inverted &# 34 ; u &# 34 ;, with side wall portion 18 and 19 reaching over the parallel side walls 20 and 21 of the valve housing 11 . a linking bridge portion 17 of lever 16 is designed for finger application , having on its outside appropriate anti - slip ridges and a hump with a release flank 27 , the purpose of which will be described further below . the inner side of the bridge portion 17 engages the upper extremity of the valve plunger 15 . thus , when the actuating lever 16 is gradually depressed , it slowly pushes the valve plunger 15 into the valve housing 11 , away from its valve seat . the fully closed and fully open positions of the actuating lever 16 and of the valve plunger 15 are shown in fig1 and fig2 respectively . as can be seen in fig3 the valve housing 11 has a generally rectangular cross section , its side walls 20 and 21 serving to loosely guide the overhanging side wall portions 18 and 19 of the actuating lever 16 . the four walls are thus perpendicular to the pivot axis of the actuating lever 16 . the deflation valve 10 is normally self - closing , under the influence of its plunger return spring ( not shown ), meaning that finger pressure is necessary to maintain the actuating lever 16 in the desired deflation position . a removal of the finger pressure will immediately close the valve . however , for a complete evacuation of the measuring system , following termination of the measuring procedure , the deflation valve 10 also has a detent mechanism 24 which maintains the valve in its dumping mode , i . e . the fully open valve position , without requiring finger pressure on the actuating lever 16 . for this purpose , the housing side walls 20 and 21 and the lever side wall portions 18 and 19 have cooperating detent members in the form of triangular detent grooves 26 in the housing side walls 20 and 21 and matching triangular detent ridges 25 in the lever side wall portions 18 and 19 . the detent grooves 26 and cooperating detent ridges 25 are preferably arranged in a near - radial orientation with respect to the pivot axis of the actuating lever , although this is not a requirement . in order to obtain a highly sensitive adjustment operation on the actuating lever 16 and valve plunger 15 , it is desirable to minimize the frictional contact between the valve housing 11 and the actuating lever 16 . this can be achieved by arranging the location of the detent members 25 and 26 near the upper edge of the valve housing 11 and close to the bridge portion 17 of the actuating lever 16 , so that the protruding detent ridges 26 will not come in contact with the housing side walls 20 and 21 , until the actuating lever 16 has almost reached its dumping end position . alternatively , if the detent ridges were to be arranged on the valve housing 11 , with cooperating detent grooves in the side wall portions 18 and 19 of the actuating lever 16 , then it would be preferable to locate these grooves near the lower edges of the lever side wall portions 18 and 19 . the flexibility of the side wall portions 18 and 19 and bridge portion 17 of the actuating lever 16 , in conjunction with the particular shape and depth of engagement of the detent cam formation has to be such that the pivoting torque required for the disengagement of the detent ridges 25 from the detent grooves 26 is greater than the torque which is exerted against the actuating lever 16 by the fully depressed plunger return spring . accordingly , while the detent mechanism 24 retains the actuating lever 16 in the dumping position ( fig2 ), it can readily be released from this position by applying finger pressure against the inclined release flank 27 , thereby creating a counterclockwise torque on the actuating lever 16 which adds itself to the valve closing torque produced by the plunger return spring . this deflation valve is thus designed for operation with one finger , preferably the thumb of the hand in which the unit is held . in fig4 - 6 is shown a second embodiment of the invention , as applied to a compact blood pressure measuring device which has a valve housing 28 , a pressure gauge 30 , and an inflation bulb 29 mounted together in a hand - held pressure unit . the valve housing 28 has an oblique mounting face for the pressure gauge 30 , thus giving the housing 28 a generally triangular contour . as is shown in fig4 the actuating lever 31 has a corresponding triangular contour , being recessed into the body of the valve housing 28 . this is shown in detail in fig5 and 6 . the valve housing 28 of this embodiment has a rounded lower contour , being preferably injection - molded of plastic material . fig5 shows how the cup - shaped sheet metal housing 33 of the pressure gauge 30 is directly attached to the oblique mounting face of the valve housing 28 . for this purpose , the gauge housing 33 has two openings 34 surrounded by outwardly tapering wall portions into which are engaged matching weld buttons 35 of the valve housing 28 . these weld buttons , initially cylindrical integral extensions of the housing 28 , are inserted through the bottom openings 34 of the gauge housing at assembly , whereupon they are flattened into the tapered depressions which surround the openings 34 , using a suitable heated tool . the actuating lever 31 of this embodiment , being received in a recess 32 of the valve housing 28 , has a shape which substantially fills out the recess . the pivot pin 40 for the actuating lever is again arranged near the forward extremity of the lever 31 which , in this case , is much narrower than the rear portion of lever 31 . the orientation of the pivot pin 40 is perpendicular to the oblique mounting face for the pressure gauge 30 . although generally triangular in contour , the actuating lever 31 has again a u - shaped cross section , the outer extremity of the valve plunger bearing against the inside of a transverse wall portion of lever 31 . but , because the side walls of the actuating lever 31 are no longer parallel , the detent mechanism 36 of this embodiment is restricted to only the upper lever side wall 39 which extends in a radial plane with respect to the lever pivot axis . one of the cooperating detent members is defined by a detent groove 37 near the edge of the lever side wall 39 ; the other detent member is a cantilever - type spring member 38 of round spring wire . the attached end portion of the detent spring member 38 is shaped in the form of an eye portion 42 , surrounding one of the two weld buttons 35 and being clamped between the valve housing 28 and the rim of the opening 34 of gauge housing 33 . the free extremity of the spring member 38 is rounded to form a detent nose 41 engaging the detent groove 37 of lever 31 . in this case , the detent cam formations are not triangular , but rounded , i . e . matchingly convex and concave . the arrangement of the detent grooves 37 near the edge of the lever side wall 39 has again for its purpose to avoid frictional resistance against the movements of the actuating lever 31 , until shortly before the latter reaches its fully depressed dumping position . at this point , a bevel on the edge of side wall 39 lifts the detent nose 41 onto the side wall 39 . a tongue - shaped lever guide 44 extends outwardly from the bottom of the housing recess 32 with a small clearance to the inner side of the lever side wall 39 , thereby serving as a support for the actuating lever 31 , against the transverse bias of the detent spring member 38 . a recess 43 in the upper portion of the valve housing 28 gives the detent spring member 38 freedom to move against the lever side wall 39 . in the lateral sense , this recess 43 is only slightly larger than the wire diameter of the detent spring member 38 , thereby positioning and guiding the latter . in general , the operation of the deflation valve of the embodiment of fig4 - 6 is the same as that of the previously described embodiment , the actuating lever 31 having again an upwardly inclined release flank on its narrow forward end portion , for the application of finger pressure , when the deflation valve is to be released from the dumping position in which it is held by the detent mechanism 36 . the deflation valve and pressure unit of fig4 - 6 is designed for right - handed operation . it should be understood that an equivalent pressure unit for left - handed operation requires only a left - to - right mirror image rearrangement of the housing recess 32 , actuating lever 31 , and detent mechanism 36 inside the valve housing 28 . in fig7 and 8 is shown a third embodiment of the invention which is generally similar to the embodiment of fig4 - 6 just described . outwardly , the differences between these two embodiments would not be visable in fig4 . the device of fig7 and 8 differs from the device of fig5 and 6 only in the type of spring member which serves as the second detent member , in cooperation with the upper side wall of the actuating lever 53 . the other features of this embodiment are unchanged from the previously described embodiment and will therefore not be separately described here . taking the place of the earlier wire spring detent member 38 is a spring member 45 of flat spring steel . this leaf spring is again of the cantilever type , having one end portion clamped between the oblique mounting face of the valve housing 46 and the bottom of the gauge housing 50 . this clamped end portion of the detent spring member 45 is retained inside a shallow recess portion 48 of the valve housing 46 , having a bore 47 engaged by a small integral positioning knob 49 of the valve housing 46 . a downwardly offset portion of the spring member 45 is positioned inside a deep recess portion 52 of the valve housing 46 , extending outwardly into the housing recess of the actuating lever 53 and engaging a detent groove 55 in the side wall of the latter . while the detent spring member 45 is no longer positioned around one of the weld buttons 51 of the unit , its assembly is similar , though somewhat simpler , than is the case in the previously described embodiment : the detent spring member 45 is placed into its recess , the gauge housing 50 is inserted over the -- initially cylindrical -- weld buttons 51 , and the latter are permanently set into their surrounding tapered depressions . the small positioning knob 49 , engaging the bore 47 of spring member 45 , prevents the latter from being pulled out of its seat in the shallow recess portion 48 . the detent cam formations of this embodiment , rather than being convexly and concavely curved , as previously , are triangular in shape , the downwardly offset length portion of the detent spring member 45 being preferably located just above the side wall of the actuating lever 53 . the use of a leaf spring as a detent member has the advantage of providing a larger contact surface between the spring and the cooperating detent groove of the actuating lever , thereby greatly reducing any potential wear on the detent cam formations over the long run . it should be understood , of course , that the foregoing disclosure describes only preferred embodiments of the invention and that it is intended to cover all changes and modifications of these examples of the invention which fall within the scope of the appended claims . | 0 |
before describing the invention , a typical computer is described to provide a basis for understanding the invention . fig1 illustrates a typical computer system 10 that includes a host computer 12 , a small computer system interface ( scsi ) peripheral device 14 , and a scsi buss 16 for conveying communications between the host computer 12 and the scsi peripheral device 14 . the host computer 12 includes a memory ( not shown ) for storing instructions that are executed by a processor ( not shown ). a set of instructions for performing a particular task form a program . one of the programs that is typically executed by the host computer 12 is an operating system program that performs certain basic tasks , like processing input from a keyboard , sending output to a monitor or printer , keeping track of files and directories , and controlling the operation of peripherals , such as the scsi device 14 , at a general level . in many situations , the host computer 10 also executes an application program 20 . an example of an application program is a word processing program that is used to produce documents . the execution of an application program typically requires the use of a peripheral , such as the scsi device 14 . for example , if the application program is a word processing program , the documents produced with the word processing program are typically transferred from the memory of the host computer 12 to a storage peripheral so that the memory within the host computer 12 , which is typically limited , can be used for other purposes . consequently , in many situations , the scsi device 14 is a storage peripheral ( e . g ., tape drive , disk drive , tape library , disk library ). in most cases , it is impracticable for an application program to communicate directly with a peripheral device , such as the scsi device 14 . this impracticability stems from the facts that : ( 1 ) there are typically a number of different peripherals in a computer system that each have different command / communication protocols ; and ( 2 ) the peripherals associated with one computer system are likely to be different from the peripherals associated with another computer system . for an application program to work in such an environment , the program would have to be customized for each of the computer systems in which it is installed . to avoid this problem , most application programs are designed to work with a particular operating system ( e . g ., windows , macintosh and unix ), which has a set of generic commands that the application program can use to communicate with a peripheral . to translate the generic commands into device specific commands that a particular peripheral understands , the operating system 18 utilizes a device driver . in the case of scsi device 14 , a scsi device driver 22 is utilized by the operating system 18 to translate the generic commands into the commands used by the scsi device 14 . in addition to the translation of generic commands into device specific commands , the host computer 12 must also convey command related information to and from a peripheral device according to a data transfer protocol . the protocol typically includes some kind of “ handshake ” between the host computer and the peripheral device that is used to assure that both the host computer and the peripheral are synchronized . the protocol also typically defines the manner in which data is transferred and when the data transfer is complete . in the case of the scsi device 14 , the host computer includes a scsi adapter driver 24 and a scsi adapter 26 . the scsi adapter 26 is a card that interfaces with the scsi buss 16 and includes the electrical circuitry that is used to transfer scsi command related information between the host computer 12 and the scsi device 14 . the scsi driver adapter 24 controls the scsi adapter 26 and the transfer of scsi command related information to and from the scsi device driver 22 . fig2 illustrates a basic computer network 28 that includes a first computer system 30 and a second computer system 32 . the first computer system 30 includes a first computer 34 and a first scsi device 36 . the second computer system 32 includes a second computer 38 and a second scsi device 40 . connecting the first computer system 30 and the second computer system 32 is a network cable or buss 42 . the operating system associated with the first computer system 30 utilizes a first network card 44 to conduct communications of the network buss 42 . likewise , a second network card 46 is utilized by the second computer 32 to conduct communications over the network buss 42 . communications between the first and second computer systems 30 , 32 , are conducted over the network buss 42 according to a protocol . a popular protocol that allows communications to occur over many different types of carriers ( e . g ., ethernet , modems , satellite links etc .) is tcp / ip . with continuing reference to fig2 the first computer system 30 includes a scsi device driver that , once installed , identifies the first scsi device 36 to the operating system associated wit the first computer 30 and allows the operating system to interact with the first scsi device 36 . because the first scsi device 36 is known to the operating system of the first computer 34 , the first scsi device 36 is commonly referred to as a “ local ” device . the second scsi device 40 is likewise recognized by the second computer 38 as a “ local ” device . however , the first scsi device 36 is not part of and not recognized by the second computer system 32 . further , for the second computer system 32 to communicate with the first scsi device 36 , the network buss 42 must be utilized . for these reasons , the first scsi device 36 is referred to as a “ remote ” device relative to the second computer system 32 . likewise , the second scsi device 40 is a “ remote ” device relative to the first computer system 30 . with continuing reference to fig2 if it is desirable for an application program executing on the first computer 34 to conduct communications with the second scsi device 40 , which is a remote device relative to the first computer 30 , the application program must be modified relative to the application program 20 shown in fig1 that utilizes the local scsi device 14 . further , the time and resources of the second computer system 32 must be utilized . for example , if an appropriately modified application program executing on the first computer 34 wants to send information to the second scsi device 40 , the operating system of the first computer 34 must bundle the information in the appropriate format to be sent over the network buss 42 and the network card 44 must engage in the appropriate protocol exchanges to transfer the information . upon receiving the information at the second network card 46 , the operating system associated with the second computer system 38 must process the information received by the second network card 46 and then engage in whatever other processing is necessary to place the information in condition for sending to the second scsi device 40 . the present invention allows an application program executing on one computer system to communicate with a remote peripheral device as if the remote device were a local device . as a consequence , the invention prevents an application program that was designed to use local peripherals from having to be modified to work with a remote peripheral , i . e ., a peripheral that is situated such that communications must occur over a network buss . fig3 illustrates an embodiment of a computer network 50 in which an unmodified application program is capable of communicating with a remote scsi device . the computer network 50 includes a computer 52 , a remote scsi peripheral 54 , and a network buss 56 for conveying data between the computer 52 and the remote scsi peripheral 54 . the computer 52 includes , when the invention is in use , an application program 58 that has been written to communicate with local peripherals associated with the computer 52 . for simplicity , no local peripherals have been shown as being associated with the computer 52 . however , such peripherals are not precluded . further included in the computer 52 is an operating system 60 for performing the tasks noted with respect to the operating system 18 shown in fig1 . among those tasks , the operating system 18 receives requests from the application program 58 that require communication with a peripheral and if necessary , provides information to the application program resulting from the communication with a peripheral . the computer 52 also includes a scsi device driver 62 that identifies a remote scsi device 64 associated with the remote scsi peripheral 54 to the operating system 60 . the scsi driver 62 also translates the generic commands that the operating system 60 receives from the application program into a scsi command / commands that is / are recognized by the remote scsi device 64 . further , the scsi device driver 62 receives any communications back from the remote scsi device 64 that result from the execution of a command previously sent to the scsi device 64 and , if necessary , provides or makes available any such communications to the operating system 60 and / or application program 58 . unlike the scsi device driver 22 shown in fig1 the scsi device driver 62 communicates with a scsi virtual adapter 66 that : ( 1 ) takes any scsi command received from the scsi device driver 62 and embeds the scsi command in the format required for sending the command over the network buss 56 and provides the embedded scsi command to the operating system 60 , which can then cause the command to be conveyed over the network buss 56 via a network controller 68 ; and ( 2 ) receives any response to a previously issued scsi command ( which has also been embedded or encoded by the scsi peripheral 54 for transmission over the network buss 56 , received by the network controller 68 , and provided to the operating system 60 ), un - encodes the response , and provides the un - encoded response to the scsi device driver 62 . generally , the encoding of scsi command related information for transport in either direction over the network buss 56 involves the transmitting element placing the scsi command related information in a pre - determined structure that can be decoded or un - embedded by the receiving element to obtain the relevant information . scsi commands and their related data are encoded or embedded by the computer for transmission of the computer network and decoded or un - embedded by the scsi peripheral or device . with respect to the embodiment illustrated in fig3 the virtual adapter 66 encodes or embeds scsi commands ( including any command data ) that are to be executed by the remote scsi peripheral 54 ( more specifically , the scsi device 64 ) for transmission over the network buss 56 pursuant to the tcp / ip protocol . the ethernet - to - scsi controller 70 decodes or un - embeds the encoded scsi commands so that the commands can be applied to the scsi device 64 . fig4 a illustrates one type of pre - determined structure , a scsi request block ( srb )- command request data operation packet ( dop ), that is suitable for embedding or encoding scsi command information for transmission from a computer to a scsi peripheral , e . g ., from the computer 52 to the remote scsi peripheral 54 . the srb includes a dop header that specifies the nature and length of the scsi command related information that follows . this information facilitates the proper decoding or un - embedding of the following scsi command related information by the scsi peripheral or device . following the dop header is a srb command header that provides information relating to the identification of a specific scsi command to be performed by a scsi device , e . g ., the scsi device 64 . following the srb command header is the srb command data block that provides the data associated with the scsi command identified in the srb command header . the responses to scsi commands and their related data are encoded or embedded by the scsi peripheral or device and decoded or un - embedded by the computer . with respect to the embodiment illustrated in fig3 the ethernet - to - scsi controller 70 encodes or embeds the responses ( including any data ) to scsi commands that have been executed by the remote scsi peripheral 54 ( more specifically , the remote scsi device 64 ) for transmission over the network buss 56 pursuant to the tcp / ip protocol . the virtual adapter 66 decodes or un - embeds the encoded scsi command responses so that the responses can be supplied to the operating system 60 and / or application program 58 . fig4 b illustrates one type of pre - determined structure , a scsi request block ( srb )- command response data operation packet ( dop ), that is suitable for embedding or encoding responses to scsi commands for transmission from a scsi peripheral or device to a computer , e . g ., from the remote scsi peripheral 54 to the computer 52 . the srb includes a dop header that specifies the nature and length of the scsi command response related information that follows . this information facilitates the proper decoding or un - embedding of the following scsi command response related information by the computer . following the dop header is a srb command header that provides information relating to the status of the scsi command that has been performed by a scsi device , e . g ., the scsi device 64 . following the srb command header is the srb command data block that provides any data associated with the processing of the scsi command by the scsi peripheral 54 and , in particular , the scsi device 64 ( such as data read from a tape ). in the illustrated embodiment , the network buss 56 is a lan or wan and the tcp / ip protocol is utilized to manage the transmissions over the buss 56 . it should , however , be appreciated that the invention is not limited to any particular network or data transfer protocol . with continuing reference to fig3 the remote peripheral 54 includes the scsi device 64 . additional scsi devices can be incorporated into the remote peripheral 54 if desired . also part of the remote peripheral 54 is an ethernet - to - scsi controller 70 for : ( 1 ) receiving encoded scsi command related information that has been transmitted from the computer 52 over the network 56 and un - encoding the scsi command related information so that the scsi command related information can be transmitted to the scsi device 64 via a scsi buss 72 ; and ( 2 ) receiving scsi command related information from the scsi device 64 via the scsi buss 72 and encoding the received scsi command related information for transmission to the computer 52 over the network buss 56 . it should be appreciated that the invention is not limited to ethernet based networks . consequently , other types of scsi controllers can be utilized . having described the computer network 50 , an example of the operation is now provided . in this particular example , the scsi device 64 is a data storage device with data that the application program 58 needs to accomplish its task . initially , the application program 58 issues a generic file read command to the operating system 60 that identifies the file that the application program 58 requires to have brought into the computer 52 . in response , the operating system 60 associates the file identified with the scsi device 64 and passes the generic read command onto the scsi device driver 62 for translating the generic read command into one or more scsi read commands that are appropriate for retrieving the requested file from the scsi device 64 in the remote peripheral 54 . the scsi commands produced by the scsi device driver 62 are conveyed to the scsi virtual adapter 66 . in response , the scsi virtual adapter 66 encodes or embeds the scsi command ( s ) for transmission over the network 56 and issues a request to operating system 60 to cause the transmission to occur . in response , the operating system 60 causes the encoded scsi command ( s ) to be placed on the network buss 56 by the network controller 68 for transmission to the remote peripheral 54 . initially , the ethernet - to - scsi controller 70 receives the encoded scsi command ( s ) that have been transmitted over the network buss 56 by operation of the computer 52 . in response , the ethernet - to - scsi controller 70 un - encodes the scsi command ( s ) from the overhead associated with transmitting the commands over the network buss 56 and places the scsi command ( s ) on the scsi buss 72 such that the commands are directed to the scsi device 64 . upon receipt of the scsi command ( s ), the scsi device 64 takes the action ( s ) required by the command ( s ), which in this case are operations related to reading data from the identified file . to elaborate , once the scsi device 64 has located the identified file , it reads the data contained in the file and conveys the data to the ethernet - to - scsi controller 70 over the scsi buss 72 according to the scsi protocol . the ethernet - to - scsi controller 70 , in response , encodes or embeds the data ( scsi command related information ) in a form for transmission over the network buss 56 and causes the encoded data to be transmitted over the network buss 56 . the network controller 68 receives the encoded data and informs the operating system 60 that a network communication has been received that is related to the scsi device 64 . since the scsi virtual adapter 66 appears to the operating system 60 to be the scsi device 64 , it causes the encoded data to be communicated to the scsi virtual adapter 66 . upon receiving the encoded data , the scsi virtual adapter 66 un - encodes the data and provides the un - encoded data to the scsi device driver 62 . the scsi device driver 62 and the operating system 60 , then cooperate to make the data available to the application program 58 . other aspects of the operations associated with the communications between a host computer and a remote scsi tape storage device that appears to the operating system of the host computer as a local device are now described . the present invention recognizes that operating systems in many computer systems , upon booting up , endeavor to identify all the local scsi devices associated with the computer system and that this identification process occurs before the operating system enables network communications . consequently , any remote scsi device that is meant to appear to the operating system to be a local cannot be identified at the time that the operating system has allotted for identify local scsi devices because network communications have not yet been enabled . this problem is addressed by providing a program that is executed on the computer system 50 as part of installation of the virtual adapter 66 and permits a user to identify the remote scsi tape storage devices associated with the virtual adapter 66 . once identified , the program stores the information that would be requested by the operating system if the remote scsi tape storage device were a conventional local device in a portion of the memory allocated solely to the operating system and known as the system registry . when the operating system subsequently issues an inquiry to the virtual adapter to provide the information required by the operating system for conducting communications with the remote scsi tape storage device , the virtual adapter 66 responds by providing the information stored in the system registry to the operating system . memory other than the system registry may be used to store the information provided that the memory is accessible to the virtual adapter 66 when the operating system requests the information on boot up of the system 50 . another aspect of the communications between a computer system and a remote scsi tape storage device that appears to the operating system of the computer system to be a local device is a reduced number of exchanges between the computer system and the remote scsi tape storage device . fig5 a illustrates the known sequence of exchanges that occurs between a computer and a scsi device . the sequence commences with the computer sending a command without any of the data associated with the command to the device . in response , the scsi device accepts the command and sends a request for the data associated with the command to the computer . the computer , in reply to the request , sends the command data to the device . once the device receives the command data , the device has all of the information needed to process the command and proceeds to do so . once the command has been processed by the device , a response is sent from the device to the computer . examples of responses include providing an indication that the command has been completed or that the command could not be executed . in other cases , the response may involve the providing of user data to the computer that was stored on the device . in any event , at least four exchanges between the computer and the device are required to process a scsi command . with reference to fig5 b , the computer system 52 and , in particular , the virtual adapter 66 and ethernet - to - scsi controller 70 , have been designed to reduce the number of exchanges between the computer system 52 and the remote device 54 that are needed to process a scsi command to two exchanges . to elaborate , the virtual adapter 66 , instead of sending the command and the command data in separate communications to the remote device 54 , sends both the command and the command data to the remote device 54 in the same communication and pursuant to the tcp / ip protocol . the remote device 54 is , however , only able to process the command and the associated command data when sufficient resources , such as memory and processing time , are available . consequently , the remote device 54 does not allow the tcp / ip protocol to provide an acknowledgment to the computer system 52 until the resources needed to process the command are available . until the resources are available , the command and data are essentially retained in the pipeline provided by the buss 56 . stated differently , the computer system 52 and the remote device 54 make use of the network buss 56 and the tcp / ip protocol to synchronize the exchange of scsi command related information instead of the sequence of scsi exchanges described with respect to fig5 a . in one embodiment , this control is achieved by the ethernet - to - scsi controller 70 reviewing the dop header of a srb command request dop ( fig4 a ) to determine what scsi command the computer 52 wants to have the remote scsi device 64 perform . based on this determination , the controller 70 determines if the resources for processing the command are available . if the resources are not available , a flag is set that is used to instruct the tcp / ip event handler not to acknowledge the receipt of any data associated with the command . once the resources are available , the flag is reset and the receipt of the data is acknowledged . yet a further aspect of the communications between a computer system and a remote scsi tape storage device that appears to the operating system of the computer system to be a local device is an increase in the frequency of scsi write commands to remote scsi tape storage devices relative to the known approach . fig6 a illustrates the sequence of exchanges that presently occur between a computer and a scsi device in processing a write command . initially , the computer system issues a write command to the remote device . in response , the controller associated with the device initiates processing of the command , waits for processing of the command to be completed ( e . g ., data written to a tape storage device ), and sends an indication to the computer that the processing of the command has been completed . only after the computer receives the indication that the command has been completed is the computer free to issue further commands . with reference to fig6 b , the sequence of operations associated with the processing of a write command in the system 50 is discussed . initially , the computer system 52 issues a write command to the remote device 54 via the virtual adapter 66 . the ethernet - to - scsi controller 70 , upon receiving the write command , sends a response back to the computer system 52 that the write command has been completed before the write command has actually been completed by the remote scsi tape storage device 64 . as a consequence , the computer system 52 is free to issue another command . in one embodiment , the ethernet - to - scsi controller 70 only provides the noted write completed response if the immediately preceding write or similar command was successfully completed by the remote device 54 and , in particular , the scsi device 64 . the successful processing and completion of the command immediately preceding the current write command provides assurance that the scsi device 64 is likely to successfully complete the processing of the current write command . in an alternative embodiment , the virtual adapter 66 , rather than the ethernet - to - scsi controller 70 , generates the response to the write command indicating that the write command has been completed before the scsi device 64 completes the command . another aspect of the communications between a computer system and a remote scsi tape storage device that appears to the operating system of the computer system to be a local device is the ability to provide robust or error tolerant communications between the computer system and the remote scsi tape storage device . to elaborate , the virtual adapter 66 operates to terminate endpoint connections ( i . e ., connections established at the tcp / ip level between the computer system 52 and the remote device 54 ) if a predetermined amount of time has elapsed from the point at which it had no outstanding scsi commands . by having the virtual adapter terminate endpoint connections in this fashion , the exposure to situations that can disrupt endpoint connections ( e . g ., endpoint resets and restarts , transport carrier disruption etc .) and require lengthy and / or resource consuming recovery procedures is reduced . however , while purposely terminating endpoints avoids such problems , such terminations adversely impact the ability to support : ( 1 ) scsi “ reserve ” functionality which allows a scsi device to be exclusively used by what is known as an initiator to complete all or a portion of a task and ( 2 ) scsi “ release ” functionality which allows a present initiator to release the scsi device for use by other initiators when the present initiator no longer needs the scsi device . to provide this functionality , the virtual adapter 66 is capable of defining a “ session ” of two or more endpoint connections that allows the computer system 52 and the remote device 54 to relatively quickly resume the execution of sequence of commands when the computer system 52 has reserved the scsi device 64 even though the sequence has been interrupted by the noted endpoint terminations . a session is defined by the virtual adapter to have an identifier during an endpoint connection that is communicated to the scsi device 64 and allows , should the endpoint connection be purposefully terminated due to a time out , the computer system 52 and the scsi device 64 to resume execution of a command string when the virtual adapter 66 is next presented with a command without having to engage in a lengthy “ handshake ” process . more specifically , the identifier is used to store state and / or property information , such as the scsi i / t / l nexus , that can be subsequently recalled and used to quickly resume execution of the command string rather than have to be re - created . in one embodiment , the virtual adapter changes the session identifier each time a new endpoint connection is established to enhance security . in one embodiment , a pseudo - random number generator is used to alter the session identifier . while the purposeful termination of endpoint connections reduces the possibility of disruptions and lengthy and / or resource consuming recovery procedures and the use of a session identifiers that allow status information ( e . g ., scsi i / t / l ) to be preserved over multiple tcp / ip endpoint connections to support scsi reserve / release functionality , there is still the possibility that an endpoint connection will fail rather than be purposefully terminated by the virtual adapter 66 . to address this possibility , the virtual adapter 66 and the scsi device 64 have the ability to re - synchronize following an endpoint failure so that previously executed commands are not duplicated and commands that were unlikely to have been executed are queued up for execution . to elaborate , both the virtual adapter 66 and the scsi device 64 maintain lists of outstanding commands . following an endpoint failure , the virtual adapter 66 initiates a comparison of the two lists . if a command is in the adapter list but not in the scsi device list , it is likely that the scsi device 64 never received the command from the computer system 52 and so the command is added to the scsi device list for execution . conversely , if the command is not in the adapter list but is in the scsi device list , then it is likely that the scsi device 64 completed the command , informed the computer system 52 of the completion , but failed to receive an acknowledgment from the computer system 52 that would have allowed the scsi device 64 to delete the command from its list . the failure to receive the acknowledgment is likely due to the endpoint connection failure . in this case , the command is deleted from the scsi device list . finally , if a command is in both the adapter list and the scsi device list , the command remains on both lists . there is also a possibility that a computer system would need to obtain or discover information relating to a remote scsi tape storage device 64 while the device is engaged in one or more sessions with the computer system or other computer systems . to accommodate this possibility the virtual adapter 66 and controller 70 are capable of establishing an endpoint connection between the computer system 52 and the scsi device 64 that does not interfere with existing sessions . to avoid such interference , the adapter 66 and controller 70 operate to establish an endpoint connection that only permits that use of scsi commands that do not change the state of the scsi device 64 and , as such , do not interfere with any existing sessions in which the device is engaged . the foregoing description of the invention has been presented for purposes of illustration and description . further , the description is not intended to limit the invention to the form disclosed herein . consequently , variations and modifications commensurate with the above teachings , and the skill or knowledge in the relevant art are within the scope of the present invention . the embodiment described hereinabove is further intended to explain the best mode known of practicing the invention and to enable others skilled in the art to utilize the invention in various embodiments and with the various modifications required by their particular applications or uses of the invention . it is intended that the appended claims be construed to include alternate embodiments to the extent permitted by the prior art . | 7 |
the following discussion is presented to enable a person skilled in the art to make and use the invention . the general principles described herein may be applied to embodiments and applications other than those detailed above without departing from the spirit and scope of the present invention . the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed or suggested herein . fig5 is a schematic diagram of an electronic circuit having a front - end bypass test circuit for testing logic according to an embodiment of the invention . the electronic circuit includes typical elements associated with an atpg such as launch flip - flop 511 and capture flip - flop 521 . the electronic circuit to be tested resides between the launch flip - flop 511 and the capture flip - flop 521 and , in this embodiment , the electronic circuit to be tested includes input logic 510 and output logic 520 associated with a memory block , such as the ram block 500 . the electronic circuit also includes front - end bypass circuitry 508 . these elements and their relationships between each other are detailed in the following paragraphs . as was discussed previously in the background section , it is extremely difficult to predict the logical outcome of values passed through a memory block in an electronic circuit using a scan vector test in an atpg tester . as such , a reliable and predictable way of passing logical values either through or around the memory block is needed such that known values loaded at the launch flip - flop 511 will yield expected logical values at the capture flip - flop 521 . one such way utilizes an off - the - shelf type of memory block that includes a write - through capability and a built - in self - test mode ( bist mode ) inputs . a memory block that has write - through capability , such as ram block 500 , monitors a specific write - through input 535 to determine the operation of its inputs and outputs . in one embodiment , if the write - through input 535 is set to a low logic value , the outputs of the ram block 500 typically operate normally according to the functions of the memory blocks . on the other hand , if the write - through input 535 is set to a high logic value , the outputs of the ram block 500 typically reflect the logic value of respective corresponding inputs . that is , any logic value received on an input will be written directly through to a corresponding output . although discussed in more detail below with respect to the operation of the embodiment of fig5 , memory blocks having write - through capability are well - known in the industry and will not be discussed in further detail herein . the ram block 500 also includes a bist mode such that another input is able to set the ram block 500 to a bist mode ( e . g ., bist input 536 set to a high logical value ) or a functional mode ( e . g ., bist input 536 set to a low logical value ). when in bist mode , a memory block will typically receive inputs through dedicated test inputs ( e . g ., test mode input 551 ) and when in functional mode , a memory block will receive inputs through dedicated functional mode inputs ( e . g ., functional mode input 552 ). as a result , when in bist mode , logical values on the functional input 552 will be ignored , and , when in functional mode , logical values on the test mode input 551 will be ignored . again , this aspect of the ram block 500 is discussed in more detail below with respect to the operation of the embodiment of fig5 ; however , memory blocks having bist capability are also well - known in the industry and will not be discussed in further detail herein . as can be seen in fig5 , the electronic circuit monitors inputs that include write - through input 535 , bist input 536 , and scan mode input 506 . various combinations of logical values on these inputs control some aspects of the operation of the entire electronic circuit . the schematic layout and connections of these inputs are discussed below and then a discussion of the operation of the electronic circuit in the various combinations of input values is presented . the write - though mode input 535 controls the operation of the output multiplexor 565 ( only one is shown for clarity , but several may all be linked to the same write - through mode input 535 ). in one embodiment , when the write - through input 535 is set to a low logic value , the output multiplexor 565 recognizes the logical values received from the ram cells 504 according to normal operation of the ram block 500 and passes these logic values to the output 502 of the ram block 500 ( again , only one shown for clarity ), while at the same time ignoring any logic value on the write - through bypass line 555 . likewise , when the write - through input 535 is set to a high logic value , the output multiplexor 565 recognizes the logical values received on the write - through bypass line 555 and also passes these logic values to each respective ram block output 502 , while at the same time ignoring any logic value from the ram cells 504 . similarly , the bist input 536 controls the operation of the input multiplexor 560 ( only one is shown for clarity , but several may all be linked to the same bist mode input 536 ). this input multiplexor can reside inside or outside of the ram block . in one embodiment , when the bist input 536 is set to a high logic value , the input multiplexor 560 recognizes the logical values received on the test mode input 551 and passes these logic values accordingly , while at the same time ignoring any logic value on the functional mode input 552 . likewise , when the bist input 536 is set to a low logic value , the input multiplexor 560 recognizes the logical values received on the functional mode input 552 and also passes these logic values accordingly while at the same time ignoring any logic value on the test mode input 551 . both the write - through mode and bist mode are discussed in greater detail below with respect to the operation of this embodiment of the electronic circuit of fig5 . as was briefly mentioned above , the embodiment of fig5 includes front - end bypass circuitry 508 for handling scan tests when in an atpg environment . the front - end bypass circuitry 508 includes an observation flip - flop 550 and a front - end multiplexor 517 . the input of the observation flip - flop 550 is coupled to the functional input 552 of the ram block 500 . the electronic circuit of fig5 may include bypass circuitry 508 for each input to the ram block 500 , but only one is shown here for clarity . the output of the observation flip - flop 550 is coupled to one of two selectable inputs on the front - end multiplexor 517 . the other input of the front - end multiplexor 517 is coupled to a signal line from a bist circuit 516 ( not shown in detail ). the input which the front - end multiplexor 517 selects is determined by the logic value of the bist input 536 . in one embodiment , when the bist input 536 is set to a high logic value , the front - end multiplexor 517 recognizes the logical values received from the bist circuit 516 and passes these logic values accordingly while at the same time ignoring any logic value from the observation flip - flop 550 . likewise , when the bist input 536 is set to a low logic value , the front - end multiplexor 517 recognizes the logical values received from the observation flip - flop 550 and passes these logic values accordingly while at the same time ignoring any logic value from the bist circuit 516 . in a similar manner to the bist input 536 , the scan mode input 506 also controls the operation of the input multiplexor 560 ( only one is shown for clarity , but several may all be linked to the same scan mode input 506 ). in one embodiment , when the scan mode input 506 is set to a high logic value , the input multiplexor 560 recognizes the logical values received on the test mode input 551 and passes these logic values accordingly . likewise , when the scan mode input 506 is set to a low logic value , each input multiplexor 560 recognizes the logical values received on the functional mode input 552 and also passes these logic values accordingly . since the input multiplexor 560 is coupled to two different inputs ( scan mode input 506 and bist input 536 ), if either one is set to a high logic value , then the input multiplexor 560 selects the test mode input 551 for passing signals and rejects logic values on the functional mode input 552 . this may be accomplished by using or gate 507 such that the signal line controlling the input multiplexor 560 is a high logic value if either the scan mode input 506 or bist input 536 or both are at a high logic value . with these three inputs ( scan mode input 506 , bist input 536 , and write - through input 535 ) controlling some aspects of the operations of the electronic circuit , eight possible control states exist with respect to these three binary input values . while a technician has the option of setting up to eight control states using the three binary inputs values , the primary control states for the purposes of the present invention include a functional mode state , a scan mode state , and a bist mode state . although other input combinations exist ( and consequently , other possible control states , such as write - though mode ), only the afore - mentioned control states will be discussed herein as the other combinations may be duplicative and / or unused . in a first control state , the electronic circuit may be set for functional mode . in this control state , each of the inputs ( write - through input 535 , scan mode input 506 , and bist input 536 ) is set to a low logic value . as such , logic signals that are initiated at the launch flip - flop 511 propagate through the input logic 510 to the functional mode input 552 . at the input multiplexor 560 , the logic value at the functional mode input 552 is recognized while any logic value at the test mode input 551 is ignored because neither the scan mode input 506 nor the bist input 536 is set to a high logic value . thus , only the logic value on the functional mode input 552 is allowed to pass . furthermore , even though logic values are , in fact , passed through the observation flip - flop 550 and the front - end multiplexor 517 , any resultant logic value on the test mode input 551 is ignored because the input multiplexor 560 is set to only pass logic values on the functional mode input 552 . in essence , when in functional mode operation , the electronic circuit is unconcerned with any signals propagating through the front - end circuitry 508 . once logic values are passed to the ram block 500 at the input multiplexor 560 , the ram block 500 behaves normally . that is , input values are passed to ram cells 504 according to the parameters of operation of the ram block 500 itself . additionally , all logic values at the input multiplexor 560 are passed along the write - through bypass line 555 to the output multiplexor 565 . the output multiplexor 565 is set to only recognize logic values from the ram cells 504 , however , as the write - through mode input 535 is set to a low logic value when in functional mode operation . as a result , even though logic values are passed to the output multiplexor 565 on the write - through bypass line 555 , the output multiplexor 565 ignores these logic values because the write through input 535 is set to a low logic value . the recognized logic values from the ram cells 504 are passed to the output 502 of the ram block 500 , then to the output logic 520 , and eventually to the capture flip - flop 521 . the front - end bypass circuit 508 is not used in functional mode since its main purpose is control and observation of the ram block inputs 551 during scan mode . furthermore , the timing of signals propagating through the electronic circuit will be approximately two clock cycles . during a first clock cycle , a logic value propagates to the input of the ram block 500 through the input logic 510 . likewise , during a second clock cycle , the logic value propagates from the output of the ram block 500 through the output logic 520 . the additional time that it takes a signal to pass through the multiplexors 560 and 565 inside the ram block 500 have a negligible timing impact with respect to the two clock cycles during functional mode operation despite the fact that they are designed into the ram block 500 and are not removable . thus , it is desirable that any testing of the electronic circuit is also accomplished in the same time frame ( i . e ., two clock cycles ). when a technician needs to test the input logic 510 and output logic 520 using an atpg , the technician may set the scan mode control state wherein the scan mode input 506 is set to a high logic value . at the same time , the write - through input 535 is also set to a high logic value to take advantage of the write - through capability of the ram block 500 . the bist input 536 remains at a low logic value during an atpg test . in this control state ( scan mode ), logic signals that are initiated at the launch flip - flop 511 propagate normally through the input logic 510 to the functional mode input 552 . at the input multiplexor 560 , any logic value at the functional mode input 552 , however , is ignored , while , at the same time , any logic value at the test mode input is recognized because the scan mode input 506 is set to a high logic value which controls the input multiplexor 560 . thus , only the logic value on the test mode input 551 is allowed to pass . any resultant logic value on the test mode input 551 is recognized and passed because the input multiplexor 560 is set to only pass logic values on the test mode input 551 . in essence , when in scan mode operation , the electronic circuit is unconcerned with any signals propagating to the functional mode input 552 at the ram block 500 . furthermore , logic values on the functional mode input 552 are also the same as logic values at the input to the observation flip - flop 550 , and are passed through the observation flip - flop 550 and the front - end multiplexor 517 accordingly . the front - end bypass multiplexor 517 , in scan mode , is set to recognize and pass logic values from the output of the observation flip - flop 550 while ignoring any logic values from the bist circuit 516 . this is because the bist input 536 is still set to a low logic value . once logic values are passed to the ram block 500 at the input multiplexor 560 , the ram block 500 again behaves normally . that is , input values are passed to ram cells 504 according to the parameters of the ram block 500 itself . additionally , all logic values at the input multiplexor 560 are passed along the write - through bypass line 555 to the output multiplexor 565 . however , in scan mode , the output multiplexor 565 is set to only recognize logic values from the write - through bypass line 555 and to ignore any logic values from the ram cells 504 . this is because the write - through mode input 535 is set to a high logic value when in scan mode operation . as a result , even though logic values are passed to the output multiplexor 565 from the ram cells 504 , the output multiplexor 565 ignores these logic values because the write through input 535 is set to a high logic value . the recognized logic values from the write - through bypass line 555 are passed to the output 502 of the ram block 500 , then to the output logic 520 , and eventually to the capture flip - flop 521 . in scan mode , the launch flip - flop 511 and the capture flip - flop 521 will , in fact , be part of the overall logical circuitry in the electronic circuit as these flip - flops are a typical feature of an atpg environment that facilitates the testing procedure . furthermore , much like the timing of signals in functional mode , the timing of signals propagating through the electronic circuit in scan mode will also be approximately two clock cycles . during a first clock cycle , a logic value propagates to the input of the observation flip - flop 550 through the input logic 510 . likewise , during a second clock cycle , the logic value propagates from the output observation flip - flop 550 through the ram block 500 and the output logic 520 . again , the additional time that it takes a signal to pass through the multiplexors 560 and 565 inside the ram block 500 as well as the bypass multiplexor 517 is negligible with respect to the two clock cycles during scan mode operation . therefore , any testing of the logic is accomplished in the same time frame ( i . e ., two clock cycles ) as the timing of the functional mode . that is , the scan test may be run at - speed . furthermore , the bypass circuitry 508 is not within the critical path of the electronic circuit . thus , the critical path of the electronic circuit will remain as fast as possible while at the same time still having test circuitry ( bypass circuitry 508 ) for testing the circuit at - speed . a third control state that is available in this embodiment of the invention is a bist mode . in this control state , logic signals that are initiated at the launch flip - flop 511 ( or any other circuit that may be coupled to the input logic 510 ) propagate normally through the input logic 510 to the functional mode input 552 . as was the case with scan mode , at the input multiplexor 560 , the logic value at the functional mode input 552 is ignored . any logic value at the test mode input 551 is recognized because the bist input 536 is set to a high logic value . thus , only logic values on the test mode input 551 are allowed to pass and any resultant logic values on the test mode input 551 are recognized and passed because the input multiplexor 560 is set to only pass logic values on the test mode input 551 . in essence , when in bist mode operation , the electronic circuit is unconcerned with any signals propagating to the functional mode input 552 at the ram block 500 . the front - end bypass multiplexor 517 , in the bist mode , is set to recognize and pass logic values from the bist circuit 516 while ignoring any logic values from the output of the observation flip - flop 550 . this is because the bist mode input 536 is set to a high logic value causing the bypass multiplexor 517 to only recognize and pass signals from the bist circuit 516 . once logic values are passed to the ram block 500 at the input multiplexor 560 , the ram block 500 behaves according to the parameters of the bist testing procedures . the bist parameters are not described in further detail as they are not within the scope of the present invention . thus , signals may be passed to the output 502 of the ram block 500 , then to the output logic 520 and eventually to the capture flip - flop 521 according to known bist test procedures . fig6 is a block diagram of a typical atpg 600 that may be used in conjunction with the electronic circuit of fig5 according to an embodiment of the invention . the atpg 600 includes two test paths that may be used to compare a first electronic circuit against a standard test circuit or a second electronic circuit . as shown , the first path 610 includes a first launch flip - flop 611 , a first input logic 612 a test flip - flop 613 , a first output logic 614 and a first capture flip - flop 615 . likewise , the second path 620 also includes a second launch flip - flop 621 , a second input logic 622 , a second output logic 624 , and a second capture flip - flop 625 . additionally , instead of a test flip - flop , the second path 620 includes a device between the input logic 622 and output logic 624 , such as ram block 623 . the second input logic 622 , the ram block 623 and the output logic 624 may be similar to the electronic circuit of fig5 and may also include the bypass circuitry 508 of fig5 . as such , a technician may perform a scan vector test using the atpg 600 of fig6 on both the first path 610 and the second path 620 . the results may be analyzed and compared according to known test procedures . furthermore , each test may be performed at - speed such that testing is accomplished at the same speed in which the electronic circuit in either path would operate normally . | 6 |
fig1 is a block diagram of a virtual machine based computer system 100 in which one or more embodiments may be practiced . computer system 100 includes a hardware platform 130 , including , for example , central processing units ( cpus ) 131 , system memory 132 , host bus adapters ( hbas ) 133 that connect computer system 100 to remote data storage systems , and network interface controllers ( nics ) 134 that connect computer system 100 to a computer network , e . g ., the internet . a virtualization software , commonly known as a hypervisor 114 , is implemented on top of hardware platform 130 , to support a virtual machine execution space 101 within which n virtual machines ( vms ) 103 can be instantiated and executed . in one embodiment , hypervisor 114 corresponds to the vsphere product ( and related utilities ) developed and distributed by vmware , inc ., palo alto , calif . although it should be recognized that vsphere is not required in the practice of the teachings herein . hypervisor 114 provides the services and support that enable concurrent execution of vms 103 . each vm 103 supports the execution of a guest operating system 108 , which , in turn , supports the execution of applications 106 . examples of guest operating system 108 include microsoft ® windows ®, the linux ® operating system , and netware ®- based operating systems , although it should be recognized that any other operating system may be used in embodiments . guest operating system 108 includes a native or guest file system , such as , for example , an ntfs or ext3fs type file system . the guest file system may utilize a host bus adapter driver ( not shown ) in guest operating system 108 to interact with a host bus adapter emulator 113 in a virtual machine monitor component ( vmm ) 104 of hypervisor 114 . conceptually , this interaction provides guest operating system 108 ( and the guest file system ) with the perception that it is interacting with actual hardware . fig1 also depicts a virtual hardware platform 110 as a conceptual layer in vm 203 ( 0 ) that includes virtual devices , such as virtual hba 112 and virtual disk 111 , which itself may be accessed by guest operating system 108 through virtual hba 112 . in one embodiment , the perception of a virtual machine that includes such virtual devices is effectuated through the interaction of device driver components in guest operating system 108 with device emulation components ( such as host bus adapter emulator 113 ) in vmm 104 ( 0 ) ( and other components in hypervisor 114 ). file system calls initiated by guest operating system 108 to perform file system - related data transfer and control operations are processed and passed to vmm 104 ( 0 ) and other components of hypervisor 114 that implement the virtual system support necessary to coordinate operation with hardware platform 130 . for example , hba emulator 113 functionally enables data transfer and control operations to be ultimately passed to hbas 133 . file system calls for performing data transfer and control operations generated , for example , by one of applications 106 are translated and passed to a virtual machine file system ( vmfs ) driver 116 that manages access to files ( e . g ., virtual disks , etc .) stored in data storage systems ( such as storage system 150 ) that may be accessed by any of vms 103 . for example , guest operating system 108 receives file system calls and performs corresponding command and data transfer operations against virtual disks , such as virtual scsi devices accessible through hba emulator 113 , that are visible to guest operating system 108 . each such virtual disk may be maintained as a file or set of files stored on vmfs , for example , in a data store exposed by storage system 150 . the file or set of files may be generally referred to herein as a virtual disk and , in one embodiment , complies with virtual machine disk format specifications promulgated by vmware ( e . g ., sometimes referred to as a vmdk files ). file system calls received by guest operating system 108 are translated to instructions applicable to particular file in a virtual disk visible to guest operating system 108 ( e . g ., data block - level instructions for 4 kb data blocks of the virtual disk , etc .) to instructions applicable to a corresponding vmdk file in vmfs ( e . g ., virtual machine file system data block - level instructions for 1 mb data blocks of the virtual disk ) and ultimately to instructions applicable to a data store exposed by storage system 150 that stores the vmfs ( e . g ., scsi data sector - level commands ). such translations are performed through a number of component layers of an “ io stack ,” beginning at guest operating system 108 ( which receives the file system calls from applications 106 ), through host bus emulator 113 , vmfs driver 116 , a logical volume manager 118 which assists vmfs driver 116 with mapping files stored in vmfs with the data stores exposed by storage system 150 , a data access layer 120 , including device drivers , and hbas 133 ( which , e . g ., issues scsi commands to storage system 150 ). according to one or more embodiments , an io manager 117 running inside vmfs driver 116 implements the functionalities described herein . io manager 117 is responsible for setting up request queues for each resource of storage system 150 that are being targeted by ios issued by vms 103 in a “ blocking context .” a “ blocking context ” as used herein refers to ios performed on a storage resource , such as a data block or data blocks , that would block other ios from being issued thereto . one example of a “ blocking context ” is a write . fig2 is a conceptual diagram that illustrates an io management method that employs request queues . for simplicity , only five concurrently executing threads are shown in fig2 . in practice , the number of concurrently executing threads may equal the number of virtual cpus . in the example of fig2 , the threads request ios r1 , r3 , r2 , rm , and rn in the following time order : t0 , t1 , t2 , t3 , and t4 , respectively . each request has an associated priority assigned thereto by the thread according to the relative importance of the io . five levels of priority , p1 through p5 , are assigned in the example shown , with p1 being the lowest priority , then p2 , p3 , and p4 , and p5 being the highest priority . for example , a metadata io may be given a high priority , such as p5 . on the other hand , a data io may be given a tow priority , such as p1 . when multiple ios are placed in the same request queue , io manager 117 examines the priorities assigned to the ios and issues the ios according to the priorities , with the higher priority ios being processed before lower priority ios . in one embodiment , when an io is issued from a request queue , an event identifier associated with the io is stored . in fig2 , the storage area for request queue 201 is indicated as event id 211 and the storage area for request queue 202 is indicated as event id 212 . upon completion of the io , the event identifier of the io is updated . as a result , an io request that is queued in request queue 201 can detect a completion of an in - flight io that caused it to be queued , and an io request that is queued in request queue 202 can detect a completion of an in - flight io that caused it to be queued . in the example shown in fig2 , it is assumed that resource x is targeted in ios requested by threads 1 , 2 , 3 and resource y is targeted in ios requested by threads m , n . also , resource x is assumed to be unblocked at time t0 and resource y is assumed to be blocked from time t3 through time t4 . thus , when thread 1 requests io r1 at time t0 , the io is issued right away because resource x is available . in addition , event bd 211 is updated with an event identifier for io r1 . when the io completes , event id 211 is updated with a different value . for purposes of illustrating this embodiment , however , it is assumed that io r1 does not complete by the time io r3 is requested at time t1 and io r2 is requested at time t2 . continuing with the example , when thread 3 requests io r3 at time t1 , the request is added to request queue 201 because resource x is not available . also , when thread 2 requests io r2 at time t2 , the request is added to request queue 201 because resource x is not available . when the io associated with io r1 eventually completes , thread 1 updates the event identifier stored in event id 211 . when threads 2 and 3 detect this update , thread 2 issues io associated with its request ( io r2 ) out of request queue 201 ( assuming no other ios of higher priority have been added to request queue 201 ) and thread 3 is forced to wait again because io r2 has a higher priority than io r3 ( p4 & gt ; p3 ). when thread 2 issues io r2 , it inserts a new event identifier in event id 211 . upon completion of this io , thread 2 updates the event identifier stored in event id 211 . when thread 3 detects this update , thread 3 issues io r3 out of request queue 201 ( assuming no other ios of higher priority have been added to request queue 201 ). when thread 3 issues io r3 , it inserts a new event identifier in event id 211 . upon completion of this io , thread 3 updates the event identifier stored in event id 211 . when thread m requests io rm at time t3 and thread n requests io rn at time t4 , both requests are added to request queue 202 because resource y is not available . when resource y becomes available , thread m issues io rm out of request queue 202 before thread n issues io rn out of request queue 202 . although io rm and io rn have the same priorities , io rm is issued first because it was added to request queue 202 prior to io rn . when thread m issues io rm , it inserts a new event identifier in event id 212 . upon completion of this io , thread m updates the event identifier stored in event id 212 which causes thread n to issue io rn out of request queue 202 ( assuming no other io requests of higher priority have been added to request queue 202 ). fig3 is a flow diagram of method steps for issuing ios according to an embodiment . in the embodiment described herein , the method steps of fig3 are carried out by io manager 117 , in particular the individual threads that are managing ios requested by vms 103 . in this embodiment , the threads place blocking ios requested by vms in appropriate queues if they cannot be executed because another io is concurrently targeting the same storage resource . according to a predetermined schedule , the threads check the availability of the storage resource and issue the ios as the storage resource becomes available . the predetermined schedule may define equally spaced time intervals between the checks or time intervals that are exponentially increasing between the checks . the method shown in fig3 begins at step 302 , with a thread determining whether or not the requested io has a blocking context . if it does not , the io is issued in the normal manner ( step 330 ). if the requested io has a blocking context , the requested io is added to a request queue for a storage resource targeted by the io ( step 304 ). then , at step 306 , the thread determines whether or not the storage resource is available . if the storage resource is not available , a loop counter is updated at step 308 and a timer is set based on the loop counter at step 310 . in one embodiment , the timer is set as a product of the loop counter and a predetermined time interval . for example , the first time through the loop , the timer may be set at x msec and n - th time through the loop as n * x msec . in another embodiment , the timer is set as a product of a multiplier and a predetermined time interval , where the multiplier may be some number raised to the power of the loop counter minus 1 . for example , the first time through the loop , the timer may be set at 2 ^ 0 * x msec and n - th time through the loop as 2 ^( n − 1 )* x msec . at step 312 , the thread waits for the timer to expire and returns to step 306 when the timer expires . returning to step 306 , if the thread determines that the storage resource is available , the thread issues the io at step 316 . then , at step 318 , the io issued at step 316 is removed from the request queue . fig4 is a flow diagram of method steps for issuing ios according to another embodiment . in the embodiment described herein , the method steps of fig4 are carried out by io manager 117 , in particular the individual threads that are managing ios requested by vms 103 . in this embodiment , the threads place blocking ios requested by vms in queues if they cannot be executed because another io is concurrently targeting the same storage resource . when this other io that is concurrently targeting the same storage resource completes , the thread that issued this other io updates an event identifier associated with the queue of the storage resource . upon detecting that this event identifier has been updated , the io request in the queue having the highest priority is executed next . the process repeats in this manner until all io request in the queue are executed . the method shown in fig4 begins at step 402 , with a thread determining whether or not the requested io has a blocking context . if it does not , the io is issued in the normal manner ( step 430 ). if the requested io has a blocking context , the requested io is added to a request queue for a storage resource targeted by the io ( step 404 ). then , at step 406 , the thread determines whether or not the storage resource is available . if the storage resource is not available , at step 408 , the thread tracks an event identifier that has been assigned to the request queue . at steps 410 and 412 , the thread polls the event identifier for updates . if the event identifier has been updated ( indicating that the pending io has completed ), the decision block at step 414 is executed . in this decision block at step 414 , the thread determines whether its io should be issued . in one embodiment , if the thread &# 39 ; s io has been placed in the request queue at the earliest time among the ios having the highest io priority , the thread issues the io and inserts a new event identifier for this request queue ( step 416 ). at step 418 , the io that was issued at step 416 is removed from the request queue . returning to step 414 , if another thread &# 39 ; s io has a higher priority or has the same priority and was placed in the request queue earlier , this other thread &# 39 ; s io is issued , and the method returns to step 408 where the thread tracks for updates the event identifier for this request queue as inserted by this other thread . the inventive features described herein may be applied in non - virtualized embodiments having applications running on top of an operating system and a filter driver implemented on top of a native file system driver of the operating system . the filter driver in such embodiments may be implemented in software or hardware and is configured to expose and manage thinly - provisioned files in a similar manner as the virtual disk in the virtualized embodiments . the various embodiments described herein may employ various computer - implemented operations involving data stored in computer systems . for example , these operations may require physical manipulation of physical quantities — usually , though not necessarily , these quantities may take the form of electrical or magnetic signals , where they or representations of them are capable of being stored , transferred , combined , compared , or otherwise manipulated . further , such manipulations are often referred to in terms , such as producing , identifying , determining , or comparing . any operations described herein that form part of one or more embodiments of the invention may be useful machine operations . in addition , one or more embodiments of the invention also relate to a device or an apparatus for performing these operations . the apparatus may be specially constructed for specific required purposes , or it may be a general purpose computer selectively activated or configured by a computer program stored in the computer . in particular , various general purpose machines may be used with computer programs written in accordance with the teachings herein , or it may be more convenient to construct a more specialized apparatus to perform the required operations . the various embodiments described herein may be practiced with other computer system configurations including hand - held devices , microprocessor systems , microprocessor - based or programmable consumer electronics , minicomputers , mainframe computers , and the like . one or more embodiments of the present invention may be implemented as one or more computer programs or as one or more computer program modules embodied in one or more computer readable media . the term computer readable medium refers to any data storage device that can store data which can thereafter be input to a computer system — computer readable media may be based on any existing or subsequently developed technology for embodying computer programs in a manner that enables them to be read by a computer . examples of a computer readable medium include a hard drive , network attached storage ( nas ), read - only memory , random - access memory ( e . g ., a flash memory device ), a cd ( compact discs )— cd - rom , a cd - r , or a cd - rw , a dvd ( digital versatile disc ), a magnetic tape , and other optical and non - optical data storage devices . the computer readable medium can also be distributed over a network coupled computer system so that the computer readable code is stored and executed in a distributed fashion . although one or more embodiments of the present invention have been described in some detail for clarity of understanding , it will be apparent that certain changes and modifications may be made within the scope of the claims . accordingly , the described embodiments are to be considered as illustrative and not restrictive , and the scope of the claims is not to be limited to details given herein , but may be modified within the scope and equivalents of the claims . in the claims , elements and / or steps do not imply any particular order of operation , unless explicitly stated in the claims . virtualization systems in accordance with the various embodiments , may be implemented as hosted embodiments , non - hosted embodiments or as embodiments that tend to blur distinctions between the two , are all envisioned . furthermore , various virtualization operations may be wholly or partially implemented in hardware . for example , a hardware implementation may employ a look - up table for modification of storage access requests to secure non - disk data . many variations , modifications , additions , and improvements are possible , regardless the degree of virtualization . the virtualization software can therefore include components of a host , console , or guest operating system that performs virtualization functions . plural instances may be provided for components , operations or structures described herein as a single instance . finally , boundaries between various components , operations and data stores are somewhat arbitrary , and particular operations are illustrated in the context of specific illustrative configurations . other allocations of functionality are envisioned and may fall within the scope of the invention ( s ). in general , structures and functionality presented as separate components in exemplary configurations may be implemented as a combined structure or component . similarly , structures and functionality presented as a single component may be implemented as separate components . these and other variations , modifications , additions , and improvements may fall within the scope of the appended claims ( s ). | 6 |
fig1 shows a wood processor according to the invention , especially a first illustrative example of the arm system and the unit in a lateral view . the arm system contains an outer beam 10 intended to be attached to a vehicle , for example a wood tractor ( not shown ). the arm system is particularly designed to be utilized as a so - called rotator unit at the power take - off of a usual wood tractor , but can also be used for bigger wood processing machines . movably arranged within this outer beam 10 , as an inner beam 12 which supports , at one of its ends , a delimbing head 13 connected to a felling head 14 in the position shown in fig1 . the felling head is attached to the outer beam 10 . an attachment 15 for a double - armed hinge 16a , 16b is arranged at the outer end of the inner beam 12 , one arm hinge 16a being pivotably connected at one of its ends to the attachment 15 and pivotably connected at its other end to the other arm hinge 16b . the other arm hinge 166 is pivotally attached to an attachment 17 at its other end . the attachment 17 is attached to a slide bar 18 sliding on the outer beam 10 . the double - armed hinge 16a , 16b is operated by a hydraulic cylinder 19 which is also attached to the slide bar 18 . an attachment 20 for a second double - armed hinge 21a , 21b is also attached to the slide bar 18 , one arm hinge 21a being pivotably attached at one of its ends to the attachment 20 and pivotably connected with the other arm hinge 21b at its other end . the arm hinge 21b is pivotably connected at its other end to an attachment 22 attached to the outer beam 10 . this second arm hinge 21a , 21b is operated by a second hydraulic cylinder 23 . although not apparent from the figure , a corresponding second arm hinge and second hydraulic cylinder are attached at the other side of the outer beam 10 and the other side of the slide bar 18 . part of the arm system in fig1 is shown in fig2 viz , the outer portion of the arm system , with the difference from fig1 that the unit consisting of delimbing head 13 and felling head 14 is opened to a substantially vertical position to enable felling of standing wood . as is apparent from this figure , a hydraulic cylinder 24 is attached to the outer beam 10 and to the felling head 14 at its other end to enable turning of the felling head 14 together with the delimbing head 13 about a tilt shaft 25 at the outer end of the inner beam 12 . fig3 is a lateral view of the arm system in a position , in which the inner beam 12 has been moved out of the outer beam 10 and , thus , the delimbing head 13 has been separated from the felling head 14 and is spaced from the felling head 14 . the inner beam 12 has been pushed out , in that the hydraulic cylinder 19 has been activated and pushed out its piston rod , which has caused turning of the arm hinge 16b about its turning point in the attachment 17 and consequently a displacemant of the arm hinge 16a which has enforced extraction of the inner beam out of the outer beam . in fig4 a position is shown , in which the other hydraulic cylinder 23 also has been activated and pushed out its piston rod and compelled , in this way , the arm hinge 21b to pivot about its turning point in the attachment 22 , forcing , in this way , the arm hinge 21a to be moved forwards . however , this arm hinge 21a is attached to an attachment 20 on the slide bar 18 , and , in this way , the slide bar 18 has been forced to be moved forwards along the outer beam 10 and move the inner beam 12 further outwards . an intermediate beam 11 arranged between the inner beam 12 and the outer beam 10 also is pushed out of the outer beam 10 . this intermediate beam 11 has been drawn out of the outer beam 10 , in that it has been carried along by the inner beam 12 when this has reached its furthest pushed - out position relative to the intermediate beam 11 . the intermediate beam 11 can then be arranged to be brought along into the outer beam 10 upon retraction of the inner beam 12 , when the inner beam 12 has reached its most pushed - in position relative to the intermediate beam 11 . fig5 shows the outer end of the inner beam 12 with the attachment 15 of one arm hinge ( 16a ) and with an attachment 26 at its underside to receive the delimbing head and turning thereof about the tilt shaft 25 . as is apparent from fig5 a locking plate 27 is also attached to the underside of the outer beam 12 . the locking plate 27 has a hole 28 for securing the delimbing head to the beam 12 when the beam 12 is pushed out of the outer beam 10 . this is described in greater detail below . fig6 shows a section of the inner beam 12 according to the arrows vi -- vi on fig5 . fig7 is a view corresponding to fig5 but of the end of the outer beam 10 . this end of the outer beam supports a mounting clamp 29 for the felling head ( not shown in this figure ). as is apparent from fig7 the mounting clamp 29 projects in the longitudinal direction of the beam 10 , past the end of the beam , and has a hole 30 for attachment of a pivot pin for the suspension of the felling head . the projection of the mounting clamp 29 past the end of the beam 10 is so adapted that the center of the hole 30 coincides with the center of the attachment 26 of the delimbing head , so that the tilt shaft 25 of the felling head and that of the delimbing head coincide . for illustrative purposes , this mounting clamp 29 has been omitted in fig1 - 4 , because it would otherwise hide other essential parts . in fig8 a section according to the arrows viii -- viii in fig7 is shown , from which it is apparent that the mounting clamp also projects from the side of the outer beam 10 to leave a sufficient space between its two arm ends in order that the delimbing head and the felling head might pass therebetween . fig9 is an end view of the slide bar 18 , from which it is apparent that the slide bar comprises a supporting surface which is inwardly flanged at its ends to engage flanges 31 projecting on both sides of the outer beam 10 , as is apparent from fig1 and 11 . the slide bar supports attachments 17 and 20 for the arm hinges 16b and 21a , respectively . thus , the slide bar is movable in the longitudinal direction of the outer beam , 10 and is guided along the beam in that its ends are folded around the flanges 31 projecting sidewise from the beam . fig1 and 13 are lateral and end views , respectively , of the delimbing head 13 carrying gripping claws 32 which are arranged at the same time to delimit a tree - trunk upon displacement of the delimbing head . the delimbing head 13 has a circular recess 33 located substantially centrally , and , in parallel with this recess 33 , a smaller hole 34 extends receiving a locking pin 35 . at one of its ends , this locking pin projects over the edge of the delimbing head 13 to project into the locking plate 27 when the delimbing head is in the position shown in fig3 and 4 . in the hole 34 , the locking pin 35 is spring biased to enter this position when not actuated by other forces , the locking pin projecting out of the delimbing head . at its other end , the locking pin is bent with substantially two right angles and projects with an end surface 36 into the recess 33 . this end surface 36 and its bending are made to be able to displace the locking pin 35 out of engagement with the locking plate 27 and into the delimbing head upon insertion of an actuating means into the recess . fig1 and 16 are a lateral view and an end view , respectively , of the felling head 14 . the felling head 14 , also , supports gripping claws 37 and a cutter which , however , is not shown in the drawings . the felling head 14 has attaching arms 38 which have through holes 39 at their ends , in which pins can be attached to connect the attaching arms 38 and , consequently , the felling head 14 with the mounting clamp 29 , in that the pin passes through the holes 30 in the mounting clamp . the felling head has a substantially circular projection 40 projecting in parallel with the attaching arms and somewhat beneath these . the projection 40 is arranged to project into the recess 33 in the delimbing head 13 when the beams have been moved to the position shown in fig1 and 2 . when the projection is introduced into the recess 33 in the delimbing head , the projection 40 will press the end surface 36 further into the recess and move , in this way the locking pin 35 out of engagement with the locking plate 27 . by this movement , the delimbing head 13 is then connected to the felling head 14 and can be turned around the tilt shaft 25 when the felling head is actuated by the hydraulic cylinder 24 . although not shown in fig1 and 16 , the felling head 14 is also provided with an attachment for attaching the piston rod of the hydraulic cylinder 24 , as is apparent from fig1 and 2 . the elements described herein as attachments are shown including respective ear - like flanges mounted on the respective parts , and having openings for respective pins for pivotally securing the respective other elements to the elements on which the ear - like flanges are mounted . the elements described herein as arm hinges are , perhaps , more accurately thought of as being hinge arms . by the arrangements according to the invention , a relatively simple and easily - operable unit consisting of a delimbing head and a felling head has been achieved , which can be easily opened to the position shown in fig2 for felling standing wood . felling is then carried out by means of the cutter mentioned above , but not shown in the drawing , which can be of a type usual with wood processors and , for example , a hydraulically - operated chain saw . when a tree is to be felled , the wood processor is driven up to the tree with the arm system in the position shown in fig1 with the end provided with the delimbing head 13 and felling head 14 close to the tree to be felled . the hydraulic cylinder 24 is thereafter activated to lower the felling head 14 and the delimbing head 13 to the position shown in fig2 after which the gripping claws of these two units grab the tree - trunk in a conventional manner and the cutter saws off the tree . after this , the tree is felled , in that the hydraulic cylinder 24 retracts its piston rod and folds - up the felling head 14 back to the position shown in fig1 . when the felling head thereafter has returned to the position shown in fig1 the gripping claws 32 of the delimbing head will loosen their grip somewhat and the tree - trunk is held fast merely by the gripping claws 37 on the felling head 14 . the hydraulic cylinder 19 is thereafter activated and actuates the double - armed hinge 16a , 16b , pushing out the inner beam 12 and , consequently , the delimbing head 13 away from the felling head . the delimbing head 13 , moving along the tree - trunk , and the gripping claws 32 , running loosely against the tree - trunk , will then delimb the tree - trunk , and in dependence on the desired length of the trunk , the other hydraulic cylinder 23 can also be activated when the inner beam 12 has been pushed out , in order to also push out the intermediate beam 11 to the position shown in fig4 by the displacement of the slide bar 18 . when the intended length of the tree - trunk has been reached , corresponding to the distance between the delimbing head 13 and the felling head 14 , the gripping claws 32 of the delimbing head 13 will again grab firmly around the tree - trunk , while the gripping claws 37 of the felling head 14 will loosen their grip somewhat , after which the hydraulic cylinders 19 and 23 , respectively , are again activated to draw - in the beams 11 and 12 to the position shown in fig1 . when this has been attained , the saw in the felling head 14 is activated to cut - off the tree - trunk and a new delimbing process can next be carried out . fig1 shows a illustrative example of an arm system for a wood processor according to the invention . in this design , the arm system is composed of merely two arms , an outer beam 50 which at one of its ends is intended to be attached to a wood tractor and receives displaceably in itself an inner beam 51 which receives a delimbing head 13 at its outer end . the outer beam 50 carries a felling head 14 . the delimbing head 13 and the felling head 14 are of the same design as described in connection with the first illustrative example , however with the single essential difference that the felling head 14 in connection with the second illustrative example is attached to a traveling carriage 52 which is movable along the outer beam 50 . the traveling carriage 52 can preferably run by means of rollers 53 on the upper side of the outer beam . as in the first illustrative example , the felling head 14 can be opened to a substantially vertical position by means of a hydraulic cylinder 24 attached to the traveling carriage 52 . in order that the inner beam 51 might be pushed out of the outer beam 50 for extension of the arm system , an hydraulic cylinder 54 is arranged within the outer beam 50 and attached to each beam 50 , 51 by one attaching point . at both ends of the outer beam 50 , chain wheels 55 , 56 are arranged for control of chains 57 , 58 , which are attached at their one ends to the inner beam 51 and at their other ends to the traveling carriage 52 in such a way that the carriage moves on the outer beam 50 in a opposite direction relative to the inner beam 51 . by this embodiment of the arm system , a very simple and easy construction is obtained which can be carried even by small tractors . | 0 |
a first embodiment of a pumping chamber for a micropump according to the invention will be described with reference to fig1 a , 1b , and 2 . this pumping chamber is determined by the wafers 2 , 4 sealed to each other , for example by anodic welding or by adhesion . these wafers are generally of the order of a few tenths of a millimeter thick . the cavity 6 defining the pumping chamber as well as an inlet channel 8 and an outlet channel 10 are obtained by etching the wafer 2 using conventional photolithographic techniques , such as wet etching . the diameter of the cavity is of the order of 1 cm and it is between 5 and 200 micrometers high . the wafer 2 is of a material which can be easily etched , such as monocrystalline silicon ; the wafer 4 is for example of glass . a control element such as , for example , a piezoelectric disc 12 is bonded to the outside face of the wafer 4 at the level of the cavity 6 . each face of this piezoelectric disc is covered by an electrode connected to a source of potential ( not shown ). fig1 a and 2 respectively illustrate the position of the wafer 4 in which no electrical potential is applied to the piezoelectric disc 12 ( first position ) or in which an electrical potential is applied to this piezoelectric disc ( second position ). according to the invention the pumping chamber is provided with a stop 14 which , in limiting the amplitude of the movement of the flexible wall 13 of the wafer 4 , precisely defines the second position of this flexible wall . as a result , the volume of the pumping chamber at the end of the delivery operation , i . e . when the flexible wall 13 is in the second position , has a value that is precisely definable and reproducible . when the flexible wall is in the first position the distance between the stop and the opposing wall of the chamber is of the order of 10 μm or less . this distance clearly depends on the dimensions of the pumping chamber and on the fluid output desired in the embodiment shown in fig1 a , 1b and 2 , the piezoelectric disc 12 is fixed to the glass wafer 4 . it is of course possible to fix the piezoelectric disc 12 onto the silicon wafer 2 . a pumping chamber of this type is shown in section along the line iii -- iii and in plan view in fig3 a and 3b respectively . in these figures the elements identical to those shown in fig1 a , 1b and 2 have the same reference numerals . when the silicon wafer 2 supports the piezoelectric disc 12 , a layer 16 of sio 2 is interposed between the disc 2 and the piezoelectric disc 12 for purposes of electrical insulation . finally , it should be noted that , in this embodiment , the diameter of the stop 14 must be substantially lower than that of the piezoelectric disc so as not to excessively restrict the flexibility of the wafer 2 . in the two first described embodiments , the stop 14 is composed of a stop which extends from one wall of the pumping chamber . this projection is provided in the silicon wafer 2 during the etching of the cavity and of the inlet and outlet channels the upper surface 18 of the projection , against which the opposing wall of the pumping chamber impinges when the piezoelectric disc is subjected to an electrical potential is preferably planar . this makes it possible to define the second position of the flexible wall more precisely . it is also possible to use the bottom of the cavity itself as the stop . this is the case when a cavity is provided , the height of which is equal to the desired amplitude of movement of the flexible wall . fig4 and 5 show transverse sections through a pumping chamber of this kind in the first and second positions respectively of the flexible wafer 4 . in these figures , the pumping chamber is defined by a cavity 6 linked to an inlet channel 8 and an outlet channel ( not shown ). this pumping chamber is composed of a silicon wafer 2 and a glass wafer 4 as in the previous figures . the piezoelectric disc is disposed on the glass wafer 4 ; this wafer 12 may of course also be disposed on the silicon disc 2 , as in fig3 a and 3b . the advantage of using the bottom 20 of the cavity 6 as a stop for the flexible wall is that it reduces the number of operations needed to etch the silicon wafer 2 in comparison to the previous embodiments in which the stop is composed of a projection . moreover , as shown in fig5 the volume of the chamber at the end of the delivery phase is very small . this ensures effective pumping , even if the liquid contains many gas bubbles ( provided the parasite volume between the valves and the chamber itself is also very small ). on the other hand , if the volume of the pumping chamber remains relatively large at the end of the delivery phase , and this is generally the case when the stop is a projection , the gas bubbles can be compressed without being expelled from the pumping chamber . in contradistinction it should be noted that the resistance to fluid flow is greater with a pumping chamber as shown in fig4 which is thus particularly suitable for very low output micropumps . one embodiment of a micropump of the invention is shown in section along the line vi -- vi and in plan view in fig6 a and 6b respectively . this micropump mainly comprises a silicon wafer 22 disposed between glass wafers 24 and 26 . the wafer 22 is etched on one face to form a cavity 28 defining the pumping chamber and on the other face to regulate the thickness of the part of the wafer 22 which constitutes the flexible wall 30 of the pumping chamber . this thickness is for example 150 μm . the two faces of the wafer 22 are in addition engraved to form a membrane 32 and an annular rib 34 of an inlet valve , a membrane 36 and an annular rib 38 of an outlet valve , and an inlet channel 40a , 40b and an outlet channel 42a , 42b . to prevent the valves adhering to the glass wafers , the former are covered with a fine layer 35 , 39 of sio 2 . the piezoelectric disc 44 which controls the movement of the flexible wall 30 is bonded using cyano acrylate glue after the flexible wall has been covered with a fine layer 46 of sio 2 to provide electrical insulation . the piezoelectric disc 44 can be of the pxe - 5 type , manufactured by philips , 10 mm in diameter and 0 . 20 mm thick . since the flexible wall 30 and the membranes 32 , 36 are formed in the silicon wafer 22 , the latter is preferably a wafer of monocrystalline silicon of & lt ; 100 & gt ; orientation with good mechanical properties and which is very suitable for etching . this disc can be 5 cm in diameter and be of the order of 300 micrometers thick . the wafers 24 and 26 are of polished glass . they are 5 cm in diameter and 1 mm thick . the wafer 24 is pierced by an inlet hole 48 and an outlet hole 50 . the wafers 24 and 26 are sealed to the wafer 22 using the technique known as anodic welding . in the embodiment shown in fig6 a and 6b , the height of the pumping chamber , that is the distance between the flexible wall 30 and the wafer 26 when no electrical potential is applied to the piezoelectric disc 44 , is selected ( during etching of the wafer 22 ) so that the stop is formed by the surface of the wafer 26 . the pumping chamber is thus similar to that described with reference to fig4 and 5 , the only difference being that the piezoelectric disc is fixed onto the silicon wafer instead of onto the glass wafer . fig7 a and 7b respectively show a section along the line vii -- vii and a plan view of a micropump according to another embodiment of the invention . this micropump is more compact than the micropump shown in fig6 a and 6b . this is achieved by placing the inlet valve of the micropump directly onto one of the walls of the pumping chamber . it would be possible also to place a part of the outlet valve thereon . this micropump is composed of a silicon wafer 52 disposed between two glass wafers 54 and 56 . one face of the wafer 52 is etched to form a cavity 58 , defining the pumping chamber and during this etching operation a projection 60 is formed to constitute a stop according to the invention . the two faces of the silicon wafer 52 are also etched to form a membrane 62 and an annular rib 64 of an inlet valve , and an inlet channel 70 and an outlet channel 72a , 72b . layers 65 , 67 of sio 2 are formed on the annular ribs 64 , 68 to prevent the valves adhering to the glass wafers . the inlet valve is preferably centered on the cavity 58 . in this case , the projection 60 , also centered in relation to the cavity 58 and to the inlet valve , is in the form of a ring . the valves can be provided with an amplitude limiter to reduce the risk of breakage of the membrane . in the case of the outlet valve , this limiter is composed of an annular rib 69 ; in the case of the inlet valve , it is the projection 60 which acts as the limiter . channels 71 , 73 are preferably provided in the amplitude limiters of the valves to permit flow of liquid when these limiters are in contact with the glass wafers 54 , 56 . after the etching operations , the glass wafers 54 and 56 are sealed by anodic welding to the silicon wafer 52 , the glass wafer 54 being provided with an inlet opening 74 and an outlet opening 76 . the flexible wall 78 of the pumping chamber is composed of part of the glass wafer 56 ; its thickness is of the order of 200 μm . a piezoelectric disc 80 is bonded to this wall 78 to control its movement . in accordance with the invention the annular projection 60 limits the amplitude of movement of the flexible wall which makes it possible to precisely define the volume of the pumping chamber at the end of the delivery operation . this stop also makes it possible to keep the output of the micropump constant under normal use . as may be seen from the diagram of fig8 the output 0 of a conventional two - valve micropump is a linear function of the pressure p prevailing at the outlet of the micropump ( curve a ). in contrast , the output 0 of a micropump of the invention is substantially constant in the normal operating pressure range ( curve b ). this is because , for a pressure below the maximum operating pressure , the variation in volume caused by displacement of the flexible wall is limited . the output is thus virtually the same as that corresponding to the maximum operating pressure . | 5 |
fig1 presents a typical application of the preferred embodiment of this invention . in that application , a missile 10 with folded tail fins 12 is launched from an aircraft weapons bay along guide rails 14 . fixed fins 15 are not involved with this invention although any number of folded fins can be accommodated by the invention , with minor modifications . launch is initiated by means not part of this invention but which might be explosive bolts , solenoid actuated pin retractors or any suitable device used to separate the missile from its carrier tie down or securement position . at initiation of launch , a forcing function device such as hydraulic or pneumatic plunger system 16 , imparts vertical velocity to the missile proper . travel of missile 10 is controlled by guide rails 14 along either side thereof . at the aft end of the weapons bay , fixed to aircraft structure , is the slotted deployment mechanism 20 of this invention . mechanism 20 comprises a rigid plate 18 of metal or plastic , with curved or slanted slots 22 cut therein . slot 22 can be designed with an initial vertical section 24 followed by arcs of curvature or straight slanted sides 26 of a given character . for most launcher configurations , slot 22 will be of the j - type , with a mechanical blocking switch 28 located at , or slightly above , its maximum horizontal width point 30 . missile 10 is stowed in the bay with control fins 12 folded . figures herein show a missile with two of its four fins folded , but variations of this invention can deploy one folded fin or as many thereof as can be accommodated by separate j - slots . each of folded fins 12 has a pin 34 affixed at a position along the trailing edge of hinged section 36 . pin 34 follows slot 22 in base plate 18 by reason of forces exerted by edges 26 thereon as missile 10 drops vertically between rails 14 . at the point of maximum outboard horizontal excursion 30 of pin 34 , folded portion 36 of fin 12 will be horizontal , and this point is selectable by design , based on stress analysis of pin and fin structure and dynamics of the launch environment . as pin 34 passes inflection point 30 , it changes direction of its horizontal excursion and continues to force folded fin portion 36 into alignment with fixed portion 42 thereof . as pin 34 passes inflection point 30 , a mechanical switch 28 is activated , whereby pin 34 depresses its spring restrained lever arm 38 . lever arm 38 of switch 28 has spring 46 urging it upwards to a position across slot 22 . when pin 34 has passed over lever arm 38 , spring 46 urges the arm upwards and brings surface 48 across slot 22 , effectively blocking return travel of pin 34 . switch 28 has lever arm 38 pivoted at axle 54 and urged upwardly by spring 46 fixed to axle 50 of spring housing 52 . axles 50 and 54 are fixed to base plate 18 . spring 46 tension can be nominally small since its primary purpose is to bring surface 48 of lever arm 38 upwards across slot 22 . when folded surfaces 12 have been deployed , a variety of means , not part of this invention , can be used to secure them there . spring loaded pins riding on ridges of the folded portion can be caused to seat themselves in sockets of the folded portion and a variety of other securement devices can be employed to insure stability of the deployed surface . with fins 12 fully extended , missile 10 continues its vertical travel , with pins 34 moving down the slot &# 39 ; s second vertical section 44 . | 5 |
aspects of the present invention relate to predictive text used by electronic messagers , such as mobile phones . in accordance with the present invention , a user &# 39 ; s messager maintains a user message profile . the user message profile includes information about incoming and outgoing message histories for each of the user &# 39 ; s contacts . the user profile also includes the user &# 39 ; s personal data , including inter alia the user &# 39 ; s contact names , items in the user &# 39 ; s scheduler , and files and file names in the messager &# 39 ; s file system . reference is now made to fig1 , which is a simplified block diagram of an electronic messager 100 with a predictive text editor , in accordance with an embodiment of the present invention . messager 100 is used for receiving incoming messages , for sending outgoing messages , and for composing messages . as such , messager 100 includes a receiver 110 , a transmitter 120 , a key pad 130 for inputting characters when composing a message , and a display 140 for displaying received messages , sent messages , and messages being composed . messager 100 includes a text editor 150 for composing messages . many compact messagers have limited space for only a small key pad 130 for inputting characters . as a trade - off for the compactness of key pad 130 , several button presses are often required to input a single character , which is cumbersome . a user may spend several minutes composing , a short message of 10 - 20 words . to speed up the process of composing messages , messager 100 includes a text predictor 160 , which predicts words and phrases based on characters that were input . for example , if a user has input the characters r - e - a , then text predictor 160 may provide a list of predicted words and phrases the user can select from to complete the characters , including inter alia “ reach ”, “ react ”, “ read ”, “ ready ”, “ rear ” and “ really ”. the user can select one of the words in the list and thereby accelerate composing his message . in general , text predictor 160 receives a character string as input and produces on - the - fly a list of predicted words and phrases as output . conventional text predictors 160 use dictionaries to generate the list of predicted words and phrases . in accordance with the present invention , text predictor 160 predicts its words and phrases from a user message profile 170 generated and maintained in a storage unit of messager 100 . user message profile 170 includes a data structure , such as the tree data structure described hereinbelow with reference to fig4 , used by text predictor 160 to generate its output list . user message profile 170 is generated and maintained by a data manager 180 . data manager 180 regularly updates the data structure of user message profile 170 dynamically , based on incoming and outgoing messages that the user has received and sent , respectively . data manager 180 may also update message profile 170 based on personal user information , such as a list of the user &# 39 ; s contacts , the contents of a user &# 39 ; s scheduler , and user files stored within messager 100 . implementation details for text predictor 160 are described hereinbelow with reference to fig4 . when the user is composing a message to a designated recipient contact , text predictor 160 bases its predictions on messages in user message profile 170 that were received from the designated contact and on messages that were sent to the designated contact , if such messages exist . if the user is composing a message to a new contact then user message profile 170 does not contain a history of messages for the new contact , and text predictor 160 bases its predictions on general messages in user message profile 170 . it will be appreciated by those skilled in the art that the data structure stored in user message profile 170 may also be populated by words detected in speech during a conversation between the user and a user &# 39 ; s contact . speech - to - text conversion is used to convert voice to text . words extracted from the converted text are then added to user message profile 170 . such speech - to - text conversion may be performed by a speech - to - text convertor component within messager 100 ( not shown in fig1 ), or via a service provided by an application server . an example of such a service is the mobile speech - to - text interface available at http :// www . jott . com . when the user is replying to a message received from a contact , text predictor 160 derives its predictions based on the contents of the received message . a text parser 190 identifies special words , phrases and questions in the received message , and text predictor 160 uses these results to present the user with reply text he can choose from . for example , if text parser 190 identifies a question beginning with “ where ” in the received message , then text predictor 160 retrieves data from the user &# 39 ; s scheduler . thus , if the user responds to a message beginning with “ where ” while the user is in a meeting that is posted in the user &# 39 ; s scheduler as , subject : meeting with john location : my office start - time : wed oct . 17 , 2007 8 : 00 am end - time : wed oct . 17 , 2007 9 : 00 am then the predicted response takes the form “ i am in a meeting with john in my office between 8 : 00 am and 9 : 00 am .” alternative , if text parser 190 identifies a question beginning with “ where ” in the received message , then text predictor 160 presents a list of locations that user can choose from , including his home , his office and his physical location as determined by a gps unit , in case massager 100 contains a gps unit ( not shown ). if text parser 190 identifies a question beginning with “ who ” in the received message , then text predictor 160 presents a list of people the user can choose from , including his contacts . if text parser 190 identifies a question beginning with “ when ” in the received message , then text predictor 160 presents text beginning with “ at . . . ”, and if the user chooses this text then text editor 150 automatically switches into a numeric input mode . if text parser 190 identifies a question beginning with “ why ” in the received message , then text predictor 160 presents a text reply beginning with “ since . . . ” or “ because . . . ” if text parser 190 identifies a phone number in the received message , then text editor 150 enables the user to edit , save or dial the identified phone number . if text parser 190 identifies a special phrase , such as “ how are you ?” in the received message , text predict 160 presents text replies beginning with “ i &# 39 ; m fine ”, “ i &# 39 ; m doing well ” and “ i &# 39 ; m tired ” that the user can choose from . reference is now made to fig2 , which is a simplified flow chart of a method for text prediction when composing a new message , in accordance with an embodiment of the present invention . at step 210 a user initiates a new message to a recipient contact , using a message editor . at step 220 a determination is made whether the user &# 39 ; s new message is the first message the user is writing to the recipient contact . if not , then at step 231 the message editor predicts text patterns based on words in the user &# 39 ; s message history for the recipient contact . the predicted text may be based on the most recent message sent or received from this contact , or may be based on frequencies of word occurrences in the user &# 39 ; s overall message history for the recipient contact , or both . for example , if a first word was used 10 times , but not recently , and a second word was used 5 times and recently , then based on most recent , the second word is predicted , and based on most frequent , the first word is predicted . based on both most recent and most frequent , a score based on these two factors is derived and the first word or the second word is predicted in accordance with their respective scores . if the user &# 39 ; s new message is the first message the user is writing to the recipient contact , as determined an at step 220 , then at step 232 the message editor predicts text patterns based on word frequencies in the user &# 39 ; s general message history . implementation details for steps 231 and 232 are described hereinbelow with reference to fig4 . at step 240 the user sends his new message , and at step 250 information about the sent message is added to the user &# 39 ; s message profile for reference when subsequently predicting text . reference is now made to fig3 , which is a simplified flow chart of a method for text prediction when composing a reply message , in accordance with an embodiment of the present invention . at step 310 a user receives a message on his mobile phone , from one of his contacts . at step 320 the user initiates a new message as a reply to the message he received at step 310 , using a message editor . at step 330 the message received at step 310 is parsed for the presence of questions that begin with “ wh ”. in fact , because of their short lengths , many short messages such as sms messages include questions that begin with “ where ”, “ who ”, “ when ” and “ why ”. depending on the outcome of step 330 , processing proceeds to one of the pairs of steps 341 and 351 , 342 and 352 , etc . if the message received at step 310 contains a question that begins with “ where ”, as determined at step 341 , then at step 351 the message editor offers a list of locations the user can choose from , including inter alia the user &# 39 ; s home , the user &# 39 ; s workplace , and the user &# 39 ; s location as determined by gps information . alternatively , as described hereinabove , the message editor may generate a response based on the user &# 39 ; s scheduler . if the message received at step 310 contains a question that begins with “ who ”, as determined at step 342 , then at step 352 the message editor offers a list of people the user can choose from , including inter alia the user &# 39 ; s contacts . if the message received at step 310 contains a question that begins with “ when ”, as determined at step 343 , then at step 353 the message editor offers to begin the reply message with “ at . . . ”, and the characters are automatically switched to numerical mode . if the message received at step 310 contains a question that begins with “ why ”, as determined at step 344 , then at step 354 the message editor offers to begin the reply message with “ because . . . ”. if the message received at step 310 contains a phone number , as determined at step 345 , then at step 355 the message editor offers to save , edit or dial the identified phone number . if the message received at step 310 contains a special phrase , as determined at step 346 , then at step 356 the message editor offers to formulate the reply according to pre - defined options . for example , if the incoming message contains the phrase “ how are you ?”, then possible replies may include “ i &# 39 ; m fine , thanks ” and “ i &# 39 ; m tired ”. if the incoming message contains a yes / no question , then possible replies may include “ yes ”, “ no ” and “ perhaps ”. at step 360 the user sends the reply message that he composed , and at step 370 information about the sent message is added to the user &# 39 ; s message profile . reference is now made to fig4 , which is a simplified illustration of a data structure for predicting text , in accordance with an embodiment of the present invention . the data structure shown in fig4 is stored in user message profile 170 of fig1 , and such a data structure is generated and maintained by data manager 180 for each one of a user &# 39 ; s contacts . the data structure includes a tree 410 whose nodes 420 contain alphabetically left - to - right sorted character strings , where a parent node is a prefix of its child nodes . the root 430 of tree 410 is the character string “ c ”, although it will be appreciated by those skilled in the art that “ c ” may itself be a child node , together with siblings “ a ”, “ b ”, “ d ”, etc ., of a parent node corresponding to an empty character string . conversely , node 430 may not be present , and tree 410 may include three trees with respective root nodes “ ca ”, “ ch ”, “ cl ”. in addition to its character string , within each node 420 of tree 410 is also stored a linked list 440 corresponding to those words that have that character string as their prefix . each linked list 440 includes words and their frequencies of use with the specific user &# 39 ; s contact for whom the data structure is associated with . the linked lists 440 are ordered based on frequency of use . data manager 180 is responsible for generating and maintaining tree 410 and linked lists 440 , and for dynamically updating them when new messages are sent and received to and from the specific user &# 39 ; s contact , respectively , and new words and frequencies are derived therefrom . when a word &# 39 ; s frequency of use changes , or when a new word is added , data manager updates tree 410 and its linked lists 440 accordingly . as mentioned hereinabove with reference to fig1 , text predictor 160 operates by accepting as input a character string entered by a user , and providing on - the - fly as output a list of predicted words that have the input character string as prefix , the list being sorted according to frequency . using the tree data structure of fig4 , text predictor 160 directly generates the words in the output list from the linked list 440 associated with the input character string . the output list may be empty if the input character string is not a node of tree 410 . conversely , the output list may need to be truncated if the linked list 440 is too large . for example , if text predictor 160 receives the character string “ ca ” as input , then using tree 410 it references the linked list 440 at the node for “ ca ”, and generates as output the ordered list of words ( 1 ) cat , ( 2 ) cable , ( 3 ) car , ( 4 ) camel . in case the output list is limited to three words , the above list is truncated to ( 1 ) cat , ( 2 ) cable , ( 3 ) car . it will be appreciated by those skilled in the art that linked lists 440 may contain pointers to words stored in memory , instead of the words themselves . the data structure of fig4 is appropriate for frequency - based sorting for the output list . if a sorting based on most recent use is desired , than linked lists 440 store a most recent date & amp ; time of use for each word , instead of a frequency of use . if a sorting based on most frequent and most recent is desired , then linked lists 440 store a score for each word entry , the score being a function of how frequently and how recently a word has been used . it is noted that the data structure of fig4 has redundancy , since each linked list 440 may be derived from the linked list of its parent node . as such , the linked list of root node 430 of tree 410 contains all of the information necessary to generate each of the linked lists of the other nodes of tree 410 . an alternate data structure , instead of the tree structure illustrated in fig4 , is a tabulated dictionary of words sorted in alphabetical order , where each word entry includes a frequency and at least one date & amp ; time of use . as above , text predictor 160 operates by accepting as input a character string entered by a user , and providing as output a list of words that have the input character string as prefix , the list being sorted according to frequency . using this dictionary data structure , text predictor 160 performs a dictionary word look - up and word sort in order to generate its output list . for example , if text predictor 160 receives the character string “ ca ” as input , then using the dictionary it looks - up the words cable , camel , car and cat , and sorts these words according to their frequencies of use ; namely , ( 1 ) cat ( freq = 9 ), ( 2 ) cable ( freq = 7 , ( 3 ) car ( freq = 4 ), ( 4 ) camel ( freq = 1 ). as above , if the output list is limited to three words , the above list is truncated to ( 1 ) cat , ( 2 ) cable , ( 3 ) car . in accordance with the present invention , such a dictionary data structure is generated and maintained for each of the user &# 39 ; s contacts . it will be appreciated by those skilled in the art that storing tree data structures or dictionary data structures for a large number of contacts may require more memory than is available in messager 100 . in such case , a first in first out ( fifo ) policy is implemented to purge the oldest words and profiles in order to accommodate new words and profiles . for example , if a user has 200 contacts and if the average size of a dictionary for the contacts is 10 , 000 entries and if each entry requires 16 bytes of storage , then the required memory is 200 * 10 , 000 * 16 bytes = 32 mb of storage . for messagers that include one or more gbs of memory , the required memory for the dictionaries is approximately 3 % or less of the total capacity . comparing the tree data structure with the dictionary data structure , it will be appreciated that the data structure illustrated in fig4 requires less on - the - fly processing by text predictor 160 , at the expense of storing a lot of redundant data in tree 410 and at the expense of more background processing by data manager 180 to maintain tree 410 and its linked lists 440 . in distinction , the alternative data structure using a dictionary uses less memory and requires less background processing by data manager 180 to maintain the dictionary , at the expense of requiring more on - the - fly processing by text predictor 160 . it will further be appreciated by those skilled in the art that various optimizations may be performed to enhance the performance of text predictor 160 and data manager 180 , for both the tree data structure and the dictionary data structure embodiments . thus , the output list of text predictor 160 may be sorted only relative to the first three characters , say , of the predicted words . such partial sort reduces processing requirements for data manager 180 vis a vis the tree data structure , and for text predictor 160 vis a vis the dictionary data structure . additionally , the entries in the dictionary data structure may be pre - sorted for specific prefixes , thereby reducing on - the - fly processing requirements for text predictor 160 vis a vis the dictionary data structure . the present invention may be embodied as an enhancement to existing text prediction , such as t9 text prediction , by fine - tuning the prediction to each specific user contact . t9 bases its prediction on key strokes . for example , when a user presses on “ 228 ”, predictions such as “ cat ”, “ bat ”, “ act ” are derived , since the “ 2 ” key represents “ a ”, “ b ” and “ c ”, and the “ 8 ” key represents “ t ”, “ u ” and “ v ”. the t9 predictions may also include words that have prefixes that correspond to “ 228 ”, such as “ cats ”, “ bats ”, “ actor ”, “ acting ”. the predictions are sorted by frequency of use . the present invention enhances t9 prediction inter alia by generating and sorting predictions according to frequencies of use for a specific user contact . the present invention may also be embodied as a stand - alone text predictor . in distinction to t9 , when the present invention is embodied as a stand - alone predictor , predictions are based on characters that are input , instead of key strokes per se . for example , when a user presses on “ 222 - 2 ”, for example , corresponding to “ c - a ”, predictions include words that have “ ca ” as prefix , such as “ cat ”, “ cable ”, “ car ”, “ camel ”, as in fig4 . in reading the above description , persons skilled in the art will realize that there are many apparent variations that can be applied to the methods and systems described . although the present invention has been described with reference to text messages , such as short message service ( sms ) messages , it also applies to other modes of communication , including inter alia e - mail messages and multi - media messaging service ( mms ) messages . the data structure in fig4 may integrate combined usage histories , sms / e - mail / mms , for each user contact . alternatively , separate data structures may be generated and maintained for each mode of communication , namely , an sms usage history , an e - mail usage history and an mms usage history ; for each user contact . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will ; however , be evident that various modifications and changes may be made to the specific exemplary embodiments without departing from the broader spirit and scope of the invention as set forth in the appended claims . accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense . | 8 |
certain terminology will be used in the following description for convenience in reference only and will not be limiting . the words “ up ”, “ down ”, “ right ” and “ left ” will designate directions in the drawings to which reference is made . the words “ in ” and “ out ” will refer to directions toward and away from , respectively , the geometric center of the device and designated parts thereof . such terminology will include derivatives and words of similar import . in the drawings , only a fragment of a birthing bed 10 has been illustrated , namely , that part of the bed 10 having a mattress section 11 upon which the birthing mother sits with her legs extending beyond the right edge 12 thereof . if desired , another mattress surface can be provided to the right of the mattress section 11 and therebelow so that the feet of the birthing mother can rest thereon . the mattress section 11 is supported on a mattress frame 13 which in turn is elevatably supported on a main frame 14 . the mechanism for elevating the mattress frame 13 up and down in relation to the main frame 14 is well known in the art and , accordingly , a further detailed discussion thereof is believed unnecessary . a labor grip mechanism 15 is mounted on both lateral sides of the main frame 14 as shown in fig6 and both labor grip mechanisms are the mirror image of each other and include a post 16 having a free end section 17 and a hand grip 18 mounted at the aforesaid free end 17 . for purposes of simplifying this disclosure , only one labor grip mechanism is shown in the drawings and will be described in detail . in this particular embodiment , the post 16 is an elongate rod - like member having a first section 19 and a second section 21 forming an angle θ ( fig3 ) formed therebetween . the handle 18 is a continuation of the rod - like member and is bent at a 90 ° angle with respect to the section 21 . a protective member 22 is secured to the free end of the pipe section , namely , the handle 18 . the labor grip mechanism 15 further includes an elongate straight rod section 23 connected at a right angle to the rod section 19 . the straight section 23 is supported in a guide opening 24 provided on the main frame 14 , which guide opening guides the straight section 23 between a first position thereof illustrated in fig1 and a second position thereof illustrated in fig3 . an additional support mechanism 45 described in more detail below in reference to fig6 is provided for assisting the guiding of the straight section 23 between the aforesaid first and second sections , particularly in order to stabilize the straight section 23 when it is in the second position illustrated in fig3 . a spring 26 is either anchored to the main frame 14 on a side of the birthing bed remote from the side illustrated in fig3 of the drawings and is connected at the other end to the end of the straight section 23 remote from the rod section 19 or is embodied in the additional support mechanism 45 discussed in more detail below . as the straight section is transitioned between the first and second positions , the spring 26 will generate a return force urging the straight section 23 and , consequently , the labor grip mechanism to the first position of the labor grip mechanism illustrated in fig1 . while the spring 26 is illustrated in fig3 as a tension spring , it will be recognized by those of ordinary skill in the art that the straight section 23 can be configured to operate utilizing a compression spring as will be described below with reference to fig6 . as is illustrated in the drawings , the mattress frame 13 includes a cut out section 27 of a sufficient dimension to permit the region of the labor grip mechanism 15 adjacent the juncture between the rod section 19 and the straight section 23 to move therethrough when the labor grip mechanism 15 is transitioning between the first position illustrated in fig1 and the second position illustrated in fig3 . a hand grip positioning bracket 30 is secured by means of a base member 31 to the underside of the mattress frame 13 by means of a plurality of screws ( not illustrated ) received in appropriate holes 32 . an elongate rod 33 is secured to the base member 31 and extends in a direction generally parallel to the straight section 23 . the distal end of the rod 33 terminates adjacent an outer edge 34 of the mattress frame 13 . a reinforcement or bracing member 36 is secured to the base member 31 and the distal end of the rod 33 . the brace 36 also provides a smooth surface between the end thereof adjacent the main frame 14 through to the end thereof adjacent the distal end of the rod 33 . an elongate arm , also known as a cam , 37 is secured to the straight section 23 and is movable therewith in all directions of movement of the straight section 23 . the cam 37 extends radially outwardly from the straight section 23 and a surface 38 thereof is configured to engage the surface of the brace 36 so as to prevent counterclockwise rotation of the labor grip mechanism 15 about an axis defined by the longitudinal axis of the straight section 23 . rotational movements of the labor grip mechanism 15 in the opposite direction , namely , the clockwise direction is prevented by a surface 39 on the cam 37 engaging the undersurface 41 of the mattress frame 13 . the labor grip mechanism 15 is movable between the aforesaid first position thereof illustrated in fig1 and the second position thereof illustrated in fig3 by a simple manual force being applied to the post 16 and pulling outwardly in a direction parallel to the longitudinal axis of the straight section 23 . in the second position , the cam 37 will be oriented between the distal end of the rod 33 and the edge 34 of the mattress frame 13 so that the cam 37 can be moved therebetween by rotating the labor grip mechanism about the longitudinal axis of the straight section 23 . once the cam 37 is moved to a location generally above the rod 33 , the return spring 26 will cause the straight section 23 to retract back into the guide opening 24 to orient the cam 37 on the upper surface of the rod 33 as illustrated in fig4 . the base member 31 forms a stop against which the cam 37 will abut when the cam 37 is oriented above the rod 33 as illustrated in fig4 . the base 31 effectively orients the cam 37 in a position spaced outwardly from the main frame 14 so that the post sections 19 and 21 of the labor grip mechanism 15 are oriented laterally of the mattress frame 13 and mattress 11 mounted thereon . as is illustrated in fig3 the cam 37 has a width x . the spacing between the exterior surface of the rod 33 and the undersurface 41 of the mattress frame 13 is equal to the aforesaid distance x or a slightly greater distance so as to facilitate the receipt of the cam 37 snugly therebetween . this snug orientation of the cam 37 between the exterior surface of the rod 33 and the surface 41 of the mattress frame 13 ( see fig4 ) provides a substantial rigidity to the orientation of the hand grip 18 and will provide a perceived sense of security to the birthing mother to cause her to think that as much force as she wishes to place onto the hand grip 18 will be sufficiently supported . the additional support mechanism or translational device 45 is shown in more detail in fig6 . the additional support mechanism or translational device 45 additionally facilitates simultaneous deployment or stowing of both labor grip mechanisms in response to manual forces applied to only one labor grip mechanism 45 to effect deployment or stowing as described above . more specifically , the additional support mechanism 45 includes a pair of axially spaced hollow bearing members 46 and 47 configured to be fastened to the underside of the mattress frame 13 as schematically represented in fig1 . an elongate housing 48 is provided which has a pair of axially aligned openings 49 and 51 in opposite ends which are configured to be coaxially arranged with the holes in the bearing members 46 and 47 so that the straight sections 23 of each labor grip mechanism is axially slidably and rotatively received in and supported by the bearing members 46 and 47 and extend into the interior 52 of the housing . a pair of toothed racks , only one rack 53 is shown in fig6 are slidably supported in corresponding guides 56 and 57 . each rack 53 is secured to an end of the respective straight section 23 that terminates in the interior of the housing . a compression spring 58 encircles each straight section 23 and is oriented between spring abutments formed by each end wall of the housing 48 and the end of the straight section 23 whereat the toothed rack 53 is secured . the racks 53 are spaced from each other and a pinion gear 59 rotatably supported on the housing 48 is configured so that its teeth schematically illustrated at 61 matingly engage the teeth 62 of each rack . as a result , a pulling force applied to one labor grip mechanism 15 to effect a movement thereof from the first position illustrated in fig1 to the second position illustrated in fig3 will cause the driven rack to rotatively drive the pinion gear 59 and cause a corresponding driven movement of the other rack to effect a corresponding and simultaneously occurring deploying movement of the other labor grip mechanism 15 . the bearing elements 46 and 47 will enable simultaneous rotation of the straight sections 23 between the second position shown in fig3 to the deployed position where the hand grips 18 are oriented above the upper surface of the mattress 11 as well as vice versa . although a particular preferred embodiment of the invention has been disclosed in detail for illustrative purposes , it will be recognized that variations or modifications of the disclosed apparatus , including the rearrangement of parts , lie within the scope of the present invention . | 0 |
as illustrated in fig1 and 2 , the diving stick of the first preferred embodiment of the invention includes a generally cylindrical or elongated body 1 made of a material having sufficient softness and / or malleability to bend when it encounters a person so as 1 include soft polyvinyl chloride and rubber , although the invention is intended to encompass any material with similar properties of softness and malleability . body 1 of the diving stick is divided into two sections or chambers 2 and 3 , which may be separated from each other by an inwardly extending flange 4 . chamber 2 is arranged to hold a weight 5 and includes an end cap 6 that enables removal of the weight , although those skilled in the art will appreciate that the weight 5 may instead be permanently enclosed within the chamber and the end cap replaced by an end wall of the body 1 . the weight 5 , may for example be of the approximate size and weight of a { fraction ( 3 / 16 )}″× ½ ″ bolt and nut , although the configuration of the weight may be varied depending on the size and desired sink rate of the stick . in order for the diving stick of this embodiment to work , however , the weight must be confined to the end portion of the stick represented by chamber 2 . chamber 3 includes at least two openings , one at each end , to permit flow of air and water . in particular , opening 7 , which is the opening closest to divider 4 of the illustrated embodiment , is arranged to permit ingress of water while openings 8 , of which there are three in the illustrated embodiment are arranged to vent air as water flows into openings 8 . as a result , when the diving stick of this embodiment is initially tossed into a swimming pool or other body of water , it will initially float in a horizontal orientation . because one end is weighted , the end of the diving stick containing the weight will dip sufficiently into the water to cause water to begin to enter opening 7 , as illustrated in fig3 a . as water enters opening 7 , air will be expelled through openings 8 , as illustrated in fig3 b , causing the stick to be filled with water up to the level of the closest of openings 8 to the end of the stick opposite to the weighted end . however , a pocket of air will remain trapped in the end portion of chamber 3 , which will cause the stick to maintain an upright orientation as it sinks and comes to rest on the bottom of the pool , as illustrated in fig3 c . once the diving stick is retrieved from the bottom of the pool , the water will flow out through openings 7 and 8 and the stick will be ready for re - use . in the embodiment illustrated in fig4 the diving stick includes an elongated soft body 10 made of a natural or synthetic , water permeable , cloth or fabric material such as polyester or nylon , filled with a soft stuffing material such as foam or polyfill 11 . again , the invention is intended to encompass any materials having properties of softness and pliability corresponding to the described materials , with softness and pliability being defined by the lack of potential for impalement or serious injury to a diver . in this embodiment , the weight is provided by a mesh or cloth sack 12 filled with sand 13 or a similar material will cause the stick to have a preferred orientation as it sinks . the enlarged end 14 opposite the weighted end helps the stick of this embodiment maintain an upright posture by serving as a reservoir for air trapped in the polyfill stuffing material as water is absorbed through the cloth outer layer 10 . in a modification of this embodiment of the invention , the fabric and polyfill construction of the stick illustrated in fig4 may be replaced by a tube of woven material 15 , as shown in fig5 that is stiff enough to maintain a generally cylindrical shape without stuffing , and that has a weighted end 16 so that the specific gravity of the tube at the weighted end is greater than 1 . this type of tube will sink in the same manner as the conventional diving tube as water enters the tube through the woven material or through openings in the tube , and may optionally include provision for an air pocket at the top to help maintain the upright posture . the material in question is often used in lawn furniture , and also in a novelty device known as the lawyer &# 39 ; s handcuff . although various preferred embodiments of the invention have been described with sufficient particularity to enable a person skilled in the art to make and use the invention without undue experimentation , it will be appreciated that numerous other variations and modifications of the illustrated embodiments , in addition to those already noted above , may be made by those skilled in the art . for example , the diving stick may have a shape other than the generally cylindrical shapes illustrated in the drawings , so long as the sticks are generally elongated so as to have a preferred orientation and so long as the sticks can easily be grasped by a diver . in addition , it is possible that other ways of achieving negative buoyancy could be used without departing from the broadest principle of the invention , which is to make the diving sticks of a soft , malleable material in order to eliminate the risk of impalement . for example , although the illustrated embodiments use discrete weights , the illustrated diving sticks may utilize any construction in which one end has a specific gravity greater than 1 ( the specific gravity of water ) so that the stick will begin to sink and therefore take on enough water to bring the overall specific gravity of the stick to greater than one . each of these variations and modifications , including those not specifically mentioned herein , is intended to be included within the scope of the invention , and thus the description of the invention and the illustrations thereof are not to be taken as limiting , but rather it is intended that the invention should be defined solely by the appended claims . | 0 |
the terpolymers utilized in the self - emulsifiable resin powders of the present invention are synthesized utilizing a free radical polymerization technique in an aqueous medium . these terpolymers are comprised of repeat units which are derived from three or more different monomers . two of the monomers that are utilized in the preparation of these terpolymers are acrylic acid and methacrylic acid . in addition to the acrylic acid and methacrylic acid monomers , one or more additional copolymerizable monomers are also utilized in the preparation of the terpolymer . in other words , the terpolymers utilized in the powder compositions of the present invention are comprised of repeat units derived from ( 1 ) acrylic acid , ( 2 ) methacrylic acid , and ( 3 ) at least one copolymerizable monomer . the term &# 34 ; copolymerizable monomer &# 34 ; as used herein means any monomer that can be copolymerized with acrylic acid and methacrylic acid . in cases where more than one copolymerizable monomer are utilized it is , of course , necessary for the copolymerizable monomers to be capable of being copolymerized together . these terpolymers will normally contain ( 1 ) from about 0 . 1 to 6 weight percent acrylic acid , ( 2 ) from about 0 . 1 to 4 weight percent methacrylic acid , and ( 3 ) from about 93 to 99 weight percent copolymerizable monomers . technically , these terpolymers contain repeat units ( chain linkages ) which are derived from acrylic acid monomers , methacrylic acid monomers , and one or more copolymerizable monomers . these repeat units differ from the monomers that they were derived from in that they contain one less carbon - carbon double bond than is present in the monomer . in other words , an carbon - carbon double bond is consumed during the polymerization of the monomer into a repeat unit in the polymer . thus , in saying that a polymer contains various monomers in actuality means that it contains repeat units derived from those monomers . preferably the terpolymers utilized in the present invention will have from 0 . 5 to 4 weight percent of their repeat units being derived from acrylic acid and from 0 . 5 to 3 weight percent of their repeat units being derived from methacrylic acid . in any case no more than 7 weight percent of the repeat units in the terpolymer can be derived from acrylic acid , methacrylic acid , and other carboxyl group containing monomers . preferably no more than 5 weight percent of the repeat units in said terpolymers will be derived from acrylic acid , methacrylic acid , and other carboxyl group containing monomers . most preferably from 2 to 4 weight percent of the repeat units in such terpolymers will be derived from acrylic acid and methacrylic acid monomers . generally the only repeat units in such terpolymers that contain carboxyl groups are the repeat units which are derived from the acrylic acid and the methacrylic acid monomers . in other words , normally acrylic acid and methacrylic acid are the only carboxyl group containing monomers that are utilized in the preparation of the terpolymers utilized in the present invention . the terpolymers of the present invention are synthesized in an aqueous reaction mixture by utilizing a free radical polymerization technique . the reaction mixture utilized in this polymerization technique is comprised of water , the appropriate monomers , a suitable initiator , and a metal salt of an alkyl sulfate or a metal salt of an alkyl sulfonate . the reaction mixture utilized in this polymerization technique will normally contain from about 10 to about 80 weight percent monomers , based upon the total weight of the reaction mixture . the reaction mixture will preferably contain from 20 to 70 weight percent monomers and will most preferably contain from 40 to 50 weight percent monomers . the reaction mixtures utilized in carrying out such polymerizations also contain from about 0 . 005 to 1 phm ( parts per hundred parts of monomer by weight ) of at least one member selected from the group consisting of metal salts of alkyl sulfates and metal salts of alkyl sulfonates . preferably from 0 . 008 to 0 . 3 phm and most preferably from 0 . 01 to 0 . 1 phm of a metal salt of an alkyl sulfonate and / or a metal salt of an alkyl sulfate will be utilized in the reaction mixture . the free radical polymerization technique utilized in this synthesis is normally initiated by including a free radical initiator in the reaction mixture . the utilization of a metal persulfate or ammonium persulfate as the initiator works well with potassium persulfate , sodium persulfate , and ammonium persulfate being highly suitable as the initiator . the subject polymerization can be carried out in a batch process , on a semi - continuous basis , or in a continuous process . the polymerization temperature that can be used varies greatly with the type of initiator being employed and with the copolymerizable monomers that are being polymerized . as a general rule the polymerization temperature utilized is from 20 ° c . to 95 ° c . in most cases the polymerization temperature utilized will vary between 60 ° c . and 80 ° c . normally , the polymerization will be continued until a high monomer conversion is attained . the terpolymer emulsion that is produced by this process is therefore comprised of the terpolymer , water , and at least one member selected from the group consisting of metal salts of alkyl sulfonates and metal salts of alkyl sulfates . the amount of initiator employed will vary with the monomers being polymerized and with the desired molecular weight of the terpolymer . however , as a general rule from 0 . 005 to 1 phm of an initiator will be included in the reaction mixture . in the case of metal persulfate initiators most commonly from 0 . 1 to 0 . 5 phm will be utilized . the metal salts of alkyl sulfates and metal salts of alkyl sulfonates that are utilized in the practice of the present invention will generally contain from 1 to 30 carbon atoms in their alkyl group . preferably these salts will have alkyl groups that contain from 8 to 18 carbon atoms and most preferably they will have alkyl groups that contain from 10 to 14 carbon atoms . sodium lauryl sulfate ( dodecyl sodium sulfate ) is a highly preferred metal salt of an alkyl sulfate . the copolymerizable monomers that are utilized in the terpolymers of this invention are selected with the ultimate use of the particular latex being synthesized in mind . most commonly the copolymerizable monomers utilized will be vinylaromatic monomers , acrylate monomers , alkyl acrylate monomers , and / or diene monomers . the vinyl monomers that can be employed will contain at least one vinyl group ( ch 2 ═ ch --). these vinyl monomers generally contain from 2 to 16 carbon atoms . such vinyl monomers can also contain nitrogen , oxygen and / or halogen . some representative examples of vinylaromatic monomers that can be used include styrene , orthomethylstyrene , metamethylstyrene , paramethylstyrene , ethylstyrene , dimethylstyrene , α - methylstyrene , parachlorostyrene , paramethoxystyrene , parachlorostyrene , 2 , 4 - dichlorostyrene , 2 , 5 - dichlorostyrene , parabromostyrene , α - methyl - paramethylstyrene , metaethylstyrene , paraisopropylstyrene , vinylnaphthalene , and the like . the alkyl acrylate monomers that can be utilized have the structural formula : ## str1 ## wherein r represents an alkyl group which contains from 1 to 20 carbon atoms and wherein r &# 39 ; represents a methyl group or a hydrogen atom . preferably the alkyl group in such alkyl acrylate monomers will contain from 1 to 12 carbon atoms . some representative examples of alkyl acrylate monomers that can be utilized include ethylacrylate , propylacrylate , butylacrylate , 2 - ethylhexylacrylate , n - octylacrylate , ethylmethacrylate , propylmethacrylate , butylmethacrylate , 2 - ethylhexylmethacrylate , n - octylmethacrylate , and the like . the diene monomers that can be utilized normally contain from 4 to about 12 carbon atoms . either conjugated diene monomers or nonconjugated diene monomers can be utilized . some representative examples of conjugated diene monomers that can be utilized include isoprene , 1 , 3 - butadiene , piperylene , 1 , 4 - hexadiene , 1 , 3 - heptadiene , 1 , 3 - octadiene , 2 , 4 - hexadiene , 2 , 4 - heptadiene , 2 , 4 - octadiene , 2 , 3 - dimethylbutadiene , 2 , 3 - dimethyl - 1 , 3 - hexadiene , 2 , 3 - dimethyl - 1 , 3 - heptadiene , 2 , 3 - dimethyl - 1 , 3 - octadiene , 2 , 3 - dimethyl - 1 , 3 - nonadiene , and the like . the terpolymers that are used in latices which are used in making surface coatings or paints will preferably be hard resins and have a glass transition temperature of at least 40 ° c . the copolymerizable monomers used in making such terpolymers will be selected with these properties being kept in mind . for example , alkyl methacrylate monomers can be copolymerized into terpolymers in order to increase the glass transition temperature of the terpolymer . on the other hand , use can be made of the ability of alkyl acrylate monomers to plasticize or lower the glass transition temperature of such terpolymers . in other words , by a judicious choice of alkyl acrylate monomers , alkyl methacrylate monomers or mixtures thereof the desired glass transition temperature can be obtained . a terpolymer resin that has good properties for utilization in coatings can be synthesized utilizing as the monomers 43 to 89 weight percent vinylaromatic monomers , 10 to 50 weight percent alkyl acrylate monomers , 0 . 5 to 4 weight percent acrylic acid , and 0 . 5 to 3 weight percent methacrylic acid . it is preferable to utilize from 55 to 78 weight percent vinylaromatic monomers , from 20 to 40 weight percent alkyl acrylate monomers , from 1 to 3 weight percent acrylic acid , and from 0 . 5 to 2 weight percent methacrylic acid in such resins . a preferred vinylaromatic monomer for use in such resins is styrene and the preferred alkyl acrylates are those which have alkyl groups containing from 2 to 6 carbon atoms . butylacrylate is a highly preferred alkyl acrylate for use in such applications . all acrylic resins can be made by sutstituting methyl methacrylate for the vinylaromatic monomer ( styrene ) without substantially changing the glass transition temperature of the resulting resin . the self - emulsifiable resin powder compositions of the present invention can be prepared by simply spray drying a terpolymer emulsion which was made in accordance with the present invention . this spray drying process can be carried out by utilizing conventional equipment which is readily commercially available and techniques which are well known to persons skilled in the art . the self - emulsifiable resin powder compositions which are made in this manner can then be redispersed in water by simply adjusting the ph of the water to above 7 and mixing the resin powder into it with only mild agitation being required . the ph of the water can be adjusted to above 7 by adding to it an organic or inorganic base , such as ammonium hydroxide , sodium hydroxide , potassium hydroxide , monoethanolamine , or the like . a fugitive base is preferred . the ph of the water will most commonly be adjusted to a ph of between 8 and 10 . the reconstituted latices made in accordance with this invention can then be utilized in many applications . for instance , they could be used in making surface coatings , paints , and concrete ( cement ) additives . it is , of course , also possible to use the latices of the present invention in such applications without first drying them into a powder form followed by reconstituting them to latex form by adding water . surface coating compositions or paints made by utilizing the reconstituted latices of the present invention will quite commonly be comprised of ( a ) the terpolymer resin ; ( b ) water ; ( c ) a coalescing agent ; ( d ) a plasticizer ; and ( e ) optionally a wetting or dispersing agent . in general , the use of wetting or dispersing agents is not required since the reconstituted latex acts as a dispersing agent by itself . such surface coatings or paints will also commonly contain a pigment in order to provide the desired color . the amount of coalescing agent and plasticizer needed in such surface coating compositions varies greatly with the type of terpolymer resin being utilized . more specifically , in surface coating compositions that utilize a terpolymer resin with a high glass transition temperature greater amounts of coalescing agents are required than if the terpolymer resin has a low glass transition temperature . in fact , if a terpolymer resin having a glass transition temperature of about 20 ° c . to about 25 ° c . is utilized , then it will probably not be necessary to include a coalescing agent in the surface coating composition . in any case , persons having skill in the art will be able to determine the amount of coalescing agent that is required in order for the surface coating composition to ensure that it provides a continuous film upon drying after application to a surface . compounds that are designed to increase the open time or drying time of the surface coating composition are also commonly utilized in such compositions . the amount of pigment required to produce a desired color will vary greatly with the pigment or combination of pigments being utilized which in turn will influence the gloss and other properties of the final paint film . a typical paint composition can be comprised of 20 to 40 weight percent water , 20 to 40 weight percent of the terpolymer resin of the present invention , 5 to 10 weight percent of a coalescing agent , 1 to 4 weight percent of a plasticizer , and 15 to 35 weight percent of a pigment . butyldiglycol is a coalescing agent that is commonly used in such applications which also acts as a transient plasticizer . white spirits are also commonly used in such compositions as a coalescing agent . propylene glycol is sometimes utilized in such surface coating compositions in an amount ranging from about 1 percent to about 4 percent in order to increase the open time of the surface coating composition . this invention is illustrated by the following examples which are merely for the purpose of illustration and are not to be regarded as limiting the scope of this invention or the manner in which it can be practiced . unless specifically indicated otherwise , all parts and percentages are given by weight . an aqueous reaction mixture was prepared by mixing 67 phm of styrene , 30 phm of butylacrylate , 2 phm of acrylic acid , 1 phm of methacrylic acid , 0 . 6 phm of tertiary - dodecyl mercaptan , 0 . 05 phm of sodium lauryl sulfate , 0 . 8 phm of ammonium persulfate and 200 phm of water in a reaction vessel . the polymerization mixture was allowed to polymerize for 1 hour at 59 ° c . the reaction temperature was then increased to 79 ° c . and the polymerization was allowed to continue for an additional 2 . 5 hours with a terpolymer emulsion being formed . the terpolymer emulsion produced was then spray dried utilizing a buchi 190 mini spray dryer . the spray dryer was operated utilizing an inlet temperature of 90 ° c ., an outlet temperature of 57 ° c . and with the pump , aspirator , and heater settings being 3 , 5 , and 4 . 5 , respectively . a self - emulsifiable resin powder composition was obtained by this procedure . reconstituted latices were prepared by simply shaking equal amounts of the powder composition prepared and water together in bottles . the water utilized in this procedure had a ph of 9 - 10 which was attained by the addition of ammonia . the 50 percent solids latex formed was very stable and after 12 months of standing did not show any signs of destabilization . the procedure utilized in example 1 was repeated in this experiment except that no sodium lauryl sulfate was included in the reaction mixture . in this experiment the powder composition produced could not be reconstituted to form a stable latex . in fact , after the resin powder composition was dispersed in the water phase separation occurred very quickly upon standing . the reconstituted latex prepared in example 1 was utilized in making a white paint . this paint was prepared by mixing 100 parts of the resin powder composition made in example 1 with 100 parts of water , 1 part of surfinol ™ 104 ( a wetting agent and antifoam agent ), 10 parts of propylene glycol , 5 parts of an amine , 10 parts of butyldiglycol , 8 parts of plastilit ™ ( a plasticizer ), 12 . 5 parts of white spirits , and 80 parts of titanium dioxide ( a white pigment ). this paint was prepared with only a moderate amount of agitation being required . in fact , much less mechanical agitation was required in preparing this paint than is normally required using conventional latices in making paints . the white paint made in this experiment exhibited excellent adhesion to steel and aluminum . this paint was also determined to provide a copper plate with excellent protection against oxidation . more specifically , copper surfaces which have been painted utilizing this paint do not quickly turn blue due to oxidation as do copper surfaces which have been painted using conventional water borne paint formulations . while certain representative embodiments have been shown for the purpose of illustrating the invention , it will be apparent to those skilled in this art that various changes and modifications can be made therein without departing from the scope of the invention . | 2 |
this is a division of ser . no . 09 / 752 , 086 , filed dec . 29 , 2000 . reference should now be made to the drawing figures herein , numbered from 1 to 9 , on which similar or identical elements are given consistent identifying numerals throughout the various figures thereof , and on which parenthetical references to figure numbers direct the reader to the view ( s ) on which the element ( s ) being described is ( are ) best seen , although the element ( s ) may be seen also on other views . [ 0025 ] fig1 illustrates inner elements of a shock - absorbing bicycle seat mount , generally indicated by the reference numeral 200 , constructed to accomodate longitudinal movement of a slotted seat post 210 , onto which bicycle saddle 212 is clamped by collar 214 but which is prevented from rotational motion by protrusion 262 that extends inwardly from snug fitting , dimensionally conforming insert 250 into slot 264 of seat post 210 . rotational motion of insert 250 is prevented by tab 220 extending outwardly from the outer wall of 250 , depending from flange 252 and protruding into notch 240 of seat tube 202 . seat post 210 , optional spacer blocks 222 , biasing means 224 and vibration eliminator wafer 230 are supported on platform 232 which is enabled to move longitudinally in seat tube 202 with it &# 39 ; s opposite ends extended through diametrically opposite openings 246 through the wall of seat tube 202 . the ends of platform 232 are connected to one embodiment of an extension spring arrangement for use in a bicycle seat mount system that re - directs the downward force loading on 232 to an upper portion of a bicycle seat tube as shown in fig2 a . [ 0028 ] fig2 a , generally indicated by the reference numeral 200 , is a side elevational view , partially in cross section , that illustrates a preferred embodiment of a bicycle shock - absorbing seat mount constructed according to the present invention . extension spring arrangement 700 includes a first vertical tube 710 having disposed therein an extension spring 712 . the upper end of extension spring 712 is attached to the lower end of a first rod 720 and the lower end of extension spring 712 is attached to the upper end of a second rod 722 . the lower end of second rod 722 and the upper end of a third rod 730 are threadedly attached to a turnbuckle 732 . the upper end of first rod 720 is attached to a collar 740 operatively fixedly disposed around an upper perimeter of bicycle seat tube 702 , while the lower end of third rod 730 is attached to a yoke 742 which , in turn , is attached to the ends of support platform 744 that protrude through the wall of bicycle seat tube 702 through diametrically opposite vertical slots 746 ( only one shown on fig2 a ) which may be provided with a flexible cover . a second vertical tube 750 telescoping inserted into the lower end of first vertical tube 710 permits access to turnbuckle 732 for the adjustment thereof and provides for an adjustable total length of extension spring arrangement 700 that is suitable for emplacement along bicycle seat tube 702 of any originally manufactured bicycle . upper and lower clamps 760 and 762 , respectively , may be provided for the attachment of extension spring arrangement 700 to bicycle seat tube 702 and / or the arrangement may be attached by weld 764 . platform 744 movably supports a bicycle seat post and any ancillary components including biasing means which may be similar to those described above in fig1 . in any case , extension spring arrangement 700 re - directs a downward force loading on longitudinally movable support platform 744 to an upper portion of the bicycle and provides mechanical shock absorption . upper and lower sliding means 770 and 772 , respectively , may be provided between bicycle seat tube 702 and first and third rods 720 and 730 and may consist of rollers , wheels , low friction blocks or the like . [ 0030 ] fig2 b is a frontal elevational view of the same components of extension spring 700 except weld 764 is not visible . [ 0031 ] fig3 illustrates a more simplified extension spring arrangement , generally indicated by the reference numeral 800 , as compared with extension spring arrangement 700 of fig2 a and 2b . extension spring arrangement 800 includes an extension spring 810 disposed in a vertical tube 812 . the upper end of extension spring 810 is attached to the lower end of an upper rod 820 , while the lower end of the extension spring is attached to the upper end of a lower rod 822 . the upper end of upper rod 820 is attached to a collar 826 disposed around an upper perimeter of bicycle seat tube 802 , while the lower end of lower rod 822 is attached to a yoke 830 which , in turn , is attached to the ends of support platform 832 that protrude through diametrically opposite openings in bicycle seat tube 802 . upper and lower sliding means 840 and 842 may be provided , respectively , between bicycle seat tube 802 and upper rod 820 and lower rod 822 . vertical tube 812 may be attached to bicycle seat tube 802 by means of a weld 850 . extension spring arrangement 800 is applicable in oem bike manufacture where the length of bicycle seat tube 802 is known and no adjustment of the total length of extension spring arrangement is required , as would be required for retrofitting in a variety of bicycle seat tube lengths . [ 0033 ] fig4 illustrates in more detail , the components of upper clamp 760 attaching first tube 710 to bicycle seat tube 702 while fig5 illustrates in more detail , the components of lower clamp 762 attaching second tube 750 to the bicycle seat tube . [ 0034 ] fig6 illustrates means to manually prevent downward motion of a bicycle seat post ( and an attched saddle ) 650 at a selected elevation when inserted in a bicycle seat tube 652 . a plurality of indents , as at 660 , is defined in the inner surface of vertical slot 662 . an annular collar 670 is disposed around bicycle seat post 650 , the collar having a threaded fastener 672 inserted therethrough and into a selected one of indents 660 , and the collar having dimensions such that it can rest on the top of bicycle seat tube 652 or any insert therein . thus arranged , the minimum height of bicycle seat post 650 can be selectively fixed and further cushiong action dis - engaged . [ 0035 ] fig7 illustrates another arrangement for restriction of downward motion of a bicycle seat post 750 in a bicycle seat tube 752 . a plurality of holes , as at 760 , is defined in the inner surface of vertical slot 762 . a peg 772 with length exceeding the outer diameter of a flanged perimeter of bicycle seat tube 752 , is selectively inserted through one of the holes diametrically across and on the surface of said tube perimeter . thus arranged , the minimum height of bicycle seat post 750 can be selectively fixed at which point of elevation , the means for shock - absorption described above are dis - engaged . [ 0036 ] fig8 is a side elevational view of a bicycle seat tube 900 with notch cut - out 910 in it &# 39 ; s upper perimeter for protrusion of a tab extending from the outer wall of a cylindrical , shape conforming insert ( depicted as 220 and 240 respectively on fig1 ) that prevents rotational motion of a seat post enclosed therein . diametrically opposite , longitudinal , oblong slots 920 in a lower portion of seat tube 900 allow extension therethrough of a longitudinally movable seat post support platform . [ 0037 ] fig9 depicts a common bicycle frame with seat tube 900 identified . in the embodiments of the present invention described above , it will be recognized that individual elements and / or features thereof are not necessarily limited to a particular embodiment but , where applicable , are interchangeable and can be used in any selected embodiment even though such may not be specifically shown . terms such as “ upper ”, “ lower ”, “ inner ”, “ outer ”, “ inwardly ”, “ outwardly ”, “ vertical ”, “ horizontal ”, and the like , when used herein , refer to the positions of the respective elements shown on the accompanying drawing figures and the present invention is not necessarily limited to such positions . it will thus be seen that the objective set forth above , among those elucidated in , or made apparent from , the preceding description , are efficiently attained and , since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matter contained in the above description or shown on the accompanying drawing figures shall be interpreted as illustrative only and not in a limited sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween . | 1 |
[ 0017 ] fig1 illustrates a frequency shift keying ( fsk ) signal that can be generated using a particular technique for cycle - by - cycle synchronous waveform shaping . this technique generates a fsk signal by sending a mixed square waveform through a low pass filter . within each predefined frame , the mixed square waveform is either a lower frequency square wave or a higher frequency square wave . thus , the filtered output represents a fsk signal . however , since the mixed square waveform contains both lower and higher frequency square waveforms , the single lowpass filter is not sufficient . this is because the harmonics of the lower frequency square waveforms are not removed . therefore , the harmonics of the lower frequency square waveforms interfere with the higher frequency components of the output signal . as can be seen in fig1 this approach generates a distorted fsk signal . more effective approaches to cycle - by - cycle synchronous waveform shaping are discussed below . [ 0018 ] fig2 is a high level functional block diagram of an illustrative embodiment 200 of a fsk cycle - by - cycle synchronous waveform shaping circuit in accordance with the present invention . the circuit 200 produces a fsk cycle - by - cycle synchronous waveform 290 having distinct data periods including data periods 292 , 294 , 296 , and 298 . four synchronous digital signals 201 , 202 , 203 , and 204 are provided as inputs to the circuit . the digital signals 201 and 202 each has a cycle of length t during which time the signal level transitions from a high level to a low level , or vice versa . similarly , the digital signals 203 and 204 each has a cycle of length t / 2 in which time the signal level transitions from a high level to a low level , or vice versa . typically , the digital signals 201 , 202 , 203 , and 204 can be generated by any of a number of conventional techniques such as digital logic , a processor , or the others implementations . the digital signal 201 is passed through a digital block unit 211 and a low pass filter 221 , to produce a filtered signal 231 . the digital signal 202 is passed through a digital block unit 212 and a low pass filter 222 , to produce a filtered signal 232 . the digital signal 203 is passed through a digital block unit 213 and a low pass filter 223 , to produce a filtered signal 233 . finally , the digital signal 204 is passed through a digital block unit 214 and a low pass filter 224 , to produce a filtered signal 234 . the digital block units 211 , 212 , 213 , and 214 each removes the dc component from each of the digital signals 201 , 202 , 203 , and 204 , respectively . the filtered signals 231 and 232 combine at a combiner 242 to form a first combined signal 252 . the filtered signals 233 and 234 combine at a combiner 244 to form a second combined signal 254 . the first combined signal 252 might include regions in the signal a “ null ”. consider for example , the region “ a ” of the input signals 201 , 202 . the figure shows that at the region “ a ”, there is a 180 ° phase difference between the digital signals 201 and 202 . consequently , the filtered signals 231 and 232 , which correspond to the digital signals 201 and 202 , significantly cancel each other in the region “ a ” when they are combined at the combiner 242 . thus , the first combined signal 252 has an a null signal at a region that corresponds to the region “ a ”. on the other hand , in the same region of the combined signal 254 that corresponds to region “ a ”, the signal is amplified . that is , in region “ a ”, there is a 0 ° phase difference between the digital signals 203 and 204 . thus , the filtered signals 233 and 234 , which correspond to the digital signals 203 and 204 , significantly add to each other in the region “ a ” when they are combined at the combiner 244 . similarly , the second combined signal 254 is effectively a null signal in certain other regions . for example , in an illustrative region 37 b ,” there is ideally a 180 degree phase difference between the digital signals 203 and 204 . consequently , the filtered signals 233 and 234 , which correspond to the digital signals 203 and 204 , significantly cancel each other in the region “ b ” when they are combined at the combiner 244 . thus , the second combined signal 254 is effectively a null signal within the region “ b .” on the other hand , in the same region , the combined signal 252 is an amplified signal . that is , in region “ b ,” there is ideally a 0 degree phase difference between the digital signals 201 and 202 . thus , the filtered signals 231 and 232 , which correspond to the digital signals 201 and 202 , significantly add to each other in the region “ b ” when they are combined at the combiner 242 . the first and second combined signal 252 and 254 are combined to each other at a combiner 260 to form the fsk cycle - by - cycle synchronous waveform 290 suitable for transmission . the waveform 290 has distinct data periods including data periods 292 , 294 , 296 , and 298 . note that data periods 292 , 294 , and 298 correspond to regions in which the first combined signal 252 contributes a signal having a cycle of length t , and the second combined signal 254 contributes an effectively null signal . also note that data period 296 corresponds to a region in which the second combined signal 254 contributes a signal having two cycles of length t / 2 each , and the first combined signal 252 contributes an effectively null signal . it can be appreciated from fig2 that the principle of superposition provides an alternate configuration whereby the digital signals 201 - 204 are combined to produce an intermediate digital signal , prior to performing the filtering . the intermediate digital signal can then be dc blocked to remove a dc component if necessary , and then low pass filtered using a single appropriately designed low pass filter . [ 0024 ] fig3 is a block diagram 300 of an implementation of the fsk cycle - by - cycle synchronous waveform shaping circuit 200 . this implementation produces one cycle of a signal with frequency f 0 ( one cycle having a 1 / f 0 period ) to represent a bit “ 1 ” and two cycles of a signal with frequency f 1 ( two cycles each having 1 / f 1 , period ) to represent a bit “ 0 .” here , f 1 , is a frequency that is twice f 0 . a delayed lock loop ( dll ) circuit 302 receives a raw data signal 304 and an asynchronous clock signal 306 and performs the function of locking to the timing of the incoming raw data signal 304 . the dll circuit 302 outputs a sync clk signal 308 , a sync data signal 310 , and a 2 × sync clk signal 312 . the sync clk signal 308 has a frequency equivalent to the data rate of the sync data signal 310 . the 2 × sync clk signal 312 has a frequency twice the data rate of the sync data signal 310 . both clock signals 308 and 312 are synchronous with the sync data signal 310 . the sync clk signal 308 , sync data signal 310 , and 2 × sync clk signal 312 are input to a combinational logic circuit 314 , which produces a low dout signal 321 , a low clk signal 322 , a high dout signal 323 , and a high clk signal 324 . the low dout signal 321 passes through a coupling capacitor 331 and a low pass filter 341 to form a filtered signal 351 . the low clk signal 322 passes through a coupling capacitor 332 and a low pass filter 342 to form a filtered signal 352 . the high dout signal 323 passes through a delay block 326 , a coupling capacitor 333 , and a low pass filter 343 to form a filtered signal 353 . the high clk signal 324 passes through a delay block 328 , a coupling capacitor 334 , and a low pass filter 344 to form a filtered signal 354 . note that the low dout signal 321 and the low clk signal 322 together represent cycles of the lower frequency f 0 signal used to indicate the bit “ 1 ” s . however , in this implementation , the low dout signal 321 alone carries the information relating to the location of the bit “ 1 ” s . the low clk signal 322 is merely a clock signal synchronous with the low dout signal 321 . nevertheless , the low clk signal 322 is used in combination with the low dout signal 321 to ensure that the time span of a non - zero value on either digital signal 321 or 322 will be at most 2t l , where t l is the time span between two possible transitions on either signal 321 or 322 . similarly , the high dout signal 323 and the high clk signal 324 together represent cycles of the higher frequency f 1 signal used to indicate the bit “ 0 ” s . the high dout signal 323 alone carries the information relating to the location of the bit “ 0 ” s . the high clk signal 324 is merely a clock signal synchronous with the high dout signal 323 . the two signals used in combination ensure that the time span of a non - zero value on either digital signal 323 or 324 will be at most 2t h , where t h is the time span between two possible transitions on either signal 323 or 324 . also note that the low pass filters 341 and 342 together form a low pass filter group 1 in which each filter has a cut - off frequency corresponding to the pulse frequency ½t l of the digital signals ( low dout signal 321 and low clk signal 322 ) they serve . the low pass filters 343 and 344 together form a low pass filter group 2 in which each filter has a cut - off frequency corresponding to the pulse frequency ½t h of the digital signals ( high dout signal 323 and high clk signal 324 ) they serve . the low pass filters 321 , 322 , 323 , and 324 thus appropriately reduce the harmonics in the various signals being filtered . the low pass filters 321 , 322 , 323 , and 324 can be implemented as analog infinite response impulse response filters . any kind of appropriate conventionally known filter can be used , including butterworth filters , bessel filters , and so on . in a particular embodiment of the invention , for example , the low pass filters are implemented as gaussian filters , which are known to contribute less distortion in neighboring pulses of the signals being filtered . delay blocks 326 and 328 are used to add delay to the high dout signal 323 and high clk signal 324 in order to compensate for the difference between the delay associated with low pass filter group 1 and the delay associated with low pass filter group 2 . the delay blocks 326 and 328 can be implemented as adjustable digital delays , a long transmission path or wire , or others . referring again to fig3 the filtered signals 351 and 352 are differentially combined at a differential combiner 360 to produce a first differentially combined signal 364 . within each region representing a data period associated with a bit “ 0 ,” the filtered signals 351 and 352 significantly cancel each other at the differential combiner 360 , and the first differentially combined signal 364 is effectively a null signal within the region . similarly , the filtered signals 353 and 354 are differentially combined at a differential combiner 362 to produce a second differentially combined signal 368 . within each region representing a data period associated with a bit “ 1 ,” the filtered signals 353 and 354 significantly cancel each other at the differential combiner 362 , and the second differentially combined signal 368 is effectively a null signal within that region . the first and second differentially combined signals 364 and 368 are differentially combined to each other at a differential combiner 370 to produce the desired fsk cycle - by - cycle synchronous waveform 290 that is suitable for transmission . note that differential combiners 360 , 362 , and 370 are used because the various signals are transmitted in a differential mode , which allows improvements in noise rejection and formation of sinusoidal waveforms . differential signaling in this embodiment is achieved by using the combinatorial logic circuits 314 to appropriately control the polarity of the low dout signal 321 , the low clk signal 322 , the high dout signal 323 , and the high clk signal 324 . it should be noted that while fig3 illustrates the production of an fsk cycle - by - cycle synchronous waveform , a similar implementation can be used to generate a binary phase shift keying ( bpsk ) or another type of phase shift keying ( psk ) cycle - by - cycle synchronous waveform by generating digital signals of different phases and filtering and / or combining such digital signals . [ 0034 ] fig4 a , 4b , 5 a , and 5 b are time domain plots representing the various filtered signals to be differentially combined in order to produce the desired fsk cycle - by - cycle synchronous waveform 290 . fig4 a and 4b represent the filtered signals 351 and 352 , respectively . note that these two signals are characterized by the time span t l . fig5 a and 5b represent the filtered signals 353 and 354 , respectively . note that these two signals are characterized by the time span t h . fig6 is a time domain plot representing the desired fsk cycle - by - cycle synchronous waveform 290 produced by the circuit shown in fig3 . [ 0035 ] fig7 a is a functional diagram of the convolution process used in a second embodiment 800 ( fig8 ) of the cycle - by - cycle synchronous waveform shaping circuit in accordance with the present invention . a data pulse 702 and a delayed data pulse 704 are differentially combined at a differential combiner 706 to produce an impulse pair 710 having a positive impulse 712 and a negative impulse 714 . the delayed data pulse 704 is delayed in time by a precise amount relative to the data pulse 702 but otherwise resembles the data pulse 702 . the data pulse 702 and delayed data pulse 704 can be generated by digital logic , a processor , or the others implementations . the data pulse 702 and the delayed data pulse 704 overlap in a period of length t / 2 − ts . when differentially combined , the data pulse 702 and the delayed data pulse 704 cancel each other in this overlapping period , and non - overlapping portions of the pulses 702 and 704 form a positive impulse 712 and a negative impulses 714 of an impulse pair 710 . the impulse pair 710 is convolved with a gaussian filter 720 in the time domain to produce a sinusoidal pulse 730 having a positive half cycle 732 and a negative half cycle 734 . the positive impulse 712 of the impulse pair 710 produces the positive half cycle 732 , which resembles the impulse response of the gaussian filter 720 . the negative impulse 714 of the impulse pair 710 produces the negative half cycle 734 , which resembles the negative of the impulse response of the gaussian filter 720 . the gaussian filter 720 has a compact impulse response and a less oscillatory nature compared to other filter designs . the gaussian filter 720 can also be realized in the form of a lc circuit . however , other types of filters such as butterworth filters and bessel filters may also be used . [ 0038 ] fig7 b and 7c illustrate examples of how the convolution process shown in fig7 a can be used to generate a frequency shift keying ( fsk ) or a binary phase shift keying ( bpsk ) signal , respectively . the convolution process shown in fig7 a is highly controllable and precise in generating a sinusoidal pulse at a specified time . by generating and superpositioning appropriate sinusoidal pulses at particular positions in time , appropriate data modulated signals such as fsk and bpsk signals can be produced . fig7 b illustrates that a portion of an fsk signal can be produced by concatenating a sinusoidal impulse having a length of 2 t with two sinusoidal impulses each having a length of t . fig7 c illustrates that a portion of a bpsk signal can be produced by concatenating a sinusoidal impulse having a length of t with another sinusoidal impulse having a length of t but being inverse in amplitude . [ 0039 ] fig8 is a block diagram of the second embodiment 800 of the cycle - by - cycle synchronous waveform shaping circuit producing a bpsk signal in accordance with the present invention . here , two distinct sinusoidal pulses 802 and 804 are generated at particular positions in time and differentially combined to form one portion of a desired bpsk cycle - by - cycle synchronous waveform 806 . although only the sinusoidal pulses 802 and 804 are shown in fig8 it should be understood that other sinusoidal pulses preceding , following , or even overlapping with sinusoidal pulses 802 and 804 are also differentially combined to form other portions of the bpsk cycle - by - cycle synchronous waveform 806 . referring to fig8 a digital signal 810 containing data pulses of length t is generated and provided to the circuit 800 . an and function block 811 receives the digital signal 810 and a clock signal 812 , which has pulses of length t / 2 and is synchronous with the digital signal 810 . the and function block 811 outputs a half - cycle signal 813 . in this manner , each data pulse in digital signal 810 representing a bit ‘ 1 ’ ( or bit ‘ high ’) is extracted and reduced to half duty cycle , producing the half - cycle signal 813 . a delay block 814 receives the half - cycle signal 813 , introduces a delay of t s , and produces a delayed half - cycle signal 815 . the half - cycle signal 813 and the delayed half - cycle signal 815 are differentially combined at a differential combiner 816 to produce an impulse pair signal 818 . the digital signal 810 is inverted at an inverter 819 , producing an inverted digital signal 820 . an and function block 821 receives the inverted digital signal 820 and the clock signal 812 , which has pulses of length t / 2 and is synchronous with the inverted digital signal 820 . the and function block 811 outputs a half - cycle signal 823 . in this manner , each data pulse in digital signal 810 representing a bit ‘ 0 ’ ( or bit ‘ low ’) is extracted and reduced to half duty cycle , producing the half - cycle signal 823 . a delay block 824 receives the half - cycle signal 823 , introduces a delay of t s , and produces a delayed half - cycle signal 825 . the half - cycle signal 823 and the delayed half - cycle signal 825 are differentially combined at a differential combiner 826 to produce an impulse pair signal 828 . an impulse regenerating circuit 830 receives the impulse pair signal 818 and produces a regenerated impulse pair signal 832 . similarly , an impulse regenerating circuit 840 receives the impulse pair signal 828 and produces a regenerated impulse pair signal 842 . under certain conditions , the impulse pair signals 818 and 828 may not have proper signal level and / or form to be adequate impulse signals . for example , a low slew rate associated with the digital signals 813 , 815 , 823 , and 825 caused by digital data buffers supplying these signals may result in a “ smearing ” of the positive pulses and negative pulses of the impulse pair signals 818 and 828 . these positive and negative pulses could thus lack proper signal level and / or form . the impulse regenerating circuits 830 and 840 corrects such problems by adjusting the signal levels and / or other characteristics of the regenerated impulse pair signals 832 and 842 such that they provide adequate impulse signals . a differential combiner 854 receives the regenerated impulse pair signals 832 and 842 and produces a combined regenerated impulse pair signal 852 . a gaussian filter 854 of length t / 2 − t s receives the combined regenerated impulse pair signal 852 and produces the bpsk cycle - by - cycle synchronous waveform 806 . alternatively , the regenerated impulse pair signal 832 and the regenerated impulse pair signal 842 can be separately filtered and then differentially combined . in such case , two gaussian filter are needed . fig9 is a time domain plot representing the desired bpsk cycle - by - cycle synchronous waveform produced by the implementation shown in fig8 . it should be noted that while fig8 illustrates the production of a bpsk cycle - by - cycle synchronous waveform , a similar implementation can be used to generate an fsk cycle - by - cycle synchronous waveform by generating impulse pairs corresponding to different frequencies and filtering and / or combining such impulse pairs . although the present invention has been described in terms of specific embodiments , it should be apparent to those skilled in the art that the scope of the present invention is not limited to the described specific embodiments . the specification and drawings are , accordingly , to be regarded in an illustrative rather than a restrictive sense . it will , however , be evident that additions , subtractions , substitutions , and other modifications may be made without departing from the broader spirit and scope of the invention as set forth in the claims . | 7 |
in fig1 is shown an embodiment of a device for the torque limitation in a machine for processing means of payment on transmitting a torque . in the shown embodiment a torque of a drive or a motor 16 is transmitted with the help of a shaft 10 , 20 consisting of two parts to a toothed wheel 21 which e . g . with the help of a toothed belt drives parts of the machine for processing means of payment . for example , as shown in fig4 , the device for torque limitation may used in a machine 100 for processing means of payment in combination with a singler 101 or a mechanism 201 disposed in a cassette 200 for receiving means of payment , e . g . for receiving bank notes bn in a singler 101 , and transporting the bank notes on path 202 and stacking the bank notes bn in the cassette 200 . between the two shaft parts 10 , 20 there are disposed two elements 12 , 22 for limiting the transmitted torque , which form a safety coupling . the two elements 12 , 22 can be formed in a disk - shaped fashion . each of the two elements 12 , 22 is firmly connected with one end of the two shaft parts 10 , 20 . for monitoring a rotational speed that has to be observed when operating the shaft 10 , 20 , a clocking disk 11 can be provided , which is firmly connected with the shaft . with the help of a not shown forked light barrier , which is disposed in the rotating area of the clocking disk 11 the rotational speed of the shaft can be determined by evaluating the output signal of the forked light barrier . fig2 and 3 show the shaft 10 , 20 consisting of two parts in a separated state . here the surfaces of the element 12 , 22 forming the safety coupling , that adjoin each other when transmitting a torque , become visible . the first element 12 mounted at the first shaft part 10 has magnets 13 . additionally , the first element 12 can have depressions 14 , which can be formed e . g . cylindrical . moreover , the first shaft part 10 can have a tapered extension 15 , which protrudes beyond the surface of the first element 12 . the second element 22 mounted at the second shaft part 20 has magnets 23 . additionally , the second element 22 can have elevations 24 , which can be formed e . g . as spheres . moreover , the second shaft part 20 can have a bush - shaped bore 25 . when first and second shaft part 10 , 20 , as shown in fig1 , are brought together , the extension 15 of the first shaft part 10 moves into engagement with the bush 25 of the second shaft part 20 . the magnets 13 of the first element 12 and the magnets 23 of the second element 22 attract each other and connect the first element 12 and the second element 22 with each other in a non - positive fashion , so that their surfaces adjoin each other . it is obvious , that the pole direction of the magnets 13 and 23 must be chosen such that the magnets 13 of the first element 12 and the magnets 23 of the second element 22 attract each other . for example , the magnets 13 of the first element 12 are inserted such that they have a north pole at the surface of the first element 12 , whereas the magnets 23 of the second element 22 are inserted such that they have a south pole at the surface of the second element 22 . in the shown example with four magnets per element , then first and second element are connected with each other after a quarter turn at the latest . but it is also possible , that in both elements for example a north pole follows a south pole . in the shown example with four magnets per element , then first and second element are connected with each other after a half turn at the latest . by choosing number , type and size of the magnets 13 , 23 and the size , i . e . the diameter , of the elements 12 , 22 of the device for the torque limitation , or the distance between the magnets 13 , 23 and the axial center of the shaft 10 , 20 , there can be determined the maximum transmittable torque . if , for example , a diameter of 20 millimeters is chosen for the elements 12 , 22 and if four permanent magnets of the refeb type with a degree of magnetization n52 and 5 millimeters diameter at a length of 6 millimeters are chosen and disposed concentric to the axis of the shaft 10 , 20 , a maximum torque of 0 . 18 nm can be transmitted . when bringing together the first and second element 12 , 22 , moreover , the possibly additionally provided elevations 24 of the second element 22 , which e . g . are formed as spheres , move into engagement with the possibly additionally provided , for example , cylindrical depressions 14 of the first element 12 . in this way first and second element 12 , 22 can be positively connected , when viewed in the direction of rotation . with that the torque transmittable by the device for the torque limitation can be increased . the effect of the elevations 24 and depressions 14 , which increases the maximum transmittable torque , substantially depends on their dimensions , in particular on the height and depth of the elevations 24 and depressions 14 , respectively , and their form . instead of providing the elevations and depressions each on one of the elements , elevations and depressions can be alternately provided on the two elements . when the torque transmitted by the shaft 10 , 20 exceeds the maximum permissible value , e . g . because the singler for bank notes is blocked by foreign objects , the retention forces of the magnets 13 , 23 are exceeded and the device for the torque limitation effects a disruption of the shaft 10 , 20 between first and second element 12 , 22 . when , optionally , the above - described depressions 14 and elevations 24 are provided , the transmittable torque is increased respectively , so that for achieving the desired torque lower magnetic forces are sufficient . when the cause , that effects the exceeding of the maximum torque , is eliminated , first and second shaft part 10 , 20 are re - connected with each other with the help of first and second element 12 , 22 as described above , so that a torque can be transmitted until the maximum permissible torque . here the elements 12 , 22 and thus the shaft parts 10 , 20 are put together again and held together by the magnetic forces of the magnets 13 , 23 used . in particular when the described depressions 14 and elevations 24 in the surfaces of the elements 12 , 22 are used , it can be provided , that one of the elements 12 , 22 is mounted movable in axial direction on the respective shaft part 10 , 20 . this permits that in the case the maximum transmittable torque is exceeded the movably mounted element 12 , 22 can evade . the permissible axial movability here can approximately correspond to the height of the elevations 24 . in the described embodiment first and second element 12 , 22 of the device for the torque limitation each have four magnets 13 , 23 . it is obvious , that more or less than four magnets per element 12 , 22 can be used . here it is required , that the magnets 13 of the first element 12 and the magnets 23 of the second element 22 have an angular distribution of the same kind . the same applies for the optionally provided four elevations 24 or depressions 14 per element 22 or 12 . as shown , elements 12 , 22 are formed in a disk - shaped fashion , but it is obvious , that the elements 12 , 22 can also have a different form , in order to in particular accommodate the magnets 13 , 23 . from the figures and the description of the action principle of the device for the torque limitation it obviously appears , that the device for the torque limitation is suitable to effect a torque limitation in both directions of rotation . likewise , from the figures and their description results that the two shaft parts 10 , 20 are separable . for example , the second shaft part 20 can be component part of a cassette , the first shaft part 10 can be disposed in the machine for processing means of payment . thus the cassette and with that the second shaft part 20 can be easily flanged to the machine for processing means of payment and thus to the first shaft part 10 , to permit the driving of the elements located in the cassette . | 8 |
with reference to the accompanying drawings , hereinafter will be described an embodiment of the present invention , in which an apparatus for estimating the gradient of a road surface ( roadbed or roadway ) is applied to a vehicle control system for controlling acceleration of vehicles . fig1 illustrates a general configuration of the vehicle - control system including the road surface gradient estimating apparatus , which are according to the embodiment . an engine 10 , a gasoline powered internal combustion engine , includes a crank shaft 12 to which an automatic transmission system 14 is connected . the automatic transmission system 14 is provided with a torque converter and a planetary gear automatic transmission . in the planetary gear automatic transmission , any of a plurality of power transmission paths formed by planetary gears pg is selected , depending on the engagement conditions of a clutch c and a brake ( not shown ) as friction elements . the planetary gear automatic transmission is adapted to realize a gear ratio according to the selected power transmission path . the torque of the crank shaft 12 of the engine 10 is changed by the automatic transmission system 14 and then transmitted to drive wheels 16 . the drive wheels 16 and idler wheels 18 can be imparted with braking force by a hydraulic brake actuator 20 . in addition to an electrical pump po , the brake actuator 20 is provided with a retention valve vk and a decompression valve vr , for each of the wheels ( the drive wheels 16 and the idler wheels 18 ). the retention valve vk retains the pressure of the hydraulic oil supplied to a wheel cylinder 24 , and the decompression valve vr reduces the pressure of the hydraulic oil in the wheel cylinder 24 . the brake actuator 20 is also provided with a linear relief valve vf for causing pressure difference between the side of a master cylinder , not shown , and the side of the wheel cylinder 24 . the discharge side of the pump po is connected to the suction side of the pump po via the retention valve vk and the decompression valve vr . the hydraulic oil is flowed in / out between the connected portion of the retention valve vk and the decompression valve vr , and the wheel cylinder 24 . the operation of the linear relief valve vf , the retention valve vk and the decompression valve vr can realize automatic brake control which is performed independent of the user &# 39 ; s brake operation which realizes anti - brake lock braking control ( abs ), traction control and skid prevention control , for example . specifically , in retaining braking force , the pressure of the hydraulic oil in the wheel cylinder 24 is retained by closing both of the retention valve vk and the decompression valve vr . in decreasing braking force , the pressure in the wheel cylinder 24 is lowered by closing the retention valve vk and opening the decompression valve vr . in increasing braking force , the pressure of the hydraulic oil supplied to the wheel cylinder 24 is raised by opening the linear relief valve vf and the retention valve vk and closing the decompression valve vr . in this case , the pressure in the wheel cylinder 24 is controlled by controlling the current supply for the linear relief valve vf . specifically , the linear relief valve vf is adapted to cause pressure difference between the side of the master cylinder and the side of the wheel cylinder 24 , as mentioned above , in proportion to the amount of current supply . accordingly , the pressure difference can be adjusted according to the amount of current supply , which is eventually led to the pressure control in the wheel cylinder 24 . in particular , in the case where the user &# 39 ; s brake operation for realizing skid prevention control , for example , is not performed , the pump po is actuated to produce a pressure to be applied into the wheel cylinder 24 , while at the same time , the pressure is adjusted according to the amount of current supply to the linear relief valve vf . in this regard , hysteresis may be caused to the pressure difference between the side of the master cylinder and the side of the wheel cylinder 24 , accompanying the increase and decrease in the amount of current supply mentioned above . in order to reduce the hysteresis , the operation of current supply to the linear relief valve vf is so carried out based on time - ratio control for adjusting time ratio between logic “ h ” and logic “ l ” of applied voltage ( the ratio of logic “ h ” to the time periods of logic “ h ” and logic “ l ”: duty ). the frequency ( dither frequency ) of the time - ratio control ranges from about “ 1 khz ” to “ several khz &# 39 ; s ”, for example . each of the drive wheels 16 and the idler wheels 18 is provided with a wheel - speed sensor 26 for detecting the rotational speed of the wheel . a control apparatus 30 controls the travel conditions of the vehicle . specifically , the control apparatus 30 retrieves detection values of various sensors for detecting the operating conditions of the engine 10 and the automatic transmission system 14 , as well as the output signals of the wheel - speed sensors 26 , a user interface 32 and an acceleration sensor 34 to control traveling of the vehicle based on these values and signals . the user interface 32 includes an automatic travel switch through which the user can request automatic travel of the vehicle , and an accelerator operating member through which the user can request torque increase to the engine 10 . the accelerator sensor 34 is adapted to detect acceleration based on the force applied to the sensor per se . the acceleration to be detected is acceleration caused in the longitudinal direction ( i . e ., the front - rear direction or the anteroposterior direction ) of the vehicle . a pendulum type or strain - gauge type sensor , for example , can serve as the accelerator sensor 34 . when a request for automatic travel is inputted by the user through the user interface 32 , the control apparatus 30 controls the actual speed ( actual acceleration ) of the vehicle to a target value ( target acceleration ). the details are provided below . fig2 shows the processes associated , in particular , with the automatic travel control , among the processes performed by the control apparatus 30 . fig2 exemplifies such automatic travel applications as a cruise controller m 2 , a vehicle distance ( intervehicle ) controller m 4 and a so precrash controller m 6 . the cruise controller m 2 controls the travel speed of the vehicle to be kept at a certain level . the vehicle distance controller m 4 controls the distance between the vehicle and a preceding vehicle to a predetermined distance . the precrash controller m 6 controls the shock of possible collision with the preceding vehicle to be mitigated . the cruise controller m 2 , the vehicle distance controller m 4 and the precrash controller m 6 all output a requested value of acceleration ( requested acceleration ) and a requested limit value of jerk that will be described later . an arbitrator m 8 outputs a finally requested jerk limit value “ jreq ” and a requested acceleration ( application - based acceleration “ ara ”) based on the outputs from the cruise controller m 2 , the vehicle distance controller m 4 and the precrash controller m 6 , which are provided as various applications for the control apparatus . a vehicle longitudinal controller ( vlc ) m 10 outputs : a requested power - train torque “ twpt ” which is a torque requested for the power train comprising the engine 10 and the automatic transmission system 14 ; and a requested brake torque “ twbk ” which is a torque requested for the brake actuator 20 . a control cycle “ td ” of the vehicle longitudinal controller m 10 is different from a control cycle “ ta ” of the cruise controller m 2 , a control cycle “ tb ” of the vehicle distance controller m 4 and a control cycle “ tc ” of the precrash controller m 6 . specifically , the cycle “ td ” of the vehicle longitudinal controller m 10 is set shorter than the cycle “ ta ” of the cruise controller m 2 , the cycle “ tb ” of the vehicle distance controller m 4 and the cycle “ tc ” of the precrash controller m 6 . this is because the applications are adapted to calculate requested acceleration based on various detection values obtained from detecting means , such as one which detects a preceding vehicle by radar , and thus because the detection cycles of these detecting means tend to be longer than the detection cycles of actual vehicle speed and actual acceleration . a power train controller m 12 outputs a requested value of torque so for the engine 10 ( requested engine torque “ te ”), and a requested value of gear ratio for the automatic transmission system 14 ( requested gear ratio “ gr ”), in response to the requested power train torque “ twpt ”. a brake controller m 14 outputs a requested value of hydraulic oil pressure for the brake actuator 20 ( requested brake pressure “ pmc ”), in response to the requested brake torque “ twbk ”. it should be appreciated that the requested brake pressure “ pmc ” is a manipulated variable of the brake actuator 20 which adjusts , through the hydraulic oil pressure , the braking force in each of the drive wheels 16 and the idler wheels 18 . fig3 shows in detail the processes performed by the vehicle longitudinal controller m 10 . the front - rear direction controller m 10 is configured to output the application acceleration “ ara ” outputted from the arbitrator m 8 to the jerk limiter 812 , as a requested acceleration “ ar ”. the jerk limiter b 12 is configured to perform a process for limiting the amount of change in the requested acceleration value within one control cycle of the front - rear direction controller m 10 , to the requested jerk limit value “ jreq ” or less . fig4 shows a series of processes performed by the jerk limiter b 12 . first , at step s 10 , the jerk limiter b 12 obtains the requested acceleration “ ar ”, the requested jerk limit value “ jreq ” and a jerk acceleration “ aj ” that is the present output of the jerk limiter b 12 . at the subsequent step s 12 , the jerk acceleration “ aj ” is set as a previous value “ aj0 ”. at steps s 14 and s 16 , the change in the requested acceleration “ ar ” is limited so that the difference from the previous value “ aj0 ” will be equal to or less than the jerk limit value “ jreq ”. that is , at step s 16 , a value “ aj1 ” is calculated , which value corresponds to a value obtained by multiplying the jerk limit value “ jreq ” with the control cycle “ td ” and adding the resultant value to the previous value “ aj0 ”, or corresponds to the requested acceleration “ ar ”, whichever is smaller . at the subsequent step s 16 , a value “ aj2 ” is calculated , which value corresponds to a value obtained by multiplying the jerk limit value “ jreq ” with the control cycle “ td ” and subtracting resultant value from the previous value “ aj0 ,” or corresponds to the smaller value “ aj1 ” mentioned above , whichever is larger . at step s 18 , the larger value “ aj2 ” is set as the jerk acceleration “ aj ”. thus , in one control cycle of the applications , the jerk acceleration “ aj ” is shifted stepwise to the requested acceleration “ ar ” at every control cycle “ td ” of the vehicle longitudinal controller m 10 , with the jerk limit value “ jreq ” as being the maximum amount of change . in the vehicle longitudinal controller m 10 , the vehicle acceleration is controlled to the jerk acceleration “ aj ” by two - degree freedom control . in particular , the actual acceleration is feedback - controlled to the jerk acceleration “ aj ”, and at the same time , the actual acceleration is feedforward controlled to the jerk acceleration “ aj ”. an explanation will be given first on the feedback control . a reference model setter 8514 shown in fig3 outputs a reference acceleration “ am1 ” by converting the jerk acceleration “ aj ” in terms of a reference model . the reference model is to determine a behavior of the target acceleration in a transient travel time period of the vehicle , during which the jerk acceleration “ aj ” changes . the process performed by the reference model setter b 14 is shown in fig5 a as step s 20 . specifically , the reference model is a primary delay model , and thus the jerk acceleration “ aj ” is converted in terms of the primary delay model . as shown in fig5 b , the primary delay model is set based on the response characteristics at the time when the response delay of the actual acceleration ( solid lines ) is maximized , in a step change of the target acceleration ( dash - dot line ). more specifically , the response characteristics are supposed to change according to the operating conditions of the vehicle , such as the rotational speed of the engine 10 . thus , in the changing operating conditions , the characteristics at the time when the response delay is maximized are used as the base for the primary delay model . a differential operator b 16 shown in fig3 performs an operation by differentiating an actual vehicle speed “ v ” with respect to time . the actual vehicle speed “ v ” is based on the detection value derived from the wheel - speed sensor 26 provided at each of the drive wheels 16 and the idler wheels 18 . in particular , the actual vehicle speed “ v ” may , for example , be an average of the detection values of the four wheel - speed sensors 26 , or a maximum value of the detection values . a difference calculator b 22 is configured to calculate the difference ( difference “ err ”) between an actual acceleration “ a ” outputted from the differential operator b 16 and the reference acceleration “ am ” outputted from the reference model setter b 14 . a feedback controller b 24 is an element that feedback - controls the actual acceleration “ a ” to the reference acceleration “ am ”. specifically , the feedback controller b 24 of the present embodiment is configured to perform proportional - integral - differential ( pid ) control . fig6 illustrates a series of procedure performed by the feedback controller 24 . first , at step s 30 , an integral value “ ierr ” and a differential value “ derr ” are calculated based on the difference “ err ”. particularly , the current integral value “ ierr ” is calculated by multiplying the current difference “ err ” with the control cycle “ td ” and adding the resultant to a previous integral value “ ierr0 ”. also , the differential value “ derr ” is calculated by subtracting a previous difference “ err0 ” from the current difference “ err ” and dividing the resultant by the control cycle “ td ”. at the subsequent step s 32 , a feedback manipulated variable “ tfb ” is calculated . particularly , the feedback manipulated variable “ tfb ” is calculated by summing up : a value obtained by multiplying the difference “ err ” with a proportional gain “ kp ”; a value obtained by multiplying the integral value “ ierr ” with an integral gain “ ki ”; and a value obtained by multiplying the differential value “ derr ” with a differential gain “ kd ”. the proportional gain “ kp ”, the integral gain “ ki ” and the differential gain “ kd ” are for converting the integral value “ ierr ” so and the differential value “ derr ” into the requested torque . in other words , the feedback manipulated variable “ tfb ” represents a torque requested for rendering the actual acceleration “ a ” to be the reference acceleration “ am ”. when the process pf step s 32 is completed , the difference “ err ” is stored , at step s 34 , as the previous difference “ err0 ” and the integral value “ ierr ” is stored as the previous integral value “ ierr0 ”. hereinafter is explained the feedforward control in the two - degree freedom control mentioned above . a feedforward controller b 26 shown in fig3 performs the feedforward control to achieve the jerk acceleration “ aj ”. fig7 shows a series of processes performed by the feedforward controller b 26 . first , at step s 40 , a force “ fx ” is calculated , which should be added to the travel direction of the vehicle to achieve the jerk acceleration “ aj ”. at this step , the force “ fx ” is calculated as a sum of air resistance , road surface resistance , gravity and reference force . the reference force can be obtained by multiplying the jerk acceleration “ aj ” with a vehicle weight “ m ”. the reference force is necessary for having the vehicle traveled at the jerk acceleration “ aj ” in the state where no resistance is added in traveling the vehicle . the air resistance is a force of air , which is added in the direction reverse of the travel direction of the vehicle . in the present embodiment , the air resistance is calculated by multiplying the square of the actual vehicle speed “ vr ” with an air density “ ρ ”, a coefficient “ cd ” and a projection area “ s ” of the vehicle front , followed by multiplication with “ ½ ”. the road surface resistance is a resistance caused by the friction between the road surface and the drive wheels 16 and the idler wheels 18 , and is calculated by the multiplication of a friction coefficient “ μ ”, the vehicle weight “ m ” and a gravity acceleration “ g ”. the term “ gravity ” refers to a gravity which is , applied to the travel direction of the vehicle when the road surface is inclined . this “ gravity ” can be expressed by “ mg sin θ ” using a road so surface gradient “ θ ”. it should be appreciated that the road surface gradient “ θ ” is calculated based on the actual vehicle speed “ v ” and the detection value of the acceleration sensor 34 mentioned above . at the subsequent step s 42 , a feedforward manipulated variable “ tff ” is calculated by multiplying the force “ fx ” with a radius “ r ” of the drive wheel 16 . the feedforward manipulated variable “ tff ” is the torque requested for having the vehicle traveled at the jerk acceleration “ aj ”. an axle torque calculator b 28 shown in fig3 calculates a requested axle torque “ tw ” by adding the feedback manipulated variable “ tfb ” to the feedforward manipulated variable “ tff ”. a distributor b 30 divides ( distributes ) the requested axle torque “ tw ” into the requested power train torque “ twpt ” and the requested brake torque “ twbk ”. fig8 shows a series of processes performed by the distributor 530 . first , at step s 50 , it is determined whether or not the requested axle torque “ tw ” is equal to or more than a minimal torque “ tptmin ”. this process determines whether or not the requested axle torque “ tw ” can be produced only by the power train . in this regard , the minimal torque “ tptmin ” here is the minimal torque that is available by the engine 10 and the automatic transmission system 14 . if the requested axle torque “ tw ” is equal to or more than the minimal torque “ tptmin ”, the requested axle torque “ tw ” is determined as can be realized only by the power train , and control proceeds to step s 52 . at step s 52 , the requested power train torque “ twpt ” is set as the requested axle torque “ tw ”, while the requested brake torque “ twbk ” is set to zero . on the other hand , if a negative determination is made at step s 50 , the requested axle torque “ tw ” is determined as cannot be produced only by the power train , and control proceeds to step s 54 . at step s 54 , the requested power train torque “ twpt ” is set as the minimal torque “ tptmin ”, and the requested brake torque “ twbk ” is set as a value obtained by subtracting the minimal torque “ tptmin ” from the requested so axle torque “ tw ”. according to the series of processes described above , the actual acceleration of the vehicle can be controlled to the jerk acceleration “ aj ”. in the case where the jerk acceleration “ aj ” changes , the actual acceleration can be properly controlled to the reference acceleration “ am ”. in other words , in the case where the jerk acceleration “ aj ” changes and where the acceleration of the vehicle is feedforward controlled to the jerk acceleration “ aj ”, response delay is caused in the actual acceleration with respect to the change in the jerk acceleration “ aj ”, due to the response delay of the vehicle . however , the actual acceleration estimated from the response delay can be approximated to the reference acceleration “ am ”. in addition , owing to the feedback control , the actual acceleration can be controlled to the reference acceleration “ am ” with high accuracy . the accuracy of the feedforward control described above resultantly relies , for example , on the accuracy of estimating the road surface gradient “ θ ”. in particular , when the accuracy of estimating the road surface gradient “ θ ” is low , the accuracy may be deteriorated in estimating the torque required for controlling the actual acceleration to the jerk acceleration “ aj ”, which may eventually be led to the deterioration in the feedforward controllability . in estimating a road surface gradient , the influence of noises superposed on the detection value of the acceleration sensor 34 and on the differential value of the actual vehicle speed “ v ” are unignorable . to cope with this , the road surface gradient is estimated through the following procedure in the present embodiment . fig9 is a block diagram illustrating the procedure for estimating road surface gradient according to the present embodiment . a first road surface gradient estimator 840 is configured to calculate and output a first estimation value “ accrg ” as a difference between a detection value “ accg ” of the acceleration sensor 34 and a differential value “ accw ” of the actual vehicle speed “ v ”. the difference between the detection value “ accg ” and the differential value “ accw ” is inherently expressed using the road surface gradient “ θ ” as “ g · sin θ ”. however , when the road surface gradient “ θ ” is small , the difference can be expressed by “ g · θ ”. accordingly , the difference between the detection value “ accg ” and the differential value “ accw ” almost equals to a constant multiplication of the road surface gradient ( g - fold of the gravitational acceleration ). a pitch angle estimator b 42 is configured to estimate the amount of rotation in the direction of the rotation angle ( pitch angle “ φ ”) of the lateral axis of the vehicle , based on the requested axle torque “ tw ”. this estimation is carried out considering that the vehicle tilts rearward ( squats ) when the vehicle is accelerated , and the vehicle tilts forward ( dives ) when the vehicle is decelerated . specifically , the pitch angle “ φ ” is considered to be no longer zero during the acceleration or deceleration of a vehicle , and hence the pitch angle “ φ ” can be estimated based on the torque generated by the actuators ( the power train and the brake actuator 20 ). for this reason , the pitch angle “ φ ” is estimated based on the requested axle torque “ tw ”. more specifically , considering that there is a delay for the actual vehicle pitch angle to responsively change according to the axle torque “ tw ”, the pitch angle “ φ ” is estimated , in the present embodiment , using the following primary delay model . where “ kpit ” is a pitch angle gain , and “ tpit ” is a time constant . a pitch angle corrector b 44 is configured to calculate a correction amount for correcting the first estimation value “ accrg ”, based on the pitch angle “ φ ”. since the acceleration sensor 34 tilts in response to the pitch angle “ φ ” of the vehicle , the correction is made considering that , of the acceleration factors sensed by the acceleration sensor 34 , those which are induced by the gravity will be expressed by “ g sin ( θ + φ )”. considering that the first estimation value “ accrg ” here corresponds to “ g · θ ”, the correction amount is set to be “ g · φ ”. a gradient corrector b 46 is configured to calculate and output a second estimation value “ accrgp ” by correcting the output of the first road surface gradient estimator b 40 using the output of the pitch angle corrector 644 . in particular , the gradient corrector b 46 subtracts the correction amount “ g · φ ” from the first estimation value “ accrg ”, that is , corrects the first estimation amount “ accrg ” using the correction amount “ g · φ ”, to calculate and output the second estimation value “ accrgp ”. as a result , the second estimation value “ accrgp ” will be appropriately compensated for the influence of the “ squatting ” and “ diving ” of the vehicle on the detection value “ accg ” of the acceleration sensor 34 . a lowpass filter b 48 is configured to selectively permeate low - frequency components of the second estimation value “ accrgp ” to output a final gradient estimation value “ accrgf ”. particularly , the lowpass filter b 48 is made up of a primary delay filter . more particularly , the lowpass filter b 48 is made up of a filter that uses cut - off frequency “ fc ” and can be expressed by “ 1 /{ 1 /( 2πfc ) s + 1 }”. the cut - off frequency “ fc ” can be variably set through the processes explained below . a lowpass filter b 50 is configured to perform a filtering process of permeating low - frequency components of the first estimation value “ accrg ” to thereby output a delay estimation value “ accrgl ”. the delay estimation value “ accrgl ” expresses the road surface gradient , but when the road surface gradient changes , will be a signal delayed from the first estimation value “ accrg ”, the delay being caused by the filtering process . a gradient change estimator 52 b is configured to calculate and output an estimation value of an amount of change in the road surface gradient ( gradient change estimation value “ δ ”) in terms of a difference between the delay estimation value “ accrgl ” and the first estimation value “ accrg ”. in particular , it is considered that the larger the change in the road surface gradient is , the more the delay estimation value “ accrgl ” is delayed from the first estimation value “ accrg ”. focusing on this point , the gradient change estimator 52 b is adapted to quantify the difference between these values as a gradient change estimation value “ δ ”. a first frequency setter b 54 is configured to set a cut - off frequency “ fc1 ” for determining the cut - off frequency “ fc ” for the filtering process performed by the lowpass filter b 48 . in particular , the cut - off frequency “ fc1 ” is set to a higher value as the gradient change estimation value “ δ ” becomes larger . this is because , if there is a change in the road surface gradient , the delay in the final gradient estimation value “ accrgf ” is likely to be the cause of trouble , which delay is ascribed to the delay effects of the filtering process performed by the lowpass filter b 48 . specifically , considering that the amount of delay is increased as the cut - off frequency “ fc ” is decreased , the first frequency setter b 54 is configured to set the cut - off frequency “ fc1 ” to a higher value , as the delay in the final gradient estimation value “ accrgf ” from the actual gradient is more likely to be the cause of trouble . in other words , a higher value is set for the cut - off frequency “ fc1 ” as the change in the gradient becomes larger . on the other hand , when the change in the road surface gradient is small , the amount of delay in the final estimation value “ accrgf ” from the actual gradient is unlikely to be the cause of trouble . in this case , it is the noises , not the delay in the final gradient estimation value , that are considered to give a larger influence to the estimation accuracy of the road surface gradient , which noises are superposed on the detection value “ accg ” of the acceleration sensor 34 and the differential value “ accw ” of the actual vehicle speed “ v ”. for this reason , the cut - off frequency is decreased as the change in the road surface gradient becomes smaller . in this way , the present embodiment provides a filtering process which establishes a trade - off relationship between the noise removal effects and the responsiveness . specifically , the present embodiment is so configured to variably set the cut - off frequency according to the change in the road surface gradient , and , from hence , to apply an optimal filtering process depending on the degree of contribution of either the noise removal effects or the responsiveness , whichever is larger , to the estimation accuracy of the road surface gradient . a second frequency setter b 56 is configured to switch the cut - off frequency for the filtering process performed by the lowpass filter b 48 , depending on whether or not the automatic transmission system 14 is in the process of effecting switch control for gear ratio . this configuration is based on an idea that , with the switch control for gear ratio , transmission shock is caused , which in turn will trigger the entry of the noises into the detection value “ accg ” of the acceleration sensor 34 , for example . the transmission shock is caused , for example , when transmission of the torque is stopped from the crank shaft 12 of the engine 10 to the drive wheels 16 through the automatic transmission system 14 , or when the conditions of engagement are changed between friction elements , such as the clutch c in the automatic transmission system 14 and the brake . in particular , a cut - off frequency “ fc2 ” under switch control for gear ratio is set lower than a cut - off frequency “ fc3 ” in a steady state where no control is effected for gear ratio . this setting is purposed to enhance the filtering effects and thus to suppress the influence of the noises which are caused in effecting the switch control for gear ratio . a frequency determining section b 58 is configured to determine the cut - off frequency “ fc ” for the lowpass filter 548 , based on the output from the first frequency setter b 54 and the output from the second frequency setter b 56 . in particular , the output value of either the first or second frequency setter b 54 or 556 , whichever is smaller , is set as the final cut - off frequency “ fc ” and outputted to the lowpass filter b 48 . the cut - off frequency “ fc3 ” in the steady state where no switch control is effected for gear ratio , is set to a value equal to or more than the maximum value of the cut - off frequency “ fc ” of the first frequency setter b 54 . this setting is purposed to employ the cut - off frequency “ fc1 ” outputted from the first frequency setter b 54 , as the final cut - off frequency “ fc ”, unless the switch control is being effected for gear ratio . it should be appreciated that the minimum value of the cut - off frequency “ fc1 ” should have been set to an appropriate value by the first frequency setter b 54 , in the case where there is no change in the road surface gradient and no switch control is effected for gear ratio . in other words , the minimum value of the cut - off frequency “ fc1 ” should have been set to a value larger than the cut - off frequency “ fc2 ” used during the switch control of the gear ratio . with the process explained above , the influence of the squatting or diving of the vehicle on the detection value “ accg ” of the acceleration sensor 34 can be compensated by the pitch angle correction amount “ g · φ ”. also , in order to suppress the influence of the vibration transmitted to the vehicle , the process of the lowpass filter b 48 is carried out , with the cut - off frequency for the filter being variably set depending on whether or not the road surface gradient has changed or whether or not the switch control for gear ratio has been conducted . thus , the gradient estimation value “ accrgf ” can be calculated as accurately as possible according to the operating conditions of the vehicle . in this way , high accuracy can be expected in the calculation of the feedforward manipulated variable “ tff ”, which may further be led to the high - accuracy control of the acceleration of the vehicle . it should be appreciated that the gradient estimation value “ accrgf ” corresponds to “ g sin θ ” in the term “ mg sin θ ” at step s 40 shown in fig7 . the present embodiment described above in detail may provide the advantages as provided below . ( 1 ) the second estimation value “ accrgp ” based on the detection value “ accg ” of the acceleration sensor 34 and the differential value “ accw ” of the actual vehicle speed “ v ” has been subjected to filtering process of the lowpass filter b 48 to calculate the gradient estimation value “ accrgf ”. in the calculation , the cut - off frequency “ fc ” for the so filtering process has been variably set according to the operating conditions of the vehicle . thus , the gradient estimation value “ accrgf ” can be calculated with high accuracy in any operating conditions . ( 2 ) the cut - off frequency “ fc ” of the lowpass filter 548 has been variably set based on the information on the change in the road surface gradient , which is outputted from the gradient change estimator b 52 . thus , when the responsiveness in the estimation of the road surface gradient is desired to be enhanced in spite of the changing road surface gradient , the responsiveness can be enhanced by increasing the cut - off frequency “ fc ”. ( 3 ) the gradient change has been estimated based on the difference between the first estimation value “ accrg ” and the delay estimation value “ accrgl ” resulting from the filtration of the first estimation value “ accrg ”. thus , the change in the road surface gradient can be appropriately estimated . ( 4 ) under the switch control for gear ratio , the cut - off frequency “ fc ” has been decreased . thus , the influence quantity of the transmission shock in the estimation of the road surface gradient can be appropriately suppressed . ( 5 ) the pitch angle “ φ ”, i . e . the rotation angler of the lateral axis of the vehicle has been estimated . then , the estimated road surface gradient ( first estimation value “ accrg ”) has been corrected based on the estimated pitch angle “ φ ”. thus , the influence of the pitch angle “ φ ” can be appropriately removed from the estimation of the road surface gradient . ( 6 ) the actual acceleration of the vehicle has been subjected to feedforward control according to the requested acceleration ( jerk acceleration “ aj ”), based on the gradient estimation value “ accrgf ”. thus , the feedforward control can be appropriately performed . as a result , the travel conditions of the vehicle , as well as the ride quality can be improved . under the switch control for gear ratio , the above embodiment has given priority to the removal of noises accompanying the transmission shock , over the enhancement of the responsiveness for the change in the road surface gradient . alternatively , in the case where the change in the road surface gradient is more than a predetermined level , the cut - off frequency “ fc1 ” may be employed as the final cut - off frequency “ fc ”, irrespective of whether or not the switch control for gear ratio is performed . the above embodiment has estimated the pitch angle “ φ ” using the primary delay model by inputting the requested axle torque “ tw ”. alternatively , for example , a secondary delay model may be used . the above embodiment has employed the first estimation value “ accrg ” as the difference between the detection value “ accg ” and the differential value “ accw ” of the actual vehicle speed . alternatively , considering that the above difference corresponds , to be exact , to “ g · sin θ ”, the first estimation value “ accrg ” may be the value expressed by “ arcsin {( difference )/ g }”. also , the first estimation value “ accrg ” may be the value obtained by dividing the above difference with a gravitational acceleration “ g ”. in any case , the pitch angle correction amount in such a case may desirably be the pitch angle “( p ”. the lowpass filters b 48 and b 50 are not limited to primary delay filters , but butterworth filters may alternatively be used . the lowpass filter b 48 to which the cut - off frequency is variably set may be applied to at least one of the detection value “ accg ” of the acceleration sensor and the differential value “ accw ” of the actual vehicle speed “ v ”, instead of applying to the second estimation value “ accrgp ”. the above embodiment has estimated the road surface gradient based on the detection value “ accg ” of the acceleration sensor and the differential value “ accw ” of the actual vehicle speed “ v ”. alternatively , for example , the road surface gradient may be estimated based on the differential value “ accw ” of the actual vehicle speed “ v ” and the acceleration estimated from the torque ( requested axle torque “ tw ”) generated by the actuators of the vehicle . alternatively , the road surface gradient may be estimated based on the detection value “ accg ” of the acceleration sensor and the torque ( requested axle torque “ tw ”) generated by the actuators of the vehicle . the above embodiment has estimated the pitch angle rain from the requested axle torque “ tw ”. alternatively , for example , the pitch angle “ φ ” may be estimated from the differential value “ accw ” of the actual vehicle speed . in the embodiment described above , the reference model has been set based on the response characteristics at the time when the response delay of the actual acceleration is maximized with respect to the step change of the target acceleration . alternatively , for example , the reference model may be variably set according to the response characteristics for every operating condition of the vehicle . also , the reference model is not limited to the primary delay mode , but may , for example , be a secondary delay model . the feedback controller b 24 is not limited to the one that performs pid ( proportional - integral - differential ) control , but may be the one that performs either one of or any two of p control , i control and d control . alternatively , modern control may be used instead of classical control . the feedforward controller b 26 is not limited to the one that performs the processes described above . the feedforward controller b 26 may calculate the feedforward manipulated variable “ tff ” only from the reference force “ maj ”, for example . also , the feedforward manipulated variable “ tff ” may be calculated using either one of or any two of the air resistance , the road surface resistance and the gravity . in the embodiment described above , the two - degree freedom control has been performed . alternatively , for example , only feedforward control may be performed . in the embodiment described above , the model follow - up control so has been performed . alternative to this , the reference model setter b 14 may not be furnished . in the acceleration control in the embodiment described above , the means for imparting positive torque to the vehicle ( more particularly the drive wheels 16 of the vehicle ) has been exemplified by the power train , i . e . motive power generator , including the engine 10 and the automatic transmission system 14 . alternatively , however , a motor may be used , for example , as the motive power generator . also , the automatic transmission system 14 may not necessarily be the one having a planetary gear automatic transmission , but may , for example , be the one having a continuously variable transmission ( cvt ) which is able to adjust the gear ratio in a continuous manner . in the acceleration control in the embodiment described above , the means for imparting negative torque to the vehicle ( more particularly the drive wheels 16 of the vehicle ) has been exemplified by the hydraulic brake actuator . alternatively , however , a generator may be used , for example , which converts the torque of wheels ( drive wheels 16 and the idler wheels 18 ) into electric energy . the apparatus for estimating road surface gradient may not necessarily be applied to the front - rear direction controller m 10 . also , the apparatus for estimating road surface gradient may not necessarily be applied to a vehicle control system equipped with the front - rear direction controller m 10 . the present invention may be embodied in several other forms without departing from the spirit thereof . the embodiments and modifications described so far are therefore intended to be only illustrative and not restrictive , since the scope of the invention is defined by the appended claims rather than by the description preceding them . all changes that fall within the metes and bounds of the claims , or equivalents of such metes and bounds , are therefore intended to be embraced by the claims . | 1 |
a pallet assembly 10 according to one embodiment of the present invention is shown in fig1 . the pallet 10 generally includes an upper structure 12 and a lower structure 14 . the upper structure 12 includes an upper deck 16 having a generally planar upper support surface 18 and a plurality of column connectors 20 protruding downwardly therefrom . the lower structure 14 includes an integrally molded lower portion 22 including a plurality of columns 24 with runners 26 extending therebetween . fig2 and 3 are front and side views of the pallet assembly 10 . fig4 is a top view of the pallet assembly 10 . fig5 is a bottom view of the pallet assembly 10 . as shown , the lower structure 14 includes a lower reinforcement sheet 30 , shaped to align with the runners 26 and the columns 24 . the upper structure 12 includes an upper reinforcement sheet 32 secured to the bottom thereof . an exploded view of the pallet assembly 10 is shown in fig6 . the upper structure 12 includes the upper deck 16 , reinforcement frame 36 and the upper reinforcement sheet 32 . the reinforcement frame 36 includes a plurality of elongated , hollow rods , preferably having a rectangular cross - section . the rods include peripheral rods 38 forming a periphery of the reinforcement frame 36 and optionally welded to one another . a longitudinal reinforcement rod 40 extends longitudinally along a center of the reinforcement frame 36 between opposite front and rear peripheral rods 38 . a lateral reinforcement rod 42 extends along a center - line between opposite side peripheral rods 38 . optional angled reinforcement rods ( not shown ) may extend diagonally across each of the quadrants formed by the rods 38 , 40 , 42 . the upper reinforcement sheet 32 is generally a planar single piece of plastic extruded as a sheet and having peripheral column openings 46 around its periphery , including the corners , and a central column opening 48 . the lower structure 14 includes the lower portion 22 integrally injection molded as a single piece of plastic including the columns 24 and runners 26 . a lower reinforcement frame 50 includes a plurality of peripheral reinforcement rods 52 around a periphery , which may optionally be welded to one another . a longitudinal reinforcement rod 54 may extend along a center line longitudinally between two opposite peripheral reinforcement rods 52 . a lower reinforcement sheet 30 is generally shaped to align with the bottom of the lower portion 22 . referring again to fig6 , although the pallet assembly 10 is illustrated with all of the reinforcements , the pallet assembly 10 can be configured with various combinations of the reinforcements depending on the application . for example , one configuration might not include any of the reinforcements at all . another configuration would include only the peripheral reinforcement rods 52 and the longitudinal reinforcement rod 54 in the lower structure 14 and only the longitudinal reinforcement rod 40 in the upper structure 12 . another configuration would include the peripheral reinforcement rods 52 and the longitudinal reinforcement rod 54 in the lower structure 14 and peripheral rods 38 , the longitudinal reinforcement rod 40 and the lateral reinforcement rod 42 in the upper structure 12 . another configuration would include the peripheral reinforcement rods 52 and the longitudinal reinforcement rod 54 in the lower structure 14 and peripheral rods 38 , the longitudinal reinforcement rod 40 , the lateral reinforcement rod 42 and the angled reinforcement rods in the upper structure 12 . the various reinforcement rods can be different sizes ( gauge ), depending on the application , as are the channels in the bottoms of the deck and runners for receiving the rods . for example , the peripheral reinforcement rods 38 ( and the corresponding channels in the upper deck 16 ) could have a smaller cross - section ( e . g . ½ ″, which is less than half the total height of the upper deck 16 ) than the other rods and channels ( e . g . ¾ ″). therefore , when the channels are welded shut by the upper reinforcement sheet 32 , the upper deck 16 will be strong with or without the peripheral reinforcement rods 38 . fig7 is an exploded bottom perspective view of the pallet assembly 10 . the upper deck 16 includes a plurality of ribs 56 extending downwardly from the upper sheet 18 . the lower portion 22 also includes a plurality of ribs 58 extending downwardly . a bottom perspective view of the upper deck 16 is shown in fig8 . the plurality of ribs 56 and the column connectors 20 protrude downwardly from the upper sheet 18 . snap - fit connectors may be formed with the column connectors 20 for connecting to the columns 24 in a known manner . peripheral ribs are provided along the periphery of the upper deck 16 . openings are formed between some of the ribs 56 and column connectors 20 to accommodate the upper reinforcement frame 36 ( fig7 ). fig9 is a bottom perspective view of the lower portion 22 in which the columns 24 and runners 26 are integrally molded as a single piece of plastic , such as by injection molding . a plurality of ribs 58 extend downward . openings may be formed through the ribs 58 to accommodate the lower reinforcement frame 50 ( fig7 ). a cross - section of a portion of the upper reinforcement sheet 32 is shown in fig1 . a cross - section of a portion of the lower reinforcement sheet 30 is shown in fig1 . each sheet 30 , 32 includes a pair of coextruded sheets or layers 70 , 72 that may optionally be then die - cut to the shapes shown . the upper layer 70 is formed of a material that matches the material of the upper deck 16 and the lower portion 22 . for example , the upper deck 16 and lower portion 22 may be injection molded of high density polyethylene , and the upper layer 70 may be high density polyethylene . however , “ match ” does not necessarily mean “ identical ”; rather , in this context “ match ” means that matched materials are selected to improve the bond between the two components . the matched materials improve the weld between the upper layer 70 and the upper deck 16 and lower portion 22 via vibration welding or hot plate welding ( or adhesive , etc ). the lower layer 72 is formed of a material with improved fire retardant properties ( such as halogens , metal hydrates , intumescents or other additives ). in a fire , the bottom surfaces of the pallet assembly 10 , including the bottom of the upper deck 16 and the bottom of the lower portion 22 , including the runners 26 is the most important area for fire retardant material . by coextruding the fire retardant material in the lower layer 72 with the upper layer 70 of a material that matches the structure to which the sheet is bonded , a good bond can be obtained while also obtaining good fire retardant characteristics . fig1 is a section view of an optional upper reinforcement sheet 32 and fig1 is a section view of an optional lower reinforcement sheet 30 . each sheet 30 , 32 includes three ( or more ) coextruded sheets or layers 70 , 72 , 74 that may be die - cut or trimmed as needed . again , the upper layer 70 is formed of a material that matches the material of the upper deck 16 and the lower portion 22 . for example , if the upper deck 16 and lower portion 22 are injection molded of high density polyethylene , then the upper layer 70 may be high density polyethylene . the matched materials improve the weld between the upper layer 70 and the upper deck 16 and lower portion 22 via vibration welding or hot plate welding ( or adhesive , etc ). the middle layer 72 is formed of a material with improved fire retardant properties ( such as halogens , metal hydrates , intumescents or other additives ). the lower layer 74 could match the upper layer 70 ( and match the upper deck 16 and lower portion 22 ). alternatively , the lower layer 74 may be another layer of fire retardant material ( which may be the same or different material as that of the middle layer 72 ). as another option , one or more of the layers 72 , 74 could have increased stiffness ( e . g . through additives — in fact , the fire retardant additives increase stiffness too ) which may increase the overall stiffness of the pallet 10 . this may also increase the brittleness of the layers 72 , 74 ; however , because the sheets 30 , 32 are spaced away from the perimeter of the pallet , they will be less subject to impact from fork tines , etc . fig1 is a bottom exploded perspective view of a pallet 110 according to an alternative embodiment . the upper deck 16 and lower portion 22 may be the same as before . the upper reinforcement frame 136 is similar , but only includes ones cross - bar . a lower reinforcement frame is not shown , but could be the same as before . in this embodiment , there are two upper reinforcement sheets 132 secured to the ribs 56 of the upper deck 16 ( again , via vibration or hot plate welding , adhesive , etc ). the upper reinforcement sheets 132 do not cover the upper reinforcement frame 136 , but only cover the two large surfaces of the upper deck 16 between the upper reinforcement frame 136 . on the bottom ribs of the lower portion 22 , a plurality of lower reinforcement sheets 130 ( show optionally overlapping ) are welded or otherwise secured . using the plurality of narrow lower reinforcement sheets 130 in this embodiment reduces the amount of material cut sheet to form the large openings in the single , large extruded of the first embodiment . alternatively , the upper reinforcement sheets 132 and lower reinforcement sheets 130 could be injection molded ( including the numerous apertures formed therein ). in that case , there are several options for achieving improved fire resistance . first , the injection - molded plastic could include some fire retardant additive , such as magnesium hydroxide ( mdh ). second , the injection - molded sheet 130 , 132 could be a twin shot or multi - shot injection , such that the sheet 130 , 132 has a matching upper layer and a fire retardant lower layer formed by different shots in the mold , such that the injection - molded sheets 130 , 132 have an upper layer 70 ( matching ) and lower layer 72 ( fire retardant ) as in fig1 - 11 . the injection - molded sheets 130 , 132 could also have a third layer 74 ( matching or some other property ) as a bottom layer as in fig1 - 13 , with all three layers formed in a multi - shot mold . as a third option , a fire retardant coating could be applied to one side of a mold prior to injection . the plastic is shot into the mold over the fire retardant coating . again , the sheets 130 , 132 include an upper layer 70 ( matching ) and lower layer 72 ( fire retardant ) as in fig1 - 11 . alternatively , the fire retardant layer may be added post injection molding by applying a coating to the bottom side of the injection molded layers ( in which case the lower layers 72 of fig1 - 11 would be the fire retardant coating and the upper layer 70 would be the injection molded layers ). as yet another option , the fire retardant coating layer could also be added to an extruded sheet instead of coextruding the sheets . the fire retardant materials and additives described herein include intumescent type materials , aluminum hydroxide ( ath ) and magnesium hydroxide ( mdh ). in accordance with the provisions of the patent statutes and jurisprudence , exemplary configurations described above are considered to represent a preferred embodiment of the invention . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . alphanumeric identifiers in claimed method steps are for ease of reference in dependent claims and do not signify a required sequence of such method steps unless otherwise explicitly indicated . | 1 |
shown in fig1 is a gas turbine 10 . the gas turbine 10 includes a compressor 12 which provides compressed fluid to a combustor 14 . fuel is injected into the combustor 14 , mixes with the compressed air and is ignited . the hot gas products of the combustion flow to a turbine 16 which extracts work from the hot gas to drive a rotor shaft 18 which in turn drives the compressor 12 . a transition piece 20 is coupled at an upstream end 22 to the combustor 14 at a combustor liner 24 and at a downstream end 26 to an aft frame 28 of the turbine 16 . the transition piece 20 carries hot gas flow from the combustor liner 24 to the turbine 16 . the combustor 14 includes a combustor sleeve 30 spaced radially outward from the combustor liner 24 defining a combustor flow channel 32 therebetween . a combustor cap 34 is coupled to an upstream end 36 of the combustor liner 24 and includes at least one nozzle 38 disposed therein an extending into a combustion chamber 40 defined by the combustor cap 34 and the combustor liner 24 . an impingement sleeve 42 is coupled to the combustor sleeve 30 and is radially spaced from the transition piece 20 defining a transition flow channel 44 therebetween . during operation , discharge flow 46 flows from the compressor 12 through a diffuser 48 to the impingement sleeve 42 . the discharge flow 46 proceeds through a plurality of impingement holes 50 in the impingement sleeve 42 and toward the combustor 14 in the transition flow channel 44 . the discharge flow 46 proceeds from the transition flow channel 44 and through the combustor flow channel 32 until it is finally introduced to the combustor liner 24 through the at least one nozzle 38 . in addition to providing air to the combustor 14 for the combustion process , the relatively cool discharge flow 46 further provides much needed cooling to the components exposed to hot combustion gas , for example , the combustor liner 24 and the transition piece 20 . at the interface between the transition piece and the combustor liner , there is a telescoping fit , where the aft end of the combustor liner is received within the forward end of the transition piece . with reference to fig2 , an annular spring - finger seal 52 , also known as a hula seal , is located radially between the aft end 54 of the liner 24 and the forward end 22 of the transition piece 20 . typically , the spring fingers 56 have uniform widths and extend from a solid end or edge 58 of the seal in an axial direction , uniformly spaced about the circumference of the seal edge , separated by slots 60 as best seen in fig3 . it will be appreciated that the solid edge 58 may be on the upstream or downstream ends of the spring fingers . as in well understood in the art , the seal comprises two or more arcuate segments which , when assembled , form a complete 360 ° annular seal . in exemplary but nonlimiting embodiments of the invention , the hula seal is reconfigured to direct cooling air to specific high - temperature regions of the liner and / or transition piece identified as having “ hot streaks ” related to fuel / air ratio ( far ) and combustion swirling angles . in fig4 , for example , an annular hula seal 62 is formed with discrete groups 64 of two axially - oriented spring fingers 66 , 68 each , at spaced locations about the circumference of the seal . while the spacing between the groups is shown to be substantially uniform , it will be appreciated that the spacing may vary in asymmetric fashion , based on the location of identified hot streaks . in other words , the groups 64 of spring fingers , and just as importantly , the groups of slots 70 between the spring fingers , may be located and arranged so as to preferentially cool any desired region of the aft end of the liner and / or the forward end of the transition piece . seal portions 72 between the groups 64 in fact comprise spring fingers of substantially greater width than fingers 66 , 68 . as such , the larger - width spring fingers may also be used / arranged to divert cooling air away from identified cooler regions of the liner or transition piece toward the hot regions so as to promote cooling uniformity without the need for additional cooling air . fig5 illustrates a further example embodiment of an annular hula seal 74 where the spring fingers 76 and slots 78 are uniformly spaced about the circumference of the seal , but angled relative to a centerline axis cl through the seal to swirl the cooling air passing through the seal . it will be appreciated that the embodiments shown in fig4 and 5 can be combined so that discrete groups of spring fingers and associated slots are angled in the same or different directions to not only swirl the cooling air but to also preferentially cool certain liner and or transition piece regions . here again , spring fingers and slots between the spring fingers can have the same or differential width dimensions . by preferentially targeting specific regions of the adjacent components , ( whether hot or cold ) through unique seal design , more efficient cooling is provided with minimum air flow . minimizing cooling flow , in turn , reduces emissions and increases the service life of the components . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . | 5 |
hereinafter , an embodiment of the present invention will be described with reference to the accompanying drawings . fig4 is a view showing a concept of relay in a wireless communication system . in fig4 , a communication device ‘ a ’ 410 cannot directly communicate with a communication device ‘ c ’ 430 , but communicates with the communication device ‘ c ’ 430 through the relay of a communication device ‘ b ’ 420 . first , the communication device ‘ a ’ 410 exchanges ad hoc network information with the communication device ‘ b ’ 420 . at the same time , the communication device ‘ c ’ 430 exchanges the ad hoc network information with the communication device ‘ b ’ 420 . since a message needs to be broadcasted to all , the ip layer processing unit 206 instructs the mac layer processing unit 205 at a code that does not require ack communication , e . g ., an address code ‘ 0 ’ and performs a wireless transmission . in the above , if information has been successfully exchanged , it becomes possible that the communication device ‘ a ’ 410 communicates with the communication device ‘ c ’ 430 through the relay of the communication device ‘ b ’ 420 . at this time , since the communication device ‘ a ’ 410 , communication device ‘ c ’ 430 , and communication device ‘ b ’ 420 come to join to the same network , as shown in fig6 , they have unique ip addresses within the same network . fig6 is a view for explaining an ip address when establishing an ad hoc network in the wireless communication system . as to the ip address , the ip layer processing unit 206 determines an address code by , e . g ., the combination of final numbers . the address codes generated by combining unique ip addresses become also unique on the ad hoc network . here , a participation number of the generated address codes are set to 2 and a response order is determined by ascending order of ip addresses . this information is defined as adaptive address code information . the adaptive address code is also set in the mac processing unit 205 . next , the operation of the wireless communication system in accordance with the embodiment of the present invention will be described with reference to fig7 and 8 . fig7 a to 7d are views for explaining adaptive address code information when establishing the ad hoc network in the wireless communication system in accordance with the embodiment of the present invention . fig8 is a view for explaining an arp information update when establishing the ad hoc network in the wireless communication system in accordance with the embodiment of the present invention . in fig8 , an arp information storage unit 826 stores adaptive address code information tables of fig7 b to 7d . when ip layer processing units 513 and 823 exchange the ad hoc network information , the exchange is performed by assigning a mac address and an ip address of the communication device . by using them , when receiving the ad hoc network information , the ip layer processing units 513 and 823 updates arp ( address resolution protocol ) information having combination of the mac address and the ip address . up to this point , it is a pre - process to be executed until a terminal such as a pc transmits an ip packet . next , a process when an ip packet is inputted from a terminal such as a pc to a communication device will be described . when an ip packet is inputted from a terminal such as a pc to a communication device , the ip layer processing units 513 and 823 in the communication device determines whether or not there is relay transmission from the information exchanged on the ad hoc network . the determination of relay transmission is shown in fig9 . fig9 a to 9d are views for explaining relay determination when establishing the ad hoc network in the wireless communication system in accordance with the embodiment of the present invention . for the relay determination , connection information of a wireless section ( hereinafter , referred to as “ link information ”) is used as the content of the ad hoc network information . in this embodiment , since it is known that the communication device ‘ b ’ 420 is connected to the communication device ‘ c ’ 430 as the destination , the communication device ‘ a ’ 410 designates the communication device ‘ b ’ 420 as a relay device . when outputting an ip packet to the mac layer processing unit , a mac address of the destination is set in a case that there is no relay device , and in a case that there is a relay device , a mac address of the relay device is set . at this time , an ip address corresponding to the mac address is extracted from the arp information . the extracted ip address and an ip address of its own communication device are used as search keys to extract a matched address code from the adaptive address code information . the address code is given when the ip packet is inputted to the mac layer processing unit . the mac layer processing unit generates a mac frame based on the given address code and the ip packet , outputs the mac frame to the physical layer processing unit , and performs wireless communication . since the communication device as the destination also holds the adaptive address code information , when the communication device as the destination receives the mac frame , the device determines that the received information is addressed to itself , and transmits ack to the transmission destination , and then sends the received information to the ip layer processing unit . this case is shown in fig1 a and 10b . fig1 a and 10b are a view for explaining relay communication using the adaptive address code in the wireless communication system in accordance with the embodiment of the present invention . in fig1 a and 10b , the arp information storage units 826 and 1016 store the adaptive address code information tables of fig7 b to 7d . relay information storage units 1017 and 1027 store relay information tables of fig9 b to 9d . the communication device ‘ a ’ 410 uses the adaptive address code information shown in fig7 b to 7d and the relay information shown in fig9 b to 9d . from the relay information , it is seen that the communication device ‘ b ’ 420 is used as the relay device to send an ip packet to a terminal # 2 . therefore , the communication device ‘ a ’ 410 selects adaptive address code information ( address code “ 0x0102 ”) constructed between itself and the communication device ‘ b ’ 420 , outputs the selected information to a mac layer processing unit 512 , and wirelessly transmits a mac frame . upon receiving the wireless information , the communication device ‘ b ’ 420 also refers to the adaptive address code information and the relay information , and transmits an ip packet to the communication device ‘ c ’ 430 to send data to the terminal # 2 . at this time , the communication device ‘ b ’ 420 selects adaptive address code information ( address code “ 0x0203 ”) constructed between itself and the communication device ‘ c ’ 430 , outputs the selected information to a mac layer processing unit 522 , and wirelessly transmits a mac frame . then , the communication device ‘ c ’ 430 receives the wireless information . as described above , optimum address code information is constructed and an address code is selected at the time of communication . the wireless communication system in accordance with the embodiment of the present invention can generate address code information with a minimum delay when establishing the ad hoc network . as described above about the present invention in detail , the present invention is useful and available in a wireless communication system . further , it goes without saying that the present invention is not limited to the wireless communication system described herein but can be widely applied to other wireless communication systems . the present application claims priority based on japanese patent application no . 2014 - 244896 filed on dec . 3 , 2014 , the entire contents of which are incorporated herein by reference . 206 , 513 , 523 , 1013 , 1023 , 1033 : ip layer processing unit 514 , 523 , 1034 : ad hoc network processing unit 515 , 525 , 1035 : address code information management unit | 7 |
fig1 is a schematic illustration of a photoconductor based printing system 100 using an intermediate transfer member according to an exemplary embodiment of the invention . in fig1 a photoconductor drum 10 is illustrated as operative for preparing a latent image for transfer to output . details of the production of the image are substantially irrelevant to the present invention and the process is indicated generally by a block 12 . a wide range of methods known in the art for the production of liquid toner images can be used . optionally , an electrified squeegee roller 14 , as known in the art , is provided to remove excess liquid from the image and to compress the image . optionally , alternatively or additionally , other means for removing excess moisture are used , such as an air knife or other means known in the art . in some embodiments of the invention , the latent image is not transferred directly to an output medium 60 ( e . g . paper or plastic ), but instead it is transferred to an intermediate transfer member ( itm ) 20 , for example in order to protect photoconductor drum 10 and / or to provide a more efficient , controllable process and to improve transfer . in some systems , individual color separations are transferred to the itm and then to the final substrate . in other embodiments , multiple toner images are accumulated on the itm , and transferred as a group to the final substrate . itm 20 is a drum ( or a blanket on a drum ) coated with materials suitable for receiving the toner from photoconductor drum 10 and transferring it to output medium 60 , for example as described in u . s . pat . nos . 4 , 974 , 027 ; 5 , 335 , 054 ; 5 , 276 , 429 ; 5 , 815 , 782 ; 5 , 410 , 392 ; 5 , 592 , 269 ; 5 , 745 , 829 ; 6 , 551 , 716 ; 6 , 584 , 297 ; and pct publication wo 97 / 07433 , the disclosures of which is incorporated herein by reference . in an exemplary embodiment of the invention , a heating roller 80 is coupled to itm 20 , such that it will rotate with itm 20 while forming direct contact , in order to directly heat the toner image on the surface of itm 20 . optionally , heating roller 80 is made from a metal and coated with a substance that is durable to heat , smooth and non - adhesive , for example silicone , condensation cured silicone , teflon , htv and rtv fluorosilicone or other fluoromaterials ; blends of silicone and fluorosilicone , blends of silicone and polyurethane , for example in a range of 10 / 90 to 20 / 80 , of silicone to polyurethane . heater roller 80 preferably heats the toner without degrading the toner image . in an embodiment of the invention , the heater roller is coated with a material that is more replacing than the release coating of the itm . alternatively or additionally , the itm is operated for a number of cycles . operation of an itm generally deteriorates the release properties of the itm , so that the roller is more replacing than the itm . in an exemplary embodiment of the invention , heating roller 80 is heated to a temperature between 60 - 200 ° c . in some embodiments of the invention , the selected temperature of heating roller 80 is a function of the process speed and duration of contact . at a faster process speed contact between heating roller 80 and the toner particles on itm 20 is shorter and a higher temperature is needed . optionally , heating roller 80 comprises an internal heating unit 82 , as known in the art . in preferred embodiments of the invention , contact with roller 80 performs one or more and preferably all of forming the toner articles into a film , removing additional liquid from the image and increasing the transferability of the toner to the substrate . in an exemplary embodiment of the invention , as itm 20 rotates , the heated toner image comes into contact with output medium 60 , which is guided and pressed against itm 20 by a transfer roller 30 . the toner image on itm 20 forms a sharp printout on output medium 60 as a result of its tacky state and from the pressure exerted by transfer roller 30 . in some embodiments of the invention , transfer roller 30 is additionally electro - statically charged in order to cause the toner to be pulled toward the paper during contact . alternatively or additionally , transfer roller 30 is heated in order to assure that the toner is exposed to sufficient heat . the substrate can be pre - heated , for example as described in u . s . pat . no . 6 , 562 , 539 , the disclosure of which is incorporated herein by reference . in this reference , the substrate is heated to a temperature that is below that of the itm at the transfer point , but above room temperature . when used in conjunction with the present invention , the substrate is preferably heated to a temperature that is lower than the temperature of the image . however , it may be heated to a temperature that is above that of the relatively cool itm . in some embodiment of the invention output medium 60 is mounted on transfer roller 30 , in order to form better alignment between the output medium 60 and the toner image on itm 20 . optionally , itm 20 comprises an internal heating unit 40 used to maintain a given temperature level on the surface of itm 20 . this given temperature is lower , optionally 10 , 20 , 30 or more degrees lower than required for complete transfer of the image , without the presence of roller 80 . in some embodiments the itm temperature is only 40 ° c . which is 70 - 80 ° c . lower than necessary in the absence of heating roller 80 . when the itm temperature is low , the toner image does not harden as quickly , if , for example , a malfunction causes the printer to stop . in some embodiments of the invention , internal heating unit 40 supply less than 50 %, 40 % or 30 % of the heat energy for heating the toner image on the surface of itm 20 . the rest of the heat is supplied by directly heating the toner image with heating roller 80 . the roller may be as hot as 130 ° c . to 200 ° c ., although lower temperatures can be used with good effect . in some embodiments of the invention , the total amount of energy needed to heat the toner image to a desired temperature using heating roller 80 is less than 50 %, 60 % or 75 % of the energy needed to heat the image using the methods from the prior art . it should be noted that although heating roller 80 is applied to heat the image toner , some of the heat energy heats the surface of itm 20 by contact between non printed areas and heating roller 80 . however , since the image toner is heated by direct contact the heating efficiency is much greater than in the methods of the prior art . also , the great bulk of the itm , including the bulk of the itm drum , is heated to only a minor degree by roller 80 . the surface of the itm , after transfer of the image to the substrate ( and partly because of cooling by the substrate ) is much lower than it would be in the absence of roller 80 , so that the energy required to maintain this temperature is relatively low , as indicated above . in an embodiment of the invention , in addition to heat and pressure , the roller is electrified with respect to the intermediate transfer member . this electrification has a polarity that presses the toner particles to the intermediate transfer member . thus electrifying the roller has the dual effect of compacting the image and urging the toner from the roller . in general , the toner has a tendency to stick to the hot roller . fig2 is a schematic illustration of an alternative printing system 200 using an intermediate transfer member 20 according to an exemplary embodiment of the invention . in printing system 200 , heating unit 80 is replaced by a belt 90 . belt 90 is optionally mounted on two or more wheels 95 ( an embodiment with three wheels is shown ), to allow coupled motion of belt 90 with itm 20 . in some embodiments of the invention , heating belt 90 provides a larger area of contact between heating belt 90 and the image toner , since it is not limited to a single tangent point of contact such as with heating roller 80 . optionally , heating belt 90 is heated to a lower temperature than heating roller 80 since it is in longer contact with the toner image for transferring heat . alternatively to utilizing a belt , a relatively soft roller 80 is provided , so that a larger nip at its contact with photoconductor 20 is provided . in some embodiments of the invention , heating belt 90 is heated by one or more heating units positioned in wheels 95 . alternatively or additionally , heating belt 90 is heated by one or more heating units 92 positioned in the void covered by heating belt 90 as shown in fig2 . alternatively , the belt may be formed with an internal heater which heats all of its surface or selectively heats only the region of contact ( optionally together with a portion prior to contact ). the present invention has been described using non - limiting detailed descriptions of embodiments thereof that are provided by way of example and are not intended to limit the scope of the invention . it should be understood that features and / or steps described with respect to one embodiment may be used with other embodiments and that not all embodiments of the invention have all of the features and / or steps shown in a particular figure or described with respect to one of the embodiments . variations of embodiments described will occur to persons of the art . it is noted that some of the above described embodiments may describe the best mode contemplated by the inventors and therefore include structure , acts or details of structures and acts that may not be essential to the invention and which are described as examples . for example , the invention is described with reference to particular types of toner . the invention is usable with other types of known toners . furthermore , the invention is described in the context of using a “ photoconductor ” to form the image . however , the invention is not limited to electrophotography or to any particular method of forming the image . structure and acts described herein are replaceable by equivalents which perform the same function , even if the structure or acts are different , as known in the art . therefore , the scope of the invention is limited only by the elements and limitations as used in the claims . when used in the following claims , the terms “ comprise ”, “ include ”, “ have ” and their conjugates mean “ including but not limited to ”. | 6 |
a first embodiment of the instant invention may consist of two parts , the socket 30 and the handle assembly 31 . the socket 30 , seen in fig1 and 5 , may be a hollow cylinder that may have axially fluted interior walls . the fluting 32 may provide a good grip on nuts and bolts having different shapes , i . e ., square or hexagonal . an example of a hexagonal nut 36 within the socket 30 may be seen in fig5 and 6 . the handle assembly 31 may have a solid cylindrical head 33 with fluting 34 on its outer surface which may cooperate with and complement the fluting 32 of the interior of the socket 30 . the head 33 may be attached to one end of a shaft 35 . the shaft 35 may be affixed to the head 33 by welding or other means known in the art . the head 33 and shaft 35 may also be of singular construction . see fig2 , 3 and 4 . the head 33 may be inserted into the top of the socket 30 to form a socket wrench . to use the wrench the socket 30 may be placed over the nut 36 or bolt ( not shown ) and the head 33 of the handle assembly 31 inserted into the top of the socket 30 . the shaft 35 may be rotated in one direction as far as possible , then the head 33 lifted until it may be separated from the socket 30 so the shaft 35 may be rotated to the starting position , reseated in the socket 30 and rotated again . these steps may be repeated until the nut or bolt is tightened sufficiently or removed , as needed . the smaller the available turning arc , the more often these steps must be repeated to complete the task . the fluted interior of the socket and exterior of the head may enable use of this wrench when only a very small turning arc is available . a second embodiment of the instant invention may also consist of a hollow cylindrical socket 40 and handle assembly 41 . referring to fig7 , the socket 40 may be divided into two interior compartments , an upper compartment and a lower compartment , by means of a transverse partition 46 . the interior walls of both compartments may be fluted . the fluting 42 of the upper compartment may have the same tooth size and arrangement as in the lower compartment , or it may be different , according to usage and method of manufacture . there may be a depression or opening 47 with threaded walls centrally located on the upper surface of the partition 46 . alternatively , a threaded nut or small cylinder ( not illustrated ) may be welded to the center of the partition . the handle assembly 41 may also consist of a solid cylindrical head 43 with a fluted 44 outer surface and a shaft 45 . there may be a smooth bore 48 through the end of the shaft 45 and extending through the center of the head 43 . fig8 and 9 . a pin 37 having one threaded end 38 and one flattened end forming a stop 39 ( fig1 ) may be a part of the wrench . the pin 37 may be inserted downwardly through the bore 48 and fastened into the opening 47 in the partition 46 by mating the threading 38 of the pin 37 with the threaded wall of the opening 47 in the partition 46 . the length of the pin 37 may be slightly greater than the sum of the thickness of the shaft 45 , the depth of the head 43 , and the depth of the upper compartment of the socket 40 . the diameter of the pin 37 may be slightly smaller than the diameter of the bore 48 so that the pin 37 may be easily inserted through the bore 48 and so that the head 43 may be smoothly moved upward and downward while the pin 37 remains fixed in the opening 47 in the partition 46 . the stop 39 of the pin 37 may be larger than the bore 48 so that the head 43 may not slip off the end of the pin 37 . the pin 37 may be used to prevent the head 43 from becoming completely disengaged from the socket 40 and so the head 43 may be quickly and accurately reinserted into the socket 40 for greater efficiency during use . in operation , the head 43 may be set into the upper compartment of the socket 40 where the fluting 44 of the head 43 and the fluting 42 of the socket 40 may be in intimate cooperation . the pin 37 may be inserted through the bore 48 and held in place by means of the treaded opening 47 . the socket 40 may be placed over the nut or bolt to be manipulated and the shaft 45 rotated as far as space may permit . the handle assembly 41 may then be lifted upward until the fluting 44 of the head 43 is no longer in cooperation with the fluting 42 of the socket 40 while the pin 37 may prevent complete separation of two components . the shaft 45 may then be rotated in the reverse direction and the head 43 lowered back into the socket 40 . these steps may be repeated as many times as necessary until the nut or bolt is as tight as desired or as loose as desired . a third embodiment of the instant invention may be the most efficient when operating in a limited space . a socket 50 may be constructed in a similar manner to socket 40 , having a partition 56 separating the interior into two compartments . there may be a threaded depression or opening 57 in the center of the upper surface of the partition 56 . the lower compartment may have fluting 59 as previously noted . however , the fluting 52 in the upper compartment may converge inwardly toward the partition 56 . see fig1 and 12 . to accommodate the converging fluting 52 in the upper compartment , the handle assembly 51 may be altered accordingly . the head 53 of the handle assembly 51 may be frusto - conical in shape and may have fluting 54 on its exterior surface to cooperate with the converging fluting 52 of the upper compartment of the socket 50 . there may be a bore 58 through the end of the shaft 55 of the handle assembly 51 and through the head 53 as seen in fig1 . a pin 60 with a threaded end 61 may be disposed within the bore 58 and screwed into the threaded opening 57 in the partition 56 of the socket 50 . the socket 50 and handle assembly 51 form a wrench that is operable as described above . however , the inward sloping fluting 52 and frusto - conical head 53 , enable the user to reset the wrench by merely lifting the handle assembly 51 a very small distance above the socket 50 . this dissociates the two components sufficiently to rotate the handle assembly 51 in either direction and reinsert it into the socket 50 . these steps may be repeated as necessary and the turning arc may be as great or as small as the working space permits . the pin 60 of the third embodiment 50 need only be slightly longer than the thickness of the shaft 55 and the depth of the head 53 taken together . a small turning arc a may be seen in fig1 , while a larger turning arc b is illustrated in fig1 . when the straight sided socket 40 is used , the head 43 must be lifted upward a distance equal to the full depth of the head 43 , the distance c as seen in fig1 , before the head 43 may be reinserted . the advantage of the alternately shaped system of the third embodiment may be evident in reviewing fig1 which may illustrate the small distance d the head 53 must be lifted to disengage the two components before rotating and reseating the head 53 . to further increase the efficiency of the wrench , a compression spring 62 may surround the lower portion of the pin 60 extending beyond the bottom of the head 53 . a washer 63 may be placed against the spring 62 before the pin 60 is screwed into the threaded opening 57 in the partition 56 of the socket 50 . the pin 60 may have a flattened or enlarged stop 64 at the top so the head 53 may be restrained by the pin 60 from becoming completely separated from the socket 50 even under the tension of the spring 62 . see fig1 and 15 . to operate the wrench composed of socket 50 , handle assembly 51 , and pin 60 with the spring 62 , the components may be put together as illustrated in fig1 . the socket 50 may be placed over the nut or bolt to be rotated and the shaft 55 pressed downward to engage the flutings 52 and 54 . the shaft 55 may then be rotated to the left or right as needed and through the turning distance or arc as permitted by the accessible space . when rotated as far as possible the pressure on the shaft 55 may be released so that the spring 62 forces the head 53 upward . the length of the pin 60 may be dimensioned to permit the head to be raised just far enough to disengage the fluting 54 of the head 53 from the fluting 52 of the socket 50 . the frusto - conical shape of the head 53 and the corresponding shape of the upper compartment of the socket 50 may enable a very short distance d through which the head 53 must be raised to disengage the head 53 from the socket 50 . see fig1 . once the flutings are disengaged the user may rotate the shaft in either direction as far as permitted by the available space and thereafter press the shaft 55 downward to re - engage the components . the above described steps may be repeated until the nut or bolt is tightened sufficiently or removed . it should be noted that if the socket 40 and handle assembly 41 of the second embodiment are used with the pin 37 , a spring and washer may be used also . for these components , the pin 37 , as noted above must be long enough to raise the head 44 above the socket 40 in order to disengage the flutings , with or without the assist of the spring . see fig1 . the fluted socket may enable one socket to accommodate a variety of nuts and bolts of different shapes and , within limitations , different sizes . one single handle assembly may be used with more than one socket as long as the upper compartments of the sockets are of the same dimensions and have the same fluting arrangement to cooperate with the fluting of the head . the socket may then have a lower compartment with a smaller diameter to accommodate smaller nuts and bolts as seen in fig2 , or a lower compartment with a larger diameter as seen in fig2 to accommodate larger nuts and bolts . the wrench may be sold in combinations with one handle assembly and several sockets . there may be more than one such wrench combination to accommodate most common nut and bolt sizes . at times the nut or bolt to be rotated may be recessed in such a way that the handle assembly cannot reach into the area . an extender 65 may be used with the wrench . a typical extender 65 seen in fig2 may have a female cylindrical upper member 66 of comparable dimensions as the upper compartment of the socket and having the same fluting 67 . one end of a rod 68 may be affixed to the underside of the upper member 66 and the other end of the rod 68 may be affixed to a solid cylindrical male member 69 . the male member 69 may have fluting 70 about its outer surface to cooperate with the fluting of the upper compartment of the socket . in operation , the male member 69 of the extender 65 may be inserted into the upper compartment of the socket so that the user may extend the socket into the recessed area and place it over the nut or bolt to be rotated . to insure that the socket does not separate from the extender 65 a spring loaded ball 71 or other retention means known in the art may be placed within a recess in the male member 69 to hold it in place within the socket . the handle assemblies 35 and 45 described above may be used with the extender 65 in the described manner . handle assembly 51 may require the interior fluting of the upper member of the extender to converge downwardly so as to accommodate the head 53 , and the male member to be frustoconical in shape . when the nut or bolt to be rotated may be situated within a recess with insufficient room to permit any rotation of the handle assembly an alternate handle assembly may be used . one type of alternate handle assembly 72 may be seen in fig2 . a configured rod 73 may have a u - shaped section 74 near the top . there may be hand grip 75 rotatably affixed to the top of the rod 73 . a solid cylindrical male member 76 with fluting 77 about its outer surface may be affixed to the bottom of the rod 73 . in operation , the male member 76 may be inserted into the upper compartment of the socket in the same manner as noted above for the extender 65 . to insure that the socket does not separate from the male member 76 , a spring loaded ball 78 or other retention means known in the art may be placed within a recess in the male member 76 . the combination unit may then be lowered to the site of the nut or bolt to be rotated and placed over the nut or bolt . the hand grip 75 may be held in one hand and the vertical portion 79 of the u - shaped section of the rod 73 may be held in the other hand . the rod 73 may then be rotated using both hands and the nut or bolt may be rotated with it . this alternate handle assembly 72 may also be used when a nut or bolt is resistant to rotation when only a small rotation arc is available , since the added leverage obtained by the use of two hands may provide an advantage . also , continued rotation may be possible when using the alternate handle 72 since it may not have to be reset after each rotation . a similar alternate handle assembly with a frustoconical male member may be used with the socket 50 of the third embodiment . the various embodiments of the sockets of the instant invention may be manufactured from one single cylinder , more especially socket 30 . the other embodiments , sockets 40 and 50 may be made from one piece or they may be made from two sections welded together with the partition welded between the two sections . it may also be noted that the wrench may be made with an alternate socket 80 which may have a male member 81 as its upper section and a female member 82 as the head of the handle assembly 83 . a set of two or more sockets with different sized lower compartments may be accommodated by the same handle assembly 83 . while several embodiments of the instant invention have been illustrated and described in detail , it is to be understood that this invention is not limited thereto and may be otherwise practiced within the scope of the following claims . | 1 |
the drawing shows part of an annealing lehr 1 having refractory roof and sole walls 2 and 3 , along which a freshly formed glass ribbon 4 , supported on rollers 5 , is conveyed in the direction indicated by arrow 6 , from a ribbon forming section ( not shown ) of the flat glass manufacturing plant . the ribbon may for example be formed by a libbey - owens type glass drawing machine , or it may be formed by the float process . the glass ribbon passes beneath a refractory screen 9 to a coating station within the lehr . above the coating station there are fixed rails 15 which extend transversely across the top of the lehr and form a track for a carriage 16 . the carriage has rollers 17 which run along flanges of the said rails . the carriage supports a vertical tube 18 within which there are conduits such as 19 for conducting compressed air and a liquid coating material , e . g . a solution of a coating precursor compound , to a spray gun 20 which is carried by the tube 18 . driving mechanism ( not shown ) displaces the carriage 16 to and fro along the rails 15 so that the spray gun 20 travels to and fro transversely across the path of the glass ribbon 4 . the coating solution discharges from the spray gun as a steady conical spray cone 21 . the coating precursor is transformed on contact with the hot glass ribbon into the required metal oxide or other coating substance , with which the ribbon becomes progressively coated over its entire width during its travel through the lehr . ducting 22 extends through the roof 2 of the lehr , rearwardly of the track rails 15 , for conducting pre - heated gas into the lehr for heating the spray 21 in accordance with the present invention . the ducting 22 may comprise a single duct of flat elongate cross - section which extends over substantially the full width of the lehr , or it may comprise a plurality of ducts disposed side by side across the lehr . the lower end portion 23 of the ducting is disposed substantially horizontally and at a level such that the current or currents of pre - heated gas which issue from the discharge end orifice or orifices 24 of the ducting and is or are represented by the dotted lines 25 , intersect ( s ) the spray 21 at a medial region of the droplet trajectories during the reciprocation of the spray across the ribbon path . the gas current or currents can be pre - heated to a temperature above or below the normal environmental temperature at the coating station so that such current ( s ) heat or cool the droplets during their travel towards the glass ribbon . it is preferable for the ducting 22 to comprise a plurality of side by side ducts as above referred to and for heating means , e . g . electrical resistance heaters , to be provided by which the volumes of gas supplied through the different ducts can be independently heated to different temperatures . it is then possible to modify the temperature of the droplets of spray cone 21 to an extent which varies during any given traversal across the ribbon of glass . compensation can thereby be made for any residual inequalities in the temperature of the glass across the width of the ribbon , and for any accelerations and decelerations of the spray gun during each traversal of the spray cone across the ribbon , with a view to forming a coating which is of substantially uniform thickness over that width . gas discharging from the ducting 22 out of line with the spray 21 flows forwardly across the transverse path of such spray and assists in keeping that path free from vapours which may become entrapped in the spray and adversely affect the quality of the coating , as is described in the co - pending patent application ser . no . 228 , 232 claiming priority from united kingdom patent application no . 80 , 03 , 382 previously referred to . the rate of discharge of pre - heated gas from the orifice or orifices 24 is such that the spray cone 21 is not disrupted by the gas jets . the droplet trajectories are not significantly affected . at positions spaced forwardly from the path of transverse motion of the spray cone 21 across the ribbon there are exhaust ducts 26 which extend across the lehr and are connected to means ( not shown ) for maintaining suction forces in those ducts . the object of this exhaust system is to cause gases in the environment of the spray to be aspirated forwardly away from the path of reciprocation of the spray and into the entry nozzles 27 of the exhaust ducts , as suggested by the broken lines 28 , and thereby reduce the risk of spurious surface deposits on the formed coating . the suction forces are adjusted so that the trajectories of the droplets from the spray gun are substantially unaffected and the process is therefore in accordance with the invention described and claimed in united kingdom pat . no . 1 , 523 , 991 hereinbefore referred to . in addition to influencing the temperature of the spray droplets , the pre - heated gas currents issuing from the ducting 22 intercept or dilute some reaction products which may contaminate the environment behind the spray and be entrained downwardly into contact with the glass immediately before it is coated by the spray 21 . this action , which is described and claimed in the aforesaid co - pending patent application ser . no . 228 , 233 claiming priority from united kingdom patent application no . 80 , 03 , 359 , can however better be achieved by propelling currents of gas against the glass ribbon immediately to the rear of the impingement zones of the spray so that such currents flow against the bottom region of the spray cone . the illustrated apparatus can be modified by providing the ducting 22 with branch nozzles 29 as shown in broken lines so that rear gas currents acting in that manner are formed by some of the pre - heated gas supplied to the ducting 22 . the following are examples of processes according to the invention performed with the aid of apparatus as above described . coating apparatus as described with reference to fig1 was employed for coating a ribbon of glass 3 meters in width in course of its travel along an annealing lehr from a libbey - owens type glass drawing machine . the speed of the glass ribbon along the lehr was of the order of 1 meter per minute . the mean temperature of the glass ribbon at the coating station was about 600 ° c . the temperature of the marginal zones of the glass was appreciably lower than that of the central part of the ribbon width . the spray gun 20 was of a conventional type , and was operated at a pressure of the order of 4 kg / cm 2 . the gun was displaced to and fro across the ribbon path at a height of 30 cm above the glass ribbon , so as to complete nine reciprocations per minute along a path extending just beyond each side edge of the ribbon . the spray gun was directed so that the axis of the spray was at 30 ° to the plane of the glass ribbon . the spray cone angle was 20 °. the spray gun was fed with an aqueous solution of tin chloride at 25 ° c ., such solution having been formed by dissolving hydrated tin chloride ( sncl 2 2h 2 o ) in water in an amount of 375 g of the tin chloride per liter and adding per liter 55 g of nh 4 hf 2 . the rate of delivery of the coating solution was adjusted to form on the glass ribbon a coating of tin oxide doped by fluorine ions and having a thickness as near as possible to 7500 a . the suction forces in the exhaust ducts 26 were adjusted to maintain a continuous flow of environmental gases away from the path of the spray cone as suggested by arrows 28 in the drawing without disrupting the spray cone . the ducting 22 comprises ten side by side ducts covering equal portions of the ribbon width . the axes of the discharge end portions 23 of the ducts were 15 cm above the top face of the glass ribbon and the discharge orifices 24 were at a horizontal distance of 25 cm from the path swept by the rear of the travelling spray cone . pre - heated air was supplied to the ducting at a temperature such that an air current discharged from each orifice 24 at a temperature of the order of 600 ° c . the hot air was supplied to the ducting at a volume rate of about 1800 m 3 / hr to maintain from each of the ten ducts a jet 25 having a velocity of 2 m / sec . the pre - heating temperatures of the volumes of gas supplied through the ten ducts were independently adjustable in steps of 20 ° c . and the temperatures of the different volumes were independently adjusted to values such that the coating formed on the ribbon had a substantially uniform thickness across the full width of the ribbon notwithstanding the temperature gradients across the ribbon on reaching the coating station . the coating thickness at various places across the ribbon was continuously detected at a position within the lehr downstream from the exhaust ducts 26 using a laser beam and a sensor responsive to laser beam reflection , and signals from such sensor were used automatically to control the temperatures of the gas jets . in the result the coating thickness was at all positions across the ribbon 7500 a ± 200 a . in a comparative test in which the process was performed without employing the pre - heated gas jets but under otherwise unchanged conditions , the coating formed on the substrate was found to be thinner on side marginal portions of the ribbon than on its central portion . the variation in the thickness of the coating from the required value of 7500 a could not be reduced below ± 500 a . by pre - heating the gas supplied to ducting 22 to lower temperatures , e . g . to temperatures of the order of 120 ° c ., the rate of evaporation of the solvent can be reduced , thereby leading to thinner coatings . in another modification of the process according to example 1 , ducting 22 was used which had branch nozzles 29 via which a quantity of the pre - heated gas was discharged as downwardly inclined jets which impinged on the glass ribbon just to the rear of the path of the spray cone and flowed against the bottom of the spray cone during its movements across the ribbon . a comparison of the glass coated under those conditions with the glass coated without the influence of such downwardly inclined rear gas jets showed that those jets were beneficial for avoiding or reducing the occurrence of light - diffusing defects at the glass / coating interface . a coating process according to the invention can be carried out by using the apparatus shown in fig1 as in the foregoing example with the sole modification that the glass ribbon travels in the opposite direction to arrow 6 . in those circumstances the droplet stream is directed downwardly and rearwardly within the meaning of this specification . the apparatus shown in fig1 was used for coating a ribbon of float glass 2 . 5 meters in width with cobalt oxide during travel of the ribbon along the annealing lehr at a speed of 4 . 5 m / min . the spray gun was fed with a solution obtained by dissolving cobalt acetylacetonate co ( c 5 h 7 o 2 ) 2 2h 2 o in dimethylformamide in an amount of 140 g of the acetylacetonate per liter of the solvent . the gun was directed at an angle of 30 ° to the plane of the glass ribbon and was located 25 cm above the ribbon and at a position in the lehr such that the droplets of the sprayed solution impinged on the glass ribbon where the glass had a mean temperature of the order of 580 ° c . the spray gun was reciprocated at ten complete reciprocations per minute . the rate of discharge of the coating solution was adjusted to form on the glass a coating of cobalt oxide ( co 3 o 4 ) having a thickness as near as possible to 920 a . the ducting 22 comprised ten side by side ducts having their discharge orifices 24 located below the path of the spray gun and 10 cm above the glass ribbon . hot air pre - heated to 350 ° c . was supplied through this ducting 22 at a volume rate of 1500 m 3 / hr to form the side by side currents of air 25 with a velocity of 2 m / sec . the temperatures of the air currents were independently regulatable in steps of 20 ° c . and regulation was effected in dependence on signals from a coating thickness detector as in example 1 in order to keep the coating thickness an uniform as possible over the width of the ribbon . it was found that a coating could be formed which had a thickness of 920 a ± 50 a over the full width of the glass ribbon . in a comparative test in which the spray was not heated by gas currents but which otherwise employed the same conditions , it was found to be impossible to obtain a coating having such a high standard of uniformity . by heating the air supplied to ducting 22 to lower temperatures , e . g . to temperatures of the order of 150 ° c . regulatable in steps of 10 ° c ., the rate of evaporation of the dimethylformamide from the droplets and the rate of decomposition of the acetylacetonate can be decreased , thereby leading to thinner coatings . the foregoing coating procedures can be followed for forming coloured layers composed of a mixture of oxides by feeding the spray gun with a solution containing a mixture of compounds of different metals , e . g . compounds of metals selected from the group iron , cobalt , chromium and nickel , or by making use of a plurality of spray guns and feeding different solutions simultaneously through different guns . | 2 |
in fig1 and 2 there are illustrated the bag opening horns 54 and 55 . particularly , in fig1 the operator &# 39 ; s hand ( shown in fragment ) is shown inserting a chicken carcass into a top open - ended bag , supported upon a bag elevator . as the bag is filled , the operator advances bag and carcass against hocking plate 161 , pivoted between upright sides 160 , so as to activate air terminal valve 156 . table top 64 and horns 54 , 55 are then retracted axially away from the package , which is then removed by the operator for shrinking , freezing or other final packaging operation . in fig2 which is a top plan , table top 64 is shown fragmentarily , while the bag elevator is illustrated as having rear guide vertical members 100 , rear slide top cross member 102 , as well as cam track side plates 80 and 81 . the bag supply support plate 106 is urged upwardly by the lift cylinder 87 ( illustrated in fig3 ). the elevator assembly may also include a back mounting plate 79 . the bag opening horns 54 , 55 are mounted by means of identical horn retainer pins 56 which extend into horn opening adjusting holders 47 , each in turn being mounted upon t - slot plates 45 and 46 , the plates being mounted , as illustrated in fig5 and 6 upon transversely extending rods 33 or the like . horns 54 , 55 are extended transversely by means of longitudinal reciprocation of the triangular cams 154 , 155 contacting the complementary plates 152 , 153 , as cam 157 cylinder is actuated . horn 55 and / or 54 may include a moving air jet spacer arm 52 , having a movable air jet mounting block 53 . the frame assembly which supports the reciprocable table top 64 , may include side plates 108 . in fig3 there is illustrated the bag elevator lift cylinder 87 , axially aligned with the bag opening horns 54 , 55 . the longitudinally reciprocable table top 64 is shown superposed with respect to initial opening jet cover 105 and table top support gusset 115 . the apparatus frame may include corner posts 9 and , vertical members 11 and 12 superposed with respect to corner attaching plates 8 and 6 and leg assembly 3 . crossslide rod 33 is shown as supporting bushing 35 , bushing mounting block 34 and the individual t - slot plates 45 and 46 with respect to cam plate base 38 and transverse bars 39 and 40 . the table top bushing mounting block 24 is shown supporting longitudinal carriage 21 in bushing snaprings 25 for the table reciprocating or advancing cylinder 165 . in the elevator assembly cylinder 87 is mounted upon lower pivot pin 85 secured by cotter pins 84 and 86 . the elevator assembly back mounting plate 71 is shown with respect to front slide vertical member 98 . the elevator lift arm pivot mounting bracket 91 is illustrated with respect to lift arm pivot pin 92 and front slide vertical members 97 , 98 . lift arm slide rollers 95 are secured to the vertical members by means of slide roller shaft 96 . the lift cylinder 87 shaft includes a lift cylinder upper clevis 88 which engages upper pivot pin 89 . this mechanism is illustrated in phantom at the lefthand side of fig7 . in fig4 there are illustrated side plates 108 , 109 and top plate 110 supported with the frame . an air pressure manifold 114 is shown in phantom , as secured in support gusset 115 , and connectable with a plurality of pressure regulators 116 . an air pressure on - off selector switch 131 may be provided for activating the entire system . air support elbow 119 supports air control system crossnipple 128 and air supply tube 121 . an access door 130 may be provided between side plates 108 and 109 . the primary air filter 122 is supported between air supply tee 121 , and adjacent air supply tee 123 . a 0 . 01 micron coalescing air filter 124 is shown adjacent bag opening jet air supply tee 125 . a filter system support plug 126 may also be employed . a logic assembly module base , generally illustrated at 129 may be provided for activating the various reciprocating cylinders and pressurized air valves . at the right hand side of fig7 the air control assembly is further illustrated as including a control panel backplate 107 , supply line mounting plate 120 and air supply conduit 118 . the logic elements 140 and 142 are shown supported above logic valve 141 and logic assembly standoff 142 , secured by logic base strap 145 . functional control pressure regulator manifold 114 , secured by means of bottom gusset 113 . a logic manifold 146 is shown , in phantom . also illustrated in fig7 is rear end table top run out protective cover 134 which is stationary . in the mid - section of fig7 table top 64 is shown supported above table top support cross member 61 , top gusset 115 and support upright 62 . a lower support gussett 63 may also by employed to secure the entire mechanism adjacent carriage assembly base plate 28 . a limit valve mounting bracket 76 may also be employed together with valve mounting bracket 67 and mounting bar 69 , as well as power valve mounting bracket 68 and mounting bar 70 . cam slide driving cylinder front mounting plate 58 is shown adjacent the cylinder 157 . initial opening jet orifice block 104 is shown positioned adjacent initial open jet cover 105 . air jet spacer arm 52 is shown adjacent moving air jet mounting block 53 , the pressurized air for bag opening was diverted through air jet quick disconnect valve 150 and coupler 151 . initial opening jet orifice block 104 and initial opening jet cover 105 are illustrated in phantom . for the purposes of poultry packaging , it is assumed that a source of pressurized air is provided for maintaining a constant 80 p . s . i . air supply to the air supply tube 121 . 1 . the operator takes a wicket load of bags , removes the two ( 2 ) rubber grommets retaining the bags on a conventional wicket ( not illustrated ) and inserts the two legs of the wicket into the proper holes in the elevator lift slide and straightens the bags on bag support plate 106 . 2 . the operator places the &# 34 ; run / stop &# 34 ; toggle selector valve in the &# 34 ; stop &# 34 ; position and then slides the &# 34 ; main air supply sleeve valve &# 34 ; into the &# 34 ; open &# 34 ; or &# 34 ; full forward &# 34 ; position . this supplies air to the entire machine causing the following things to occur : a . the bag elevator rises to its uppermost position , locking the cross - bar of the wicket against the bag opening air blast plate . when the bag elevator is fully up , the operator moves the &# 34 ; run / stop &# 34 ; toggle selector valve to the &# 34 ; run &# 34 ; position . the following actions occur : a . the bag opening air blast is turned on , blowing open the top bag on the elevator . c . after an adjustable delay , the table top carriage moves forward . this was accomplished because when the run / off selector valve was moved to the &# 34 ; run &# 34 ; position , the automatic air circuit was then pressurized to the supply port on each of the limit valves in the circuit . the rear most limit valve ( lv - 1 , not illustrated ), which is &# 34 ; normally closed &# 34 ; is held open by the limit valve activator for air to flow through it to pressurize the pilot port on the horns open and close power valve , which causes the horns 54 , 55 to close , if not already closed , as is the case on initial start - up . it also supplies air to the time delay valve ( td - 1 , not illustrated ) which controls the signal to make the carriage movement power valve to shift to move the the horns into the opened top bag . this occurs after the time set on the timer allows the control valve portion of the timer to allow air to pass to the pilot port on the carriage movement power valve , which controls forward motion on the carriage . the carriage moves full forward causing the limit valve activator bar to depress the full forward limit valve ( lv - 2 ) and releasing limit valve ( lv - 1 ). a . lv - 2 is now allowing air to flow to the opposite side of the bag opening power valve pilot port , thus shifting the spool to the &# 34 ; off &# 34 ; position stopping all air flow to the bag opening jets and blast nozzle . b . it also pressurizes the pilot port on the horns &# 34 ; open / close &# 34 ; power valve to shift that valve to the horns open ( or stretch ) position . c . it further sends a signal to the elevator &# 34 ; up &# 34 ; air supply line control valve shutting off the air supply to the elevator lift cylinder , and to a time delay valve ( td - 2 ) which controls the amount of air to be bled out of the elevator lift cylinder to control the amount of &# 34 ; drop &# 34 ; which will occur before the timed valve closes , stopping the air from further bleeding out of the elevator lift cylinder . this elevator drop is a feature used to release the bag wicket cross - bar from the bag opening jet plate , a controlled amount , to prevent locking the portion of each individual bag from being torn off between the wicket holes in each bag and leaving a slug of plastic film which prevents proper opening of the next bag as well as the possibility of introducing those slugs into bags further down in the stack . 3 . the machine is now ready with the bag to be filled stretched open , the air blast turned off and the elevator dropped to its proper position . the operator procures the product to be loaded into the bag , usually a &# 34 ; whole fryer &# 34 ;, by its two legs , places it on its back with the wings between the &# 34 ; lead - in &# 34 ; portion of the two horn blades which have entered and are holding the bag in its stretched open position proceeds to push the chicken into the bag until the chicken and bag press against the swinging &# 34 ; hocking plate &# 34 ;. when the chicken first presses against the swinging &# 34 ; hocking plate &# 34 ;, the pivoting action of the plate depresses limit valve ( lv - 4 ) which sends a signal to the pilot port on the carriage movement power valve which shifts its spool to cause the carriage to move back , pulling the horns out of the loaded bag as the operator finishes &# 34 ; hocking &# 34 ; the chicken . backward movement of the carriage causes the limit valve activator bar to release limit valve ( lv - 2 ) which releases the air pressure holding the &# 34 ; elevator up &# 34 ; blocking valve , allowing it to open and let air return to the elevator lift cylinder to the &# 34 ; full up &# 34 ; position and to reset the elevator lift cylinder bleed valve time delay valve . the operator now lifts the loaded bird out of the &# 34 ; hocking station &# 34 ; and either ties and trims the bag at an attachment mounted on the machine or places it on a conveyor or other device of the processors choosing and the bag is &# 34 ; tied and trimmed &# 34 ; down stream from the loader . 4 . the return of the carriage automatically causes the limit valve activator bar to first trip or open lv - 2 which starts the bag opening air flowing again and when fully back trips or opens lv - 1 to start a new cycle . in the event of a &# 34 ; hocking station &# 34 ; is not used or the horns fail to enter and open the bag or a defective bag tears and allows the horns to move fully open , an activator on the horn opening slide , trips or opens a limit valve ( lv - 4 ) which sends a signal to the carriage movement power valve causing it to shift its spool to make the carriage to move back . both lv - 4 and or lv - 5 cause the same action . cylinder speed for both the carriage movement and the horns open and closing movement are controlled by individual adjustable needle valves in the exhaust ports of their respective power valves . to insure clean , oil free air to open the bags , a primary air filter 122 is used first in the line of the incoming air and then proceeds down stream through a &# 34 ; oil removing filter &# 34 ; 124 which removes all of the oil vapors which might be present in the air . moving the main air sleeve valve to its rearmost position releases all air pressure in the machine and also allows the bag elevator to drop to its lowest position . the dropping of the elevator slide causes the top portion of the elevator slide to move outward from the vertical position to facilitate loading of a wicket of bags . the horn holder blocks 47 are held in place by a tee - nut so that each horn assembly is individually and infinitely adjustable for proper position to enter and open various sized bags . air pressure to the control circuit , carriage movement power valve , horn stretch power valve , elevator lift cylinder and the bag opening air power valve are all individually adjustable by individual regulators or needle valves . the horns and table top and the flexible air line to the air blast nozzle are easily removable for easy access to clean the machine inside and out to meet u . s . d . a . requirements . the &# 34 ; hocking station &# 34 ; is adjustable to allow for different size products if required . also , there is a provision to adjust the height of the table top surface in relation to the floor . | 1 |
referring now to the drawings , fig1 shows merely those units which are necessary for an understanding of the present invention . filters , limiters and amplifiers have been deleted in fig1 . the signal interpreting circuitry begins with the incoming lines t1 to t4 and h1 to h4 . lines t1 to t4 carry frequencies pertaining to a first group or band of low frequencies , and lines h1 to h4 carry frequencies pertaining to a second group or band of high frequencies . the differences of potential appearing on the aforementioned lines t1 to t4 , and h1 and h4 , are those of the audible frequency receivers ( not shown ) of the group or band of low frequencies and that of high frequencies . reference characters a1 to a5 have been applied to indicate five outgoing lines of the system . the called numbers are received in what is often termed the touch - tone code , also referred - to as pushbutton code , or key code , since touch - tone is a trademark of the bell system . the outgoing lines a1 to a4 of the signal interpreting circuitry carry the called numbers in bcd format in which they are transmitted by appropriate coupling or transmission means to the register of the telephone system . the outgoing line a5 informs the register of the presence of a new number and delays the end of key pressure . assuming that a calling subscriber at the remote end of the line depresses the key number 3 for the period of time indicated in line 1 of fig3 . as a result , the transmitters in the key or pushbutton selector produce the trains of oscillations shown in line 2 of fig3 . according to ccitt code 2 × 1 - out - of - 4 signal code the line carries simultaneously the frequencies of 697 hz and 1477 hz . the audio receivers ( not shown ) tuned to these frequencies oscillate and interrupt their oscillations as indicated in line 3 of fig3 and supply the incoming lines t1 and h3 with signals to be interpreted shown in line 4 of fig3 as d - c pulses . the code tester cp shown in fig1 determines that one , and only one , frequency of each frequency group is received . in the affirmative , unit cp transmits these voltages -- je of line 4 of fig3 -- instantly to the delay line vz1 also shown in fig1 . delay line vz1 has a delay time of , for instance , 15 ms as a result of which a voltage pulse received by delay line vz1 is subsequently , or 15 ms later , received by the serially arranged delay device vz2 , unless -- as shown at the beginning of lines 4 and 5 of fig3 -- prior to the termination of the delay period of , e . g . 15 ms , the voltage level at the signal receiver undergoes a short time reduction . in that instance delay line vz1 returns instantly to its initial state , and produces only 15 ms after the return of the voltage je to normal the output voltage jf , as shown on line 5 of fig3 . simultaneously with the appearance of the voltage pulse jf , a voltage pulse te appears at the output of delay device vz2 . this has been indicated in fig1 and the voltage pulse te has been shown in line 6 of fig3 . the arrow in line 6 of fig3 indicates the steeply rising leading edge of voltage pulse te . in fig1 reference characters sp1 , sp2 , sp3 , sp4 have been applied to indicate four bistable storage logic elements having dynamic inputs e2 . the aforementioned steep leading edge of pulse te causes a change of state of elements or flip - flops sp1 , sp2 , sp3 , sp4 . as a result , the four outputs a1 , a2 , a3 , a4 of flip - flop sp1 , sp2 , sp3 , sp4 assume the voltages which correspond to their previously set inputs e1 and e3 . in the specific example under consideration , i . e . transmittal of the fig3 only the bcd outputs of 2 0 = 1 and 2 1 = 2 of the code converter uc carry a voltage . this voltage is supplied to the inputs e3 of flip - flops sp1 to sp4 and , upon being inverted , also supplied to the inputs e1 of flip - flops sp1 to sp4 . these voltages appear at the outputs a1 and a2 of flip - flops sp1 and sp2 as shown in lines 7 and 8 of fig3 . no output voltage appears at the outputs a3 and a4 of bistable devices or flip - flops sp3 and sp4 . the pulse te for controlling flip - flops sp1 to sp4 with its steep leading edge appears also at the output a5 , and forms a control signal which , when transmitted by a transmission line connected to output a5 to the register of the system , informs the register that new numbers may be received from output terminals a1 to a4 . the voltage signal te restores delay line vz2 to its original state only after a predetermined disconnecting delay period tps which , for instance , may be 25 ms following zero of the voltage pulse jf . this has been shown in lines 5 and 6 of fig3 . since the total time of the second disturbance lasting less than 10 ms ( see lines 3 and 4 of fig3 ) plus the delay time ts ( see line 5 of fig3 ) is less than the time tps , the second disturbance has no consequence , and the signal voltage te drops to zero only about 25 ms upon release of pressure upon the dialing key . this is apparent from line 6 of fig3 . the trailing edge of this signal voltage has no effect upon storage means sp1 to sp4 , i . e . the voltages of outputs a1 and a2 remain unchanged at least to the time of the next rise of the voltage te ( see lines 7 and 8 of fig3 ). it will thus be apparent that disturbances as , for instance , the second short decline of the voltage level , do not result in a change or a repetition of the interpretation of the signal . the right side of the diagrammatic representation of fig3 shows the effects of another depression of one of the dialing keys , namely that of actuating key number 5 . the time of key depression is about 40 ms and so short that after a build - up time of the line of about 20 ms and a protective period ts of 15 ms there remains an impulse time jf ( see line 5 of fig3 ) of but a few msec . in order to secure proper signal interpretation delay element vz2 prolongs that impulse for a period of time tps , or 25 ms , as shown in line 6 of fig3 . according to the recommendations of the ccitt the number 5 is formed by the second frequency ( 770 hz ) of the group or band of lower frequencies and by the second frequency ( 1336 hz ) of the group or band of upper frequencies . hence signal interpreting inputs t2 and h2 carry voltages which are converted by the code converter uc into outputs 2 0 = 1 and 2 2 = 4 . since output 2 0 carried a voltage when number 3 was transmitted , the voltages of set terminals e1 and e3 of storage device of flip - flop sp1 remain unchanged -- as shown on line 7 of fig3 -- and , therefore , also the voltage at the output a1 when the storage devices sp1 to sp4 are reset by the leading edge of the signal voltage te ( see line 6 of fig . 3 ). as this leading edge appears , the voltage heretofore prevailing at the output a2 disappears , as shown in line 8 of fig3 and reset storage device sp3 exhibits a voltage at its output a3 shown in line 9 of fig3 . the voltage that appears simultaneously at the signal output terminal a5 which lasts at least 25 ms ( see line 6 of fig5 ) informs the register of the central station that the code transmitting lines carrying the outputs a1 to a4 now transmit another dial number . the register may accept the number immediately and transmit an acknowledgement signal back to the dial receiver to the effect that -- irrespective of the subsequent duration of the pressure exerted upon a dialing key , the dial receiver is not needed any longer , and its bistable storage means may be reset , or cancelled . as an alternative , the register may scan the transmitted dial number in the period of time available up to the next change of signal . depending upon selection of either of these alternatives , the holding time and the number of required tone receivers and signal interpreting and interrogating means may change . referring now more specifically to fig2 this figure shows in more detail the time delay means vz1 and vz2 of fig1 and the operational amplifiers forming a part thereof . if the code tester cp ( fig1 ) supplies a high input voltage je to the terminals shown to the left of fig2 a base current flows through transistor t1 . this current removes the short across capacitor c1 by the collector - emitter circuit of transistor t2 . hence capacitor c1 starts to be charged through resistor r1 . capacitor c1 reaches the positive voltage determined by the position of a potentiometer connected to the positive input terminal of operational amplifier v1 within a time t1 = r1 . sup .. c1 ( ts = 15 ms ). then the output voltage jf which had previously been positive drops suddenly to 0 . as a result , capacitor c2 is suddenly charged 10 volt by way of diode d1 , the voltage at the negative input of amplifier v2 changes from plus 10 volt to 0 , and the output voltage of amplifier v2 rises simultaneously from 0 to plus 10 volt . the current which had flowed heretofore from the plus 5 volt terminal by way of diode d2 and the output terminal of the amplifier v2 to 0 is interrupted by diode d2 , and the voltage at the terminal te rises from 0 to to plus 5 volt . this voltage remains unchanged upon reversal of the output voltage of amplifier v1 from 0 to plus 10 volts as long as the charge of capacitor c2 being discharged by way of resistor r2 exceeds the voltage which is applied to the positive input of amplifier v2 by a fixedly adjusted potentiometer . the time of discharge tps = r2 . sup .. c2 terminates at about 25 ms , and then the voltage at the negative input of amplifier v2 exceeds that at the positive input , and the output voltage of amplifier v2 changes again from plus 10 volt to 0 , a change which is accelerated by the positive feed - back of the amplifier . therefore the terminal voltage te drops likewise from plus 5 volt to 0 . the times relating to the delay means vz1 and vz2 are given only by way of example , and depend upon the prevailing conditions of signal evaluation . it the period of protection ts is relatively long , this enhances protection against disturbances by voice transmission , but it reduces the times required for recognition of frequency , and consequently the number of frequencies that can be recognized per unit of time . this is so since the time tsp must exceed the longest interruptions of signals that may occur by the time of the periods of protection ts . if this condition were not met , too long key - depressing times might result in plural signal recognition . | 7 |
hereinafter , preferred embodiments are described in detail with reference to the accompanying drawings so that those skilled in the art to which the present invention pertains may easily practice the present invention . in this case , in describing the preferred embodiments of the present invention in detail , a detailed description of the known functions or elements will be omitted if it is deemed to make the gist of the present invention unnecessarily vague . furthermore , the same reference numerals designate elements having similar functions and operations throughout the drawings . in addition , throughout the specification , when it is described that one element is ‘ connected ’ to the other element , the one element may be ‘ directly connected ’ to the other element or ‘ indirectly connected ’ to the other element through another element . furthermore , when it is described that one element ‘ includes ’ another element , it means that the one element does not exclude another element , but may include other elements , unless otherwise described . fig1 is a diagram illustrating the configuration of an interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention , and fig2 is a diagram illustrating a process of measuring current through the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig1 , the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention may be configured to include magnetic sensor modules 100 , a signal collection module 200 , and a signal interference correction module 300 . more specifically , in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention , as illustrated in fig2 , the n magnetic sensor modules 100 installed adjacent to respective n busbars 10 may measure the amounts of current i 0 , i 1 , . . . , i n , . . . , i n in their respective locations . the signal collection module 200 may collect the measured amounts ( measured signals ) and transfer the collected amounts to the signal interference correction module 300 . the signal interference correction module 300 may derive corrected current values i ′ 0 , i ′ 1 , . . . , i ′ n , . . . , i ′ n from which interference has been removed by calculating the amount of interference between the busbars . each of the elements of the single - point detection current sensor proposed by the present invention is described below . the magnetic sensor modules 100 are brought in insulation contact with or installed adjacent to the plurality of respective busbars 10 , and they may measure currents flowing into the busbars 10 using magnetic sensors and output the measured currents . since the magnetic sensor modules 100 are installed in the respective busbars , the magnetic sensor modules 100 and the busbars 10 may be configured to have the same number . the magnetic sensor modules 100 may function to convert magnetic field lines , generated by currents flowing into the multiple busbars 10 , into electrical signals . fig3 is a diagram illustrating the current measurement method of the magnetic sensor module in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig3 , when current flows into the busbar 10 , a magnetic field line is formed according to the right - handed screw rule . the magnetic sensor module 100 may convert the magnetic field line into an electrical signal and measure current flowing into the busbar 10 . in accordance with an embodiment of the present invention , the magnetic sensor module 100 may be configured to include a magnetic sensor which is brought in insulation contact with or installed adjacent to the busbar 10 and which collects a magnetic field line generated by current flowing into the busbar 10 and a signal analysis circuit which interprets a signal collected by the magnetic sensor and calculates back to information about current that flows into the busbar 10 . the magnetic sensor may use a hall sensor , but is not limited thereto . various sensors may be used as the magnetic sensor . fig4 is a diagram illustrating a case where interference is generated due to current that flows into a busbar adjacent to a single busbar in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig4 , if several busbars 10 are disposed as in a common switch board or panel board environment , a magnetic sensor module 101 mounted on a busbar 11 whose amount of current is to be measured is also influenced by a magnetic field that is subject to interference attributable to current flowing into an adjacent busbar 12 in addition to current flowing into the corresponding busbar 11 . this may be a further serious problem if the distance between the busbars 10 is close , if current flowing into an adjacent busbar is strong , or if perfect shielding is difficult due to a problem , such as the discharging of high voltage . furthermore , although physical shielding is performed , a certain amount of an interference phenomenon is generated because a leaking magnetic field is not perfectly shielded . in order to solve such a problem , the inventor of the present invention proposes that an accurately corrected current value from which interference has been removed can be derived using an interference coefficient , formulated or modeled from a previously measured value , in a measured signal measured by each busbar 10 by including the signal collection module 200 and the signal interference correction module 300 . the signal collection module 200 may function to collect measured signals output by the plurality of magnetic sensor modules 100 and transfer the collected signals to the signal interference correction module 300 . the signal interference correction module 300 may derive corrected current values from which interference has been removed by calculating the amounts of interference between the plurality of busbars 10 in the signal collected by the signal collection module 300 . fig5 is a diagram illustrating a detailed configuration of a signal interference correction module in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig5 , the signal interference correction module 300 of the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention may be configured to further include an interference coefficient matrix generation unit 310 , an interference coefficient derivation unit 320 , and a correction current value calculation unit 330 . in some embodiments the signal interference correction module 300 may be configured to include interference correction memory 340 . the interference coefficient matrix generation unit 310 may generate an interference coefficient matrix . the interference coefficient may be represented by h n , m , which means the amount of current that flows into an n th busbar 10 and that interferes with an m th busbar 10 . fig6 is a diagram illustrating a structure for modeling an interference equation in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig6 , the amount of interference current measured by an ( n + 1 ) th magnetic sensor modules 100 due to current i ′ n actually flowing into the n th busbar 10 may be represented by h n , n + 1 * i ′ n . accordingly , current in measured by the n th busbar 10 may be represented by the amounts of interference current h 0 , n * i ′ 0 + h 1 , n * i ′ 1 + h 2 , n * i ′ 2 . . . based on the amount of current i ′ n actually flowing into the n th busbar 10 and the amounts of current i ′ 0 , i ′ 1 , i ′ n − 1 , and i ′ n + 1 flowing into adjacent busbars 10 . assuming that a matrix indicative of current actually flowing into each busbar 10 is i ′ and a matrix indicative of current measured by the magnetic sensor modules 100 is i , a measured current i may be equal to h * i ′ ( a value obtained by multiplying actual current by an interference coefficient ) according to an interference coefficient matrix h ( refer to equation 1 and a matrix below ). that is , the measured current i may be considered to be a value influenced by interference attributable to the actual current i ′ that flows into the adjacent busbars 10 . the interference coefficient matrix h may be defined in a table form by measuring a temperature and the distance through experiments . if h is the function of i ′, that is , if h is influenced by i ′, i ′ may be calculated as a converging value by repeatedly calculating i = h − 1 * i and obtaining h after obtaining h in the state in which the initial value of i ′ is set to i . h 00 , h 11 , h 22 , and h nn denote ratios of the busbars 10 to be measured which are influenced by the respective busbars 10 and each may be 1 , but may not be 1 depending on variables , such as a temperature , the amount of current , and the distance . the aforementioned interference coefficient matrix may be derived in an equation form according to the physical shape of the busbars 10 and the magnetic sensor modules 100 or may be derived by measurement in an actual environment . furthermore , the aforementioned interference coefficient matrix may be featured according to environment variables , such as a temperature , the distance from a busbar , and the intensity of a magnetic flux , and a value in an environment in which measurement is not performed may be estimated through an interpolation method . experimentally , if current is made sequentially flow into the busbars and measured , when current of 1 a flows into only a no . 1 busbar 10 , a measured current i 0 in a no . 0 busbar is i 0 = h 0 , 0 * i ′ 0 + h 1 , 0 * i ′ 1 + h 2 , 0 * i ′ 2 + . . . + h n , 0 * i ′ n + . . . + h n , 0 * i ′ n . ( in this case , i = current measured by the magnetic sensor module , h n , m = an interference coefficient of current that flows into the n th busbar and that interferes with the m th busbar , i ′= actual current , n = order of a busbar to be measured ) if the actual current is substituted in the measured current , i 0 = h 1 , 0 * i ′ 1 . that is , if current of 0 . 1 a is measured in the no . 0 busbar 10 when an actual current of 1 a flows into the no . 1 busbar 10 , the no . 0 busbar 10 is subject to interference of 10 % due to the no . 1 busbar 10 . in this case , an interference coefficient h 1 . 0 becomes 0 . 1 . meanwhile , although the busbars 10 are assumed to be very regularly installed , such an interference coefficient has a basic physical difference attributable to the distance between the busbars 10 and the distance between the magnetic sensor module 100 and the busbar 10 . accordingly , an interference coefficient needs to be calculated in each of the regularly configured busbars 10 . meanwhile , the interference coefficient may differ depending on a temperature , the intensity of a magnetic flux ( the amount of current ), and the distance between a measured location and the busbar 10 . preferably , a plurality of the interference coefficient matrices may be generated in each predetermined unit within a predetermined range of one or more variables selected from the group consisting of a temperature , the amount of current , and the distance between a measured location and the busbar 10 . the plurality of generated interference coefficient matrices may be stored in the interference correction memory 340 or another separate memory . that is , the interference coefficient may be measured based on a temperature and the intensity of a magnetic flux . the amount of physical interference is proportional to the amount of current , but may be different depending on the arrangement of busbars and a degree that interference is shielded . the matrix h according to a temperature and the amount of current may be derived by measuring the interference coefficient using a different amount of current for each temperature in the aforementioned experiments , and a coefficient may be extracted using an interpolation method with respect to a required part and may be used . accordingly , a plurality of the matrices h may be present with respect to a temperature value and a current value . input for selecting the actual coefficient includes a temperature and the intensity of current . reference may be made to a coefficient corresponding to a temperature value suitable to a matrix h using the temperature value measured by a temperature sensor . as a similar method , a matrix value for the intensity of current has only to be selected based on the current i measured after a temperature value is determined . for example , the aforementioned experiments correspond to a case where the matrices were measured using the amounts of current 1 a , 10 a , 25 a , and 50 a at temperatures of − 40 degrees , − 20 degrees , 0 degrees , 20 degrees , 40 degrees , 60 degrees , and 80 degrees with respect to the busbar 10 of 50 a standard , which is represented by h ( t , c ) for convenience sake . in this case , t is assumed to be a temperature , and c is assumed to be the amount of current . with respect to such a combination , the matrix h has a total number of 4 ( the number of types of the amounts of current )* 7 ( the number of types of temperature ) types = 28 types . if a temperature when the busbar 10 operates is about 40 degrees , the amount of current i ′ 0 is 10 a , and the amount of current i ′ 1 is 20 a , h ( t , c ) results in h ( t = 40 degrees , c = 10 a ) because the first row of the matrix h is an interference coefficient attributable to i ′ 0 , and h ( t , c ) results in h ( t = 40 degrees , c = 20 a ) because the second row is an interference coefficient attributable to i ′ 1 . if a temperature or a current value is not included in the table , h ( t , c ) may be calculated using an interpolation method . mathematical modeling is possible because an influence attributable to the distance and the amount of current that belong to the interference coefficients corresponds to a physical phenomenon . the interference coefficient matrix may be modeled based on the distance from the busbar and the amount of current measured in the busbar because a magnetic flux density b is in inverse proportion to the distance and is proportional to the amount of current . that is , the interference coefficient matrix may be modeled and generated according to the following equation . ( in this case , b = a magnetic flux density , u 0 = permeability in vacuum , i = current , r = the distance from a conductor ( the distance from the busbar or an adjacent busbar ), dl = the curvilinear integral of a current direction , and r ̂= a unit vector in a direction r ) in summary , each element h n , m of the matrix h may be considered to be a function , such as each distance , current , shielding , or temperature . the element may be determined by performing measurement for each temperature , for each current , and for each distance , performing measurement in the state in which the busbar 10 has been installed , or performing modeling . the interference coefficient derivation unit 320 may derive the interference coefficient of a corresponding busbar 10 using an interference coefficient matrix or an interpolation method . the correction current value calculation unit 330 may derive a corrected current value using a corresponding interference coefficient . furthermore , the interference correction memory 340 may store the interference coefficient matrix generated by the interference coefficient matrix generation unit and an interference correction equation for deriving the corrected current value using an interference coefficient . the interference coefficient derivation unit 320 and the correction current value calculation unit 330 may read a value necessary to correct the interference of a measured signal from the interference correction memory 340 and calculate the corrected current value . meanwhile , an actual interference coefficient having sufficient accuracy may be obtained by taking into consideration only interference with a secondarily adjacent busbar because interference in the busbar 10 is rapidly attenuated according to the distance . accordingly , the actual interference coefficient may be represented very simply as in the following equation and the matrix . ( in this case , i = current measured by the magnetic sensor module , h n , m = the interference coefficient of current that flows into the n th busbar and that interferes with the m th busbar , i ′= an actual current , and n = order of a busbar to be measured ) the above example illustrates an example in which the interference of a signal sampled on a time axis has been removed . if the interference of current remains constant for a short time , the amount of currents i ′ and i may be converted into complex numbers by taking a phase into consideration and calculated at once without calculating them for each current sampling value , thereby being capable of reducing a total computation load . fig7 is a diagram illustrating the configuration of an interference correction type single - point detection current sensor for multiple busbars in accordance with another embodiment of the present invention . as illustrated in fig7 , the interference correction type single - point detection current sensor for multiple busbars in accordance with another embodiment of the present invention may be configured to further include a temperature measurement module 400 . a plurality of interference coefficient matrices may be generated in each predetermined unit within a predetermined temperature range and stored . the signal interference correction module 300 may derive a corrected current value using an interference coefficient matrix that complies with a temperature measured by the temperature measurement module 400 . furthermore , the single - point detection current sensor may be configured to further include a measurement error correction module 500 for deriving a measurement error correction value for each sensor by calculating environment variables , including a temperature , the distance from the busbar , and the intensity of a magnetic flux , with respect to a measured signal output by the magnetic sensor module . the signal interference correction module 300 may derive a corrected current value based on a measurement error correction value derived by the measurement error correction module . each of the magnetic sensor modules 100 may have an error attributable to environment variables , such as a temperature , the distance , and the intensity of a magnetic flux , and thus may derive a measurement error correction variable according to environment variables , such as a temperature and the distance , by comparing the measured amount of current , measured by each busbar not having interference , with the actual amount of current . such a measurement error correction variable may be stored in separate memory and used . the present invention described above may be modified or applied in various ways by those skilled in the art to which the present invention pertains , and the scope of a technical spirit according to the present invention should be determined by the following claims . | 6 |
referring now in detail to the illustrative embodiment depicted in the accompanying drawings , there is shown in fig1 a pressure regulator 10 having an inlet end portion 12 and an outlet end portion 14 . the inlet end portion 12 is adapted for connection to a source of fluid pressure such as a tank of pressurized breathing air as conventionally used by scuba divers . an output portion 16 of such a breathing tank is shown in fragmentary form in operative connection with the inlet portion 12 . the inlet end portion 12 includes an inlet passage 13 which leads to a pressure chamber 18 . adjacent to pressure chamber 18 and in communication therewith is an outlet passage 15 disposed in outlet end portion 14 . a valve actuator housing 20 is disposed adjacent to pressure chamber 18 . a floating piston 22 is slidably mounted within housing 20 for movement therein in a sealed manner by means of the sealing ring 24 which is disposed in the circumferential surface of piston 22 so as to interact with the interior wall of housing 20 . piston 22 has associated therewith a valve stem 26 and a valve member 28 . the valve member 28 and valve stem 26 , being integrally formed with piston 22 , undergo movement therewith . valve member 28 is adapted to engage a valve seat 30 formed as part of the inlet end portion 12 . in this regard , the valve member 28 carries a sealing element 32 . the valve stem 26 carries a sealing member 34 which sealingly engages that portion of the regulator body in which the valve stem is mounted . the valve member 28 and valve stem 26 respectively include connecting passages 36 and 38 whereby pressure in chamber 18 is openly communicated to the chamber defined in the lefthand interior of housing 20 and end surface 22a of piston 22 . a pressure bleed means in the form of a passage opening 40 is provided in piston 22 to extend between piston end surface 22a and piston end surface 22b . as will be more fully described hereinbelow , the passageway 40 is further formed with an orifice configuration 42 adjacent to the piston end surface 22b . a biasing means in the form of coil spring 44 is provided within the valve actuator housing 20 to engage the end surface 22b if piston 22 so as to urge the latter , as well as the valve stem 26 and valve member 28 , away from valve seat 30 . the valve actuator housing 20 is affixed to the main body portion of the regulator by means of a threaded engagement at 48 and is sealed with respect to the main portion of the regulator by use of a sealing gasket 50 . however , a pressure relief opening 52 is provided through the wall of the valve actuator housing 20 so as to insure that ambient pressure will be reflected in the chamber defined by end surface 22b of the piston , the right - hand portion of housing 20 and the main body of the regulator . a check valve 53 is provided over vent hole 52 to prevent water from entering , while allowing for exhaust of air from orifice 42 . as described in part hereinabove , it has been common practice in the prior art to provide a pressure relief opening such as 52 to provide communication of ambient pressure changes to surface 22b of piston . accordingly , the force exerted by spring 44 and ambient pressure conditions can be predicted . in the general use of the regulator 10 , a supply pressure on the order of 200 to 4 , 000 psi may be supplied through inlet passage 13 -- in other words , the supply pressure undergoes considerable variation as the breathing air is consumed . the principal purpose of regulator 10 , therefore , is to provide or rather maintain a constant output pressure , for example on the order of 150 psi above ambient , which in turn can be effectively consumed by a user of associated scuba diving apparatus . accordingly , the regulated pressure , say 150 psi , is to be maintained in the pressure chamber 18 which in turn communicates such regulated pressure to the output passage 15 disposed in the outlet end portion 14 . furthermore , the regulated pressure in chamber 18 is communicated to the end surface 22a of piston 22 by the passage 36 and 38 . as to be understood by those skilled in the art , the regulated pressure acting on surface 22a of piston 22 imparts a specified force on the piston tending to urge the same to the right so as to close valve member 28 against the valve seat 30 . to counteract this tendency , biasing means , such as spring 44 , can be formed to engage surface 22b of the piston so as to be operable to afford substantially a constant force on piston 22 throughout its range of travel with respect to a regulated pressure in chamber 18 . the force of spring 44 is transmitted to end surface 22a of the piston . should the valve member 28 tend to close against valve seat 30 too much so that the pressure in chamber 18 falls below the desired regulated level , the force applied to end surface 22a of the piston proportionately decreases and the biasing means 44 would tend to open the valve member 28 so as to increase the pressure in chamber 18 and corresponding pressure applied to surface 22a of the piston . conversely , if the valve member 28 tends to open too much with respect to valve seat 30 , the pressure in chamber 18 would exceed the desired regulated level and the corresponding greater amount of force applied to end surface 22a of the piston would tend to move the latter to the right , as viewed in fig1 against the biasing means 44 so as to close down the valve member 28 until the regulated pressure level is reached . in this manner of employing counterbalancing forces , a substantially regulated pressure level is maintained in the output passage 15 . when the regulator is in use , water necessarily could pass inwardly of housing 20 through the pressure relief opening , 52 , absent the present invention , so as to completely fill the volume of space in which the biasing spring 44 is disposed . this water would be necessary to transmit ambient water pressure to surface 22b of piston . normally , this would not present a problem ; but when the regulator is used in extremely cold water , potential icing can take place about the biasing spring 44 which would preclude proper functioning thereof . under such circumstances , a highly dangerous situation could be presented if , for example , the biasing means 44 became inoperative and the force exerted on end surface 22a of the piston urged the valve member 28 to close against the valve seat 30 . with a view towards the potential safety hazard related to water , and particularly very cold water , being present in the area of housing 20 including the biasing spring 44 , the present invention teaches the provision of the pressure bleed means 40 to maintain the housing 20 free of ambient water . a continuous flow of air , restricted in amount by orifice 42 , flows into the housing 20 around spring 44 outwardly through the pressure relief opening 52 . a check valve 53 is provided over vent hole 52 to prevent water from entering , but allow exit of air from orifice 42 . this condition exists only when external pressure is greater than internal pressure . in this manner , ambient water cannot flow inwardly through the opening 52 . due to the relative configuration and size of the orifice 42 , the loss of breathing air will be relatively insignificant . also , the effective operation of the bleed orifice 42 and relief opening 52 can be readily checked by a scuba diver by simply placing the regulator under water and watching for air bubbles passing outwardly of opening 52 . although passage 40 and orifice 42 are shown in fig1 as part of piston 22 , necessarily equivalent types of passages could be potentially formed in the valve stem 26 or the outlet end portion of the regulator so as to bleed air into the housing 20 about the biasing spring 44 . from the foregoing , it is apparent that the objects of the present invention have been fully accomplished . as a result of this invention , an improved pressure regulator for use particularly with scuba diving equipment is provided for increasing the safety thereof . having thus described and illustrated a preferred embodiment of my invention , it will be understood that such description and illustration is by way of example only and that such modifications and changes as may suggest themselves to those skilled in the art are intended to fall within the scope of the present invention as limited only by the appended claims . | 8 |
in the following detailed description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the disclosed embodiments . it will be apparent , however , that one or more embodiments may be practiced without these specific details . in other instances , well - known structures and devices are schematically shown in order to simplify the drawing . referring to fig1 to fig4 , fig1 is a flow chart of a method for forming a case for an electronic device according to the first embodiment of the disclosure ; fig2 is a schematic view of forming the first plastic layer in the method according to the first embodiment of the disclosure ; fig3 is a schematic view of forming the pcm ( phase change material ) microcapsule layer in the method according to the first embodiment of the disclosure ; fig4 is the front view of the structure of the pcm microcapsule according to the first embodiment of the disclosure . the first embodiment of the disclosure provides a method for forming a case for an electronic device . the method comprises : s 1 : forming a first plastic layer by injection molding . specifically , as shown in fig2 , the injection molding machine 10 makes the first plastic material 14 become the first plastic layer 161 and forms the first plastic layer 161 in the mold 15 by injection molding . in this embodiment , the material of the first plastic layer 161 ( the first plastic material 14 ) is a mixture of polycarbonate and abs resin , but the disclosure is not limited thereto . s 2 : forming a pcm microcapsule layer on one side of the first plastic layer by injection molding . specifically , as shown in fig3 and fig4 , the injection molding machine 10 makes a plurality of pcm microcapsules 20 become the pcm microcapsule layer 163 and forms the pcm microcapsule layer 163 on one side of the first plastic layer 161 . in this embodiment , the pcm microcapsule layer 163 comprises a plurality of pcm microcapsules 20 . the pcm microcapsules 20 each comprises a capsule shell 22 and a capsule core 24 . the capsule core 24 is located inside the capsule shell 22 . preferably , the capsule core 24 is enclosed by the capsule shell 22 . the material of the capsule shell 22 is a high polymer , and the material of the capsule core 24 is a pcm . the melting point of the pcm is between 20 ° c . and 75 ° c ., preferably between 35 ° c . and 55 ° c . in this embodiment , the high polymer forming the case shell 22 is a mixture of polycarbonate and glass fiber . the pcm forming the case core 24 is a heat absorbing substance , such as alkanes ( e . g . icosane to triacontane ), alcohols ( e . g . decan - 1 - ol to icosane - 1 - ol ), acids ( e . g . decanoic acid to icosanoic acid ) or paraffin . however , the material and the composition of the capsule shell 22 and the capsule core 24 are not limited to the disclosure . in this embodiment , the diameter of the pcm microcapsules is between 0 . 1 and 1000 micrometers ( μm ), preferably between 10 and 30 micrometers , and more preferably between 20 and 30 micrometers . since the first plastic material 14 is a mixture of polycarbonate and abs resin , and the melting of the mixture of polycarbonate and abs resin is about 230 ° c . by comparison , the melting point the mixture of polycarbonate and glass fiber which forms the capsule shell 22 is about 285 ° c . in other words , the melting point of the capsule shell 22 is higher than the melting point of the first plastic material 14 . consequently , when the pcm microcapsules 20 is undergone the injection molding process after the first plastic layer 161 , the temperature , set for the first plastic layer 161 for the injection molding , of the injection molding machine 10 is lower than the melting point of the capsule shell 22 . thereby , structural integrity of the pcm microcapsules 20 can be maintained . moreover , the disclosure provides a case structure for the electronic device . referring to fig4 and fig5 , fig5 is the front view of the case structure for the electronic device according to the first embodiment of the disclosure . after the injection molding machine 10 forms the pcm microcapsule layer 163 on one side of the first plastic layer 161 , the users may remove the case structure 16 for the electronic device from the mold 15 . the case structure 16 for the electronic device comprises a first plastic layer 161 and a pcm microcapsule layer 163 . the pcm microcapsule layer 163 is disposed on one side of the first plastic layer 161 . in the case structure for the electronic device and the manufacturing method thereof according to the first embodiment of the disclosure , the pcm microcapsule layer 163 is disposed on one side of the first plastic layer 161 , and the pcm has a great latent heat . that is , the pcm is capable of absorbing a large amount of heat when phase is changing . therefore , the heat dissipation performance of the case structure 16 for the electronic device is improved , and this approach does not require attaching the aluminum foil and the graphite sheet on the surface of the case . thereby , the additional working cost caused by attaching the aluminum foil and the graphite sheet to the case surface , as mentioned in the related art , is eliminated . the second embodiment of the disclosure provides a manufacturing method for a case structure for an electronic device . referring to fig2 , fig3 , fig6 and fig7 , fig6 is a flow chart of a method for forming a case for an electronic device according to the second embodiment of the disclosure ; fig7 is a schematic view of forming the second plastic layer in the method according to the second embodiment of the disclosure . the manufacturing method for the case structure for the electronic device according to the second embodiment is similar to that in the first embodiment , wherein the difference is that a step s 3 is added after fig3 . the step s 3 comprises : forming a second plastic layer on one side of the pcm microcapsule layer by injection molding , wherein the first plastic layer and the second plastic layer surround the pcm microcapsule layer . in this embodiment , the material of the second plastic layer is a mixture of polycarbonate and abs resin , but the disclosure is not limited thereto . specifically , as shown in fig7 , the injection molding machine 10 make the second plastic material 26 become the second plastic player 365 and forms the second plastic player 365 on one side of the pcm microcapsule layer 363 . the first plastic player 361 and the second plastic player 365 surround the pcm microcapsule layer 363 . moreover , the second embodiment of the disclosure provides a case structure for the electronic device . referring to fig8 , fig8 is the front view of the case structure for the electronic device according to the second embodiment of the disclosure . after the injection molding machine 10 forms the second plastic layer 26 on one side of the pcm microcapsule layer 363 , the users may remove the case structure 30 for the electronic device from the mold 15 . the case structure 30 for the electronic device comprises a first plastic layer 361 , a second plastic layer 365 and a pcm microcapsule layer 363 . the first plastic layer 361 and the second plastic layer 365 surround the pcm microcapsule layer 363 . in the case structure for the electronic device and the manufacturing method thereof according to the second embodiment of the disclosure , since the case structure 30 for the electronic device comprises the pcm microcapsule layer 363 , and the pcm has a great latent heat . that is , the pcm is capable of absorbing a large amount of heat when phase is changing . therefore , the heat dissipation performance of the case structure 30 for the electronic device is improved , and this approach does not require attaching the aluminum foil and the graphite sheet on the surface of the case . thereby , the additional working cost caused by attaching the aluminum foil and the graphite sheet to the case surface , as mentioned in the related art , is eliminated . in the case structure for the electronic device and the manufacturing method thereof according to the above - mentioned embodiments , since the case structure for the electronic device comprises the pcm microcapsule layer , the heat dissipation performance can be improved . furthermore , this approach does not require attaching the aluminum foil and the graphite sheet to the case surface . thereby , the additional working cost of attaching the aluminum foil and the graphite sheet can be eliminated . it will be apparent to those skilled in the art that various modifications and variations can be made to the disclosed embodiments . it is intended that the specification and examples be considered as exemplary only , with a true scope of the disclosure being indicated by the following claims and their equivalents . | 1 |
like reference numerals refer to like parts throughout the following description and the accompanying drawings . fig1 shows an exploded perspective view of an exemplary shoulder prosthesis 100 including an exemplary glenoid component 120 according to the present invention . prosthesis 100 also includes an exemplary humeral component 140 . humeral component 140 is configured in a known manner for implantation in a humerus 160 and replacement of a natural humeral head ( not shown ) and , accordingly , includes a prosthetic humeral head 180 . glenoid component 120 is configured for implantation in a scapula 200 and replacement of a natural glenoid fossa ( not shown in fig1 ). glenoid component 120 includes a bearing 220 . bearing 220 is made from a durable biocompatible plastic or any other suitable durable biocompatible material . for example , bearing 220 may be made from a polyethylene . one particular polyethylene that is well suited for bearing 220 is a high molecular weight polyethylene , for example ultra - high molecular weight polyethylene (“ uhmwpe ”). one such uhmwpe is sold as by johnson & amp ; johnson of new brunswick , n . j . as marathon ™ uhmwpe and is more fully described in u . s . pat . nos . 6 , 228 , 900 and 6 , 281 , 264 to mckellop , which are incorporated herein by reference . bearing 220 includes a generally concave surface 240 that is configured as known for bearing against prosthetic humeral head 180 or , in cases where the natural humeral head is spared , for bearing against the natural humeral head . bearing 220 further includes a post 260 , or some other feature or mechanism capable of mating the bearing to a stem element of the glenoid component , such as stem 280 discussed below . glenoid component 120 also includes a stem 280 . as discussed further below , stem 280 is configured to model a normal or pathologic glenoid vault morphology such that stem 280 fits within a cavity 300 that may be defined , at least partially , by endosteal walls 320 of scapula 200 . to this end , it is noted that the present invention may provide a series of rigidly scaled or sized versions of stem 280 for accommodating various glenoid vault sizes that may be presented among different patients . it should also be appreciated that the glenoid vault of scapula 200 may include some cancellous bone 340 . stem 280 is made from a suitable biocompatible metal such as , for example , a cobalt chromium alloy , a stainless steel alloy , a titanium alloy , or any other suitable durable material . in alternative embodiments , stem 280 may include a porous coating to facilitate bone in - growth into glenoid component 120 . the porous coating may be any suitable porous coating and may for example be porocoat ®, a product of johnson & amp ; johnson of new brunswick , n . j . and more fully described in u . s . pat . no . 3 , 855 , 638 to pilliar , which is incorporated herein by reference . stem 280 can be solid or a thin shell of suitable durable material . stem 280 includes a generally superior surface 360 , a generally inferior surface 380 , a generally anterior - medial surface 400 , a generally posterior - medial surface 420 , and a generally lateral surface 440 . stem 280 defines a socket 460 that extends inwardly from surface 440 . socket 460 receives post 260 ( of bearing 220 ). stem 280 may also define a through - channel 480 that extends , coaxially with socket 460 , through stem 280 . glenoid component 120 further includes a fastener 500 in the form of , for example , a screw . the screw , or screws , may be any screw capable of additionally securing glenoid component 120 within scapula 200 . for example , the screw may be a cortical screw such as depuy ace catalog number 8150 - 36 - 030 available from depuy orthopaedics , inc . of warsaw , ind . the screw has a diameter sufficient to properly secure glenoid component 120 within scapula 200 and may , for example , have a diameter of about two to five millimeters . the screw may have any suitable length capable of properly securing glenoid component 120 within scapula 200 . for example , the screw may have a length of from 10 to 60 millimeters . the screw may be secured to stem 280 in any suitable manner . in the exemplary embodiment , fastener 500 extends through through - channel 480 ( of stem 280 ). however , it is noted that fastener 500 is not indispensable and may be omitted from alternative embodiments . bearing 220 is secured to stem 280 in any suitable manner . for example , bearing 220 may be bonded to stem 280 , or bearing 220 could be made from polyethylene and compression molded to stem 280 . alternately , the bearing 220 may be glued to stem 280 by , for example , an adhesive . alternatively , bearing 220 may be mechanically interlocked to stem 280 by taper locking or otherwise press - fitting post 260 in socket 460 , or post 260 and socket 460 may include any other suitable interlocking features , for example , rib ( s ), lip ( s ), detent ( s ), and / or other protrusion ( s ) and mating groove ( s ), channel ( s ), or indent ( s ) ( not shown ). additionally , it is noted that in alternative embodiments , bearing 220 and stem 280 may be integrated into a single part made from uhmwpe or any other suitable material — with or without an omission of fastener 500 . the present invention contemplates a method for preparing a glenoid component that will satisfy a majority of patient anatomies . thus , in accordance with one method , the steps described in flow diagrams of fig2 a - 2 c correspond to one exemplary method used to model the normal or pathologic glenoid vault morphology , and ultimately to prepare an optimally sized and configured implant . in a first step 1020 ( fig2 a ), a suitable sample of human scapulae (“ scapulae sample ”) is selected to represent a reasonable demographic cross section of an anticipated patient population . in the exemplary embodiment , the scapulae sample included sixty - one human scapulae selected from different sources , thirty - two left - sided and twenty - eight right - sided . various criteria were applied to the selection process so that the sample was as representative of the patient population as possible , including height , sex , gender and ethnicity . at step 1040 ( fig2 a ), volumetric scan of each scapula in the sample was performed using a siemens volume zoom scanner ( a ct scanner available from siemens medical systems of malvern , pa .). it is noted that the initial orientation of the scapulae in the ct images is dependent on the physical placement and orientation of the scapulae within the ct scanner , which is inherently difficult to reproduce . nevertheless , the scapulae were placed in a supine anatomic position and axial images were obtained in one mm increments ( with 0 . 27 to 0 . 35 mm in - plane resolution ). the images were acquired at 120 kv , 100 ma , using a 180 mm field - of - view , large focal spot , and rotation speed of 0 . 5 sec / rev . a medium - smooth reconstruction algorithm was used for reconstruction of the images . fig3 shows a rectangular (“ cartesian ”) coordinates reference system 1060 relative to the plane body of a typical scapula 1080 as defined by three surface points 1100 , 1120 , and 1140 of the scapula 1080 . as at least partially discernable from fig3 , point 1100 represents an inferior tip of the scapula 1080 , point 1120 represents a medial pole of the scapula 1080 where the spine intersects the scapula 1080 , and point 1140 represents the center of the typical glenoid fossa 1160 . further , it should be appreciated that coordinates reference system 1060 defines , among other things , an xz - plane 1180 , an xy - plane 1190 , a vector 1200 extending from the medial pole of the scapula to the center of the glenoid fossa 1160 , and an x - axis 1220 . at step 1230 ( fig2 a ), the three - dimensional (“ 3 - d ”) images of the scapulae were re - sampled to align them on coordinates reference system 1060 ( see fig3 ) for subsequent analysis . in the exemplary embodiment , points 1100 , 1120 , and 1140 were interactively chosen on the 3 - d image of each scapula and the scapulae were again re - sampled such that the plane of the body of each scapula was aligned parallel to the xz - plane 1180 of the coordinates reference system 1060 ( see fig3 ), and such that the vector 1200 extending from the medial pole of the scapula to the center of the glenoid fossa 1160 was parallel to the x - axis 1220 ( see fig3 ). fig4 shows the superior - inferior (“ si ”) dimension 1240 and the anterior - posterior (“ ap ”) dimension 1260 of the glenoid fossa 1160 . at step 1280 ( fig2 a ), the si dimension 1240 and the ap dimension 1260 ( see fig4 ) of each scapula was determined by interactively placing points on the 3 - d images using a suitable software program . at step 1300 ( fig2 a ), the scapulae sample were arbitrarily divided into six sub - groups based on their si dimensions 1240 ( see fig4 ) to reduce the initial number of morphological comparisons and to facilitate determination of the relationship between the global or overall typical glenoid vault size and the typical glenoid vault morphology . fig5 shows a table listing exemplary range and exemplary average si dimension for the six sub - groups of scapulae based on their si dimensions . at step 1420 ( fig2 a ), the endosteal walls 320 of the glenoid vaults of the scapulae were manually traced and digitized . fig6 shows a substantially complete tracing 1320 ( toward the inferior end of the typical glenoid fossa 1160 ) of the endosteal walls 320 of the typical glenoid fossa 1160 . fig7 shows a partial tracing 1360 ( toward the inferior end of the typical glenoid fossa 1160 ) of the endosteal walls 320 of the typical glenoid fossa 1160 as a result of fossa occlusion in the region of the typical scapular spine 1380 . reference line 1400 ( fig7 ) is discussed further below . each endosteal boundary was traced on each of the two - dimensional (“ 2 - d ”) xy - slices of the respective re - sampled image ( see fig6 ), starting at the respective glenoid fossa and extending medially to the scapular spine 1380 ( see fig7 ), but not into the interior of the spine . both the anterior and posterior wall tracings in the region of the spine are terminated at reference line 1400 ( see fig7 ), which was defined to be simultaneously perpendicular to the plane of the respective glenoid fossa and tangential to the surface of the respective endosteal notch . at step 1440 ( fig2 a ), each endosteal tracing defining the respective glenoid vault was normalized by its extent in the si dimension . this measurement was made from the inferior limit of the endosteal walls of the glenoid fossa to the superior limit in the z - dimension ( see fig3 ) of the image . the vaults were rigidly scaled in all three dimensions ( i . e ., x , y , and z ) to normalize the si dimension of the vault tracing to the average within its corresponding sub - grouping . this approach substantially eliminated size differences between the different vaults , facilitating an appropriate shape determination . an assumption was made that right - sided and left - sided scapulae are approximately anatomically symmetrical . under this assumption , right - sided vaults were mirrored about the xz - plane ( see fig3 ) to allow morphological determinations to be made within the entire sample . in the exemplary embodiment , the normalized vaults within each of the six scapular sub - groupings were spatially aligned ( i . e ., “ registered ”) using an iterative closet point (“ icp ”) algorithm such as discussed in besl p . j . and mckay n . d ., “ a method for registration of 3 - d shapes ,” ieee trans . pattern analysis and machine intelligence 1992 , volume 14 , pages 239 - 256 , which is incorporated herein by reference . at step 1460 ( fig2 b ), a 3 - d model of the normalized glenoid vault morphology was then constructed for each sub - group of the scapulae of the scapulae sample based on the morphological constraints imposed by each of the vaults in the sub - group . for each sub - group , the set of registered glenoid vaults were overlaid and the approximate average endosteal walls 320 ( see fig6 and fig7 ) of the sub - group were manually digitized . each endosteal boundary was traced on each of the two - dimensional (“ 2 - d ”) xy - slices of the respective re - sampled image ( see fig6 ), starting at the respective glenoid fossa and extending medially to the scapular spine 1380 ( see fig7 ), but not into the interior of the spine . both the anterior and posterior wall tracings in the region of the spine were terminated at reference line 1400 ( see fig7 ), which was defined to be simultaneously perpendicular to the plane of the respective glenoid fossa and tangential to the surface of the respective endosteal notch . the resulting 3 - d model satisfied the endosteal wall boundaries for each vault within the group . at step 1480 ( fig2 b ), a relatively complex 3 - d model 1500 ( see fig8 ) approximating the average normalized glenoid vault morphology of the entire scapulae sample was constructed based on the morphological constraints imposed by the models for each sub - group . the registered glenoid vaults for the sub - groups were overlaid and the approximate average endosteal walls 320 ( see fig6 and fig7 ) of the sub - group models were manually digitized . each endosteal boundary was again traced on each of the two - dimensional (“ 2 - d ”) xy - slices of the respective re - sampled image ( see fig6 ), starting at the respective glenoid fossa and extending medially to the scapular spine 1380 ( see fig7 ), but not into the interior of the spine . both the anterior and posterior wall tracings in the region of the spine were terminated at reference line 1400 ( see fig7 ), which was defined to be simultaneously perpendicular to the plane of the respective glenoid fossa and tangential to the surface of the respective endosteal notch . the resulting 3 - d model 1500 satisfies the endosteal wall boundaries for each vault within the scapulae sample . fig8 shows views of a volumetric rendering of the relatively complex 3 - d model 1500 generated in the previous steps . as at least partially discernable in fig8 , model 1500 includes a generally superior surface 1520 , a generally inferior surface 1540 , a generally anterior - medial surface 1560 , a generally posterior - medial surface 1580 , and a generally lateral surface 1600 . it should be appreciated that generally superior surface 360 ( of stem 280 ) corresponds roughly to generally superior surface 1520 , generally inferior surface 380 ( of stem 280 ) corresponds roughly to generally inferior surface 1540 , generally anterior - medial surface 400 ( of stem 280 ) corresponds roughly to generally anterior - medial surface 1560 , generally posterior - medial surface 420 ( of stem 280 ) corresponds roughly to generally posterior - medial surface 1580 , and generally lateral surface 440 ( of stem 280 ) corresponds roughly to generally lateral surface 1600 . at step 1720 ( fig2 b ), intermediate 3 - d model 1700 was constructed by inscribing a plurality of mutually parallel triangular cross sections within the boundaries defined by the model walls on a plurality of xy - plane ( see fig3 ) cross - sections of relatively complex 3 - d model 1500 ( see fig8 ). fig9 shows views of a volumetric rendering of this intermediate 3 - d model 1700 of the normalized glenoid vault morphology of the scapulae sample based on relatively complex 3 - d model 1500 ( see fig8 ). at step 1800 ( fig2 b ), a simplified 3 - d model 1820 ( see fig1 ) of the average normalized glenoid vault morphology of the scapulae sample was constructed by selecting five equidistantly inferior - superior spaced - apart mutually parallel triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) ( see fig1 and 11 ) from intermediate 3 - d model 1700 ( see fig9 ). these triangular cross - sections were selected to account for more than 90 % of the volume of intermediate 3 - d model 1700 with almost negligible spatial deviation of the anterior and posterior walls . it should be appreciated that simplified 3 - d model 1820 thus provides a concise geometrical model of the normalized glenoid vault morphology while substantially preserving the morphological nuances inherent to the endosteal walls 320 ( see fig1 ). a perspective view of this simplified 3 - d model 1820 of the average normalized glenoid vault morphology of the scapulae sample is shown in fig1 . fig1 shows a superior view of each of the triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) obtained from the simplified 3 - d model 1820 . as at least partially discernable from fig1 and 11 , cross section 1840 includes a generally medially positioned vertex 2000 , a generally anteriorly and generally laterally positioned vertex 2020 , and a generally posteriorly and generally laterally positioned vertex 2040 . similarly , cross section 1860 includes a generally medially positioned vertex 2060 , a generally anteriorly and generally laterally positioned vertex 2080 , and a generally posteriorly and generally laterally positioned vertex 2100 . cross section 1880 includes a generally medially positioned vertex 2120 , a generally anteriorly and generally laterally positioned vertex 2140 , and a generally posteriorly and generally laterally positioned vertex 2160 . the next cross section 1900 includes a generally medially positioned vertex 2180 , a generally anteriorly and generally laterally positioned vertex 2200 , and a generally posteriorly and generally laterally positioned vertex 2220 . finally , cross section 1920 includes a generally medially positioned vertex 2240 , a generally anteriorly and generally laterally positioned vertex 2260 , and a generally posteriorly and generally laterally positioned vertex 2280 . further , cross section 1840 includes a “ base ” edge 2400 extending between vertex 2020 and vertex 2040 , cross section 1860 includes a “ base ” edge 2420 extending between vertex 2080 and vertex 2100 , cross section 1880 includes a “ base ” edge 2440 extending between vertex 2140 and vertex 2160 , cross section 1900 includes a “ base ” edge 2460 extending between vertex 2200 and vertex 2220 , and cross section 1920 includes a “ base ” edge 2680 extending between vertex 2240 and vertex 2280 . in addition , cross section 1840 includes a “ left ” edge 2500 extending between vertex 2000 and vertex 2020 , cross section 1860 includes a “ left ” edge 2520 extending between vertex 2060 and vertex 2080 , cross section 1880 includes a “ left ” edge 2540 extending between vertex 2120 and vertex 2140 , cross section 1900 includes a “ left ” edge 2560 extending between vertex 2180 and vertex 2200 , and cross section 1920 includes a “ left ” edge 2580 extending between vertex 2240 and vertex 2260 . finally , cross section 1840 includes a “ right ” edge 2600 extending between vertex 2000 and vertex 2040 , cross section 1860 includes a “ right ” edge 2620 extending between vertex 2060 and vertex 2100 , cross section 1880 includes a “ right ” edge 2640 extending between vertex 2120 and vertex 2160 , cross section 1900 includes a “ right ” edge 2660 extending between vertex 2180 and vertex 2220 , and cross section 1920 includes a “ right ” edge 2480 extending between vertex 2260 and vertex 2280 . the respective base edges ( 2400 , 2420 , 2440 , 2460 , 2680 ) of the triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) define lateral boundaries of simplified 3 - d model 1820 , corresponding to the region of the typical glenoid fossa 1160 ( see fig3 ). further , the respective left edges ( 2500 , 2520 , 2540 , 2560 , 2580 ) of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) define anterior boundaries of simplified 3 - d model 1820 , while the respective “ right ” edges ( 2600 , 2620 , 2640 , 2660 , 2480 ) of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) define posterior boundaries of simplified 3 - d model 1820 . the respective generally medially positioned vertexes ( 2000 , 2060 , 2120 , 2180 , 2260 ) of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) sweep from a more posterior orientation at the inferior end of simplified 3 - d model 1820 to a more anterior orientation at the superior end of simplified 3 - d model 1820 . each of the triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) has a respective width dimension (“ w ”) and a depth dimension (“ d ”). the table in fig1 summarizes the respective width dimension (“ w ”) ( see fig1 ), depth dimension (“ d ”) ( see fig1 ), and resulting area of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ). the table in fig1 lists the coordinates for the respective vertexes of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) relative to rectangular (“ cartesian ”) coordinates reference system 1060 ( see fig3 ). it is contemplated that simplified 3 - d model 1820 may be rigidly scaled according to si size ( see fig4 ) to accommodate larger or smaller glenoid vaults while maintaining the integrity of the basic morphological model . at step 3000 ( fig2 c ), stem 280 is initially fashioned in the shape of the simplified 3 - d model 1820 . in one embodiment , this step 3000 contemplates loading the coordinates of each of the vertexes defining the simplified 3 - d geometrical model 1820 into a suitable stereo lithography system . the stereo lithography system may be operated to produce a corresponding 3 - d form made of a plastic , wax , or any other suitable material as is known in the art . a mold is then prepared from the 3 - d form and a stem 280 is fashioned , such as by injection molding using this mold . in alternative embodiments stem 280 may be otherwise suitably produced in accordance with simplified 3 - d model 1820 via stereo lithography , by hand , or by any other suitable method ( with or without an intervening form or mold ) as known . in subsequent steps , the stem 280 is machined to provide the features necessary to prepare the stem for implantation . thus , at step 3020 ( fig2 c ), socket 460 is bored into stem 280 . at step 3040 ( fig2 c ), through - channel 480 is bored ( coaxially with socket 460 ) through stem 280 . it should be understood that the rough stem produced from the 3 - d model may be machined according to other protocols depending upon the interface between the stem 280 and the bearing 220 . it is further contemplated that the stem 280 may be formed as a solid or a hollow body and may further be provided with certain surface features to facilitate fixation of the stem within the glenoid vault . the improved stem may then be implanted in accordance with known surgical procedures . for instance , cancellous bone 340 may first be removed from the glenoid vault of scapula 200 to construct cavity 300 , which extends to endosteal walls 320 ( see fig1 ). stem 280 is then inserted into cavity 300 into intimate contact with endosteal walls 320 to facilitate alignment and reliable fixation of glenoid component 120 within scapula 200 . bone cement may be used to enhance fixation of the stem within the bone . fastener 480 is inserted through through - channel 480 into engagement with scapula 200 . after fastener 480 is fully inserted into scapula 200 , post 260 is inserted into socket 460 and bearing 220 is secured to stem 280 . the foregoing description of the invention is illustrative only , and is not intended to limit the scope of the invention to the precise terms set forth . further , although the invention has been described in detail with reference to certain illustrative embodiments , variations and modifications exist within the scope and spirit of the invention as described and defined in the following claims . for example , the glenoid components may be solid or hollow bodies . in particular , the stem 280 may be formed as a solid implant , but may be preferably at least partially hollow to reduce the weight and material requirements for the component . if the implant component is hollow , it must have sufficient wall thickness to maintain its strength and integrity under maximum expected physiological loads . the present invention contemplates a glenoid stem component that is formed to closely approximate a normalized glenoid vault morphology . in the embodiments discussed above , this normalized morphology is generated from a relatively large sample size of human scapulae from which relevant measurements were obtained . it was found that the normalized component dimensions obtained in accordance with the invention well approximated the actual dimensions of the sample population . in particular , it was found that at least 85 % of the surface points of the sampled glenoid vaults varied by less than 2 . 0 mm , which represents a minimal variation given the overall dimensions of the endosteal walls of the vault . in generating the vault models for the different groups noted above , it was discovered that for the entire set of vault geometries , 98 . 5 % of the surface points comprising the interior surface models varied by less than 2 . 0 mm . this finding refuted the a prior assumption that vault morphology was dependent upon the global vault size . as a result , a single vault model was derived from the group models using the same steps described above . this final model is depicted in fig9 . from that model of the actual glenoid vault morphology for the entire sample population , the simplified geometric model was developed as described above . this simplified model was found to account for over 80 % of the volume of the model of the actual sample population , while also preserving the morphological nuances inherent to the endosteal surfaces of the glenoid vault . in one aspect of the invention , a morphological model is developed for several discrete groups of glenoid sizes . the groups may be preferably grouped by si ( superior - inferior ) dimension , as summarized in the table of fig5 . the simplified model used to create the component mold in the illustrated embodiment corresponded to group 4 , but it is understood that the simplified model for the other groups may be obtained by directly scaling the dimensions as a function of the ratio of si values . | 1 |
embodiments according to the present invention are described hereunder referring to tables 3 and 4 accompanied hereto on separate sheets . porous black a - 1 , b - 1 and 2 , c - 1 , 2 , 3 , 4 , 5 , 6 and 7 , d - 1 , e - 1 , 2 and 3 , f - 1 , 2 and 3 and g - 1 , 2 and 3 are shown in table 4 , said porous black being produced by etching carbon blacks a , b , c , d , e , f and g shown in table 3 under high temperatures of 900 ° c .˜ 950 ° c . by means of carbon dioxide gas or steam , thus increasing respective specific surface areas thereof by various magnitudes depending on the varying temperatures . ( according to the 32nd and 47th embodiments , carbon blacks were made porous by means of steam treatment .) the numerals after said alphabetic symbols indicate that the respective magnitudes of specific surface areas are different . the specific surface areas indicated have been measured according to astm d3037 - 88 . high density polyethylene ( 1300j with a melting point of 131 c : manufactured by mitsui petrochemical industries ) was used as the aforementioned crystalline polymer . next , each of said porous black and said high density polyethylene ( 1300 j ) were combined together according to the porous black content ratio shown in table 4 and then blended together in a mixing test roller ( manufactured by kodaira seisakusho co ., ltd . : 150 mmφ × 200 mml ) adjusted at 135 ° c . ; the blended ingredients were processed into material for shaping , chips of approximately 1 mm in size , by means of a crusher ( sprec mini f 180 : manufactured by matsui seisakusho co ., ltd .) and a fine grinder ( wiley - w - 100 : manufactured by ikeda rika co ., ltd .). said material for shaping was shaped together with metallic foils ( produced by fukuda metal foils & amp ; powder co ., ltd . ), which was to serve as electrodes , under pressure of 65 kg / cm 2 and a temperature of 200 ° c . for 3 mins , and finally into the shaped articles through thermal treatment at 120 ° c . for 1 hour . then , said shaped articles were exposed to 10 m rad of gamma radiation and then shaped into articles measuring l 1 = 10 mm , l 2 = 4 . 5 mm , t = 1 . 5 mm , the shape of which is shown in fig6 . thus , ptc device 3 , which comprises ptc element 1 having both sides thereof metallic foil 2 , was obtained . next , ptc device 3 thus obtained was placed in a constant temperature oven and heated with temperature elevation speed of 1 ° c ./ min . therein , with resistivity value r at each temperature measured , and height of ptc was computated from thus measured values r , utilizing the formula ( 1 ) below . the result of the computation is shown in table 4 . the volume resistivity ρ 20 and ρ peak were calculated from the resistivity r of ptc device 3 shown in fig6 utilizing the formula ( 2 ) ## equ1 ## separate table 5 shows examples for comparison , according to which , the same carbon black as that of the present embodiments was combined with high density polyethylene without being made porous by means of vapor etching , but by otherwise identical procedures to produce shaped ptc devices . the resulting volume resistivities and ptc characteristics are shown in table 5 . comparison between the volume resistivities ρ 20 of the examples of table 5 and the embodiments of table 4 shows that the volume resistivites of ptc devices made porous by means of the vapor etching method according to the embodiments of the present invention are smaller in spite of the identical amounts of carbon black in the examples for comparison and the embodiments . this result indicates that the amount of carbon black filler made porous by the vapor etching method required to produce an equivalent degree of conductivity is relatively small compared with that for devices of the examples with unetched carbon black . fig7 through 14 are charts concerning ptc devices of the present embodiments and those of the examples for comparison , showing the relationship between the amount of carbon black in high density polyethylene and the volume resistivity at 20 ° c . ( ρ 20 ): fig7 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black a and porous black a - 1 were combined respectively with high density polyethylene ; fig8 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black b and porous blacks b - 1 and b - 2 were combined respectively with high density polyethylene ; fig9 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black c and porous blacks c - 1 c - 2 , c - 3 and c - 4 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black c and porous blacks c - 5 , c - 6 and c - 7 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivities ρ 20 when various amounts of carbon black d and porous black d - 1 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black e and porous blacks e - 1 e - 2 and e - 3 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black f and porous blacks f - 1 , f - 2 and f - 3 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black g and porous blacks g - 1 , g - 2 and g - 3 were combined respectively with high density polyethylene . all of these charts clearly show that , at the same content , the volume resistivites ρ 20 of ptc devices of the present embodiments are lower than those of the examples for comparison , where unetched carbon black itself was used . separate table 6 shows the result of measuring volume resistivities ρ 20 and ptc characteristics of ptc devices produced by combining conventional carbon blacks ( shown in table 1 ) with high density polyethylene in the same manner as that for the present embodiments and through further identical procedures . comparison between table 6 showing examples of conventional carbon blacks and table 4 showing the embodiments proves that ptc characteristics of the conventional carbon blacks are below 1 . 0 , except for examples 4 and 9 , while ptc characteristics of the embodiments are all above 1 . 0 . according to fig1 , which is a resistivity - temperature characteristics chart , and fig1 , which is a current - voltage characteristics chart . ptc characteristics are shown as log ( rpeak / ro ). the resistance at ( a ) in fig1 and 16 is ro = vp / ip = vrxir , ptc characteristics value = n = log ( rpeak / ro )= 2 log ( vr / vp ). given that vp is the voltage drop across a ptc device of a self - resetting overcurrent protection device and that vr is the circuit voltage , in general cases , vp must not be more than 20 % of vr . therefore , as n = 2 log ( vr / vp )= 2 log ( 1 / 0 . 2 )= 1 . 39 , a value not less than 1 is required for a device with ptc characteristics to be used as a self - resetting overcurrent protection device . this indicates that ptc characteristics values of the examples of examples of conventional unetched carbon blacks are not sufficient for self - resetting overcurrent protection devices . all of the embodiments of the invention using etched carbon black have favorable ptc characteristics values , greater than 1 . 0 , enabling their use as self - resetting overcurrent protection devices . further , carbon black and porous black were separately blended with high density polyethylene and made into shaped articles in the same manner as said embodiments and examples for comaprison , with the variation of resistance at 70 ° c . of elements made from said shaped articles shown in separte tables 7 and 8 as an example . said variation of resistance was calculated utilizing formula ( 3 ). ## equ2 ## 70 ° c . mentioned above is in general the highest surrounding temperature of an electrical device in use . in case the temperature around a self - resetting overcurrent protection device in use changes , it sometimes presents a problem in that the change in resistance of the element may cause fluctuations in the voltage in the electrical circuit of the apparatus . for this reason , it is important that variation of resistance of a device be small . it is evident from the tables that the variation of resistance of the present embodiments shown in table 7 are lower than those of the examples for comparison shown in table 8 . although high density polyethylene was used for crystalline polymer in the embodiments , it is possible to use alone or in combination , other kinds of polymers , such as low density polyethylene , middle density polyethylene , polypropylene , fluorocarbon polymers , poly ( ethylene terephthalete ), etc . according to the present invention , since the porous carbon black produced by increasing the specific surface area of carbon black by means of the vapor etching method is porous without significant change in particle size and / or structure thereof , the content of porous carbon black dispersed in crystalline polymer to obtain equivalent volume resistivity can be relatively small . further , since porous carbon black is obtained by making carbon black raw material porous by means of vapor etching , oil furnace black , lamp black and other kinds of carbon black with favorable ptc characteristics can be chosen freely for carbon black . therefore , higher ptc characteristics values can be obtained compared with conventional conductive carbon black ( as described in table 1 ), which is obtained by making carbon black porous at the time of its formation . furthermore , as the variation of resistance at 70 ° c . of a self - resetting overcurrent protection device according to the present invention is low , it is possible to stabilize the voltage decrease of the self - resetting overcurrent protection device in relation to changes in the surrounding temperature when the current is below the rated current value . moreover , according to the present invention , as the volume resistivity at 20 ° c . of a self - resetting overcurrent protection device is set in the range of 0 . 4 ohm cm ˜ 150 ohm cm , the device can be designed to fit the range of 0 . 06a ˜ 20a , which is substantially the same as that of the rated current value of ordinary fuses . table 3______________________________________ specific particle surfacecarbon name of diameter areablack grade manufacturer ( mμ ) ( m . sup . 2 / g ) ______________________________________a asahi # 80 asahi carbon co . 20 119 . 6 oil furnace blackb asahi # 70 &# 34 ; 26 77 oil furnace blackc asahi # 60h &# 34 ; 41 45 oil furnace blackd asahi # 60 &# 34 ; 45 40 oil furnace blacke asahi # 55 &# 34 ; 66 29 . 2 oil furnace blackf asahi # 50hg &# 34 ; 80 22 oil furnace blackg lamp black 101 degussa 95 20 ( west germany ) ______________________________________ table 4__________________________________________________________________________ ptc characteristics embodiment porous black area ( m . sup . 2 / g ) specific surface area magnitudespecific surface content ( wt %) porous ρ . sub . 20 ( ωcm ) volume resistivity ## str1 ## __________________________________________________________________________1 a - 1 860 7 . 1 28 . 6 1 . 55 1 . 462 a - 1 860 7 . 1 23 . 1 3 . 88 1 . 743 a - 1 860 7 . 1 20 7 . 86 2 . 164 b - 1 187 2 . 4 33 . 3 0 . 61 2 . 615 b - 1 187 2 . 4 28 . 6 0 . 97 2 . 826 b - 1 187 2 . 4 23 . 1 2 . 11 3 . 397 b - 1 187 2 . 4 20 5 . 87 4 . 268 b - 1 187 2 . 4 16 . 7 12 . 6 4 . 879 b - 1 187 2 . 4 13 . 0 40 . 7 7 . 3310 b - 2 1140 14 . 8 23 . 1 1 . 13 1 . 5911 b - 2 1140 14 . 8 20 2 . 08 2 . 0212 b - 2 1140 14 . 8 16 . 7 4 . 63 2 . 3313 b - 2 1140 14 . 8 13 15 . 2 3 . 1914 c - 1 65 . 4 1 . 5 37 . 5 0 . 52 2 . 6215 c - 1 65 . 4 1 . 5 33 . 3 0 . 87 3 . 3116 c - 1 65 . 4 1 . 5 28 . 6 1 . 92 4 . 6417 c - 1 65 . 4 1 . 5 23 . 1 6 . 02 5 . 5118 c - 1 65 . 4 1 . 5 20 17 . 9 & gt ; 7 . 7919 c - 1 65 . 4 1 . 5 16 . 7 111 & gt ; 6 . 8920 c - 2 415 9 . 2 33 . 3 0 . 56 2 . 2821 c - 2 415 9 . 2 28 . 6 1 . 1 3 . 022 c - 2 415 9 . 2 23 . 1 3 . 0 4 . 0223 c - 2 415 9 . 2 20 7 . 3 5 . 3124 c - 2 415 9 . 2 16 . 7 40 & gt ; 7 . 625 c - 3 813 18 . 1 28 . 6 0 . 61 2 . 0726 c - 3 813 18 . 1 23 . 1 1 . 49 2 . 7827 c - 3 813 18 . 1 20 2 . 89 3 . 3328 c - 3 813 18 . 1 16 . 7 7 . 14 4 . 8129 c - 3 813 18 . 1 13 30 . 5 7 . 5230 c - 4 983 21 . 8 23 . 1 1 . 09 2 . 0431 c - 4 983 21 . 8 20 1 . 83 2 . 2432 c - 5 408 9 . 1 33 . 3 0 . 79 2 . 6333 c - 5 408 9 . 1 28 . 6 1 . 58 3 . 034 c - 5 408 9 . 1 23 . 1 4 . 64 5 . 4835 c - 5 408 9 . 1 20 12 . 1 7 . 2936 c - 5 408 9 . 1 16 . 7 32 7 . 5137 c - 6 528 11 . 7 37 . 5 0 . 43 1 . 3938 c - 6 528 11 . 7 33 . 3 0 . 68 1 . 7439 c - 6 528 11 . 7 28 . 6 1 . 30 2 . 3940 c - 6 528 11 . 7 23 . 1 3 . 63 3 . 1641 c - 6 528 11 . 7 20 7 . 43 3 . 7242 c - 6 528 11 . 7 16 . 7 21 . 3 5 . 1643 c - 7 630 14 37 . 5 0 . 41 1 . 6944 c - 7 630 14 33 . 3 0 . 64 2 . 2845 c - 7 630 14 28 . 6 1 . 25 2 . 5346 c - 7 630 14 23 . 1 3 . 46 4 . 0447 c - 7 630 14 20 7 . 36 4 . 7848 d - 1 451 11 33 . 3 0 . 66 2 . 1549 d - 1 451 11 28 . 6 1 . 24 3 . 050 d - 1 451 11 23 . 1 3 . 56 5 . 1451 d - 1 451 11 20 7 . 37 7 . 6652 d - 1 451 11 16 . 7 25 . 9 & gt ; 7 . 653 e - 1 173 . 7 6 . 0 35 . 5 0 . 88 3 . 854 e - 1 173 . 7 6 . 0 33 . 3 1 . 16 3 . 955 e - 1 173 . 7 6 . 0 28 . 6 2 . 77 5 . 756 e - 1 173 . 7 6 . 0 23 . 1 9 . 85 & gt ; 857 e - 1 173 . 7 6 . 0 20 26 . 6 & gt ; 7 . 658 e - 2 489 16 . 7 33 . 3 0 . 68 2 . 9259 e - 2 489 16 . 7 28 . 6 1 . 5 3 . 3760 e - 2 489 16 . 7 23 . 1 4 . 5 6 . 3561 e - 2 489 16 . 7 20 13 & gt ; 7 . 962 e - 2 489 16 . 7 16 . 7 44 & gt ; 7 . 463 e - 3 659 22 . 6 33 . 3 0 . 53 2 . 1164 e - 3 659 22 . 6 28 . 6 1 . 1 2 . 7265 e - 3 659 22 . 6 23 . 1 3 . 1 4 . 4466 e - 3 659 22 . 6 20 6 . 3 5 . 967 e - 3 659 22 . 6 16 . 7 21 & gt ; 7 . 868 f - 1 220 . 7 10 33 . 3 1 . 11 4 . 1669 f - 1 220 . 7 10 28 . 6 2 . 69 8 . 4870 f - 1 220 . 7 10 23 . 1 12 . 1 & gt ; 7 . 871 f - 1 220 . 7 10 20 81 . 7 & gt ; 6 . 972 f - 2 449 20 . 4 33 . 3 0 . 85 3 . 6573 f - 2 449 20 . 4 28 . 6 1 . 9 6 . 2974 f - 2 449 20 . 4 23 . 1 7 . 47 & gt ; 8 . 175 f - 2 449 20 . 4 20 22 . 3 & gt ; 7 . 676 f - 3 945 43 33 . 3 0 . 46 2 . 0177 f - 3 945 43 28 . 6 0 . 86 2 . 778 f - 3 945 43 23 . 1 2 . 67 4 . 5879 f - 3 945 43 20 7 . 08 6 . 4980 f - 3 945 43 16 . 7 42 . 1 & gt ; 7 . 681 g - 1 66 . 1 3 . 3 37 . 5 0 . 56 3 . 4882 g - 1 66 . 1 3 . 3 33 . 3 0 . 99 3 . 983 g - 1 66 . 1 3 . 3 28 . 6 2 . 34 5 . 8284 g - 1 66 . 1 3 . 3 23 . 1 12 . 7 & gt ; 7 . 985 g - 1 66 . 1 3 . 3 20 153 & gt ; 5 . 886 g - 2 420 21 37 . 5 0 . 38 2 . 6587 g - 2 420 21 33 . 3 0 . 68 2 . 7588 g - 2 420 21 28 . 6 1 . 48 3 . 9289 g - 2 420 21 23 . 1 5 . 55 & gt ; 8 . 190 g - 2 420 21 20 22 . 3 & gt ; 7 . 591 g - 3 930 46 . 5 23 . 1 2 . 1 3 . 2392 g - 3 930 46 . 5 20 4 . 72 4 . 25__________________________________________________________________________ table 5__________________________________________________________________________ ptc characteristics comparisonexample for blackcarbon area ( m . sup . 2 / g ) specific surface content ( wt %) carbon black ρ . sub . 20 ( ωcm ) volume ## str2 ## __________________________________________________________________________1 a 119 . 6 33 . 3 0 . 96 2 . 342 a 119 . 6 28 . 6 1 . 63 2 . 633 a 119 . 6 20 10 . 8 3 . 584 a 119 . 6 16 . 7 29 . 3 5 . 445 b 77 37 . 5 0 . 88 2 . 776 b 77 33 . 3 1 . 66 3 . 267 b 77 28 . 6 3 . 73 4 . 368 b 77 23 . 1 12 . 9 6 . 169 b 77 20 41 . 5 & gt ; 7 . 310 c 45 37 . 5 0 . 69 2 . 8211 c 45 33 . 3 1 . 1 3 . 7112 c 45 28 . 6 2 . 4 4 . 0813 c 45 23 . 1 9 . 6 7 . 2614 d 40 37 . 5 0 . 83 3 . 3615 d 40 28 . 6 3 . 33 6 . 3416 d 40 23 . 1 16 . 0 & gt ; 7 . 917 d 40 20 40 . 8 & gt ; 7 . 518 e 29 . 2 41 . 2 0 . 8 4 . 6219 e 29 . 2 37 . 5 1 . 42 5 . 5920 e 29 . 2 33 . 3 3 . 04 6 . 7621 e 29 . 2 28 . 6 9 . 5 8 . 122 e 29 . 2 23 . 1 53 7 . 623 f 22 37 . 5 1 . 59 5 . 6924 f 22 33 . 3 3 . 77 & gt ; 8 . 525 f 22 28 . 6 11 . 5 & gt ; 826 g 20 50 0 . 21 2 . 6827 g 20 47 . 4 0 . 3 2 . 8928 g 20 44 . 4 0 . 4 3 . 2929 g 20 41 . 2 0 . 61 3 . 8530 g 20 37 . 5 0 . 93 4 . 9331 g 20 33 . 3 1 . 93 & gt ; 7 . 932 g 20 28 . 6 5 . 67 & gt ; 8 . 4__________________________________________________________________________ table 6__________________________________________________________________________ ptc characteristics carbon blackexample of conventional carbon black area ( m . sup . 2 / g ) specific surface content ( wt %) carbon black ρ . sub . 20 ( ωcm ) volume resistivity ## str3 ## __________________________________________________________________________1 black pearls 2000 1475 28 . 6 0 . 61 0 . 522 black pearls 2000 1475 23 . 1 1 . 31 0 . 663 black pearls 2000 1475 16 . 7 4 . 76 0 . 744 black pearls 2000 1475 9 . 1 84 . 4 1 . 145 conductex 40 - 220 1066 33 . 3 0 . 46 0 . 346 conductex 40 - 220 1066 28 . 6 1 . 09 0 . 77 conductex 40 - 220 1066 23 . 1 2 . 5 0 . 738 conductex 40 - 220 1066 16 . 7 9 . 2 0 . 859 conductex 40 - 220 1066 9 . 1 242 1 . 8210 ketjen black ec 950 33 . 3 0 . 25 0 . 2311 ketjen black ec 950 28 . 6 0 . 43 0 . 5412 ketjen black ec 950 23 . 1 0 . 85 0 . 713 ketjen black ec 950 16 . 7 2 . 81 0 . 91__________________________________________________________________________ table 7______________________________________ volume vari - specific porous resistivity ation of surface black ( at 20 ° c .) resis - embodi - porous area content ρ . sub . 20 tancement black magnitude ( wt %) ( ωcm ) (%) ______________________________________53 e - 1 6 . 0 35 . 5 0 . 88 22 . 054 e - 1 6 . 0 33 . 3 1 . 16 19 . 755 e - 1 6 . 0 28 . 6 2 . 77 23 . 956 e - 1 6 . 0 23 . 1 9 . 85 30 . 257 e - 1 6 . 0 20 26 . 6 36 . 558 e - 2 16 . 7 33 . 3 0 . 68 17 . 659 e - 2 16 . 7 28 . 6 1 . 5 15 . 560 e - 2 16 . 7 23 . 1 4 . 5 17 . 861 e - 2 16 . 7 20 13 20 . 562 e - 2 16 . 7 16 . 7 44 26 . 963 e - 3 22 . 6 33 . 3 0 . 53 13 . 264 e - 3 22 . 6 28 . 6 1 . 1 13 . 165 e - 3 22 . 6 23 . 1 3 . 1 11 . 766 e - 3 22 . 6 20 6 . 3 12 . 367 e - 3 22 . 6 16 . 7 21 14 . 868 f - 1 10 33 . 3 1 . 11 17 . 069 f - 1 10 28 . 6 2 . 69 19 . 670 f - 1 10 23 . 1 12 . 1 27 . 571 f - 1 10 20 81 . 7 58 . 772 f - 2 20 . 4 33 . 3 0 . 85 13 . 473 f - 2 20 . 4 28 . 6 1 . 9 13 . 574 f - 2 20 . 4 23 . 1 7 . 47 18 . 275 f - 2 20 . 4 20 22 . 3 24 . 976 f - 3 43 33 . 3 0 . 46 10 . 277 f - 3 43 28 . 6 0 . 86 7 . 8778 f - 3 43 23 . 1 2 . 67 7 . 0479 f - 3 43 20 7 . 08 8 . 1880 f - 3 43 16 . 7 42 . 1 12 . 9______________________________________ table 8______________________________________example specific carbon volume variationfor surface black resistivity ofcom - carbon area content ρ . sub . 20 resistanceparison black ( m . sup . 2 / g ) ( wt %) ( ωcm ) (%) ______________________________________18 e 29 . 2 41 . 2 0 . 8 20 . 019 e 29 . 2 37 . 5 1 . 42 22 . 820 e 29 . 2 33 . 3 3 . 04 27 . 521 e 29 . 2 28 . 6 9 . 5 30 . 422 e 29 . 2 23 . 1 53 39 . 723 f 22 37 . 5 1 . 59 21 . 924 f 22 33 . 3 3 . 77 24 . 525 f 22 28 . 6 11 . 5 29 . 3______________________________________ | 2 |
turning now to the drawings , and particularly to fig2 , and 4 , the liquid crystal display ( lcd ) element 10 or components thereof made in accordance with the method of the invention is illustrated . according to fig3 and 4 , liquid crystal display element 10 is generally defined as having a first transparent substrate , or alternatively deck plate , 12 fixedly bonded to a second transparent substrate , or alternatively signal plate , 18 . according to fig2 among other things , deck plate 12 provides barrier protection for an indium tin oxide ( ito ) coating layer 32 deposited on active surface 20 of signal plate 18 . referring to fig2 the ito coating layer 32 provides electrical continuity between active surfaces 20 , 22 through vias 30 . it should be appreciated that existing lcd panels teach an ito coating layer 32 deposited only on one active surface of the signal plate in contradistinction to the present lcd element having an ito coating layer 32 deposited on opposing active surfaces 20 , 22 of signal plate 18 . referring to fig2 and 4 , important to the present invention , a plurality of through holes , commonly referred to as vias 30 , is formed in the signal plate 18 . as indicated , vias 30 provide electrical continuity paths between the opposing active surfaces 20 , 22 of the signal plate 18 , as described in greater details below . skilled artisans in the field of lcd manufacturing will appreciate that the present invention necessitates solving a range of new and challenging problems never before presented in traditional lcd manufacturing . to maintain transparency of the signal plate 18 , it was discovered that vias 30 then had to be filled with an optical grade adhesive material 34 ( described below ) free of air bubbles or voids so as to prevent light scattering from the functioning lcd ( compare fig1 and 2 ). moreover , it was discovered that the adhesive material 34 provides the unexpected benefit of further protecting the ito coating layer 32 bonding the deck plate 12 to the signal plate 18 . referring to fig2 and 3 , by carefully controlling gap 11 separating the deck plate 12 and active surface 20 of signal plate 18 , we were able to facilitate capillary action that efficiently wicked the optical grade adhesive material 34 into the vias 30 formed in signal plate 18 . spacers 28 , such as standoffs or shims , affixed to deck plate 12 is preferably used to control the spacing between deck plate 12 and signal plate 18 . as shown in fig5 surface tension and the presence of a cavity 70 in the assembly fixture 60 prohibit the optical grade adhesive material 34 from wicking out onto second active surface ( alternatively referred to as the pixel side of the lcd element ) 22 of signal plate 18 . second active surface 22 of signal plate 18 is then coated with a first polyimide alignment layer 38 which aligns the lcd medium 42 ( typically a liquid crystal material formulation ) with a second polyimide alignment layer 39 applied over a third transparent substrate ( typically an electrode panel ) 46 . lcd medium 42 contains spacers , such as a plurality of glass spheres , 40 that separate first polyimide alignment layer 38 from second polyimide layer 39 on electrode panel 46 thereby forming the active region 43 of lcd . an epoxy seal 44 is applied to the perimeter of the electrode panel 46 before it is bonded to the second active surface 22 of signal plate 18 . as shown in fig2 electrode panel 46 comprises an active electrode surface 48 containing an ito coating layer 52 and an outer passive electrode surface 50 opposite active electrode surface 48 . active electrode surface 48 generally faces lcd medium 42 . referring to fig2 , 4 and 5 , in constructing lcd element 10 of the invention , deck plate or first transparent substrate 12 is provided with a first surface 14 and an opposed second surface 16 . spacers 28 are bonded along peripheral edges 29 , 31 of first surface 14 of deck plate 12 with a suitable adhesive , such as an epoxy . we prefer using an optical grade adhesive material 34 such as the same epoxy used to bond deck plate 12 and signal plate 18 . alternatively , the spacers 28 could be integrally formed into the deck plate 12 by etching and machining the deck plate 12 . as can be appreciated in fig2 signal plate 18 containing vias 30 filled with an optical grade adhesive material 34 provides a boundary wall for the liquid crystal when it is injected into the active region 43 of the lcd element 10 . moreover , second surface 16 of deck plate 12 is coated with a protective ultra - violet transparent protective layer 24 of a predetermined thickness to prevent light penetration through deck plate 12 and into gap 11 . those skilled in the art will appreciate that deck plate 12 , of the present invention , is not contemplated in existing lcd elements . with reference to fig3 we have experimentally determined that the preferred thickness of spacers 28 structurally associated with deck plate 12 is about 0 . 150 mm . this preferred thickness of spacers 28 corresponds to deck plate 12 having a thickness of about 0 . 500 - mm and a signal plate 18 having vias 30 with an average diameter of about 0 . 300 - mm . therefore , our experience indicates that the spacer thickness is modified based on the average diameter of the vias 30 . the thickness of spacer 28 must be controlled to allow the adhesive material to flow into the vias 30 . referring again to fig3 formation of undesirable voids in adhesive material 34 filling vias 30 as well as insufficient filling of the vias 30 with optical grade adhesive material 34 , preferably epotek 310 ™, are strongly influenced by the diameter of the vias 30 and dimensions of spacers 28 . as examples , vias 30 having an average diameter of about 0 . 300 mm and the absence of spacers 28 affixed to deck plate 12 have both shown to produce voids in vias 30 and filling problems . the same result was observed if the spacers 28 had a thickness of less than about 0 . 075 mm . referring to fig2 gap 11 defined by the height of spacers 28 enables the vias in the signal plate 18 to be filled efficiently without introducing voids or air bubbles into the vias 30 . as indicated previously , experience indicates that the presence of air bubbles in the vias 30 causes the light to scatter in the operating lcd . according to fig4 signal plate 18 , in greater details , has opposed first and second active surfaces 20 , 22 . in stark contrast , prior art signal plates only have one active surface . in constructing the lcd element 10 , first active surface 20 of signal plate 18 is bonded with a suitable optical grade adhesive material 34 , such as an epoxy , acrylic or ester , to second surface 16 of deck plate 12 . it is important to the invention that signal plate 18 has formed therein a plurality of vias 30 . vias 30 pass between the first active surface 20 and the second active surface 22 to facilitate electrical continuity between the first active surface 20 and the second active surface 22 . also , vias 30 in the signal plate 18 allow a higher patterning density for the lcd , thereby decreasing the lcd size . vias 30 are filled with the optical grade adhesive material 34 , as described more fully below , that prevents the formation of voids or air bubbles in the optical grade adhesive material 34 . as indicated above in the prior art , voids or air bubbles in the adhesive filling become a source of undesirable light scatter ( see for instance prior art fig1 ). referring to fig2 and 4 , skilled artisans will appreciate that vias 30 in signal plate or second substrate 18 may be formed in one of several ways . we prefer vias that have been drilled in the signal plate or second substrate 18 because the drill process is easier to use and results in smoother wall surfaces within the vias hole . referring to fig2 and 5 , vias 30 in signal plate 18 are filled when the lcd element 10 of the invention is assembled . as indicated above , deck plate 12 is assembled with spacers 28 that spatially separate the deck plate 12 from the signal plate 18 . the optical grade adhesive material 34 is dispensed along the perimeter of the deck plate 12 in an optimized pattern to minimize voiding between the two substrates ( first transparent substrate or deck plate 12 and second transparent substrate or signal plate 18 ). moreover , spacers 28 allow the optical grade adhesive material 34 to fill the vias 30 without voids . the process disclosed herein allows the manufactured lcd panels to meet the specification of a void free epoxy plug in the vias 30 and a void free deck plate 12 attachment to the signal plate 18 . voids in the adhesive either between the signal plate 18 and deck plate 12 or in the vias 30 of the signal plate 18 cause light to scatter in the lcd application . referring again to fig2 and 5 , wicking of the optical grade adhesive material 34 beyond vias 30 and onto ito pattern features is controllable by , among other ways , a novel and unobvious dispensing process . also , predetermining surface tension effects of optical grade adhesive material 34 , selectively designing cavity 70 in assembly fixture 60 , and predetermining the height of spacers 28 also play important roles in preventing the optical grade adhesive materials 34 from wicking beyond vias 30 and onto the ito coating layer 32 . by using the dispensing process of the invention , vias 30 are filled to a plug height ( h ) that ranges from no more than about 5 microns above active surface 22 of signal plate 18 to not less than 40 microns below active surface 22 of signal plate 18 . referring to fig6 if optical grade material in vias 30 exceed a plug height ( h ) greater than about 5 microns beyond second active surface 22 , the excess material level 34 a which extends into the polyimide layer 38 and into the liquid crystal medium 42 will interfere with the application , preferably coating , of polyimide alignment layer 38 onto the second surface 22 of signal plate 18 . moreover , the excess material level 34 a may interfere with the formation of patterns ( not shown ) on polyimide layer 38 . furthermore , excess material level 34 a may cause an increased separation between second active surface 22 and an active surface 48 of electrode panel 46 . therefore , the result of excessive material level 34 a in vias 30 would be improper alignment of the liquid crystal medium 42 . referring now to fig7 if optical grade material in vias 30 exceed a plug height ( h ) less than about 40 microns below the second active surface 22 , the deficient material level 34 b which falls below the polyimide layer 38 in vias 30 will also interfere with the application , preferably coating , of polyimide alignment layer 38 onto the second surface 22 of signal plate 18 . therefore , the result of deficient material level 34 b in vias 30 would also be improper alignment of the liquid crystal medium 42 . those skilled in the art will appreciate that several known processes exist for filling vias 30 in a workpiece , for instance , an lcd element . among the method currently used include screen printing and pressure rolling . however , these alternative methods are known to exert a force on the lcd element 10 forcing the optical grade adhesive material 34 through vias 30 and thereby contaminating second active surface 22 of signal plate 18 . of course , an additional process step would then be required which would include an adhesive removal and cleaning process . experience has taught that optical grade adhesive material 34 removal affects the optical quality of the optical grade adhesive material 34 as well as the adherence of the remaining optical grade adhesive material 34 to interior walls 33 of vias 30 . moreover , dispense processes , like screen - printing , introduce air into the vias 30 as the optical grade adhesive material 34 is dispensed into the vias 30 . referring again to fig5 an important novel and unobvious process for filling vias 30 free of air pockets or voids is now described . our preferred adhesive material dispense process requires several important steps in order to construct the lcd element 10 of the invention . assemblage for adhesive material dispense process 68 containing assembly fixture 60 is used . assembly fixture 60 has a cavity 70 alignable under the vias 30 drilled in the signal plate 18 . cavity 70 keeps the dispensed optical grade adhesive material 34 , such as epoxy , from exiting the vias 30 after the optical grade adhesive material 34 has flowed into the vias 30 . if the cavity 70 was not present in the assembly fixture 60 , then capillary action would continue to pull the epoxy out of the vias 30 and contaminate the second active surface 22 of signal plate 18 with epoxy and create voids in the vias 30 . according to fig5 at the outset , signal plate 18 is placed in the assembly fixture 60 and a positioning bracket 61 is slid into place . the positioning bracket 61 was designed to hold the deck plate 12 in place during the epoxy dispensing process . the positioning bracket 61 allows the deck plate 12 to be aligned properly prior to adhesive dispense . moreover , the positioning bracket 61 was designed with a gap 72 so it would not slide on top of first active surface 20 of signal plate 18 . furthermore , it is important that the design of positioning bracket 61 not interfere with the optical grade adhesive material 34 as it flows between the deck plate 12 and signal plate 18 . referring again to fig5 after the deck plate 12 is positioned on top of the signal plate 18 , a stabilizing member , preferably a glass block 62 , is placed on top of the deck plate 12 . the weight of glass block 62 keeps the deck plate 12 from moving either rotationally or translationally , during adhesive dispensing . a quartz block is preferably used , however the glass block 62 could also be fabricated from other materials such as aluminum . since the deck plate 12 is mounted to signal plate 18 at the same time the optical grade adhesive material 34 in the vias 30 is cured , some sort of supporting weight on the deck plate 12 is required . without the glass block 62 , there would be thickness variations in lcd elements produced in this process . if the deck plate 12 is allowed to float , i . e ., is not supported by glass block 62 or its equivalent , the deck plate 12 would displace the excess optical grade adhesive material 34 from the vias 30 to the second active surface 22 of the signal plate 18 . the same would result if deck plate 12 is allowed to stabilize to the plug height ( h ) of spacers 28 during adhesive material curing . displacement of the optical grade adhesive material 34 invariably contaminates the patterned ito and causes defective pixels in the lcd . again referring to fig5 once the signal plate 18 and deck plate 12 are arranged in the assembly fixture 60 , the optical grade adhesive material 34 is dispensed with an automated dispensing unit 63 . the dispensing unit 63 contains a base plate 65 with a heating element 66 , preferably a hot plate , that preheats the assembly fixture 60 , the signal plate 18 , and the deck plate 12 . preheating assists the flow of the optical grade adhesive material 34 . the optical grade adhesive material 34 is dispensed in a predetermined pattern , preferably a substantially “ l ” shaped pattern along two perimeter edges of deck plate 12 . this technique prevents the occurrence of voids or air bubbles in the adhesive layer 34 between the signal plate 18 and deck plate 12 , as previously described . a void in adhesive material 34 causes incoming light to scatter during the lcd application . more particularly , adhesive material 34 is dispensed along perimeter 64 of the deck plate 12 . capillary action allows the adhesive material 34 to flow between the deck plate 12 and the signal plate 18 . by dispensing adhesive material 34 along the perimeter 64 of the deck plate 12 , capillary action fills the gap 11 between the deck plate 12 and signal plate 18 . the 0 . 15 - mm spacer 28 between the deck plate 12 and the signal plate 18 enables the adhesive material 34 to flow into the vias 30 without trapping air in the vias 30 and creating voids . since surface tension controls the flow depth of the adhesive material 34 in vias 30 , when the adhesive material exits the vias 30 , surface tension keeps it from flowing out of the vias 30 onto the patterned ito . the invention has been described with reference to a preferred embodiment . however , it will be appreciated that variations and modifications can be effected by a person of ordinary skill in the art without departing from the scope of the invention . [ 0044 ] 4 prior art active surface second side signal plate [ 0045 ] 5 prior art active surface first side signal plate [ 0082 ] 64 adhesive dispensed along perimeter of deck plate 12 | 6 |
in fig1 , a six - cylinder internal combustion engine , for example a diesel engine , is denoted by 1 , the crankshaft 2 of which is coupled to a single - disk dry plate clutch denoted generally by 3 , which is enclosed in a clutch case 4 . the crankshaft 2 is connected , non - rotatably , to an input shaft 7 , which is rotatably mounted in the housing 8 of a gearbox denoted generally by 9 . also rotatably mounted in the housing 8 are a main shaft 10 and an intermediate shaft 11 . a gear wheel is rotatably mounted on the input shaft 7 and can be locked on the shaft with the aid of a synchronizing device provided with a coupling sleeve , which is mounted in a non - rotatable but axially displaceable manner on a hub connected , non - rotatably , to the output shaft . with the aid of the coupling sleeve , a gear wheel rotatably mounted on the main shaft 10 can be locked relative to the input shaft 7 . with the coupling sleeve in a middle position , both the gearwheels are disengaged from their respective shafts 7 and 10 . the above mentioned gear wheels , together with the synchronizing device and the coupling sleeve , form a splitter gear . disposed in a rotationally secure manner on the intermediate shaft are further gear wheels , which each engage with a respective gear wheel rotatably mounted on the main shaft 10 , which latter gear wheels can be locked on the main shaft with the aid of further coupling sleeves , which , in the illustrative embodiment shown , have no synchronizing devices . in the illustrative embodiment shown , a range gear step of the planetary gear type is also provided on the output end of the main shaft . all coupling sleeves are displaceable with the aid of servo elements ( not shown ), which can be pneumatically operated piston cylinder devices of the type utilized in a transmission of the kind described above , which is marketed under the name the servo elements are electronically controlled by a control unit 45 , comprising a microcomputer , in dependence on signals fed into the control unit and representing various engine and vehicle data , which minimally comprise engine speed , vehicle speed , the position of the gas pedal 48 of the vehicle , and , where appropriate , engine brake on - off , when an electronic gear selector 46 , coupled to the control unit 45 , is in its automatic gear position . the gas pedal position is obtained from an angle transmitter 49 , which is coordinated with the pedal arm 51 , pivotably mounted on a shaft 50 , of the gas pedal 48 . when the selector 46 is in the manual gearshift position , the gearshift is realized on the command of the driver via the gear selector 46 . the control unit 45 also controls the fuel injection , i . e . the engine speed , in dependence on the gas pedal position and the air supply to a pneumatic piston - cylinder device 47 , by which the clutch 3 is disengaged . the control unit 45 is programmed so that the freewheel function is activated when the driver , with the vehicle in motion and with possible engine brake , for example an exhaust - gas regulator or compression brake , deactivated , lets up the gas pedal 48 to a position within the predefined swivel angle range , represented in fig1 and denoted by α , of the pedal arm 51 , in which γ denotes the total swivel angle of the pedal arm 51 and β denotes a predefined angular range within which the engine does not inject fuel but within which disengagement does not take place , so that engine braking is obtainable . in the illustrative embodiment shown , the swivel angles α and β are about 5 ° each within the total swivel angle of the pedal arm 51 of about 30 ° but the angle β can be chosen , where appropriate , at 0 °. this means that when the gas pedal is let up to a position below about 5 ° from its non - actuated rest position , the freewheel function is activated by the control unit 45 first controlling the engine speed , so that no torque is transmitted between the input shaft 7 of the transmission and the main shaft 10 . the control unit 45 then transmits a signal to a servo element so that the input shaft 7 is disengaged from the intermediate shaft 11 by displacement of the coupling sleeve of the splitter gear into its neutral position , after which the engine is set to idling speed . the drive line is now separated and the vehicle is able to freewheel . in this case , therefore , a synchronized splitter gear is disengaged in order to achieve the freewheel function . other means for disengaging the engine from the drive wheels of the vehicle can also be used to achieve the freewheel function . according to the present invention , the control unit 45 is programmed so that the freewheel function is automatically deactivated when the speed of the vehicle exceeds a predetermined speed limit v max . in the embodiment according to fig1 , a device is shown for setting the predetermined speed v max , which device is denoted by 47 . this device can be a separate control with selectable speed levels on the instrument panel of the vehicle , alternatively the device 47 can be a selectable setting function in a menu system belonging to , for example , the trip computer of the vehicle . in one embodiment of the invention , the device 47 can be a unit which automatically predetermines the speed in dependence on the road gradient on which the vehicle is found or will be found (“ will be found ” is more fully explained below ). various arrangements for measuring the road gradient are known per se . the control diagram 20 according to fig2 shows in greater detail the various control steps performed by the control unit 45 according to one embodiment of the invention . in the step 21 , the control unit 45 detects whether the pedal arm 51 is within the swivel angle range a or not . if it is established that the pedal arm 51 is outside the swivel angle range α , then the freewheel function is not activated . the control unit 45 continuously detects the position of the pedal arm 51 . if it is established that the pedal arm 51 is inside the swivel angle range α , then the freewheel function is activated according to the disengagement of , for example , the splitter gear . this is done according to step 22 . if the freewheel function is activated , the instantaneous speed v of the vehicle is compared in step 23 with the predetermined speed according to this embodiment , the control unit 45 performs this comparison continuously as long as the freewheel function is engaged . according to the illustrative embodiment shown in fig2 , the control unit 45 activates the freewheel function in step 24 if the instantaneous speed v of the vehicle exceeds the predetermined speed v max whereupon the control unit 45 , according to the next step 25 , brakes the vehicle by , for example , activating the brake system ( not shown ) of the vehicle . the brake system can be constituted by the service brake and / or auxiliary brake of the vehicle , in which the auxiliary brake can be a compression brake disposed in the engine or an exhaust brake disposed on the exhaust pipe . as an alternative or in addition thereto , the vehicle can be engine - braked , i . e . with the aid of the internal friction of the engine 1 . in the following patent claims , the means comprises one or more of : engine brake ( through the internal friction of the engine ), service brake auxiliary brake . engine braking , with the aid of the internal friction of the engine , can be realized in those situations where the braking force from the engine friction is calculated to be sufficient . in this case , the control unit chooses in the transmission 9 a gear which is tailored to the braking force . in the deactivation of the freewheel function , the control unit 45 firstly adjusts the engine speed to a rev speed which allows synchronization , and the gear which has previously been disengaged is then reengaged . the drive line is now reconnected and engine braking or driving is again possible . the control unit 45 compares , according to step 26 , the instantaneous speed v of the vehicle with the predetermined speed v max , the control unit 45 terminating the braking , in step 27 , once the control unit 45 has established that the speed - lowering means have reduced the speed v of the vehicle to below following completed braking of the vehicle , the control diagram 20 proceeds to the return step 28 . according to a further embodiment of the invention , an identification is made of the fact that the downhill slope on which the vehicle is traveling will end within a near future . this can preferably be done by the control unit 45 with the aid , for example , of a gps - based navigation system positioning system ) disposed in the vehicle . with the aid of gps and electronic maps in the navigation system of the vehicle , the control unit 45 acquires information on the instantaneous position of the vehicle and the surrounding topography . the control unit 45 registers the future topography continuously throughout the period the freewheel function is deactivated . once the control unit 45 has identified that the downhill slope will soon end , the freewheel function is reactivated some time before the vehicle has fallen below the speed limit v max , i . e . when the instantaneous speed v is close to and somewhat above the predetermined speed limit v max . the time before the vehicle has fallen below the speed v max depends on when the downhill slope is calculated to end . this can be calculated through knowledge of the current speed v of the vehicle , expected deceleration and future topography . in a preferred embodiment of the invention , the control unit 45 takes account of how the topography looks after the downhill slope has come to an end , i . e . whether the downhill slope is followed by an uphill slope of a certain gradient or whether it is followed by an approximately flat road . simulations in the control unit 45 allow the most fuel - efficient controlling of the freewheel function , for example , to be chosen . in a further preferred embodiment , the system comprises an upper absolute maximum speed which lies a bit above v max and which the vehicle , with the aid of the automatic control system , must absolutely not be allowed to exceed , despite , for example , a simulation finding promising good fuel economy through maximum exploitation of the fact that the downhill slope will soon end and that this is followed by a steep uphill slope , steep enough to brake the vehicle to below v max . for safety reasons , the absolute maximum speed should be factory - set . according to a further embodiment of the invention , the control unit 45 continuously monitors the future topography both during the time the freewheel function is deactivated and when it is activated . the control unit 45 can hence allow the speed v of the vehicle to increase to somewhere between v max and the absolute maximum speed without the freewheel function being deactivated or without the system braking the vehicle with the brake system ( or just engine braking ), and subject to the control unit 45 having identified that the downhill slope will soon end and that the speed of the vehicle is hence calculated to stay below the absolute maximum speed . taken as a whole , this can further improve the fuel economy . should the device 47 automatically determine the speed v max in dependence on the road gradient for the downhill slope on which the vehicle is found , then the determination of v max can here form part of the continuous simulations , i . e . determination of when the freewheel function is to be deactivated , and then possibly reactivated , is realized continuously and in dependence on the instantaneous state of the vehicle and on future topography . in the embodiments , account has hitherto only been taken of the road gradient on which the vehicle is traveling . the acceleration and deceleration of the vehicle are also influenced , however , by rolling resistance and air resistance . the road gradient , the rolling resistance and the air resistance , taken together , are commonly referred to as road resistance . in a further embodiment of the invention , the automatic determination of v max and / or the simulations are realized in dependence on the instantaneous and , in some actual embodiments , also future road resistance of the vehicle . fig3 shows an apparatus 500 according to one embodiment of the invention , comprising a nonvolatile memory 520 , a processor 510 and a read and write memory 560 . the memory 520 has a first memory part 530 , in which a computer program for controlling the apparatus 500 is stored . the computer program in the memory part 530 for controlling the apparatus 500 can be an operating system . the apparatus 500 can be enclosed in , for example , a control unit , such as the control unit 45 . the data - processing unit 510 can comprise , for example , a microcomputer . the memory 520 also has a second memory part 540 , in which a program for controlling the freewheel function according to the invention is stored . in an alternative embodiment , the program for controlling the freewheel function is stored in a separate nonvolatile data storage medium 550 , such as , for example , a cd or an exchangeable semiconductor memory . the program can be stored in an executable form or in a compressed state . when it is stated below that the data - processing unit 510 runs a specific function , it should be clear that the data - processing unit 510 is running a specific part of the program stored in the memory 540 or a specific part of the program stored in the nonvolatile recording medium 550 . the data - processing unit 510 is tailored for communication with the memory 550 through a data bus 514 . the data - processing unit 510 is also tailored for communication with the memory 520 through a data bus 512 . in addition , the data - processing unit 510 is tailored for communication with the memory 560 through a data bus 511 . the data - processing unit 510 is also tailored for communication with a data port 590 by the use of a data bus 515 . the method according to the present invention can be executed by the data - processing unit 510 , by the data - processing unit 510 running the program stored in the memory 540 or the program stored in the nonvolatile recording medium 550 . in the present application , the use of terms such as “ including ” is open - ended and is intended to have the same meaning as terms such as “ comprising ” and not preclude the presence of other structure , material , or acts . similarly , though the use of terms such as “ can ” or “ may ” is intended to be open - ended and to reflect that structure , material , or acts are not necessary , the failure to use such terms is not intended to reflect that structure , material , or acts are essential . to the extent that structure , material , or acts are presently considered to be essential , they are identified as such . the invention should not be deemed to be limited to the illustrative embodiments described above , but rather a number of further variants and modifications are conceivable within the scope of the following patent claims . | 8 |
referring now to fig1 there is shown emission apparatus 10 in accordance with the present invention which comprises a housing 18 , and emission cell 10a comprising a u - shaped conduit 12 having separated cylindrical electrodes 14 and 16 , a first radiation detector 30 ( typically a photodiode ), an essentially light tight chamber 32 , a collimator 34 , a filter assembly 36 and a second radiation detector 38 ( typically a photodiode ) which is optional . a sample of gas being analyzed is flowed through conduit 12 at a controlled pressure and flow rate . the present invention uses the apparatus shown in fig .&# 39 ; s 1 , 2 and 3 and a method which utilizes emission spectrosocopy for measuring the composition or relative concentration of at least one component gas of a multi - component gas mixture . the spectrum used is typically the visible spectrum which is defined herein as 200 to 900 nanometers ( nm ). conduit 12 comprises a base portion 22 and leg portions 20 and 24 which extend through housing 18 . cylindrical electrodes 14 and 16 , formed preferably of non - corrosive conducting materials , surround sections of leg portions 22 and 20 , respectively , of conduit 12 in a spaced - apart mutually longitudinal relationship . typically electrode 14 is solid and electrode 16 is meshed . conduit 12 is transparent , preferably of glass or quartz , to permit transmission of the visible spectra to an optical detection device 30 ( also shown in fig2 ). electrodes 14 and 16 are mounted externally of conduit 12 to avoid exposure to the gases being measured and are connected by respective conductors 26 and 28 to a conventional rf ( radio - frequency ) power source 52 which is not shown in fig1 but is shown in fig2 . electrode 16 is typically grounded . it has been found that the ratio of the areas of the hot and ground electrodes is one factor which determines the voltage distribution within the sheath of the plasma created by the application of rf energy to the emission cell . gas flowing through conduit 12 experiences an r . f . glow discharge reaction in the region of conduit 12 between electrodes 14 and 16 when power source 52 is on . light emitted as a product of the glow discharge reaction is collimated through collimator 34 and illuminates photodiode 30 . optional detector ( photodiode ) 38 is positioned within housing 18 to sense the radiation therein and thereby to provide an operational on - means of the generation of electromagnetic radiation within housing 18 during analysis of a gaseous mixture . the voltages present at cell electrodes 14 and 16 give rise to an electric field which tends to accelerate ions and electrons in the enclosed gas and to form a plasma which is manifested by a stable glow discharge . in the plasma electrons , ions and neutral atoms and molecules are in continuing collision with each other . visible photons are thus emitted . there are many discrete energy levels at which photons can be emitted and the wavelengths of these photons is known to be inversely proportional to the energy of the transitions between levels . if only one gas species is present a continuous spectrum of visible radiation is observed and the gas can be identified from its characteristic pattern of wavelengths and lines of intensity . spectra of individual gases have been catalogued . for background information on the general subject of the interpretation of spectral signals in gas compositions , reference is made to the book by bochkov et al . published in 1965 by academie press and entitled &# 34 ; spectroscopic analysis of gas mixtures &# 34 ;. the emission spectrum emanating from a discharge within a mixture of gases is the sum of all the photons being emitted with the result that the combined spectrum is not a linear sum of the individual spectra . the relative intensities of the spectral lines associated with the individual gases are not preserved due to what is known as the matrix effect . deconvolution or separation of the individual spectra from a combined spectrum is thus more of an art than a science . complexity increases rapidly in multigas mixtures . in general matrix effects are obtained whenever two or more gases are mixed . furthermore , the effects are invariably nonlinear , which is to say that the change in shape of the emission spectrum of a particular gas is dependent not only on the quantity of another gas with which it is mixed , but also on the characteristics of the other gas or gases added . with a relatively simple binary mixture of , say , oxygen and argon , it is possible in many cases to determine empirically the variation in peak height of a particular feature versus composition . provided that this variation is monotonic , it is feasible to use this relationship to act as an indication of the relative amounts of the two gases present . however , when more than two gases are present in a mixture , the relationships between any set of the various relative heights of emission peaks and overall gas composition become too complex for reliable interpretation by prior methods . despite the inordinate complexity of multigas analysis i have found that for at least several multigas mixtures there exists an algebraic relationship , or more properly a family of such relationships , which does accurately and uniquely describe the composition of a multigas mixture over a specific range of compositions in terms of specific components of the spectral emission from that gas mixture . such an analytical algorithm can then be embedded in the program memory of a dedicated microcomputer capable of running that algorithm and continually recalculating the gas composition based on spectral data supplied by the optical detector . there then exists a dedicated , real - time gas analyzer . given a stable source configuration , the first step is to retrieve the visible emission spectrum for each of the pure gases of interest for different source regions and operating conditions . the mixture of interest for analysis in the preferred embodiment consists of percentage - level argon and oxygen with parts per million ( ppm ) levels of nitrogen to be monitored and controlled . it is to be noted that the intensity of the nitrogen signal depends not only the nitrogen concentration but also on the argon / oxygen ratio . the very low level of nitrogen means that it is desirable that the rf excitation source favor the generation of nitrogen emission energy compared with the more abundant argon and oxygen in the gas . this is accomplished by positioning the optical detector longitudinally with respect to the leg about which is wrapped the ground electrode . the spectrum varies along the length of the cell . it is preferred to select a region of the cell near electrode 16 . there is a tendency for the nitrogen peaks to be stronger in this area . i have found this positioning attitude makes it possible to develop an emission source that provides sufficient light output at an intensity and stability commensurate with a good signal - to - noise ratio and a rapid retrieval rate . the second step is to find a broad set of candidate wavelength regions by which interferences among spectral lines are not overpowering and where intensities are of comparable magnitude . fig4 depicts the emission spectrum corresponding to a gas mixture consisting of 500 ppm nitrogen , 18 % argon and the balance oxygen . the abscissa represent wavelengths in nanometers and the ordinates represent light intensity in arbitrary units . the gap in the vicinity of 800 nm represents off - scale argon and oxygen lines . a number of different peaks are identified as resulting from each of the component gases . a series of spectra were retrieved over a rang of cell operating pressures . it was found that intensity declined with cell pressures in the range of 2 . 75 to 5 . 75 torr ( one torricelli = 1 / 760 atmosphere ). however , it was noted that the rate of intensity decline of the different regions was most similar at pressures greater than about 4 torr . at higher pressures the response time of the cell declines ( at a constant gas sampling rate ) along with signal intensity . accordingly , a compromise pressure of 4 . 0 torr is assumed . the third step is to learn if and how the various light intensities are related to gas composition . to accomplish this task a large number ( 50 to 100 different compositions were used to provide a workable data set ) of emission spectra were generated from known gas proportions using a monochromator and the resultant spectra were digitized . the spectra were next split up into wavelength regions and for each region intensities of light emission were integrated and their relationships to nitrogen and argon concentrations were identified . from this analysis it became possible to determine the minimum number o ± regions needed to correlate reliably with these concentrations . application of well known principles of linear regression reveals that a high correlation exists with continuous , well behaved functions of the integrated light intensities within three of the selected regions . as shown in fig4 these three regions are centered on these emission peaks : the final step is to derive an analytical function or algorithm . the integrated light intensities from each of the three regions can be denominated as v1 , v2and v3 . two of these values can be normalized with respect to the third in order to facilitate two - dimensional plotting . thus , two independent variables are made available as : the relationship between each gas component and the independent variables r1 and r2 can in fact be described by a set of full quadratic equations with appropriate boundaries . the analytic response functions thus derived are of the following forms : where the a &# 39 ; s and b &# 39 ; s are numerical coefficients and z1 = r1 - m1 , z2 = r2 - m2 , and m1 and m2 are midvalues of the respective data groups . if these equation do not yield solutions of the desired accuracy because of possible discontinuities , the responses can be segregated into adjoining segments . in the preferred embodiment the equations were derived for three segments : a = r 2 & lt ;= 1 . 62 ; b = 1 . 62 & lt ; r2 & lt ;= 1 . 88 ; and c = r2 & gt ; 1 . 88 . the resultant midpoint values and coefficients adopted are shown in the following table i : ______________________________________coefficient a b c______________________________________a0 313 . 60 196 . 57 87 . 41a1 - 211 . 64 - 259 . 27 - 227 . 14a2 - 626 . 94 - 424 . 81 - 211 . 21a3 - 116 . 41 - 79 . 41 - 67 . 03a4 - 126 . 24 8 . 306 104 . 31a5 892 . 24 387 . 65 107 . 89b0 13 . 88 12 . 53 8 . 47b1 25 . 90 21 . 34 14 . 40b2 - 19 . 00 - 14 . 89 - 6 . 172b3 9 . 792 7 . 604 4 . 316b4 - 32 . 89 - 22 . 03 - 14 . 49b5 17 . 20 16 . 87 1 . 860m1 0 . 8185 0 . 884 0 . 850m2 1 . 537 1 . 738 2 . 1415______________________________________ referring again to fig2 filter assembly 36 is comprised of rotating filter wheel 54 connected by shaft 56 to motor 58 and is provided with three filter elements 60 , 62 and 64 . the filter elements 60 , 62 and 64 have spectral transmission characteristics which are matched to certain features of the visible emission spectra emanating from the excited mixture of nitrogen , argon and oxygen . the bandwidths of the filter elements are matched to the molecular species in the gaseous mixture in breadth sufficient to allow transmission of sufficient light at the wavelengths of interest without undue contribution from neighboring features of the spectrum which are not needed . the bandwidth of each filter element is defined as the width of the bandpass at some arbitrarily defined proportion of the peak transmission . generally , as previously discussed , the particular site from which the visible emission is sensed is preferably located at a point where the intensity of the band for each species is about the same thereby to minimize gain effects on the photodiode which may result when the photodiode is subjected to extreme ranges between high and low intensities of light emission . a timing wheel 66 is mounted on shaft 56 and is provided with a plurality of equally spaced - apart apertures 68 with one - half of such apertures aligned with respect to the filters 60 , 62 and 64 , it being understood that an electronic circuit may be employed to adjust and compensate for mechanical misalignment . radiation detector 30 is coupled to a conductor 70 for transmitting information to a data processing section 40 . timing wheel 66 is provided with two light emitting diodes 72 and phototransistors 74 to receive information via apertures 68 and transmit timing information via conductors 76 and 78 to data processing section 40 . in data processing section 40 , the information from radiation detector 30 comprised of a repeating series of the three spectral intensity signals is passed via conductor 70 and is correlated with the signals received from the phototransistors 74 transmitted via conductors 76 and 78 and wherein the data processing section 40 is provided with hardware to continually translate the spectral signals into signals proportional to the peak intensity of each waveform . data - processing section 40 comprises sample - and - hold circuits ( s / h ), differential amplifiers , and other circuits , all denoted by number 79 , an analog - to - digital converter 81 , digital microcomputer 82 and digital - to - analog converter 83 . circuits 79 receive the train of exponential waves from photodiode 30 over lead 70 resulting from the integration of energy in the exemplary three filters on filter wheel 36 . circuits 79 are also supplied with two timing signals derived from timing wheel 68 . both timing signals are cyclic with the rotation of shaft 56 . the first timing signal provides two sampling instants through a conventional ring counter for each selected bandpass . the second timing signal establishes the sequence in which each of the spectral signals generated is read . fig3 shows details of circuits 79 of fig2 . the top input line 70 shows a voltage waveform 105 which varies with time that represents spectral signals from collimator 34 and filter wheel 54 that are converted into electrical waves in photodiode and amplifier 30 in a conventional manner and appear on output line 70 as separate and sequential wave samples from each of the individual filters in wheel 54 . the sampling and cycle timing signals generated by the apertures in timing wheel 66 are converted into electrical signals in phototransistor block 74 in a conventional manner and appear on lines 76 and 78 . these signals are referred to a fixed base level in pulseformers 77 and 107 , which can constitute conventional operational amplifiers . the sample timing pulses from pulseformer 77 are subjected to a delay adjustment in block 90 and are applied to sample and hold block 100 in the form of timing pulses shown in waveform 97 . the sample timing pulses are also applied as clock pulses to ring counter 91 . similarly , reset pulses of the form shown in waveform 96 and occurring at the cyclic rate of timing wheel 66 are formed in pulseformer 107 from signals appearing on lead 78 from phototransistor 74 . ring counter 91 , which is typically composed of conventional jk - type flip flops , is driven by clock pulses from pulseformer 77 and reset pulses from pulseformer 107 . ring counter 91 delivers a group of six gating pulses ( waveforms 98 ) to sample and hold block and differential amplifier block 100 so that the delay - adjusted sampling pulses from delay adjust block 77 can respond to the respective peak ( designated 1 , 3 and 5 on waveform 105 ) and baseline ( designated 2 , 4 and 6 on waveform 105 ) pulses of the spectral signals shown in waveform 105 . the respective peak and rest levels held in sample and hold portion of block 100 are then made available to differential amplifiers portion of block 100 which then generate analog voltage signals proportional to the energy levels in the selected bandwidths of the complete spectral signals . these signals are delivered on leads 80 - 1 80 - 2 and 80 - 3 to converter 81 and microcomputer 82 for analysis according to the algorithms set forth above . referring again to fig2 converter 81 digitizes these analog magnitudes into suitable input signals for microcomputer 82 . microcomputer 82 processes these applied signals in accordance with the algorithm set forth above using the coefficients in table 1 to generate signals proportional to the amount of the contaminant nitrogen in the mixed gas being analyzed and the percentage of the desired argon noble gas . digital output signals from computer 82 are coupled to inputs of d / a converter 83 which converts them into analog form . the resultant analog signals appear on leads 84 and 86 to drive suitable display devices 85a and 85b , respectively . device 85a displays by direct readout the parts - per - million nitrogen content and device 85b , the percentage of argon in the mixture . in operation , the gaseous mixture to be analyzed is introduced into conduit 12 of emission cell 10 via leg 20 at a pressure of from about 1 to 10 torr . electrodes 14 and 16 are in spaced longitudinal relationship about the conduit 12 of from 1 / 8 to 10 inches and a source of rf energy connected thereto to generate the light emission spectra as generally determined by the electrical properties of the cell wall material . conduit 12 is formed of a dielectric material , such as quartz or like transparent material , for example , glass , i . e ., which also acts as an electrical insulator . the generated spectral emission must be capable of visual observation or sensing by a radiation detector with minimal attenuation . the conduit 12 may be formed into any desired geometry depending on the gaseous mixture to be analyzed , the visible emission spectra to be generated and its spectroscopy given the desire to evaluate wavelength peaks of like amplitude representative of the components of the gaseous mixture . electrodes 14 and 16 may be formed of a suitable electrically conductive material in either solid or meshed form thereby permitting viewing or sensing at any predetermined location along the conduit 12 as best determined by a general assay of the gaseous mixture being analyzed and specifics as to inherent variables when considering process requirements of the adjunct processing equipment , e . g ., trace amounts of nitrogen in an argon - oxygen gaseous mixture ( 4 - 20 % argon - balance o 2 ). in the instant application as previously disclosed , it was found particularly desirable to use the visible emission spectra along the axis of the leg portion 20 of the conduit 12 with the electronic circuitry hardwired for the composition of such aforementioned gases with appropriate filter elements 60 , 62 and 64 for argon - ni - trogen - oxygen positioned in the filter orifices of the filter assembly 36 . in one illustrative example , a gaseous stream ( approximately 20 sccm ) is continuously withdrawn from a gaseous conduit of an argon purification process to determine in real time the nitrogen content thereof . the nitrogen content is to range with trace concentrations of from 100 to 1500 ppm in an argon - oxygen gas mixture ( 4 - 20 % argon - balance o 2 ). outside this range the overall process will tend to break down . the gaseous stream at a pressure of 4 . 0 torr is introduced via leg portion 20 into conduit 12 ( 0 . 152 &# 34 ; id ) including cylindrically - shaped solid stainless steel electrode 14 and a cylindrically - shaped mesh electrode 16 formed of stainless steel and spaced apart about 5 mm . an rf energy source of 13 . 56 mhz is applied to generate a visible emission spectra . the light emission from conduit 12 is viewed by radiation detector 30 via collimator 34 and filter assembly 36 along the axis of leg portion 20 of conduit 12 , it being understood that the exact positioning thereof is determined by trial and error with reference to generated signals including amplitudes of each signal . filter wheel 52 is provided with commercially available circular optional bandpass interference filters having the following details : ______________________________________ bandwidthfiltercenter wavelength ( nm ) ( nm ) comment______________________________________1 360 11 corion p10 - 360 - f2 620 10 corion s10 - 620 - f inclined 12 ° to incident angle3 700 25 corion s25 - 700 - f + neutral density filter______________________________________ the signals received on radiation detector 30 are converted into three analog voltages corresponding to each optical channel from which gas composition is computed in real time from the magnitude . in the aforementioned example , use was made of a filter wheel to disperse the emission spectra ; however , it is to be understood by one skilled in the art that a spectrograph or rapid scanning monochromator could be used in conjunction with one or more optoelectronic detectors or a plurality of photodetectors with individual fixed filters . simplified for ease of understanding , the basic principles of this invention can be summarized as follows : the invention is a technique for measuring the composition , or relative concentration , of at least one component of a multicomponent ( two or more ) gas mixture within a more or less specific range of compositions . in some applications the interest is in determining when a particular component falls outside , either above or below a specified range , as in the important application of assuring that the nitrogen component in the example nitrogen , argon and oxygen mixture remains within a desired range . for the three - gas mixture example , the technique involves the application of radio - frequency energy to a gas mixture in order to excite visible emission which is dispersed into certain discrete spectral regions such that the gaseous composition is a function of the light intensity emanating within those spectral regions . the light intensities in the target regions are separately converted into electrical currents . by observing a sufficient number of controlled mixtures whose compositions vary over the working range of concentrations , one can devise an algorithm providing a continuum of compositional values of the component gases in terms of the light intensities observed in the chosen regions . the algorithm itself can be stored , typically in the electronic memory of a computer along with appropriate coefficients . subsequently , an unknown gas mixture with components within the assumed working range can be analyzed quantitatively through the application of the previously derived stored algorithm . while the invention has been described in connection with a specific exemplary embodiment , it will be understood that many modifications will be apparent to those skilled in the art , and that this disclosure and the appended claims are intended to cover any adaptations or variations thereof . moreover , while the invention has been disclosed in the context of a specific three - gas mixture which can be charted in two dimensions , its principles are clearly extensible into more complex mixtures where the matrix effect may be more intractable and the charting multidimensional | 6 |
preferred embodiments of the present invention will be described herein below with reference to the accompanying drawings . in the following description , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . a slide type terminal is illustrated in describing the present invention , but the present invention is not limited thereto . for example , the present invention may be applied to various wireless devices such as personal digital assistants ( pdas ), general terminals , and wireless notebook computers including plate type built - in antenna modules . as illustrated in fig1 and 2 , the slide type portable wireless terminal 100 includes a main body 110 , and a slide body 120 that can slide a predetermined length on the main body 100 in a length direction of the terminal 100 . the slide body 120 is installed on the main body 110 . as illustrated in fig2 , the slide body 120 is slid over the main body 110 to the predetermined length , and is used for overall functions of the terminal such as a call operation . a display unit 121 is installed on a front surface of the slide body 120 . the display unit 121 may be a color wide liquid crystal display ( lcd ) module , and may be a touch screen panel . a speaker unit 122 is installed above the display unit 121 , and at least one keypad assembly 123 is installed under the display unit 121 . the keypad assembly 123 may include a functional key button or a navigating key button so that a user can use a portion of functions of the terminal without opening the slide body 120 on the main body 110 . another keypad assembly 111 including a plurality of key buttons may be installed on a surface of the main body 110 viewed when the slide body 120 is opened on the main body 110 . the keypad assembly may be number key buttons ( 3 × 4 key buttons ). a microphone unit 112 is installed under the keypad assembly 111 . the main body 110 includes upper and lower case frames 13 and 14 , respectively , and a built - in antenna module ( 10 of fig3 ) is provided within a predetermined space defined by the upper and lower case frames 13 and 14 . as the built - in antennal module , a planar inverted f - antenna ( pifa ) may be used . the built - in antenna module 10 may be installed in an inner side ( indicated by a dotted line in fig2 ) of a rear upper portion of the main body 110 above a battery pack 113 . fig3 is an exploded perspective view of a built - in antenna module 10 according to the present invention . the built - in antenna module 10 includes the upper case frame 13 of the terminal , a main board 20 installed in the case frame 13 , an antenna radiator 40 installed on the main board 20 , and an electro - magnetic interference ( emi ) pigment 132 applied on an inner surface 131 of the case frame 13 to face a bottom surface 24 ′ ( see fig4 ) opposite a top surface 24 of the main board 20 on which the antenna radiator 40 is installed . the main board 20 includes a ground pad 21 and a feed pad 22 on the top surface 24 . the ground pad 21 and the feed pad 22 are electrically connected respectively to a ground pin 41 and a feed pin 42 extending from the antenna radiator 40 . the feed pad 22 is electrically connected to a radio frequency ( rf ) connector 25 by a pattern 23 formed on the main board 20 . the antenna radiator 40 may be fixed on an antenna carrier 30 having a predetermined height . the antenna carrier 30 may be formed of a synthetic resin . this is because if the antennal radiator 40 , a thin metallic plate , is fixed directly onto the main board 20 without the antenna carrier 30 , the shape of the antenna radiator 40 might be twisted afterward , deteriorating a radiation characteristic of the antenna module . thus , the antenna radiator 40 may include a plurality of opening 43 and thus be fixed to the antenna carrier 30 by , for example , ultrasonic welding . the antenna carrier 30 may include through holes 31 and 32 at predetermined locations , so that the ground pin 41 and the feed pin 42 of the antenna radiator 40 pass through the through holes 31 and 32 and are connected to the ground pad 21 and the feed pad 22 of the main board 20 , respectively . also , fixing protrusions 36 protrude downwardly from both sides of the antenna carrier 30 . the fixing protrusions 36 are inserted in fixing grooves 26 formed in the main board 20 so that the antenna carrier 30 can be firmly fixed to the main board 20 . the emi pigment 132 is formed on the inner surface 131 of the case frame 13 of the terminal . the emi pigment 132 may be deposited or applied on the inner surface 131 of the case frame 13 . the emi pigment 132 may have a greater area than that of the antenna radiator 40 , and may be applied or deposited at a location overlapping a portion of the main board 20 where the antenna radiator 40 is installed . thus , one end of the emi pigment 132 is electrically connected to the ground pad 21 , and the other end thereof is electrically connected to a ground layer ( 29 of fig4 ) of the main board 20 , so that the emi pigment 132 may serve as a ground surface for the antenna radiator 40 . however , the present invention is not limited to the above description . besides the emi pigment 132 , similar conductors may be used . examples of the conductor may include a metal plate or a flexible printed circuit ( fpc ) that has a predetermined area and thickness , and the conductor is attached to the inner surface 131 of the case frame 13 . for example , the metal plate excluding a portion for the electrical connection may be inserted into the case frame 13 by insertion molding when the case frame 13 is fabricated . of course , an electrical connection unit is used for an electrical connection of the ground pad 21 and the ground layer ( item 29 in fig4 ) with the emi pigment 132 as the conductor . as the electrical connection unit , conductive tapes 11 and 12 , each formed by being wound a plurality of times and having a predetermined height , are used . however , the electrical connection unit is not limited to the conductive tapes , but other materials such as a conductive foam or a plate type metal spring may also be used . fig4 is a rear perspective view of the main board 20 according to the present invention . the ground layer 29 is formed on the bottom surface 24 ′ of the main board 20 opposite the top surface 24 where the antenna radiator 40 is installed . the ground layer 29 serves to ground various electronic function groups used in the portable wireless terminal 100 , and also serves as a ground surface of the antenna radiator 40 . thus , the ground layer 29 may be formed on a bottom surface of the main board 20 , which is located at the farthest vertical distance from the antenna radiator 40 . the ground layer 29 may not be formed in a clearance area on the bottom surface 24 ′; the clearance area is an area in which the antenna radiator 40 is orthogonally projected on the bottom surface 24 ′. of course , a first contact point 27 electrically connected to the ground pad 21 is formed on the bottom surface 24 ′ opposite the top surface 24 where the ground pad 21 is formed , therefore the first contact point 27 may be electrically connected to the ground pad 21 through a via . also , a second contact point 28 electrically connected to the ground layer 29 is exposed on the bottom surface 24 ′, and the ground layer 29 is not exposed from the main board 20 in general . particularly , the first and second contact points 27 and 28 may be used as contact points with the conductive tapes 11 and 12 , the electrical connection unit ( fig5 ). fig5 is a cross - sectional view of a main part , illustrating that the built - in antenna module is installed at the main board according to the present invention , which will now be described with reference to fig3 through 5 . first , the antenna radiator 40 is fixed on the top surface 24 of the main board 20 via the antenna carrier 30 . here , the feed pin 42 of the antenna radiator 40 is connected to the feed pad 22 of the main board 20 , and the ground pin 41 is connected to the ground pad 21 of the main board 20 . in this case , the ground pad 21 of the main board 20 and the ground pin 41 of the antenna radiator 40 are electrically connected together , but are not yet connected to the ground layer 29 of the main board 20 . thereafter , when the main board 20 having the antenna radiator 40 is mounted to the case frame 13 , the main board 20 and the emi pigment 132 are electrically connected together by the conductive tapes 11 and 12 . here , the first contact point 27 of the main board 20 contacts one end of the emi pigment 132 by the conductive tape 11 , and the second contact point 28 contacts the other end of the emi pigment 132 by another conductive tape 12 . consequently , the antenna radiator 40 is grounded in the order of ground pin 41 of antenna radiator 40 → ground pad 21 of main board 20 → first contact portion 27 of main board 20 → conductive tape 11 → emi pigment ( conductor ) 132 → conductive tape 12 → ground layer 29 of main board 20 . thus , the emi pigment 132 is used as a ground surface together with the ground layer 29 for the antenna radiator 40 of the main board 20 . also , since the emi pigment 132 is formed on the inner surface 131 of the case frame 13 , an effect of maximizing a distance from the antenna radiator 40 can be obtained . that is , as illustrated in fig5 , the distance between the antenna radiator 40 and the ground surface is t 1 + t 2 . the maximum distance between the antenna radiator 40 and the ground surface may contribute to improving radiation performance of the antenna radiator 40 . fig6 a and 6b are graphs showing voltage standing wave ratio ( vswr ) according to opening and closing of a slide type terminal including a built - in antenna module according to the present invention . the antenna was designed to optimize its characteristic in a slide - up mode , an actual call mode of the terminal . since a slide - down mode is a reception stand - by mode in most cases , somewhat high vswr ( marker 1 and marker 3 in the drawing ) in transmission does not have significant influence on the terminal performance . in actuality , it is almost impossible to implement a design that satisfies performance in both the slide - up and slide - down modes . based on a mutual trade - off relation , the transmission characteristic in the slide - down mode which less affects the terminal performance is sacrificed . the sar in the case of the global system for mobile communications ( gsm ) and the sar in the case of the digital cellular system ( dcs ) are shown in tables 1 and 2 below . as shown in table 1 and table 2 , the sar was maximum 0 . 472 w / kg in the case of the gsm , and was maximum 0 . 137 w / kg in the case of the dcs . it can be seen that excellent performance can be achieved compared to the average 2 . 0 w / kg per log of the european standard . because the sar characteristic has recently been emphasized to a great extent and strictly managed internationally , such results are very much satisfactory , and may be used as a reference in developing a like terminal . in the built - in antenna module according to the present invention , a ground surface interacting with the antenna radiator is applied to the case frame of the terminal . thus , a distance between the antenna radiator and the ground surface is maximized without increasing the volume of the terminal , so that radiation performance can be improved , and thus the slimness and high quality of the terminal can be achieved . while the invention has been shown and described with reference to certain preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
the features and description of one embodiment the present invention are best understood while viewing the cross sectional structure views ( fig1 - 12 ) in light of the process block diagram fig1 , illustrating the use of capped seed layers during the formation of a perpendicular write head with a trailing shield . an alternate embodiment of the present invention is disclosed in fig1 - 15 , which illustrates the use of capped seed layers during the formation of a perpendicular write head having a wrap around shield . although these two example shield geometries have been chosen to illustrate the application of capped seed layers , application to these examples should not be taken as limiting , as the disclosed embodiments of the present invention may equally applicable to other shield or head geometries , as would be evident to those of skill in the art . fig1 is a schematic block diagram of the process for fabricating a trailing shield , in accordance with an embodiment of the present invention . the process begins at step 1302 , wherein the layer stack of fig1 is deposited . fig1 is a partial cross sectional view 100 looking into the air bearing surface ( abs ) of a blanket deposited film stack prior to fabrication of a perpendicular write head with a trailing shield , in accordance with an embodiment of the present invention . the film stack comprises blanket layers 102 - 112 deposited on substrate 114 , which is typically alumina ( at the air bearing surface ), but may be other materials such as magnetic pole shaping layers deeper ( further from the abs ) into the structure . for the purposes of this disclosure , substrate 114 can be a bulk material on which all subsequent layers are deposited , or it can be a layer deposited over previously deposited under - layers . for example , when fabricating a combined read and write head structure , the latter is usually the case , as the read head structure is generally deposited first ( not shown ). layer 112 makes up the magnetic pole material , and is typically a laminated , multilayer structure comprising layers of magnetic and non - magnetic materials . above pole layer 112 is gap layer 110 , comprised of alumina or other non - magnetic materials . preferably , alumina is used . above gap layer is cmp stop layer 109 . typically , dlc ( diamond like carbon ) is used for this layer . a spacer layer 108 is deposited above dlc layer 109 , and is comprised of durimide . above spacer layer 108 , layers 102 , 104 , and 106 are deposited . layer 102 comprises the imaging photo resist layer that defines the width and location of the write pole . layers 104 and 106 aid in transferring the developed features of photo resist layer 102 to the spacer layer 108 . layer 106 is typically comprised of silica , and layer 104 is typically comprised of durimide . in step 1304 of fig1 , photo resist layer 102 is imaged and developed , creating feature 102 ′ in fig2 . fig2 is a partial cross sectional view 200 looking into the air bearing surface ( abs ) of the film structure following the imaging and development of photo - resist layer 102 , in accordance with an embodiment of the present invention . in step 1306 of fig1 , photo resist feature 102 ′ is transferred to layers 106 and 108 , creating features 106 ′ and 108 ′. fig3 is a partial cross sectional view 300 looking into the air bearing surface ( abs ) of the film structure subsequent to the transfer of patterned feature 102 ′ into layers 106 and 108 , in accordance with an embodiment of the present invention . the transfer is carried out with three consecutive rie process steps comprising a first oxidation step to etch layer 104 , a second fluorine etch step to etch silica layer 106 , followed by a third oxidation step to etch spacer layer 108 . details of the rie processes are well known to those skilled in the art . during the oxidation steps , photo resist layer 102 is removed , resulting in structure 300 . in step 1308 of fig1 , the structure of fig3 is etched and ion milled to form the pole structure comprising features 108 ′, 109 ′, 110 ′ and 112 ′. fig4 is a partial cross sectional view 400 looking into the air bearing surface ( abs ) of the film structure subsequent to etching and ion milling to form the pole structure , in accordance with an embodiment of the present invention . the width of the pole structure ( 108 ′, 109 ′, 110 ′, 112 ′) is w p 402 . details of the formation of the tapered pole section 112 ′ have been previously disclosed in the prior art and are well known . in step 1310 of fig1 , dielectric layer 502 is deposited around pole structure 108 ′, 109 ′, 110 ′, 112 ′. fig5 is a partial cross sectional view 500 looking into the air bearing surface ( abs ) of the film structure subsequent to deposition of dielectric layer 502 , in accordance with an embodiment of the present invention . layer 502 typically comprises alumina , and is deposited by a process known to those skilled in the art . in step 1312 of fig1 , the structure of fig5 is planarized by cmp . fig6 is a partial cross sectional view 600 looking into the air bearing surface ( abs ) of the film structure subsequent to planarization by cmp , in accordance with an embodiment of the present invention . planarization is slowed or terminated by dlc stop layer 109 ′. in step 1314 of fig1 , layer 109 ′ is removed . fig7 is a partial cross sectional view 700 looking into the air bearing surface ( abs ) of the film structure subsequent to the removal of layer 109 ′, in accordance with an embodiment of the present invention . layer 109 ′ is removed by an oxidation based rie process suitable for the removal of dlc layers , well known to those skilled in the art . in step 1316 of fig1 , the combined seed / capping layer 802 is deposited over the structure of fig7 . fig8 a is a partial cross sectional view looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of seed / capping layer 802 , in accordance with an embodiment of the present invention . fig8 b is a partial cross sectional view of detail 804 of fig8 a , in accordance with an embodiment of the present invention . seed / capping layer 802 serves as conductive cathode layer for the subsequent deposition of the wrap around shield , which is usually deposited by electroplating . prior to electroplating the shield , portions of the surface covered by seed / capping layer 802 need to be masked to define the locations to which the shield will be confined . the masking is performed by a photo resist layer , which must be exposed and developed to create the mask . the adhesion of the photo resist to the upper surface of seed / capping layer is essential to prevent under - plating of the shield , which is deposition of the shield metal under the photo resist layer . under - plating compromises the accuracy of the mask , allowing deposition of shield metal in unwanted locations , and is therefore undesirable . in the prior art , seed layers having upper surfaces of exposed precious metals such as rh , can exhibit photo resist adhesion problems . to improve photo resist adhesion to the rh seed layer , an inorganic sio x n y , anti - reflective coating is often deposited over the rh . since this coating is non - conductive , it must be removed via an rie process prior electroplating of the shield structure . while the arc can be applied over precious metal seed layers to resolve the photo resist adhesion problems , the removal process can compromise the accuracy of the photo resist mask since the rie removal process must be performed after the photo resist mask is fully formed . exposure of the mask to rie can damage portions of the mask , compromising critical dimension control . another common seed layer material used in the prior art , containing alloys of ni and cr , does not have the photo resist adhesion problem , but can exhibit corrosion or oxidation problems after exposure to air and moisture . the oxides can be poor conductors , making plating of the shield layer difficult , non - uniform , or non - adherent . these oxides are also not easily removed by the plating bath chemistry , so they may remain on the seed layer surface during electroplating . it is a main advantage of embodiments of the present invention to resolve the photo resist adhesion and corrosion problems of prior art seed layers without the need for a separate arc layer that must be removed prior to electroplating . this is accomplished by providing a dual layer seed layer , or a base seed layer 802 b with a conductive capping layer 802 a that need not be removed prior to plating . a number of advantages of the present invention are evident . the base seed layer 802 b can be chosen without concern for its corrosion performance , or photo resist adhesion performance . for example , if a high seed layer conductivity is desired , noble metals such as gold , silver , rhodium , platinum , palladium , or other precious metals may be used even though they may not have good photo resist adhesion . conductive capping layer 802 a provides an adhesive interface with the subsequently applied photo resist . in another example , cost may be an issue , suggesting the use of conventional nicr ( or another low cost material such as ir ) base seed layer . the oxide formation or corrosion of these cheaper base seed layers is suppressed through use of an appropriate capping layer 802 a . for these base seed layers , capping layer 802 b provides a adhesive interface to the plated shield . capping layer 802 a can made from alloys of co , fe , and ni , preferably alloys of cofe , conife , or nife . oxides of these alloys are easily removed in the plating bath chemistry during the deposition of the shield , allowing void free plating and good adhesion to the shield . photo resist adhesion is also acceptable . the thickness of the capping layer 802 a can range from 1 to 20 nm , preferably 2 - 5 nm . base seed layer 802 b can be comprised of : a noble metal such as au , ag , pd , pt , rh , ru , ir , and os ; alloys of ni and p ; alloys of ni and cr ; w , and ta . thickness for the base seed layer 802 b can range from 1 to 100 nm , preferably 5 to 50 nm , and more preferably 20 to 30 nm . deposition of seed layer / capping layer 802 can be performed by pvd , cvd , ion beam deposition , or any other method known to those skilled in the art . returning to fig1 , in step 1318 a blanket photo resist is deposited over seed / capping layer 802 . fig9 is a partial cross sectional view 900 looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of photo resist layer 902 , in accordance with an embodiment of the present invention . in step 1320 of fig1 , photo resist layer 902 is imaged and developed in accordance with methods well known to those skilled in the art . fig1 is a partial cross sectional view 1000 looking into the air bearing surface ( abs ) of the film structure subsequent to the imaging and development of photo resist layer 902 , in accordance with an embodiment of the present invention . in step 1322 of fig1 , the trailing shield 1102 is deposited over seed / capping layer 802 via electroplating , a process well known to those skilled in the art . fig1 is a partial cross sectional view 1100 looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of shield layer 1102 , in accordance with an embodiment of the present invention . in step 1324 of fig1 , the photo resist layer 902 is removed by methods well known to skilled in the art . fig1 is a partial cross sectional view 1200 looking into the air bearing surface ( abs ) of the film structure subsequent to the removal of photo resist layer 902 , in accordance with an embodiment of the present invention . the forgoing discussion has been focused upon the process for making a perpendicular write head having a trailing shield . however , the suitability and application of seed / capping layers is not limited only to the production of trailing shields , but may be applied to perpendicular write heads having wrap around shields as well . for simplification , structures corresponding to process steps prior to seed / capping layer deposition are not shown for the wrap around shield . fig1 a is a partial cross sectional view 1400 looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of seed / capping layer 1402 , during fabrication of a perpendicular write head with a wrap around shield , in accordance with an alternate embodiment of the present invention . in view 1400 , tapered magnetic pole structure 112 ′, gap layer 110 ′, and side gap layer 503 have been previously deposited on substrate 114 by methods well known to those skilled in the art . fig1 b is a partial cross sectional view of detail 1404 of fig1 a , in accordance with an alternate embodiment of the present invention . the materials , thickness ranges , and other limitations disclosed above for base seed layer 802 b and capping layer 802 a apply equally to layers 1502 a and 1502 b for this alternative embodiment of the present invention . fig1 is a partial cross sectional view 1500 looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of wrap around shield 1502 , in accordance with an alternate embodiment of the present invention . the preceding steps of photo resist deposition , exposure , development and removal are not shown , as these processes are self evident to those of skill in the art , and in the light of the forgoing embodiments and discussion . the present invention is not limited by the previous embodiments heretofore described . rather , the scope of the present invention is to be defined by these descriptions taken together with the attached claims and their equivalents . | 8 |
the figure shows , without being drawn to scale , a multifunction pressure probe 1 with its moving vane 10 and its fastening base 11 . the moving vane 10 , in the form of a fin , is fastened via its root 12 in a bearing 13 of the fastening base 11 , thereby allowing it to rotate about a longitudinal axis 14 and giving it the possibility of being oriented in the direction of the wind in the manner of a weather cock . the fastening base 11 is designed to be mounted on the skin of an aircraft so that the moving vane 10 of the probe 1 projects to the outside of the aircraft and is oriented according to the local flow of the air relative to the skin of the aircraft . thus , the angle of orientation adopted by the moving vane 10 is the local angle - of - attack or the angle - of - sideslip according to the configuration on the aircraft . stops ( not shown ) limit the deflection of the moving vane on either side of the neutral position , for example to ± 60 °. in addition to the local angle - of - attack measurement , the probe 1 allows measurements of the dynamic and static pressures thanks to air taps 15 , 16 made on the moving vane 10 and air lines that connect these air taps 15 , 16 to pressure sensors ( not shown ) placed on the inside of the aircraft . the air lines connecting the air taps 15 , 16 located on the moving vane to the pressure sensors placed inside the aircraft pass through the root 12 of the moving vane 10 . they must faithfully transmit the pressures at the air taps 15 , 16 to the pressure sensors , while still accommodating the relative rotational movements of the moving vane 10 with respect to the fastening base 11 and opposing these movements with only a minimal restoring force . in the first part of their path going , within the moving vane 10 , from the air taps 15 , 16 to the root 12 of the vane , the air lines are produced by means of suitably curved rigid metal tubes 17 , 18 , which terminate in openings 19 , 20 projecting beneath the root of the moving vane 12 . in the second part of their path on the outside of the moving vane 12 , the air lines are produced using lengths of flexible tubing 21 , 22 that are fitted over the openings 19 , 20 of the metal tubes 17 , 18 projecting from the root 12 of the moving vane 10 are also held in place by a plate 23 through which they pass before continuing their paths toward the pressure sensors placed on the inside of the aircraft &# 39 ; s skin . the fact of using lengths of flexible tubing 21 , 22 instead of lengths of rigid tubing butted together by means of friction rotary joints makes it possible for the dry friction during rotation of the moving vane 10 to be substantially reduced since it is therefore no longer a question of dry friction but of elastic stiffness . this elastic stiffness may be reduced as much as desired by varying the nature of the flexible tubings , their diameter , their arrangement relative to the rotation axis of the bearing 13 and the distance of the plate 23 from the root 12 of the moving vane . the figure also shows multistrand electrical wires 32 , 33 placed parallel to the lengths of flexible tubing 21 , 22 in the gap between the root 12 of the moving vane 10 and the plate 23 . these electrical wires 32 , 33 are intended for a heating system mounted in the moving vane 10 of the probe in order to prevent it from icing up . other multistrand electrical wires , again placed parallel to the lengths of flexible tubing 21 , 22 may be used , especially for measuring the value of a thermistance of a system for measuring the total temperature of the air , said system being mounted in the moving vane . these electrical wires have , unlike the flexible tubings , a high longitudinal stiffness that is transformed into elastic stiffness by the flexibility of the plate 23 or of its fastening . the error in angular measurement resulting from the difference between the true position α v and the measured position α of the vane induced by the elastic stiffness due to the lengths of flexible tubing 21 , 22 and to the electrical wires 32 , 33 may be subjected to a subsequent compensation , as it may be calculated by means of the equation : α v - α = ( α - α 0 ) r k v 2 ( 1 ) v being the air speed , kv 2 the aerodynamic restoring force of the vane in the direction of the wind , α 0 the neutral position of the vane and r the stiffness coefficient . to a first approximation : p t - p s = 1 2 ρ v 2 p t being the total pressure and p s being the static pressure , so that equation ( 1 ) becomes : α v - α = ( α - α 0 ) ρ r 2 k ( p t - p s ) = k ( α - α 0 ) ( p t - p s ) where α 0 may be set to the angle - of - attack zero and k may be measured in a wind tunnel . the parameters p t , p s and α are measured by the probe . the correction ( α v - α ) may therefore be calculated and the true angle α v deduced from the angle α measured by the probe . in this case , the system for measuring the angular position of the moving vane 10 includes a sensor for measuring the angular position of the vane 10 together with error estimation means operating on the basis of the above equation and means for correcting the measurement by the angular position sensor , taking into account the estimated error provided by the error estimation means . the lengths of flexible tubing 21 , 22 and the electrical wires 32 , 33 are fastened at the plate 23 in penetrations 24 , 25 , 26 , 27 which may have thicker walls than the plate 23 in order to improve their retention . the plate 23 is placed beneath the fastening base 11 of the probe , along the axis of and at a certain distance from the bearing 13 . it is attached to the fastening base 11 of the probe so as to greatly limit and possibly prevent any rotational movement about the axis of the bearing 13 so that the relative rotational movement of the moving vane 10 with respect to the fastening base 11 of the probe is , for the large part , between the root 12 of the moving vane 10 and the plate 23 . thus , any deformation on the lengths of flexible tubing 21 , 22 by the relative movement of the moving vane 10 with respect to the fastening base 11 of the probe is localized along the distance separating the root 12 of the moving vane 10 from the plate 23 . in the gap separating the root 12 of the moving vane 10 , the electrical wires 32 , 33 are placed symmetrically with respect to the axis 14 of the bearing 13 , close to the axis 14 so as to minimize the restoring torque due to their stiffness . likewise , the lengths of flexible tubing 21 , 22 are placed symmetrically with respect to the axis 14 of the bearing 13 so that both undergo the same deformation amplitudes . to avoid any frictional wear of one against the other during the rotational movements of the moving vane or any vibrations transmitted by the structure of the aircraft , the flexible tubings 21 , 22 and electrical wires 32 , 33 are slightly tensioned in the gap separating the root 12 of the vane 10 from the plate 23 , these being fastened to this plate 23 and to the root 12 of the moving vane so as to be parallel to the axis of the bearing 13 when the moving vane 10 is in the neutral position and are sufficiently far apart not to be touched when the moving vane 10 comes into its stop positions . because they are slightly tensioned , the lengths of flexible tubing 21 , 22 are subjected to tensile or elongational forces owing to the moving vane 10 when the latter moves away from its neutral position . they then exert , in reaction , a torque restoring the vane to its neutral position , which is deleterious as it introduces an error in the positioning of the vane in the direction of the wind , which error increases as the air speed of the aircraft decreases and as the vane moves away from its neutral position . to bring this restoring torque to a very low value , it is possible to vary various factors : the diameter , thickness and nature of the lengths of flexible tubing 21 , 22 ; the length of the flexible tubings 21 , 22 , that is to say the spacing between the root 12 of the moving vane , but this is rapidly limited by the available space in the aircraft to the rear of the probe root ; the capability of absorption , by the plate 23 or its fastening to the base 11 of the probe , of the tensile forces exerted by the moving vane 10 on the lengths of flexible tubing 21 , 22 during its rotational movements ; the distance of the lengths of flexible tubing 21 , 22 from the axis 14 of the bearing ; and the maximum deflection . when the moving vane 10 moves away from its neutral position , the plate 23 absorbs the tensile forces exerted on the electrical wires 32 , 33 and also a relatively large part of the forces exerted on the lengths of flexible tubing 21 , 22 either , as shown , thanks to an elastic system 28 , 29 for attachment to the fastening base 11 allowing a certain deflection depthwise with respect to the base , or by elastic deformation thanks to natural flexibility , or else by a combination of natural flexibility and an elastic attachment system . the lengths of flexible tubing 21 , 22 must withstand the rigorous environmental conditions encountered on the skin of the aircraft and must not undergo premature aging liable to weaken them in the long term and to impair the reliability of the probe . advantageously , they are made of a thermoplastic elastomer such as a styrene / ethylene - butylene / styrene copolymer modified with silicone oil . flexible tubings of this composition have already been proposed commercially for exclusively medical use , for example by the company consolidated polymer technologies , which sells them under the name “ c - flex ® 50a ”. the plate 23 may consist of a flexible sheet made of rubber or an elastomer , for example a thermoplastic elastomer such as a modified styrene / ethylene - butylene / styrene copolymer like the flexible tubings , and may be fastened to the base 11 of the probe by a rigid attachment system , such as a rigid clip fastened to the base by screws . | 5 |
although the disclosure hereof is detailed and exact to enable those skilled in the art to practice the invention , the physical embodiments herein disclosed merely exemplify the invention which may be embodied in other specific structures . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . fig1 - 3 illustrate a first exemplary embodiment 100 of a truck box cover according to the present invention in a first position both independently and as installed in the box 12 of a truck 10 . the box 12 of a truck 10 typically comprises a box floor 14 , a first body panel 16 with a first box rail 18 , a second body panel 20 with a second box rail 22 , a box end panel 24 with a third box rail 26 , and a tailgate 28 ( see also fig1 and 11 ). the truck box cover system 100 according to an exemplary first embodiment of the present invention preferably comprises a first frame 102 ; a second frame 124 ; a top 160 preferably comprising a first compliant material ; a second compliant material 170 ( see also fig6 ), a rear panel 70 , and a plurality of columns 190 . the first frame 102 preferably comprises a first rail member 104 , a second rail member 114 , and a third rail member 120 . the first , second , and third rail members 104 , 114 , 120 are configured to follow the shape of the truck box 12 , specifically the first , second , and third box rails 18 , 22 , 26 , respectively . the first , second , and third rail members 104 , 114 , 120 are preferably configured to be set upon the first , second , and third box rails 18 , 22 , 26 of the box 12 , respectively . securing at least the first and second rail members 104 , 114 , to the first and second box rails 18 , 22 may be accomplished by clamping , bolting , and / or any other method now known or later developed . looking at fig5 a the first rail member 104 is shown in more detail . preferably , the first rail member 104 comprises a first rail member retainer 106 and a first rail member enclosure 112 . similarly , but not shown in this figure , the second rail member 114 preferably comprises a second rail member retainer 116 and a second rail member enclosure 118 . as discussed further below , the first and second rail member retainers 106 , 116 are configured to retain a first end portion 172 of the second compliant member 170 , and the first and second rail member enclosures 112 , 118 are configured to house at least a portion of the second compliant material 170 when the truck box cover system 100 is in the first position ( see fig5 ). looking back to fig1 , the third rail member 120 is shown preferably comprising a third rail member retainer 122 , similar to the first and second rail member retainers 106 , 116 . the third rail member 120 extends between the first and second rail members 104 , 114 and is configured to retain the first end portion 172 of the second compliant member 170 . the second frame 124 is more easily seen in fig6 and 7a . the second frame 124 preferably comprises a first cover member 126 , a second cover member 136 , a third cover member 146 , and a fourth cover member 150 ( see fig4 b ). looking to fig5 a for a more detailed view , the first cover member 126 is shown preferably comprising a first cover member retainer 128 , a first cover member flange 130 , and a first cover member plate 132 extending inward from the first cover member retainer 128 . hook - and - loop fastener material 30 is preferably provided along the first cover member flange 130 . the first cover member plate 132 preferably has a shelf 134 extending the length thereof and a first cam member 80 with a surface 82 is preferably provided thereupon . the first cover member retainer 128 is preferably configured to retain a second end portion 176 of the second compliant member 170 . as shown in fig1 , the second cover member 136 is similar to the first cover member 126 and comprises a second cover member retainer 138 , a second cover member flange 140 , and a second cover member plate 142 extending inward from the second cover member retainer 138 . hook - and - loop fastener material 30 is preferably provided along the second cover member flange 140 ( see fig1 ). the second cover member plate 142 preferably has a shelf 144 and a second cam member 82 with a surface 84 is preferably provided thereupon . the second cover member retainer 138 is preferably configured to retain the second end portion 176 of the second compliant member 170 . the third cover member 146 preferably comprises a third cover member retainer 148 and extends between the first and second cover members 126 , 136 . the third cover member 146 is configured to retain the second end portion 176 of the second compliant member 170 and a third side 166 of the first compliant member 160 ( discussed further below ). looking to fig4 b , the fourth cover member 150 is shown . the fourth cover member 150 preferably comprises a fourth cover member retainer 152 ( see fig2 ) and a pair of latches 154 . the pair of latches 154 are configured to removably engage with the first and second cover members 126 , 136 . as shown in fig1 and 13 , each of the latches 154 preferably has a spring - loaded rod 156 with a pin 157 configured to interface with the first and second cover member plates 132 , 142 of the respective first and second cover members 126 , 136 when in an engaged position . the interface with the first and second cover member plates 132 , 142 may be made through the respective first and second cam members 80 , 84 . to disengage the fourth cover member 150 from the first and second cover members 126 , 136 , the spring - loaded rods 156 are moved inward toward each other until clear of the first and second cover member plates 132 , 146 and potentially the first and second cam members 80 , 84 , then the fourth cover member 150 is free to move relative to the first and second cover members 126 , 136 . the spring - loaded rods 156 may be maintained in the disengaged position by placing the pin 157 against a catch 158 . to engage the fourth cover member 150 with the first and second cover members 126 , 136 , the reverse of the disengaging procedure is performed ; however , the spring - loaded rods 156 may be in the engaged position prior to engaging with the first and second cover members 126 , 136 . in that case , during the process of lowering the fourth cover member 150 into position between the first and second cover members 126 , 136 , each of the spring - loaded rods 156 will follow the surfaces 82 , 86 of the respective first and second cam members 80 , 84 . through the biased nature of the spring - loaded rods 156 , the spring - loaded rods 156 will engage with the first and second cover member plates 132 , 142 when they are below the most inwardly extending portion of the first and second cam members 80 , 84 . looking back to fig5 a , one method of securing the second compliant material 170 is shown with respect to the first rail member retainer 106 of the first rail member 104 . the first end portion 172 of the second compliant material 170 is preferably fed into the first cover member retainer 106 through a slot 108 creating a loop 178 in the first end portion 172 . preferably , a dowel 50 is then inserted into the loop 178 along the length of the first rail member retainer 106 . the diameter 52 of the dowel 50 is preferably greater than the width 110 of the slot 108 , thereby retaining the first end portion 172 of the second compliant material 170 within the first rail member retainer 106 . clips ( not shown ) may further secure the free end 174 of the first end portion 172 of the second compliant member 170 to the first cover member retainer 106 ; however , as shown with respect to a second embodiment 200 of the cover system shown in fig5 b , the loop 178 may be formed by sewing ( or otherwise attaching ) the free end 174 back to the second compliant material . the same retention method is preferably provided for the second compliant material 170 within at least the second rail member 114 , the third rail member 120 , the first cover member 126 , the second cover member 136 , and the third cover member 146 , and the first compliant material 160 within at least the fourth cover member 150 . the second frame 124 is preferably sized and configured to be positioned adjacent to and substantially over the first frame 102 , whereby the first cover member 126 , the second cover member 136 , and the third cover member 146 of the second frame 124 are positioned substantially directly above the first rail member 104 , the second rail member 114 , and the third rail member 120 of the first frame 102 , respectively , when the truck box cover system 100 is in the first position ( see fig1 , and 5 ). additionally , as depicted in fig1 - 5 , when in the first position , the second compliant material 170 along and between the first rail member 104 and the first cover member 126 is preferably substantially positioned within the first rail member enclosure 112 and the second compliant material 170 along and between the second rail member 114 and the second cover member 136 is preferably substantially positioned within the second rail member enclosure 118 . the second embodiment 200 of the cover system shown in fig5 b preferably comprises a first frame 202 with a first rail member 204 and a second frame 224 with first cover member 226 . in the second embodiment 200 , it should be understood that the second rail member ( not shown ) of the first frame 202 and the second cover member ( not shown ) of the second frame 224 are mirror images of the respective first rail member 204 and the first cover member 226 . the first rail member 204 comprises a first rail member retainer 206 with a slot 208 and a first rail member enclosure 212 . the first cover member 226 comprises a first cover retainer 228 , a first cover member flange 230 , and a first cover member plate 232 with a shelf 234 . preferably , a hook - and - loop fastener material 30 is provided on the inside surface of the first cover member flange 230 . the first compliant material 160 preferably comprises a first side 162 , a second side 164 , a third side 166 , and a fourth side 168 . the first and second sides 162 , 164 preferably comprise hook - and - loop fastener material ( see fig1 ) therealong and are configured to be removably attachable to the first and second cover member flanges 130 , 140 of the second frame 124 , respectively . the third side 166 of the first compliant material 160 is preferably retained within the third cover member retainer 146 of the third cover member 146 and the fourth side 168 is preferably retained within the fourth cover member retainer 150 of the fourth cover member 150 . the first compliant material 160 is shown as being removably attached by the hook - and - loop fastener material 30 , however , additional or alternative fastening configurations , such as snaps , are contemplated . looking at fig1 and 14 , a plurality of removable cover supports 60 are shown . the plurality of cover supports 60 are preferably provided positioned on the shelves 134 , 144 of the first and second cover members 126 , 136 and extend therebetween . each of the plurality of columns 190 preferably comprises a telescopic assembly 192 with a base 194 , a telescopic portion 196 ( see fig1 ), and an actuator 198 ( see fig4 a ) preferably located within , or at least substantially within , the base 194 and configured to actively engage with the telescopic portion 196 . the base 194 is preferably attached to at least one of the floor 14 of the truck box 12 and the first frame 102 . the telescopic portions 196 are preferably attached to the second frame 124 . even more preferably , the telescopic portions 196 are attached to the first and second cover member plates 132 , 142 of as shown in fig5 a . looking to fig6 - 7b , the cover system 100 is shown in an intermediate state as it is being raised from the first , lowered , position to a second , raised , position . extension of the telescoping portions 196 is performed by activation of the actuators 198 through a switch ( not shown ) in electrical communication therewith . the switch ( not shown ) is preferably operated through a remote ( not shown ). upon activation , the second frame 124 is raised relative to the first frame 102 . as shown in fig7 a and 7b , the second compliant material 170 is unfurled from the first and second rail member enclosures 112 , 118 . the second compliant material 170 is preferably a continuous un - interrupted piece of material and made from a pliable and weather - resistant material such as a stretch tent textile . the second frame 124 continues the upward assent until reaching the second position shown in fig8 - 11 . in the second position , the second compliant member 170 is preferably made taught between the first frame 102 and the second frame 124 and provides a first wall 180 , a second wall 182 , and a third wall 184 . to return the second frame 124 to the first position , the actuators 198 are activated by the switch ( not shown ) in the reverse direction . the actuators 198 are preferably hydraulically driven but a pneumatic system is also within the purview of the present invention . activation of the actuators 198 to extend the telescoping portions 196 is preferably a one - touch activation , whereas the retraction of the telescoping portions 196 to lower the second frame 124 from the second position to the first position preferably requires constant activation of the switch ( not shown ) by a user ( not shown ). this is done to reduce the chance of user injury , damage to the cover 100 , and / or the load ( not shown ) being carried in the truck box 12 by accidental activation ; however , this functionality should not be viewed as limiting the invention . additionally , or alternatively , a manually operated switch ( not shown ) may be included which must be manually closed prior to activation of the actuators 198 . turning now to fig1 in which the rear panel 70 is shown as installed . the rear panel 70 preferably comprises a first rod ( hidden ) provided along a first side 72 and a second rod ( hidden ) provided along a second side 74 , a third side 76 , and a fourth side 78 . with reference to fig1 , the first rod ( hidden ) is receivable within the recesses 92 of a pair of upper brackets 90 attached to the first and second cover members 126 , 136 and the second rod ( hidden ) is receivable within the recesses 96 of a pair of lower brackets 94 attached to the first and second rail members 104 , 114 . the third and fourth sides 76 , 78 are preferably configured to be secured in a weatherproof manner to the second compliant member 170 . the weatherproof connection may be made through hook - and - loop material or any other method now known or later developed . the rear panel 70 is preferably formed from a compliant material , such as a stretch tent textile , and is configured to be rolled up and stored when not in use . turning now to fig1 - 21 a rack system 300 according to the present invention is shown . the rack system 300 is preferably configured to interface with the cover system 100 , 200 . the rack system 300 comprises a plurality of upstanding members 302 and a plurality of cross - members 320 . fig2 provides a view of an exemplary embodiment of an upstanding member 302 according to the present invention . the upstanding member 302 preferably comprises a pillar 304 , with a through - hole 306 , extending from a base 308 , and an arm 310 extending alongside at least a portion of the pillar 304 and below the base 308 . the arm 310 has an upturned end 312 . each upstanding member 302 is configured to interface with the first and second cover members 126 , 136 . as shown in fig1 and 19 with respect to placement of an upstanding member 302 on the second cover member 136 , the upstanding member 302 is positioned with the upturned end 312 received within the second cover member 136 between the second cover member retainer 138 and the second cover member flange 140 with the remainder of the arm 310 that is below the base 308 abutting the outside of the second cover member flange 140 . the base 308 is positioned atop the second cover member 136 . this arrangement allows for increased versatility as the plurality of upstanding members 302 may be placed at any location along the first and second cover members 126 , 136 . fig2 illustrates the plurality of cross - members 320 attached to and extending between opposing upstanding members 302 . here , the plurality of cross - members 320 have through - holes ( hidden ) at opposing end portions 322 , 324 which are configured to be alignable with the through - holes 306 of the pillars 304 . the plurality of cross - members 320 are preferably removably attached to the upstanding members 302 with pins 330 extending through the aligned upstanding member through - hole 306 and the cross - member through - hole ( hidden ), however , other methods of removable attachment are contemplated , such as by a threaded fastener ( not shown ). it should also be noted that the placement of the plurality of cross - members 320 on the plurality of upstanding members 302 may be adjustable . the rack system 300 is configured to be incorporated and usable with both cover system 100 , 200 in both the first position and the second position . fig1 - 20 illustrate thus with the cover system 100 . a method for raising and lowering a truck box cover is also contemplated according to the present invention and is describes with respect to the first embodiment of the truck box cover assembly 100 . the method preferably comprises the steps of : providing a first frame 102 and a second frame 124 ; providing a plurality of telescopic assemblies 192 operably connected to the first frame 102 and the second frame 124 , whereby the second frame 124 is configured to be movable relative to the first frame 102 through activation of the plurality of telescopic assemblies 192 between two positions : a first position and a second position ; whereby in the first position the first frame 102 and the second frame 124 are juxtaposed and in the second position the first frame 102 and the second frame 124 are spaced apart ; providing a first compliant member 160 supported by and extending across the second frame 124 ; providing a second compliant material 170 supported by and extending between the first frame 102 and the second frame 124 ; whereby , when in the first position , activating the plurality of telescoping assemblies 192 to move the second frame 124 to the second position wherein the second compliant material 170 is taut ; and whereby when in the second position , activating the plurality of telescoping assemblies 192 to move the second frame 124 to the first position . the method further comprises the step of actively monitoring the truck box cover system 100 when moving from the second position to the first position . active monitoring may include , but should not be limited to , constantly maintained activation of the plurality of telescopic assemblies 192 by a user ( not shown ) and / or pressure sensors ( not shown ) monitoring force applied in a direction different than the downward movement of the second frame 124 . the method may further comprise the step of tucking the second compliant member 170 into a first rail member retainer 112 and a second rail member enclosure 118 of the first frame 102 when moving the second frame 124 from the second position to the first position . the foregoing is considered as illustrative only of the principles of the invention . furthermore , because numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . | 1 |
embodiments of the present disclosure are described herein . it is to be understood , however , that the disclosed embodiments are merely examples and other embodiments may take various and alternative forms . the figures are not necessarily to scale ; some features could be exaggerated or minimized to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . as those of ordinary skill in the art will understand , various features illustrated and described with reference to any one of the figures may be combined with features illustrated in one or more other figures to produce embodiments that are not explicitly illustrated or described . the combinations of features illustrated provide representative embodiments for typical applications . various combinations and modifications of the features consistent with the teachings of this disclosure , however , could be desired for particular applications or implementations . there are several basic constructions associated with flexible circuits including single - sided flex circuits , double access or back bared flex circuits , sculptured flex circuits , double - sided flex circuits , multilayer flex circuits , rigid - flex circuits , and polymer thick film flex circuits . single - sided flexible circuits have a single conductor layer made of either , for example , a metal or conductive polymer on a flexible dielectric film . component termination features are accessible from one side . holes may be formed in the base film to allow component leads to pass through for interconnection . double access or back bared flexible circuits have a single conductor layer . selected features of the conductor pattern , however , are accessible from both sides . sculptured flexible circuits ( a subset of flexible circuit structures ) are manufactured via a multi - step etching method which yields copper conductors of differing thickness along the circuit . for example , conductors can be thin in flexible areas and thick at interconnection points . double - sided flexible circuits have two conductor layers , and can be fabricated with or without plated through holes . the plated through holes permit terminations for electronic components to be provided on both sides of the circuit . as such , components can be placed on either side . protective cover layers can be placed on one , both or neither side of the completed circuit . multilayer flexible circuits have three or more layers of conductors . the layers are typically interconnected by means of plated through holes . the layers may or may not be continuously laminated together throughout the construction except in areas occupied by plated through holes . rigid - flexible circuits are a hybrid construction of rigid and flexible substrates laminated together into a single structure . polymer thick film ( ptf ) flexible circuits have conductors that are printed onto , for example , a polymer base film . they are typically single conductor layer structures . two or more metal layers , however , can be printed sequentially with insulating layers printed between printed conductor layers . basic flex circuit materials often include a base , bonding adhesive , and metal foil . the base material is the flexible polymer film which provides the foundation for the laminate . typically , the flex circuit base material defines most of the physical and electrical properties of the circuit . the base material in adhesiveless circuit constructions , however , defines all of the characteristic properties . a number of different materials can be used as a base including polyester , polyimide , polyethylene napthalate , polyetherimide , and various fluropolymers . while a wide range of thicknesses are possible , many flexible films are manufactured in the range of 12 μm to 125 μm . thinner and thicker materials are also possible . thinner materials are more flexible , and film stiffness usually increases in proportion to the cube of thickness . adhesives can be used as the bonding medium for creating a laminate . these adhesives , however , are typically the performance limiting element with respect to temperature , particularly when polyimide is the base material . adhesive systems of different polymer families , however , can be used to address such issues . similar to the base films , adhesives are manufactured in different thicknesses . and thickness selection is typically a function of the application . different adhesive thicknesses , for example , are commonly used in the creation of cover layers to meet the fill demands of different copper foil thickness . metal foil is a common conductive element of a flexible laminate , and is the material from which circuit paths are normally etched . although a variety of metal ( and metal alloy ) foils of varying thickness are used , copper foils are often preferred because of their cost and physical and electrical characteristics . copper foils are typically electrodeposited or wrought ( rolled )— yielding different properties . as a result , a number of different types of copper foil are available for flexible circuit applications . with most copper foil , a thin surface treatment is commonly applied to one side of the foil to improve its adhesion to the base film . flexible circuits , such as those described above , are used within magnetic tape storage devices . a head assembly , for example , can include a flex circuit connected to transducer elements of a head . elements in recording heads of tape drives have become smaller over time . as a result , issues associated with flex circuit electrostatic discharge ( esd ) have become more frequent . if , for example , a single track of a multi - track recording head does not work because of an esd event , the entire head will not work . techniques to manage esd are therefore of interest . the inventors have found through experimental observation that electrostatic charge may build up on the outside of flex circuits of a recording head , which may induce a charge in the conductors of the recording head . and when the recording head is grounded ( e . g ., plugged in ), the induced charge in the conductors may result in problematic current flow through the head . certain arrangements disclosed herein may facilitate reductions in electrostatic charge associated with , for example , recording heads . prior attempts at addressing electrostatic build up in flex circuits may have relied on the inclusion of static dissipative layers on the conductors or the insulating layers of the circuits . such layers , however , can be expensive and ineffective at keeping the charge at 0 v for certain sensitive devices . other attempts may have relied on a user wiping the flex circuit with isopropyl alcohol before activation . ( the alcohol acts as a resistor — preventing rapid discharge .) application inconsistencies , however , may reduce the effectiveness of this technique . here , an ink or other material having a known resistivity , in certain examples , can be layered on the flex circuit to create an electrical path between the conductors and portions of the flex circuit used for handling purposes . thus , charge in these arrangements can travel from the conductors , through the ink , and dissipated when the flex circuit is handled during installation . that is , the conductors may be continuously grounded while the connector is being plugged in . referring to fig1 and 2 , a head assembly 10 for a magnetic tape storage device 12 includes a head 14 with a plurality of transducer elements and a flexible circuit 16 . the flexible circuit 16 includes an end 17 , a gripping portion 18 , and a substrate 19 having electrical contacts or pads 20 ( e . g ., gold ) for the head 14 , conductors 22 ( e . g ., copper ) electrically connecting the transducer elements to the electrical contacts 20 , and traces 24 thereon . a zero insertion force type connector is shown . any suitable connector , however , may be used . moreover , the underlying basic components of the flexible circuit 16 are constructed in a manner similar to one of the examples described above . any suitable construction , however , may be used . the traces 24 begin at the electrical contacts 20 ( every other of the electrical contacts 20 in this example ), extend along the end 17 between the electrical contacts 20 and gripping portion 18 , and terminate at the gripping portion 18 . space permitting , the traces 24 may begin at each of the electrical contacts 20 , etc . other configurations are also possible . the traces 24 of fig1 and 2 are formed in a tree - like pattern . that is , thin “ leaves ” of the traces 24 are in contact with the electrical contacts 20 , thick “ trunks ” of the traces 24 are formed on the perimeter of the gripping portion 18 ( in areas typically used to handle the end 17 , and “ branches ” of the traces 24 extend between the “ leaves ” and the “ trunks .” this tree - like pattern in combination with the material composition of the traces 24 , as explained in more detail below , was selected to achieve a desired resistance in the static dissipative range between the electrical contacts 20 and the gripping portion 18 to facilitate electrostatic charge dissipation when handled . if silk screening techniques are used to apply the traces 24 , silk screening alignment tolerances should be considered when selecting a width for the electrical contacts 20 . the width of each of the electrical contacts in the example of fig1 and 2 is 0 . 64 mm . moreover if printing on edge is required , a small area , for example 1 mm , should be cut out at the perimeter so the edge is exposed . the traces 24 , in the example of fig1 and 2 , are an ink ( e . g ., silk screen ink ) that is applied ( e . g ., silk screened ) onto the underlying gripping portion 18 , electrical contacts 20 , and conductors 22 of the flexible circuit 16 . other suitable materials ( e . g ., thin metal films , etc . ), however , may be used . the ink forming the traces 24 has a resistivity of at least 500 kω /□. other inks and suitable trace materials can have a resistivity in the range of , for example , 5 kω /□ to 1 mω /□ provided that such resistivity in combination with the trace pattern / dimensions yields a desirable resistance in the static dissipative range ( e . g ., 100 kω to 100 gω ). put a different way , certain trace materials may have conductivities less than a conductivity of the electrical contacts 20 but greater than a conductivity of insulating layers of the flexible circuit 16 . given the electrical characteristics of the ink described above and the tree - like pattern formed by the traces 24 , a resistance of an electrical trace path between one of the electrical contacts 20 and that section of the gripping portion 18 covered by the ink is approximately 1 mω . resistances in other such electrical paths in other examples may range from at least 100 kω to more than 1 mω depending on application and design requirements . referring to fig3 a through 3c , other example trace patterns are schematically shown . if , for example , the same trace material was used to create these patterns , it is likely that the resistances associated with the electrical paths defined by these trace patterns would be different . it is possible , however , that with proper selection of trace material for each design similar path resistances could be achieved . that is , a change in trace material resistivity from pattern to pattern may offset the impact the differing patterns have on electrical path resistance defined by the traces . flexible circuits adopting the trace concepts discussed herein may improve yield for assemblies incorporating such flexible circuits as the number of assemblies lost due to esd events during plug - in may be reduced . likewise , reliability may be improved as handling of the flexible circuits may cause electrostatic charge to dissipate prior to it becoming problematic . the words used in the specification are words of description rather than limitation , and it is understood that various changes may be made without departing from the spirit and scope of the disclosure . as previously described , the features of various embodiments may be combined to form further embodiments of the invention that may not be explicitly described or illustrated . while various embodiments could have been described as providing advantages or being preferred over other embodiments or prior art implementations with respect to one or more desired characteristics , those of ordinary skill in the art recognize that one or more features or characteristics may be compromised to achieve desired overall system attributes , which depend on the specific application and implementation . these attributes may include , but are not limited to cost , strength , durability , life cycle cost , marketability , appearance , packaging , size , serviceability , weight , manufacturability , ease of assembly , etc . as such , embodiments described as less desirable than other embodiments or prior art implementations with respect to one or more characteristics are not outside the scope of the disclosure and may be desirable for particular applications . | 7 |
like numbered elements in these figures are either identical elements or perform the same function . elements which have been discussed previously will not necessarily be discussed in later figures if the function is equivalent . fig1 shows an example of a method according to an embodiment of the invention . in step 1000 , the substrate is provided . in step 1002 , a process step is performed for forming the display component and the circuit component . in step 1004 , the document is formed using the substrate . this method reduces manufacturing costs by performing steps for manufacturing the integrated display and manufacturing the circuit component at the same time . manufacturing the integrated display directly in the substrate is also advantageous , because the substrate may have a special appearance or configuration which can be used as a security feature . manufacturing the integrated display directly on the substrate incorporates the integrated display into the substrate . if the integrated display were separate , it would be easier for someone to forge the document , because they too could incorporate a separate display into the document . in order to forge the document , the forger would need to have access to the same level of manufacturing as the manufacturer of the document . fig2 shows a substrate 158 where an integrated display 160 and an electronic circuit 164 are being manufactured . the electronic circuit 164 is shown as being coupled to the integrated display 160 . also shown is a display driver 162 . the display driver 162 may be an integrated part of the integrated display 160 , or it may be a separate component . fig2 demonstrates how a display component and a circuit component can be manufactured at the same time . for example , word line 186 is a part of the display 160 and a conductor 188 is a portion of the electronic circuit 164 , both of which can be deposited or manufactured at the same time . fig3 shows an example of a substrate 158 which can be used to form a document according to an embodiment of the invention . the substrate 158 has an integrated display 160 , an interface 172 , an antenna 142 , and an electronic device 102 . the antenna 142 may also be considered a contactless interface . the antenna can be used for powering the electronic device 102 in some embodiments and / or it may be used for exchanging data with a terminal system or a radio transceiver . the interface 172 may be a touch sensitive interface which allows an operator to manipulate the data displayed on the display . the interface 172 may also be a series of contacts which is adapted for connecting a computer or other electronic device to the document . the interface 172 may also be a biometric sensor . for example the biometric sensor may be a fingerprint sensor . the interface 172 may also contain an interface which functions as a touch sensitive interface as describe above and as a biometric or fingerprint sensor . this is because the interface may be used both to read the fingerprint of a finger in contact with the biometric sensor and to detect finger motion on the surface of the interface . the interface 172 may also comprise a switch for manual operation by a user . the integrated display comprises a display driver 162 in this embodiment . however , the display driver may also be a separate component . the integrated display 160 also comprises a display component 166 . the electronic device 102 comprises an electronic circuit 164 , a central processing unit 156 , a transmitter 130 , a receiver 128 , a security module 170 , computer memory 126 , it may also contain one or more integrated circuits 154 , and , contacts for attaching the integrated circuit to the substrate 158 . the electronic circuit 164 comprises a circuit component 168 . the electronic circuit 164 is connected to the integrated display 160 . the central processing unit ( cpu ) 156 is also shown as being connected to the display driver 162 . the central processing unit 156 is adapted for performing machine executable instructions and may contain memory for holding machine executable instructions to execute . the cpu is shown as containing a software application 110 . the software application may be considered a computer program product . the integrated circuit 154 is connected to the contacts 152 which are connected to the central processing unit 156 . a security module 170 is shown as also being connected to the cpu 156 . the security module 170 may store cryptographic keys or ciphers . and it may also provide encryption or decryption of data using hardware . the memory 126 is also shown as being connected to the central processing unit 156 . this is computer memory 126 and can be used for storing such things as data objects 104 . the computer memory contains such things as data objects 104 , image data 150 , and a computer program product 148 . the image data 150 is data which represents an image , or which can be used to generate an image which can be displayed on the integrated display 160 . the computer program product contains machine executable instructions and may comprise instructions for the electrical operation of the document . the central processing unit is shown as being coupled to the receiver 128 and the transmitter 130 . both the receiver 128 and the transmitter 130 are coupled to a power block 132 . the power block 132 performs power management for the power supply of electronic components on the substrate . the power block is connected to the antenna 142 . the power block may be adapted to receive electrical power that is coupled into the antenna 142 via electromagnetic radiation . the power block 132 may also function as a protection circuit for the electronic components on the substrate . if too high of a voltage is induced in the antenna by electromagnetic radiation the electronic components on the substrate may be damaged . the power block 132 may incorporate a single diode , a single diode circuitry or a voltage regulator integrated circuit to protect the electronic components on the substrate from voltages which may damage them . the receiver 128 and transmitter 130 and power block 132 may be attached to a common antenna , or there may be multiple antennas . for instance there may be an antenna which is only for coupling power to the power block 132 and there may be and additional antenna for transmitting and receiving data using the transmitter 130 and the receiver 128 . the receiver 128 and the transmitter 130 may also be combined into a single transceiver component . the components of the electronic device 102 may be separate discrete components or they may be combined together , e . g ., within an electronic module . for example the security module 170 may be an integrated circuit 154 . the same is true for the memory 126 and the central processing unit . the electronic circuit 164 is intended to be representative of a generic electronic circuit . the central processing unit 156 , the security module 170 , the memory 126 , the transmitter 128 , and the receiver 130 could all be considered as part of an electronic circuit . during manufacturing , a process step is performed where a display component 166 and circuit component 168 are formed or are partially formed . this may be during a single process step . during this process step , essentially a portion of the display 160 and a portion of the electronic device 102 are formed or constructed at the same time . in operation , the display 160 , electronic device 102 , and interface 172 shown in fig3 may be powered by electromagnetic energy received by the antenna 142 . although a battery or power source could be included , they are typically not not included . the antenna is also adapted to send and receive data by use of the transmitter 130 and receiver 128 . the document may receive a signal from an external data terminal or reader which requests data or information stored in the memory 126 . in some embodiments , the document may need to receive a special security code of cryptographic key before the document will respond to a request for data or information . the security module may be used to authenticate a request . the security module may also be used to encrypt or decrypt data stored within the memory 126 . once a request for data is authenticated , the document may transmit the requested data using the transmitter 130 and the antenna 142 . the interface 172 may be used to control the data or image displayed on the display . for instance , the interface could be a touch sensitive interface . as an operator drags a finger across the interface , the perspective view of a photograph could change . instead of a single two dimensional photograph being used for an identity card , multiple images could be stored in the memory 126 and recalled depending upon control signals received from the interface 172 . the cpu 156 may receive control signals from the interface 172 . the control signals are then used to select image data contained within the memory 126 using a selection criteria that programmed into the computer program product 110 . as was described previously , the interface 172 may incorporate a biometric sensor and / or touch sensitive interface . fig4 shows a document 174 according to an embodiment of the invention . the document 174 was formed using the substrate 158 which is shown in fig3 . the document has an integrated display 160 . adjacent to the integrated display 160 is an interface 172 . also on the document 174 is a printed region 176 . the document 174 may contain more than one printed region 176 . in the printed region 176 information , symbols , or markings are printed on the document 174 . the printed region 176 may contain , but is not limited to , a name 178 , a marking indicating validity of the document 180 , a signature 182 , and / or machine readable markings 184 . the display may cover the entire surface or most of the surface of the document . in this case , the display its self may function as the document . all of the information in the printed region could be represented on the display . if the display were a bistable display or electronic paper display then the document could display information even when not powered . a validity marking 180 , as used herein , is a marking which indicates the validity of the document and may include such information as a date or it may be a symbol which is used to indicate official validity of the document . the machine readable markings 184 may also be readable by a human or they may be exclusively machine readable . with such a document as is shown in fig4 , a variety of different information can be displayed on the integrated display 160 . the information that is displayed on the integrated display 160 may be controlled by a computer program product . the interface 172 may also be used to control what is displayed on the integrated display 160 . for instance the interface 172 may be a touch sensitive pad . by touching and moving a user &# 39 ; s finger or stylus , e . g ., a stylus of a pda , around on the interface 172 the view of what is shown on the integrated display 160 may change . for instance , different views of the same person may be displayed . the interface 172 could also control a menu system which is used to control what sort of information is displayed on the integrated display 160 . furthermore the interface 172 could be used to verify biometic features . for example the interface 172 could include a fingerprint sensor and / or touch sensitive pad as was described previously with respect to fig3 . fig5 shows a block diagram of one embodiment of data terminal 100 and of electronic device 102 , which is integrated into an identity document 114 . the identity document is illustrated as a passport in a schematic , perspective view and features a zone with machine - readable printed data 116 . integration of the electronic device into the identity document can be done , for example , by embedding it into the cover page or the main page of a passport . both electronic device 102 and data terminal 100 can have a contactless interface 142 or 142 ′, which is connected to both a transmitter 130 or 130 ′ and a receiver 128 or 128 ′ and facilitates the contactless communication between data terminal and electronic device . electronic device 102 can feature a memory 126 for a number of data objects 104 . personal biometric data such as a photograph , fingerprints , or iris data of the owner of identity document 114 can be stored in one or more of data objects 104 . in addition information such as address data , date of birth , location of birth , country of birth , and visa information may be stored in the data objects . storage of data objects 104 in memory 126 may follow the standard series 9303 “ machine - readable travel documents ” of the international civil aviation organization , icao . under the designation “ logical data structure ” ( lds ), the icao defines a file system that conforms to the chip card standard iso 7816 - 4 as well as an interoperable structure of the data objects stored in this file system . data terminal 100 can be programmed with computer - executable instructions 124 ′, which allow it to read data objects 104 stored in memory 126 of electronic device 102 via contactless interfaces 142 ′ and 142 . to protect the personal biometric data , in particular , from unauthorized readout , electronic device 102 can have program instructions 124 , which permit read access on data objects 104 only after a successful execution of a cryptographic protocol with data terminal 100 . one such measure is recommended by the icao , which specifies the support of a number of data protection options as a mandatory requirement for the standardized lds . various types of personal biometric data which are categorized or attributed to different levels of protection can be stored in different data objects 104 . for example , a low level of protection can be attributed to a photograph , whereas fingerprints or iris data are attributed to a higher level of protection . the various assessments of levels of protection of different data objects 104 are coded by allocation table 106 of electronic device 102 . each data object 104 in the allocation table is assigned a cryptographic protocol 108 of a different security level . the allocation table can assign free access without the mandatory implementation of a cryptographic protocol to one or a number of data objects 104 . in operation , electronic device 102 receives a request for one of the data objects 104 from data terminal 100 via receiver 128 and contactless interface 142 . thereupon , using allocation table 106 , the electronic device specifies a cryptographic protocol 108 , the successful execution of which is set as a condition for read access of the data terminal to one of the data objects . the electronic device and the data terminal carry out the cryptographic protocol and , if successful , the electronic device transmits the data object to the data terminal . alternatively , data may be displayed on the integrated display 160 . electronic device 102 may feature a software application 110 , which includes allocation table 106 . cryptographic protocol 108 is thus specified by the software application , the cryptographic protocol is executed by the data terminal and the software application , and the one data object is transmitted by the software application . the electronic device can provide an operating system 112 , which , working together with the hardware of the electronic device , prevents any unauthorized alteration or removal of the software application and only allows access to data objects 104 via the software application . in this way , it is possible to manufacture electronic device 102 on the basis of mass - produced , standardized hardware , while at the same time the specifications of the cryptographic protocols which are being used and the coded allocation of data objects 104 in allocation table 126 can be adapted to cryptographic protocols of varying requirements . the electronic device can be a java card with a virtual java machine , on which software application 110 is installed in the form of a java applet . operating system 112 can protect software application 110 including allocation table 126 from unauthorized alteration or removal , while at the same time provide an administrator function 140 , which allows alteration or removal of the software application following authentication as administrator of electronic device 102 . the administrator function is especially advantageous because the electronic device can be adapted to revised requirements instead of being replaced by a new electronic device . revised requirements can pertain , for example , to improved cryptographic protocols 108 or a revised classification of levels of protection of different data objects 104 . various encryption protocols 109 can also be assigned to different data objects in allocation table 106 , according to which electronic device 102 and data terminal 100 can encrypt their communication . encryption is particularly advantageous , since it allows third parties to be prevented from monitoring the contactless communication between the electronic device and the data terminal . electronic device 102 and data terminal 100 may have suitable cryptographic keys 118 , 120 and 146 , which are used in executing various cryptographic protocols . data terminal 100 can derive another device - specific key for electronic device 102 from machine - readable printed data 116 , e . g ., directly from or by hashing the machine - readable printed data 116 , partly or as a whole . alternatively , if the integrated display 160 is a bistable display , the machine - readable data may be displayed on the integrated display . to this end , the data terminal may be provided with an optical sensor to read printed data 116 . a symmetrical key for communicating with electronic device 102 can thus be obtained from the data recorded in this manner . in one embodiment , data 116 is used as a symmetrical key . this symmetrical key can be stored in unprotected or protected form in electronic device 102 . alternatively , electronic device 102 is designed in such a way that , if needed , it can generate this symmetrical key from data 116 also electronically stored in electronic device 102 . a general key 146 or 146 ′ can also be used , which is known to both the electronic device and data terminal 100 . the data terminal may also be provided with an asymmetrical pair of keys from public 118 and private 120 keys , whereby it transmits its public key to the electronic device as part of a cryptographic protocol . the public key can be provided with a digital signature 122 , which allows it to verify the authenticity of the key 118 by means of a certificate chain . general key 146 ′ can be used from data terminal 100 , for example , in order to generate the additional symmetrical key from optically recorded data 116 . to this end , general key 146 ′ and data 116 are associated to each other . there is an integrated display 160 coupled to the electronic device 102 . the memory 126 may contain data for being displayed on the integrated display 160 . | 6 |
the coalescing solvent is generally selected from the group consisting of ethylene glycol monomethyl ether , ethylene glycol monoethyl ether , ethylene glycol monobutyl ether , diethylene glycol monobutyl ether , diethylene glycol monoethyl ether acetate , diethylene glycol diethyl ether , ethylene glycol monomethyl ether acetate , methyl ethyl ketone , acetone , methyl propyl ketone and diacetone alcohol . of the various solvents which can be used , generally the ethylene glycol monobutyl ether , ethylene glycol monoethyl ether , diethylene glycol monomethyl ether , diethylene glycol monoethyl ether and diethylene glycol monobutyl ether are preferred . representative of the various amines which may be used to form the water reducible compositions are : primary amines such as ethyl amine , propyl amine , butyl amine , isoamyl amine , amyl amine , hexyl amine , heptyl amine and ethanol amine ; secondary amines such as diethyl amine , ethyl ethanol amine , and morpholine ; and tertiary amines such as dimethylethanol amine , trimethyl amine , triethylamine and n - methyl morpholine . the amount of water used depends on whether a high or a low viscosity dispersion is desired or whether high or low solids content is desired . it also depends on the type and amount of coalescing solvent used . the water , amine and coalescing solvent are evaporated from applied coatings usually at a temperature in the range of about 20 ° c . to about 100 ° c ., preferably about 25 ° c . to about 50 ° c . the resins which are preferred for use in water reducible compositions are those requiring the least number of monomers for their synthesis . this , of course , simplifies the manufacture of the resins . the invention will be further clarified by a consideration of the following examples , which are intended to be purely exemplary of the use of the invention . unless otherwise stated , parts are parts by weight , and percentages are by weight . polymerizations were carried out in one quart ( 0 . 95 liter ) glass bottles which were clamped in a rotating wheel - polymerizer . the wheel of this polymerizer was located in a water bath held at 52 ° c . each bottle was charged with the ingredients , purged with nitrogen , and capped with a perforated cap having a rubber disc seal through which a hypodermic needle could be inserted for the taking of samples . two bottles were run for each recipe . the percent conversion for a given polymerization time was determined by measuring total percent solids of the sample at that time and estimating conversion from a total solids - conversion straight line relationship . the total solids was determined by drying a weighed sample of the latex in a weighed aluminum dish by means of an infrared lamp until the sample appeared to be dry . the bottle polymerizations ran approximately to completion . reaction ingredients , conditions , and final product characteristics are given in table 1 . table 1______________________________________emulsion polymerization of acrylic resinssample no . ingredients ( in parts ) 406c 447a 447b______________________________________water 151 . 0 151 . 0 151 . 0 * emulsifier 3 . 0 3 . 0 3 . 0metal complexing agent 0 . 1 0 . 1 0 . 1sodium acid pyrophosphate 0 . 2 0 . 2 0 . 2k . sub . 2 s . sub . 2 o . sub . 8 ( free radical catalyst ) 0 . 1 0 . 1 0 . 1tert .- mercaptan 0 . 8 0 . 8 0 . 8isobutyl methacrylate 71 . 0 42 . 0 40 . 02 - ethylhexyl methacrylate 24 . 0 28 . 0 27 . 0styrene -- 25 . 0 25 . 0n - vinyl - 2 - pyrrolidone 2 . 0 2 . 0 5 . 0methacrylic acid 3 . 0 3 . 0 3 . 0final % solids 40 . 3 39 . 8 39 . 8final ph 2 . 7 6 . 1 6 . 0final viscosity ( cps ) 22 30 25reaction time ( hrs ) 12 12 12______________________________________ * complex surfactant phosphate ester acid neutralized with naoh to ph = 6 . 5 . surfactant used herein was gafac re - 410 , a trademark of gaf corporation . the resins produced in example i above were separated from the reaction product mixtures by coagulation and drying . the duplicate bottles were blended together before coagulation . the coagulant in each case was a mixture of 6 grams alum ( aluminum sulfate ), 3 grams sulfuric acid ( 95 - 98 %), and 4000 milliliters of water . the temperature of the coagulation is given in table 2 . the slurry resulting from each coagulation was filtered using a cloth - lined buchner funnel . after filtration the resin cake was washed twice with cold soft water . the resin was then dried at 60 ° c . in an oven . table 2______________________________________coagulation and drying of resinssample 406c 447a 447b______________________________________coagulationtemperature (° c ) 49 - 60 60 60______________________________________ film forming water reducible coating compositions can be prepared from resins such as those of example ii by mixing such a resin with a coalescing solvent generally at a temperature of from about 25 ° c . to about 80 ° c ., and generally for a period of from about 20 to about 60 minutes . sufficient volatile amine is added to achieve a ph in the final water dispersion in the range of about 8 to about 14 . the water reduced compositions are formed by mixing about 330 parts of water with the amine neutralized compositions at a temperature of from about 25 ° c . to about 80 ° c . and for a period of from about 20 to about 60 minutes . films formed by applying said coating compositions to substrates are generally dried for a period of from about 8 to about 24 hours . other embodiments of this invention will be apparent to those skilled in the art from a consideration of this specification or practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with the true scope and spirit of the invention being indicated by the following claims . | 2 |
the subject invention includes devices and methods for arousing a person from sleep . as noted above , all too often the familiar repeated alarm sounds and radio or cd music offered by conventional alarm clocks tend to become ineffective in arousing a person from sleep . to address this and other issues , the alarm clocks of the subject invention include , in addition to clock circuitry , a stored sound library , thereby substantially increasing the quantity and variety of sounds that may be used for wake - up signals . the sound library of the subject alarm clocks may include any number of different wake - up sounds . the alarm clocks of the subject invention are adapted to store a far greater number of wake - up sounds than available in conventional alarm clocks . in certain embodiments , the number of sounds of a sound library stored in a subject alarm clock may be of sufficient number to enable a different wake - up sound to be used every time the alarm is activated , ( e . g ., once per day for a period of about one month or more , for a period of about 6 months or more , for a period of about 1 year or more , for a period of about 2 or more years ). the number of sounds that may be stored in a subject alarm clock for use as a wake - up signal may range from several , to tens , hundreds , thousands or more . the sound selection played from within a given intensity mode may be the next sequential selection or track . in this way , the unit may cycle through a playlist . alternatively , the sounds may be selected at random . the random feature may play any sound , or it may be configured to avoid repetition of ones played recently or until all other sounds are played . it may be desirable that the default setting for the clock is random with regard to sound selection from a given intensity category . the sounds that make - up a sound library may differ by intensity or type . in other words , the subject alarm clocks may include a plurality of sound intensity modes — including a random setting for selection between the varioius sound intensity modes or for any sound in the library or catalogue of sounds . the particular sound mode desired ( including a fully random mode selecting any sound stored within the clock ), for a given wake - up protocol may be designatable by the user , ( e . g ., by way of a knob , switch , button , dial , user - interactive display , or the like ) of the alarm clock , as described in greater detail below . each sound mode within the sound library may include one or more sounds of the selected / given sound intensity , type or genre . user designation of particular intensity mode causes a sound within that group or intensity mode to be emitted from the alarm clock when the alarm is triggered . once a particular intensity mode is designated , the alarm clock is adapted to emit a sound from the designated type . to reiterate the above , the particular sound may be randomly selected from the set of sounds of the designated intensity ; alternatively , the sound may be one that comes next in cycling through a list or cue . embodiments include at least a first sound intensity mode and a second sound intensity mode , and may also include a random mode for random selection from the at least first and second sound modes . for example , the sound library may include a first set of sounds of a first sound intensity and a second set of sounds of a second sound intensity . certain embodiments include at least a first sound mode , a second sound mode and a third sound mode ( or four or more ), and may also include a random mode ( in which its designation provides or plays a sound from any of the stored library of sounds ). the sound intensities used may be any suitable sound intensities , with the requirement being that the intensities differ amongst the different designated intensities . for example , if two sound intensity modes are included , the sound intensity of the sounds of the first mode will differ substantially ( albeit maybe only in a subjective or relative fashion ) from the sound intensity of the sounds of the second mode . if three sound intensity modes are included , the intensities of the sounds of each mode will differ substantially from the sound intensities of the sounds of the other modes . in certain embodiments , the sound intensities may be chosen from commonly accepted sound intensities , ranging from soothing sounds to severe sounds . in a system incorporating at least first , second and third sound intensity modes , the first may be a soothing sound intensity mode , the second a “ standard ” alarm sound intensity mode , and the third mode may be a severe sound intensity mode . other groupings of sounds may include funny ( e . g ., comedic excerpt or cartoon soundtrack effect ), painful ( e . g ., nails on a chalkboard ), scary or spooky ( e . g ., sounds commonly associated with halloween like ghosts moaning , wolf howling , bat wings flapping ), disgusting ( e . g ., flatulence , vomiting , nose blowing ) or other genre . regarding a “ soothing ” sound intensity , it is one including such associated sounds as a distant fog horn , gentle ocean waves , seagulls , light wind , running water , rustling trees , bacon sizzling , and the like . a “ severe ” sound intensity is one including such sounds as charging elephants , garbage truck unloading trash , new york city traffic , train crossing gates , train passage or horn , and the like . a “ standard ” or intermediate sound intensity falls between the extremes and may even include variations on the same sounds ( though possibly altered in volume or magnitude ( e . g ., smaller vs . crashing waves , gusting or howling wind vs . a light breeze , etc .). for the purpose of further definition , table 1 of fig1 provides additional exemplary sounds that may be included as standard / intermediate , soothing and severe sound intensities . note , however , that another device according to the invention could use many of the same sounds and group them somewhat differently based on user preference , feedback studies , etc . and still fall within the intended scope . in another aspect of the invention , multiple or serial alarms may be provided as in the “ primed ” mode of alarm use described above . in one variation , the alarm clock may be programmed to trigger successive alarms at the next higher intensity mode setting ( e . g ., from soothing to standard , standard to severe , or the like ). in another variation , upon occurrence of a predetermined event such as use of a “ snooze ” button ( i . e ., alarm repeat / delay activation feature ) more than a predetermined number of times ( e . g ., about 2 , 3 , 4 , 5 or more times in certain embodiments ), or if the alarm sounds continuously for a predetermined amount of time ( e . g ., about 2 , 5 , 10 or 20 minutes in certain embodiments ), then the intensity may be ratcheted upward . referring now to the block diagram of fig2 , an exemplary hardware implementation of the subject system is shown . here , the wake - up sounds of the sound library are stored in wake - up sound memory 4 . memory device 4 may be any device capable of storing audio content , and may be removable or non - removable media , and include volatile or non volatile memory devices . in many embodiments , memory 4 is non - removable memory . memory devices that may be used include , but are not limited to , read - only memory ( rom ), random access memory ( ram ), static random access memory ( sram ), dynamic random access memory ( dram ), pcmcia standard compatible plug - in memory card , flash card for accepting recordings over a modem which may be included as part of the alarm clock circuit or may be external to the circuit of the present invention , floppy disk , hard disk , dvd , tape , flash memory , a memory stick , and the like . for example , an alarm clock may include a rom device containing instructions and programs and a ram device for storing sound in digital form . wake - up sound memory device 4 may include a plurality of memory locations and each location may store audio content of a particular sound intensity . for example , a memory device may include a first memory region for storing first intensity mode sounds ( e . g ., standard wake - up mode sounds ), a second memory region for storing second intensity mode sounds ( e . g ., soothing wake - up mode sounds ), and a third location for storing third intensity mode sounds ( e . g ., severe wake - up mode sounds ). no such organization is , however , required . any approach to addressing the stored data for access and replay will suffice . still , a more organized data structure may be desirable for the sake of programming and / or upgrading or adding sounds to the repertoire or library of the device . in any case , the subject alarm clock also includes a controller or processor 6 that can access memory 4 and control the functions of the alarm clock ( e . g ., drive a display 11 for displaying time , etc .). a “ processor ” references any combination of hardware or software which can control components as required to execute recited steps and includes , for example , a general purpose digital microprocessor suitably programmed ( e . g ., from a computer readable medium carrying necessary program code or by communication from a remote location ) to perform all of the steps required of it , or any hardware or software combination which will perform those or equivalent steps . the programming may be provided remotely to processor 6 , or previously saved in a computer program product such as memory 4 or some other portable or fixed computer readable storage medium . such media include , but are not limited to : magnetic storage media , such as floppy discs , hard disc storage medium , and magnetic tape ; optical storage media such as cd - roms and dvds ; electrical storage media such as ram , rom and eprom ; and hybrids of these categories such as magnetic / optical storage media . program - containing computer - readable medium may be read locally or from a remote location through a communication channel ( not shown ). indeed , the present invention can be run on a general - purpose computer . in which case , the product to be purchased by the user may be software package — boxed or downloaded . still , a preferred embodiment is one in which the “ clock ” is a stand - alone unit , that a user can purchase on - line or at any retail outlet . variations of the inveniton include alarm clocks that are programmable for two or more independent wake - up protocols . in other words , an alarm clock maybe adapted to store a plurality of preset wake - up protocols , e . g ., thereby obviating the need to reset the alarm for varying wake - up schedules . such may be based on time of day , day of week , etc . the presets may be user - programmed or pre - programmed and associated with a series of buttons for ease of user access . in certain embodiments , the sound library of a subject alarm clock may be modifiable ( e . g ., periodically updated or changed ). embodiments that are adapted to enable editing of the sound library increase the customization and personalization of an alarm clock . the sound library may be personalized in a number of ways . the sound library may be personalized by adding to the library recorded speech or familiar sounds . for example , familiar speech such as a spouse &# 39 ; s voice may be recorded as a wake - up sound ( e . g ., a husband or wife screaming “ wake up !”, and the like ), a baby &# 39 ; s cry may be may be recorded as a wake - up sound , etc . accordingly , an aspect of the invention may include audio acquisition 8 ( i . e ., audio input ) so that the user may add wake - up sounds to the sound library from an external sound source . sounds may be added to the sound library by / from ( but not limited to ), e . g ., computer download , internet download , voice input , keypad input , radio frequency download , wireless application protocol download , mp3 player , radio , television , home theater system , telephone , and the like . in certain embodiments , audio content may be downloaded from an external source such as via wifi . the external source may be a specific website , e . g ., a subscription music service website . for example , a user may subscribe to a web - based service that permits the download of audio content for a fee . the alarm clock may include a download button or the like and audio content may be downloaded to the alarm clock by activation button of the alarm clock to download audio content from the website , e . g ., via wifi . wake - up sounds acquired from an external source and stored in wake - up sound memory device 4 will typically be identified or designated as a particular sound intensity ( i . e ., are stored in memory 4 as one of the sound intensity modes of the alarm clock ). designation of a particular sound as a member of a set of a particular sound intensity may cause the sound to be stored in a certain location of a memory device or otherwise designated as the particular intensity . a user may designate a sound as a particular sound intensity by any suitable means ( e . g ., optional keyboard connected to the alarm clock or optional alphanumeric pad integrated with the alarm clock , or , as shown in alarm clock 2 of fig3 optional selector 12 such as a dial , toggle , button , display , etc .,) of the alarm clock . in certain embodiments , the audio input 8 is built into or otherwise integrated with the alarm clock . an alarm clock may include a built - in microphone used to record a new audio wake - up segment from a sound source and store the recorded sound in memory 4 , and / or may include an audio input jack for a monaural or stereo signal . still further , a user may download or create the sound in a computer and transmit the audio to the alarm clock , e . g ., through a connection cable . as such , input 8 may comprise a usb port or other typical digital interface means . audio input 8 may include a microphone and associated analog - to - digital ( a / d ) and digital signal processing ( dsp ) circuitry 7 ( alternatively processor 6 may provide the dsp function ) to capture an analog audio signal . the processor may then store the digitized speech in wake - up sound memory 4 , as described herein . thus , in accordance with an embodiment of the present invention , sound signals representative of the desired sound segments may be received by the microphone , converted into digital signals by an a / d converter , and processed and stored in memory under the direction of a digital signal processor . in this manner , the stored sound segments may be used to wake - up a user in a distinctive , personalized way . as part of the audio acquisition system , an alarm clock may include a visual indicator 8 a such as an led , lcd or the like to indicate audio acquisition . the indicator may also be adapted to notify the user of recording time remaining ( such as by blinking ) when a predetermined amount of record time remains . the subject alarm clocks also include audio output 10 . audio output 10 may include an amplifier , speaker , digital - to - analog ( d / a ) converter and dsp circuitry 9 ( alternatively dsp circuitry may be provided by processor 6 ) to receive digitized audio content from processor 6 and memory 4 , convert the digitized audio content to an analog audio wake - up signal , amplify , and broadcast the analog audio wake - up signal through the speaker at the pre - set wake - up time . audio output 10 may include one or more speakers for playing the intensity - specific alarm sound and may be associated with the alarm clock in any suitable manner . for example , one or more speakers may be connected to the alarm clock by one of a direct , wired connection to a speaker , a wireless radio connection to a speaker , a wireless infrared connection to a speaker , and a means of transmitting data to a speaker that includes transmitting data in a wireless manner . in certain embodiments , the one or more speakers are integrated into the alarm clock , as shown in fig3 . audio output 10 may include a volume control switch 14 for manually setting volume . use of this control may further compound the effect of recording level for the various sounds output from the device . furthermore , audio output 10 may include an automatic volume control to automatically increase the volume of the analog audio signal during wake - up , from an initial volume to a maximum volume level , over a predetermined time period to provide crescendo to certain wake - up tones . such automated volume control could also be employed in repeating one type of sound as successively higher levels to vary its intensity . an example of a sound that could be soothing at low levels is a “ distant ” fog horn . at a higher level , it offers and intermediate level of wake - up alarm . blaring at maximum speaker intensity , the fog horn could be regarded as an intense wake - up signal . in certain embodiments , the functions of the a / d , dsp and d / a circuitry may be provided on a single chip or device , such as ( but not limited to ), for example , an isd2532 single chip voice record / playback device ( manufactured by winbond electronics corp . of san jose , calif .) or analogous device . in such embodiments , audio input 8 may include a microphone and the single - chip voice record / playback device , which may include on - chip audio memory to store the digitized audio content , while audio output may include the speaker and associated amplification circuitry , which may include volume control , as noted above . the audio acquisition process may be activated by a control switch , and the analog sound signal may be input to the single - chip voice record / playback device via the microphone , converted to digitized speech and then stored in on - chip memory ( e . g ., a particular sound intensity ). in certain embodiments , speakers of the alarm clock may be used with external audio sources so that audio from the external source may be played through the alarm clock speakers ( e . g ., even when not used for wake - up ). for example , a communication link , e . g ., an input jack , may be adapted for cable connection to a conventional radio , home theater , dvd , mp3 player , computer , etc ., allowing the audio from such external sources to be amplified by the speakers of the alarm clock . alarm clocks of the subject invention may include various optional features such as multiple alarm protocols , snooze , etc ., whereas such features are well - known in the art to which the invention pertains . alarm clocks according to the present invention may be adapted to store a plurality of independent wake - up protocols or events ( see for example alarm programs 1 . . . n of display 12 b of fig6 ) and may be adapted to store weekly wake - up protocols , monthly protocols , yearly protocols , etc . in other words , an alarm clock may be programmed for a wake - up schedule for an entire week , month , year , etc ., such that the wake - up schedule includes a plurality of wake - up protocols that differ in at least one parameter ( date , time , wake - up intensity , etc .). the different wake - up protocols may be selectively activated by the user , for example on a weekday the user may simply activate the weekday schedule or schedule for a particular day of the week , or the alarm may be programmed to automatically run the stored alarm protocols at the appropriate time ( as the appropriate date / time occurs ). the protocols may be selectively deactivateable so that , ( e . g ., a first programmed alarm protocol may be deactivated for a particular week if a schedule requires temporary deactivation ) without deactivating any other programmed alarm protocols . the user may be on vacation and not require the effective wake - up offering of the present invention . setting an alarm clock for various wake - up schedules may be accomplished in any suitable manner , e . g ., by way of one or more selectors of the alarm clock . the subject alarm clocks are adapted to enable different wake - up intensities for different , independent wake - up protocols programmed into the alarm clock . for example , a subject alarm clock may be programmed for a first alarm protocol of first intensity and a second alarm protocol of second intensity . in certain embodiments , a single alarm clock may be programmed to accommodate wake - up protocols for two or more persons ( i . e ., an alarm clock may be programmed for a first wake - up protocol ( time / wake - up intensity , and the like ) for a first person and a different , second wake - up protocol for a second person ). an alarm may be programmed for two or more wake - up protocols based on the days of the week . an alarm may be programmed for a first wake - up protocol for certain days of the week ( e . g ., weekdays ) and a second wake - up protocol for certain other days of the week ( e . g ., weekend days ). the alarm intensities of the first and second wake - up protocols may differ ( i . e ., the first alarm protocol ( weekday wake - up protocol ) may be of a first alarm intensity , such as for example severe intensity mode , and the second alarm protocol ( weekend protocol ) may be of a second alarm intensity , such as for example soothing alarm intensity ). other configurations are possible as well . for example , an alarm clock may be preset for a daily , weekly , monthly , etc ., wake - up protocol that accounts for the day / time of street cleaning , parking regulations , etc . seven ( one for each day of the week ) individual alarm protocols may be preset so that a weekly schedule need only be programmed one time . it is known that a user may set the time of the clock ahead by a known amount in an attempt to deceive themselves when the alarm is triggered into thinking that the time is actually later than it really is . however , this technique is often ineffective because the person knows exactly how much time has been added to the clock . by a simple math computation when the alarm is triggered , the actual time may be quickly determined . using the microprocessor of the present invention , however , the alarm clock may include a “ time warp ” feature that belies user avoidance . in certain embodiments , a time warp may occur from about 30 to about 20 minutes before the alarm is triggered and continue until a predetermined time after the alarm is triggered or until the alarm is turned - off by the user — at which time the time is returned to actual time . for example , time warp may occur from about 1 minute to about 15 minutes before the alarm is triggered ( e . g ., from about 5 minutes before the alarm is triggered to about 10 minutes before the alarm is triggered ). the time warp may continue through the alarm signal and for a period of time after the alarm is triggered ( in certain embodiments regardless of whether the alarm is turned - off by the user or not ). for example , time warp may continue from about 30 seconds to about 20 minutes after the alarm is triggered ( e . g ., from about 1 minute to about 15 minutes after the alarm is triggered ). by such continuation , the user is not able to avoid the imperative of the alarm by waiting for the actual time to display and then return to sleep . the time warp may change on a periodic or random basis so that the time may be modulated by different amounts for different wake - up events . the warp may be set such that it may go to +/− about 5 min . 10 min , 15 , min ., etc . in other words , the clock processor may include a plus and / or minus time warp in that the time ( real or current time ) may be randomly modulated by addition or subtraction of time . yet , it will remain basically centered about the actual time . accordingly , it offers a time - piece that one can employ ( if set conservatively ) to meet the tasks of the day . for such a purpose , it may also be desirable that when employing time warp features that the actual real time may be shown . it may appear automatically after a prescribed time , or it could be accessed by a user depressing an override or “ real time ” button ( not shown ). as referenced above , the subject alarm clocks may include a snooze feature , to temporarily silence the wake - up signal for a predetermined time period . this feature may too be variable ( i . e ., set by a user to a desired time interval ) and / or randomizable in a manner similar to the time warp so that it may offer any amount of time between ( e . g ., 5 and 15 min .) or some user - set interval . the snooze mode may be activated in any suitable manner , e . g ., snooze activator 16 . in certain embodiments , the snooze function may be activated by voice command . certain alarm clocks may limit the total time that the wake - up signal will be played to a specific period , such as one hour or the like , to prevent the signal from sounding continuously if the user is unable to terminate the wake - up signal . or , as described above , after a prescribed — or even randomized — amount of time , the intensity of the alarm setting or alarm type may be edged or jump upwards . the alarm clocks of the subject invention may be powered by any suitable power source ( not shown ). the power supply may provide ac power or dc power , at the appropriate voltages and currents , to the various components of an alarm clock . in certain embodiments , the power supply may include a rechargeable , or non - rechargeable , battery , voltage regulator , power control circuitry , power switch , etc ., to provide one or more supply voltages , such as , for example , 9v , 5v , etc . for example , the power supply may operate on 120v ac power only , dc power only , a combination of ac and rechargeable , or non - rechargeable , dc power , etc . the dc power may provide a back - up against power outages . alternatively , by running on dc by being switchable between ac and dc power , the clock may be suitable for use as a travel alarm clock ( in addition to home use , if so - desired ). still further , a subject alarm clock may be adapted to utilize ac power via connection to a standard household electrical outlet , and also utilize a re - chargeable battery which re - charges when connected to the electrical outlet . the alarm clock of fig3 shows various other features that may be included in the subject alarm clocks . shown are time display 11 ( e . g ., lcd or led display ) for displaying the current time , wake - up intensity mode selector 12 , alarm on / off 22 , alarm time set 24 , actual time set 26 , hour set selector 27 , minute set selector 28 . am / pm indicator ( s ) 31 and 32 are also provided . in certain embodiments , the am / pm indicators are “ am ” and “ pm ” lighted letters , e . g ., led or lcd am / pm displays . in sum , the clock may employ a custom or any typical enclosure , power management options and / or display means . of greater interest , the alarm clocks include a wake - up intensity mode selector 12 . wake - up intensity mode selector 12 may be in any suitable form including , but not limited , such a rotatable dial , a sliding scale , an alphanumeric input control ( e . g ., allowing the user to type in a number , letter , or word ), buttons , a manual switch is shown , a touch - panel type lcd , etc . fig4 shows an exemplary embodiment of a dial 12 a that may be used to select a desired intensity mode . dial 12 a is rotatable so that pointer 13 points to the desired intensity mode . it may point to any of the aforementioned modes , including a random mode as shown . intensity mode selector may also be a digital display adapted to display characters or graphics at least corresponding to the available sound intensity modes of the invention and optional random mode . the display may include one or more screens of alarm clock content . fig5 shows an exemplary embodiment of digital display 12 b . in this embodiment , display 12 b also displays the individual sounds that fall within each intensity mode . display 12 b also includes navigation graphics 42 and 43 in the form of arrows that may be utilized for navigating or scrolling of information displayed on display 12 b . display 12 b may be adapted to allow a user to designate an intensity mode displayed on the screen . for example , display 12 b may be provided with a touch screen interface that allows a user to select displayed content . an input device , including , but not limited to , a stylus ( not shown ) may be used to interact with display 12 b . a digital display may additionally be adapted to display a variety of alarm clock information and functions such as , but not limited to , battery indicator , volume indicator , available memory size , etc . in certain embodiments , a display may be adapted for user selection of a variety of alarm parameters . for example , some or all of the wake - up time parameters of a wake - up protocol may be selected from the display , ( e . g ., by way of a touch screen as described above ). fig6 shows display 12 c that includes user selectable features for setting various parameters of a wake - up protocol . in such embodiments , the display may include icons , characters or the like that correspond to the different alarm protocol parameters such as the selection of a first alarm protocol , second alarm protocol . . . n alarm protocol , and the various parameters of that particular alarm protocol such as the day ( s ) of the week , wake - up time , intensity mode , etc . content may be shown on one screen as shown in fig6 or multiple screens navigatable by the user . using a subject alarm clock generally includes , in any order , setting a wake - up time in the alarm clock to activate the wake - up signal when the set time matches a current time , and designating a particular intensity mode . as described above , the intensity mode may be designated from a plurality of intensity modes , including random mode , e . g ., standard mode , soothing mode , severe mode and random mode . an aspect of the invention includes setting at least two different wake - up protocols wherein the designated wake - up intensities of the protocols may differ . for example , such embodiments may include , in any order , setting a first wake - up time in the alarm clock to activate the wake - up signal when the set time matches a current time , and designating a particular intensity mode for the first wake - up protocol ; and setting a second wake - up time in the alarm clock to activate the wake - up signal when the set time matches a current time , and designating a particular intensity mode for the second wake - up protocol . another aspect of the invention includes editing a sound library of an alarm clock , ( e . g ., by adding and / or deleting sounds from the sound library , and assigning the newly added sounds a sound intensity identifier ). the sound library may be edited by any suitable method , e . g ., connection cable , wireless connection ( e . g ., wifi , and the like ), etc . methods may also include connecting an external device such as an mp3 player , computer , stereo , cd player , etc ., to a subject alarm clock ( e . g ., via an input jack or the like ) and listening to audio from the external source using the audio output of the alarm clock . exemplary aspects of the invention , together with details regarding material selection and manufacture have been set forth above . as for other details of the present invention , these may be appreciated in connection with the above - referenced patents and publications as well as generally know or appreciated by those with skill in the art . the same may hold true with respect to method - based aspects of the invention in terms of additional acts as commonly or logically employed . in addition , though the invention has been described in reference to several examples , optionally incorporating various features , the invention is not to be limited to that which is described or indicated as contemplated with respect to each variation of the invention . various changes may be made to the invention described and equivalents ( whether recited herein or not included for the sake of some brevity ) may be substituted without departing from the true spirit and scope of the invention . in addition , where a range of values is provided , it is understood that every intervening value , between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention . also , it is contemplated that any optional feature of the inventive variations described may be set forth and claimed independently , or in combination with any one or more of the features described herein . reference to a singular item , includes the possibility that there are plural of the same items present . more specifically , as used herein and in the appended claims , the singular forms “ a ,” “ an ,” “ said ,” and “ the ” include plural referents unless the specifically stated otherwise . in other words , use of the articles allow for “ at least one ” of the subject item in the description above as well as the claims below . it is further noted that the claims may be drafted to exclude any optional element . as such , this statement is intended to serve as antecedent basis for use of such exclusive terminology as “ solely ,” “ only ” and the like in connection with the recitation of claim elements , or use of a “ negative ” limitation . without the use of such exclusive terminology , the term “ comprising ” in the claims shall allow for the inclusion of any additional element — irrespective of whether a given number of elements are enumerated in the claim , or the addition of a feature could be regarded as transforming the nature of an element set forth n the claims . stated otherwise , except as specifically defined herein , all technical and scientific terms used herein are to be given as broad a commonly understood meaning as possible while maintaining claim validity . the breadth of the present invention is not to be limited to the examples provided and / or the subject specification , but rather only by the scope of the claim language . that being said , we claim : | 6 |
a hydrodynamic bearing is schematically shown in fig2 as a test bearing in a stage before final assembly and is designated there in its entirety by reference numeral 10 . test bearing 10 includes a shaft seat 12 in which a shaft 14 is rotatably arranged . the shaft 14 extends in a longitudinal direction 16 . at one end of the shaft 14 , a thrust plate 15 is arranged whose outer diameter is larger than the diameter of the shaft 14 . the shaft seat 12 has a first cylindrical seat area 17 in which a section of the shaft 14 is positioned and , together with the corresponding section of the shaft seat 12 , forms a radial bearing . a second cylindrical seat area 19 is located adjacently to the first seat area 17 . thrust plate 15 is positioned within the second cylindrical seat area 19 . on final assembly , the hydrodynamic bearing is provided with a counter plate ( not shown in the drawing ) which encloses the shaft seat 12 at one end . in the embodiment shown in fig2 a cylindrical recess 21 is provided located adjacently to the second seat area 19 of the shaft seat 12 . counter plate can be inserted into the cylindrical recess 21 . a bearing gap 18 , substantially annular in cross - section , is formed between the shaft seat 12 and the shaft 14 , when the shaft 14 is in place . a typical gap width for hydrodynamic bearings , used , for example , for the rotary bearing of small - scale motors for hard disk drives , is about 3 μm , wherein tolerances in the order of ± 0 . 5 μm are permitted . in a completed bearing , a lubricant is located in the bearing gap 18 . due to these tight tolerances , a hydrodynamic bearing can only be classified before final assembly when the shaft 14 is positioned in the shaft seat 12 in its functional position , since the frictional losses within the lubricant in the bearing gap 18 are largely determined by the gap design and in particular the gap width . in accordance with the present invention , in order to verify ( inspect ) and classify hydrodynamic bearings , the test bearing 10 , with the shaft 14 placed in its functional position within the shaft seat 12 , is exposed to a gaseous measuring fluid , such as air , and the through - flow - related parameters of the fluid flowing through the bearing gap 18 of the test bearing 10 are determined . such testing is performed before final assembly of the bearing and , in particular , before the counter plate is mounted and the lubricant is injected into the bearing gap 18 . for this purpose , as shown in fig1 an admission device , designated in its entirety by reference numeral 20 , is provided for admission of a gaseous measuring fluid to the test bearing 10 . in the embodiment illustrated , the admission device includes a pressure reducer 22 , via which a defined start pressure of the gaseous measuring fluid which flows through the bearing gap 18 , can be set . an outlet 24 of the pressure reducer 22 is operatively connected to the bearing gap 18 so that a stream of measuring gas with a defined start pressure , adjusted by means of the pressure reducer 22 , can be fed to the bearing gap . when air is used as the measuring fluid , a typical pressure range for the start pressure is 2 bar to 3 bar . a filter / water separator 26 is positioned before the pressure reducer 22 . the filter / water separator 26 filters out contaminants from the measuring fluid . when air is used as the measuring fluid , water droplets can also be removed by the filter / water separator . therefore , essentially pure , dry air is preferably used as a measuring fluid in measuring the test bearing 10 . using a controllable valve 28 , the admission device 20 can be operatively ( as to fluid flow ) coupled or uncoupled to a source 30 of the measuring fluid . in the embodiment illustrated in fig1 the valve 28 is a lever - operated 2 / 2 valve . in using air as the measuring fluid , the source 30 could , for example , be the surrounding air , whereby an air compressor sucks in the air and makes it available to or feeds it to the admission device 20 . as shown in fig2 the measuring fluid is fed via a feeding device 32 to the bearing gap 18 of the test bearing 10 . for this purpose , the test bearing 10 is open at both ends 34 , 36 of the shaft seat 12 , so that the measuring fluid can flow from one end 34 through the bearing gap 18 to the other end 36 . the feeding device 32 is coupled to the end 34 . the thrust plate 15 is arranged in the region of the other end 36 , without the counter plate being assembled allowing fluid to flow freely through the bearing gap 18 . the feeding device 32 is provided with a hood 38 which can be attached to the end 34 of the test bearing 10 . a seal 42 , for example , in the form of an o - ring seal is positioned between the end face 40 of the hood 38 and the shaft seat 12 . this seal 42 encloses the bearing gap 18 and ensures that the measuring fluid from the feeding device 32 can only discharge through the bearing gap 18 . in particular , the seal 42 is positioned at the end face 40 of the hood 38 so that when the hood 38 is placed against the shaft seat 12 , suitable sealing is ensured . an inlet 44 of the feeding device 32 is operatively ( as to fluid flow ) connected to the outlet 24 of the pressure reducer 22 so that measuring fluid , which has a defined start pressure , can be provided to the feeding device 32 . by measuring one or more parameters which characterize the through - flow of measuring fluid through the bearing gap 18 , the bearing gap 18 itself can be characterized since the narrowest part of the system with through - flow determines the flow parameters . for instance , the hydraulic volume of the bearing gap 18 can be determined . since the overall dimension of the shaft seat 12 in the longitudinal direction 16 of the shaft 14 is known with great precision , a mean hydraulic diameter of the bearing gap 18 can be derived from the hydraulic volume , and the gap width can in turn be determined . it is then easy to establish whether the test bearing 10 conforms to the specified manufacturing tolerances or not . an end - mounted hydrodynamic bearing can thus be classified according to its manufacturing quality . in accordance with the invention , it is possible to determine the quantity of the measuring fluid passing through the bearing gap 18 . in the embodiment illustrated in the figures , provision is made to measure the pressure loss of the measuring fluid due to its through - flow through the gap 18 . for this purpose , the pressure reducer 22 provides a defined start pressure . a pressure sensor 46 of a measuring device 45 , positioned after the pressure reducer 22 and before the test bearing 10 , measures the pressure applied at the feeding device 32 . due to the flow resistance incurred in the through - flow of measuring fluid through the bearing gap 10 , this pressure is reduced in relation to the start pressure of the pressure reducer 22 , whereby , for an embodiment in which the defined start pressure is in the order of magnitude of 2 to 3 bar , the typical pressure difference ( pressure reduction ) is in the order of magnitude between 0 . 7 bar and 1 . 4 bar . the result of the measurement , in other words the pressure difference which characterizes the test bearing 10 , is shown on a display unit 48 . the pressure sensor 46 can be in connection with a control unit which controls the production process of hydrodynamic bearings and , for example , monitors and records the production steps for each individual bearing . thus , for example , the measurement result can be directly used to assign an identification to the measured test bearing 10 and to store this identification which characterizes the measured mean hydraulic diameter of the bearing gap 18 of the test bearing 10 . the pressure sensor 46 includes , for example , a pneumatic / electric piezo transducer by means of which the effective pressure is converted into an electric signal which can then be preferably read on the display unit 48 . a holding device , designated in its entirety by reference numeral 50 , is provided to hold the shaft 14 in the shaft seat 12 in its functional position ( fig3 and 4 ). due to the admission of measuring fluid , a force is exerted on the shaft 14 which has a tendency to move the shaft out of the shaft seat 12 . the holding device 50 is used to hold the shaft 14 in its functional position in the shaft seat 12 . in a first embodiment which is schematically illustrated in fig3 the holding device 50 includes a contact element 52 , which rests against the shaft at its end 36 and thus blocks the shaft 14 from being displaced towards the contact element 52 as soon as the shaft 14 contacts it . here , the contact element 52 is positioned in such a way that between the thrust plate 15 and an annular transverse surface 54 , which bounds the second seat area 19 , an annular gap 56 is formed as part of the bearing gap 18 . the measuring fluid is then diverted transversely in its direction of flow which , in the part of the bearing gap 18 disposed within the first seat area 17 , is essentially parallel to the longitudinal direction 16 , in order to flow into the gap 56 between one end area of the thrust plate 15 facing the end 34 and the second seat area 19 . at the outer end of the gap 56 , the measuring fluid is again diverted in order to flow between an outer side of the thrust plate 15 and the shaft seat 12 towards the end 36 , once again essentially parallel to the longitudinal direction 16 . a second embodiment of a holding device , which is schematically illustrated in fig4 and 5 , is of particular use if the thrust plate 15 is provided with re - circulation holes 58 for lubricant . such re - circulation hole 58 connects the bearing gap 18 with the recess 21 for the counter plate . in accordance with this embodiment , the holding device 50 includes a force exerting device 60 by means of which the shaft 14 can be pressed onto the transverse surface 54 of the second seat area 19 . the force exerting device 60 allows a force to be exerted in the direction opposite to the direction of through - flow of the measuring fluid through the bearing gap 18 . for this purpose , for example , the force exerting device 60 includes an elastic element 62 , such as a compression spring , so that the necessary force action can be provided . after through - flowing through the bearing gap 18 , the measuring fluid flows through the re - circulation holes 58 in the thrust plate 15 . following is the description of the method of measuring and inspecting the bearing gap in accordance with the invention . gaseous measuring fluid such as air is admitted to the bearing gap 18 under a defined start pressure p 0 specified by the pressure reducer 22 . due to the flow resistance during the flow of fluid through the bearing gap 18 , a pressure loss in relation to the start pressure is incurred so that a lower pressure p 1 appears in the feeding device 32 , whereby the magnitude of the pressure difference δp = p 0 − p 1 is characteristic for the mean hydraulic diameter of the bearing gap 18 . thus , by determining the pressure difference δp , the bearing gap 18 of the test bearing 10 can be measured , or the end - mounted hydrodynamic bearing itself can be characterized and classified . the measurement to characterize the test bearing 10 is preferably only taken when quasi - stationary conditions prevail , this means that with a start pressure explicitly specified by the pressure reducer 22 , the measurement is only taken when the pressure sensor 46 shows a stable value within the degree of measurement accuracy . the conditions of fluid admission , that is the start parameters , are preferably selected in such a way that the through - flow of fluid through the bearing gap 18 from one end 34 in the direction towards the other end 36 , does not result in a turbulent flow but rather result in a quasi - stationary , laminar flow . therefore pressure losses are not caused by turbulence . the device in accordance with the invention and the method in accordance with the invention allow a hydrodynamic bearing , even one with very narrow bearing gap widths in the order of magnitude of a few μm , to be characterized easily and quickly . in particular , test bearings in which the shaft 14 is placed in the shaft seat 12 in its functional position can be tested in this way . for the convenience of the reader , the above description has focused on a representative sample of all possible embodiments , a sample that teaches the principles of the invention and conveys the best mode contemplated for carrying it out . the description has not attempted to exhaustively enumerate all possible variations . other undescribed variations or modifications may be possible . for example , where multiple alternative embodiments are described , in many cases it will be possible to combine elements of different embodiments , or to combine elements of the embodiments described here with other modifications or variations that are not expressly described . many of those undescribed variations , modifications and variations are within the literal scope of the following claims , and others are equivalent . | 5 |
the preferred embodiment of the improved high performance aluminum connecting rod of the present invention will be described in detail , but first the high performance aluminum alloy from which it is manufactured will be described in detail . as mentioned above , this high performance aluminum alloy is a variant of the aluminum alloy taught in alcoa &# 39 ; s u . s . pat . no . 5 , 221 , 377 , which has previously been incorporated herein by reference . prior to the development leading up to the improved high performance aluminum connecting rod of the present invention , this aluminum alloy has not been known to be suitable for the fabrication of connecting rods . the preferred high performance aluminum alloy used to make the improved high performance aluminum connecting rod of the present invention is an alloy available from alcoa as 7055 - t77511 , also referred to as hp007 . this aluminum alloy has been available from alcoa for some time , but never made into extruded bar stock for forging . by working with alcoa , the inventors of the invention described herein obtained 7055 - t77511 aluminum alloy from alcoa in extruded bar stock suitable for forging . the 7055 - t77511 aluminum alloy used to fabricate the improved high performance aluminum connecting rod of the present invention is formulated ( by weight ) as follows : ______________________________________material percentage by weight______________________________________si 0 . 10fe 0 . 15cu 2 . 0 - 2 . 6mn 0 . 05mg 1 . 8 - 2 . 3cr 0 . 04zn 7 . 6 - 8 . 4zr 0 . 08 - 0 . 25ti 0 . 06al balance______________________________________ in accord with the present invention , the 7055 - t77511 aluminum alloy is provided as extruded bar stock which is suitable for forging , and may be either rectangular bar stock or round bar stock . typically , a rectangular bar stock can be used to make a billet rod that is not forged . if rectangular bar stock is used as a blank for the forging operation , it is preferably between 1 . 0 and 2 . 5 inches in thickness , between 2 . 0 and 5 . 0 inches wide , and between 6 . 0 and 15 . 0 inches long . the preferred dimensions for a rectangular bar stock blank are approximately 1 . 5 inches in thickness , approximately 4 . 0 inches wide , and approximately 12 . 5 inches long . such a rectangular bar stock blank 20 is illustrated in fig1 . generally , the length should fill the die , but not be so long as to present the possibility of breaking the die . if round bar stock is used as a blank for the forging operation , it is preferably between 1 . 5 and 2 . 5 inches in diameter , and between 11 . 5 and 14 . 5 inches long . the preferred dimensions for a round bar stock blank are approximately 2 . 0 inches in diameter , and approximately 12 . 5 inches long . such a round bar stock blank 22 is illustrated in fig2 . the single most critical portion of the manufacture of the improved high performance aluminum connecting rod of the present invention is the forging operation , which in large part determines the characteristics of the complete connecting rod . the temperature that the rectangular bar stock blank 20 or the round bar stock blank 22 is heated to for the forging operation is critical . in the development of the improved high performance aluminum connecting rod of the present invention , a substantial amount of testing was required in order to establish the temperature range which would produce a product with acceptable material characteristics , since the 7055 - t77511 high performance aluminum alloy had never been supplied as extruded forging stock , far less been used to manufacture connecting rods . in the experimental work on prototype forgings , machining revealed cracks in the vicinity of the bearing housing bore . in fact , approximately 20 - 25 percent of the prototype connecting rods were found to be cracked near the bearing housing bore . the experimental work which was performed included chemistry comparisons , mechanical property comparisons , and extrusion parameter comparisons of the 7055 - t77511 high performance aluminum alloy ; met allographic examinations and ultrasonic examinations of the bar stock ; failure analyses of the connecting rods , which included ultrasonic examination of the connecting rods , macro etching of the connecting rods to examine material flow during forging , and met allographic examination of the connecting rods ; and forging trials to duplicate failures and identify the causes therefor , including jogging samples , and forging temperature trials . the results of this experimental work reduced the possible causes one by one . the chemical composition of three different lots was nearly identical . the mechanical properties of the three different lots were substantially similar . the actual extrusion parameters for the three different lots were also substantially similar . the met allographic examinations of the bar stock revealed no material discontinuities . similarly , the ultrasonic examination of the bar stock revealed no material discontinuities . macro etching of the connecting rods found no differences in material flow when comparing good connecting rods to failed connecting rods . met allographic examination of failed connecting rods revealed internal voids . jogging samples during forging trials did not duplicate the failure mode . finally , the cause of the failure was determined to be caused by a totally unexpected cause , namely forge slug temperatures above 800 ° fahrenheit . whenever the forge slug was heated to temperatures of approximately 800 ° fahrenheit or above , internal voids resulted . the voids were quite small at approximately 800 ° fahrenheit , and became progressively larger at higher temperatures . thus , 800 ° fahrenheit was identified as the slug temperature at the top of the range of temperatures which could produce acceptable forgings . the lowest slug temperature which could be used was identified as 500 ° fahrenheit . the optimum slug temperature was identified to be approximately 775 ° fahrenheit . extruded bar stock is preferred but rectangular bar stock can be used . a blocker die used to rough out the rectangular bar stock blank 20 is illustrated in fig3 . blocker die halves 30 and 32 are shown with the rectangular bar stock blank 20 located therebetween . the forging operation is illustrated in fig3 with the rectangular bar stock blank 20 heated to the forging temperature , which in the preferred embodiment is approximately 775 ° fahrenheit . the heated rectangular bar stock blank 20 is the forging slug . the blocker die half 30 is hit , forcing it toward the blocker die half 32 , forming the heated rectangular bar stock blank 20 into a rough forging 34 ( which is illustrated in fig4 ). in the preferred embodiment , the forging slug is struck only once in the blocker die . a finisher die used to finish the rough forging 34 is illustrated in fig4 . finisher die halves 36 and 38 are shown with the rough forging 34 located therebetween . the finishing forging operation illustrated in fig4 is performed immediately after the rough forging operation illustrated in fig3 . the finisher die half 36 is hit , forcing it toward the finisher die half 38 , forming the rough forging 34 into a finished forging 40 ( which is illustrated in fig5 ). in the preferred embodiment , the rough forging 34 is truck in the finisher die , die cleaned , and hit again . a trim die used to trim the flashing ( indicated generally by the reference numeral 42 ) from the finished forging 40 is illustrated in fig5 . trim die halves 44 and 46 are shown with the finished forging 40 located therebetween . the trimming operation illustrated in fig5 is performed after cooling to room temperature after the finishing forging operation illustrated in fig4 . the trim die half 44 is hit , forcing it toward the trim die half 46 , trimming the flashing 42 from the finished forging 40 and completing the forging operation . in the preferred embodiment , the finished forging 40 need be struck only once in the trim die . the connecting rod forging is then heat treated , following which it is etched . at this point , the connecting rod forging is then penetrant inspected and ultrasonically tested in order to detect any latent defects . the connecting rod forging is then ball burnished , which completes the portion of the manufacturing process prior to machining . the various machining steps required to complete the manufacture of the improved high performance aluminum connecting rod 50 will be described with reference to the remaining figures , which show the improved high performance aluminum connecting rod 50 in its completed form . referring first to fig6 and 7 , the improved high performance aluminum connecting rod 50 is illustrated with its pin end on the right and its crank end at the left . a wrist pin bore 52 is illustrated in the pin end of the improved high performance aluminum connecting rod 50 , and a bearing housing bore 54 is illustrated in the crank end of the improved high performance aluminum connecting rod 50 . the improved high performance aluminum connecting rod 50 is split to form a cap 56 and a fork 58 of the improved high performance aluminum connecting rod 50 . ( as mentioned above , the cap 56 and the balance of the improved high performance aluminum connecting rod 50 may alternatively be forged as two separate segments .) as best illustrated in fig6 the split between the cap 56 and the fork 58 is defined by a plane which can be orthogonal or at any angle to the longitudinal axis of the improved high performance aluminum connecting rod 50 ( the axis extending between the pin end and the crank end of the improved high performance aluminum connecting rod 50 ), which plane divides the bearing housing bore 54 at the crank end of the improved high performance aluminum connecting rod 50 in half . the portion of the improved high performance aluminum connecting rod 50 located between the fork 58 and the rod end of the improved high performance aluminum connecting rod 50 forms the rod beam 60 of the improved high performance aluminum connecting rod 50 . as mentioned above , there are three methods which may be used to remove the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 , all of which are conventional in the art . these methods include sawing the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 , using a laser to divide the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 , and fracturing the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 . while the first two methods are self - explanatory , examples of fracturing the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 are provided in u . s . pat . no . 5 , 105 , 538 , to hoag et al ., u . s . pat . no . 5 , 507 , 093 , to wittenstein et al ., and u . s . pat . no . 5 , 655 , 296 , to ravenhorst et al . u . s . pat . no . 5 , 105 , 538 , u . s . pat . no . 5 , 507 , 093 , and u . s . pat . no . 5 , 655 , 296 are each hereby incorporated herein by reference . following the separation of the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 , a radius approximately 0 . 005 larger than the finished radius of the bearing housing bore 54 is machined into both the cap 56 and the fork 58 . referring particularly to fig8 in addition to fig6 , and 9 , in the preferred embodiment of the present invention , the adjoining faces of the cap 56 and the fork 58 of the improved high performance aluminum connecting rod 50 are machined into mutually engaging serrated surfaces 62 and 64 , respectively . referring now to fig6 , 9 , and particularly 10 and 11 , two holes 66 and 68 are drilled into the cap 56 . the holes 66 and 68 are located in the cap 56 on opposite sides of the bearing housing bore 54 , and are parallel to the axis of the improved high performance aluminum connecting rod 50 ( which extends between the rod end and the crank end of the improved high performance aluminum connecting rod 50 ). referring particularly to fig1 , two smaller holes 70 and 72 are drilled into the fork 58 of the improved high performance aluminum connecting rod 50 . the holes 70 and 72 are located in the fork 58 on opposite sides of the bearing housing bore 54 , and are coaxial with the holes 66 and 68 in the cap 56 . the holes 70 and 72 in the fork 58 of the improved high performance aluminum connecting rod 50 are threaded . next , the cap 56 is assembled onto the fork 58 of the improved high performance aluminum connecting rod 50 using two rod bolts 74 and 76 , which are , by way of example , 7 / 16 - 20 unfj class 3a bolts with a rockwell of 51c to 52c , rated at 272 ksi . the rod bolts 74 and 76 are preferably lubricated with s . a . e . 30 weight motor oil , and are torqued to the proper degree , preferably approximately 85 ft . lbs . four keyways , ( bearing tang grooves ) two of which are referred to by the reference numerals 78 and 80 , are machined into the cap 56 and the fork 58 in the bearing housing bore 54 at the location of the split between the cap 56 and the fork 58 , as best illustrated in fig9 . the other two keyways which are not illustrated herein are located on the opposite side of the bearing housing bore 54 from the keyways 78 and 80 . also machined into the bearing housing bore 54 in the cap 56 is a bearing pin lock aperture 82 , which is illustrated in fig9 . an oil passage 84 , which is also illustrated in fig9 is machined into the wrist pin bore 52 . following the assembly of the cap 56 to the fork 58 of the improved high performance aluminum connecting rod 50 using the rod bolts 74 and 76 , the bearing housing bore 54 is then rough bored , finish bored , and honed to the proper size . on the pin end of the improved high performance aluminum connecting rod 50 , the wrist pin bore 52 is bored and honed to the proper size . this completes the manufacture of the improved high performance aluminum connecting rod 50 of the present invention . it may therefore be appreciated from the above detailed description of the preferred embodiment of the present invention that it teaches an improved high performance aluminum connecting rod made of an improved material capable of withstanding the high compressive loads of current drag racing engine technology . the material used by the improved high performance aluminum connecting rod of the present invention has lightweight construction which is comparable to presently known high performance aluminum materials such as 7075 - t6 , while possessing substantially enhanced compression yield strength characteristics as compared to such presently known materials . in addition , this improved material also retains or enhances all of the other favorable material characteristics of such presently known materials . the improved high performance aluminum connecting rod of the present invention is readily susceptible of manufacture by conventional forging techniques , with the forged part being readily machinable to the required finished dimensions . the high performance characteristics of the aluminum material used to make the improved high performance aluminum connecting rod of the present invention are not adversely affected in either the forging or machining operations . most importantly , the improved high performance aluminum connecting rod of the present invention has sufficiently improved compression yield strength so as to hold both its dimensional length and the dimensional roundness of the wrist pin bore and the bearing housing bore . the improved high performance aluminum connecting rod of the present invention is of a construction which is both durable and long lasting , and which will remain within dimensional specifications throughout an extended operating lifetime . the improved high performance aluminum connecting rod of the present invention is also of relatively inexpensive construction to enhance its market appeal and to thereby afford it the broadest possible market . finally , all of the aforesaid advantages and objectives of the improved high performance aluminum connecting rod of the present invention are achieved without incurring any substantial relative disadvantage . although an exemplary embodiment of the improved high performance aluminum connecting rod of the present invention has been shown and described with reference to particular embodiments and applications thereof , it will be apparent to those having ordinary skill in the art that a number of changes , modifications , or alterations to the invention as described herein may be made , none of which depart from the spirit or scope of the present invention . all such changes , modifications , and alterations should therefore be seen as being within the scope of the present invention . | 8 |
an embodiment of information output unit according to the invention is shown in fig2 a and 2b in perspective view and in top view respectively . designated by 11 is a light source comprising a plurality of semiconductor laser groups 11a , 11b , 11c , . . . which are driven independently of each other and united together to form a single chip element . information from the output means of a driving system 14 is put into these semiconductor lasers in the order of 11a , 11b , 11c , . . . so that they are lighted up successively . light emitted from each of the semiconductor lasers 11a , 11b , 11c , . . . is collimated through a collimator lens 12 . when they emerge from the collimator lens 12 , the lights from the different semiconductor lasers have different exit angles with respect to each other . beam diameter and angle magnification of light emitted from the collimator lens are converted by an afocal converter 13 into those which are most suitable for the system then used . fig3 a and 3b illustrate the beam entering and emerging from the afocal converter 13 . generally , incident beam diameter hi , exit beam diameter h o , incident angle θi and exit angle θ o have the following relation : ## equ1 ## this value of r is called &# 34 ; angle magnification &# 34 ;. for very small values of θ o and θi or for a system particularly designed for this purpose , the following approximation holds : ## equ2 ## by suitably selecting the value of r in view of the system used , there can be obtained a scanning system as hereinafter described . returning again to fig2 b , the light which emerges from the afocal converter 13 is deflected by a deflector 15 ( shifting means ) which may be , for example , a galvano mirror or a polygon mirror , and is then imaged on a recording surface 17 through an imaging lens 16 . here , the light source 11a , 11b , 11c and the associated beam of light travelling up to the recording surface 17 constitute an information recording means . the imaging lens 16 is of the type known as an f - θ lens wherein the incident angle and the imaging position are in a linear relation . the unidimensional deflection of the beam by means of the deflector 15 and the unidirectional ( in the direction of arrow 17a in fig2 a ) feeding of the recording surface 17 by means of feeding means 17b enable the recording of a picture image two - dimensionally . to carry out the two - dimensional recording , the recording surface 17 may be advanced stepwise in the direction of arrow 17a after every linear area of a picture corresponding to one scanning line has been recorded on the surface 17 in the direction perpendicular to the arrow 17a , that is , in the direction across the surface 17 as a result of deflection by the deflector 15 . alternatively , the recording surface 17 may be formed as a cylindrical surface as that of a recording drum 26 shown in fig1 . to carry out two - dimensional a recording with such recording drum which is rotated by feeding means 17b , deflection by the deflector 15 is effected in such a manner that for every one revolution of feeding means 17b there may take place a deflection by l elements corresponding to the amount of shift which occurs for every clock pulse as will be described in detail later . let f 1 denote the focal length of the collimator lens 12 and d the center distance between every two light surfaces of m semi - conductor lasers . then , since usually d & lt ; f 1 , one beam of light emerging from the collimator lens 12 and the next beam of light are different in exit angle from each other by the amount of ## equ3 ## for the beam of light after passing through the afocal converter 13 the angle manification of which is r , the following equation is given : ## equ4 ## assuming that the deflector 15 such as a galvano mirror be still in its position , every spot formed by images of the neighbouring semiconductor laser light sources through the imaging lens 16 will be spaced from one another owing to the f - θ characteristics of the imaging lens , by the amount of : ## equ5 ## wherein f 2 is the focal length of the imaging lens . let ω denote the angular velocity of deflection of the beam of light by the deflection system . then each spot will be moved by the following distance during time . increment . t : here , assuming that there is a clock pulse one cycle of which is δt , it is defined that δs stands for the size of one picture element when the distance moved by every spot for time δt is δs . in addition , it is assumed that the distance δd between spots on the recording surface be a whole number (≡ n , n is a whole number ) times larger than . increment . s , namely it is assumed this assumption may be realized by suitably setting the clock pulse interval δt or the angle magnification r of the afocal converter 13 . in this manner , when information of one line of a picture is introduced in the unit in time series there is obtained a regularity with respect to the distribution of signals to m semiconductor laser light sources , the sequence of lighting of light sources , the time intervals of illumination etc . therefore , as a whole , the speed of recording may be increased m times by distributing the picture information among m number of light sources and / or making full use of vacant time provided that each light source should be operated with the same duty as that for the conventional case . now , the general rule of regularity of lighting according to the invention and the usability of the invention will be described in detail showing simple concrete examples thereof . for the purpose of explanation , the following definitions are given : the number of semiconductor laser light sources is m , the spacing between two neighbouring spots is δd , the size of pel ( picture element ) c is δs , the ratio of the spot spacing to the size of pel is n element ( s ) ## equ6 ## the amount of shift for every one clock pulse ( of which explanation will be made later ) is l element ( s ) and the number of light sources to be lighted at the same time is θ . under the above given definitions , there may be considered the following cases : this is the case wherein the pitch of spot spacing on a recording or displaying surface using five semiconductor lasers is equal to the size of one pel δs . these five light sources ( more correctly images thereof ) are shifted rightward stepwise by one pel for every clock pulse and at the same time they light up one by one in a sequence as shown in fig4 a - 4c in which coordinate of space ( r ) is taken on the abscissa and coordinate of time ( t ) on the ordinate and in which a black dot stands for semiconductor laser which is energized at that time . for the purpose of explanation , these five semiconductor lasers are numbered as 1 , 2 , 3 , 4 and 5 from left to right on the drawing . it will be understood that all the picture elements can be recorded or displayed without any dropping and without any over - lapping of elements only when the five semiconductor lasers , 1 , 2 , 3 , 4 and 5 are energized to light up in the following sequence ( lighting sequence ): cases wherein all the picture elements can be recorded without any dropping and without any overlapping are limited only to the above three cases . on fig4 a , 4b and 4c ( also on fig7 , 11 and 13 ), s is an enlarged scanning line . black dots standing for light sources in the state of on are also shown on the scanning line s in the corresponding portions for assisting in understanding of the lighting sequence . an example of an electric circuit adapted for realizing the above described sequence of lighting of light sources is shown in fig5 . one line of information to be recorded or displayed is put into the circuit in time series and the circuit distributes the information to the semiconductor laser elements and determines the sequence of lighting thereof . the electric circuit shown in fig5 is designed for realizing the lighting sequence illustrated in fig4 a , that is , the case wherein five semiconductor laser elements are energized to light up in the order of 1 - 2 - 3 - 4 - 5 . the circuit receives information of serial picture elements in an amount of one line of the picture at its input ( b ). the information received by the circuit corresponds to that designated by 0 or 1 in fig6 b . this information is delivered to 5 - bit shift register 18 in time series and in synchronism with a clock pulse ( fig6 a ) introduced into the circuit from the input ( a ). each information corresponding to each picture element is shifted successively with every clock pulse and is processed as a serial data in the order of 1a , 2a , 3a , 4a , 5a , 1b , 2b , 3b , 4b , 5b , 1c - - - in time series . outputs a , b , c , d and e of the 5 - bit shift register 13 put out data of picture elements as shown in fig6 c , 6d , 6e , 6f and 6g respectively . in a similar manner , from output k , l and m of modulo - 5 counter 19 there are put out the outputs of wave forms of fig6 h , 6i and 6j respectively . furthermore , signals of outputs n , o , p , q and r of bcd decimal decoder 20 are introduced into inverters 21a - 21e which then put out the wave forms of fig6 k , 6l , 6m , 6n and 6o respectively . outputs a , b , c , d , e from the 5 - bit shift register 18 and outputs from inverters 21a - 21e are combined together respectively and their logical products are obtained at and - gates 22a - 22e . thus , in accordance of the lighting sequence of 1 - 2 - 3 - 4 - 5 , information of each picture element can be put out continuously into the output line group 22 - 1 through 22 - 5 in the sequence of 1a - 3a - 5a - 2b - 4b - - - ( which are driving signals of the output part formed by rearranging the original time series sequence .). in the same manner and by changing the wiring sequence of the 5 - bit shift register 18 , the lighting sequence of fig4 b and that of fig4 c can be easily realized ( for 4b there is formed 1a - 5a - 4a - 3b - 2b - - - and for 4c formed 1a - 4a - 2b - 5a - 3b - - - in the same manner as described for 4a ). the following is the case wherein the pitch of spot spacing on a recording or displaying surface is two times larger than the size of pel δs . in this case , as seen from fig7 a - 7c , possible lighting sequences in which all of the picture elements can be covered without any overlapping are limited to only three cases given below : by way of example , the lighting sequence of fig7 a is considered . in order to energize the five semiconductor lasers in the sequence of 1 - 2 - 3 - 4 - 5 , it is necessary to put information out as time series pel signals in the sequence of 1a - 4a - 2b - 5b - 3c - - - ( similarly , for 7b 1a - 3b - 5a - 2c - 4b - - - and for 7c 1a - 5b - 4b - 3b - 2b - - -). fig8 shows an electric circuit used for realizing this lighting sequence . the circuit shown in fig8 is essentially the same as that shown in fig5 except that 5 - bit shift register 18 is replaced by a 10 - bit shift register 18a . the lighting sequences of fig7 b and 7c can be realized in a similar manner . in the above described cases ( i ) and ( ii ), only one light source is energized to light on at one time ( θ = 1 ). but , there may be considered other cases wherein two or more light sources are lighted up at the same time as mentioned hereinafter . this is the case wherein two light sources are energized at the same time as shown in fig9 and image of each light source is shifted by two picture elements with every clock pulse . since a shift of two picture elements is done for every clock pulse and two light sources are energized at the same time , the speed of recording is doubled without any change of load on the light sources . in order to advance the image of each light source by two picture elements with every clock pulse , a circuit as shown in fig1 which includes a 4 - bit shift register 18b , binary counter 19 etc . may be used . the frequency of clock pulses used in the circuit is doubled so that the light image is advanced by one picture element with every one clock and the light source is energized to light up with every two clocks . lighting sequence necessary for this case is illustrated in fig1 . the lighting sequence may be realized by a circuit including four gates and a decimal counter ( not shown ). ( v ) generalization with n = n and by a general formula ( m , n , l , θ ); as a general case , it is considered that on a recording surface there are arranged regularly m light sources with a pitch of spacing n times larger than the size of a picture element and that the light sources are driven in such a manner that with every one clock pulse they are shifted by l picture element ( s ) and θ of the light sources is ( or are ) energized to light up at the same time for every one clock pulse . conditions necessary for recording all of the picture elements without any dropping and without any overlapping are : ( b ) m / θ is a natural number , ( m / θ , i ) are prime to each other wherein i is a natural number satisfying the condition i ≦ m / θ and for this natural number i ( mn / θ , ni + l ) are prime to each other . when such natural numbers ( m , n , l , θ , i ) satisfying the above conditions are found out , m light sources should be energized to light up in the following sequence : 1 , m / θ + 1 , 2m / θ + 1 - - - ( but , km / θ + 1 & lt ; m wherein k is a natural number ) light up at first and then light up the above conditions will be understood more clearly from the following description . assuming that the image of each light source is shifted by l picture elements with every one clock pulse and θ pieces of pel information are issued for every one clock pulse , the number of pel information issued after c pulses will become θc . during the time , the image of light source has moved a distance of lc . if l & gt ; θ , then lc & gt ; θc , which means that there occurred some vacancy . therefore , the condition l = θ is absolutely necessary . secondly , the condition necessary for recording all of the picture elements without any overlapping is considered . among m light sources there must be energized θ light source ( s ) to light up at the same time . therefore , these light sources can be devided into θ groups . the number of light sources per group is m / θ which must be a natural number . lighting of the light sources must be made successively and without overlapping in the sequence of the first one , i + 1 th one , 2i + 1 th one , - - - ni + 1 - - -, until all of m / θ light sources have lighted up . in order to satisfy the condition , i and m / θ must be prime to each other . namely , it is only when i and m / θ are prime to each other that using m / θ as a divisor the sum of 1 and i can be distributed to m / θ without any overlapping . fig1 shows the lighting sequence for the case wherein m light sources are regularly arranged with a pitch of n . the total length of light source corresponds to m n picture elements . therefore , the number of picture elements covered by one single group is m n / θ . it is required to avoid overlapping among all of the picture elements contained in this area . the distance moved by each light source within one group with every one clock is ni + l in picture element unit . lighting of light source is advanced in the sequence of 1 , i + 1 , 2i + 1 , - - - ni + 1 . if the sequence number of lighting exceeded the number of light sources contained in one group , that is , the number m / θ , then it must be considered that lighting of light source went along into the next group because of the above described condition that ( m / θ , i ) are prime to each other . thus , in order to cover all the picture elements without overlapping , it is required that no overlapping exists among multiples of ni + l using mn / θ as a divisor . therefore , the condition that in the combination ( mn / θ , ni + l ), the two numbers mn / θ and ni + l should be prime to each other , is absolutely necessary . like the condition of ( m / θ , i ), the above condition of ( mn / θ , ni + l ) can be demonstrated as follows : numerical values produced by multiples of ni + l with mn / θ as a divisor are generally represented by : in the above equation , values which γ may to be are : here , it should be noted that ( mn / θ - 1 ) is the possible maximum value which γ may take . assume that ni + l and mn / θ were not prime to each other , and let p denote a common factor . then , ## equ7 ## here , values which the residue γ is allowed to be are : ## equ8 ## note should be taken to the fact that the possible maximum value which the residue γ can take is only ## equ9 ## which is smaller than mn / θ . therefore , under this assumption it is impossible to cover all of mn / θ . now , it is concluded that mn / θ and ni + l should be prime to each other . since l = θ = 1 and m / θ = 5 , i = 1 , 2 , 3 , 4 . ## equ10 ## the condition that mn / θ and ni + l should be prime to each other can be satisfied only when i = 1 , 2 , 3 . this corresponds to the above mentioned case ( i ) wherein m = 5 , n = 1 , l = 1 and θ = 1 . in this case , ## equ11 ## therefore , the necessary condition is satisfied only when i = 1 , 3 , 4 . this corresponds to the above mentioned case ( ii ) wherein m = 5 , n = 2 , l = 1 and θ = 1 . in this case , m / θ = 1 , ∴ i = 1 only , ( mn / θ , ni + l )=( 3 , 5 ), which are prime to each other and therefore satisfy the necessary condition . the sequence of lighting is the simultaneous lighting of 1 and 2 . this corresponds to the above mentioned case ( iii ) wherein m = 2 , n = 3 , l = 2 , θ = 2 . ## equ12 ## which are prime to each other . the lighting sequence becomes ( 1 , 3 )-( 2 , 4 ). this corresponds to the above mentioned case ( iv ) wherein m = 4 , n = 3 , l = 2 and θ = 2 . ## equ13 ## the necessary condition is satisified only when i = 2 , 3 , 4 . fig1 a through d illustrate this example in which ( m , n , l , θ )=( 10 , 3 , 2 , 2 ), fig1 a being for i = 1 , fig1 b for i = 2 , fig1 c for i = 3 and fig1 d for i = 4 . from these figures it is seen that when i = 1 there occur evidently some overlaps ( see mark . in fig1 a ) and that there is no overlap when i = 2 , 3 , 4 . in fig1 b - 13d , the portions extending rightward from α can be used for scanning , respectively . the information output unit according to the invention are applicable not only to scanning in a principal scanning direction ( constant direction ) but also to scanning in a secondary direction ( in the direction across the principal direction ). therefore , a further speed - up is attainable by doing so . for example , as shown in fig1 , light sources 11d - 11i may be arranged two - dimensionally . arrow 23a indicates the principal scanning direction and arrow 24a indicates the secondary scanning direction . when the light sources are lightened up one by one or two or more at the same time in the principal direction and all of the light sources are together driven in the secondary scanning direction in timing with the lighting of light sources in the principal direction , then scanning speed may be increase to an extent corresponding to the number of light sources . as to the example of fig1 , when ( m , n , l , θ )=( 3 , 2 , 1 , 1 ) and i = 2 , only ( mn / θ , ni + l )=( 3 , 5 ) becomes effective in the principal scanning direction and the light sources become light in the sequence of 1 , 3 , 2 - - -. in the secondary scanning direction , when ( m , n , l , θ )=( 2 , 3 , 2 , 2 ) and i = 1 , ( mn / θ , ni + l )=( 3 , 4 ) - - - become prime to each other . therefore , recording may be carried out in such manner that information shifted by three lines in the secondary direction is recorded by principal scanning at first , the light sources are advanced by two lines in the secondary direction after recording one line and then again scanning is carried out in the principal direction . by employing this mode of recording , it is allowed to use and arrange such light sources the size of which is larger than the pitch of picture element . moreover , the information output unit according to the invention is applicable to all types of apparatus in which recording is effected with scanning . thus , for a recording method using light , information recording means may be formed by combining plurality of light sources driven independently of each other . for a thermal recording method , a combination of thermal head and heating wire may be used as information recording means according to the invention . for a recording method using electric current , a combination of stylus electrode and electric current path may be used as information recording means . also , for a recording method using a spray of liquid droplets , the inject head and droplets may be combined to form information recording means according to the invention . while scanning these information means with suitable shifting means which may be deflection of light , mechanical feeding etc ., picture elements can be recorded on a recording medium according to the invention previously described in detail . fig1 illustrates one example of application form of the invention . designated by 25 is a stylus electrode which is driven in the principal scanning direction indicated by arrow 23b at a uniform speed using a suitable driving means such as linear motor . during the stylus electrodes 25 being driven in the principal scanning direction , a rotary recording drum 26 is rotated by a motor 26 in the secondary scanning direction of arrow 24a nearly perpendicular to the principal scanning direction so as to effect recording . regular arrangement of semiconductor laser , l e d or other light sources in rows may be done very easily employing conventional techniques . assuming that when one single light source is used , it takes t seconds for recording , the time necessary for recording will be reduced to t / m seconds by arranging m light sources driven independently of each other with a constant spacing in the scanning direction according to the invention . this remarkable speed - up is attainable without adding load on the light sources , that is , without changing the above mentioned duty of operation . one particular advantage of the information output unit according to the invention is found in that it is also applicable to such case where the distance between the neighbouring light source images on the recording surface is relatively large as compared with the pitch of picture elements . owing to this advantage , the arrangement of plurality of light sources ( or electrodes ) becomes easy and accuracy can be improved . furthermore , it has an advantageous effect on dissipation of heat generated from the used light sources , crosstalk of electric charge or the like . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details can be made therein without departing from the spirit and scope of the invention . | 6 |
fig1 shows an overview of how an illustrative modular personal network ( mpn ) may be used . the mpn is associated with a user 1 . the mpn may include multiple individual network components ( incs ), each of which may have one or more primary functions . each inc may include a wireless transceiver for communicating with other incs in the mpn . the wireless network may be associated with user 1 , for example , within a few meters of the user . each inc may be worn or carried by user 1 , or otherwise in the user &# 39 ; s immediate vicinity . for example , inc 2 , which may be worn on the user &# 39 ; s waist , may be a control unit that includes a processor and memory , to store and run software to control other incs in the mpn . inc 3 , which may be worn on the user &# 39 ; s hand or wrist , may be a display device . if desired , a variety of mountings may be provided to allow the display to be seen optimally in variety of circumstances , such as mounting on the side of the hand or wrist . if desired , a reusable mount may allow a display or other inc to be easily repositioned , reoriented , and replaced . inc 4 , which may be a headset or may be worn in a headband or hat , may be an audio output device . one or more speakers may be worn in the ear , or may be worn against the skin near the ear . the audio output device may support output of tones , music , or voice . audio cues of various types may be generated . if desired , the audio output device may provide multiple types of audio output . one output may be paused or muted while the other is provided . incs 5 , 7 , and 7 may be user input devices . any suitable type of user input may be provided , such as voice input , buttons , a portable keyboard , or a stylus . as shown , pressure sensors are worn in the fingertips of a glove , and are operated by tapping with the fingers . different commands may be indicated by tapping with different fingers or in different sequences . if desired , such pressure sensors may be worn on the hand , at the waist , on the foot , or in any other suitable manner . inc 8 may provide another function for the user , such as an input function , an output function , a storage function , or a control function . as many or as few incs may be included in the mpn as desired . if desired , one or more incs may be removed from the mpn to remove functions , and one or more incs , such as inc 9 , may be added to add other functions . the changed configuration may be determined dynamically or the changes may be indicated by the user . second user 10 may have a second mpn . for example , second user 10 may be riding a bicycle . inc 11 may be mounted on the handlebars of the bicycle and may include display functions , user input functions , and control unit functions . inc 12 may be an audio output device , mounted on second user 10 &# 39 ; s helmet . inc 13 may be a sensor mounted on the bicycle to measure its speed . when second user 10 comes into range of first user 1 &# 39 ; s mpn , there is no interference . each inc in either mpn is programmed with a network identifier that is common to all incs in the mpn but unique among different mpns . each message sent from one inc in an mpn to another inc in the same mpn may be tagged with the common network identifier or with a unique component identifier of the target inc , so that no unintended incs process the message . in addition , the network identifier may be stored in secure memory in each inc , so that the inc cannot be used in a different mpn without explicit authorization from the user who programmed the network identifier . the mpn may interface with a more stationary device , such as base station 15 or personal computer 16 . base station 15 may act as part of the mpn when the mpn is within range . base station 15 may include a wireless communication device to communicate with one or more of the incs in the mpn . alternatively , base station 15 may communicate with one of the incs using another means , such as a serial cable , usb , a docking station , infrared , or other connection . personal computer 16 may communicate with base station 15 . alternatively , personal computer 16 may communicate directly with one or more incs , acting as a base station . personal computer 16 or base station 15 may download software , data , settings , and other information to one or more incs . for example , software may be downloaded to control one or more incs , or to implement one or more features . as unanticipated incs are added to the mpn , new software modules may be downloaded to control and interface with them , and an application on personal computer 16 may be used to configure settings related to the new incs . personal computer 16 and base station 15 may be used to program the common network identifier into each inc in the mpn . data may be uploaded from one or more incs to personal computer 16 to be stored , displayed , or analyzed . if desired , personal computer 16 may communicate with another computer 18 over a wide area network 17 , such as the internet . software , data , settings , and other information may be sent from computer 18 to personal computer 16 for use with the mpn , and data from the mpn may be sent from personal computer 16 to computer 18 . an mpn may be used for one or more purposes . for example , the mpn may support a global turn on or turn off feature , in which all active devices may be disabled or re - enabled with a single command to a single inc . the mpn may provide clock functions 20 , such as providing the current time and date , supporting multiple time zones , providing stopwatch features , and synchronizing other features of the mpn . the mpn may provide communication functions 25 , such as communicating with another mpn to support games , competitions , and other types of data transfers , telephone features , paging features , instant messaging , and electronic mail . the mpn may provide entertainment functions 30 , such as playing music , recording audio and video media , and games . the mpn may provide personal organization functions 35 , such as scheduling appointments , managing contacts , tracking tasks , and maintaining a mobile electronic journal . the mpn may support guidance functions 40 , such as showing current position , speed , and elevation , providing route guidance , collecting and annotating position and speed data , and recommending an athletic training route . the mpn may support athletic functions 45 , such as supporting a workout plan , supporting workout definition , controlling a workout , communicating with exercise equipment , collecting athletic data , detecting and correcting errors in collected data , estimating secondary data based on collected data , providing competition between users of multiple mpns , logging lap swim workouts , providing form feedback , and providing an athletic training journal . the mpn may support physical therapy and medical functions 50 , such as measuring range of motion , gait analysis , measuring muscle strength , measuring changes in physical therapy , monitoring a metabolic value , detecting a medical problem , controlling a treatment device , providing emergency communication , storing medical databases , providing an electronic medical journal , and supporting incs that may be injected , ingested , or implanted . the mpn may provide disabled access 55 , such as alternate input devices , alternate output devices , and alternate inc mounting means . the mpn may support travel functions 60 , such as language translation , currency conversion , time zone conversion , route guidance , local information , guidebook features , wildlife recognition , a mobile electronic travel journal , weather information , local transit and entertainment schedules , and expense tracking the mpn may support outdoor functions 65 , such as compass direction , geographical location , route guidance , elevation reporting , and weather features . the mpn may support identity functions 70 , such as identifying a user to another user or another system , providing exchange of money , providing product discounts , and providing product purchasing . the mpn may support personal security functions 75 , such as an audible alert , an alert message to a public safety facility , and storage of emergency information . the mpn may support military functions 80 , such as communications , geographical position , route guidance , and weather features . the mpn may support combinations of functions , and its functions may vary over time as incs are added or removed , as different software or data is downloaded , or as the user &# 39 ; s needs change . fig1 a shows a block diagram of illustrative mpn 100 a . this mpn includes incs 110 a , 110 b , 110 c , and 110 / d . each inc includes communication device 120 , for communicating with other incs over wireless communication path 140 . communication device 120 may be , for example , a standard radio frequency wireless transceiver with a range appropriate for a personal network ( e . g ., between six feet and sixty feet ). communication device 120 may also include hardware and software implementing a standard wireless protocol , such as bluetooth or ieee 802 . 15 . an antenna may be included . if desired , transmitter and receiver may be separate devices . not shown in each inc is a power source . each inc also includes one or more other functions 130 - 137 . these other functions may be provided by hardware and / or software incorporated into the inc . the software may be firmware provided with the inc , or it may be downloaded into the inc over communication path 140 or using other means . fig1 b shows how mpn 100 a may be modified to become mpn 100 b . in the modified mpn , inc 110 c has been removed , and inc 110 e has been added . correspondingly , other function 135 associated with inc 110 c is no longer available , and other functions 138 and 139 associated with inc 110 e are now available . different manufacturers may manufacture incs . each manufacturer may be assigned a unique manufacturer identifier , as shown in table 210 of fig2 a . each manufacturer may provide various types of incs , each of which may be assigned a model identifier by the manufacturer , as shown in table 220 of fig2 b . the model identifier may be unique for a specific manufacturer . there may also be defined a set of device types , as shown in table 230 of fig2 c . the device type identifiers may be standard across all manufacturers and models . for example , model 3 by manufacturer 2 may have the same device type as model 7 by manufacturer 12 . device types may be divided into a range for input devices 234 and a range for output devices 232 . it may also have ranges 236 and 238 for manufacturers to use when a standard device type has not yet been assigned . an inc may have multiple device types , if it has multiple functions 130 - 139 ( fig1 ). for each device type , there may be a standard set of defined capabilities , which may or may not be supported by any specific inc with that device type . for example , as shown in table 240 of fig2 d , device type 257 , which may be an audio output inc , may have three standard capabilities , any of which may or may not be supported by any particular audio output inc . capability 242 may be the ability to output stereo audio . capability 244 may be the ability to control the output volume of the audio . capability 246 may specify the number of volume increments supported by a particular inc . these capabilities are merely illustrative . the manufacturer identifier , model identifier , one or more device types , and any supported device capabilities and values may be stored in read - only memory in the inc , and provided over communication path 140 ( fig1 ), to allow the inc to be identified by another inc . fig3 a through 3j illustrate an exemplary communications protocol that may be used between incs in an mpn . the protocol may include a defined set of messages that may be sent from one inc to another . this message protocol may be encapsulated in one or more lower - level protocols , such as bluetooth or ieee 801 . 15 . if desired , this protocol may function on different lower - level protocols in different environments . as shown in fig3 a , each message may include message type 301 and error detection / correction fields 302 . message type 301 may indicate to the receiving inc how to process the message . error detection / correction may include parity , checksums , cyclic redundance checks ( crcs ), or other mechanisms for detecting that a received message has one or more errors , and possibly correcting the error ( s ). identity request message 300 of fig3 a may be sent by an inc ( such as a control unit or base station ) wishing to determine the identity and characteristics of one or more other incs in the mpn . for example , this message may be broadcast and all other incs in the mpn may respond . identity request message 300 may include a unique network identifier 303 common to all incs in the mpn . it may include a network address 304 of the inc sending the request . each inc in the mpn may have a network address that is unique among all incs in the mpn . identity request message 300 may also include controller identifier 305 . this may be an identifier that is unique across all incs , and it may correspond to the control unit , base station , or other inc that is sending the message . component identity message 310 of fig3 b may be sent by an inc in response to identity request message 300 . it may include network identifier 311 of the inc sending the message . network identifier 311 may be the same as the network identifier 303 in the requesting message , if both incs are part of the same mpn . it may be blank if this inc has not yet been assigned to an mpn . it may be different if this inc belongs to a different mpn . if this inc has been assigned to an mpn , component identity message 310 may also include network address 312 . component identity message 310 may also include information about the type of inc and its capabilities that may be stored in read - only memory in the inc . for example , the message may include component identifier 313 , which may be the identifier for this inc that is unique across all incs . the message may also include manufacturer identifier 314 , model identifier 315 , one or more device types 316 , and capability list 317 . net address assignment message 320 of fig3 c may be sent by a control unit , base station , or other inc to configure a newly detected inc to function within the mpn . it may include controller identifier 305 . it may include the new network identifier 321 and network address 322 to be programmed into the inc . it may include component identifier 313 to ensure that the correct inc processes the message . it may also include security code 323 to ensure that unauthorized personnel do not change the network identifier and network address . on processing net address assignment message 320 , the inc may respond with network acknowledgement message 330 of fig3 d . this message may repeat component identifier 313 , network identifier 321 , and network address 322 , to inform the controller that the operation was successful . alternatively , the message may include a field indicating success or failure of the operation , and the reason for failure if it was not successful . output data request message 340 of fig3 e may be sent to an inc that is capable of outputting . it may include the network identifier 321 and network address 322 of the inc that is to perform the output function . the message may include request serial number 341 . this number may be used by the requesting inc and the outputting inc to keep track of multiple pending requests . output data request message 340 may include device type 316 and capability type 317 to inform an inc that supports multiple output functions how to process the data . output data request message 340 may also include the data to output 342 . the format of this data may depend on the type of inc receiving the data and how it is to be processed . after processing output data request message 340 , the output inc may respond with output acknowledgement message 350 of fig3 f . this message may include network identifier 321 , network address 322 , and request serial number 341 to allow the controller to determine which request this acknowledgement corresponds to . it may also include acknowledgement code 351 , which may indicate whether the request was processed correctly , and if not successful may include a reason for the failure . input data request message 360 of fig3 g may be sent to an inc that is capable of inputting . it may include the network identifier 321 and network address 322 of the inc that is to perform the input function . the message may include request serial number 361 . this number may be used by the requesting inc and the inputting inc to keep track of multiple pending requests . input data request message 360 may include device type 316 and capability type 317 to inform an inc that supports multiple input functions how to process the data . after processing input data request message 360 , the input inc may respond with input acknowledgement message 370 of fig3 h . this message may include network identifier 321 , network address 322 , and request serial number 361 to allow the controller to determine which request this acknowledgement corresponds to . it may include acknowledgement code 371 , which may indicate whether the request was processed correctly , and if not successful may include a reason for the failure . it may also include the requested data 372 , formatted as appropriate for the device and data type . an inc may also send unsolicited data message 380 of fig3 . this message may be sent when the inc has acquired some data for which there may be an ongoing request , or when the inc has entered a state , such as an error condition , that needs to be reported to a control unit , base station , or other inc . this message may include the network identifier 321 and network address 322 of the inc . it may include device type 316 and capability type 317 to allow the receiving inc to know how to process the data . it may also include data 381 , formatted as appropriate for the device type and capability type . a control unit , base station , or other inc may periodically send out network poll message 390 of fig3 j . this message is sent to determine whether an inc is still present on the mpn . it may include network identifier 321 and network address 322 of the inc being polled . the polled inc may respond with component identity message 310 or other suitable message . the message types shown in fig3 a through 3j are merely illustrative . other types of messages may be defined and sent between incs in the mpn . for example , a command may be sent to turn on an inc or to turn off an inc . if desired , a command may be broadcast to all incs in an mpn , rather than addressed to a specific inc . table 400 of fig4 shows an illustrative data structure that may be maintained by a control unit , base station , or other inc to track incs on the mpn . if desired , multiple incs in the mpn may maintain such information . column 410 may hold the network address of each inc . column 420 may hold the component identifier of each inc . column 430 may hold the manufacturer identifier of the inc . column 440 may hold the model identifier of the inc . column 450 may hold the device type of each inc . multiple device types may be stored for a single inc if desired . column 460 may hold a list of capability types for each device type listed for each inc . column 460 may also hold specific values related to each capability type . column 470 may hold a flag indicating whether the inc is currently active . for example , if an inc has not recently responded to a network poll message 390 ( fig3 j ), flag 470 may be changed to indicate that the inc is no longer active . if an inc responds to an identity request message 300 ( fig3 a ), the inc may be added to table 400 if it is not already present , and flag 470 may be set indicating that the inc is active . table 400 is merely illustrative . other columns may be included . other data structures may be used . if desired , this information may be stored in multiple data structures . fig5 shows flow chart 500 of an illustrative process for providing an mpn . all steps are optional and may be performed in any suitable order . in step 510 , multiple incs may be provided . this may include substep 514 of providing wireless communications with each inc . it may also include substep 512 of providing at least one primary function for each inc . the primary function may correspond to other function 130 - 139 ( fig1 a and 1b ). if desired , an inc may include multiple primary functions . alternatively , an inc may include a primary function , a secondary function , etc . in step 520 , incs may be changed dynamically . this may include substep 522 in which an inc may be removed . it may also include substep 524 in which a new inc may be added . in step 530 , the change may be detected automatically , for example using messages 300 through 390 of the communications protocol of fig3 a through 3j . the system may alternatively allow a user to enter information about the change in step 535 . for example , a user may add or remove an entry for an inc from a configuration screen on a personal computer . in step 540 , the functions of the mpn may be adjusted to compensate for the change . in substep 542 , this may include removing a function from the mpn that may have been provided ( or partly provided ) by the removed inc . in substep 544 , this may also include adding a function to the mpn that may be at least partly supported by the new inc . fig6 a shows illustrative mpn 600 showing how software may be downloaded to control incs . mpn 600 may interface with personal computer 610 to control downloading and configuration functions . personal computer 610 may include control application 620 , which may be configured to control downloading to an mpn and configuring various aspects of mpn functions . control application 620 may support plug - ins for different types of incs . for example , plug - in a 622 may support downloading code to support inc a 650 . plug - in a 622 may support loading driver a 626 , for example from local storage such as a compact disk or over the internet , as well as downloading driver a 626 . it may also support configuring inc a 650 , as well as downloading data to and uploading data from inc a 650 . personal computer 610 may include communications device 612 for communicating with one of the incs , such as a control unit 630 , using communication path 670 . control unit 630 may include communications device 632 for communicating with personal computer 610 . communications device 612 , communications device 632 , and communication path 670 may be , for example : a docking station and connector ; a universal serial bus ( usb ) port ; infrared transmitters and receivers ; serial ports ; ethernet connectors ; radio frequency ( rf ) transceivers ; or any other suitable communications means . if desired , communications may be performed wirelessly , and communications device 632 may be the same as wireless communications device 636 used to communicate between control unit 630 and other incs . one of the incs may be a control unit 630 . control unit 630 may include processor 634 and memory 638 , as well as communications device 632 for communicating with personal computer 610 , and wireless communications device 636 for communicating with other incs over wireless communication path 675 . memory 638 may hold control software 640 which may include firmware , operating system , boot software , communication software , and the like . memory 638 may also hold downloaded driver a 626 for controlling inc a 650 . mpn 600 may also include inc a 650 . this component may include wireless communications device 652 for communicating with control unit 630 and other incs over wireless communication path 675 . inc a 650 may also include device hardware and firmware 654 for performing one or more primary functions of the inc . in operation , a user may run control application 620 on personal computer 610 . the user may load and run plug - in a 622 to configure mpn 600 to function with inc 650 . the user may load driver a 626 and download it to control unit 630 . control unit 630 may subsequently use downloaded driver a 626 to control the functions of inc a 650 . the user may also use plug - in a 622 to configure aspects of inc a 650 , to download data to the inc , to upload data that may have been collected by the inc , or to perform other functions related to inc a 650 . in fig6 b , inc b 660 has been added to mpn , creating new mpn configuration 605 . inc b 660 may include wireless communications device 662 for communicating with control unit 630 and other incs over wireless communication path 675 . it may also include device hardware and firmware 664 for performing one or more primary functions associated with inc b 660 . plug - in b 624 may be loaded into control application 620 on personal computer 610 , for controlling aspects of inc b 660 . driver b 628 may be loaded into personal computer 610 and downloaded into control unit 630 for subsequently controlling inc b 660 . although fig6 a and 6b show drivers being downloaded into a control unit , software may alternatively be downloaded into any of the incs , for example , if control unit 630 is not present . fig7 shows illustrative screen 700 of mpn 600 ( fig6 a ) that may be displayed by control application 620 and plug - in a 622 on personal computer 610 . menu bar 710 may allow the user to access various application functions , such as file functions , security functions , device functions , system functions , help functions , and the like . item 720 may display information about the inc , such as the name of the manufacturer , the model number , capabilities , and other suitable information . item 730 may display the version number of the device plug - in currently loaded on personal computer 610 . button 735 may allow the user to download the selected driver to control unit 630 or other inc . button 737 may allow the user to load a more recent driver from the internet . region 740 may allow the user to set various configuration parameters associated with the inc . for example , region 742 may allow the user to enter text for a first parameter . selection 745 may allow the user to select from a set of options for a second parameter . this screen is purely illustrative and may be configured and designed in any suitable manner . fig8 shows flow chart 800 of an illustrative process to allow an unanticipated inc to be added to the mpn . for example , after a user has several incs of an mpn , a new inc with a new capability may be manufactured . the user does not need to discard any existing incs ; they can continue to be used just as they have been . the unanticipated inc can be added to the mpn and the capabilities of the mpn will be expanded to encompass the capabilities of the new inc . all steps are optional and may be performed in any suitable order . in step 810 , the unanticipated inc may be added to the mpn . the system may detect the inc using an identity request message 300 ( fig3 a ). in step 820 , a software application may be run , for example on a personal computer , which controls downloading software objects to incs . in step 830 , that application may be used to download the specific software object to control the unanticipated inc . in step 840 , software may be downloaded to control the unanticipated inc . the software may be downloaded , for example , to a control unit . alternatively , the software may be downloaded to the unanticipated inc itself . in substep 842 , multiple software objects may be downloaded , one of which may control the unanticipated inc . other software objects may be used to control other incs , or to perform other mpn functions . in step 850 , a software extension , such as a plug - in , may be provided to the software application . in step 860 , the user may be allowed to configure the new inc and the downloaded software object , using the software application and the software extension . flow chart 900 of fig9 shows an illustrative process for downloading data to control an inc . all steps are optional and may be performed in any suitable order . in step 910 , software may be downloaded . in step 912 , data may be downloaded . in step 914 , setup options may be downloaded . in step 916 , the current time may be downloaded . if desired , other suitable types of data may be downloaded as well . in step 920 , data may be downloaded over a network , such as the internet . for example , software or other data may be downloaded from an internet site into a personal computer . in step 922 , data may be downloaded from a computer , such as a personal computer . in step 924 , data may be downloaded from a base station . a base station may be a stationary device that communicates with one or more incs . the base station may be independent , or it may be connected to a personal computer . in step 930 , the data may be downloaded into the inc to be controlled . in step 932 , the data may be downloaded into a control unit . the control unit may be an inc configured with a processor and memory to control aspects of other incs in the mpn . the control unit may send information or commands to the inc in step 934 . in step 940 , the downloaded data may be used to modify one or more functions of the inc . software and other data may also be downloaded , for example into a control unit , to coordinate the functions of multiple incs . fig1 shows how two mpns 1000 and 1050 may interact . first mpn 1000 may include audio output inc 1010 , display inc 1012 , control unit 1014 , and accelerometer 1016 . second mpn 1050 may include display 1060 , heart rate sensor 1062 , and control unit 1064 . any of the incs of either mpn may send a message intended for one or more incs of the same mpn . the incs of the other mpn may need to ignore the message . for example , control unit 1014 may send data to display 1012 to be displayed . display 1060 will ignore the message , because it did not originate within second mpn 1050 . similarly , heart rate monitor 1062 may send heart rate data to control unit 1064 for processing . control unit 1014 will ignore the data , as it did not originate within first mpn 1000 . the configuration of these two mpns is merely illustrative , and all incs are optional . fig1 shows illustrative partial mpn 1100 , illustrating how an inc 1130 may be programmed with a common network identifier using a base station 1110 . base station 1110 may be a personal computer , a card installed in a personal computer , a docking station connected to a personal computer over a connection such as usb , a standalone device , or any other suitable configuration . base station 1110 may include memory 1120 , which may be random access memory , a hard disk , or other suitable memory . base station 1110 may also include communications device 1112 , which may be a wireless communications device similar to the communications device in each of the other incs , or may be any other wired or wireless connection . memory 1120 may be used to hold a common network identifier to be used within all incs of a single mpn . it may also be used to hold information about the various incs that have been configured using base station 1110 . inc 1130 may be a new inc , which has not yet been assigned a network identifier . alternatively , it may already have been assigned a network identifier , which may be stored in secure memory 1140 . secure memory 1140 may be memory that can only be read or written by inc 1130 , and cannot be accessed without a security code . a user of base station 1110 may indicate that inc 1130 is to be programmed with the base station &# 39 ; s network identifier . the user may make this indication by , for example , bringing inc 1130 into proximity of base station 1110 , making a physical connection between base station 1110 and inc 1130 , pressing a button on base station 1110 , making a menu selection on base station 1110 ( for example , if base station 1110 is a personal computer or is connected to a personal computer ), or by taking other suitable actions . the user may also be required to enter a personal code , or to invoke other security measures to ensure his or her proper identity . base station 1110 may then send a message to inc 1130 with the new common network identifier and the proper security code . if inc 1130 is a new inc , it may store the security code and the network identifier in secure memory 1140 . if it has previously been programmed with a network identifier , it may compare its stored security code with the security code it just received , and if they match may store the new network identifier . if desired , inc 1130 may also incorporate an algorithm to prevent a large number of consecutive attempts at changing the network identifier . for example , if inc 1130 receives more than three unsuccessful attempts to change the network identifier within a ten - minute period , it may lock out any further attempts for the next thirty minutes . using this configuration a user may assign any new inc into his or her mpn . a user may also move an inc from one mpn to another , but only with the authorization of the original owner of the inc . fig1 shows illustrative screen 1200 that may be shown by base station 1110 ( fig1 ) or personal computer to allow an inc 1130 to be personalized with the user &# 39 ; s network identifier . the user may be allowed to enter a security code in screen region 1210 . when the security code has been verified , and the security code and network identifier have been successfully sent to the inc 1130 , the system may display overlay 1220 . fig1 shows illustrative screen 1300 that may be shown by base station 1110 ( fig1 ) or personal computer to allow inc 1130 to be programmed with a different network identifier when it already has a network identifier stored in secure memory 1140 . the user may be prompted for a security code in screen region 1310 , as well as the old security code used to program inc 1130 with the previous network identifier in region 1320 . when the security codes have been verified , and the security code and network identifier have been successfully sent to the inc 1130 , the system may display overlay 1330 . these screens are purely illustrative and may be configured and designed in any suitable manner . fig1 shows flow chart 1400 of an illustrative process to use a common network identifier among incs in an mpn . all steps are optional and may be performed in any suitable order . in step 1410 , each inc may be programmed with a common network identifier . this may be done with a base station , personal computer , or other device . the programming may use appropriate security to ensure that an unauthorized user cannot reprogram the network identifier in any inc . in step 1420 , any messages sent from a first inc in the mpn to a second inc in the same mpn may contain the network identifier stored within the first inc . the second inc , on receiving the message , may compare the network identifier within the message to the network identifier stored in the secure memory in the second inc . if the two identifiers are different , the message may be ignored . if the two identifiers are the same , the second inc may assume that the message originated from an inc within the same mpn , and may process the message if appropriate . in step 1430 , an inc may be moved from one mpn to another . this may involve changing the network identifier stored in the inc to a new value . to do this may require explicit authorization from a user , in substep 1432 . it may also require the entry of a password or code or another security measure to ensure that the user is authorized to make the change , in substep 1434 . fig1 shows extended mpn 1500 . this block diagram shows how an mpn may interface with other systems . mpn 1500 may include control unit 1510 . the use of control unit 1510 is merely illustrative . any other suitable inc may be used . control unit 1510 may include wireless communications device 1512 for communicating over wireless communications paths 1546 and 1547 with other incs within the mpn . control unit 1510 may also include one or more other functions 1514 , which may include a processor and memory for controlling other incs in the mpn . mpn 1500 may also include incs 1520 and 1530 . these incs may include wireless communications devices 1522 and 1532 , respectively . each may include one or more other functions 1524 and 1534 , respectively . control unit 1510 , and other incs , may communicate over communication path 1545 with base station 1540 . as shown , communications path 1545 may be a wireless communications path . alternatively , base station 1540 may communication with one or more incs using any suitable wired path . base station 1540 may include communications device 1542 for communicating with control unit 1510 and other incs , and a second communications device 1544 for communicating over communication path 1555 with personal computer 1550 . if desired , communications device 1542 and communications device 1544 may be the same device . communications device 1544 may communicate with communications device 1556 on personal computer 1550 using any suitable physical and logical protocol . this may include a serial port , usb , infrared , radio frequency , a docking station , or other means . in addition to communications device 1556 , personal computer 1550 may have display 1552 , keyboard 1553 , mouse , printer 1554 , and modem 1551 . modem 1551 may be any suitable type of connection to a wide area network , and may include a telephone modem , a digital subscriber line modem , a cable modem , an ethernet hub , and ethernet router , or other suitable equipment . personal computer 1550 may connect using path 1565 to wide area communications network 1560 , which may be the internet . personal computer 1550 may be configured to send or receive information from another computer using wide area network 1560 . fig1 shows flow chart 1600 of an illustrative process for uploading information from an inc . all steps are optional and may be performed in any suitable order . in step 1610 , information may be reported by an inc . that information may have been collected by the inc , for example using a sensor within the inc . alternatively , the information may have been generated by the inc . in step 1615 , the information may be received by a control unit , which may be another inc within the same mpn . the information may be sent from the control unit , or any other suitable inc , to a base station in step 1620 , and to a personal computer in step 1622 . if desired , any of the control unit , base station , and personal computer may be omitted , or their functions may be combined in any suitable manner . if desired , the collected information may be sent over a communications network , such as the internet , in step 1624 , and received by another computer . in step 1630 , the information may be stored , for example by the base station , the personal computer , or by another computer accessed over the communications network . the information may be displayed for a user . the information may be analyzed , in step 1632 . in step 1640 , the uploaded information may be used , at least in part , to create information to download . this derived information may be downloaded to the same inc that originated the uploaded data , to the control unit , or to another inc in the mpn . refer to the description of fig9 above for steps related to downloading of data . fig1 shows a more detailed block diagram 1700 of a portion of mpn 1500 of fig1 . base station 1540 , control unit 1510 , and inc 1520 are shown . it can be seen that control unit 1510 includes processor 1742 and memory 1744 . inc 1720 , which is an audio output inc , is also shown . audio output inc 1720 includes wireless communications device 1722 for communicating over wireless communication path 1730 with control unit 1510 and other incs . audio output inc 1720 also includes digital - to - analog converter 1724 , for converting digital audio data to an analog audio signal , and speaker 1726 for playing the analog audio signal audibly . the incs shown are merely illustrative . fig1 shows flow chart 1800 of illustrative process for using an inc that is a control unit in an mpn . all steps are optional and may be performed in any suitable order . in step 1810 , the control unit may be configured to be worn . it may be attached , for example , to a waistband , a wristband , an armband , or other worn in another suitable location . if desired , the control unit may alternatively be carried , mounted on personal equipment , or otherwise associated with the user . information may be downloaded to the control unit , for example from a base station or personal computer . in step 1820 , software may be downloaded to the control unit . in step 1822 , data may be downloaded to the control unit . in step 1824 , configuration parameters may be downloaded to the control unit . in step 1826 , the date and / or time may be downloaded to the control unit . in step 1830 , data may be sent from the control unit to another inc within the mpn . for example , any of the data sent to the control unit in steps 1820 , 1822 , 1824 , or 1826 may be sent to another inc . the control unit may also send information to another inc that is derived from downloaded data , from data collected from other incs , or other suitable data . in step 1832 , the control unit may control a function of another inc . the control unit may accomplish this by sending one or more messages to the other inc , and possibly by receiving messages in response . the control may be based on downloaded software , downloaded data , downloaded parameters , time , or any derived data . in step 1834 , the control unit may collect data from another inc . the control unit may request the data by sending a message to the other inc . alternatively , the other inc may send the data unsolicited . the data may be a single item , or it may consist of several samples collected over a period of time . the control unit may process the data , combine data samples , combine data from multiple incs , or otherwise modify the collected data . in step 1850 , data may be uploaded from the control unit , for example to a base station or personal computer . this may included collected data , derived data , or data generated by the control unit . in step 1860 , functions of the control unit may be integrated with other functions . for example , the control unit may also have a display or a user input device . the control unit may also include clock functions , in step 1840 , and it may track time to coordinate functions of the mpn , to schedule actions , and to tag collected data . the control unit may treat the other integrated functions as though they were in another inc , without the need to send and receive wireless messages to communicate with them . in step 1870 , the control unit may support multiple other incs with multiple functions . some may be input incs , some may be output incs , and some may be a combination . some incs may be wholly contained without external input or output , such as a storage inc or a data processing inc . the control unit may maintain a table of active incs , and communicate with the other incs as required . the control unit may automatically detect when an inc is added to the mpn or removed from the mpn . when an inc is added to the mpn , the control unit may ignore it until it receives downloaded software or data related to the new inc . alternatively , it may automatically make use of the capabilities of the new inc . when a inc is removed from the mpn , the control unit may wait for a period of time to make sure that communications with the inc were not temporarily lost . the control unit may continue functioning with reduced functions . in addition or alternatively it may generate an alert to the user . if desired , an mpn need not include a control unit . some or all of the functions of a control unit may be incorporated into one or more of the other incs . if desired , each inc may provide its own control . if desired , software , data , configuration settings , and other information may be downloaded directly into some or all of the incs by a base station or personal computer prior to mobile use . fig1 shows flow chart 1900 of an illustrative process for providing personal incs in an mpn . all steps are optional and may be performed in any suitable order . in step 1910 , the user may wear an inc . for example , in substep 1912 , the user may wear an inc on a hand , wrist , arm , leg , foot , waist , head , or other suitable part of the body . the inc may be worn on an article of clothing in substep 1914 , such as a glove , a partial glove , a wristband , an armband , a hat , a headband , a shirt , a waistband , a shoe , or other suitable item of clothing . in step 1920 , the inc may be mounted on personal equipment that may be used by the user . for example , in substep 1922 , the inc may be mounted on a bicycle , a car , a piece of exercise equipment , or other suitable personal equipment . the inc may provide an input or output function associated with the personal equipment . in step 1930 , the mpn may also include a relatively stationary inc , such as a base station or personal computer . the base station or personal computer may function as part of the mpn while the user is in proximity to the device . the communications connection with the stationary device may be the same wireless network used to communicate between the incs , or it may be another type of connection . the other type of communication may be a docking station or other fixed method , usb or other wired method , or infrared or other wireless method . the stationary device may only support communications with one of the mobile incs , such as a control unit , or it may support communications with several or substantially all of the incs . fig2 a through 20c show several illustrative methods for mounting incs . for example , fig2 a shows some options for allowing a user 2005 to wear incs . inc 2012 , which may be an audio output inc , may be mounted on headband 2010 . inc 2022 , which may be a display , may be mounted on wristband 2020 . inc 2032 , which may be a user control , may be mounted on glove 2030 . inc 2042 , which may be a control unit , may be mounted on waistband 2040 . inc 2052 , which may be an accelerometer , may be mounted on shoe 2050 . these incs and options for wearing are merely illustrative . other options may be used if desired . the user 2005 may decide what functions will be provided simply by choosing to wear a specific set of incs at any given time . fig2 b shows some options for mounting incs on a piece of exercise equipment 2070 . for example , inc 2074 may be an input sensor to read data associated with the exercise equipment , or may be an output inc to control aspects of the exercise equipment . inc 2072 may be a display inc , or may be configured to communicate with a processor embedded within the exercise equipment . these incs may function as part of the mpn when the user is on or near the device . fig2 c shows options for mounting incs on a bicycle 2060 . for example , inc 2062 may be a display inc . inc 2064 may be a sensor for measuring pedaling cadence . inc 2066 may be a sensor for measuring wheel speed . these incs may function as part of the mpn when the user is on or near the bicycle . the options shown in fig2 a through 20c are merely illustrative . other types of incs , other types of mounting , and other types of personal equipment may be supported if desired . fig2 shows flow chart 2100 of an illustrative process for using an inc mounted on a piece of exercise equipment . all steps are optional and may be performed in any suitable order . in step 2110 , the inc may be mounted on a piece of exercise equipment . in substep 2112 , the inc may be mounted on a bicycle . the inc may function as part of the user &# 39 ; s mpn when the user is near or on the exercise equipment . in step 2120 , control commands may be sent to the inc mounted on the exercise equipment . the inc may control the function of the exercise equipment directly , or it may send a command to the exercise equipment , for example using a serial port or radio frequency transmitter . as shown in substep 2122 , the command may be to control the difficulty of the exercise , such as by changing a resistance setting , a speed setting , a slope setting , or the like . the control command may also be to a display inc or other user output inc mounted on the exercise equipment . in step 2130 , data may be collected from the inc . the inc may measure the collected data directly , or it may retrieve the data from the exercise equipment , for example using a serial port or radio frequency receiver . the data may be , for example , pedal speed of a bicycle in substep 2132 or wheel speed of a bicycle in substep 2134 . in substep 2136 , other performance information may be collected from the exercise equipment , such as speed , power , or heart rate . the data may be collected , for example , using a sensor attached to the exercise equipment or bicycle , or by communicating with a processor embedded in the exercise equipment . the collected data may be stored , it may be displayed , and it may be used to modify a workout . if desired , the collected data may be uploaded to a base station or personal computer , where it may be stored , displayed , or analyzed . an inc may function as a display inc . a display inc may be worn or carried by the user or mounted on a piece of personal equipment . a display inc may be combined with other functions , such as user controls , audio output , or a control unit , or the inc may function solely as a display inc . a single display inc may be used to display different types of information at different times , depending on the other incs in the mpn . the display inc may not need to be changed to provide new types of information display . rather this may be accomplished by adding a new inc with a new function , downloading new software into the display inc or a control unit , or otherwise modifying other parts of the mpn . in addition , the user may switch to a different style of display inc without changing any other part of the mpn , and maintain all preexisting mpn settings and functions . the display inc may include a wireless communications device for communicating with other incs in the mpn . for example , the display inc may receive display commands and data from one of the other incs , such as a control unit . the display inc may incorporate any appropriate display technology , such as liquid crystal displays ( lcds ), light emitting diodes ( leds ), etc . it may also include means for mounting the inc to the user &# 39 ; s body . if desired , a display inc may accept different types of input for display , such as text , bit - map or other graphics , video data , instructions to turn on or off specific visual indicators , instructions to turn on or off various display modes , or other suitable display items and instructions . in a mounting similar to a wristwatch , a display inc 2215 may be mounted on the back of a wrist 2210 , using wristband 2220 , as shown in fig2 a . fig2 b shows a variation , in which display inc 2235 is mounted on the side of wrist 2230 , using wristband 2240 . in another variation shown in fig2 c , display inc 2255 may be mounted on the back of hand 2250 using partial glove 2260 . in these examples , the display incs are shown to display time . however , any suitable information appropriate to the functions provided by the incs of the mpn may be shown on the display inc . fig2 a through 23f show how a display inc may be worn on the side of a hand , and may be configured with various orientations . for example , in fig2 a through 23c , the display inc may be configured to be oriented toward the back of the hand , toward the fingertips , or at an angle between them , respectively . in these figs ., the display is shown on the left hand . alternatively , the display may be configured to be worn on the right hand , as shown in fig2 d through 23f . different users with different needs may desire displays worn on opposite hands , in different positions on the hand or wrist , and at different orientations . some , for example , may wish to wear the display in the traditional wristwatch position and orientation on the back of the wrist . others , for example athletes , may desire a display that can be quickly viewed on the side of the hand without having to twist the arm . the preferred orientation may depend on the user &# 39 ; s activity . a display may be provided in which the user may configure the position and / or orientation . for example , a user may wish to switch the display between the left wrist / hand and the right wrist / hand . a user may also be allowed to change the orientation of the display . for example , if the display is implemented using a dot - matrix liquid crystal display ( lcd ), the software within the mpn may support multiple orientations . a display may also be provided with multiple mounts — e . g ., wristbands , partial gloves , and the like . fig2 a shows flow chart 2400 of an illustrative process for providing a display as an inc in an mpn . all steps are optional and may be performed in any suitable order . in step 2410 , a display may be provided as an inc . the inc may include a wireless communications device for communicating with other incs in the mpn . if desired , the display may be combined with one or more other functions into a single inc , sharing a single wireless communications device . in step 2415 , the display inc may be configured to be worn , for example on a wristband , partial glove , or the like . in step 2420 , the display inc may be configured to be mounted on an item of personal equipment . that may include , for example , a car in substep 2424 , a bicycle in substep 2422 , or a piece of exercise equipment in substep 2426 . in step 2430 , the user may be allowed to change the mounting of the display inc . for example , multiple mounts may be provided so that the display inc may be moved from one part of the body to another , or from the wrist to a piece of exercise equipment . fig2 b shows a flow chart with illustrative expanded detailed of step 2415 , in which the display inc may be worn by the user . all steps are optional and may be performed in any suitable order . in step 2460 , the display may be configured to be worn on a hand or wrist . for example , a wristband or partial glove may be provided . if desired , the display may be worn on other parts of the body instead of the hand or wrist . in step 2465 , the display may be configured to be worn on the side of the hand or wrist , allowing the display to be viewed more easily , for example by an athlete . in step 2470 , the display and mount may be configured to allow the display to be worn on either the left or right hand or wrist . in step 2480 , the display may be oriented in a direction desirable to the user . for example , in substep 2482 , the display may be oriented toward the fingertips . in substep 2484 , the display may be oriented toward the back of the hand or wrist . in substep 2486 , the display may be oriented at an angle between those two options . in step 2490 , the orientation of the display may be configurable by a user , allowing the user to select from one or more orientation options . fig2 shows illustrative flow chart 2500 of an illustrative process for providing a reusable wearable mount that may be used with various incs , such as a display inc . this method may allow the user to use different mounts or displays to match clothing , to use displays with different functions , and to quickly and easily change the position and orientation of the display . all steps are optional and may be performed in any suitable order . in step 2510 , a reusable mount may be provided that may be worn on the user &# 39 ; s body . in step 2515 , the mount may be provided as part of an article of clothing , such as a glove , partial glove , wristband , waistband , shirt , or any other suitable article of clothing . in step 2520 , the mount may use a hook and loop type of fastener . if desired , any other suitable type of fastener may be used on the article of clothing . in step 2525 , the mount may be made directly to the user &# 39 ; s skin . for example , a non - toxic adhesive may be used on the back of the inc to be mounted . in step 2530 , a plurality of mounts may be provided . for example , in substep 2532 , mounts may be manufactured in different styles or colors . in substep 2534 , mounts may be manufactured to be worn on different parts of the body . a user may choose one of the mounts based on style , whim , convenience , function , or for any other reason . in step 2540 , the mount may be used with an inc . the user may temporarily attach the inc to the mount . if desired , the mount may also be configured to allow devices that are not incs to be attached . in step 2545 , the inc attached to the mount may be a display inc . the display inc may be used to display current time and other information that may be provided by the mpn . in step 2550 , the user may be allowed to reposition the inc on the mount . for example , the user may be allowed to change the placement and orientation of a display inc to make it more convenient to read the displayed information . in step 2560 , the user may be allowed to mount various incs onto a single mount . the incs may be manufactured with different shapes , materials , colors , styles , functions , or otherwise may be of different value to a user at different times . fig2 a through 26c show various examples of reconfigurable wearable mounts that may be provided . fig2 a shows a wristband with a buckle . fig2 b shows a partial glove . fig2 c shows a stretchable band that may be looped around the hand and over the thumb . each of these mounts may be manufactured with an area of hook and loop fasteners , where the mount includes , for example , the hook portion , and the loop portion is on the back of the inc to be mounted . fig2 a through 27d show various display incs that may be used with the mounts of fig2 a through 26c . these displays may have different shapes , different materials , different functions ( for example showing either time or heart rate ), or may otherwise differ . each of the incs may provide the means to fasten to the mount , for example the loop portion of a hook and loop fastener . an inc may function as an audio output inc . an audio output inc may be worn or carried by the user or mounted on a piece of personal equipment . the audio output inc may be combined with other functions , such as user controls , display , or a control unit , or the inc may function solely as an audio output inc . a single audio output inc may be used to output different types of information at different times , depending on the other incs in the mpn . the audio output inc may not need to be changed to provide new types of information output . rather this may be accomplished by adding a new inc with a new function , downloading new software into the audio output inc or a control unit , or otherwise modifying other parts of the mpn . in addition , the user may switch to a different style of audio output inc without changing any other part of the mpn , and maintain all preexisting mpn functions . the audio output inc may include a wireless communications device for communicating with other incs in the mpn . for example , the audio output inc may receive digital audio data from one of the other incs , such as a control unit . the audio output inc may include a digital - to - analog converter ( dac ) for converting the digital audio data to an analog audio signal . alternatively , the audio output inc may receive an analog audio signal from another inc . it may include one or more amplifiers and one or more speakers . it may also include means for mounting the inc to the user &# 39 ; s body . if desired , the audio output inc may also include more advanced audio processing capabilities , including speech synthesis , recognition of various audio file formats , decryption of secure data formats , the ability to generate any of a predefined set of tones or audio segments , or other suitable circuits and algorithms . fig2 a through 28d show various types of audio output inc that may be used with an mpn . fig2 a shows an audio output inc configured as a pair of headphones 2810 . it may include two speakers 2812 and 2814 . a wireless communications device , dac , and amplifiers may also be included . the headphones may also be configured as two separate incs , which may each communicate wirelessly with control unit and other incs . each inc may have its own dac , amplifier , and speaker . headphones may be provided with connecting bar , or they may be configured as small modules to be inserted inside the ear and worn independently . fig2 b shows audio output inc 2822 that may be configured to be worn with a headband 2820 . the audio output inc may be worn near the ear so that minimal power is needed to drive its speaker . sound from the speaker may be provided via conduction through the skull . fig2 c shows two independent audio output incs 2832 and 2834 , which may be worn with a headband 2830 , to provide stereo sound . in fig2 d , audio output inc 2844 may be configured to be worn with hat 2840 . if desired , hat 2840 may be configured to function with two audio output incs ( not shown ). the audio output inc of fig2 b through 28d may be configured to fit into the ear , or to lie flat across the skin near the ear . the headband or hat may be designed to hold the audio output inc or incs in place in the ear , or to hold the audio output inc in place against the skin where sound may be conducted through the skull . if desired , the headband or hat and the audio output inc may be jointly designed so that the audio output inc may be repositioned to best meet the user &# 39 ; s needs , and so that alternate designs of audio output incs may be used with the same mount . fig2 shows flow chart 2900 of an illustrative process for providing an audio output inc in an mpn . all steps are optional and may be performed in any suitable order . in step 2910 an audio output inc may be provided . audio output inc may include a wireless communications device for receiving audio data and other audio commands from one or more other incs in the mpn . it may include dac , one or more amplifiers , and one or more speakers . it may also include speech synthesis circuitry , tone generation circuitry , digital audio file processing capability , decryption circuitry , a library of audio segments , or other suitable subsystems . in step 2920 , the audio output inc may be configured to be worn . for example , in substep 2922 , it may be configured as a headset . in substep 2924 , it may be configured as one or more independent earphones , for example to be inserted inside an ear . in substep 2926 , it may be configured to be worn with a hat . in substep 2928 , it may be configured to be worn with a headband . in step 2930 , the audio output inc may include one or more speakers . for example , it may be configured to provide stereo sound . alternatively , multiple audio output incs may be included as separate incs in a single mpn , and may be controlled independently . in step 2932 , audio output inc may provide music . music may be provided in stereo . in step 2934 , synthesized voice may be provided . the synthesized voice may be provided to the audio output inc as digital or analog audio . alternatively , the voice may be provided to the inc in another form , such as text or phonemes , and the audio output inc may create the synthesized voice . in step 2936 , tones may be output . the tones may be provided to the audio output inc as digital or analog audio . alternatively , the tones may be provided to the inc in another form , such as waveform descriptions or indexes into a table of predefined audio segments , and the audio output inc may create the tones . in step 2940 , the audio output inc may be used by the mpn to provide audio cues to the user . the audio cues may be for any purpose appropriate to the functions provided by the mpn and its other incs . for example , cues may be provided to an athlete with performance information 2941 , workout zone information 2942 , workout prompt 2943 , or change intensity prompt 2944 . route prompt 2945 or direction alert 2947 may be provided by an mpn that provides route guidance . medical alert 2946 may be provided by an mpn that monitors medical conditions . communication alert ( e . g ., notification of an incoming telephone call or message ) 2948 and voice communication 2949 may be provided by an mpn that provides communication services . in step 2950 , sound may be used to indicate different conditions or different audio cues . for example , in substep 2952 , different sounds ( e . g ., different tones ) may be used to indicate different conditions . in substep 2954 , different sound sequences may be used to indicate different conditions . in substep 2956 , sound may be sent to different speakers or audio output incs to indicate different conditions . in step 2960 , the audio output inc may be used for multiple purposes simultaneously . for example , in a system that provides both music and audible athletic workout feedback , both may be sent to the same audio output inc or incs . when an audio cue , such as workout feedback , is output , the music may be muted in substep 2962 or the volume of the music may be lowered in substep 2964 . alternatively , the music may be paused in substep 2966 while the audio cue is presented . the volume changing or pausing of the music may be controlled , for example , by a control unit . for example , the control unit may send both music and audio cues to the audio output inc , and may send commands to the audio output inc to control the volume of both . to pause the music , which may be stored in digital form in memory in the control unit , the control unit may temporarily stop reading music data from its memory while the audio cue is presented , and then resume reading the music data from where it was left off . if desired , the pausing , muting , or volume reduction of the music itself may constitute the audio cue , with no additional sound generated . for example , the system may pause the music once for two seconds as one type of cue , and pause the music three times for one half second each time as a second type of cue . in step 2970 , an audio output inc may be provided separately from a display inc . this may be an advantage over many existing systems in which these two functions are combined into a single unit worn on the wrist . in these prior art devices , either the sound volume is so loud that it disturbs other nearby people , or it is too soft to be heard by the user at all times . in this invention , the audio output inc can be provided close to the ear , and the volume can be kept low while still allowing the user to hear the audio even in poor environmental conditions . if desired , the mpn may include the ability for a user to control the volume of audio output . the system may also allow a user to independently control the volume of different types of audio output . for example , the volume of the music may be controlled separately from the volume of the audio cues , and both of those may be controlled separately from the volume of voice communications . in substep 2975 , cues may be sent to either the audio output inc as audio cues , or to the display inc as visual cues , or both . the user may be allowed to configure where different types of cues are sent . an inc may function as a user input inc . a user input inc may be worn or carried by the user or mounted on a piece of personal equipment . the user input inc may be combined with other functions , such as a display or control unit , or the inc may function solely as a user input inc . a single user input inc may be used to input different types of information at different times , depending on the other incs in the mpn . the user input inc may not need to be changed to provide new types of information input . rather this may be accomplished by adding a new inc with a new function , downloading new software into the user input inc or a control unit , or otherwise modifying other parts of the mpn . in addition , the user may switch to a different style of user input inc without changing any other part of the mpn , and maintain all preexisting mpn functions . an mpn may include multiple user input incs , which may be of similar types or of different types . the user input inc may include a wireless communications device for communicating with other incs in the mpn . for example , the user input inc may send digital commands or data to one of the other incs , such as a control unit . the user input inc may include an analog - to - digital converter ( adc ) for converting analog inputs to digital data . it may also include means for mounting the inc to the user &# 39 ; s body . if desired , the user input inc may also include more advanced input processing capabilities , including voice recognition , tensile , audible , or visual feedback of input commands , anticipation of likely commands , grouping and combining of similar inputs , or other suitable circuits and algorithms . fig3 shows flow chart 3000 of an illustrative process for providing a user input inc in an mpn . all steps are optional and may be performed in any suitable order . in step 3010 , a user input inc may be provided . in step 3020 , the user input inc may be separate from other incs , such as a display inc or a control unit . this may be an advantage to some users . for example , in many prior art systems the user controls are mounted on a display device worn on the wrist . controls may be small and close together , and may require the user to look at the display device to operate it . this requires to user to twist the arm , to look and find the controls , and to reach one hand over to the other . these actions may not be convenient for all users at all times . for example , an athlete may need to operate a system using the minimum possible motions , and without having to change the direction he or she is looking . if desired , user controls may be combined with any other inc . in step 3020 , any suitable type of user input inc may be used . preferably , the inc is one that may be used in a mobile environment . for example , a computer keyboard and mouse may not be appropriate except as attached to a personal computer or base station that may be used at times with the mpn . appropriate types of input inc may include a pressure sensor or button 3021 , multiple pressure sensors or buttons 3022 , a touch pad 3023 , a stylus 3024 used for example with a touch pad , a portable keyboard 3025 , and a microphone 3026 . microphone 3026 may be used to capture audio data , or it may include speech recognition circuitry . if desired , an mpn may include multiple user input incs . for example , one system may include several buttons , a microphone with speech recognition , and a touch pad with a stylus . in step 3030 , the user input inc may be configured to be worn or carried . for example , a pressure sensor may be attached to a fingertip 3032 , hand 3031 , foot 3035 , or waist 3034 . a touch pad or microphone may be worn at the waist 3034 . a microphone may be worn on the wrist 3033 or other part of the arm , or may be configured as part of a headset . if desired , the user input inc may be designed to be mounted on an item of clothing in step 3040 , such as glove 3041 , partial glove 3042 , wristband 3043 , waistband 3044 , or footband 3045 , shoe , or sock . the user input inc may also be mounted on an item of personal equipment in step 3050 , such as on a car 3051 , bicycle 3052 , or exercise equipment 3053 . in step 3060 , if user input inc includes one or more pressure sensors or buttons , it may be operated by tapping . for example , the user may mount a pressure sensor on one or more fingertips , and they may be operated by tapping the fingertip against the palm of the hand , the thumb , other part of the body , or another surface . the user may mount a pressure sensor on the palm of the hand and operate it by tapping it with a fingertip , with the other hand , hitting another part of the body , or striking another surface . the user may mount a pressure sensor on a waistband and operate it by tapping it . the user may mount a pressure sensor on the foot and operate it by tapping an object with the toe or by pushing off the wall while swimming laps in a swimming pool . in substep 3062 , the user may tap different sensors for different commands . for example , an athlete may tap with the sensor on one finger to start and stop a stopwatch function , and tap with the sensor on a different finger to capture a single lap split time . in substep 3064 , the user may tap different sequences to indicate different commands . for example , the user may tap once , twice in quick succession , or other suitable sequences . in substep 3066 , the user may tap a specific combination of sensors simultaneously to input a specific command . fig3 a through 31c show several illustrative methods for mounting a user input inc . in fig3 a , pressure sensors 3110 , 3111 , 3112 , 3113 , 3114 , and 3120 are mounted on a user &# 39 ; s hand 3100 . if desired , they may also be mounted on a glove or partial glove worn by the user . in this configuration , any single sensor may be operated independently . in addition , combinations of sensors may be operated simultaneously . for example , a user may tap the thumb with the forefinger and simultaneously operate both sensor 3110 and sensor 3111 . the user may also simultaneously strike a surface with one , two , or more sensors to provide various input commands . fig3 b shows pressure sensor 3134 mounted to a user &# 39 ; s foot 3130 using footband 3132 . this configuration may be useful to a swimmer , who may tap the wall of a swimming pool to count laps , and may tap the bottom of the pool to indicate other commands . fig3 c shows user 3140 who has mounted two input incs 3144 and 3146 on waistband 3142 . these input incs may be pressure sensors and may be operated by tapping . alternatively , these incs may include a microphone , portable keyboard , touchpad and stylus , or other input inc carried on the waist and retrieved for use . any suitable combination of input incs and mounts may be used . an mpn may be used for many purposes . a single mpn may be used for a single purpose , or it may be used for multiple purposes . the uses of the mpn may change over time , as the user adds and removes incs , downloads or removes software , changes configuration parameters , or just changes how he or she interacts with the system . a single inc may have a single purpose , or it may be used for multiple purposes . some types of incs , such as control units incs , display incs , audio output incs , and user input incs , may be general purpose . fig3 shows a flow chart of an illustrative process for using an mpn for multiple purposes . all steps are optional and may be performed in any suitable order . in step 3205 , the mpn may be used to provide a time - related function . in step 3208 , the mpn may be used to provide a guidance function . in step 3210 , the mpn may be used to provide an athletic function . in step 3215 , the mpn may be used to provide a medical function . in step 3220 , the mpn may be used to provide an entertainment function . in step 3225 , the mpn may be used to provide an outdoor - related function . in step 3230 , the mpn may be used to provide a communications function . in step 3235 , the mpn may be used to provide a personal organization function . in step 3240 , the mpn may be used to provide an identification function . in step 3245 , the mpn may be used to provide a personal security function . in step 3250 , the mpn may be used to provide a military function . in step 3255 , the mpn may be used to provide a physical therapy function . in step 3260 , the mpn may be used to provide a disability - related function . in step 3265 , the mpn may be used to provide a travel - related function . in step 3270 , the mpn may be used to provide multiple functions . this may include substep 3272 of providing multiple functions with a single mpn configuration . it may also include substep 3274 of providing multiple functions with multiple mpn configurations . the functions shown in fig3 are merely illustrative . other functions may be provided if desired . step 3205 , providing time - related functions , is shown in more detail in fig3 . all steps are optional and may be performed in any suitable order . in step 3310 , a clock may be provided as part of an mpn . this may include substep 3312 in which the clock is provided as part of another inc , such as a control unit or display inc . in step 3320 , the current date and time may be downloaded into the inc . this may include substep 3322 in which the current time is downloaded over the wireless network , for example from a personal computer . alternatively , it may include substep 3324 in which the inc include a radio receiver to acquire the current time from station wwv time of day radio broadcast . in step 3330 , the inc may provide a clock function . this may include displaying the current day and time on a display inc . the inc may include a time zone function in step 3331 . this may include displaying the current time in multiple time zones , or converting a time from one time zone to another . in step 3332 , the inc may provide a stopwatch function . this may include allowing the user to time individual events . it may include step 3334 of providing a split timer function , in which the user is allowed to time individual portions of an event . it may also include step 3335 in which the user is allowed to time multiple events . in step 3333 , the system may provide an interval timer function , allowing the user to mark one or more recurring intervals of specific durations . in step 3340 , the system may store collected time information . this may include collected stopwatch , split , and event times . this collected data may be tagged with the date and time on which it was stored . the user may also be allowed to input descriptive data related to the collected time data . the stored data may also include time zone settings , intervals settings , or other settings . in step 3342 , the collected time information may be uploaded , for example to a base station or personal computer . in step 3350 , the clock functions may be used to synchronize other mpn functions . for example , a control unit may collect data from a particular inc on a regular interval , or update a display once per second . the control unit may be allowed to read the current time from the clock . the clock may also be configured to provide an unsolicited interrupt to the control unit or other inc at a regular interval . in step 3352 , data collected from other incs may be tagged with the current time retrieved from the clock . fig3 shows a block diagram of an illustrative mpn 3400 with a clock function . in this system , the clock 3420 is embedded in the control unit 3410 . clock information is sent to a separate display inc 3430 , which may output the information on display 3440 . user commands , such as changing clock mode and starting and stopping the stopwatch , are provided by buttons 3460 on a separate input inc 3450 . the input inc 3450 may be worn on the hand , the control unit / clock 3410 may be worn on the waist , and the display inc 3440 may be worn on the wrist . fig3 shows an illustrative screen 3500 that may be shown on display 3440 ( fig3 ). mode list 3520 may list the available clock modes . in this case , the system may support a time mode , a zone mode ( e . g ., time zone ), a stopwatch mode , an interval timer mode , and an event timer mode . indicator 3530 may show the currently active mode , in this case the time mode . the user may change to a different mode by pressing one of buttons 3460 ( fig3 ). the current time 3510 may be displayed while in time mode . more details of step 3230 ( fig3 ), providing a communication function in an mpn , are shown in fig3 . all steps are optional and may be performed in any suitable order . in step 3610 , communication may be provided with another mpn . this may be accomplished if one of the incs in the mpn includes a communications device capable of communicating with an inc of another mpn . the wireless communications device used for communicating among the incs within an mpn may also be used for communicating with another mpn , if the user of that mpn is in close proximity . the system may be configured to accept messages with the specific network identifier associated with the other mpn , while the communications are in progress . in step 3620 , wireless telephone communications may be provided , if one of the incs includes a wireless telephone . the audio output inc for the mpn may output the incoming audio from a telephone call , and a microphone used as a user input inc for the mpn may be used to provide the outgoing audio for the telephone call . this allows the telephone inc itself to be smaller and less costly , since it does not require a built - in speaker or microphone . in step 3625 , paging services may be provided . for example , one of the incs may include a paging receiver . text pages may be shown on the display inc . audio alerts and voice pages may be sent to the audio output inc . two - way paging may be provided if desired . an instant messaging function may be provided in step 3630 , with one inc receiving text messages for display on the display inc , and another inc allowing text messages to be composed and sent to another person elsewhere . electronic mail messages may also be composed and received in a similar manner in step 3635 . different types of communication may be provided as appropriate . for example , voice communications may be provided in step 3640 . text communication may be provided in step 3642 . video communication may be provided in step 3644 . other formats of communication may also be supported if desired . in step 3650 , data may be transmitted by a communications device in one of the incs in the mpn . this may include substep 3652 transmitting image data , substep 3654 transmitting audio data , substep 3656 transmitting video data , and substep 3658 transmitting text data . the data to be transmitted may be provided by the user with a user input inc , may be stored in memory within the mpn , and may be transmitted among incs in the mpn prior to sending . in step 3660 , data may be received by a communications device in one of the incs in the mpn . this may include substep 3662 receiving image data , substep 3664 receiving audio data , substep 3666 receiving video data , and substep 3668 receiving text data . the data received may be transmitted among incs in the mpn and stored in memory within the mpn , prior to its being provided to the user on one or more of the incs , such as a display inc or audio output inc . if desired , a communications alert may be provided to the user on the display or audio output inc to let the user know that a message has been received . if desired , input and output incs in the mpn may be shared between a communications function and another function of the mpn . for example , music may be paused or muted while voice communications or communications alerts are being provided to the audio output inc . fig3 shows more detail of step 3610 ( fig3 ), communicating between mpns . all steps are optional and may be performed in any suitable order . as described above , one of the incs of the mpn may include a communications device for exchanging data with an inc of another mpn . alternatively , the communications device used for exchanging data among incs of a single mpn may also be used to exchange data with another mpn that may be in proximity . for example , the user may have downloaded software into the control unit or other inc that allows such communication . the user may use the user input inc to notify the mpn that these communications are to begin . the mpn may then begin to send messages to an inc of the other mpn , and may listen for incoming messages from the other mpn . in this manner , each mpn may determine the network identifier of the other user &# 39 ; s mpn . in step 3710 of fig3 , data may be sent from one mpn to another . for example , the control unit or other inc may tag an outgoing message with the network identifier of the other mpn . the data may include personal data in step 3720 . for example , if the two mpns are configured to provide personal organization features , the data sent from one to the other may include contact information , such as a name , phone number , electronic mail address , or other suitable information . in step 3730 , the data sent between mpns may include game data . this may allow the users to play a game that requires two or more players , if both users have the same game software installed . in step 3740 , the data may allow two users to compete athletically . for example , the two users may each be on a stationary bicycle , and performance data may be exchanged between them . the two mpns may determine who wins the competition based on data gathered from the two stationary bicycles or other sensors . in step 3750 , one user may send software to another user . this may include , for example , software that enables an mpn to perform a specific feature or provide a specific function . in step 3760 , one user may be allowed to send a digital music file , or other recorded media , to another . any other suitable type of data may be exchanged between mpns . if desired , data may be exchanged between more than two mpns simultaneously , for example allowing a game with more than two players . fig3 shows two users with mpns that are communicating . first user 3820 is wearing first mpn 3810 . first mpn 3810 includes control unit 3830 and display inc 3840 . user controls may be incorporated into either inc . second user 3870 is wearing second mpn 3860 , consisting of control unit 3880 and display inc 3890 . either of these two incs may have user controls as well . data may be exchanged between control unit 3830 and control unit 3880 . exchanged data may be displayed on display inc 3840 and display inc 3890 . user 3820 and user 3870 may , for example , exchange personal contact information or may play a game . the incs shown are merely illustrative . another example of two users with communicating mpns is shown in fig3 . first user 3920 is on first bicycle 3915 , mounted on a stationary training stand . second user 3970 is on second bicycle 3965 , also mounted on a stationary training stand . first mpn 3910 may include inc 3925 which may combine display functions and user controls with a control unit and which may be mounted on bicycle 3915 . first mpn 3910 may include audio output inc 3930 worn by first user 3920 inside a helmet or headband . it may include inc 3935 that controls the difficulty setting of the training stand . it may also include inc 3940 that measures the speed of the rear wheel of bicycle 3915 . second mpn 3960 may similarly include user input / display / control unit 3975 , audio output inc 3980 , difficulty setting inc 3985 , and speed sensor 3990 . the two control units may control the difficulty for the two riders to simulate a specific race course , and may compare the speeds of the two riders . the display incs may be used to provide feedback on the comparative progress on the simulated course of the two riders , for example notifying each rider of the comparative position of the other . the incs shown are merely illustrative . fig4 shows more detail of step 3220 ( fig3 ), providing entertainment functions . all steps are optional and may be performed in any suitable order . in step 4010 , recorded music may be played . for example , songs may be stored in digital format ( e . g ., mp3 format ) in memory in the control unit or other inc with storage capabilities . the storage inc may read the digital audio data and send it to the audio output inc , which may play the audio for the user . if desired , the system may provide audio control functions , such as volume control , playing and stopping , skipping songs , repeating a song , random play , etc . in step 4015 , broadcast music ( e . g ., radio ) may be played by the mpn . a radio receiver may be included in one of the incs . the radio signal may be received and sent to the audio output inc to allow the user to listen . if desired , the audio signal may be digitized for processing within the system . if desired , the system may include volume changing and station selection functions , and other desired radio - related features . in step 4020 , the system may allow audio to be recorded . for example , one of the incs may include a microphone . the audio may be digitized and stored into memory in one of the incs , such as a control unit . the recorded audio may be replayed by the user , using the audio output inc . similarly , video segments may be captured in step 4022 and still video images may be captured in step 4024 by an inc with a video input . the video segments may be digitized and stored in memory in one of the incs . if desired , the captured video segments and images may be viewed by the user on the display inc . if desired , any stored music or any recorded media may be shared with a user of another mpn , as described above in conjunction with fig3 . any recorded audio , video , or image data may be uploaded to a personal computer , if desired . in step 4030 , the user may be allowed to play a game . the game may involve only the user of the mpn . alternatively it may involve a user of another mpn , if one of the incs in each mpn includes a communication device capable of communicating with the other mpn . for example , the wireless communications device within each of the incs may be used to transfer game - related information between mpns if the two users are in close proximity . an inc of the mpn may also be configured to communicate with an external game device . music and audio cues may both be provided by a single mpn , as described previously in conjunction with fig2 . fig4 shows more details of step 3235 ( fig3 ), providing personal organization features with an mpn . all steps are optional and may be performed in any suitable order . in step 4110 , the mpn may support scheduling of appointments . the user input inc and display inc may be used for entering new appointments , modifying appointments , and viewing upcoming schedules . the display inc and audio output inc may be used to inform the user of imminent appointments . in step 4120 , the mpn may manage contact information . this may include names , phone numbers , addresses , electronic mail addresses , and other information about contacts . in step 4130 , the mpn may be used to manage a task list . for example , the user may be allowed to enter and prioritize tasks , and to track their completion . in step 4140 , the mpn may allow the user to keep a journal . the user may be able to create text , audio , video , and other types of entries . in step 4150 , the personal organizer data stored by the mpn may be synchronized with another system , such as a software application running on a personal computer . appointments , contacts , tasks , and journal entries created on either system may be copied to the other system . this may allow the user to keep a permanent or backup copy of data created in the mobile system , and may also allow the user to take advantage of the keyboard , mouse , and full - sized monitor on the personal computer to enter significant amounts of information . in step 4160 , information may be shared with another mpn , as described above in conjunction with fig3 . fig4 shows more detail of step 4140 ( fig4 ), allowing the user to maintain a mobile electronic journal . all steps are optional and may be performed in any suitable order . in step 4210 , a user may be allowed to enter journal entries . entries may include voice in substep 4212 , text in substep 4214 , input from an electronic sketchpad in substep 4216 , or any other suitable type of entry or combination of entries . in step 4220 , the user may be allowed to capture a video image , for example using an inc that has digital camera hardware . if desired , the user may capture a video clip . in substep 4225 , the captured video image may be stored with a journal entry . for example , it may be stored in the same memory , and there may be a link from one to the other . in step 4230 , the journal entry may be automatically tagged with the current date and time if one of the incs in the mpn includes a clock . in step 4235 , the journal entry may be automatically tagged with the current location , if one of the incs in the mpn includes a position monitor such as a global positioning system ( gps ) monitor . in step 4240 , the user may be allowed to control functions of the journal using the audio input , if the mpn includes a speech recognition function . in step 4250 , a database may be downloaded into memory in the mpn . the database may include data of interest to the user , and may relate to topics to which the user may refer in the journal . for example , the database may include travel - related information , music - related information , school - related information , work - related information , or any other suitable data . in step 4255 , the user may be allowed to link a journal entry to a database element . in step 4260 , any journal entries stored in the mpn may be uploaded to a personal computer . this may include the voice , text , and drawing parts of the entries , as well as any linked images and time and location tags . it may also include links to any database elements that may be linked to the journal entries , or it may include the data from the database elements themselves . in step 4265 , the uploaded journal may be converted into a standard file format , so that it may be easily viewed or printed with the personal computer . the file format may include html , pdf , or any other suitable format . images and audio segments may also be stored in a common file format . the data may be loaded into a database on the personal computer if desired . fig4 a shows more detail of step 3208 ( fig3 ), providing a guidance function using an mpn . in step 4310 , the mpn may include a position monitor inc . this may be a gps monitor in substep 4312 . the system may also include an elevation monitor in substep 4314 , which may , for example , use barometric pressure readings . in step 4320 , the position monitor may be used to provide current user information . this may include current position in substep 4322 , current speed in substep 4324 , current elevation in substep 4326 , and current elevation gain in substep 4328 . if desired , the system may also collect direction information , for example from a compass , and provide direction information . in step 4330 , route guidance may be provided to a user . turning to fig4 b for greater detail of step 4330 , route guidance may include step 4331 , in which map information may be downloaded into memory in the mpn . the map information may be downloaded using the wireless communications device in one of the incs . alternatively , it may be loaded from a memory device , such as a cd - rom . in step 4332 , the user may be allowed to enter a desired location . for example , the user may enter an address or the name of a destination , the user may choose a destination from a list , the user may point to a destination on a map displayed on a touch screen , or the user may speak the desired location . in step 4333 , an inc in the mpn may calculate a route from the current location to the desired location . this may be done using any suitable algorithm or combination of algorithms that may compare various routes based on distance , estimated time , traffic , road conditions , or any other suitable criteria . if desired , the user may be allowed to enter criteria for choosing a route , or may be allowed to choose from multiple routes . in step 4334 , map information may be displayed . the map information may include the current location , the desired location , and / or all or part of the route between them . in step 4335 , the user &# 39 ; s current location may be displayed on the map . this may also include other information , such as the user &# 39 ; s direction and speed . in step 4336 , route guidance may be displayed . in addition to displaying the chosen route on the map , the system may provide , either visually or audibly , prompts informing the user of turns and other actions . the system may also make corrections to the route if the user misses a turn or otherwise does not follow the guidance . returning to fig4 a , in step 4340 , the system may collect and store position information as the user moves . this may include , for example , location , speed , and elevation , along with the time at which each measurement was taken . this step may also include substep 4341 , uploading the collected data to a base station or personal computer . the collected data may be saved in a database , displayed , or analyzed , by an inc of the mpn , by a base station , by a personal computer , by a computer accessed over a wide area network such as the internet , or in any other suitable location . in step 4342 , the user may be allowed to annotate the collected position data , or otherwise modify it . for example , the user may enter text , create a voice annotation , or capture a video image or segment . annotations may include information about a location , about the route , personal notes , images or video clips of sights seen , or any other information . if desired , the system may have a number of predefined annotations that may be quickly and easily entered by the user at any point . the system may store the annotation with the position information , and may create a link between the data items . the user may also be allowed to modify the collected data itself . the annotation or modification may be created as the position information is collected in substep 4343 , for example using an input device that may be an inc in the mpn . the annotation or modification may also be created after the position information has been collected in substep 4344 , for example using an input device connected to a personal computer . in step 4345 , the collected information may be correlated with map data . this may be done in the mpn , using map data stored in memory in an inc of the mpn , or on a personal computer after the position information has been uploaded . the position information , along with any annotations , may be displayed on a map , for example showing the route taken by the user . in step 4350 , position information may be correlated with simultaneously collected performance information . this may be useful in an mpn that is also used to support athletic workouts . for example , the route may be an athletic training route or an athletic competition route . the performance information may , for example , be speed in substep 4351 , heart rate in substep 4352 , cadence , or any other suitable performance data . the personal data may be stored with the position data , and the system may also store links between the two data items . this collected performance data may be displayed during the session . it may also be displayed or printed on a personal computer at a later time . it may be displayed in a table , in a graph , on a map , on an elevation profile , or any other suitable format . in step 4353 , performance data may be collected during multiple sessions . in step 4354 , the performance data may be compared between sessions . the comparison may be for the entire sessions , or for portions of the sessions following the same route . for example , a table or graph may be used to show the performance differences between two sessions . summary information , such as averages , may also be provided . information may be displayed on an inc of the mpn , on a personal computer after being uploaded , to a computer accessed via a wide area network such as the internet , or at any other suitable location . the collected position information may be used to recommend a route for a later session in step 4360 . for example , the mpn may store position information from one or more sessions , and may construct map data of routes that are available to the user . prior to or during a later session , the constructed map data may be used to plan a route for the user . the system may also use the collected performance data to plan the route . if desired , the route may be that of an upcoming athletic competition , and the system may be used to collect information about the route , such as elevation profile , distance of individual segments , landmarks , or other information of interest . in substep 4361 , a route may be recommended based on a desired workout intensity . for example , the system may use collected heart rate data or an elevation profile to choose a route with the desired difficulty . in substep 4362 , a user may specify a desired elevation profile , and the system may choose a route that most closely matches the user &# 39 ; s preference . in substep 4363 , the system may recommend a route based on a desired distance chosen by the user . if desired , the system may allow the user to specify any other suitable criteria , or combination of criteria , for route selection . in step 4365 , the mpn may provide directions or other guidance to the user during a session , based on the selected route . if desired , the guidance may be based on a route chosen ahead of time and downloaded . alternatively , the directions may be made dynamically , as specific decision points are reached . for example , a prompt to take a specific turn may be shown on the display inc or played through the audio output inc . the system may also make modifications to the recommended route if the user does not follow the prompts . if desired , the chosen route may be based on map and elevation information loaded from a cd - rom or other memory device or loaded from the internet or other network , rather than using position information collected by the user . position data collected in one session may also be used to simulate the same route in a later session . for example , a user may travel the route of an upcoming competition in one or more sessions and collect position and elevation information . this collected position and elevation information may be used to control exercise equipment in later sessions to simulate the racecourse . fig4 shows an illustrative mpn 4400 that may be used to provide guidance to an athlete . inc 4410 may be worn on a waistband , and may include a control unit , a gps monitor , an elevation sensor , user input controls , and a clock . inc 4420 may be worn on a wristband and may include a display device and an accelerometer . inc 4430 may be worn on a headband , and may include an audio output device . inc 4440 may be worn on a chest strap and may include a heart rate sensor . inc 4450 may be worn on an ankle band and may include an accelerometer . use of accelerometers mounted on the arm and leg to perform functions such as measuring cadence and providing form feedback is described in more detail below . incs shown are merely illustrative , and all incs are optional . fig4 a through 45l show examples of screens that may be provided by display inc 4420 in an mpn 4400 ( fig4 ) that may be used for guidance and athletic functions . fig4 a provides a display of the user &# 39 ; s current altitude . fig4 b provides a display of the user &# 39 ; s current geographical location . fig4 c provides a display of the user &# 39 ; s current speed . fig4 d provides a display of the user &# 39 ; s current rate of elevation change . fig4 e provides a display of the user &# 39 ; s heart rate . fig4 f provides a display of a route prompt . fig4 g provides a display of the user &# 39 ; s current cadence . fig4 h provides a display of the user &# 39 ; s current stride length . fig4 i provides a display of the current date and time . fig4 j provides a display of a session total time and partial time from a stopwatch function . fig4 k provides a display of an interval timer . fig4 l provides a display of a speed prompt . these screens are merely illustrative . any suitable information may be displayed , in any suitable format . if desired , any of this information may be sent to an audio output inc in addition to or instead of the display inc . fig4 through 49 show illustrative screens that may be displayed on a personal computer configured to interface with an mpn that provides guidance features and athletic features . fig4 shows session overview screen 4600 that may display collected position , performance , and annotation data for a session . graphs 4610 , 4620 , 4630 , 4640 , and 4650 , along with note line 4660 , may all be displayed relative to a common time line . graph 4610 may display elevation vs . time for the session or portion of session . graph 4620 may display speed vs . time for the session or portion of session . graph 4630 may display heart rate vs . time for the session or portion of session . graph 4640 may display stride length vs . time for the session or portion of session . graph 4650 may display cadence vs . time for the session or portion of session . the user may be allowed to click on any graph to view more details of the graphed data ( such as a chart of the data ). these graphs are merely illustrative . any suitable data may be graphed or charted . note line 4660 may display indicator to show the link between time and each annotation . for example , indicator 4662 may indicate that an audio annotation has been linked to that first specific time during the session . indicator 4664 may indicate that a video annotation may be linked to that second specific time during the session . indicator 4666 may indicate that a text annotation has been linked to that third specific time during the session . the user may be allowed to point the mouse at an indicator or click on it to view the actual annotation . menu bar 4670 may provide user access to various functions . for example , file menu 4672 may allow the user to save the session data , open a file with other session data , or perform other file related functions . notes menu 4674 may allow the user to perform functions related to annotations , such as adding a new annotation , modifying an annotation , deleting an annotation , or viewing an existing annotation . time menu 4676 may allow the user to perform time - related functions , such as modifying which time span from the session is graphed . view menu 4678 may allow the user to change the display to another view of the same data ( such as a chart ), or to any other display supported by the system . this may include , for example , allowing the user to select session comparison display 4700 of fig4 or map view 4800 of fig4 . the menu options described here are merely illustrative . any suitable menu options may be offered . for example , an option may be offered to allow the user to select which types of data to graph . fig4 shows session comparison screen 4700 that may display collected position , performance , and annotation data for multiple sessions or partial session in which the user followed the same route . graphs 4720 , 4730 , and 4740 may all be displayed relative to a common distance line . graph 4720 may display elevation vs . distance for the common route or portion of route . graph 4730 may display speed vs . distance for the first session or portion of session on date 4735 . graph 4740 may display speed vs . distance for the second session or portion of session on date 4745 . the user may be allowed to click on any graph to view more details of the graphed data ( such as a chart of the data ). these graphs are merely illustrative . any suitable data may be graphed or charted . summary region 4750 may display and compare summary data from the multiple sessions . for example , if speed data is graphed on the screen , the summary region 4750 may display average and maximum speed for the graphed segment of each session . menu bar 4710 may provide user access to various functions . for example , file menu 4712 may allow the user to save the session data , open a file with other session data , or perform other file related functions . time menu 4714 may allow the user to perform time - related functions , such as modifying which time span from the session is graphed . data menu 4716 may allow the user to perform data - related functions , such as modifying which data from the session is graphed . view menu 4718 may allow the user to change the display to another view of the same data ( such as a chart ), or to any other display supported by the system . this may include , for example , allowing the user to select session overview display 4600 of fig4 or map view 4800 of fig4 . the menu options described here are merely illustrative . any suitable menu options may be offered . for example , an option may be offered to view or modify annotations . fig4 shows map view screen 4800 that may display collected position , performance , and annotation data for a session or partial session in relation to a map . date field 4820 may display the date and / or time of the session being viewed . road indicator 4830 may show the roads , trails , and other fixed items from the region in which the session occurred . route indicator 4840 may be used to indicate the actual route followed by the user during the session . route indicator 4840 may have different characteristics to indicate different performance data . for example , there may be three different line styles used to indicate heart rate above a desired zone , within a desired zone , and below a desired zone . the number of line styles and the performance parameter shown are merely illustrative . any suitable data divided into any suitable number of zones may be drawn on the map . if desired , multiple performance parameters may be shown on the same map . the user may be allowed to click on the map to view more details of the data ( such as a chart or graph of the data ). note indicators may be displayed on the map to show the link between the route and each annotation . for example , indicator 4852 may indicate that an audio annotation has been linked to that first specific time during the session . indicator 4854 may indicate that a video annotation may be linked to that second specific time during the session . indicator 4856 may indicate that a text annotation has been linked to that third specific time during the session . the user may be allowed to point the mouse at an indicator or click on it to view the actual annotation . legend 4860 may display a legend of the line styles used for the road indicator and route indicator , along with any other information that may be displayed on the map . for example , a legend may be provided for the different styles of annotation indicator . menu bar 4810 may provide user access to various functions . for example , file menu 4812 may allow the user to save the session data , open a file with other session data , or perform other file related functions . notes menu 4814 may allow the user to perform functions related to annotations , such as adding a new annotation , modifying an annotation , deleting an annotation , or viewing an existing annotation . data menu 4816 may allow the user to perform data - related functions , such as modifying which data from the session is shown on the map . view menu 4818 may allow the user to change the display to another view of the same data ( such as a chart ), or to any other display supported by the system . this may include , for example , allowing the user to select session overview display 4600 of fig4 or session comparison display 4700 of fig4 . the menu options described here are merely illustrative . any suitable menu options may be offered . for example , an option may be offered to zoom into a portion of the route . fig4 shows session planning screen 4900 that may allow the user to enter desired attributes of an upcoming session , to allow the system to plan an appropriate route . for example , the user may be allowed to enter a desired total distance in screen region 4910 . screen region 4920 may allow the user to enter a desired total time for the session . screen region 4930 may allow the user to enter a desired elevation gain for the route . screen region 4940 may allow the user to enter a desired pace or speed for the session . screen region 4950 may allow the user to enter a desired heart rate or heart rate range for the session . these parameters are merely illustrative . any suitable parameters may be offered . the user may be allowed to enter a subset of desired parameters , and the system may create a route that best matches the entered parameters . menu bar 4960 may provide user access to various functions . for example , file menu 4962 may allow the user to save the session data , open a file with other session data , or perform other file related functions . maps menu 4964 may allow the user to perform functions related to maps , such as viewing maps of available routes , and selecting one or more preferred routes . the menu options described here are merely illustrative . any suitable menu options may be offered . for example , an option may be offered to view data from previous sessions . fig5 shows more detail of step 3210 of fig3 , providing an athletic function with an mpn . all steps are optional and may be performed in any suitable order . in step 5005 , the mpn may be used to control a workout . in step 5010 , the mpn may be used to control one or more sections of a workout . in step 5015 , the mpn may be used to collect data from a workout . in step 5020 , the mpn may be used to provide both music and audio workout cues , as described previously with respect to fig2 . in step 5025 , the mpn may be used to provide route guidance during a workout , as described previously with respect to fig4 a . in step 5030 , the mpn may measure an athlete &# 39 ; s cadence . in step 5035 , the mpn may measure an athlete &# 39 ; s stride length . in step 5040 , the mpn may be used to control a piece of exercise equipment , as described previously with respect to fig2 . in step 5045 , the mpn may be used to collect data from a piece of exercise equipment , as described previously with respect to fig2 . in step 5050 , the mpn may correct errors in collected athletic data . in step 5055 , the mpn may remind an athlete to consume a consumable . in step 5060 , the mpn may use previously stored data to estimate a performance parameter . in step 5065 , the mpn may provide for an athletic competition between two or more athletes , as described previously with respect to fig3 . in step 5070 , the mpn may provide for a coaching interface . in step 5075 , the mpn may count swimming laps . in step 5080 , the mpn may provide form feedback to an athlete . in step 5085 , the mpn may provide a training journal . more details of these embodiments are described below . these athletic uses of the mpn are merely illustrative . other athletic uses are possible if desired . fig5 shows flow chart 5100 of an illustrative process for providing workout control and feedback . all steps are optional and may be performed in any suitable order . in step 5110 , workout parameters may be defined . the parameters may be defined , for example , on a coach &# 39 ; s computer or on an athlete &# 39 ; s computer . the parameters may be entered by a user such as the coach or athlete , or they may be generated automatically by a coaching software application . the parameters may define aspects of a planned workout , such as its type , duration , intensity , etc . in step 5120 , if the workout parameters were defined on a coach &# 39 ; s computer , they may be downloaded to the athlete &# 39 ; s computer . in step 5125 , the parameters may be downloaded from the athlete &# 39 ; s computer to an inc in the mpn , such as a control unit . in step 5130 , the inc may control aspects of the workout session , using an output inc in the mpn . in step 5140 , the inc may collect workout results from an input inc in the mpn . in step 5150 , the workout results may be uploaded to the athlete &# 39 ; s computer . in step 5155 , the workout results may be uploaded to the coach &# 39 ; s computer . in step 5160 , the workout results may be stored , for example on the athlete &# 39 ; s computer or the coach &# 39 ; s computer . in step 5170 , the workout results may be analyzed , for example on the athlete &# 39 ; s computer or the coach &# 39 ; s computer . for example , the workout results may be displayed , or may be compared with workout results from other workout sessions . in step 5180 , the workout results may be used to determine parameters for one or more upcoming workout sessions , for example on the athlete &# 39 ; s computer or the coach &# 39 ; s computer . fig5 shows a block diagram of an illustrative system 5200 for communicating between a personal computer 5210 and a control unit 5240 that is an inc in an mpn . personal computer 5210 may have communications device 5220 , control unit 5240 may have communications device 5250 , and they may communicate using communication path 5230 . communication path 5230 may be a wireless radio frequency link , an infrared link , a docking station link , a usb link , a serial port link , or any other suitable type of communications path . control unit 5240 may include processor 5260 for executing software related to controlling a workout , collecting workout results , communicating with personal computer 5210 , and communicating with other incs in the mpn . control unit 5240 may also include memory 5270 for holding software , downloaded workout parameters , and collected workout results . fig5 shows a block diagram of an illustrative mpn 5300 for controlling aspects of an athletic workout and collecting results from a workout . control unit 5240 may be the same control unit shown in fig5 , and may be configured to communicate with a personal computer as shown in that fig . it may also have wireless communications device 5310 for communicating with other incs in mpn 5300 over wireless communication path 5350 , such as data collection inc 5320 and output inc 5330 . if desired , wireless communications device 5310 may be the same as communications device 5250 . if desired , control unit 5240 may be omitted , and its functions may be assumed by other incs in the mpn . data collection inc 5320 may have wireless communication device 5322 for sending collected data to control unit 5240 or other inc having storage capabilities . it may also have data collection circuit 5324 . data collection circuit 5324 may collect any athletic data , such as speed , heart rate , power , resistance , location , cadence , or any other suitable type of athletic data . data collection inc 5320 may be worn by the athlete . if desired , data collection inc 5320 may be mounted on a piece of athletic equipment or a bicycle and may collect data from that equipment . output inc 5330 may have wireless communication device 5332 for receiving control commands from control unit 5240 or other suitable inc . it may also have output circuit 5334 . output circuit 5334 may output athletic control data using any appropriate method , such as displaying a prompt to the user , outputting a prompt to the user , controlling resistance , controlling speed , or any other suitable type of athletic control . output inc 5330 may be worn by the athlete . if desired , output inc 5330 may be mounted on a piece of athletic equipment or a bicycle and may send control commands to that equipment . fig5 shows how mpn 5300 ( fig5 ) may communicate with an athlete &# 39 ; s personal computer 5210 and a coach &# 39 ; s personal computer 5410 . athlete &# 39 ; s personal computer 5210 may communicate with coach &# 39 ; s personal computer 5410 using any suitable network 5415 , such as the internet . either computer may connect with network 5415 using connection 5412 and 5418 , such as a telephone modem , a cable modem , a digital subscriber line modem , or any other suitable type of connection . as shown previously , athlete &# 39 ; s personal computer 5210 may connect to control unit 5240 , and control unit 5240 may send commands to athletic output inc 5330 and collect data from athletic data collection inc 5320 . if desired , connections may not all be in place simultaneously . for example , at a first time , coach &# 39 ; s computer 5410 may be connected to network 5415 , and workout parameters may be uploaded to a web server . at a second time , athlete &# 39 ; s computer 5210 may be connected to network 5415 , and workout parameters may be downloaded from the web server . at a third time , athlete &# 39 ; s personal computer 5210 may be connected to control unit 5240 , and workout parameters may be downloaded into control unit 5240 . at a fourth time , which may be during a workout session , the control unit 5240 may send control commands to athletic output inc 5330 and may receive data from athletic data collection inc 5320 . at a fifth time , workout results may be uploaded from control unit 5240 to athlete &# 39 ; s personal computer 5210 . at a sixth time , workout results may be uploaded from athlete &# 39 ; s personal computer 5210 to a web server in network 5415 . at a seventh time , workout results may be downloaded from the web server in network 5415 into coach &# 39 ; s computer 5410 . if desired , data may be sent directly between coach &# 39 ; s computer 5410 and athlete &# 39 ; s computer 5210 , rather than using a web server to store data sent from one to the other . if desired , control unit 5240 may be omitted , and athlete &# 39 ; s personal computer 5210 may connect directly to athletic output inc 5330 and athletic data collection inc 5320 or storage inc ( not shown ). fig5 shows illustrative mpn 5500 that may be used to provide control of an athletic workout and collect workout results . inc 5510 may be a control unit , and may be worn by the athlete . inc 5515 may be an athletic data collection inc worn by the athlete , and may include a heart rate sensor . inc 5520 may be an athletic output inc worn by the athlete , and may include an audio output inc . inc 5525 may be an athletic output inc mounted on a bicycle , and may include a display inc . inc 5530 may be an athletic data collection inc mounted on a bicycle , and may include a pedal cadence sensor . inc 5535 may be an athletic data collection inc mounted on a bicycle , and may include a wheel speed sensor . inc 5540 may be an athletic output inc mounted on a bicycle training stand , and may include resistance control device . during a workout , the control unit may control aspects of the workout by changing the cycling difficulty using inc 5540 , and by providing prompts to the athlete using inc 5520 and inc 5525 . prompts may include , for example , prompts to pedal faster , slower , harder , or easier , to stand or sit , to pedal with one leg or both legs , or any other suitable prompts . incs shown are merely illustrative , and each inc is optional . fig5 shows a flow chart of an illustrative process 5600 for managing a workout plan . all steps are optional and may be performed in any suitable order . the workout plan may be managed using software on athlete &# 39 ; s computer 5210 or coach &# 39 ; s computer 5410 ( fig5 ). in step 5610 , a workout goal may be defined . this may include a specific date in substep 5612 , a specific upcoming competition in substep 5614 , a specific performance goal in substep 5616 , a specific health goal in substep 5618 , or any other suitable type of goal . if desired , multiple goals may be defined . in step 5620 , a workout plan may be defined based on the workout goal . this may include different types of workouts , different periods of time with specific sub - goals , or other suitable plan . in step 5625 , a workout session may be defined . that may include a type of workout , duration , intensity , repetitions , or any other suitable parameters . as many parameters as desired may be created for each workout . the workout plan may include tracking of multiple planned workout sessions . in step 5630 , the workout parameters may be downloaded from the coach &# 39 ; s computer or athlete &# 39 ; s computer into an inc of the mpn , such as a control unit or storage inc . in step 5635 and step 5640 , during a workout session , aspects of the workout may be controlled and data may be collected . in step 5645 , workout results may be uploaded . this may include storing results on the athlete &# 39 ; s computer or the coach &# 39 ; s computer . results may be stored for multiple workout sessions . this may include storing the parameters that were used to define the workout sessions , as well as data collected during the sessions . in step 5650 , workout results may be displayed for the athlete or coach . in step 5655 , workout results may be analyzed . this may include comparing results between multiple workout sessions . in step 5660 , the workout results may be used to modify one or more parameters for an upcoming workout session . workout results may include data collected during a workout , as well as the workout parameters used during the workout session . workout results may include information on missed workout sessions . workout results may also include related information such as athlete health information , athlete eating and drinking records , athlete &# 39 ; s resting heart rate , and other auxiliary information . for example , a future workout may be made easier or harder depending on the results of the workout . in another example , if the time of a workout session was changed , an upcoming session may also be moved or canceled . if desired , in substep 5665 , rules may be applied to restrict how future workout modifications may be made . for example , a rule may restrict the system from scheduling two workouts of the same type on the same or consecutive days . as another example , the intensity , difficulty , or duration may not be allowed to increase more than a fixed percentage , such as ten percent . and in step 5670 , the results of all workouts in a plan may be tracked as they occur . the coach or athlete may be allowed to view historical data , to view trends and improvements , or compare the results of two or more workout sessions . this may also include comparing the collected workout results to the workout plan goal or goals . if desired , other data , such as data entered by the coach or athlete , may be compared with the workout plan goal . in fig5 , more details are shown of step 5625 ( fig5 ), defining the workout parameters . all steps are optional and may be performed in any suitable order . in step 5710 , the day and time of a workout may be defined . the workout time may be defined with any suitable degree of specificity , such as any time within a week , any time within a three day period , any time on a specific day , before or after a different workout , or at a specific hour . in step 5720 , the type of workout may be defined . this may include a general workout type , such as running , cycling , swimming , weightlifting , rowing , or the like . it may also include a style of workout , such as endurance , speed work , interval training , fartlek (“ speed play ”— bursts of speed during a training run ) training , hill work , strength training , or any other suitable style . in step 5730 , the duration of the workout may be defined . the duration may be measured in time , distance , or any other suitable units . the duration may be expressed as a range , if desired . in step 5740 , the workout may be divided into sections . each section may have its own goal , such as warm up , increasing anaerobic threshold , recovery , increasing endurance , cool down , or any other suitable goal . each section may be provided its own set of workout parameters . for example , in step 5750 , target intensity may be defined for a section . in step 5760 , target heart rate , speed , power , cadence , or any other parameter to be controlled may be defined for the section . if desired , multiple parameters to be controlled may be defined . if desired , the desired profile of the parameter or parameters during the section may be specified . if desired , a section may be defined with no parameter to be controlled . for example , the desired heart rate for a section may be 100 beats per minute at the start of the section , and may increase linearly to a value of 130 beats per minute at the end of the section . in step 5770 , the duration of each section may be defined . the duration may be measured in units of time , units of distance , or any other suitable units . in step 5780 , the controlling parameter for the section may be defined . for example , to control the heart rate , the athlete &# 39 ; s speed may be controlled by sending audible prompts , the speed may be controlled by sending commands to a piece of exercise equipment , or the resistance may be controlled by sending commands to a piece of exercise equipment . if desired , multiple controlling parameters may be specified . if desired , limits on the values or rate of change of the controlling parameter may be specified . in step 5790 , repetitions of sections may be defined . for example , two sections may be alternated , and the combination may be repeated four times . any other suitable attributes of a section may also be defined . if desired , the definition of one section may be copied from the definition of another section . fig5 shows illustrative screen 5800 that may be shown on athlete &# 39 ; s computer or coach &# 39 ; s computer for defining a workout . region 5810 may be used to enter the total number of sections . region 5820 may be used to enter the duration of a section , in this example in minutes . selection 5830 may be used to choose the parameter to be controlled . in this example , heart rate has been chosen , and other choices are cadence , power , and speed . the user may also choose to control no parameter during the section . selection 5840 may allow the user to specify the type of control , such as constant , between two values , linear , or on a defined curve . in this example , the user has chosen linear control . in region 5850 , the user may enter the value or values at which to control the parameter . in this example , the user has entered a desired starting and ending heart rate for the section . selection 5860 may allow the user to specify the controlling parameter , such as controlling heart rate by controlling speed or difficulty . in this example , the user has chosen difficulty as the controlling parameter . scroll bar 5880 may allow the user to view and modify more fields , such as parameters for other sections in the workout . menu bar 5870 may allow the user to access other features , such as file features ( e . g ., save and loading workout session definition files ), edit features , download features ( e . g ., downloading workout definitions from a coach &# 39 ; s computer or to an inc of the mpn ), and help features . fig5 shows illustrative data structure 5900 that may be used to store information about a workout session . this data structure or a similar structure may be stored in a personal computer , in memory in an inc of the mpn , or in any other suitable location . if desired , similar information may be stored in multiple data structures . a workout session may consist of multiple “ super sections ,” wherein each super section consists of one or more sections , and wherein each super section may be repeated multiple times . data structure 5900 may include a definition of the number of super sections 5910 . it may also include the definition of each super section , such as super section definition 5920 , super section definition 5940 , and super section definition 5960 . each super section definition may include a definition of number of sections in the super section , such as definition 5921 , definition 5941 , and definition 5961 . each super section definition may include a definition of number of times the super section is to be repeated during the workout session , such as definition 5922 , definition 5942 , and definition 5962 . section a definition 5925 may specify that the section is to have a duration of 15 minutes in duration definition 5926 . it may specify that the heart rate is to be controlled in primary parameter definition 5927 , and that the heart rate is to follow a linear curve from 100 beats per minute to 125 beats per minute in curve definition 5928 . it may specify a secondary parameter of cadence , which is to be kept at a rate of 90 revolutions per minute in secondary parameter specification 5929 . it may specify in controlling parameter definition 5930 that the heart rate is to be controlled by user audio prompt . in this definition , section a is to occur once during the workout session . section b definition 5945 may specify that the section is to have a duration of 5 minutes in duration definition 5946 . it may specify that the heart rate is to be controlled in primary parameter definition 5947 , and that the heart rate is to be maintained in a range between 150 beats per minute and 160 beats per minute in curve definition 5948 . it may specify a secondary parameter of cadence , which is to be kept at a rate of 90 revolutions per minute in secondary parameter specification 5949 . it may specify in controlling parameter definition 5950 that the heart rate is to be controlled using a resistance setting output . section c definition 5955 may specify that the section is to have a duration of 1 minute and 30 seconds in duration definition 5956 . it may specify that speed is to be controlled in primary parameter definition 5957 , and that the speed is to be maintained below 15 miles per hour in curve definition 5958 . it may specify a secondary parameter of resistance , which is to be kept at the easy setting in secondary parameter specification 5959 . it may specify in controlling parameter definition 5960 that the speed is to be controlled by user audio prompt . in this definition , section b and section c are combined into a single super section , which is to occur twice during the workout session . section d definition 5975 may specify that the section is to have a duration of 15 minutes in duration definition 5976 . it may specify that the heart rate is to be controlled in primary parameter definition 5977 , and that the heart rate is to be maintained at a constant rate of 110 beats per minute in curve definition 5978 . it may specify a secondary parameter of cadence , which is to be kept at a rate of 90 revolutions per minute in secondary parameter specification 5979 . it may specify in controlling parameter definition 5980 that the heart rate is to be controlled by user audio prompt . in this definition , section d is to occur once during the workout session . fig6 shows flow chart 6000 of an illustrative process for controlling multiple sections of a workout . all steps are optional and may be performed in any suitable order . in step 6010 , an athletic workout session may be defined as multiple sections . this workout definition may occur , for example , on an athlete &# 39 ; s computer or on a coach &# 39 ; s computer . in substep 6012 , the definition may specify that a section is to be repeated multiple times during a workout session . the repetitions do not have to be consecutive . in substep 6014 , groups of sections , such as super sections , may be repeated multiple times . in substep 6016 , one section may be a copy of another section , in the same workout or in another workout . in substep 6018 , one section may be a variation of another section , in the same workout or another workout . in substep 6020 , the starting value of a parameter in one sections may be specified as the ending value of the same parameter in the previous section . in step 6030 , the workout parameters for each section may be defined . this may include substep 6032 in which a performance parameter to be controlled may be specified . this may include , for example , heart rate , cadence , power , or speed . in substep 6034 , the desired value , values , or profile of the performance parameter to be controlled may be specified . this may include specifying a constant level , a defined curve , the end points of a linear variation , or two values to maintain the parameter between . if desired , a range above and below the desired curve may be defined . in substep 6036 , an output parameter to be used to control the performance parameter may be specified . in substep 6038 , one or more secondary performance parameters with corresponding desired values may be specified . in substep 6040 , the duration of the section may be specified , for example , in time or distance . after all workout parameters have been defined , they may be downloaded from the coach &# 39 ; s computer or athlete &# 39 ; s computer into memory in an inc of the mpn , such as a control unit , for use during the workout . if desired , the workout parameters may be transmitted directly from the coach &# 39 ; s computer into an inc of the mpn , or they may be transmitted over a wide area network such as the internet to the athlete &# 39 ; s computer , and downloaded from the athlete &# 39 ; s computer into an inc of the mpn . in step 6050 , data may be collected during the section of the workout session . that may include heart rate data in substep 6052 , speed data in substep 6054 , position data in substep 6056 , cadence data in substep 6058 , power data in substep 6060 , data from a sensor mounted on a piece of exercise equipment in substep 6062 , data from a sensor mounted on a bicycle in substep 6064 , or any other suitable type of input data . data collected during a workout may be presented to the athlete during the workout , for example on a display inc . if desired , collected data may be uploaded to a base station , the athlete &# 39 ; s personal computer or the coach &# 39 ; s personal computer , where they may be stored , displayed as a chart or graph , compared with results from previous workouts , or otherwise analyzed . if desired , collected workout results may be used to modify workout parameters of future workout sessions . in step 6070 , a performance parameter may be controlled during the section of the workout session . this may be done by prompting the user in substep 6072 . the prompt may be a visual prompt in substep 6074 or an audible prompt in substep 6076 . in substep 6078 , the prompt may be to change speed , change intensity or level of effort , change route , or any other suitable prompt . in substep 6080 , the control may be performed by changing a setting , such as a difficulty , speed , or resistance setting , on an output inc . in substep 6082 , the control may be performed by changing a setting on a piece of exercise equipment . in substep 6084 , the control may be performed using a position - integral - derivative ( pid ) servo algorithm , in which the value of an input parameter , the rate of change of the input parameter , and previous values of the input parameter are used to calculate a new value for the controlling parameter . the system may also include a set of limits on the output value to prevent it from exceeding a minimum value , a maximum value , and / or a maximum rate of change . in substep 6086 , the input data used in the algorithm may be data that was collected in step 6050 , and the definition of the input parameter and the controlling parameter may be part of the workout parameters that were defined in step 6030 . the constants in the servo equation may be standard values , may be entered or downloaded by a user , or may be derived and modified with use . in substep 6088 , one or more additional parameters may be controlled during the workout section , as specified in the workout parameters . for example , a secondary parameter may be maintained between two values in substep 6090 , maintained at a constant level , controlled linearly , or controlled in any other suitable fashion . in addition to directly collecting data to measure a performance parameter , an mpn may use stored information along with collected information to estimate a derived performance parameter . a process for doing so is illustrated in flow chart 6100 of fig6 . all steps are optional and may be performed in any suitable order . in step 6110 , previously collected personal data may be stored in an inc of the mpn . the personal data may be age in substep 6112 , gender in substep 6114 , weight in substep 6116 , resting heart rate in substep 6118 , maximum heart rate in substep 6120 , vo 2 max in substep 6122 , results ( e . g ., time and distance or speed and distance ) from a previous athletic effort in substep 6124 , or any other suitable personal data . the personal data may have been collected using an inc of the mpn , in step 6130 . alternatively , the personal data may have been downloaded in step 6135 , for example from an athlete &# 39 ; s computer or from a coach &# 39 ; s computer , where it may have been entered . in step 6140 , primary performance data may be collected , for example by an inc of the mpn during an athletic effort . the data may be a single sample , or it may be many samples collected over a period of time . in step 6150 , a secondary performance parameter may be estimated using the stored personal data and the collected primary performance data . in substep 6162 , maximum heart rate ( mhr ) may be calculated . mhr is the maximum rate at which the athlete &# 39 ; s heart can beat during a maximal effort , and is commonly measured in beats per minute . the mhr value may be entered by the user as personal data . the mhr may be estimated by the system based on the age and gender entered by the user . for example , mhr is commonly estimated as 220 - age in years . alternatively it may be estimated as 214 -( age * 0 . 8 ) for males and 209 -( age * 0 . 7 ) for females . another method of estimating mhr is 210 -( 0 . 5 * age )−( 0 . 05 * weight in pounds )+( 4 if male or 0 if female ). the estimate may be modified based on the specific type of activity or other factors . alternatively , mhr may be estimated based on actual heart rate measurements in a defined athletic effort . resting heart rate ( rhr ) may be entered by the athlete as personal data or it may be measured . rhr is a measure of the rate at which the athlete &# 39 ; s heart beats when at complete rest , and is also measured in beats per minute . rhr may be estimated based on actual heart rate measurements taken over a period of time , for example while the athlete is asleep . regardless of how mhr was entered , measured or estimated , the percent of maximum heart rate may be estimated by dividing actual heart rate ( hr ) by mhr , in substep 6154 . percent of heart rate reserve may be estimated as ( hr - rhr )/( mhr - rhr ), in substep 6156 . another performance parameter of interest to athletes is oxygen uptake ( vo 2 ) and maximum oxygen uptake ( vo 2 max ). vo 2 is a measure of the amount of oxygen removed from the blood and used by the muscles during an athletic effort . vo 2 max is a measure of the maximum amount of oxygen that can be used by the athlete during an effort . both are commonly measured in units of ml / kg / min . although the actual measurement of vo 2 requires sophisticated equipment , there are several known methods to estimate it . for example , in “ jack daniels , conditioning for distance running — the scientific aspects ,” wiley & amp ; sons , 1978 , the following formulas are used : in the above formulas , t is the time to complete a race - level effort in minutes , and v is the speed during the race in meters per minute . oxygen uptake may be estimated during an athletic effort in substep 6152 , using the above formula or any other suitable method . vo 2 max may similarly be estimated in substep 6166 . the system may also estimate the speed , heart rate , or other parameter corresponding to the level of effort at which vo 2 max is reached . if desired , time and speed data may have been entered by the athlete as personal data , or may be measured by the mpn . in substep 6158 , the system may estimate energy consumed during an athletic effort . energy consumption may be expressed in calories , and may be estimated based on age , gender , height , and weight , which may be entered as personal data . it may also be estimated based on type of activity , hr , speed , elevation gain , and other factors that may be measured during an athletic effort . similarly , the power exerted while exercising may be estimated in substep 6160 . lactate threshold ( lt ) may be estimated in substep 6164 . lt represents the highest level at which exercise may be maintained for an extended period without a build - up of lactate in the blood . it may be measured , for example as a percent of vo 2 max or a percent of mhr above which lactic acid begins to accumulate in the blood . it may be estimated , for example , by using the average heart rate for a maximal athletic effort over a half hour . alternatively , it may be estimated by measuring heart rate during a series of progressively more difficult efforts , and based on the rate of increase of heart rate between the efforts . in step 6170 , the estimated secondary parameter may be used to modify an athletic workout . for example , the intensity of a workout may be expressed as percent of lt , and during the workout the system may measure heart rate , estimate lt , and increase or decrease the speed setting of a piece of exercise equipment to maintain the proper level of effort . in step 6175 , the user may be prompted to modify the level of effort based on an estimate of a secondary performance parameter . for example , the intensity of a workout may be expressed as percent of vo 2 max , and during the workout the system may measure heart rate , estimate vo 2 , and prompt the user to speed up or slow down to maintain the proper level of effort . the estimated secondary parameter may also be displayed for the user by the mpn , or it may be uploaded to a base station or personal computer to be stored , displayed , or analyzed . fig6 shows illustrative mpn 6200 that may be used to measure a primary performance parameter and estimate a secondary performance parameter . inc 6210 may be a control unit or other inc with memory and processing capabilities , and may include software to control the other incs , as well as to perform the estimation . it may also include memory to hold software , as well as downloaded personal data such as age , gender , and weight . it may also include a communications device to download the personal data . inc 6220 may be a display inc , on which the primary and secondary performance parameters may be displayed . inc 6230 may be a heart rate sensor , used for monitoring the athlete &# 39 ; s heart rate , which may be a primary performance parameter . inc 6240 may be an accelerometer for measuring cadence , which may also be a primary performance parameter . inc 6250 may be an audio output inc , which may be used to prompt the user to modify the level of effort based on the estimated secondary performance parameter . these incs are merely illustrative , and all incs are optional . fig6 shows illustrative display screen 6300 that may be displayed by the athlete &# 39 ; s personal computer to allow the entry of personal data . it may include entry region 6310 for entering the athlete &# 39 ; s name . it may include entry region 6320 for entering the athlete &# 39 ; s age . it may include entry region 6330 for entering the athlete &# 39 ; s weight . it may include selection 6340 for entering the athlete &# 39 ; s gender . it may include entry region 6350 for entering the athlete &# 39 ; s height . it may include entry region 6360 for entering the athlete &# 39 ; s rhr . it may include entry region 6370 for entering the athlete &# 39 ; s mhr . these fields are merely illustrative . any suitable personal data may be entered on a screen such as display screen 6300 . display screen 6300 may also include menu bar 6380 , which may allow the user to perform other functions . other functions supported may include file - related functions ( e . g ., loading and storing personal data ), device - related functions ( e . g ., downloading personal data to a device ), system - related functions , user - related functions , security - related functions , and help - related functions . these functions are merely illustrative . fig6 a through 64f show illustrative display screens that may be displayed by a display inc in an mpn during an athletic effort . fig6 a shows screen 6410 , which may be a prompt for the athlete to go faster , and may be based on an estimated secondary performance parameter . fig6 b shows screen 6420 , which may display the athlete &# 39 ; s currently measured heart rate 6422 , percent of mhr 6424 , and percent of hrr 6426 . fig6 c shows screen 6430 , which may display the estimated vo 2 max 6432 , lt 6434 , and mhr 6436 at the end of a testing effort . fig6 d shows screen 6440 , which may display the athlete &# 39 ; s estimated vo 2 during or after an effort . fig6 e shows screen 6450 , which may display the athlete &# 39 ; s cumulative energy consumption for a workout 6452 and current power exertion 6454 . fig6 f shows screen 6460 , which may show the athlete &# 39 ; s current actual percent of hrr 6462 , the target hrr range for the workout 6464 , and a prompt to the athlete 6466 to modify the level of effort based on those values . as described herein , the mpn may be used to collect data , such as heart rate and other athletic data . however , at times the data collection may be unreliable , for example because of interference with the wireless communications between incs in the mpn . temporary interference may be common because of nearby electro - mechanical devices , other radio frequency transmitters , poor contact between a metabolic sensor and the skin , and even static electricity between the athlete &# 39 ; s body and clothing . one way of handling this is by including memory in the data collection inc , and retransmitting any lost data once the interference is gone . however , this may not be practical , as it may significantly increase the cost of the data collection inc . also , at times data samples may not be collected successfully by the data collection inc , due to such factors as intermittent connections between the inc and the athlete &# 39 ; s body . therefore , the mpn may include algorithms to recognize invalid data samples and to estimate new values for the invalid samples . fig6 shows illustrative mpn 6500 that may be used to collect data and that may include detection of invalid data and estimation of replacement data for the invalid data . control unit 6520 may collect data samples from heart rate monitor 6530 using wireless communication path 6550 and store the collected heart rate data in memory in control unit 6520 . control unit may display heart rate data on display 6540 . control unit 6520 may detect invalid data received from heart rate monitor 6530 , perhaps due to a failure in communication path 6550 , and may estimate replacement data to store and to send to display 6540 . collected heart rate data may also be uploaded to personal computer 6510 and stored there . personal computer 6510 may recognize invalid samples , and may estimate replacement data for the invalid data samples . the collected heart rate data , including any estimated replacement data may be displayed on a monitor attached to personal computer 6510 . incs shown are merely illustrative . all incs are optional . fig6 shows flow chart 6600 of an illustrative process for estimating replacement data for invalid collected data . all steps are optional and may be performed in any suitable order . in step 6610 , data samples , such as athletic performance data samples , may be collected by an mpn . this may be , for example , heart beat data in substep 6612 , or heart rate data in substep 6614 . any suitable type of data may be collected . in step 6620 , one or more invalid samples may be recognized . the invalid samples may be recognized , for example , by a control unit while data is being collected or by a personal computer after collected data has been uploaded . in substep 6621 , invalid samples may be recognized on the basis of missing values . in substep 6622 , invalid samples may be recognized on the basis of zero values , i . e ., samples with the value of zero . in substep 6623 , invalid samples may be recognized on the basis of values outside a defined range , for example , heart rate data lower than the resting heart rate or greater than the maximum heart rate . in substep 6624 , invalid samples may be recognized on the basis of a rapid change in values , for examples values that indicate a very significant change in heart rate in a very short period of time . in substep 6625 , invalid samples may be recognized on the basis of values inconsistent with other data , for example significantly different from samples collected before and after , or for example heart rate data inconsistent with collected speed and elevation data . in step 6630 , replacement values may be estimated for the invalid samples . replacement values may be interpolated based on valid samples collected before , after , or both before and after the invalid samples in substep 6631 . replacement values may be interpolated linearly in substep 6632 . replacement values may be interpolated based on the first derivative of valid samples in substep 6633 . replacement values may be interpolated linearly based on the first derivative in substep 6634 . replacement data may be interpolated using a quadratic equation in substep 6636 . replacement data may be interpolated using a polynomial equation in substep 6638 , and may match the values and / or derivatives of valid samples at the end points of the interpolation range . the data may also be estimated based on data collected in previous sessions under similar conditions , for example , the rate of change of the data may be made to match the rate of change of data collected in the similar session . in step 6640 , the data samples may be listed , for example on personal computer 6510 ( fig6 ). in substep 6642 , estimated samples may be indicated in the listing . in step 6645 , the data samples may be graphed , for example on personal computer 6510 . in substep 6647 , estimated samples ranges may be indicated in the graph . in step 6650 , secondary data may be derived from the collected data . in step 6652 , the secondary data may be listed , for example on personal computer 6510 . in substep 6654 , secondary data values derived from estimated samples may be indicated in the listing . in step 6656 , the secondary data may be graphed , for example on personal computer 6510 . in substep 6658 , secondary data values derived from estimated samples ranges may be indicated in the graph . fig6 shows an example 6700 of heart beat data that may have been collected by an mpn . the data may include samples 6705 through 6740 . it may be seen that each sample is approximately 0 . 5 seconds after the previous , with the exception of sample 6725 . this sample was collected almost three seconds after the previous sample , indicating that samples were likely lost . by interpolation , it may be estimated that five samples were missed , and the user &# 39 ; s heart rate may be estimated at about 122 beats per minute during this time by dividing the number of samples by the time . fig6 a and 68b illustrate how samples may be estimated to replace invalid samples . fig6 a shows illustrative heart rate sample data 6800 that may have been collected at a regular interval , such as every 15 seconds . in this example , heart rate data is increasing at a rate of eight beats per minute per minute in first sample range 6805 . heart rate data samples are all zero and are assumed to be invalid in second sample range 6810 . heart rate data is increasing at a reduced rate of four beats per minute per minute in third sample range 6815 . heart rate data samples are all out of range and are assumed to be invalid in fourth sample range 6820 . and heart rate data is decreasing at a rate of one beat per minute per minute in fifth sample range 6825 . fig6 b shows how replacement values may be created for the invalid samples , creating revised heart rate sample data 6830 . range 6835 , which corresponds to range 6810 in the original data , has been filled using a linear interpolation between samples collected just prior to and just after the invalid data in range 6810 . similarly , range 6840 , which corresponds to range 6820 in the original data , has been filled using a linear interpolation between samples collected just prior to and just after the invalid data in range 6820 . fig6 a shows illustrative display screen 6900 , which lists and graphs collected sample heart rate data . sample data list 6905 may include estimated samples 6910 . estimated samples may be marked as estimated , for example with an asterisk . the sample data may also be shown in graph 6915 . range 6920 of the graph , corresponding to the estimated data , may be drawn with a different line style to indicate that the samples were estimated . fig6 b shows illustrative display screen 6950 , which lists and displays average heart rate data derived from the collected heart rate data samples . data list 6955 may include data point 6960 and 6970 derived from estimated samples . estimated data may be marked as estimated , for example with an asterisk . the derived data may also be shown in graph 6965 . values 6960 and 6970 on the graph , corresponding to the data derived from estimated samples , may be marked , for example with an asterisk , to indicate that data is estimated . an mpn may also be used to provide an athlete , such as a runner or walker , with cadence information and stride length information . fig7 shows flow chart 7000 of an illustrative process for providing this information . all steps are optional and may be performed in any suitable order . in step 7010 , an accelerometer may be provided as an inc in the mpn . the accelerometer may send acceleration data to a control unit or other inc with storage capabilities at regular intervals . if desired , multiple accelerometers may be used to measure motion by different parts of the body , or components of motion in different directions . in step 7020 , the accelerometer may be worn by the user . for example , it may be worn on the leg in substep 7022 , the foot in substep 7024 , the arm in substep 7026 , or the hand in substep 7028 . in step 7030 , the accelerometer may be used to measure cadence . for example , a control unit may collect the data from the accelerometer , and measure the frequency at which the data reaches its relative maximums and minimums . this may correspond to the rate at which the user is swinging his or her arms or moving his or her legs , which translates directly to cadence . in step 7040 , a position monitor may be provided as an inc in the mpn . the position monitor may be a gps monitor in substep 7042 . the position monitor may send position data to a control unit or other component with storage capabilities at regular intervals . the position monitor may also be worn by the user . in step 7050 , the position monitor may be used to measure the user &# 39 ; s speed , which can be calculated as distance traveled divided by time . in step 7060 , stride length may be calculated based on the speed and cadence of the user . in substep 7062 , the stride length may be calculated as speed divided by cadence . if desired , the units of stride length displayed to the user may be converted to feet , meters , or other appropriate units . if desired , any of speed , cadence , and stride length may be displayed for the user . fig4 g shows an example of how cadence may be displayed on a display inc in the mpn . fig4 h shows an example of how stride length may be displayed on a display inc in the mpn . if desired , any of speed , cadence and stride length may be recorded for the duration of a session , and uploaded to a personal computer or base station for storage , display , or analysis . fig4 shows illustrative mpn 4400 that may be used to calculate and display cadence and stride length . a significant impact on athletic performance is the loss of certain valuable consumables by the athlete during a training or competition event . for example , as the user continues at a high level of exertion , levels of water , sodium , carbohydrates , and other nutrients will decrease , and performance will correspondingly decrease . as levels decrease further , performance levels will decrease at an even higher rate , until the athlete is no longer able to continue . however , if the athlete consumes too much of any of these consumables , performance will also suffer , with conditions such as stomach distress and cramping , hyponatremia , and hypernatremia . the mpn can be used to measure the usage or loss of such consumables , and provide the athlete with reminders to take in specific amounts of one or more of them . fig7 shows flow chart 7100 of an illustrative process for providing consumption reminders to an athlete . all steps are optional and may be performed in any suitable order . in step 7110 , metabolic data may be collected from a user such as an athlete . for example , an inc in an mpn may include a sensor to measure a specific metabolic value . in substep 7112 , heart rate data may be collected . in substep 7114 , skin resistance data may be collected . in substep 7116 , body temperature data may be collected . in substep 7118 , blood pressure data may be collected . in step 7120 , the loss of a consumable may be estimated based on the metabolic data . for example , water may be estimated in substep 7122 , carbohydrates in substep 7124 , and sodium in substep 7126 . a rate of loss of each consumable based on level of effort indicated by heart rate may be used skin resistance may be used to measure the amount of sweat , which translates to water and sodium loss . an increasing body temperature or blood pressure may indicate a significant loss of water . need may also be estimated based on information stored about the athlete , such as weight or gender . in step 7130 , time may be measured since the most recent reminder , and the time may be used to refine the estimate of lost consumables . in step 7140 , the mpn may include an inc to measure the amount of consumable , such as energy drink or water , carried by the user . the measured amount may be reported to the user . additionally , the measured amount may be used to calculate the amount previously consumed by the user , and may be used to refine the estimate of needed consumables . in step 7150 , the user may be reminded to consume a consumable based on the estimated loss . in substep 7152 , the reminder may be presented when the loss or usage reaches a defined amount . in substep 7154 , the user may be told a specific amount of the consumable to consume . in substep 7156 , the user may be given an audible reminder . in substep 7158 , the user may be given a visual reminder . fig7 shows illustrative mpn 7200 that may be used to provide consumable reminders to an athlete . inc 7210 may be a control unit , which may include memory for storing input data samples , a processor for estimating consumable loss , and a wireless communications device for receiving metabolic data and sending reminders to the user . inc 7220 may be a metabolic data monitor , such as a skin resistance monitor , body temperature monitor , or blood pressure monitor . inc 7230 may be an audio output inc for providing audible reminders . inc 7240 may be a display inc for providing visual reminders . inc 7250 may be a device capable of measure the volume of consumable in , for example , a bladder worn by the user . inc 7260 may be a heart rate monitor . incs shown are merely illustrative and are optional in practice . fig7 shows illustrative display screen 7300 that may be provided on display inc 7240 ( fig7 ). prompt 7310 may tell the user to consume a specific amount of consumable , in this case four ounces of sports drink . information display 7320 may tell the user how much sports drink is remaining . display 7330 may inform the user that a salt pill should be taken in 15 minutes . an mpn may be used by a swimmer to provide swimming - related information , such as lap counts . this is illustrated in flow chart 7400 of fig7 . all steps are optional and may be performed in any suitable order . in step 7410 , the mpn may include a monitor , such as a flow meter , which may be worn by the swimmer in a swimming pool . other examples of monitors that may be used include a turbulence meter , or an accelerometer to measure arm or leg movements . preferably , the monitor should provide data with one characteristic while swimming and another characteristic while turning . if desired , multiple monitors may be worn , of the same or different types . in step 7415 , the monitor may be used to measure a parameter , such as rate of flow of water past the user &# 39 ; s body , amount of water turbulence near the user &# 39 ; s body , arm movements , or leg movements . in step 7420 , a characteristic of the parameter may be evaluated . for example , one characteristic of the flow may be the irregular readings during the turbulence of the turn at the end of the pool , as opposed to the more cyclical readings seen while swimming . water flow may maintain a fairly constant positive value while swimming , and may vary in rate and direction while turning . arm or leg movements may have different characteristics while swimming various strokes , while kicking , while turning , or while resting . arm or leg movements may be regular and cyclical while swimming , and irregular while turning or resting . if desired , multiple characteristics of the measurement may be evaluated to determine which of several strokes is being used . in step 7425 , transitions between the two values or characteristics may be counted . in step 7430 , the count of transitions may be used , to provide a lap count . if desired , more than two characteristics of the parameter may be measured . for example , a third characteristic may be seen while the swimmer rests at the end of the pool . also , different characteristics may be seen when the swimmer performs different strokes . for example , a system in which an athlete wears a water flow meter and a single accelerometer on one wrist can be used to detect the difference between swimming the crawl , breaststroke , backstroke , butterfly , and kicking . in step 7440 , the duration of the two or more characteristics may be measured , and this measurement may be used to provide a lap time in step 7445 . if desired , the measured lap time may be compared with a typical lap time in step 7450 , and validated that it falls within a normal range . for example , if two consecutive measured lap times are much less than the typical lap time , the user may have paused in the middle of a lap . similarly , the turn time may be measured in step 7460 , and may be validated in step 7465 . typical lap times and typical turn times may be standard values , they may be entered by the swimmer , they may be measured during a calibration swim , or they may be entered in any other suitable way . in a calibration swim , for example , the swimmer may swim a small number of laps of each stroke , while the system measures the characteristics of the data collected by the monitor and measures the typical lap times . based on the data collected during a swim workout , the system may construct a model of the entire workout , including each swim , with type of stroke , speed , and distance for each swim , duration of rest periods , and other data . the data from the model may be stored , displayed , graphed , analyzed , or processed in any other suitable manner . fig7 shows illustrative mpn 7500 that may be used to provide lap swimming information . inc 7510 may combine the functions of a control unit and a flow meter , and may be configured to be worn attached to the swimsuit . inc 7520 may combine the functions of a display and an accelerometer and may be configured to be worn on the wrist . inc 7530 may be an audio output inc , and may be configured to be worn attached to a goggle strap or swim cap . inc 7540 may be an input inc worn on the foot , and it may be operated by tapping the end or bottom of the pool . incs shown are merely illustrative and are optional in practice . fig7 a shows an example of a screen 7600 that may be displayed on display inc 7520 ( fig7 ) to provide distance information to the swimmer . for example , the swimmer may have configured the system with the length of the pool , and the mpn may convert a lap count into a total distance 7605 for display . screen 7610 of fig7 b may be provided on display inc 7520 at the conclusion of a swim . it shows the distance of the swim 7612 which may have been derived from the measured lap count . it shows the swim stroke 7615 , which may be determined automatically based on the characteristic of data measured by input inc 7510 and 7520 ( fig7 ). screen 7610 also includes total swim time 7620 , which may be measured by the system . fig7 shows illustrative display screen 7700 which may be shown on a monitor attached to a personal computer , after data has been uploaded from inc 7510 ( fig7 ) of the mpn . date and time of workout 7710 may be displayed , and may have been determined automatically by a clock embedded in inc 7510 . distance 7720 may be listed for each swim , along with stroke 7722 and time 7724 . rest times 7726 may also be listed . the user may be allowed to scroll through more data , using scroll bar 7730 . other functions may be available using menu bar 7740 . other functions may include file - related functions ( e . g ., loading and saving data sets ), data - related functions ( e . g ., viewing different subsets of data , or viewing the data in different formats or units ), profile - related data ( e . g ., defining the length of the pool , typical swim times , etc . ), history - related functions ( e . g ., comparing performance between swim sessions ), and help - related functions . an mpn may be used to provide form or gait feedback to an athlete or other user . through the use of one or more accelerometers mounted on a part of the body that is moved during a particular activity , the system may compare the measured movements with ideal movements , and provide feedback to the user . an example of such a process is shown in flow chart 7800 of fig7 . all steps are optional and may be performed in any suitable order . in step 7810 , a user may be allowed to wear an accelerometer , which may be included in an inc of an mpn . it may be worn on a part of the body that is moved , intentionally or unintentionally , during an activity for which the user desired form feedback . for example , it may be worn on a foot , leg , hand , arm , or wrist . any other suitable part of the body may also be monitored . in step 7815 , multiple accelerometers may be worn by the user . multiple accelerometers may be worn on a single part of the body , for example to provide validation of readings , or to provide readings of different components of motion in different directions . accelerometers may be worn on corresponding parts of the body , on opposite sides , such as opposite arms or legs , for example to monitor symmetry of motion . accelerometers may be worn on different parts of the body , such as an arm and a leg , for example to monitor different motion aspects of an activity . in step 7820 , the user may be allowed to wear the accelerometer or accelerometers during a training activity . for example , one or more accelerometers may be worn while running in substep 7821 , walking in substep 7822 , swimming in substep 7823 , bicycling in substep 7824 , rowing , during a physical therapy activity in substep 7825 , or during any other suitable activity . in step 7830 , characteristics of desired movements of the monitored part or parts of the body may be stored . for example , the characteristics may have been captured by an expert in the activity wearing one or more accelerometers in the same location or locations . alternatively , the characteristics may have been generated by monitoring multiple users and averaging the results , or by calculating optimum characteristics theoretically . if desired , the characteristics of desired motions may be stored in a personal computer , or they may be downloaded into memory in an inc of the mpn . if desired , a coach or physical therapist may wear the accelerometer or accelerometers and demonstrate the motion , while the mpn captures the characteristics of the coach &# 39 ; s motions or therapist &# 39 ; s motions . in step 7835 , data from the accelerometer or accelerometers may be collected during the training activity . if desired , the collected accelerometer data may be uploaded from the mpn into a personal computer . in step 7840 , the system may compare the collected accelerometer data with the stored characteristics of desired motion . this comparison may be performed in the mpn , for example using a control unit , or it may be performed using a personal computer to which the data was uploaded . in step 7845 , the comparison may be used to evaluate the user &# 39 ; s form during the training activity , for example to determine incorrect aspects of the user &# 39 ; s form . for example , while running , incorrect form may include over - striding , under - striding , lifting the feet too high , crossing the arms excessively in front of the body , or any other suitable type of incorrect form . feedback on incorrect form may be provided to the user during the activity in step 7850 . this may be audible feedback , for example using an audio output inc , and may be synthesized voice . the feedback may be visual feedback , for example using a display inc . in step 7855 , feedback may be provided to the user after the training activity has been completed , for example using a personal computer . the raw data may be collected and uploaded to the personal computer , which may provide the comparison to create the feedback . alternatively , the comparison may be performed in an inc of the mpn , and the results of the comparison may be collected and uploaded to the personal computer . the feedback may be in the form of a chart , table , or graph , it may be displayed or printed , or it may be presented in any other suitable form . form feedback data may be combined with other suitable data when displayed , such as time , speed , or percent grade uphill or downhill . in step 7860 , the collected data or the form feedback may be transmitted to a coach or physical therapist , for example over a network such as the internet , and the coach or physical therapist may view the data or feedback . fig7 shows an example of an mpn 7900 that may be used to provide form feedback based on accelerometer data collected during a training activity . inc 7930 may be a control unit . the control unit may include a processor to control the data collection and to perform the form comparison . it may also include memory to store desired form characteristics and collected data . it may also include a wireless communications device for collecting accelerometer data and for providing form feedback . inc 7920 may be an accelerometer mounted on the left wrist , for measuring movements of the left arm . inc 7910 may be a display inc for providing visual feedback to the user . if desired , a display inc and an accelerometer may be combined into a single inc . inc 7940 may be an audio output inc , for providing audible form feedback . incs 7950 may be accelerometers worn on the feet for measuring movements of the legs and feet . if desired , accelerometers may be worn on any part of the body , and may be combined with any other inc . if desired , an accelerometer may be worn on a part of the body that is not expected to move , and the system may use it to detect incorrect motions by that part of the body . incs shown are merely illustrative and are optional in practice . fig8 a through 80c show examples of screens that may be shown on display inc 7910 ( fig7 ) during a training activity such as running or walking , to provide form feedback to a user . screen 8010 of fig8 a may suggest that the user shorten his or her stride , if the collected data indicates a stride length longer than the desired stride length . screen 8020 of fig8 b may suggest that the user relax his or her shoulders . tightly held shoulders may be inferred , for example , based on the range of motion measured from the arms . screen 8030 of fig8 c may suggest that the user run with less bounce , for example if the collected data indicates too much vertical motion . any suitable type of feedback may be provided for any suitable characteristic of the training activity . any suitable training activity may be monitored . feedback may be provided audibly during the training activity if desired , for example using audio output inc 7940 ( fig7 ). screen 8100 of fig8 is an illustrative example of a display screen that may be displayed after a training activity on a personal computer , to provide form feedback on the training activity . the screen may be displayed for the user ( e . g ., athlete or physical therapy patient ) or may be displayed for a coach , physical therapist or other interested party . graph 8110 may include curve 8120 of ideal motions , and curve 8130 of actual motions . this type of graph may illustrate the parts of the user &# 39 ; s motions that vary from the ideal motions . if desired , multiple types of curves may be shown on the same graph . for example , the forward component of the motion may be represented using one curve , and the side - to - side component of the motion may be represented using a second curve . as another example , motions of both legs or of both arms may be shown on a single graph , or motions of an arm and a leg may be shown on the same graph . legend 8140 may illustrate the line styles of the various curves . menu bar 8150 may provide access to various functions , such as file - related functions ( e . g ., saving or loading collected data files or loading a file with a different set of ideal characteristics ), session - related functions ( e . g ., looking at data from different training sessions ), data - related functions ( e . g ., looking at data collected using different accelerometers during a single session ), or help - related functions . an mpn may be used to provide an athletic training journal . fig8 shows flow chart 8200 of an illustrative process for providing an athletic training journal . all steps are optional and may be performed in any suitable order . in step 8210 , a mobile electronic journal may be provided , for example as described earlier in connection with fig4 . in step 8220 , the journal may include an exercise database . for example , the exercise database may include a list of different types of exercises , and may include characteristics of each , such as calories burned per hour at different intensities or muscle groups trained . the exercise database may also include data on recommended levels , types , and amounts of exercise . in step 8230 , the journal may include a nutrition database . for example , the nutrition database may include a list of different types of foods , and characteristics of each , such as calories , amount of fat , carbohydrates , protein , and other nutrients . the nutrition database may also include data on recommended amounts of various types of nutrients . in step 8240 , the journal may include a competition database . the competition database may include lists of competitions of various types of activities , results , times , and other information . in step 8250 , the journal may include a personal database . the personal database may include data on the user &# 39 ; s own exercise needs or plans , the user &# 39 ; s own nutrition needs , the user &# 39 ; s own competition history or goals , or other suitable user data . it may include data on the user &# 39 ; s weight , body fat percentage , waist measurement , and other suitable health measurements . in step 8260 , the journal may include an athletic data collection inc . for example , it may include a heart rate monitor , a blood pressure monitor , a stopwatch , or other inc that may be used to measure athletic performance . in practice , the user may enter journal entries related to exercise , nutrition , competition , health , and other related items . for example , the user may log foods eaten , exercises performed , competitions entered , and other items of interest . if desired , journal entries may be linked to suitable database entries . the journal may make automatic calculations related to the journal entry and the database , such as calories consumed or burned , nutrition taken in or needed , etc . journal entries may also be linked to audio or video media files , clock data , position data , or other suitable information . as described in step 3255 of flow chart 3200 of fig3 , an mpn may be used to provide physical therapy functions . this is illustrated in more detail in fig8 . all steps are optional and may be performed in any suitable order . in step 8310 , the mpn may be used to measure range of motion . for example , a range of motion monitor may be one of the incs in the mpn . in step 8320 , the mpn may be used to measure gait or do gait analysis . for example , the form feedback functions described previously in conjunction with fig7 may be used . in step 8330 , the mpn may be used to test muscle strength . for example , a muscle - strength tester may be incorporated into an inc of the mpn . in step 8340 , the mpn may be used to measure changes in a user &# 39 ; s physical capabilities . this may be done , for example , using the functions of the mobile electronic journal described in conjunction with fig4 . if desired , the mobile electronic journal used for physical therapy purposes may include a patient database , a treatment database , an insurance database , a diagnostic database , a range of motion sensor , accelerometers to be used for form feedback , a muscle strength tester , or other appropriate incs . as described in step 3215 of flow chart 3200 of fig3 , an mpn may be used to provide medical functions . this is illustrated in more detail in fig8 . all steps are optional and may be performed in any suitable order . in step 8410 , an inc may be worn or carried by a doctor , patient or nurse , mounted on equipment such as a wheelchair , or implanted , ingested , or injected into a patient . any suitable method of providing a portable medical inc may be used . in step 8420 , an inc of the mpn may be used to measure a metabolic value of a patient . this may include heart rate in substep 8421 , blood oxygen level in substep 8422 , body temperature in substep 8423 , skin resistance in substep 8424 , breath rate in substep 8425 , blood pressure in substep 8426 , blood sugar level in substep 8427 , or any other suitable metabolic parameter . in step 8430 , the mpn may be used to automatically detect a medical problem . in step 8440 , the mpn may control a medical device , such as a treatment device . the medical device may be an inc in the mpn , or an inc in the mpn may send commands to the device . in substep 8445 , the mpn may control a syringe pump . in step 8450 , the mpn may provide emergency communications , such as an alert to emergency medical personnel . in step 8460 , the mpn may provide storage of medical records . in step 8465 , the mpn may provide storage of insurance information . in step 8470 , the mpn may store a medical database , such as a treatment database , diagnostic database , pharmaceutical database , medical instrument database , or health alert database . in step 8480 , the mpn may provide a medical journal . fig8 shows flow chart 8500 of an illustrative process for using a measured metabolic parameter to detect a medical problem . all steps are optional and may be performed in any suitable order . in step 8510 , a metabolic parameter of the user may be measured , for example by an inc of the mpn . this may include measuring heart rate in substep 8511 , blood oxygen level in substep 8512 , body temperature in substep 8513 , skin resistance in substep 8514 , breath rate in substep 8515 , blood pressure in substep 8516 , blood sugar level in substep 8517 , or any other suitable metabolic parameter that may be measured using a portable system . in step 8520 , the system may use the measured metabolic parameter to estimate a medical problem . other factors may also be used to estimate the medical problem , such as information stored about the user , level and time of exertion , water and other substances consumed , or other suitable data . estimating a medical problem may include detecting a medical problem , predicting a medical problem , or estimating the likelihood that the medical problem exists or will occur . for example , the system may estimate the likelihood that the user is affected with dehydration in substep 8521 , hyponatremia in substep 8522 , a heat injury in substep 8523 , heat cramps in substep 8524 , heat exhaustion in substep 8525 , heatstroke in substep 8526 , heart attack in substep 8527 , hypoglycemia in substep 8528 , hyperglycemia in substep 8529 , insulin shock , diabetic coma , or any other medical problem . the system may take an action to address the estimated medical problem in step 8530 . for example , a prompt may be provided to the user , visually or audibly , in step 8540 . that may include a prompt to drink in substep 8541 , a prompt to consume sodium in substep 8542 , a prompt to slow down in substep 8543 , a prompt to cease activity in substep 8544 , a prompt to eat in substep 8545 , a prompt to take insulin in substep 8546 , a prompt to take medication in substep 8547 , a prompt to seek emergency medical attention in substep 8548 , or any other suitable prompt . if desired , the system may send an alert message in step 8550 . for example , a radio frequency message may be sent to emergency medical personnel . in step 8560 , an audible alert may be sounded . if desired , the action may include control of a medical treatment device , such as a portable syringe pump , an implanted defibrillator , or other suitable device . fig8 shows more detail of step 8480 ( fig8 ), providing a mobile electronic medical journal . all steps are optional and may be performed in any suitable order . in step 8610 , a mobile electronic journal may be provided as described earlier with reference to fig4 . in step 8620 , a treatment database may be provided , which may provide information about different types of medical treatments . a diagnostic database may be provided in step 8625 , and may contain information about different medical diagnoses . a patient database may be provided in step 8630 , and may include information about patients of a medical provider , such as medical history , previous diagnoses , previous treatments , family medical history , risk factors , insurance and payment information or other suitable types of information . in step 8635 , a pharmaceutical database may be provided , and may include information about various drugs , including indications for use , recommended dosage , side effects , availability , and other suitable drug information . in step 8640 , an insurance database may be provided , and may include information about different insurance providers , such as types of policies , payment histories , covered expenses , and other suitable information . a medical instrument database may be provided in step 8645 , and may include information about various medical instruments , their uses , risks , and other related data . a health alert database may be provided in step 8650 , and may include information about current and recent health alerts , such as may be issued by public agencies like the centers for disease control . any journal entry may be linked to one or more elements from one or more of the included databases . each journal entry may have one or more linked images or video clips . medical images such as x - rays , cat scans , mris , bone scans and the like , may also be input and linked to journal entries . each journal entry may also have one or more audio clips , such as a doctor &# 39 ; s dictation . the dictation may be translated into text using voice recognition software if desired . the journal may include a medical diagnostic instrument in step 8660 , and a journal entry may be linked to one or more readings from the instrument . the journal may include a medical treatment device in step 8670 . any journal entry may be linked to a usage report of the treatment device . fig8 shows an illustrative block diagram of a mobile electronic medical journal 8700 . journal 8700 may include processor 8710 , which may , for example , be in a control unit . image memory 8712 for holding images and other user data and library memory 8714 for holding one or more databases may also be included in the control unit if desired , and if desired may be the same memory . digital camera 8720 may be provided . it may be capable of capturing video still images to link to journal entries . if desired it may also be capable of capturing video clips for the journal entries . communications device 8730 may be used for downloading database information and uploading journal entries . text input inc 8740 , drawing pad / touch screen input 8742 , and voice input inc 8744 may be provided to allow text , drawing , and voice portions of a journal entry respectively . if desired , voice input inc 8744 may also include a voice recognition capability . a device such as a scanner may also be included to input medical images . clock 8750 may be provided to tag journal entries with the current time . medical device 8752 may be included to perform a medical function , and may be either a medical diagnostic / input device or a medical treatment device . if desired , multiple medical devices may be included . display 8760 may also be provided to view journal entries , database information , and other data . if desired , an audio output inc , not shown , may be provided . incs may be separate devices , or may be combined in any suitable fashion . all incs shown are merely illustrative and are optional . fig8 shows more detail of step 3260 of fig3 , providing features for a disabled user . all steps are optional and may be performed in any suitable order . in step 8810 , braille may be output for a visually impaired user . for example , an inc may include an output device capable of generating braille characters . in step 8820 , audio may be output for a visually impaired user , in addition to or instead of a visual output . this may include speech generation . in step 8830 , information may be output visually for a hearing impaired user , in addition to or instead of an audible output . in step 8835 , voice input may be translated into a visual input for a hearing impaired user . for example , the mpn may include an audio input inc to accept a voice input that the user wishes to have translated . the system may use voice recognition to provide a visual display , which may be , for example , text or sign language . in step 8840 , voice input may be accepted from a physically impaired user . in step 8850 , breath input may be accepted from a physically impaired user . this may include allowing a user to input commands to the mpn by blowing into a tube . in step 8860 , one or more incs may be configured to be mounted on a wheelchair or other device used by a disabled user . as described in step 3265 of fig3 , an mpn may be used by a traveler to provide travel - related functions . this is illustrated in more detail in fig8 . all steps are optional and may be performed in any suitable order . in step 8902 , the system may provide language translation . it may translate from the user &# 39 ; s language to a second language , or from a second language to the user &# 39 ; s language . input may be text or it may be spoken with voice recognition . output may be text , spoken with speech generation , or both . translation may be based on a local dialect or local slang . in step 8904 , the system may provide currency conversion . it may convert home currency to travel currency , or travel currency to home currency . in step 8906 , the system may provide time zone conversion . it may allow the display of time in the local time zone , in the home time zone , or any other time zone . in step 8910 , the mpn may monitor the user &# 39 ; s position , for example using a gps monitor . information on the user &# 39 ; s position may be provided to the user in step 8912 . in step 8914 , the system may provide guidance to the user based on the user &# 39 ; s location . in step 8916 , the system may provide the user with information about a geographical region . this may include geographical information , local customs , laws , tipping guidelines , and other suitable local information . in step 8920 , the system may provide directions to a local business or attraction , which may be based on the user &# 39 ; s location . in step 8922 , a discount with a local business may be provided . in step 8924 , an advertisement for a local business may be provided to the user . in step 8930 , information may be provided about local flora and / or fauna . in step 8932 , the system may assist the user in identifying local wildlife . in step 8940 , the system may allow the user to maintain a travel journal . in step 8950 , the system may provide weather information , such as a local weather forecast . in step 8952 , the system may provide a transit schedule , such as an airline schedule to or from a travel location , local train and bus schedules , and the like . in step 8954 , the system may provide a local entertainment schedule . in step 8956 , the system may allow the user to track expenses , for example in either local or home currency . the system may accept text input in step 8960 , voice input in step 8962 , video input in step 8964 , still image input in step 8966 , sketch pad input in step 8968 , or any other suitable form of user input . in step 8970 , the system may be customized to a specific geographical region . for example , prior to a trip , a user may enter the destination or destinations into a software application running on a personal computer . suitable information for the specific region or regions may be downloaded over a network such as the internet , and may be downloaded into an inc of the electronic travel journal , such as a control unit . suitable information may include local language and dialect translation dictionaries , currency exchange rates , time zone information , information about a location , businesses , customs , laws , geography , wildlife , flora , climate information and weather forecasts , local transit schedules , local entertainment schedules , and any other suitable local information . if desired , local information may be updated while traveling , for example by connecting one of the incs to a connection such as an internet connection . fig9 shows a block diagram of illustrative mpn 9000 that may be used while traveling . mpn may include processor 9010 , which may , for example , be part of a control unit . image memory 9012 may be used for storing video images and other user inputs . database memory 9014 may be used to store downloaded data . image memory 9012 and database memory 9014 may be the same memory , and may be part of a control unit . digital camera 9020 may be provided . it may be capable of capturing video still images . if desired it may also be capable of capturing video clips . communications device 9030 may be used for downloading data into database memory 9014 , and for uploading user data form image memory 9012 . text input inc 9040 , drawing pad / touch screen input 9042 , and voice input inc 9044 may be provided to allow text , drawing , and voice input for travel features , respectively . if desired , voice input inc 9044 may also include a voice recognition capability . clock 9050 may be provided to tag user entries with the current time , and to provide a user time display . gps monitor 9052 may be included to provide location information in support of travel features . display 9060 may also be provided to view information . if desired , an audio output inc , not shown , may be provided . incs may be separate devices , or may be combined in any suitable fashion . step 8940 ( fig8 ), providing a travel journal , is described in more detail in fig9 . all steps are optional and may be performed in any suitable order . in step 9110 , a mobile electronic journal may be provided , for example as described in conjunction with fig4 . the travel journal may be configured , for example , as the mpn shown in fig9 . any suitable travel database or databases may be included and stored in database memory 9014 . for example , a database of local businesses may be provided in step 9120 . a database of local attractions may be provided in step 9121 . a database of local parks may be provided in step 9122 . a database of local plants may be provided in step 9123 . a database of local animals may be provided in step 9124 . a database of local geology may be provided in step 9125 . a database of local customs may be provided in step 9126 . any other suitable travel data may also be included . the database or databases may be downloaded into the database memory prior to a trip , based on the planned destination or destinations . if desired , any database may be updated during a trip , for example using communications device 9030 to connect to a network such as the internet . any journal entry may be allowed to link to one or more database elements from any of the supported databases . the travel journal may also provide any other suitable travel function or functions , such as language translation in step 9130 , currency conversion in step 9132 , time zone conversion in step 9134 , route guidance in step 9136 , electronic guidebook features ( e . g ., information about local customs , businesses , attractions , etc .) in step 9138 , advertisements in step 9140 , a discount at a local business in step 9142 , a local weather forecast in step 9144 , transit schedules in step 9146 , entertainment schedules in step 9148 , or expense management in step 9150 . if desired , any journal entry may be linked to an element from another travel feature . step 8932 ( fig8 ), assisting a user in identifying local wildlife , is described in more detail in fig9 . all steps are optional and may be performed in any suitable order . the mpn may be configured , for example , as shown in fig9 . in step 9210 , the user may be allowed to capture an image of wildlife , for example using digital camera 9020 , and it may be stored in image memory 9012 . in step 9220 , a library of images of wildlife may be stored , for example in database memory 9014 . the library of images may be downloaded into database memory 9014 in step 9222 for example using communications device 9030 . the images downloaded may be specific to a geographical region in step 9224 . in step 9230 , the captured image may be compared with the images from the library , using , for example , processor 9010 . in step 9232 , the system may allow the user to assist the search , for example by using a user input inc to narrow a list of potential matches . in step 9234 , one or more potential matches may be presented to the user , for example using display 9060 . in step 9240 , additional information may be provided for the wildlife in the library . for example , there may be text descriptions , descriptions of habitat and habits , sound samples characteristic of the wildlife , etc . in step 9250 , the user may be allowed to annotate the captured image . for example , the user may be allowed to add text in substep 9252 , voice or other captured audio in substep 9254 , a drawing in substep 9256 , or any other suitable type of user annotation . in step 9260 , the captured image may be automatically annotated . that may include an annotation with a link to any match or matches from the wildlife library in substep 9262 , the time the image was captured determined for example using clock 9050 in substep 9264 , the location at which the image was captured in substep 9266 determined for example using gps monitor 9052 , or any other suitable automatic annotation . fig9 shows more detail of step 3225 of fig3 , supporting outdoor enthusiast features with an mpn . all steps are optional and may be performed in any suitable order . in step 9310 , the mpn may provide directional information . for example , one of the incs may include a compass . in step 9320 , the mpn may provide position information , if for example one of the incs contains a position monitor . in step 9330 , the mpn may provide elevation information , using an inc that may include an elevation monitor . in step 9340 , the mpn may provide route guidance . guidance may be based on , for example , topographical information , trail maps , visual landmarks , and other items useful to a hiker , skier , snowshoer , or other outdoor enthusiast . the mpn may also provide weather related information , such as environmental temperature readings in step 9350 , humidity readings in step 9360 , or barometric readings in step 9370 . other suitable outdoor features may also be included if desired . fig9 shows more detail of step 3240 of fig3 , providing an identification function with an mpn . all steps are optional and may be performed in any suitable order . in step 9410 , the mpn may confirm an identity using a smart card , with an inc that may include a smart card reader . in step 9415 , the mpn may confirm an identity using a personal code or password , for example if one of the incs allows numeric or text entry . in step 9420 , an identity may be confirmed using biometrics . the biometric may be any suitable technique adapted to a portable inc in the mpn , and may include fingerprint analysis in substep 9421 , voice identification in substep 9422 , hand or finger scanning in substep 9423 , analysis of typing characteristics in substep 9424 , signature analysis in substep 9425 , iris scanning in substep 9426 , retina scanning in substep 9427 , or facial scanning in substep 9428 . if desired , other physical characteristics may be used for identification , such as athletic performance data or metabolic data . in step 9430 , exchange of money may be provided based on the confirmed identity . in step 9440 , the identity may be proven to another person . in step 9445 , the identity may be proven to another system , such as another mpn . in step 9450 , a product discount may be provided based on the confirmed identity . in step 9455 , product purchasing may be provided based on the confirmed identity . if desired , the system may store purchasing information , such as a credit card number , a bank account number , a bank balance , or any other suitable information . if desired , the personal identification may also be used to prevent unauthorized use of the mpn or any of its incs . the personal identification may also be used to provide secure access to restricted areas , features , and the like . fig9 shows more detail of step 3245 of fig3 , providing a personal security function with an mpn . all steps are optional and may be performed in any suitable order . in step 9505 , the mpn may be capable of providing an audible alert , such as a whistle or other alarm . in step 9510 , the mpn may be configured to provide an alert to public safety personnel . for example , an inc may be provided that includes a communication inc configured to transmit a message to an emergency dispatch facility , a police department , a fire department , or an emergency medical facility . the audible alert or emergency message may be triggered by a specific user input , or by any other suitable input or lack of input that may arise in the event of a personal or public emergency . in step 9520 , the mpn may store emergency contact information for the user , and may be configured to display or otherwise provide that information with suitable authorization . in step 9530 , the mpn may be configured to store emergency medical information , such as preexisting conditions , allergies , current prescriptions , etc ., and may be configured to display or otherwise provide that information with suitable authorization . fig9 shows more detail of step 3250 of fig3 , providing a military function in an mpn . all steps are optional and may be performed in any suitable order . for example , individual military members involved in ground support may each be equipped with an mpn having suitable incs and functions . the mpn may provide a communications function in step 9610 , such as instant message , and voice , data , text , or video communications . the mpn may provide location functions in step 9620 , such as providing the current location using a gps monitor . the mpn may include guidance functions in step 9630 . that may include guidance to specific position in substep 9632 , and directional information in substep 9634 . the mpn may provide weather functions in step 9640 . this may include barometric readings in substep 9642 , environmental temperature readings in substep 9644 , humidity readings in substep 9646 , or any other suitable weather function . as described in step 3270 of fig3 , an mpn may support multiple functions . some combinations have been described above . for example , providing both athletic and guidance functions was described in conjunction with fig4 a . providing both music and other audio cues was described in conjunction with step 2960 of fig2 . another example of an mpn 9700 that may be used for multiple purposes is shown in fig9 . mpn 9700 may include inc 9710 , configured to be worn on the wrist . inc 9710 may include a display inc , user controls , and a microphone . mpn 9700 may include inc 9720 , configured to be worn on a waistband . inc 9720 may include control unit functions , clock functions , storage of audio and video media , and a gps monitor . mpn 9700 may include inc 9730 , which may be a video / still camera configured to be worn on a waistband . mpn 9700 may include inc 9740 , which may be an audio output inc . mpn 9700 may include inc 9750 , which may be a heart rate sensor configured to be worn on the chest . these incs are merely illustrative . any suitable incs and method of carrying may be used . fig9 shows flow chart 9800 of an illustrative process for allowing multiple uses of mpn 9700 ( fig9 ). all steps are optional and may be performed in any suitable order . in step 9805 , the user may be allowed to listen to music . music may be stored digitally in inc 9720 and sent to inc 9740 to be heard . in step 9810 , the user may be allowed to collect media data . for example , using the microphone in inc 9710 and using inc 9730 , the user may collect audio data in substep 9812 , video data in substep 9814 , and still images in substep 9816 . in step 9820 , the mpn may collect personal data . that may include , for example , heart rate data 9822 collected from inc 9750 or other suitable athletic data 9826 , and speed , location 9824 , and elevation data collected from the gps monitor in inc 9720 . in step 9830 , the media data may be stored , for example in memory in inc 9720 . in step 9832 , the personal data may be stored , for example in memory in inc 9720 . in step 9834 , a relationship may be stored between the media data and the personal data . for example , the personal data may be stored at a regular interval with a time stamp , and the collected media data may use the same time stamp . in step 9840 , the mpn may interpret collected media . that may include speech recognition in substep 9842 . the interpreted media may be used to control the functions of the mpn in step 9845 , for example controlling the collection of personal data . alternatively , the interpreted media may be stored as text or in another suitable format . in step 9850 , data may be uploaded , for example to a base station or personal computer . that may include uploading the personal data in substep 9852 , the media data in substep 9854 , and the relationship between them in step 9856 . in step 9860 , the uploaded data may be stored . this may include storing the personal data in substep 9862 , the media data in substep 9864 , and the relationship data in substep 9866 . in step 9870 , the personal data may be displayed . in step 9872 , the media data may be displayed or output based on its relationship to the personal data . see the description of fig4 and 48 for examples of the display of personal data and the related media data . fig9 shows illustrative data structure 9900 that may be used to store personal data and their relationships to media data . in this example , personal data samples are stored every second . first sample 9920 has time stamp 9910 and has no linked media . second sample 9940 has time stamp 9930 , and has related media link 9950 . in this case , the media link is the name of a file containing a still image captured by the user . the mpn has automatically named the file based on the type of content and date and time of capture . third sample 9970 with stamp 9960 in this example has no linked media . the ability to easily turn off all incs in an mpn may be useful to conserve power . it may also be useful to terminate radio frequency transmission in an environment in which they may cause unwanted interference , such as on a commercial airliner . one of the commands received by the user input inc may be a turn on command , or a turn off command . these may be global commands applying to all incs in the mpn . a process for handling a global turn on command and a global turn off command is shown in fig1 a and fig1 b . all steps are optional and may be performed in any suitable order . flow chart 10100 of fig1 a shows an illustrative process that may be performed by a user input inc , or by an inc such as a control unit that receives commands from a user input inc . in step 10102 , the inc may be in its normal “ on ” state , in which it processes commands and data normally . the inc may check for user input in step 10104 . if no user input is received , the inc may remain in its normal “ on ” state and continue with normal functions . if user input is received , the inc may check to see if it is a turn off command in step 10106 . any appropriate type of user input may be used , such as a voice input , a key press , etc . if the user input is not a turn off command , the inc may process the user input normally in step 10108 and continue with normal functions . if the user input is a turn off command , the inc may check to see if the command is validated in step 10110 . validation may consist of a second input , holding the key down for an extended period , the entry of a personal code , or any other suitable user validation . if desired , the inc may not require validation . if the turn off command is not validated within a defined period of time , the inc may return to its normal “ on ” state . if the turn off command is validated , the inc may proceed with the turn off sequence . in step 10112 , the inc may send a turn off command to all of the incs in the mpn . this may be a single message that is broadcast to all incs with the same network identifier in substep 10114 . alternatively , individual messages may be sent addressed to each inc in substep 10116 . in step 10118 , the inc may wait for confirmation from each other inc . if confirmation is not received , the inc may resend the turn off command , display an error message , or perform another suitable action . if desired , the wait for confirmation step may be optional . once all confirmations have been received , the inc may enter a low power mode , in step 10120 . for example , if a processor with a sleep mode is used in the inc , it may enter the sleep mode , and it may configure an interrupt to be generated when a user input is received . while in the low power turned off state , the inc may check for user input , in step 10122 . for example , an interrupt may be generated when a user input is received . if no user input is received , the inc may remain in the turned off state . if user input is received , the inc may check to see if it is a turn on command , in step 10124 . if not , the user input may be ignored and the inc may remain in the turned off state . if the turn on command is confirmed , the inc may resume its high power mode , in step 10126 . turn on messages may be sent to all components in step 10128 , either as a single broadcast message or as individually addressed messages . the inc may resynchronize with the other components in step 10130 . this may include waiting for acknowledgement from the turn on message , resending the turn on message if required , or synchronizing functions that may have been in progress prior to the turn off command . in step 10132 , normal functioning may resume . flow chart 10150 of fig1 b shows an illustrative process that may be performed by an inc that does not receive user input . the inc may start in its normal “ on ” state , in step 10152 . it may be performing its normal functions , such as data collection , output , control , storage , or other functions or combination of functions . in step 10154 , the inc may check for a message , such as a wireless message from another inc in the mpn . this may include checking to see if the message has the correct network identifier , component identifier , or other address . if no message is received , the inc may continue its normal functions . when a message is received , the inc may check to see if it is a turn off message , in step 10156 . if not , the message may be handled normally , in step 10158 , and the inc may remain in its normal “ on ” state . when a turn off message is received , the inc may acknowledge the message in step 10160 . the acknowledgement may be optional . in step 10162 , the inc may stop its normal functions . this may include stopping any data collection , output , or control functions . the inc may stop sending any information using its wireless transmitter . preferably , the inc will retain any stored information in memory , including information about any processes that may have been underway , and any other information required to later resume normal functions . in step 10164 , the inc may enter a low power mode . for example , if a processor with a sleep mode is used in the inc , it may enter the sleep mode , and it may configure an interrupt to be generated when a wireless message is received . while in low power mode , the inc may check for incoming messages , in step 10166 . if no message is received , it may remain in low power mode . when a message is received , the inc may check to see if it is a turn on message , in step 10168 . if the message is not a turn on message , the inc may ignore it and remain in the low power off state . when the turn on message is received , the inc may resume its high power mode in step 10170 . an optional acknowledgement message may be sent in step 10172 . optionally , the inc may resynchronize with other incs in the mpn , in step 10174 . this may include synchronizing any functions that were in progress when the power off message was received . in step 10176 , the inc may resume normal functions , and return to its normal “ on ” state . although various embodiments have been described herein in terms of an mpn , many of them are possible without all of the features and aspects of an mpn . for example , components may be designed specifically for a single purpose , and may not support dynamic configuration of a wireless network . although our present invention has been described in considerable detail with reference to certain preferred embodiments thereof , other embodiments are possible . this includes uses , functions , components , and combinations thereof that may not be fully described . therefore , the spirit and scope of the appended claims should not be limited to the description of the preferred embodiments contained herein . | 6 |
although , for sake of clarity and brevity , this invention is described in detail herein with respect to pumping hdpe , it can be used in the pumping of any molten polymer . fig1 shows polymer pump 1 having a closed top 2 and closed bottom 3 . upstanding , spaced apart sides 15 and 16 support internally of pump 1 a pair of parallel , opposed shafts 11 and 13 that extend fully across the pump &# 39 ; s interior ( fig4 ). upstanding side 4 and an opposing upstanding side 20 ( fig3 ) complete the enclosure of the interior of pump 1 . side 4 is the inlet side of pump 1 . side 4 has an opening 5 through which polymer is introduced into the interior of pump 1 to be forced to the outlet 21 ( fig2 ) of the pump . through opening 5 pumping teeth ( teeth ) carried by shafts 11 and 13 can be seen . shaft 11 carries chevron style teeth 7 and 9 , while shaft 13 carries chevron style teeth 6 and 8 . these teeth are shown in a more spaced apart configuration than actual for sake of clarity . the teeth shown are chevron style , but can be any style , including spur gear or single helical . line 10 denotes the demarcation line between shafts 11 and 13 and is the line ( point ) of closest approach for teeth carried by opposing shafts 11 and 13 when those teeth are at their closest approach and in a meshed configuration ( fig6 ). shafts 11 and 13 carry key ways 12 and 14 respectively so that shafts 11 and 13 can be fixed to one another by conventional apparatus ( not shown ) that maintains , while the pump is in operation , the non - touching registry between adjacent opposing teeth when at their point of closest approach . fig2 shows the outlet side 20 of pump 1 to carry an opening 21 to allow pressurized polymer to issue from the interior of the pump . fig2 shows a pair of opposing chevron teeth 22 and 23 carried respectively by shafts 13 and 11 after they have pushed polymer toward opening 21 and as they near their line of closest approach 10 for meshing engagement thereof . again , although a plurality of teeth are present around the entire periphery of both shafts 11 and 13 ( fig6 ), only two pairs of teeth are shown only for sake of clarity . fig3 shows the side 16 of pump 1 wherein shaft ends 11 and 13 are exposed outside the interior of pump 1 . shaft ends 11 and 13 have center points 32 and 31 , respectively . the shafts rotate about their respective center points in the directions shown by arrows 33 and 34 . entering polymer shown by arrow 35 passes into inlet 5 ( fig1 ) wherein it is picked up by moving pumping teeth and forced to outlet 21 as shown by arrow 36 , and as shown in greater detail in fig6 . fig4 shows the view of fig1 with side 4 removed to reveal that shafts 11 and 13 extend across the full interior of the pump . shaft 11 has an exposed end face 41 outside of the pump , while its opposing end 44 is carried in side 15 journaled in circular bearing 45 . similarly , shaft 13 has end face 40 that is exposed outside the interior of the pump , and an opposed end 42 journaled in side 15 in circular bearing 43 . fig4 shows that shafts 11 and 13 are of substantially larger diameter inside pump 1 , these larger diameter portions 47 and 48 being the part of the shafts that carries the pumping teeth . in this figure , the pumping teeth spaces 49 and 50 for shaft parts 47 and 48 , respectively , are shown to be relatively larger than normal for sake of clarity only , the teeth being relatively small compared to the diameter of parts 47 and 48 . this is better shown in fig6 . fig5 shows a plurality of teeth in general and a close - up of teeth 6 through 9 on the inlet side 5 ( fig1 ) in particular . fig5 shows these teeth as they are rotated away from meshing along line of closest approach 10 . in this mode , the teeth pickup additional polymer ( not shown ) and move it in a pumping mode . on the inlet side of the pump , upper teeth 6 and 8 on shaft part 47 are moving upwardly ( and carrying polymer upwardly ) as shown by arrow 51 while lower teeth 7 and 9 on shaft part 48 are moving downwardly ( and carrying polymer downwardly ) as shown by arrow 52 . all of the moving teeth are carrying incoming polymer with them in the direction of their movement , whether up ( arrow 51 ) or down ( arrow 52 ). in this figure , for example , when in the meshing configuration at line 10 , tooth 7 was in between teeth 6 and 8 , and , when so disposed , with proper pump timing registry , tooth 7 is maintained at its 0 . 02 inch tolerance with teeth 6 and 8 . thus , tooth 7 did not physically contact either of teeth 6 and 8 , the tolerance being filled with polymer . fig6 shows vertical cross - section a - a of fig5 . fig5 shows inlet opening 60 to be of substantially larger area and volume than outlet opening 61 . polymer entering at 35 is forced by its conveying teeth into progressively smaller volumes 67 and 68 , and thereby put under substantially greater compressive forces when delivered to outlet 61 . thus , exiting polymer 36 is under a substantially higher pressure , e . g ., 3000 psig , than entering polymer 35 , e . g ., 30 psig . this pressure differential can cause flow back in the direction of arrow 73 if the teeth carried by shaft parts 47 and 48 become worn by repeated physical contact between the opposing teeth when in their point of closest approach 10 ( fig4 ). cross - sectional fig6 shows that after teeth 6 , 7 , and 8 have delivered their conveyed polymer through restricted passage ways 69 and 71 to outlet 61 , these teeth then move into the meshing configuration of closest approach shown in fig6 . in this inter - meshing configuration , tooth 7 is physically disposed between and adjacent to teeth 6 and 8 , but not physically touching either of those teeth . this is the point of closest approach 10 for these three teeth . the gaps 65 , between teeth 6 and 7 , and 66 , between teeth 7 and 8 , are both desirably maintained at the 0 . 02 inch registry tolerance mentioned hereinabove for hdpe . this prevents premature wear of these teeth when repeatedly put into and out of this meshed configuration during the pumping life of pump 1 . initially , for example , when new , pump 1 is timed in a conventional manner well known in the art . after some operation of pump 1 so that it contains polymer in its interior , template 80 is prepared so that it is unique to the particular shafts of pump 1 . once made , the template can be used to restore pump 1 to its timed state at any time over the service life of that pump . if the teeth carrying shafts of pump 1 are re - used in another pump , template 80 could be used to establish proper timing for those shafts . fig7 shows the first step in carrying out this invention . in this step , when pump 1 is not in operation and shafts 11 and 13 are in proper timing registry to maintain the desired 0 . 02 inch tolerance , shaft faces 40 and 41 are exposed , i . e ., separated from the apparatus ( not shown ) that causes shafts 11 and 13 to stay in the desired registry during the operation of pump 1 . each exposed shaft face 40 and 41 has at least two spaced apart apertures drilled there into . in the case of face 40 , apertures 76 and 77 are drilled a finite distance into the body of shaft 13 . in this example , apertures 76 and 77 are placed asymmetrically on face 40 in that aperture 76 is further from center point 31 and closer to outer periphery 75 of shaft 13 than is aperture 77 . apertures 78 and 79 are shown in this example to be drilled symmetrically into the body of shaft 11 . that is , apertures 78 and 79 are each located an equal distance above and below center point 32 ( an equal distance from outer periphery 74 ). fig8 shows a separate , unitary template member 80 that is employed in this example of the process of this invention . template 80 is co - extensive with shafts 13 and 11 in that it essentially covers at least a substantial area of shaft end faces 40 and 41 . a pattern of holes 81 through 84 is provided which holes extend fully through template 80 . this pattern of holes is made to match the pattern of apertures 76 through 79 in end faces 40 and 41 ( fig7 ) with a symmetrical aperture pattern 78 / 79 such as that shown for shaft 11 there is more than one way ( front or back side ) template 80 can be held up to shaft ends 40 and 41 and the hole pattern 83 / 84 matched ( aligned ). however , with asymmetrical aperture pattern 76 / 77 there is only one orientation in which template 80 can be held up to shaft ends 40 and 41 and hole pattern 81 / 82 matched to pattern aperture 76 / 77 . thus , pursuant to this invention , at least one of shafts 11 and 13 will have an asymmetrical aperture pattern . if desired , both shafts can have an asymmetrical shaft pattern with their asymmetries the same or different . fig9 shows an exploded view in respect of template 80 being held adjacent ( abutting ) faces 40 and 41 in order to match the aperture patterns of faces 40 and 41 to the hole patterns of template 80 . if pump 1 is out of timing , the patterns cannot be made to match . in such a case , one or both of shafts 11 and 13 are rotated until the patterns can be made to match exactly . dowels are then inserted through the template holes into the shaft apertures . to ensure that the desired gap , e . g ., 0 . 02 of an inch for hdpe , is obtained between the teeth then meshing inside the pump , the tolerance between the dowel inserted and the hole / aperture pair in which it is inserted should not be greater than about 0 . 001 of an inch . fig9 shows template 80 essentially up against , but not touching shaft faces 40 and 41 for sake of clarity only . in practice , template 80 will be firmly touching faces 40 and 41 . this can be achieved in any desired manner known in the art such as drilling and tapping either or both of center points 31 and 32 to form a threaded opening 95 , 96 , 97 and 98 to receive a holding bolt ( not shown ) that temporarily affixes template 80 to shafts 11 and 13 . with template 80 in place abutting faces 40 and 41 , dowels 91 , 92 , 93 , and 94 are inserted , respectively , through holes 81 , 82 , 83 , and 84 , and fully into apertures 76 , 77 , 78 , and 79 . when template 80 is firmly abutting faces 40 and 41 with the template hole / shaft aperture patterns matching , and dowels firmly inserted through the holes into the apertures , the desired timing registry between the meshing teeth inside the pump is achieved even though those teeth are covered with polymer . dowels 91 through 94 are then removed from their apertures , and template 80 removed from contact with faces 40 and 41 . shafts 11 and 13 are then re - attached to the apparatus ( not shown ) that is normally used during pump operation to maintain these shafts in their desired registry , and operation of the pump begun . a matching template hole / shaft end aperture pair can be straight sided or tapered . in a specific embodiment , hole / aperture pairs can be straight sided , tapered , or a combination of such pairs . if a hole / aperture pair is tapered , the taper should be uniform from the start of the hole to the end of the aperture so that the mating dowel , with its close tolerance , can tightly and uniformly follow the taper angle from the start of the hole to the end of the aperture . the cross - section of the dowels used can be curvilinear , polygonal , or any desired combination thereof . all apertures need not be drilled to the same depth in the shafts . if desired , apertures can be drilled to differing depths with dowels being sized in length to match those depths in order to give an added dimension of asymmetry . more than two apertures can be employed on a given shaft face . the cross - sectional distance across a shaft aperture and / or template hole , e . g ., the diameter for a straight sided matching aperture / hole pair that is round , can be at least ⅛th of an inch , and preferably not more than about 1 inch . the apertures in the shaft ends can vary in depth from about ½ to about 1 inch . the template itself can be any rigid member such as carbon steel plate at least ½ inch in thickness . the dowels can be solid metal members and should not be semi - rigid or otherwise flexible such as are hollow roll pins and the like . | 8 |
hereinbelow , embodiments of the present invention are described with reference to the accompanying drawings . fig1 gives an appearance perspective view of the present invention . this figure consists of a transmission - side unit s and a reception - side unit r , the equipment comprising a light emitter ssd and a light receiver srd on the transmission side , and a light emitter rsd and a light receiver rrd on the reception side , as main components . transmitting light s 1 from the light emitter ssd on the transmission side is received by the light receiver rrd as received light r 2 on the reception side . also , as feedback from the reception side to the transmission side , transmitting light s 2 emitted from the light emitter rsd on the reception side is received by the light receiver srd as received light r 1 on the transmission side . fig2 is a configuration example of electronic equipment having an optical communication function according to a first embodiment of the invention . the electronic equipment having an optical communication function of this figure comprises , as main components , a light - receiving circuit 1 , a light - emitting circuit 2 , a cpu 3 , a power - supply control circuit 4 and a signal discriminating circuit 5 . the light - receiving circuit 1 comprises a photodiode , an amplifier , a transistor or the like , and its output is connected to the signal discriminating circuit 5 . the signal discriminating circuit 5 comprises a counter implemented by , for example , a flip - flop , and discriminates whether or not the frequency of an input optical signal is a preset frequency , by referencing a sub - clock from the cpu . a resultant signal after the discrimination is outputted to a terminal rx of the cpu 3 , by which the received signal is inputted to the cpu 3 . the light - emitting circuit 2 comprises a light - emitting diode and a transistor , and its input is connected to a terminal tx of the cpu 3 . the light - emitting circuit 2 , fed with a transmitting signal from the cpu 3 , performs light emission according to the transmitting signal from the cpu 3 . to the power - supply control circuit 4 , a power - supply control signal is inputted from the cpu 3 , by which the power supply for the light - receiving circuit 1 can be interrupted . the power - supply control circuit 4 comprises , for example , a transistor , and power control is implemented by the transistor turning on / off . in addition , a timing chart of signals used on the circuit structure of fig2 is presented as fig4 . in fig4 reference characters designate received light by a , transmitting light by b , a received signal by c , a transmitting signal by e and a received signal after the signal discrimination by f . also , the power - supply control signal for the light receiver is designated by d . in order to show how the standby state of the cpu is changed by these signals , a main clock clk 1 , which is a high - speed clock for the cpu , and a sub - clock clk 2 , which is a low - speed clock , are charted . in this case , while the cpu is in the standby mode , the main clock clk 1 keeps halted , where only the sub - clock clk 2 is operating . also , when the cpu , after cancellation of the standby mode , actually starts optical communication , both clk 1 and clk 2 are operating . at the beginning of the timing chart of fig4 the cpu 3 of fig2 is in the standby mode . at that time , the cpu 3 is outputting a power - supply control signal d that is a signal resulting from frequency - dividing by two the sub - clock clk 2 by an unshown frequency divider . in this state , when the received light a is inputted to the light - receiving circuit 1 , subsequent operation differs depending on the state of the power - supply control signal d . with d “ inactive ” ( low state in fig4 ), even if this received light a is inputted , the signal is not transferred to the succeeding - stage signal discriminating circuit 5 , nor is the standby mode canceled . with d “ active ” ( high state in fig4 ), when the received light a is inputted , the signal is transferred to the succeeding - stage signal discriminating circuit 5 . in fig4 when the received light a is inputted , the signal d is “ inactive ”, with no operations going . when the signal d goes “ active ”, the received signal c goes operative so that the received signal is inputted to the signal discriminating circuit 5 . it is noted that a signal ( c 1 ) of c is the same as a signal ( a 1 ) of the received light a . the signal discriminating circuit 5 makes an internal counter operate at an inputted frequency c 1 , determines the count value by referencing the sub - clock g , and measures the frequency of the c 1 input . in this case , if the count value is not a desired value , the signal ( received signal f in fig4 ) is not transferred to the succeeding - stage cpu , so that the cpu 3 holds the standby mode . in fig4 assuming that the frequency is the desired value , the received signal f is operated . as a result of this , the standby mode of the cpu 3 is canceled ( the main clock is operated ). after the cancellation of the standby mode , a cnt signal of the cpu 3 itself ( i . e ., the power - supply control signal d ) is always set to the “ active ” state , where light reception is normally enabled . in the case of fig4 the a 2 signal of the received light a is communication data . this data passes , in fig2 through the light - receiving circuit 1 and the signal discriminating circuit 5 , becoming the received signal c and the received signal f , thus being connected to the cpu 3 as an rx signal , where the communication is started . fig3 shows a configuration example of an electronic circuit system according to a second embodiment of the invention . the electronic circuit system comprises , as main components , a light - receiving circuit 6 , a light - emitting circuit 7 , a cpu 8 , a power - supply control circuit 9 , a signal discriminating circuit 10 and a signal feedback circuit 11 . the light - receiving circuit 6 is of the same structure as the light - receiving circuit 1 . its output is connected to a terminal rxs of the signal discriminating circuit 10 , and a received signal is inputted to the signal discriminating circuit 10 . the signal discriminating circuit 10 , although similar in structure to the signal discriminating circuit 5 , additionally has a function of once connecting a discriminated signal to the signal feedback circuit 11 , and an output for uniquely implementing power supply control for the light - receiving circuit . in order to discriminate over several cycles on the sub - clock basis whether the signal from the light - receiving circuit 6 is extraneous light ( noise ) or a signal from the transmission side , a received signal k will not be connected to the cpu until it is finally discriminated that the signal is a transmitting signal . then , if it is finally discriminated that the optical input is a received signal , the received signal k is transferred to the cpu 8 . in the state of halfway the discrimination , a power - supply control signal 2 ( o ) is outputted to maintain the light receiver always “ active ”, and the received signal is connected to the signal feedback circuit 11 , by which the signal that is being received is fed back to the transmission side . the signal feedback circuit 11 is a switch that functions , in the standby mode , to connect a signal from the signal discriminating circuit 10 to the light - emitting circuit 7 and , in the operation mode , to connect a terminal txs signal of the cpu 8 to the light - emitting circuit 7 . the light - emitting circuit 7 is of the same structure as the light - emitting circuit 2 . the power - supply control circuit 9 is also of the same structure as the power - supply control circuit 4 , controlling the power supply for the light - receiving circuit 6 . however , the power - supply control signal is connected in two from the cpu 8 and the signal discriminating circuit 10 . the signal discriminating circuit 10 , although equivalent in structure to the signal discriminating circuit 5 , has a feedback signal p connected to the signal feedback circuit to feed back a signal to the transmission side , and also outputs a unique power - supply control signal . the signal discrimination is executed as the cpu 8 is kept in the standby mode . further , the signal discriminating circuit 10 has a plurality of desired count values , and has a structure that the counter can be freely set so that whether or not a desired value is set can be discriminated for a plurality of frequencies . after the discrimination that the signal is a desired frequency , the signal discriminating circuit 10 transfers the received signal to the cpu 8 , canceling the standby mode , where normal optical communication is executed . in addition , a timing chart of signals used on this circuit structure is presented as fig5 . in fig5 reference characters designate received light by h , transmitting light by i , a received signal by j , and a transmitting signal by q . also , power - supply control signals for the light receiver are designated by l , o , and a signal fed back from the reception side to the transmission side is designated by p . also , a received signal from the signal discriminating circuit to the cpu ( a received signal after the final discrimination of being an optical signal ) is designated by k , and a transmitting signal from the cpu is designated by m . further , in order to show how the standby state of the cpu is changed by these signals , a main clock clk 3 and a sub - clock clk 4 of the cpu are shown . in this case , while the cpu is in the standby mode , the main clock clk 3 keeps halted while only the sub - clock clk 4 is operating . also , when the cpu , after cancellation of the standby mode , actually starts optical communication , both clk 3 and clk 4 are operating . in fig5 the operation to be executed until the received light h is inputted to the light - receiving circuit so that the power - supply control signal l goes “ active ” is equivalent to the operation described in fig4 . after that , with the received signal j inputted to the signal discriminating circuit 10 , if it is discriminated by half the sub - clock n that the signal is a desired frequency , then the power - supply control signal 2 ( o ) is made “ active ” so that signal reception is always enabled , where the transmission feedback signal p is connected to the signal feedback circuit 11 . this signal p is a signal for feeding back the received frequency signal , as it is , to the transmission side , where h 11 and p 12 are signals of the same frequency at the time of start of the feedback . the signal feedback circuit 11 outputs the feedback signal p as a transmitting signal q . the transmission side , receiving transmitting light i outputted as an optical signal into which the signal q comes , changes the frequency of its transmitting signal . received light h is inputted as an h 12 signal of this changed frequency . at this time point , the frequency p 12 of the feedback signal p becomes the same as the h 12 . after that , the signal discriminating circuit 10 counts the h 12 signal at the half - clock time of the sub - clock n , thereby verifying that the signal is of a desired frequency . then , the feedback signal p 12 is changed to a signal p 13 having a frequency resulting from frequency - dividing by two the received signal j as an example . as a result , a q 13 signal of the transmitting signal q becomes the same frequency signal as the p 13 . when this fed - back optical signal i 13 is returned to the transmission side , the transmission side outputs the signal with its frequency further changed . the received light h is inputted as h 13 of the changed frequency . such a sequence is iterated a plurality of times , by which it is correctly discriminated whether the received light is an optical signal or noise such as extraneous light . if it is an optical signal , received signal k in fig3 is outputted to the cpu 8 so that the standby mode of the cpu is canceled . after that , the power - supply control signal 1 ( l ) is changed “ active ”, by which a normally communicatable state is set . then , an h 2 signal , which is actual communication data , is received . at any time point , if it is discriminated that the inputted optical signal is not a desired frequency , the received signal k is not outputted to the cpu 8 , and the reception side equipment holds the standby mode . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . | 7 |
the present invention will be understood from the following detailed description of preferred embodiments , which are meant to be descriptive and not limiting . for the sake of brevity , some well - known features , methods , systems , procedures , components , circuits , and so on , are not described in detail . fig1 depicts the wheel to be braked by the prior art vehicular brake and by the vehicular brake of the present invention . a wheel 30 of a vehicle is screwed by screws to studs 40 of a wheel carrier 52 ( hidden ) thereof . fig2 is a side sectional view of a braking system according to one embodiment of the present invention . wheel 30 , held by studs 40 to wheel carrier 52 , spins together with axle 36 . a vehicular brake 10 of the present invention brakes wheel carrier 52 by reducing or even totally blocking the flow of hydraulic liquid 72 therewithin . this hydraulic braking is intended to replace the prior art brake caliper twisting a disk . wheel carrier 52 spins together with a disk 12 , through wheel bearings 48 , about the stationary package 54 of vehicular brake 10 . seals 46 confine lubricant 72 of wheel bearings 48 . braking the rotation of wheel carrier 52 is performed by rotating a sheave 44 to close a faucet 24 , for blocking the flow of hydraulic liquid 72 within vehicular brake 10 . fig3 is a front view of the hydraulic pump of the braking system of fig2 . a significant part of the external envelope 56 of disk 12 is annular . stationary package 54 includes an annular round internal envelope 58 . the center of disk 12 is shifted from the center of annular internal envelope 58 of package 54 , providing eccentric rotation of disk 12 about annular internal envelope 58 of stationary package 54 . this eccentric disposition forms an initial tunnel 14 containing hydraulic liquid 72 between external envelope 56 of rotating disk 12 and internal envelope 58 of stationary package 54 . the terms “ top ” and “ bottom ” refer herein to the locations as drawn in the sheets of fig2 and 3 only . however , initial tunnel 14 is present at the “ top ” and “ sides ” of fig2 and 3 and is absent at the “ bottom ” of fig2 and 3 , due to this eccentric disposition . disk 12 includes and is connected to vanes 22 , thus disk 12 and vanes 22 move together . motion of vanes 22 within initial tunnel 14 moves hydraulic liquid 72 therethrough . vanes 22 are formed as slideable pistons 22 within cylinders 60 . the external sides 64 of pistons 22 are adapted to always touch internal envelope 58 of package 54 , blocking pistons 22 when hydraulic liquid 72 does not flow , i . e ., when braking is activated . pistons 12 rotating together with vehicle wheel 30 and disk 12 together press hydraulic liquid 72 to flow within initial tunnel 14 . however , the hydraulic liquid 72 cannot flow at the portion where initial tunnel 14 is absent , which is at the bottom of fig3 between external envelope 56 of disk 12 and internal envelope 58 of package 54 . instead , the hydraulic liquid 72 flows from initial tunnel 14 and returns thereto through a bypass 62 . the term “ closed - circuit tunnel ” refers herein to initial tunnel 14 together with bypass 62 . thus , rotation of vehicle wheel 30 circulates hydraulic liquid 72 within a closed - circuit tunnel including initial tunnel 14 and bypass 62 , within wheel brake 10 . appropriate hydraulic liquid 72 is to be selected for reducing friction of the hydraulic liquid flow . in order to bring external sides 64 of pistons 22 towards internal envelope 58 of package 54 , and in order that external sides 64 of pistons 22 will not enter inlet 68 of bypass 62 , a stationary track 18 delimits and leads pistons 22 between internal wall 66 and an external wall 70 thereof . stationary track 18 and initial tunnel 14 are inherent elements of stationary package 54 . external wall 70 of track 18 delimits external bearings 20 a of piston 22 , and internal wall 66 of track 18 delimits internal bearings 20 b of piston 22 . faucet 24 may reduce the cross - section area of bypass 62 from area a 1 to area a 2 or other . the level of the braking may be adjusted by the level of closing faucet 24 . hydraulic liquid 72 may be added through an inlet 28 . in the figures and / or description herein , the following reference numerals have been mentioned : numeral 10 denotes a vehicle brake , according to one embodiment of the present invention ; numeral 12 denotes a disk within the brake , which spins together with the vehicle wheel ; numeral 14 denotes a tunnel in which hydraulic liquid is moved by the pistons ; numeral 18 denotes a stationary track for leading the pistons ; numerals 20 a and 20 b denote bearings in the pistons for being led by the stationary track ; numeral 22 denotes a vane for moving hydraulic liquid ; according to a preferred embodiment this vane is a piston ; numeral 24 denotes a faucet for blocking the flow of the hydraulic liquid ; numeral 26 denotes a cable for closing and opening the faucet ; numeral 28 denotes a inlet for adding hydraulic liquid to the vehicular brake ; numeral 30 denotes the wheel of the vehicle to be braked ; numeral 36 denotes an axle of the wheel ; according to the depicted example , the axle spins together with the wheel ; numeral 40 denotes a stud for connecting the wheel to the vehicle ; numeral 44 denotes a sheave for opening or closing the faucet of the hydraulic liquid ; numeral 46 denotes a seal for confining lubricant of the wheel bearings ; numeral 48 denotes a wheel bearing , which allows the wheel to spin about the stationary elements of the vehicle ; numeral 52 denotes a wheel carrier ; numeral 54 denotes the package of the vehicular brake , and it is stationary ; numeral 56 denotes the perimeter , which is the external envelope of the rotating disk ; numeral 58 denotes the internal envelope of the stationary package ; this envelope is round , and includes an inlet and an outlet of the bypass ; numeral 60 denotes a cylinder in which a piston may slide outward or inward the rotating disk ; numeral 62 denotes a bypass for the hydraulic liquid continuing the initial tunnel ; numeral 64 denotes the external side of the piston , i . e ., the side close to the perimeter of the disk which spins together with the vehicular wheel ; numeral 66 denotes an internal wall of the leading track ; numeral 68 denotes the inlet of the bypass ; the leading track avoids entrance of the pistons thereinto ; numeral 70 denotes the external wall of the leading track ; and numeral 72 denotes hydraulic liquid . the foregoing description and illustrations of the embodiments of the invention has been presented for the purposes of illustration . it is not intended to be exhaustive or to limit the invention to the above description in any form . any term that has been defined above and used in the claims , should to be interpreted according to this definition . | 5 |
in this example the oligomerization is carried out in a continuous stirred tank reactor , which is continuously charged with fresh and recycled monomer and with recycled catalyst complex and which is pressurized with bf 3 in order to establish an excess of bf 3 . cooling is provided by circulating the reactor content via an external heat - exchanger . for example 1 - decene is used as monomer and n - butanol as cocatalyst . the temperature is set on - 10 ° c . to + 70 ° c ., preferably on 0 ° to 50 ° c ., for example on 30 ° c . bf 3 gas is supplied at constant rate to obtain the quantity required in producing bf 3 - buoh complex . the pressure is maintained to 0 . 05 to 10 bars , preferably to 1 . 5 to 4 bars . subsequent to oligomerization the reactor product , consisting of unreacted monomer , dimers , trimers and higher oligomers , free and dissolved bf 3 and catalyst complex , is fed in 1 to a distillation column 2 operated under vacuum . pressure at the top 3 of the column is lower than 30 mbar , preferably lower than 15 mbar , for example 10 mbar . the temperature is maintained as low as possible in the upper part of the column , which is located above the feed position 1 , for example 50 °- 60 ° c . in any case at the top 3 of the column the temperature is less than 70 ° c ., preferably 45 °- 50 ° c . above 70 °- 80 ° c ., the catalyst complex of the present example starts to decompose into undesired products . preferably , the temperature at the top 3 of the column 2 is also lower than the boiling temperature of the dimer fraction resulting from the oligomerization , in order to avoid a distillation of any dimer . vaporization of the catalyst complex and unreacted monomer at low temperature is achieved while operating at the above disclosed low pressures . in order to obtain an essentially complete removal of both unreacted monomer and bf 3 - residues from the bottom product , the pressure at the lower packing 4 of the column is maintained lower than 50 mbar , preferably lower than 25 mbar . here , the temperature is lower than the boiling temperature of the dimer fraction , and lower than the decomposition temperature of the cocatalyst complex , at the applied pressures , and higher than the boiling temperature of the unreacted monomer and of the cocatalyst complex . in the present example , at the lower packing 4 of the column , a temperature of 70 °- 80 ° c . is maintained at pressure of 15 mbar . in the illustrated example , a reboiler 5 is mounted to receive the bottom product of the column 2 and to heat the latter . this product is completely free of cocatalyst complex and of monomer . in a following flash drum 6 a portion of vaporized dimer is separated from the heated oligomerized product at a temperature of for example 200 °- 220 ° c . and the vaporized dimer portion is recycled in 7 into the bottom 11 of the distillation column . by means of a pump 8 , the product issuing from the bottom of the flash drum 6 and consisting of the desired products ( dimers , trimers , tetramers and heavier oligomers ) essentially free from monomer and bf 3 - residues is transferred towards the next treatment . at the outlet of the pump 8 , bottom product still at its boiling point is recycled via a minimum - flow line 10 into the bottom 11 of the distillation column . in the illustrated example the bottom 11 of the distillation column is consequently a contact zone for a liquid coming down from the lower packing 4 , a dimer vapor rising from the flash drum 6 and a bottom product at its boiling point issuing from the outlet of the pump 8 . if residual monomer and catalyst complex are still included in the liquid from the lower packing 4 , they are evaporated in the bottom 11 of the column by the heat inputs via lines 7 and 10 . in this way , by a direct heating , it is possible to prevent especially the catalyst complex from entering the reboiler 5 , where catalyst residues can cause severe corrosion . the evaporation of said components is advantageously achieved without exposing the catalyst complex to hot heat - transfer surfaces . obviously the step of heating the bottom product in the bottom 11 of the column could be obtained also by other means , for example by heat exchangers . obviously the introduction in 7 of the vaporized dimer and in 10 of a fraction of vaporized bottom product may be controlled by any known means . this introduction must regulate the required heat for monomer and catalyst complex evaporation and enable a good temperature control of the bottom 11 of the column . in the bottom 11 of the column , at a pressure of approximately 15 mbar , the temperature is in the present example regulated advantageously to a temperature of 130 °- 150 ° c . the distillate fraction leaving in 9 the distillation column 2 consists of free bf 3 , catalyst complex and monomer . distillate vapor is condensed and catalyst complex is separated from the monomer phase by gravitation and the two are independently recycled back to the oligomerization process . uncondensable bf 3 - gas is optionally trapped in a vacuum system such as the system disclosed in ep - a - 0493024 . the catalyst complex formed in the vacuum system as a result of the reaction between bf 3 and n - butanol is also recycled to the oligomerization process . it is also possible to conceive a direct recycling of the condensed distillate without previous separation of the monomer from the cocatalyst complex . a separation of the condensed vapour may also be carried out for example by means of a centrifuge or cyclonesystem . | 1 |
embodiments of the present invention are described below in detail with reference to the accompanying drawings . in this disclosure , a gray tone mask may be a mask with a transparence region , a translucence region and a blocked region , and the translucence region can be obtained with slits that can diffract light , a translucent material of low transmissivity and the like , thus a gray tone mask also comprises a half tone mask . fig1 is a top view showing a pattern after a first photolithography is carried out with a first gray tone mask , fig1 a is a cross - sectional view along line a - a ′ in fig1 , and fig1 a ′ is a cross - sectional view along line b - b ′ in fig1 . as shown in fig1 , 1 a , and 1 a ′, a gate conductive layer 11 , a first insulating layer 12 , a semiconductor layer 13 , and a doped semiconductor layer 14 are deposited in sequence on a substrate 100 , a photoresist film is applied on the resultant layer structure , and an exposure process with the first gray tone mask and development process are carried out to form a photoresist pattern corresponding to a gate line and gate island pattern , as shown in fig1 . as can be seen from fig1 , 1 a , and 1 a ′, there is no photoresist in the region other than a gate line 101 and a gate electrode 102 that are to be formed , an isolating groove 103 is to be formed on the gate line and corresponds to the partially retained photoresist region 15 in the first photolithography process , and the portions other than the isolating groove 103 on the gate line corresponds to the fully retained photoresist region 15 ′ in the first photolithography . then , etching is carried out by using the photoresist pattern as an etching mask so that the region which is not protected by the photoresist pattern is removed , i . e ., the doped semiconductor layer 14 , the semiconductor layer 13 , the first insulating layer 12 , and the gate conductive layer 11 in the non - photoresist region that is not covered by the photoresist is etched away . fig1 b shows a cross - sectional view along line a - a ′ in fig1 after etching on the non - photoresist region . then , an ashing process on photoresist is carried out . the cross - sectional view along line a - a ′ in fig1 after ashing is shown in fig1 c , and the cross - sectional view along line b - b ′ in fig1 after ashing is shown in fig1 b ′. as shown in fig1 b ′, a portion of the doped semiconductor layer 14 corresponding to the isolating groove 103 on the gate line is exposed , and the fully retained photoresist region 15 ′ is thinned in thickness . the exposed portion of the doped semiconductor layer 14 and the semiconductor layer 13 under the doped semiconductor layer 14 are etched to form the isolating groove 103 ′ on the gate line , as shown in fig1 c ′. then , a second insulating layer 16 is deposited to protect the gate line and gate electrode . the cross - sectional view along line a - a ′ in fig1 after deposition of the second insulating layer is shown in fig1 d . a lift - off process is carried out to remove the fully retained photoresist region 15 ′ together with the second insulating layer 16 deposited thereon . the cross - sectional view along line a - a ′ in fig1 after the lift - off process is shown in fig1 e . the cross - sectional view along line b - b ′ in fig1 after deposition of the second insulating layer 16 is shown in fig1 d ′. the semiconductor layer 13 corresponding to the isolating groove 103 ′ is covered by the second insulating layer 16 . the substrate 100 may be a glass substrate or a plastic substrate . the gate conductive layer 11 may be a single layer film of al / nd , al , cu , mo , mo / w or cr , or a composite film of any combination of al / nd , al , cu , mo , mo / w and cr . the first insulating layer 12 and second insulating layer 16 may be a single layer film of sinx , siox or sioxny , or a composite film of any combination of sinx , siox and sioxny . both of the first insulating layer 12 and the second insulating layer 16 may be transparent so as to allow transmission of light . the semiconductor layer 13 may comprise amorphous silicon ( a - si ), poly - silicon ( p - si ) and the like . the doped semiconductor layer 14 may be doped with a dopant such as boron ( b ) or phosphor ( p ). here , all the processes with the first gray tone mask have been described , and the plan view of the pixel structure after the processes are completed is shown in fig1 ′. as can be seen from the above processes , in the present embodiment , a second insulating layer is deposited during the first photolithography process so that the pixel structure is planarized , which provides process tolerance for subsequent processes . in addition , the conventional gray tone mask and lift - off process for manufacturing a tft - lcd can be used in the first photolithography process , which makes the first photolithography process easy to implement . then , a transparent pixel electrode layer 21 and a source / drain electrode layer 22 are deposited in sequence over the pixel structure after the above processes . a photoresist film is applied on the resultant structure , and an exposure process with a second gray tone mask and a development process are carried out to form a second photoresist pattern having a photoresist pattern 201 corresponding to the data line to be formed and a photoresist pattern 202 corresponding to the pixel electrode to be formed , as shown in fig2 . the photoresist pattern 201 is relatively thin in thickness , i . e ., it is a partially retained photoresist region 23 in the second photolithography process . the photoresist pattern 202 is relatively thick thickness , i . e ., it is a fully retained photoresist region 23 ′ in the second photolithography process . other region corresponds to the non - photoresist region , as shown in fig2 a . then , etching is carried out with the photoresist patterns as an etching mask on the non - photoresist region so that the source / drain electrode layer 22 , the transparent pixel electrode layer 21 , the doped semiconductor layer 14 and the semiconductor layer 13 which are not covered by the photoresist are removed . as a result , the source electrode 203 together with the data line , the drain electrode 204 together with the pixel electrode , and the channel of the semiconductor layer defined between the source electrode 203 and the drain electrode 204 are formed . then , an ashing process on photoresist is carried out so that the source electrode 203 and the data line are exposed and the thick photoresist pattern 202 ( i . e ., the fully retained photoresist region 23 ′) is thinned in thickness , as shown in fig2 c . then , a passivation layer 24 is deposited on the resultant structure , as shown in fig2 d . a lift - off process is carried out to remove the photoresist 23 ′ together with the passivation layer deposited thereon . the cross - sectional view along line a - a ′ in fig2 after the lift - off process is shown in fig2 e . since the region corresponding to the source electrode 203 and the data line is protected by the passivation layer , an etching process is carried out on the pixel electrode region to etch away the source / drain electrode layer 22 in the region corresponding to the pixel electrode to be formed and expose the transparent pixel electrode layer 21 as the pixel electrode , as shown in fig2 f . in this way , the manufacturing process of the tft - lcd pixel structure is completed here . the transparent pixel electrode layer 21 may be formed of indium tin oxides ( ito ) which is superior in conductivity and transparency and can block ultraviolet and far - infrared radiation as well as electronic radiation which is harmful to a human being . therefore , ito can be applied in the pixel structure to enhance the conductivity and transparency and block the ultraviolet and far - infrared radiation as well as electronic radiation which is harmful to a human being . in addition , indium zinc oxide , tin oxide and other transparent conductive material can be used for the transparent pixel electrode layer 21 . the source / drain electrode layer 22 may be a single layer film of mo , mo / w or cr , or a composite film of any combination of mo , mo / w and cr . in addition , different materials in the drawings are differently indicated in the drawings . since the substrate 100 , the source / drain electrode layer 22 , the second insulating layer 16 , and the transparent pixel electrode layer 21 are all transparent , these layers are illustrated with pure colors . one can refer to the indications in each drawing . furthermore , during the second gray tone photolithography process in the above embodiment , a portion of the transparent pixel electrode is also formed as the drain electrode of the tft , which can avoid the problem about contact resistance . two masks can be used in the embodiment of the present invention to manufacture a tft - lcd , thus the number of mask can be decreased , the cost for the array process and the occupation time can be reduced , and the production volume and yield can be improved compared with the conventional method . in addition , the conventional gray tone photolithography process and the lift - off process can be employed , which makes simple and convenient to implement the complete process . the tft manufactured by the method described above comprises a substrate 100 , a gate line 101 , a first insulating layer 12 , a semiconductor layer 13 , a doped semiconductor layer 14 , a second insulating layer 16 , a source electrode 203 which is a portion of a data line , a drain electrode 204 which is a portion of a pixel electrode , and a passivation layer 24 . in the pixel structure of the embodiment of the present invention , the first insulating layer 12 , the semiconductor layer 13 , and the doped semiconductor layer 14 are disposed sequentially over the gate 102 and the gate line 101 , the isolating groove 103 is formed on the gate line 101 and disconnects the semiconductor layer on the gate line , the second insulating layer 16 covers the isolating groove 103 as well as the portion of the substrate where the gate line 101 and the gate 102 are not formed , the transparent pixel electrode layer 21 is retained under the source electrode 203 which is integral with the data line , the drain electrode 204 which is integral with the pixel electrode is formed over the second insulating layer 16 , that is , the pixel electrode is connected with the doped semiconductor layer 14 on the gate 102 at the place where the drain electrode 204 is formed , and the passivation layer 24 covers the portion of the substrate where the pixel electrode 204 is not formed , i . e ., exposes the pixel electrode 204 . the surface of the second insulating layer 16 flushes with that of the doped semiconductor layer 14 . the transparent pixel electrode layer 21 for forming the drain electrode 204 which is a portion of the pixel electrode is also retained under the source electrode 203 which is a portion of the data line . in the embodiment described above , description is made by reference to the structure with one tft and the manufacturing process thereof . there can be formed a plurality of tfts on the substrate , and the tfts can be manufactured simultaneously by the photolithography processes , in which case the isolating groove on the gate line can prevent the short circuit among the data lines . the embodiment of the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to those skilled in the art are intended to be comprised within the scope of the following claims . | 7 |
the composition for treating diabetes of the present invention includes fenugreek and bile from the gallbladder of ruminants , such as cattle , sheep , bison , and goats . bile from the gallbladder of cattle is preferred . the fenugreek is preferably pulverized into a powder . the bile and fenugreek is mixed together to form an acceptable medium for administering a dose . this acceptable medium can be a solution , a syrup , an emulsion , a dispersion , a paste , or a pill . it is preferred that a small amount of water be added to the mixture of fenugreek and bile to aid in the formation of pills . pills are the preferred medium for administering the dose . alternatively , the active components of fenugreek can be made synthetically and be formulated into the composition of the present invention . fenugreek , also spelled foenugreek , is a slender annual herb of the pea family . its dried seeds have been used for generations as a food , a flavoring , and a medicine . steroidal saponins account for many of the beneficial effects of fenugreek , particularly the inhibition of cholesterol absorption and synthesis . the seeds are rich in dietary fiber , which may be the reason it can lower blood sugar levels in diabetics . it is contemplated , as part of the present invention , that fennel seed can be used to replace all or part of the fenugreek in the composition for treating diabetes of the present invention . fennel seed , like fenugreek , is an herb native to southern europe and the mediterranean area . the second primary component of the present invention is bile from the gallbladder of ruminant mammals . synthetic compositions of the active components in bile can also be used in the composition of the present invention . bile , also called gall , is a for concentration , storage , or transport into the first region of the small intestine , the duodenum . bile is composed of bile acids and salts , cholesterol , pigments , water , and electrolyte chemicals that keep the total solution slightly acidic . the ph of bile is typically about 5 to 6 . bile acid typically includes cholic , deoxycholic , chenodeoxycholic , and lithocholic acids . the bile salts include the salts of these acids with amino acids , such as glycine and taurine . other components of bile include hemoglobin , mucus , serum proteins , lecithin , neutral fats , fatty acids , and urea . the method of treating diabetes of the present invention begins with the preparation of doses of a composition for treating diabetes which includes an effective amount of fenugreek and / or fennel seed mixed together with an effective amount of bile from the gallbladder of ruminant mammals . the doses are often mixed together in a paste to form pills . the doses are administered at regular intervals throughout the day . by administered , what is meant is providing the composition to a patient and the patient consuming the composition by accepted medical practice . accepted medical practice is meant to include any method approved by the american medical association for introduction of the composition into the human body . the amount of the composition administered as part of the doses is an amount sufficient to counteract the effects of diabetes . these effects or symptoms which are affected will include blood glucose levels , stomach neuropathy , appetite , sleep habits , general energy level , strength , body weight , reflux , headaches , minear &# 39 ; s disease , and eye sight . a sufficient amount is an amount , when administered , that provides relief from one or more of the effects or symptoms . when the composition is administered in the form of a pill , it is preferred that the pills be used with approximate dimensions of 0 . 5 inches diameter and 0 . 125 inches thickness . the preferred dose administration is three pills administered three times during the day . a composition for treating diabetes was made by mixing approximately 3 ounces by weight of pulverized fenugreek and approximately 1 ounce by weight of bile from the gallbladder of a calf . a small amount of water was added to the mixture to form a paste from which pills were formed . each pill weighed approximately that of an average 5 gram aspirin pill . the pills were administered to a male subject aged 58 who suffers from type iii diabetes and demonstrated particular side effects , such as irregularity , stomach neuropathy , poor appetite , insomnia , lethargy , reflux , migraine headaches , minear &# 39 ; s disease , and deteriorating eyesight . the subject took three pills , three times during the day and just prior to going to sleep for the night . the subject reported a marked improvement in all of the above - mentioned symptoms after one week to two weeks of treatment . the invention has been described with reference to the preferred embodiment . obvious modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof . | 0 |
as best shown in fig1 - 3 , the present invention is directed to a molded plywood door skin d having an exterior surface 2 and an interior surface 4 , and at least one panel portion 10 . a molded depression 12 surrounds and is integral with panel portion 10 . an outer portion 14 surrounds and is integral with molded depression 12 . as best shown in fig3 molded depression 12 is preferably formed to have a depression base 16 that is recessed from the plane of outer portion 14 from between about 6 mm to about 9 mm . panel portion 10 is preferably coplanar with outer portion 14 . however , it should be understood that panel portion 10 may also lie on a plane that is spaced from the plane of outer portion 14 . molded depression 12 may include an inclined wall 18 extending from base 16 to panel portion 10 , and a contoured portion 20 extending from base 16 to outer portion 14 . preferably , molded plywood door skin d is formed from a luan plywood board . the luan plywood board used to form multi - layer door skin d includes a high - grade solid , natural wood ply , which provides a wood grain pattern on exterior surface 2 . preferably , luan plywood having a thickness of between about 2 . 5 millimeters ( mm ) to about 4 . 0 mm is used . other types of plywood may also be used to form molded plywood door skin d . as used herein , the term plywood includes any multi - layer substrate having an exteriorly disposed solid , natural wood ply , such as a veneer . the plywood may include more than solid wood plies . alternatively , the plywood may include only one solid wood ply , or veneer , preferably forming exterior surface 2 of door skin d . the plywood may also include one or more composite core layers . the core layer ( s ) may be formed from a wood composite , such as mdf , chipboard , osb , hardboard , soft board , or particleboard . the solid , natural wood layer is bonded to the core layer ( s ) to form a plywood board b . for example , an exterior layer of veneer may be bonded to a wood composite substrate , such as mdf , to form plywood board b . as best shown in fig4 plywood board b is first subjected to a conditioning step in a chamber 22 , wherein board b is heated and treated with steam generated by a boiler 24 to increase moisture content of board b , thereby softening the plies and resin of board b . preferably , plywood board b has an initial water content of about 7 % prior to conditioning . however , it should be understood that different types of plywood may have different initial water contents . various methods of conditioning board b may be used . the plywood may be exposed to steam in an atmospheric ( i . e . non - pressurized ) chamber . alternatively , the plywood may be exposed to steam in a pressurized , sealed steam injection cavity . preferably , the plywood is exposed for about 30 minutes in a pressurized cavity having a steam pressure of about 100 psi . alternatively , the plywood may be soaked in a water bath , or exposed to surface water sprays . the preferred soaking time is between about 4 hours and about 24 hours . surfactants may also be used to achieve the desired moisture pick - up . for example , the plywood may be soaked in a water - surfactant bath for between about 4 hours and about 24 hours , wherein the bath comprises water and about 0 . 2 % rhodasurf surfactant . in any case , the plywood board b is conditioned through the use of water and heat in chamber 22 until moisture content of the board b has increased to a moisture content of between about 10 % to about 40 %, depending on the depth of molded depression 12 to be achieved during the molding process , as well as the type of plywood being reformed . the thermal softening point of the plywood board is a function of the wood species comprising the plies of the plywood board , the initial cellular moisture content of the wood species , and the chemical properties of the resin adhering the plies together . as such , the amount of heat and water required in chamber 22 to increase the moisture content to the preferred range is variable . softening at as low a temperature as possible is preferred . after board b has been conditioned in chamber 22 , board b is forwarded via a conveyor 25 to a deforming press 26 . as known in the art , press 26 includes upper and lower platens 28 , 30 , which define in the closed state of press 26 a contoured mold cavity 32 . the heated , moistened board b is then pressed into a molded shape using a relatively slow , continuous closure rate of press 26 . preferably , the closure rate of press 26 is about 3 mm per minute to about 7 mm per minute , more preferably about 5 mm per minute . press 26 preferably applies between about 100 psi to about 500 psi to moistened board b during compression . in addition , platens 28 , 30 are heated to create a temperature in mold cavity 32 of between about 350 ° f . and 450 ° f ., preferably about 400 ° f . the softened board is thereby deformed using heat and pressure in press 26 . however , the preferred pressure and temperature ranges disclosed herein are not dependent on the closure rate of press 26 . as such , different pressure and temperature ranges may be appropriate depending on the type of plywood species being molded . the slow closing rate of about 5 mm per minute is preferably maintained regardless of the pressure and temperature associated with press 26 . water is driven from the plywood board during deformation , whereby excess steam is permitted to escape due to the relatively slow closure rate of press 26 . the resulting plywood door skin d is formed to have a contoured shape corresponding to contoured mold cavity 32 , as best shown in fig5 . preferably , plywood door skin d is compressed to a final thickness of between about 2 . 0 mm to about 4 mm . the post - formed plywood door skin d has a substantially uniform thickness , as well as a substantially uniform density . as best shown in fig6 the present invention is also directed to a door 50 having a peripheral interior frame f , as known in the art , and first and second door skins . at least one of the door skins is a molded plywood door skin d , as disclosed above . thus , door skin d includes at least one panel portion 10 , but may include multiple panel portions 10 . for example , door 50 has four panel portions 10 , forming panels p 1 , p 2 , p 3 and p 4 . each of molded panels p 1 - p 4 includes a panel portion 10 , a depression 12 and outer portion 14 , as described above . it will be apparent to one of ordinary skill in the art that modifications and variations can be made in construction or configuration of the present invention without departing from the scope or spirit of the invention . therefore , it is intended that the disclosed invention cover all such modifications and variations , provided they come within the scope of the following claims and their equivalents . | 1 |
reference will now be made in detail to the preferred embodiment of the present invention . referring to fig1 - 3 , a cable connector assembly 100 for mating with a complementary connector ( not shown ) comprises a connector 6 and a cable 2 having a plurality of wires 20 . each wire 20 has a front end ( not labeled ) connected with the connector 6 . the connector 6 comprises a contact module 1 connected with the front ends of the wires 20 , a mounting ring 3 attached to the cable 2 , a shielding shell 4 attached to the mounting ring 3 , and a front shell 5 attached to the shielding shell 4 along a front - to - back direction . the shielding shell 4 and the mounting ring 3 both have a plurality of screw threads to match with each other . the mounting ring 3 is received in the shielding shell 4 . the contact module 1 comprises a mating portion 10 for mating with the complementary connector , and a connecting portion 11 connected with the wires 20 . the contact module 1 is attached to the front shell 5 . the mating portion 10 is received in the front shell 5 . the cable 2 comprises a braided layer 21 surrounding the wires 20 , and an insulative layer 22 coating on the braided layer 21 . the mounting ring 3 comprises a plurality of screwed portions 30 , and a plurality of riveting portions 31 riveted on the cable . the screwed portions 30 have a plurality of screw threads formed on an outer surface thereof for matching with the shielding shell 4 . each riveting portion 31 is disposed between adjacent two screwed portions 30 . the screwed portions 30 and the riveting portions 31 are spaced one by one along a circling direction around the cable 2 . a part of the braided layer 21 is exposed outside of the insulative layer 22 and the mounting ring 3 is riveted on said part of the braided layer 21 . the mounting ring 3 is electrically connected between the shielding shell 4 and the braided layer 21 . to install the mounting ring 3 , a part of the braided layer 21 is firstly exposed outside of the insulative layer 22 . then , make said part of the braided layer 21 bent rearwards to surround the insulative layer 22 . thirdly , install the mounting ring 3 on said part of the braided layer 21 which is bent rearwards to surround the insulative layer 22 . fourthly , rivet the riveting portions 31 to make the mounting ring 3 attached to the cable 2 . in another option , the mounting ring 3 could be directly riveted on the insulative layer 22 . the shielding shell 4 comprises a receiving room 40 recessed from a front end of the shielding shell 4 for partially receiving the cable 2 , a plurality of side walls 41 surrounding the receiving room 40 , and a thread - portion 42 located at a rear end of the receiving room 40 and having a plurality of screw threads formed on an inner surface thereof for matching with the mounting ring 3 . the thread - portion 42 has a stop - hole 44 defined at a rear end thereof behind the screwed portions 30 . the stop - hole 44 has a diameter smaller than a diameter of the mounting ring 3 and greater than a diameter of the cable 2 . referring to fig1 - 3 , the front shell 5 is attached to the shielding shell 4 along a front - to - back direction . the front shell 5 cooperates with the shielding shell 4 to form a receiving cavity therebetween for receiving the contact module 1 . the wires 20 are curly or slack within the shielding shell 4 . the front shell 5 comprises a front portion 51 receiving the mating portion 10 and a rear portion 50 attached to the shielding shell 4 . the rear portion 50 comprises a plurality of outer protrusions 501 . the shielding shell 4 comprises a plurality of slots 43 receiving the outer protrusions 501 , respectively . the front shell 5 , the shielding shell 4 and the mounting ring 3 are made of conductive material , so that the contact module 1 does not need another shielding structure for suppressing electromagnetic interference . the wires 20 are long enough to ensure that the front shell 5 and the contact module 1 do not interfere the screwing movement of the shielding shell 4 . when the connector assembly 100 is assembled well , the wires 20 are shrunk to be curly and secured in the shielding shell 4 . to manufacture the cable connector assembly 100 , firstly , provide the cable 2 with a plurality of wires 20 . secondly , provide the shielding shell 4 with the receiving room 40 and make the cable 2 pass into the shielding shell 4 through the receiving room 40 , the shielding shell 4 has a plurality of screw threads . thirdly , provide the mounting ring 3 having a plurality of screw threads for matching with the shielding shell 4 and mount the mounting ring 3 to the cable 2 . fourthly , provide the contact module 1 for mating with the complementary connector , and connect the contact module 1 with the front ends of the wires 20 . fifthly , provide the front shell 5 , and attach the contact module 1 to the front shell 5 . sixthly , screw the shielding shell 4 to the mounting ring 3 , with the front ends of the wires 20 , the front shell 5 and the contact module 1 exposed outside of the shielding shell 4 . seventhly , attach the front shell 5 to the shielding shell 4 along a front - to - back direction with the wires 20 shrunk to be curly and secured in the shielding shell 4 . it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . | 8 |
fig1 shows a plurality of users 1 - n between whom data is to be transferred , whereby for the transmission of data between the users , parameters are to be negotiated which determine how the data is to be transferred ( scanning rate , bandwidth , coding etc ., particularly codec modes for tfo ) or , for example also which options can be supported in a protocol . for this purpose , the users disclose between themselves the number of parameter sets supported by them ( number of supported codec modes , supported protocol options etc . ), the individual parameter weighting , supported parameters and the parameters presently in use in step a 1 , in order to prepare the parameter voting by means of an election method . in step a 2 , each user determines , in accordance with a predetermined method , the parameters to be used for the transmission of data to other users , taking account of parameter sets ( codecs etc .) supported by this user and by other users . for this , a weighting factor ( a number of votes ) for the parameters is first determined in step a 2 . 1 , if these are not already specified in a protocol known to all users , with the weight factors stating the number of votes a user has in each case for which parameter set ( codec ). based on the weighting factors ( negotiated or specified by a protocol ) and the parameter sets offered by this and the other user , the total number of votes per user and the number of parameter sets to be selected are determined . in step a 2 . 3 , the voting method to be used is determined on the basis of the number of votes available to a user in each case ( whereby the user in the case of the method shown in fig1 knows how many votes the users have and how they apply them ). this can , for example , be similar to the dehondt method , or another method , used to elect candidates to parliament , but used in this case for the election of parameter sets ( codec modes etc .) for transmission in a mobile radio network etc . in step a 2 . 4 , the users ( mobile stations , pda , etc .) vote ( corresponding to a parliamentary election but with a different number of votes for the voting users ), but each user 1 - n determining according to an identical method which user selects , e . g . which codec mode ( whereby , for example , in a protocol known to all users it can be determined that each user chooses the highest ( or lowest ) codec mode available to him , or codec modes are given certain votes according to their level ). in step a 2 . 5 , an election result is thus obtained in the form of a list of all the parameters used by all the users 1 - n ( e . g . mobile radio codecs ). then , in step a 3 , the parameters determined in this way by each user 1 - n are used to transmit data ( voice data etc .) between the users . in fig2 , instead of a ( vote for ) determination of the parameters in each user ( mobile station , pda etc .) in accordance with an identical method , a determination of the parameters takes place in a control centre . to do this , the information relevant to selecting the parameters is sent in step b 1 to the control centre ( for instance , the examples of information given for this purpose in fig2 ). in step b 2 , a selection of the parameters ( codecs etc .) takes place in the control centre . in step b 3 , the parameters determined in the control centre that can now be used for the transmission of data are sent to each user 1 - n . in step b 4 , the determined parameters ( the available and / or actual selected codecs ) are used by each user for the transmission of data ( voice data etc .) to another user . in fig2 , instead of a ( vote for ) determining the parameters in each user ( mobile station , pda etc . ), a determination of the parameters in a control centre takes place in accordance with an identical method . in fig4 , instead of a ( vote for ) determining the parameters in each user ( mobile station , pda etc . ), a determination of the parameters takes place in accordance with an identical method in several decision units in the network ( transcoder ( tc ), transcoder rate adaptor unit ( trau ) base station subsystem ( bss ), radio network controller ( rnc ) etc .) allocated to the users . for this purpose , in step c 1 the information relevant to selecting the parameters is sent to the decision units ( for instance , the information given as examples for this purpose in fig2 ). in step b 2 , a selection of the parameters ( codecs etc .) takes place in the decision units . in step c 3 , the parameters determined in the decision units that can now be used for the transmission of data are sent to each user 1 - n . in step c 4 , the determined parameters ( the available and / or actual selected codecs ) are used by each user for the transmission of data ( voice data etc .) to one of the other users . fig3 shows an example of an application for the use of the methods for determining codecs for a tfo communication ( amr - eb - tfo ) between users . various modes are given in fig3 a by showing their transmission rate parameters ( 6 , 65 , 8 , 85 to 23 , 85 kbits / s ). for example , the method can be defined so that the number of votes specified for this ( 2 , 4 , . . . , 1 ) are available in each case to the user that supports this mode ( for example 2 votes for the first mode , 4 for the second etc .) as shown in fig3 b , the first user ( side b ) can , for example , support the parameter sets ( codec modes 6 , 65 / 8 , 85 / 12 , 65 / 14 , 25 / 15 , 85 / 19 , 86 kbits / s ) given under scs and proposes the modes 6 , 65 / 8 , 85 / 12 , 65 / 14 , 25 shown in bold under acs , for which he receives 2 + 4 + 6 + 8 = 20 votes . as shown in fig3 c , the second user ( side a ) supports the modes 8 , 85 - 23 , 85 shown in bold under scs and proposes the modes 15 , 85 / 18 , 25 / 19 , 85 / 23 , 05 / 23 , 85 shown in bold under acs , for which he receives 10 + 9 + 7 + 3 + 1 = 30 votes . whereas ( fig3 b , mcas = 4 ) the first user ( b ) desires a maximum of four of the modes to be used , the second user ( a ), according to fig3 c ( macs = 5 ) would like a maximum of five of the modes to be supported . therefore , the number of parameters to be given ( modes ), in fig3 d , is set to the minimum number of modes receiving the maximum support from the two users ( minimum of 4 and 5 ), i . e . four , so that four parameter sets ( modes ) are to be selected from the four modes 8 , 85 / 12 , 65 / 14 , 25 / 15 , 85 / 19 , 85 , given under cscs ( common supported code set ) and known to both users ( modes shown in bold under scs in fig3 b and 3 c ). based on the number of votes determined in fig3 b and fig3 c , who has what voting right is determined , for example in accordance with the dehont or stlague / schepers method etc . in this case user a has voting right 1 and voting right 3 , but user b has voting right 3 and voting right 4 ( i . e . for the second and fourth codec mode to be selected ). in the simplest case , the voting method can be such that voting takes place alternately after the first vote . fig3 e shows that b has voted for mode 15 , 85 , which , for example , can mean that a automatically selects the largest mode ( that should be known to a control centre in accordance with fig2 or to all users in accordance with fig1 ). as shown in fig3 f , a now votes for mode 14 , 85 because , for example , it is predetermined that b votes for a mode proposed by a that is as high as possible , as a first mode . as shown in fig3 g , b now votes for mode 19 , 85 because it is predetermined that a has supported a mode , proposed by b , that is the lowest possible ( according to fig3 d ) as a cscs supported mode , with 19 , 85 being the lowest in this case . then , in fig3 h , a votes for the next highest mode proposed by a contained in the cscs set , i . e . 12 , 65 . this means that finally modes 12 , 65 , 14 , 25 , 15 , 85 and 19 , 85 have been selected and are now available or determined for the transmission of data between users . the method is very flexible and can also be used with any new codec modes introduced and be quickly adjusted to various assessments of the voice quality of the amr - wb mode by changing the number of votes for the codec mode in the voting method . | 7 |
the invention relates to a cover for a centrifugal compressor which is intended to be fixed to a casing of a turbine engine , comprising an upstream edge and a downstream edge in the flow direction of the gases crossing the compressor , said cover comprising a plurality of openings and fixing means . this cover is characterised in that upstream fixing means are located upstream relative to the openings and can be accessed by a fixing tool through at least one of said openings in the cover . the object of facilitating assembly of the cover is achieved by the invention by means of permitting access from downstream to the fixing means when the cover is put in place . clamping means can have been pre - positioned on the fixing means , and it is then sufficient to pass the fixing tool through the opening providing access to said means in order to fix the cover against the casing by clamping . advantageously this arrangement corresponds to openings intended for air offtake . the cover is thus initially intended to participate in a high - pressure air distribution system by taking off air in the region of the compressor . in this case , there is certainty that said openings are correctly positioned and dimensioned in order not to disrupt the operation of the compressor , and there is also no need to modify the design of the cover in this region . preferably , said upstream fixing means for the cover of the centrifugal compressor comprise an outer flange and fixing holes which pierce said flange , the unit being intended to cooperate with clamping means , of the screw and nut type , which can be actuated by the fixing tool . the holes in the flange are easy to machine and to position on the flange . the screw and nut system , which is widely used , makes it possible to easily fix the cover by clamping said cover against the casing . for example , since each upstream fixing means defines an axis corresponding to the rotation of the movable clamping means for the clamping thereof , said axis passes through at least one of said openings in the cover . in particular , in the case where fixing is achieved by bolting , this makes it possible to use a spindle wrench without a complex mechanism . advantageously , said outer flange forms a wall which completely surrounds said cover . said flange , which is arranged so as to ensure a sealed circumferential connection , upstream of said openings , to a part of the casing when the fixing means are clamped , makes it possible to prevent air from the compressor , which passes through the openings in the cover , from escaping from the front during operation of the turbine engine . firstly , this prevents the space which receives the air escaping through the openings in the cover from being brought into communication with the upstream stages of the turbine engine and disrupting the operation thereof . in addition , devices already described in the documents cited above make it possible to ensure sealing of the connection between the cover and the casing in the region of the largest radius thereof , downstream of the openings . thus , during operation of the turbine engine , the fact that the flow in the compressor is brought into communication with the outside of the cover , via the openings used for allowing the fixing tools to pass through , does not have a detrimental effect on the efficiency of the compressor , since the pressure will equalise . similarly , in view of an offtake of air for uses in other equipment , the lack of leaks in this region contributes to maintaining an elevated pressure in the air distribution circuit . advantageously , each fixing hole in the flange can receive a damping screw by passing through at least one of said openings in the cover . this makes it possible , for example , to pass the screws through after installing the cover on the casing . in a variant , if the holes in the flange are positioned on studs connected to the casing , the openings make it possible to pass through nuts and to install said nuts on the studs . preferably , said flange extends close to the upstream edge of the cover . in a particular embodiment , the cover of the centrifugal compressor further comprises a downstream flange for holding against the casing of the turbine engine , which flange is fastened to the outer wall of the cover between said openings and the downstream edge and forms a sealing means . using a downstream holding flange , which is arranged so as to ensure a sealed circumferential connection against the casing , makes it possible to easily adapt the cover in order to ensure perfect sealing of the space for receiving the gases taken off , and to permit easy assembly thereof . advantageously , this flange is bolted onto the casing of the turbine engine . the invention also relates to a turbine engine comprising a centrifugal compressor having a cover as described above , the casing of which is arranged so as to form a sealed connection to the upstream flange of the cover when the clamping means are clamped . advantageously , the casing is arranged so as to form , together with said cover , at least one closed space which recovers the air passing through the openings in the cover . advantageously , at least some of the openings in the cover , and said air recovery space , are designed to participate in an air offtake system . the present invention will be more readily understood and other details , features and advantages of the present invention will become clearer upon reading the following description with reference to the accompanying drawings , in which : fig1 is an axial section of a first embodiment of a turbine engine compressor comprising a cover according to the invention . fig2 is an enlargement of fig1 , in the upstream fixing region of the cover , showing an exploded view of the screw and nut . fig3 is an axial section of the turbine engine , showing the cover of fig1 , during the assembly phase . with reference to fig1 , the invention relates to the cover 1 of a centrifugal compressor , which forms the radially outer wall of the duct in which the blades 2 of the rotor wheel 3 rotate . the unit has a rotational symmetry about an axis which is not shown but which would be horizontal with respect to fig1 , and below the parts shown . by rotating about this axis , the rotor sucks air in through its input 4 , which is axially oriented , in order to expel said air at higher pressure through its output 5 , which is radially oriented . in a general manner , said compressor discharges its compressed air into a radial recovery duct 6 which is intended to supply the combustion chamber , which is not shown but is located on the right - hand side with reference to fig1 , and is supplied upstream by an axial compressor 7 . the cover 1 is a part which rotates about the axis of symmetry of the compressor , the shape of which follows , with minimal clearance , the surface swept by the radial end of the blades 2 . in addition , the cover 1 is arranged so that the upstream leading edge 8 thereof ensures continuity in shape with the radially outer wall 9 of the duct of the axial compressor 7 , and so that the downstream trailing edge 10 thereof ensures continuity in shape with the wall 11 of the recovery duct 6 . fixing the cover on the casing of the turbine engine should make it possible to position said cover in a sufficiently precise manner in order to take account of the stresses mentioned above and to also permit the cover to move according to the operation of the turbine engine , in order to follow the deformation of the blades 2 while maintaining an optimal clearance . many types of solutions are proposed in the prior art , in particular fixing the cover by means of two flanges , such as in us2011 / 0002774 and ep2206882 , which have already been cited . with regard to holding the cover , this assembly by means of two flanges overdetermines the fixing points of the cover , which must be taken into account in the type of connections made . however , it is entirely possible to achieve an assembly of this kind , as is shown in the documents cited in the prior art . it is within the scope of the invention to use other combinations between the flanges , by adjusting the resilience of the connections they provide . a first embodiment according to the invention uses fixing of this kind , comprising two flanges . an annular flange 12 , fastened downstream in the portion of the cover 1 having the maximum radius relative to the axis of rotation , is bolted to the edge of a circumferential part 13 of the casing . in addition , the cover is also fixed in the upstream portion thereof by a flange 14 to another part 15 of the casing , over the entire circumference thereof . said flange 14 is a frustoconical part which extends radially outside the cover 1 and separates the upstream edge 8 from the downstream edge 10 over the entire circumference of the cover . said flange is fixed to the cover 1 very close to the upstream edge 8 of the cover 1 and has a small radial extension . the connection between the cover and the part 15 of the casing is therefore made very close to the upstream edge 8 . said flange 14 , on account of the position thereof , provides an additional benefit , which is set out below . in some turbine engines , the cover also participates in a function of offtake of high - pressure air in the region of the compressor , in order to introduce said air into a distribution circuit towards various equipment inside the aircraft . in the example shown , the cover 1 is pierced with a plurality of openings 16 , one of which is shown in the section in fig1 . these openings 16 are located on a ring about the axis of symmetry , having a radius which is approximately equal to the minimal radius of the cover , on the upstream edge 8 , and increased by a quarter of the difference from the maximum radius , on the downstream edge 10 . viewed in a different manner , said openings are also located in a region of maximum curvature of the axial profile of the cover 1 . in this way , said openings are located in a region where the cover fulfils a lesser role for containing the flow inside the compressor . said openings can thus be arranged to have a cross section which is sufficient to allow a fraction of the air circulating in the rotor to pass to the outer side of the cover , without causing significant deterioration in the operation of the compressor . the air taken off is recovered in a recovery space 17 , which itself is brought into communication with a distribution circuit ( not shown ). in the example shown in fig1 , said space 17 is delimited , close to the cover , by a portion of the cover 1 , by means of : in the downstream direction , the downstream flange 12 and then an annular part 13 of the casing , in the upstream direction , the upstream flange 14 then an annular part 15 of the casing . thus , as shown in fig2 , the upstream flange is fixed to the part 15 by means of systems consisting of a screw 18 and a nut 19 which pass through holes 20 and 21 , the flange 14 and the part 15 . said holes are , of course , positioned so as to be facing one another during assembly of the cover . said holes , in particular the holes 20 formed in the flange 14 , are circumferentially distributed . the holes 20 which pierce the flange 14 thus form , together with the portion of the flange 14 which surrounds them , as many fixing means fastened to the cover 1 . said fixing means 20 cooperate with the holes 21 arranged on the edge of the annular part 15 and the bolting means , 18 and 19 , in order to press the flange 14 against the part 15 . the portions in contact with the flange and the edge of the part 15 are arranged , optionally with an interposed adjustment shim 23 , so as to ensure that the connection is sealed with respect to the high - pressure air , by virtue of the pressure applied by the bolting means 18 - 19 when said means are clamped . similarly , the downstream flange 12 is bolted to the edge of the part 13 of the casing and ensures that the space 17 for receiving the air taken off is sealed on the downstream side of the cover 1 . the flange 12 generally extends radially outside the cover , which makes it possible to access , from downstream of said flange , the end thereof bolted to the casing when assembling or disassembling the cover . the difficulty in assembling this configuration lies in the fact that , in order to ensure sealing upstream of the cover , the part 15 of the casing approaches the upstream edge 8 of the cover 1 where the radius thereof is the smallest . during assembly in the turbine engine , the cover is installed downstream of the parts of the casing and of the compressor which are already assembled , as is shown in fig3 . the cover 1 , similarly to the downstream flange 12 , thus blocks access to the fixing means 20 and the bolting means 18 - 19 . in the cover according to the invention , the openings 16 in the cover 1 , which are provided for the offtake of air , have been located opposite the fixing holes 20 in the flange 14 , such that a fixing tool , for example a wrench 22 , can grip the head of the screw 18 ( not visible in fig3 ) by passing through the holes 20 in the flange 14 and the holes 21 in the part 15 of the casing , in order to screw said casing onto the nut 19 . in the example shown , the nut 19 is fixed opposite the hole 21 in the part 15 of the casing , on the upstream side thereof , and is prevented from rotating . it is thus possible to install the cover from the rear of the casing , in order to screw the screws 18 there in the nuts 19 through the holes 20 in the flange and the holes 21 in the part 15 of the casing , which holes have been aligned in advance . the offtake opening 16 permits the spindle of a wrench 22 , aligned with the axis of the fixing hole 20 , to pass through , which makes it possible to turn said wrench in order to screw the screw 18 . moreover , while still meeting the operating criterion of the compressor , this opening 16 is sufficiently large to permit the screw 18 to pass through , so as to introduce said screw into the nut 19 through the holes 20 and 21 , as well as the head of the wrench 22 which cooperates with the head of the screw 18 . in a variant , the head of the wrench 22 can be narrower than that of the screw 18 , conversely to what is shown in fig3 , if said wrench head cooperates with a hollowed pattern in the head of the screw . in this way , the screws 18 can have been pre - positioned on the fixing holes 20 of the upstream flange 14 of the cover before said cover is put into position on the casing . in this case , the cross section of the offtake opening 16 only has to permit a relatively narrow wrench 22 to pass through . in another variant , the direction of the placement of the screws 18 , or of the nuts 19 , is reversed . the screw 18 , which is prevented from rotating on the part 15 of the casing , thus forms a stud on which the hole 20 of the flange 14 comes into position , before the nut 19 is screwed . | 5 |
the invention will be described below in relation to a communications environment . although well suited for use with circuit - switched or packet - switched networks , the invention is not limited to use with any particular type of communications system or configuration of system elements and those skilled in the art will recognize that the disclosed techniques may be used in any application in which it is desirable to provide secure feature access . for example , the systems and methods disclosed herein will also work well with sip - based communications systems and endpoints . moreover , the various endpoints described herein can be any communications device such as a telephone , speakerphone , cellular phone , sip - enabled endpoint , softphone , pda , conference system , video conference system , wired or wireless communication device , or in general any communications device that is capable of sending and / or receiving voice and / or data communications . the exemplary systems and methods of this invention will also be described in relation to software , modules , and associated hardware and network ( s ). in order to avoid unnecessarily obscuring the present invention , the following description admits well - known structures , components and devices that may be shown in block diagram form , are well known , or are otherwise summarized . for purposes of explanation , numerous details are set forth in order to provide a thorough understanding of the present invention . it should be appreciated however , that the present invention may be practiced in a variety of ways beyond the specific details set forth herein . fig1 illustrates an exemplary communications environment 100 according to this invention . in accordance with this exemplary embodiment , the communication environment is for video conferencing between a plurality of endpoints . more specifically , communications environment 100 includes a conferencing module 110 , and one or more networks 10 , and associated links 5 , connected to a video camera 102 viewing one or more conference participant endpoints 105 . the communication environment 100 also includes a web cam 115 , associated with conference participant endpoint 125 , and one or more non - video enabled conference participant endpoints 135 , connected via one or more networks 10 and links 5 , to the conference module 110 . the conference module 110 includes a messaging module 120 , an emotion detection and monitoring module 130 , a gesture reaction module 140 , a gesture recognition module 150 , a gesture analysis module 160 , processor 170 , transcript module 180 , control module 190 and storage 195 , as well as other standard conference bridge componentry which will not be illustrated for sake of clarity . in operation , a video conference is established with the cooperation of the conference module 110 . for example , video camera 102 , which may have associated audio inputs and presentation equipment , such as a display and loudspeaker , could be associated with conference participants 105 . webcam 115 is provided for conference participant 125 with audio and video therefrom being distributed to the other conference endpoints . the non - video enabled conference participants 135 either because of endpoint capabilities or user impairment are not able to receive or view video content . the capabilities of these various endpoints can be registered with the conference module 110 , and in particular the messaging module 120 , upon initiation of the video conference . alternatively , the messaging module 120 can interrogate one or more of the endpoints and determine its capabilities . in addition , one or more of each endpoint and / or a user associated with each endpoint may have a profile that not only specifies the capabilities of the endpoint but also messaging preferences . as discussed , these messaging preferences can include the types of information to be received as well as how that information should be presented . as discussed hereinafter in greater detail , the messaging module 120 forwards this information via one or more of the requested modalities to one or more of the conference endpoints . it should be appreciated that while the messaging module 120 will in general only send the description information to non - video enabled conference participants , this messaging could in general be sent to any conference participant . transcript module 180 , in cooperation with one or more of the processer 170 and storage 195 can be enacted upon the commencement of the video conference to create a conference transcript that includes one or more of the following pieces of information : participant information , emotion information , gesture information , key gesture information , reaction information , timing information , and in general any information associated with the video conference and / or one of the described modules . the conference transcript can be conference participant centric or , a “ master ” conference transcript that is capable of capturing and memorializing any one or more aspects of the video conference . upon commencement of the video conference , one or more of the video - enabled participants are monitored and one or more of their emotions and gestures recognized . in cooperation with the emotion detection monitoring module 130 and gesture recognition module 150 , once one or more of an emotion and gesture are recognized , a determination is made whether that is a reportable gesture . if it is a reportable gesture , and in cooperation with the transcript module 180 , that emotion or gesture is recorded in one or more of the appropriate transcripts . in addition , the gesture analysis module 160 analyzes the recognized gesture to determine if it is a key gesture . if the gesture is a key gesture , and in cooperation with the gesture reaction module 140 , the corresponding action associated with that key gesture is taken . the storage 195 can store , for example , a table that draws a correlation between a key gesture and a corresponding reaction . once the correlation between a key gesture and a corresponding reaction is made , the gesture reaction module 140 cooperates with the control module 190 to perform that action . as discussed , this action can in general be any action capable of being performed by any one or more of the components in the communications environment 100 and even more generally , any action associated with a video conferencing environment . the determination by the gesture recognition module 150 as to whether a gesture is reportable can be based on one or more of a “ master ” profile as well as individual profiles associated with one or more conference participants . a profile could also be associated with a group of conference participants for which common reporting action is desired . thus , the gesture recognition module 150 is capable of parallel operation ensuring the transcript module 180 receives all necessary information to ensure all desired reportable events are being recorded and / or forwarded to one or more endpoint ( s ). typical gesture information includes the raising of a hand , shaking of the head , nodding and the like , and more in generally can include any activity being performed by a monitored conference participant . emotions are generally items such as whether a conference participant is nervous , blushing , smiling , crying , or in general any emotion a conference participant may be expressing . while the above has been described in relation to a gesture reaction module it should be appreciated that comparable functionality can be provided based on the detection of one or more emotions . similarly , it should be appreciated that it could be a singular emotion or gesture that triggers a corresponding reaction , or a combination of one or more emotions and / or gestures that triggers a corresponding reaction ( s ). examples of reactions include one or more of panning , tilting , zooming , increasing microphone volume , decreasing microphone volume , increasing loud speaker volume , decreasing loud speaker volume , switching camera feeds , and in general any conference functionality . fig2 - 3 illustrate exemplary conference transcripts according to an exemplary embodiment of this invention . in conference transcript 200 , illustrated in fig2 , four illustrative conference participants ( 210 , 220 , 230 and 240 ) are participating and , as each participant speaks , their speech recognized , for example , with the use of a speech - to - text converter and logged in the transcript . in addition , there is an emotion section 250 that summarizes one or more of the various emotions and gestures recognized as time proceeds through the video conference . the emotion section 250 can be participant - centric , and can also include motion and / or gesture information for a plurality of participants that may coincidently be performing the same gesture or experiencing the same emotion . even more generally , any action taken by a conference participant could also be summarized in this emotion portion 250 , such as conference participant 1 typing during conference participant 3 speaking . as mentioned above , this conference transcript 200 and in a similar manner conference transcript 300 , can be customized based on , for example , a particular conference participant &# 39 ; s profile . this conference transcript could be presented in real - time for one or more of the conference participants and stored either in storage 195 , at an endpoint and / or forwarded to , for example , a destination specified in the profile at the conclusion of the conference , e . g . email . fig3 illustrates an optional embodiment of a conference transcript 300 . in this particular embodiment , the emotion and / or gesture information is located adjacent to the corresponding conference participant . this could be useful to assist with focusing more particularly on a particular conference participant . in addition , one or more of the conference transcript 200 and conference transcript 300 could be dynamic and , for example , selectable such that a user could return to the conference transcript after conference has finished and replay either a recoded portion of the conference and / or the particular footage associated with a recorded emotion and / or gesture . even though not illustrated , one or more of the conference transcripts 200 and 300 could also include a reaction column that provides an indication as to which one or more reactions were performed during the conference . fig4 illustrates an exemplary method of operation of providing descriptions of non - verbal communications to video telephony participants who are not video - enabled . while fig4 will generally be directed toward gestures , it should be appreciated that corresponding functionality could be applied to emotions and / or a series of emotions and gestures that , when combined , are a triggering event . in particular , control begins at step s 400 and continues to step s 410 . in step s 410 , the system can optionally assess the capabilities of one or more of the meeting participants . next , in step s 420 , and for each meeting participant that is not video - enabled , the messaging preferences and / or capabilities of one or more of the meeting participants can be determined . then , in step s 430 , a transcript template can be generated that includes , for example , portions for one or more of the conference participants , emotions , gestures , and reaction portions . control then continues to step s 440 . in step s 440 , the conference commences and transcripting optionally started . next , in step s 450 , and for each video - enabled participant , their gestures are monitored and recognized . then , in step s 460 , a determination is made whether the gesture is a reportable gesture . if the gesture is reportable , control continues to step s 470 where gesture information corresponding to a description of the gesture is one or more of provided and recorded to one or more appropriate endpoints . control then continues to step s 480 . in step s 480 , a determination is made whether a gesture , or a sequence of gestures , is a key gesture . if it is a key gesture , control continues to step s 490 with control otherwise jumping to step s 520 . in step s 490 , a control action ( s ) associated with the gesture is determined . next , in step s 500 , a determination is made whether the control action ( s ) is allowable . for example , this determination could be made based on one or more of the capabilities of one or more endpoints , information associated with a profile governing whether gestures from that particular endpoint will be recognized , and a particulars specific key gesture , or the like . if the action ( s ) is allowable , control continues to step s 510 where the action is performed . as discussed , this action could also be logged in a transcript . control then continues back to step s 520 . in step s 520 , a determination is made whether the conference has ended . if the conference has not ended , control jumps back to step s 450 where further gestures are monitored . otherwise , transcripting , if initiated , is concluded with control jumping to step s 530 where the control sequence ends . a number of variations and modifications of the invention can be used . it would be possible to provide or claims for some features of the invention without providing or claiming others . the exemplary systems and methods of this invention have been described in relation to enhancing video conferencing . however , to avoid unnecessarily obscuring the present invention , the description omits a number of known structures and devices . this omission is not to be construed as a limitation of the scope of the claimed invention . specific details are set forth to provide an understanding of the present invention . it should however be appreciated that the present invention may be practiced in a variety of ways beyond the specific detail set forth herein . furthermore , while the exemplary embodiments illustrated herein show various components of the system collocated , certain components of the system can be located remotely , at distant portions of a distributed network , such as a lan , cable network , and / or the internet , or within a dedicated system . thus , it should be appreciated , that the components of the system can be combined in to one or more devices , such as a gateway , or collocated on a particular node of a distributed network , such as an analog and / or digital communications network , a packet - switch network , a circuit - switched network or a cable network . it will be appreciated from the preceding description , and for reasons of computational efficiency , that the components of the system can be arranged at any location within a distributed network of components without affecting the operation of the system . for example , the various components can be located in a switch such as a pbx and media server , gateway , a cable provider , enterprise system , in one or more communications devices , at one or more users &# 39 ; premises , or some combination thereof . similarly , one or more functional portions of the system could be distributed between a communications device ( s ) and an associated computing device . furthermore , it should be appreciated that the various links , such as link 5 , connecting the elements can be wired or wireless links , or any combination thereof , or any other known or later developed element ( s ) that is capable of supplying and / or communicating data to and from the connected elements . these wired or wireless links can also be secure links and may be capable of communicating encrypted information . transmission media used as links , for example , can be any suitable carrier for electrical signals , including coaxial cables , copper wire and fiber optics , and may take the form of acoustic or light waves , such as those generated during radio - wave and infra - red data communications . also , while the flowcharts have been discussed and illustrated in relation to a particular sequence of events , it should be appreciated that changes , additions , and omissions to this sequence can occur without materially affecting the operation of the invention . in yet another embodiment , the systems and methods of this invention can be implemented in conjunction with a special purpose computer , a programmed microprocessor or microcontroller and peripheral integrated circuit element ( s ), an asic or other integrated circuit , a digital signal processor , a hard - wired electronic or logic circuit such as discrete element circuit , a programmable logic device or gate array such as pld , pla , fpga , pal , special purpose computer , any comparable means , or the like . in general , any device ( s ) or means capable of implementing the methodology illustrated herein can be used to implement the various aspects of this invention . exemplary hardware that can be used for the present invention includes computers , handheld devices , telephones ( e . g ., cellular , internet enabled , digital , analog , hybrids , and others ), and other hardware known in the art . some of these devices include processors ( e . g ., a single or multiple microprocessors ), memory , nonvolatile storage , input devices , and output devices . furthermore , alternative software implementations including , but not limited to , distributed processing or component / object distributed processing , parallel processing , or virtual machine processing can also be constructed to implement the methods described herein . in yet another embodiment , the disclosed methods may be readily implemented in conjunction with software using object or object - oriented software development environments that provide portable source code that can be used on a variety of computer or workstation platforms . alternatively , the disclosed system may be implemented partially or fully in hardware using standard logic circuits or vlsi design . whether software or hardware is used to implement the systems in accordance with this invention is dependent on the speed and / or efficiency requirements of the system , the particular function , and the particular software or hardware systems or microprocessor or microcomputer systems being utilized . in yet another embodiment , the disclosed methods may be partially implemented in software that can be stored on a storage medium , executed on programmed general - purpose computer with the cooperation of a controller and memory , a special purpose computer , a microprocessor , or the like . in these instances , the systems and methods of this invention can be implemented as a program embedded on personal computer such as an applet , java ® or cgi script , as a resource residing on a server or computer workstation , as a routine embedded in a dedicated measurement system , system component , or the like . the system can also be implemented by physically incorporating the system and / or method into a software and / or hardware system . although the present invention describes components and functions implemented in the embodiments with reference to particular standards and protocols , the invention is not limited to such standards and protocols . other similar standards and protocols not mentioned herein are in existence and are considered to be included in the present invention . moreover , the standards and protocols mentioned herein and other similar standards and protocols not mentioned herein are periodically superseded by faster or more effective equivalents having essentially the same functions . such replacement standards and protocols having the same functions are considered equivalents included in the present invention . the present invention , in various embodiments , configurations , and aspects , includes components , methods , processes , systems and / or apparatus substantially as depicted and described herein , including various embodiments , subcombinations , and subsets thereof . those of skill in the art will understand how to make and use the present invention after understanding the present disclosure . the present invention , in various embodiments , configurations , and aspects , includes providing devices and processes in the absence of items not depicted and / or described herein or in various embodiments , configurations , or aspects hereof , including in the absence of such items as may have been used in previous devices or processes , e . g ., for improving performance , achieving ease and \ or reducing cost of implementation . the foregoing discussion of the invention has been presented for purposes of illustration and description . the foregoing is not intended to limit the invention to the form or forms disclosed herein . in the foregoing detailed description for example , various features of the invention are grouped together in one or more embodiments , configurations , or aspects for the purpose of streamlining the disclosure . the features of the embodiments , configurations , or aspects of the invention may be combined in alternate embodiments , configurations , or aspects other than those discussed above . this method of disclosure is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim . rather , as the following claims reflect , inventive aspects lie in less than all features of a single foregoing disclosed embodiment , configuration , or aspect . thus , the following claims are hereby incorporated into this detailed description , with each claim standing on its own as a separate preferred embodiment of the invention . moreover , though the description of the invention has included description of one or more embodiments , configurations , or aspects and certain variations and modifications , other variations , combinations , and modifications are within the scope of the invention , e . g ., as may be within the skill and knowledge of those in the art , after understanding the present disclosure . it is intended to obtain rights which include alternative embodiments , configurations , or aspects to the extent permitted , including alternate , interchangeable and / or equivalent structures , functions , ranges or steps to those claimed , whether or not such alternate , interchangeable and / or equivalent structures , functions , ranges or steps are disclosed herein , and without intending to publicly dedicate any patentable subject matter . | 7 |
in the general formula ( a ) to express the photosensitive material of the present invention , the halogen represented by r 1 to r 8 is preferably chlorine , bromine or iodine , the alkyl group represented by r 1 to r 8 is preferably an alkyl group having 1 to 4 carbon atoms such as methyl , ethyl , propyl , isopropyl , n - butyl , isobutyl , secbutyl , t - butyl ; the alcoxyl group is preferably an alcoxyl group having 1 to 4 carbon atoms such as methoxy , ethoxy , hydroxyethoxy , propoxy , hydroxypropoxy , isopropoxy , n - butoxy , isobutoxy , sec - butoxy , or t - butoxy ; the aralkyl group is preferably benzyl group , phenetyl group , benzhydryl group , etc . ; the aryl group is preferably phenyl , tolyl , hydroxyphenyl , naphthyl , etc . ; the monoalkylamino group is preferably a monoalkylamino group having 1 to 4 carbon atoms such as monomethylamino , monoethylamino , monopropylamino , monoisopropylamino , mono - n - butylamino , monoisobutylamino , mono - sec - butylamino , or mono - t - butylamino ; the dialkylamino group is preferably a dialkylamino group having alkyl substitution group with 1 to 4 carbon atoms such as dimethylamino , diethylamino , dipropylamino , diisopropylamino , di - n - butylamino , diisobutylamino , di - sec - butylamino , di - t - butylamino , etc . ; the acylamino group is preferably an aliphatic substitution acylamino group having 2 to 5 carbon atoms respectively such as acetylamino , propionylamino , butyrylamino , isobutyrylamino , isovalerylamino , pivaloylamino , and an aromatic substitution acylamino group such as benzoylamino , or toluoylamino ; the alkylcarbamoyl group is preferably an alkylcarbamoyl group having 2 to 5 carbon atoms such as methylcarbamoyl , ethylcarbamoyl , propylcarbamoyl , isopropylcarbamoyl , n - butylcarbamoyl , isobutylcarbamoyl , sec - butylcarbamoyl , t - butylcarbamoyl , etc . ; the arylcarbamoyl group is preferably phenylcarbamoyl , tolylcarbamoyl , etc . ; the alkylsulfamoyl group is preferably an alkylsulfamoyl group having 1 to 4 carbon atoms such as methylsulfamoyl , ethylsulfamoyl , propylsulfamoyl , isopropylsulfamoyl , n - butylsulfamoyl , sec - butylsulfamoyl , t - butylsulfamoyl , etc . ; arylsulfamoyl group is preferably phenylsulfamoyl , tolylsulfamoyl , etc . ; the acyl group is preferably an aliphatic acyl group having 1 to 5 carbon atoms such as formyl , acetyl , propionyl , butyryl , isobutyryl , valeryl , isovaleryl , pivaloyl , etc . and an aromatic acyl group such as benzoyl , toluoyl , salicyloyl , naphthaoyl , etc . ; the alkyloxycarbonyl group is preferably an alkyloxycarbonyl group having 2 to 5 carbon atoms such as methoxycarbonyl , ethoxycarbonyl , propoxycarbonyl , isopropoxycarbonyl , n - butoxycarbonyl , isobutoxycarbonyl , sec - butoxycarbonyl , t - butoxycarbonyl , etc . ; the aryloxycarbonyl group is preferably an aryloxycarbonyl group such as phenoxycarbonyl ; the acyloxy group is preferably an aliphatic acyloxy group having 2 to 5 carbon atoms such as acetoxy , propionyloxy , butyryloxy , isobutyryloxy , valeryloxy , isovaleryloxy , pivaloyloxy , etc . and an aromatic acyloxy group such as benzoyloxy , toluoyloxy , naphthoyloxy , etc . in the above general formula ( a ), the alkyl group represented by r 9 to r 12 is preferably an alkyl group having 1 to 4 carbon atoms such as methyl , ethyl , propyl , isopropyl , butyl , isobutyl , sec - butyl , t - butyl , etc . the compound expressed by tile general formula ( a ) can be easily synthesized by condensing a derivative of spirobiindan or spirobichroman with 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride or 1 , 2 - naphthoquinonediazide - 4 - sulfonyl chloride or mixture of these substances , whereby said derivative of spirobiindan or spirobichroman is expressed by : general formula ( b ) ## str3 ## where r 13 to r 20 each independently rtepresents hydrogen , hydroxyl group , halogen , alkyl group , alcoxyl group , aralkyl group , aryl group , amino group , monoalkylamino group , dialkylamino group , acylamino group , alkylcarbamoyl group , arylcarbamoyl group , alkylsulfamoyl group , arylsulfamoyl group , carboxyl group , cyano group , nitro group , acyl group , alkyloxycarbonyl group , aryloxycarbonyl group , or acyloxy group , and at least one of r 13 to r 20 is hydroxyl group , amino group or monoalkylamino group ; r 21 to r 24 each independently represents hydrogen or lower alkyl group , and r 21 and r 22 and / or r 23 and r 24 may form a ring ; r 25 to r 28 each independently represents hydrogen or lower alkyl group , and r 25 or r 26 and r 27 or r 28 may form a ring . however , at least one of r 25 to r 28 is a substitution group other than hydrogen ; and the compound expressed by the general formula ( b ) can be synthesized , for example , by applying the method of w . baker et al . [ j . chem . soc ., ( 1939 ), p . 195 ff .] more concretely , the compound can be obtained by dehydrated condensation of substituted or unsubstituted ( poly ) hydroxyphenyl compound and carbonyl compounmd except acetone , e . g . methylethylketone , diethylketone , methylisobutylketone , cyclohexanone , etc . in the presence of acid catalyst . in the compound thus obtained , at least one substitution group other than hydrogen is introduced at position 2 or position 2 &# 39 ; in case of spirobiindan compound , and at least one substitution group other than hydrogen is introduced at position 3 or position 3 &# 39 ; in case of spirobichroman compound . actually , a single product is not obtained by the introduced substitution group and substituting position isomer of hydroxyl group , but it is obtained as a mixture of many types of isomers . the compounds expressed by the general formula ( b ) are summarized in tables 1 to 7 but are not limited to these . table 1______________________________________no . compounds______________________________________1 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 - 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol2 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol3 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol4 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol5 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol6 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol7 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol8 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol9 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol10 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol11 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol12 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol______________________________________ table 2______________________________________no . compounds______________________________________13 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - buthyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol14 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - buthyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol15 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - buthyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol16 2 - methyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol17 2 - methyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol18 2 - methyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol19 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol20 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol21 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol22 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol23 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol24 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol25 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol______________________________________ table 3______________________________________no . compounds______________________________________26 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol27 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol28 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol29 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol30 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol31 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol32 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol33 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol34 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol35 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol36 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol37 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol38 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol39 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol40 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol______________________________________ table 4______________________________________no . compounds______________________________________41 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol42 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol43 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol44 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol45 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol46 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol47 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol48 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol49 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol50 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol51 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol52 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol53 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol54 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol55 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol______________________________________ table 5______________________________________no . compounds______________________________________56 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol57 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol58 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol59 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol60 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol61 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol62 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol63 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol64 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol65 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol66 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol67 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol68 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol69 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol70 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol______________________________________ table 6______________________________________no . compounds______________________________________71 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol72 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol73 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol74 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol75 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol76 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol77 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol78 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol79 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol80 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol81 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 5 &# 39 ;- diol82 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 &# 39 ;- diol______________________________________ table 7______________________________________no . compounds______________________________________83 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol84 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 5 &# 39 ;- diol85 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 &# 39 ;- diol86 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol87 5 , 5 &# 39 ;- di - t - buthyl - 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol88 5 , 5 &# 39 ;- di - t - buthyl - 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol89 7 , 7 &# 39 ;- dibromo - 2 , 3 , 5 , 3 &# 39 ;, 5 &# 39 ;- heptamethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol90 5 , 5 &# 39 ;- diamino - 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol91 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 7 , 6 &# 39 ; 7 &# 39 ;- tetrol92 7 , 7 &# 39 ;- dichlor - 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 6 &# 39 ;- diol93 5 , 5 ═- dichlor - 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 6 &# 39 ;- diol94 6 , 6 &# 39 ;- di - t - buthyl - 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 7 , 7 &# 39 ;- diol______________________________________ the compound of the present invention can be obtained by normal esterification reaction of a part or all of hydroxyl groups of said polyhydroxy compound with 1 , 2 - naphthoquinonediazide - 5 -( and / or - 4 -) sulfonyl chloride in the presence of basic catalyst . specifically , a predetermined quantity of polyhydroxy compound and 1 , 2 - naphthoquinondiazide - 5 -( and / or - 4 -) sulfonyl chloride as well as solvents such as dioxane , acetone , methylethylketone , n - methylpyrolidone , etc . are placed in a flask , and this is condensed by dropping basic catalyst such as sodium hydroxide , sodium carbonate , sodium hydrogencarbonate , triethylamine , etc . the resultant product is rinsed with water , purified and dried . by the above esterification reaction , mixtures with different ester values and different esterification positions can be obtained . as the alkali - soluble resin used in the present invention , novolak resin , vinylphenol resin , n -( hydroxyphenyl ) maleimide ( co ) polymer , styrene - maleic acid anhydride copolymer , or metacryl or acrylic resin containing carboxyl group , sulfonyl group , or phosphonic acid group may be used . the alkali - soluble novolak resin used in the present invention can be obtained by condensation of 1 mol of phenols and 0 . 6 to 2 . 0 mols of aldehydes in the presence of acid catalyst . as the phenols , phenol , p - chlorphenol , o - cresol , m - cresol , p - cresol , ethylphenol , resorcinol , naphthol and xylenol , etc . may be used alone or in combination . as the aldehydes , formaldehyde , paraformaldehyde , acetoaldehyde or furfural , etc . may be used . as the acid catalyst , hydrochloric acid , sulfuric acid , formic acid , oxalic acid and acetic acid may be used . the novolak resin thus obtained has molecular weight of 1 , 000 to 50 , 000 and is alkali - soluble . the photosensitive material and the alkali - soluble novolak resin in the present invention are used in the following ratio : novolak resin by 100 weight parts and the photosensitive material by 5 to 100 weight parts , or more preferably , by 10 to 50 weight parts . if the ratio of the latter is used by less than 5 weight parts , the ratio of ( remaining ) film extremely decreases . if it is used by more than 100 weight parts , sensitivity and solubility to solvents decrease . in the present invention , the above photosensitive materials should be primarily used , whereas the following photosensitive materials may be used : for example , ester compound of 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride with polyhydroxybenzophenones such as 2 , 3 , 4 - trihydroxybenzophenone , 2 , 4 , 4 &# 39 ;- trihydroxybenzophenone , 2 , 4 , 6 - trihydroxybenzophenone , 2 , 3 , 4 , 4 &# 39 ;- tetrahydroxybenzophenone , 2 , 2 &# 39 ;, 4 , 4 &# 39 ;- tetrahydroxybenzophenone , 2 , 4 , 6 , 3 &# 39 ;, 4 &# 39 ;, 5 &# 39 ;- hexahydroxybenzophenone , 2 , 3 , 4 , 3 &# 39 ;, 4 &# 39 ;, 5 &# 39 ;- hexahydroxybenzophenone , etc ., polyhydroxyphenylalkylketones such as 2 , 3 , 4 - trihydroxyacetophenone , 2 , 3 , 4 - trihydroxyphenylhexylketone , etc ., bis (( poly ) hydroxyphenyl ) alkanes such as bis ( 2 , 4 - dihydroxyphenyl ) methane , bis ( 2 , 3 , 4 - trihydroxyphenyl ) methane , bis ( 2 , 4 - dihydroxyphenyl ) propane - 1 , etc ., polyhydroxy - benzoic acid esters such as 3 , 4 , 5 - trihydroxy propyl benzoate , 3 , 4 , 5 - trihydroxy phenyl benzoate , etc . bis ( polyhydroxybenzoyl ) alkane or bis ( polyhydroxybenzoyl ) aryl such as bis ( 2 , 3 , 4 - trihydroxy - benzoyl ) methane , bis ( 2 , 3 , 4 - trihydroxybenzoyl ) benzene , etc ., alkylene - di -( polyhydroxybenzoate ) such as ethylene glycol - di -( 3 , 5 - dihydroxybenzoate ), etc . in this case , it is preferable to use the photosensitive material of the above general formula ( a ) by 100 weight parts and the above compound by less than 100 weight parts , or more preferably , less than 30 weight parts . further , in the present invention , polyhydroxy compound may be contained in order to promote dissolution in developing solution . as the preferable polyhydroxy compounds , phenols , resorcin , phloroglucin , 2 , 3 , 4 - trihydroxybenzophenone , 2 , 3 , 4 , 4 &# 39 ;- tetrahydroxybenzophenone , 2 , 3 , 4 , 3 &# 39 ;, 4 &# 39 ;, 5 &# 39 ;- hexahydroxybenzophenone , acetone - pyrogallol condensed resin , etc . may be used . as the solvents to dissolve the photosensitive materials and the alkali - soluble resin of the present invention , ketones such as methylethylketone , cyclohexanone , etc ., alcohol ethers such as ethyleneglycol - monomethylether , ethyleneglycol - monoethyl ether etc . ethers such as dioxane , ethyleneglycol - dimethyl ether , diethyleneglycoldimethyl ether , etc ., cellosolve esters such as methylcellosolve acetate , ethylcellosolve acetate , etc ., fatty acid esters such as buthyl acetate , ethyl lactate , methyl lactate , etc ., halogenated hydrocarbons such as 1 , 1 , 2 - trichloroethylene , etc . or high polar solvents such as dimethylacetoamide , n - methylpyrolidone , dimethylformamide , dimethylsulfoxide , γ - butylolactone , etc . may be used . these solvents may be used alone or in combination . to the composition for photoresist of the present invention , dyes , plasticizers , supplementary bonding agents , surface active agents , etc . may be blended . more concretely , the dyes such as methyl violet , crystal violet , malachite green , etc ., the plasticizers such as stearic acid , actal resin , phenoxy resin , alkyd resin , etc ., supplementary bonding agent such as hexamethyldisilazane , chloromethylsilane , etc ., and the surface active agents such as nonylphenoxy - poly -( ethyleneoxy ) ethanol , octylphenoxy - poly -( ethyleneoxy ) ethanol , etc . may be used . also , the compounds described in japanese patent publication laid - open 58 - 149042 or japanese patent publication laid - open 58 - 182633 may be added . when the above photoresist composition is coated on a substrate ( e . g . silicon / silicon dioxide film ) used in the manufacture of precision integrated circuit by adequate coating method such as spinner , coater , etc . and it is further exposed to light through a predetermined mask and developed , satisfactory resist can be obtained . as the developing solution for the photoresist composition of the invention , aqueoous solution of the following substances may be used : inorganic alkalis , such as sodium hydroxide , potassium hydroxide , sodium carbonate , sodium silicate , sodium metasilicate , aqueous ammonia , etc ., primary amines such as ethylamine , n - propylamine , etc ., secondary amines such as diethylamine , di - n - butylamine , tertiary amines such as triethylamine , methyldiethylamine , etc ., alcoholamine , such as dimethylethanol amine , triethanol amine , etc ., quaternary ammonium salts such as tetramethylammonium hydroxide , tetraethylammonium hydroxide , choline hydroxide , etc . or alkalis of cyclic amines such as pyrrole , piperidine , etc . further , adequate quantity of alcohols or surface active agents may be added to aqueous solution of the above alkalis . when necessary , image reversal treatment may be performed on the photosensitive resin composition of the present invention by the methods described in british patent 844 , 039 , u . s . pat . no . 4 , 104 , 070 or japanese patent publication 55 - 32088 , and negative image can be obtained . in the following , description will be given on embodiments of the present invention , while the present invention is not limited to such embodiments . the symbol &# 34 ;%&# 34 ; means weight % unless otherwise specified . first , description will be given on synthesis of the photosensitive materials and novolak resin . into a three - neck flask , 1513 . 3 g of pyrogallol , 2800 ml of acetic acid , and 2400 ml of conc . hydrochloric acid were placed , and the mixture was uniformly dissolved while stirring . it was heated in a water bath , and 1297 . 9 g of methylethylketone were dropped over a period of 6 hours 40 minutes . after heating and stirring in a water bath for 80 minutes , it was cooled down to room temperature . after cooling , the precipitates were filtered , rinsed with 10 liters of distilled water and was dried under reduced pressure . into a three - neck flask , 22 . 0 g of isomer mixture thus obtained and represented by 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol , 80 . 6 g of 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride , and 750 ml of acetone were placed , and these were uniformly dissolved while stirring . then , 32 . 5 g of triethylamine were gradually dropped , and this was allowed to react for 2 hours 30 minutes at room temperature . after the reaction was completed , the content was dropped into 2 . 5 % aqueous solution of acetic acid . the resultant precipitates were filtered and dried under reduced pressure , and the photosensitive material ( a ) was obtained . using pyrogallol and diethylketone , isomer mixture represented by 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol was prepared by the same procedure as the photosensitive material ( a ). into a three - neck flask , 24 . 5 g of the isomer mixture represented by 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol obtained above , 80 . 6 g of 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride and 750 ml of acetone were placed , and this mixture was uniformly dissolved while stirring . then , 32 . 5 g of triethylamine was gradually dropped and this was allowed to react at room temperature for 2 hours 30 minutes . after the reaction was completed , the content was dropped into 2 . 5 % aqueous solution of acetic acid . the resultant precipitates were filtered and dried under reduced pressure , and the photosensitive material ( b ) was obtained . using 1 , 2 , 4 - triacetoxybenzene and methylethylketone , 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol was obtained by the same procedure as the photosensitive material ( a ). then , 22 . 0 g of 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol , 80 . 6 g of 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride , and 750 ml of were placed into a three - neck flask , and the mixture was uniformly dissolved while stirring . next , 32 . 5 g of triethylamine were gradually dropped and were allowed to react at room temperature for 2 hours 30 minutes . after the reaction was completed , the content was dropped into 2 . 5 % aqueous solution of acetic acid . the resultant precipitates were filtered and dried under reduced pressure , and the photosensitive material ( c ) was prepared . into a three - neck flask , 45 g of metacresol , 55 g of paracresol , 54 . 0 g of 37 % formalin aqueous solution , and 0 . 05 g of oxalic acid were placed . this was heated up to 115 ° c . while stirring and was refluxed for 15 hours . then , the bath temperature was gradually increased to 230 ° c ., and water was distilled away . further , the pressure was reduced to 2 mmhg , and the remaining monomer was removed . the novolak resin thus obtained has average molecular weight of 6 , 600 ( converted to polystyrene ). 0 . 51 g of the photosensitive material ( a ) synthesized in ( 1 ) above and 2 . 01 g of novolak resin synthesized in ( 4 ) above were dissolved in 7 . 50 g of ethoxyethyl acetate , and the resultant mixture was filtered through 0 . 2 μm microfilter , and a resist composition was prepared . this resist composition was coated on a silicon wafer using spinner . this was dried on a vacuum adsorption type hot plate at 90 ° c . for 60 seconds , and a resist film with thickness of 1 . 2 μm was obtained . next , using a nikon reduction projection aligner ( exposure system ) ( g - ray ; numerical aperture : 0 . 48 ), exposure to light was performed through a test chart mask . the wafer thus exposed was heated on a hot plate at 120 ° c . for 60 seconds , and development was performed for one minute in aqueous solution of tetramethylammonium hydroxide of 2 . 38 weight %. then , it was rinsed with ion exchange water and a resist pattern was obtained . the resist pattern thus obtained was examined under scanning electron microscope . the sensitivity was defined by a reciprocal of the exposure to reproduce a mask pattern of 0 . 7 μm and was expressed by the relative value to the sensitivity of the comparative example described below . remaining film ratio was expressed by percentage of film thickness of non - exposed portion after development to the thickness before development . to determine heat - resistance , a silicon wafer having a resist pattern was baked for 4 minutes on a vacuum adsorption hot plate at a predetermined temperature , and heat resistance was expressed by the temperature value , at which the resist patterns began to deform . resolution was expressed by linewidth of the smallest mask pattern resolved in the exposure to reproduce a mask pattern of 0 . 7 μm . sidewall angle was expressed by an angle between the substrate and side wall of the resist pattern when cross - section of the resist pattern of 0 . 7 μm was examined from lateral direction under electron microscope . the relative sensitivity was 1 . 05 , remaining film ratio was 99 . 7 %, heat resistance was 150 ° c ., resolution was 0 . 45 μm , and sidewall angle was 89 degrees . the photosensitive materials synthesized in ( 2 ) and ( 3 ) above were used at the ratio shown in table 8 below , and resist compositions were prepared by the same procedure as in example 1 and were evaluated . the results are given in table 9 . table 8______________________________________ novolakexamples photosensitive materials resin solvents______________________________________example 2 photosensitive 0 . 49 g 1 . 99 g ethyl lactate material ( a ) 7 . 49 gexample 3 photosensitive 0 . 50 g 2 . 00 g same as material ( b ) example 1 7 . 50 gexample 4 photosensitive 0 . 49 g 1 . 98 g same as material ( c ) example 1 7 . 48 g______________________________________ table 9______________________________________ heat - side - relative resolu - remaining resis - wallexamples sensitivity tion film ratio tance angle______________________________________example 2 1 . 1 0 . 45 99 . 6 150 ° c . 89 ° example 3 1 . 0 0 . 47 99 . 8 145 ° c . 89 ° example 4 1 . 05 0 . 45 99 . 7 150 ° c . 89 ° ______________________________________ as it is evident from the above results , the photo - resist of the present invention has excellent sensitivity , high resolution , remaining film ratio and heat resistance , and sidewall angle of pattern exceeded 88 degrees in all cases . using the photosensitive materials , cresol novolak resin and solvents shown in table 10 below , resist solution was prepared by the same procedure as in example 1 and was evaluated . the results are given in table 11 . table 10__________________________________________________________________________comparativeexample photosensitive materials resin solvents__________________________________________________________________________comparative 1 , 2 - naphthoquinone - 0 . 50 g same as example 1 same as example 1example 1 diazide - 5 - sulfonic acid 1 . 99 g 7 . 48 g ester of 3 , 3 , 3 &# 39 ; 3 &# 39 ;- tetra - methyl - 1 , 1 &# 39 ;- spiro - biindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexolcomparative 1 , 2 - naphthoquinone - 0 . 50 g same as example 1 ethyl lactateexample 2 diazide - 5 - sulfonic acid 2 . 01 g 7 . 51 g ester of 2 , 3 , 4 , 4 &# 39 ;- tetra - hydroxybenzophenonecomparative 1 , 2 - naphthoquinone - 0 . 50 g same as example 1 same as example 1example 3 diazide - 5 - sulfonic acid 2 . 00 g 7 . 50 g ester of 4 , 4 , 4 &# 39 ;, 4 &# 39 ;- tetramethyl - 2 , 2 &# 39 ;- spiro - bichroman - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol__________________________________________________________________________ table 11______________________________________compara - heat - side - tive relative resolu - remaining resis - wallexample sensitivity tion film ratio tance angle______________________________________compara - 1 . 0 0 . 47 99 . 5 150 ° c . 87 ° tiveexample 1compara - 0 . 8 0 . 50 98 . 9 140 ° c . 86 ° tiveexample 2compara - 0 . 9 0 . 47 99 . 0 145 ° c . 87 ° tiveexample 3______________________________________ in none of the comparative examples , sidewall angle exceeded 88 degrees . | 6 |
for the purpose of promoting an understanding of the principles of the invention , reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . a time domain reflectometry ( tdr ) apparatus 10 of the present invention , shown in fig1 , is used to measure electrical properties of the concrete 12 . the apparatus 10 generally comprises a probe 14 , a plurality of equally spaced spike sensors 16 ( available at most local hardware stores ), a coaxial cable 18 , and a tdr tester ( such as tdr 100 tester available from campbell scientific , inc ., not shown ). an apparatus of the type described above is described in more detail in u . s . pat . no . 6 , 215 , 317 to siddiqui et al ., which patent is hereby incorporated by reference . data collected by the tdr tester is analyzed in accordance with the present invention by a general purpose computer running a specially developed computer program that implements the equations described below . a typical tdr signal and information content for tdr measurement in a material is shown in fig2 . a “ peak ” and a “ valley ” are caused by reflections and are characteristic of tdr signals measured in geomaterials . the “ peak ” is caused by the first reflection , which occurs when the electromagnetic pulse crosses the air / material interface . the “ valley ” is caused by the second reflection , which occurs when the electromagnetic pulse arrives at the end of the measurement probe . dielectric constant , and electrical conductivity are two pieces of important information that can be obtained from analysis of a tdr signal . material dielectric constant is analogous to young &# 39 ; s modulus in that it determines the electromagnetic wave speed . it can be determined from travel time analysis and is generally called apparent dielectric constant , denoted k a . k a represents the real part of the frequency dependent dielectric permittivity . equation ( 1 ) gives the mathematic expression for computing dielectric constant from tdr measurement . where l p is the length of the probe in the material and l a is the scaled horizontal distance between the two reflections , called apparent length . the electrical conductivity , ec b , causes attenuation of tdr signal and is another important piece of information that can be obtained from tdr waveforms . different approaches can be used to obtain electrical conductivity from a tdr signal . equation ( 2 ) uses an approach based on analysis of the long - term response of a tdr system to determine electrical conductivity . ec b = 1 c ( v s v f - 1 ) ( 2 ) where v s is the source voltage , v f is the long term voltage level , and c is a constant related to probe configuration , determined from equation ( 3 ) for coaxially configured probes , c = 2 π l p r s ln ( ⅆ 0 ⅆ i ) ( 3 ) in which l p equals the length of the probe in the material , r s the internal resistance of the pulse generator ( typically 50 ohms ), and d o and d i are the diameters of outer and inner coaxial conductors , respectively . water plays an important role in concrete mixtures . it serves as a necessary agent for hydration reactions , in which free water molecules become chemically bound with cement particles . the amount of water involved in these reactions is typically only a fraction of the water added to the mixture . as the result , the major factor that controls the amount of water used in concrete is to provide a mixture that can be placed and is workable . water in concrete mixtures comes from two main sources , i . e ., water added during mixing process and the adsorbed water from aggregates . the moisture contents of coarse aggregates generally range from 0 . 5 % to 2 % and those of fine aggregates range from 2 % to 6 %, which can introduce significant amount of water into the concrete mixture . currently , there is no effective approach for field measurement of water content in freshly placed concrete . the strong correlation between tdr - measured dielectric constant and the amount of water in concrete is attributed to the much larger dielectric constant of free water ( around 81 at room temperature ) as compared with the dielectric constant of air ( around 1 ) or geomaterial solids ( around 3 to 7 ). gravimetric water content and concrete dry densities can be related to concrete dielectric constant using eq . ( 4 ). k a ρ w ρ d = a + bw ( 4 ) where a and b are concrete specific constants obtained from calibration tests . for rapid determination of water content , a batch sample can be obtained and put into a cylindrical mold of known volume , from which total density of concrete in the mold , ρ t , can be determined . the relationship between total density and dry density in given by eq . ( 5 ) ρ d = ρ t 1 + w ( 5 ) substituting eq . ( 5 ) into eq . ( 4 ) and solving for the water content gives : w = k a ρ w ρ t - a b - k a ρ w ρ t ( 6 ) equation ( 6 ), with appropriate values of a and b for concrete , can be used to obtain the free water content of concrete . two different concretes were studied using a method of the present invention . the mixture proportions of the two concretes are shown in table 1 . the samples were obtained from field and put into standard 6 ′× 12 ″ plastic molds with volume of 6 . 107 × 10 − 3 m 3 . additional samples were obtained to determine oven dry water content . water contents in concrete are computed from tdr - measured dielectric constant by eq . ( 6 ). a temperature compensation factor ( eq . ( 7 )) was applied before computing water content to compensate the effects of temperature on tdr - measured dielectric constant , based on a linear relationship observed between the value of apparent dielectric constant k a at a given temperature and the value of k a at a standard temperature , e . g . 20 ° c . specifically , the value of k a obtained from the tdr signal at a given temperature is normalized to the standard temperature by multiplying the tdr - measured value of k a by a temperature compensation factor ( tcf ), where , for the above two concrete mixtures , tcf k ab = 1 0 . 0019 · t + 0 . 952 ( 7 ) physical interpretation as well as typical range of constants a and b are predominantly dependent on dielectric properties of dry solid phases and b being mostly decided by pore fluid . the values of constants a and b used in eq . ( 6 ) for the concrete tested were set to a = 1 . 0 and b = 14 . 5 . a summary of measured water contents by tdr for the fresh concrete samples are shown in table 2 . there are several observations from this table . for both of these concretes , the oven dry water content is slightly larger than the water contents calculated from batch receipts ( 0 . 4 % ( for mixture 2 ) and 0 . 3 % ( for mixture 1 )). these are equivalent to aggregates moisture content of 0 . 6 % and 0 . 8 % respectively , which are at the lower end of typical moisture range of aggregates discussed above . it is expected that the effects of aggregate moisture could be much more pronounced in other situations . table 2 shows eq . ( 6 ) provides better accuracy for water content measurement in concrete than from what can be determined from batch records because it accounts for moisture content contained in aggregate used in the concrete mixtures . water in concrete exists in two different types , i . e ., free water and chemically bound water . these two types of water show significantly different dielectric behavior . it has been established that free water has relaxation frequency of around 18 ghz while the relaxation frequency for bound water is within mhz range . ( relaxation frequency is a term that is analogous to resonant frequency for vibrating systems .) the tdr system used in the present invention has an effective frequency into the low gigahertz range and is more sensitive to the amount of free water than to bound water . thus , it is a more direct indicator of amount of free water in concrete . this makes tdr - measured dielectric constant more instructive and easier to interpret compared with the system used in the past . the plots of tdr - measured dielectric constant with time are shown in fig3 and 4 for both concretes . the dielectric constant consistently decreased with time . the tdr measured dielectric constant decreases at a high rate at the initial stage , which indicates the high intensity of hydration reactions . the rate of decrease becomes smaller with time , which reflects reduced intensity of hydration . the free water contents calculated using siddiqui - dmevich equation ( eq . ( 6 )) are also plotted in this figure , which clearly shows the decreasing amount of free water in concrete with time . after 196 days , the free water content in concrete sample from mixture 1 was around 3 . 0 % and after 166 days that mixture 2 was around 3 . 5 %. the fact that tdr measurements can be easily automated makes it an attractive tool for monitoring the free water content in concrete . the tdr - measured water content can be combined with the information of cement content from batch receipts to make an estimate of water - cement ratio . the calculated water - cement ratio of concrete samples from mixture 1 was 0 . 53 and that of mixture 2 was 0 . 52 , which are slightly higher than calculated from batch receipts ( by 0 . 1 and 0 . 4 ), respectively . as mentioned before , the moisture contents of aggregates in these concretes are believed to be at the lower end of typical moisture content range . the resulting difference in water - cement ratio can be more significant for aggregates with higher water content or in situations where water is added at the job site . while hydration causes the change of concrete mechanical structure and corresponding increase of concrete strength , it simultaneously changes concrete physico - chemical and electrical properties . thus , electrical properties of concrete and mortar , especially the electrical conductivity , are strongly related to the strength of concrete . while chemical reactions are the most important process occurring during concrete curing , the exact nature of the entire hydration process is complicated and not fully understood . generally speaking , hydration reactions take place between cement powder and water upon mixing and theoretically , the process continues forever . major products of the reactions include calcium silicate , calcium aluminate , ettringite , etc . calcium silicate is the major component affecting concrete strength and calcium aluminates predominantly determine the time of initial setting . a significant amount of heat is generated during hydration process . a direct consequence of the hydration process is a change in the microscopic structure . this results in the increase of modulus and strength . there is a strong linear correlation between concrete strength and degree of hydration . the hydration process , which significantly changes the microstructure of concrete , changes the electrical behavior of concrete as well . bulk water becomes chemically bound water , which shows significantly different dielectric behavior compared with free bulk water . the formation of solid structures by hydration reactions reduces the amount of free ions in pore solution , which results in a decrease of electrical conductivity . thus , concrete electrical behavior can be a strong indicator of the progress of the hydration process . as the hydration process directly results in the increase of concrete strength , electrical properties can thus be used to monitor strength development . the dielectric properties of concrete are dependent on factors such as the amount of water in the pore system and the concrete microstructure . the measured results of dielectric properties are also influenced by electrode configuration and measurement frequency band . optimized design , both in sensor geometry and measurement frequency range , is necessary to achieve the best measurement results . accurate measurement of dielectric properties of concrete is critical to achieving the best measurement accuracy . various technologies and system designs can be used for this purpose , including technologies based on measurement of frequency dependant behavior as obtained with an impedance analyzer or network analyzer . while these systems collect more information , measurements are generally expensive and data analysis is difficult . such systems typically are not suitable for field applications . in addition to automatically monitoring dielectric properties of the two concrete mixtures with time , strengths at 1 day , 7 days , and 28 days also were measured using specimens collected at the time of concrete placing . the compressive tests were performed in certified laboratories . fig5 and 6 show how the dielectric properties , electric conductivity and dielectric constant , change with time . dielectric constant consistently decreases with time , which is an indication of the decreasing amount of free water in concrete . due to hydration reactions , free water becomes chemically bound water , which has much smaller dielectric constant than free water . the observed changes of dielectric constant shown in fig5 are different from previous study results that found the dielectric constant first increases and then decreases with time . since the frequency used in previous studies were within the relaxation frequency range of chemically bound water , measurements were sensitive to the behaviors of both free water and chemically bound water . the previously observed increase of dielectric constant at the initial stage was the result of the dominant role played by the increasing amount of bound water . the decrease of dielectric constant in the longer term was dominated by the decreasing amount of free water . while previous studies helped to explain mechanisms of hydration in the fresh concrete mixture , they also caused difficulty in the interpretation of results since effects of bound water and free water could not be separated . the effective measurement frequency of the tdr tester used in the present invention is in the low gigahertz range , which is beyond the relaxation frequency of bound water . thus , the dielectric constant measured by tdr is predominantly influenced by the amount of free water in concrete . this makes the measurement much easier to interpret since the reduced amount of free water reflects the increased amount of bound water . the decrease of electrical conductivity as shown in fig6 is more significant , as it provides a strong indication of the structural changes and reduced amount of free ions in the concrete . the data for the initial part of the test in fig6 is replotted with an arithmetic time scale to show the behavior of freshly mixed concrete in fig7 . the electrical conductivity increases slightly after the mixing ( fig7 ), which possibly is caused by effects of consolidation and particle rearrangement . another important observation from fig6 is that for both of these concrete samples , after completion of the initial stages , the change of electrical conductivity decreases linearly with the logarithm of time . the slope of this line , which is believed to be related to rate of hydration , is similar for both concretes . at any given time after the initial stages , the electrical conductivity of the mixture 2 concrete is smaller than that of mixture 1 concrete . from fig5 - 7 , we can see that the temperature curves of the two concretes are similar . a group of tests were performed to investigate the effects of temperature on tdr measured dielectric constant and electrical conductivity . the cured concrete specimens from both mixtures were sealed and stored for 24 hours in temperature controlled room of 4 ° c . and 40 ° c ., respectively , and then allowed to return to ordinary laboratory room temperature . as the mixture temperature was being restored to room temperature , tdr and thermocouple readings were taken to monitor the change of dielectric constant and electrical conductivity with temperature . the measured values of dielectric constant and electrical conductivity for the two mixtures are normalized by those at room temperature ( 22 ° c .) and are plotted in fig8 and 9 . fig8 and 9 show that both the dielectric constant and electrical conductivity increase linearly with temperature within the temperature range of the study . the effect of temperature on electrical conductivity measurement is much more significant than that of dielectric constant as indicated by the steeper slope in fig9 . from these observations , the following temperature compensation factors ( eq . ( 8 )) are recommended to compensate for the effects of temperature on tdr measured dielectric constant and electrical conductivity . tcf k a = 1 0 . 0019 · t + 0 . 952 tcf ec b = 1 0 . 0247 · t + 0 . 453 ( 8 ) the results of compressive strength obtained from concrete cylinder testing are shown in fig1 and 11 . there is significant ( about 20 %) although not unreasonable scatter of results , which is possibly due to effects of sampling disturbance and curing process . the phenomena are common when evaluating concrete strength from cylinder samples . hyperbolic curves give good fit to the data and can be used to describe the evolution of compressive strength with time . the compressive strengths at different curing times predicted by the hyperbolic curves in fig1 and 11 are plotted against the temperature compensated tdr measured electrical conductivity in fig1 . fig1 indicates that the compressive strengths show reverse relationships with electrical conductivity , which are similar for the two concretes tested . these curves show linear trend in the middle and are slightly curved at high electrical conductivities ( initial stage ) and at low electrical conductivities ( long term ). the reverse trend between concrete strength and electrical conductivity is believed to be valid since the hydration process reduces the amount of free ions in concrete ( and thus reduces the electrical conductivity ) and at the same time increases its compressive strength . it is observed that a curve in the form of eq . ( 9 ) gives good fit to the data in fig1 and gives the reasonable strength values for extreme conditions . f c = α [ π 2 - tan - 1 ( β ( ec b - ec 0 ) ) ] p a ( 9 ) where ƒ c is compressive strength ( same units as p a ); α is an empirical constant ( no units ), β is an empirical constant ( units of m / ms ), and ec 0 ( units of ms / m ) are obtained from calibration tests ; the term ec b ( in units of ms / m ) is tdr measured electrical conductivity after temperature compensation by eq . ( 8 ); and p a is the atmospheric pressure ( p a = 0 . 098 mpa for si units and p a = 14 . 7 lb / in 2 for u . s . customary units ). using eq . ( 9 ), three curves are plotted in fig1 , one for mixture 2 concrete , one for mixture 1 concrete , and one for both concretes combined . the equation for the curve for the combined data and corresponding error bars of ± 10 % are given in the figure by the darker solid line . the combined data were also used with equations recommended in the prior art , also shown in fig1 , having a concave upward shape . from fig1 it can be seen that fitted curve by eq . ( 9 ) gives reasonable estimation of compressive strength from tdr measured electrical conductivity . the estimated strength generally falls within ± 10 % of the optimized compressive strengths from cylinder tests . equations recommended in the prior art on the other hand cannot accurately describe the data trend , especially at low electrical conductivity ( corresponding to long term strength ). the measured electrical conductivity for mixture 1 concrete was 11 . 96 ms / m after 196 days and that of mixture 2 is 11 . 95 ms / m after 166 days . the estimated strengths by eq . ( 9 ), using the parameters obtained from the combined data , are 47 . 6 mpa and 47 . 6 mpa , respectively . equations recommended in the prior art on the other hand , gives unreasonable estimated strengths of 225 . 0 mpa and 224 . 7 mpa , respectively . thus , eq . ( 9 ) is believed to be more robust for estimating compressive strength from electrical conductivity . to apply eq . ( 9 ), a group of calibration tests are needed to determine the calibration constants . the calibration involves making several cylinders for a given mix design . for one of the cylinders , the tdr probe and a temperature sensor are installed to monitor the dielectric constant , electrical conductivity , and temperature with time . compression tests are performed on the other cylinders to determine compressive strength at different ages , typically one day , seven days , and twenty eight days . the compressive strength and temperature compensated electrical conductivity are then analyzed in a spreadsheet to obtain the calibration constants in eq . ( 9 ). once the calibrations are obtained , the measured electrical conductivity , either in the field or in the laboratory , can be applied to estimate the compressive strength . fig6 shows that the electrical conductivity linearly decreases with time on a logarithmic scale after about one day , which is similar for both concretes . this can be described by eq . ( 10 ). ec b ( t ) = ec b ( t 1 ) + ( δ ec b log cycle ) log ( t ) ( 10 ) where : t is the curing time in days , ec b ( t 1 ) is the electrical conductivity measured at one day , δec b /( log cycle ) is the change in electrical conductivity over one log cycle , all in units of ms / m . for mixture 1 concrete , the corresponding values of ec b ( t 1 ) and δec b /( log cycle ) are 37 . 75 ms / m and − 5 . 05 ms / m , respectively . the corresponding values for mixture 2 concrete are 36 . 29 ms / m and − 4 . 96 ms / m , respectively . note that t in eq . ( 12 ) may have decimal values , but that values of t must not be smaller than the linear portion of the curve on the log - time plot used to establish the coefficients . for example , for the mixture 2 curve in fig6 , the value of t must be greater than approximately 0 . 5 days . once its relationship with time is established , the electrical conductivity measured at curing times sufficiently long to establish the straight line on the semi - log plot could be used to estimate long - term electrical conductivity , and consequently , the long - term compressive strength by combining eqs . ( 11 ) and ( 12 ) as shown in eq . ( 11 ). f c = α [ π 2 - tan - 1 { β [ ec b ( t 1 ) + ( δ ec b log cycle ) log ( t ) - ec 0 ] } ] p a ( 11 ) where the parameters are defined above for eqs . ( 9 ) and ( 10 ). fig1 and 14 show the predicted compressive strength versus time in days ( log scale ) by eq . ( 11 ) for both mixture 1 concrete and mixture 2 concrete . the parameters used in eq . ( 11 ) to predicted these curves are summarized in table 3 , where the values of αβ , and ec 0 are from the equation shown in fig1 ( solid curve with the thick line ) and the values of ec b ( 1 day ) and δec b ( per log cycle ) are from fitting the straight lines through the linear portion in fig6 for each of the concrete samples . the actual measured compressive strengths are also plotted for comparison . they generally fall within ± 10 % of predicted strength . even though these curves are based on tests only up to 28 days , fig1 and 14 indicates that the longer term strengths given by eq . ( 11 ) appear quite reasonable . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected . | 6 |
fig1 - 4 illustrate a connector 20 formed in accordance with one embodiment of the present invention . the connector 20 is adapted to selectively attach a workpiece 22 to a power tool ( not shown ). although the workpiece 22 is illustrated as a phillips head screwdriver , other workpieces , such as a standard screwdriver and a drill bit , are also within the scope of the present invention . the connector 20 includes a first collar 24 , a spring biased ball pin assembly 26 , a shaft assembly 28 , and a second collar 30 . the workpiece 22 is suitably formed from a high strength material and includes a cylindrical drive portion of the hex stem 32 and an appropriate shaped head portion 34 . the drive portion of the hex stem 32 is sized to be slidably received within the shaft assembly 28 and is seated therein on a spring biased ball pin assembly 26 . the spring biased ball pin assembly 26 includes a coil spring 36 , a ball pin 38 , and a plug 40 . the spring biased ball pin assembly 26 is biased to selectively eject the workpiece 22 from within the connector 20 , as is described in greater detail below . the shaft assembly 28 includes a shaft 42 , collar springs 44 , a ball spring 46 , and centering balls 48 . one end of the shaft 42 is adapted to be received within a corresponding chuck of a well known power tool . the other end of the shaft 42 includes a cavity 50 adapted to lockingly receive the hex stem 32 of the workpiece 22 . three of the centering balls 48 are disposed around the shaft 42 and are received within corresponding tapered cavities 52 . the centering balls 48 are restrained within the cavities 52 by the ball spring 46 . the shaft 42 also includes a pair of tapered cavities 54 aligned along a longitudinal axis extending between the open ends of the shaft 42 , such that a forward ball 60 is located near the forward or open end of the shaft 42 . a rearward ball 62 is located substantially near a midpoint defined along a longitudinal axis extending between the opened and closed ends of the shaft 42 . still referring to fig1 - 4 , operation of the connector 20 will now be described in greater detail . to selectively couple the workpiece 22 to the connector 20 , the drive portion of the hex stem 32 of the shaft 42 is inserted into the connector 20 , such that the three centering balls 48 near the front lift up and over a lower portion 33 of the hex stem 32 and drop into a power groove 64 . continued insertion of the shaft 42 causes the centering balls 48 to lift up and over the power groove 64 and contact the drive portion of the hex stem 32 . the lower portion 33 of the hex stem 32 eventually contacts the ball pin 38 at the back of the shaft &# 39 ; s cavity 50 . the operator then continues to press the workpiece 22 into the connector 20 . this operation causes the ball pin 38 , which is tensioned forward by the coil spring 36 to react until the lower portion 33 of the hex stem 32 presses up against the plug 40 . the plug 40 retains the ball pin 38 and allows clearance for a hex pin 37 found in other optional hex stem configurations , such as the hex pin found in a reversible drill and driver manufactured by jore corporation and seen in fig1 . the ball pin 38 retracts rearwardly to allow the rearward ball 62 to drop into its corresponding tapered hole 54 and flush to the diameter of the shaft 42 . this , in turn , allows the first and second collars 24 and 30 to shift forward because it is tensioned towards the forward position . in translating forward , the collar forces the forward ball 60 to drop into its tapered hole 54 , thereby locking the hex stem 32 at the power groove 64 . the collar continues forward to contact the three centering balls 48 located at the front of the connector 20 . the internal taper 100 ( fig4 ) at the front portion of the first collar 24 forces the three centering balls 48 to contact the drive portion of the hex stem 32 and lock it into a centered position . this locking and centering operation takes place by the user simply inserting the workpiece 22 into the connector 20 . to remove the workpiece 22 , the order of operations is basically reversed . the operator pulls the collar back . with this operation , the tension is removed from the centering balls 48 and the ball locking mechanism , comprised of the forward ball 60 and the forward tapered hole 54 . at the end of its travel , the collar allows space for the rearward ball 62 to move back up out of its hole 54 in the shaft 42 . the coil spring 36 , inside the connector 20 , forces the ball pin 38 forward . this in turn forces the rearward ball 62 up and secures the collar in place . the ball pin 38 then moves forward , thus moving the workpiece 22 to a position where the three centering balls 48 , which are tensioned radially inward by the ball spring 46 , move off of the drive portion of the hex stem 32 and drop back into the power groove 64 . the three tensioned balls 48 hold the workpiece 22 at the power groove 64 with a light grip until the operator selectively removes the workpiece 22 from the connector 20 . referring now to fig5 - 9 , an alternate shaft 142 formed in accordance with the present invention will now be described in further detail . the shaft 142 of the alternate embodiment is identical in materials and operation as the shaft 42 described above with the following exception . as best seen by referring to fig9 , the aft hole 154 has been relocated to a position 180 degrees ( based on a longitudinal axis running down the center of the shaft 142 ) from its position shown in the shaft 42 of the first embodiment of fig1 - 4 . with the ball location change of this alternate embodiment , all of the ball holes are oriented symmetrically around the shaft &# 39 ; s center axis 160 . all other connector components are also symmetric about the axis 160 when in the assembled position . the radial balance of this alternate embodiment helps to minimize centripetal ( centrifugal ) forces when the connector is rotating in a power drill . minimizing the forces that result from rotation results in less vibration . this in turn helps utilize the minimized runout capabilities of the connector . less runout from the hex stem component ( drill , nut driver , power bit , etc .) results in easier use , and greater accuracy from the user &# 39 ; s standpoint . for the purposes of this invention , radial balance is defined as the center of mass for the assembly as it is aligned with the axis of rotation for the assembly . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention . | 8 |
hereinafter , certain exemplary embodiments according to the present invention will be described with reference to the accompanying drawings . here , when a first element is described as being coupled to a second element , the first element may be not only directly coupled to the second element but may also be indirectly coupled to the second element via a third element . further , some of the elements that are not essential to the complete understanding of the invention are omitted for clarity . also , like reference numerals refer to like elements throughout . fig1 is a view illustrating a comparable organic light emitting display device . referring to fig1 , the comparable organic light emitting display device includes a panel 2 , a data driver 6 , a scan driver 8 , and pixels 12 . the pixels 12 are formed at intersections ( or crossings ) between scan lines s 1 to sn and data lines d 1 to dm . the pixels 12 are selected when scan signals are supplied , charge ( or store ) a voltage corresponding to data signals , and emit light of set ( or predetermined ) brightness in response to the charged voltage . the data driver 6 supplies the data signals to the data lines d 1 to dm when the scan signals are supplied from the scan driver 8 . the scan driver 8 supplies the scan signals to the scan lines s 1 to sn sequentially . here , the scan driver 8 is formed to be mounted on the panel 2 when the pixels 12 are formed . to this end , the scan driver 8 includes input lines 20 and connecting lines 22 positioned between the input lines 20 and the scan driver 8 . the input lines 20 receive clock signals from a printed circuit board . the connecting lines 22 are electrically coupled to the input lines 20 respectively and formed parallel to the data lines d 1 to dm to supply the clock signals to various stages included in the scan driver 8 . here , the connecting lines 22 formed in the panel 2 are positioned to be overlapped with a cathode electrode 4 . when the cathode electrode 4 is overlapped with the connecting lines 22 , the connecting lines 22 and the cathode electrode 4 form capacitors so that a delay of the clock signals occurs . in order to solve the problem , according to the comparable embodiment , a plurality of flexible printed circuits ( fpc ) are installed at set or predetermined intervals to be coupled to the panel 2 and the clock signals are additionally supplied to the connecting lines 22 using the fpc . however , when the clock signals are additionally supplied using the fpc , manufacturing costs are increased and the yield is lowered . hereinafter , the embodiments of the present invention will be described such that those skilled in the art can easily practice the present invention in detail with reference to fig2 to 6 . fig2 is a view illustrating an organic light emitting display device according to a first embodiment of the present invention . referring to fig2 , the organic light emitting display device according to the first embodiment of the present invention includes a panel 120 , a data driver 106 , a scan driver 108 , and pixels 112 . the pixels 112 are formed at crossings ( or intersections ) between scan lines s 1 to sn and data lines d 1 to dm respectively . the pixels 112 are selected when scan signals are supplied , charge ( or store ) a voltage corresponding to data signals , and emit light of predetermined brightness in response to the charged voltage . the data driver 106 supplies the data signals to the data lines d 1 to dm when the scan signals are supplied from the scan driver 108 . here , the data driver 106 is made into a plurality of data integrated circuits . each of the data integrated circuits includes j ( j is a natural number ) channels such that j data signals may be supplied . the scan driver 108 sequentially supplies the scan signals to the scan lines s 1 to sn . here , the scan driver 108 is mounted on the panel 102 when the pixels 112 are formed . the scan driver 108 mounted on the panel 102 receives clock signals supplied from the outside . to this end , on the panel 102 , input lines 120 , first connecting lines 122 , second connecting lines 124 , and third connecting lines 126 are formed . the input lines 120 receive the clock signals from a printed circuit board through a channel of the data integrated circuits that are included in the data driver 106 . more specifically , some channels of the data integrated circuits having j channels are not used . the input lines 120 receive the clock signals from the printed circuit board via the unused channels . the first connecting lines 122 are formed parallel to the scan driver 108 and electrically coupled to the input lines 120 . the first connecting lines 122 supply the clock signals from the input lines 120 to the scan driver 108 . in more detail , the scan driver 108 , as illustrated in fig3 , includes n stages 109 respectively coupled to the scan lines s 1 to sn . the first connecting lines 122 supply the clock signals to the respective stages 109 such that the scan signals may be generated from the stages 109 . fig3 illustrates that each of the stages 109 is coupled to the same first connecting lines 122 , but the present invention is not limited thereto . for example , different clock signals may be supplied to odd order or even order stages 109 . that is , the present invention may be applied to various suitable forms of scan drivers 108 . also , since the first connecting lines 122 are electrically coupled to the stages 109 for forming the scan driver 108 , the first connecting lines 122 are formed close to the scan driver 108 . in this case , the first connecting lines 122 positioned close to the scan driver 108 are overlapped with a cathode electrode 104 . the second connecting lines 124 are formed parallel to the scan driver 108 and electrically coupled to the input lines 120 . the second connecting lines 124 are electrically coupled to the first connecting lines 122 via third connecting lines 126 . here , the third connecting lines 126 electrically couple the second connecting lines 124 to the first connecting lines 122 to receive each of the specific clock signals at two or more nodes . when the second connecting lines 124 and the first connecting lines 122 configured to receive same clock signals are electrically coupled to each other , resistance of the first connecting lines 122 is lowered so that delay of the clock signals may be reduced ( or minimized ). especially , the second connecting lines 124 of an embodiment of the present invention are not overlapped with the cathode electrode 104 . in this case , the second connecting lines 124 do not overlap the cathode electrode and do not form capacitors with the cathode electrode and as a result delay of the clock signals is reduced ( or minimized ). therefore , delay of the clock signals is reduced ( or minimized ) at even the first connecting lines 122 configured to receive the clock signals at some node via the second connecting lines 124 . fig4 is a view illustrating an organic light emitting display device according to a second embodiment of the present invention . in the description with reference to fig4 , same reference numerals are assigned to same elements as illustrated in fig2 and detail description will be omitted . referring to fig4 , the organic light emitting display device according to the second embodiment of the present invention further includes buffers 130 formed between the first connecting lines 122 and the second connecting lines 124 , that is , at the respectively third connecting lines 125 . the buffers 130 deliver the clock signals from the second connecting lines 124 to the first connecting lines 122 . the buffers 130 may reduce ( or minimize ) crush of the clock signals and then may guarantee driving stability . fig5 is a view illustrating an organic light emitting display device according to a third embodiment of the present invention . in the description with reference to fig5 , same reference numerals are assigned to same elements as illustrated in fig2 and detail description will be omitted . referring to fig5 , in the organic light emitting display device according to the third embodiment of the present invention , first connecting lines 127 are not coupled with the input lines 120 and receive other clock signals from the outside . in this case , the input lines 120 are coupled to the second connecting lines 124 and supply clock signals to the second connecting lines 124 . fig6 is a view illustrating an organic light emitting display device according to a fourth embodiment of the present invention . in the description with reference to fig6 , same reference numerals are assigned to same elements as illustrated in fig2 and detail description will be omitted . referring to fig6 , the organic light emitting display device according to the fourth embodiment of the present invention further includes a second scan driver 111 positioned to face the scan driver 108 . the second scan driver 111 supplies the scan signals to even order ( or odd order ) scan lines s 2 , . . . . in this case , the scan driver 108 supplies the scan signals to odd order scan lines s 1 , . . . . the second scan driver 111 is mounted on the panel . in order to supply the clock signals to the second scan driver 111 , the organic light emitting display device further includes second input lines 121 , fourth connecting lines 123 , fifth connecting lines 125 , and sixth connecting lines 128 . the second input lines 121 receive the clock signals from a printed circuit board through a channel of the data integrated circuits included in the data driver 106 . the fourth connecting lines 123 are formed parallel to the second scan driver 111 and electrically coupled to the second input lines 121 . the fourth connecting lines 123 supply the clock signals from the second input lines 121 to the second scan driver 111 . here , the fourth connecting lines 123 are overlapped with a cathode electrode 104 . the fifth connecting lines 125 are formed parallel to the second scan driver 111 and electrically coupled to the second input lines 121 . the fifth connecting lines 125 are electrically coupled to the fourth connecting lines 123 via the sixth connecting lines 128 . here , the fifth connecting lines 125 are not overlapped with the cathode electrode 104 and thus clock signals delay of which is reduced ( or minimized ) may be supplied to the fourth connecting lines 123 . the sixth connecting lines 128 electrically connect the fourth connecting lines 123 to receive specific clock signals to the fifth connecting lines 125 to receive the specific clock signals at two more nodes . the organic light emitting display device according to the fourth embodiment of the present invention is substantially the same as the organic light emitting display device illustrated in fig2 in structure and operative principle except for the scan driver 111 and the connecting lines 123 , 125 , and 128 to be coupled to the scan driver 111 . while the present invention has been described in connection with certain exemplary embodiments , it is to be understood that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims , and equivalents thereof . | 6 |
fig1 illustrates a window or windshield 1 for a motor vehicle , which its outline indicates is intended as a rear or front windshield . this windshield is vapor - deposited in conventional fashion with a good - conducting metal coating , so that the metal coating may be regarded as a low - resistance one . it is known to use such a metal coating for windshield heating . further , such tinted windshields inhibit entry of sunlight , and viewing of the interior of the vehicle from outside . these characteristics of the vapor - coated windshield are , however , of merely secondary significance here . upon metallic - vapor - coating of the windshield , a slot 2 of sufficient length and slight breadth is kept uncoated , essentially parallel to and at a spacing a from one edge , for example the bottom edge , of the vapor - deposited surface . current supply for heating current is applied adjacent respective slot ends 3 , 4 at other edges 5 , 6 of the vapor - deposited surface , for example the left and right edges . the edges of the metal coating itself can form supply busses 7 , 8 for such current supply . alternatively , special metal strips or the like can be affixed to serve as supply busses . in any event , the slot ends 3 , 4 remain at a minimum spacing a from the supply busses . slot ends 3 , 4 could also be angled with respect to a central region 9 of the slot , and could run parallel to supply busses 7 , 8 in order to achieve a greater overall slot length . when such a windshield is placed in the electromagnetic field of an fm broadcast transmitter , an alternating electrical field forms over the slot , and a circular alternating current flows around the slot . the length of the slot is selected to correspond approximately to the electrical value λ / 2 in the fm frequency band . this length thus depends upon the dielectric constant ε r of the glass of the windshield . the breadth of the slot can be kept very small with respect to the half - wavelength λ / 2 , while the spacing a is selected to be small with respect to half - wavelength λ / 2 . preferably , the value of the dielectric constant ε r is so selected that it is not necessary to angle the slot ends in order to obtain a slot antenna with a value on the order of λ / 2 in the fm band , because angling of the slot ends under certain circumstances degrades the flow of heating current , permitting formation of an unheated zone between the angled ends . as shown in fig1 in a first embodiment , the middle point 10 of the upper rim of slot 2 is connected to the inner conductor 12 of a coaxial cable leading to the radio receiver , while the middle point 11 of the lower rim of slot 2 is connected over a capacitance 14 to the vehicle chassis surrounding the windshield . an outer conductor 13 of this same coaxial cable is also connected to the vehicle chassis . 5 and 6 are fm ( and am ) isolator - blocks 7 is a part of the vehicle chassis and 18 is an isolator gap between the coating and the chassis fig2 illustrates a second embodiment of a slot antenna , whose electrical length in the fm or ukw band is λ / 4 . the bottom point 21 of the slot 20 ends in a circumferential free or uncoated area 22 . slot 20 preferably runs essentially vertically into the path of the heating current which is fed between left windshield edge 23 and right windshield edge 24 . the two edges of slot 20 are connected at the bottom point 21 by a coil 25 , which is also connected to an inner conductor 26 of a coaxial cable , whose outer connector 27 is again connected to the vehicle chassis . since the vapor - deposited surface is surrounded by circumferential free space 22 , coil 25 also transmits to the coaxial cable the signals in the am reception band . 28 and 29 are fm ( and am ) isolator - blocks fig3 illustrates a third embodiment , in which a circumferential free space 32 , having a whole - wavelength λ electrical length in the fm or ukw band , is left between the vapor - coated surface and the surrounding edge 31 of the windshield . if the inner conductor 33 of a coaxial cable 35 is connected to the vapor - coated surface , for example at the middle of the bottom edge as shown , and the outer conductor is connected to chassis potential , the cable will pick up signals adequate for both fm and ukw and am reception . in the fm band , the free space 32 acts as a slot antenna , since the metallic chassis rim for the windshield , as indicated at 34 , surrounds the windshield 30 . in the am band , the entire vapor - coated surface serves as the conductor , as in the fig2 embodiment . 36 and 37 are fm ( and am ) isolator - blocks . fig4 illustrates a fourth embodiment , in which a strip conductor 42 is used to connect the coaxial cable to the upper rim 41 of slot 40 . for this purpose , a t - shaped structure is left uncoated within the coated surface . the strip conductor 42 is arranged between the adjacent vertical edges 43 , 44 of the t - shaped area . as shown in more detail in fig4 a , the lower end of strip 42 is connected to the inner conductor 45 of a coaxial cable 46 . the vertical slot is covered by a metallic insulating layer 47 which , together with edges 43 , 44 , forms a capacitive coupling for a circular alternating current around the slot antenna . the metal of insulating layer 47 is connected at 48 with the chassis , as is the outer conductor 49 of coaxial cable 46 . the edges 43 , 44 can also serve as supply busses for heating current . supply leads 50 , 51 to the respective supply busses can be connected to respective coils 52 , 53 for improved reception of am signals . preferably , these coils 52 , 53 can be wound on separate portions of a common toroidal core 54 , as shown . fig5 illustrates an improved version of the slot antenna of fig1 . at a spacing h from a first slot 55 analogous to that of fig1 there is provided a second slot 56 , which in length and breadth approximately corresponds to the first slot 55 . an antenna gain in the horizontal is thereby achieved . the length of slot 56 and the spacing h from slot 55 are a function of the antenna gain and must be selected according to the desired design characteristics . various changes and modifications are possible within the scope of the inventive concept . in particular , features of any of the embodiments can be combined with features of other embodiments . | 7 |
it was determined that under the control of the cpu , by varying the voltage sent to the positive displacement gear pump , the speed of the pump varies and controllable as to inject the desired concentrated first solution only at the suitable delivery rate into the second solution to consistently provide the drinking water at the resultant desired concentration . the actual voltage requirements were determined by trial and error in a practical environment . a vane - axle turbine driven flow rate sensor ( kobolt instrumentation ), which delivered 1 , 800 pulses per gallon , provided sufficient data points to measure low flow rates and monitor changes in flow rate . a microprocessor based controller for the generation and monitoring of an iodine supplemented livestock watering system was designed . the controller monitors the vane - axle turbine flow rate sensor and two or three thermocouples . the controller will control one or two positive displacement pumps dispensing liquor into the water feed line , along with a heater in the iodine dissolution cartridge chamber which maintains a constant temperature in the recharge chamber , preferably 80 degree . the unit included a 4 digit display for readout of liters dispensed and various other values , along with keyboard or other access for display control and user variable adjustment . control functions were implemented as detailed in the specification hereinbelow , with whatever modifications necessary after field trials . provision was made for use of an infrared or other method of external monitoring and control . with reference to fig1 , this shows generally as 10 a drinking water delivery system containing 2 – 15 ppm iodine species comprising the unit shown generally as 12 within the dotted lines . although unit 12 is essentially self - contained , it clearly requires fittings , lines and the like for it to constitute part of full working system 10 . unit 12 has a microprocessor based controller ( cpu ) 14 in data communication with a vane - axle turbine water flow rate sensor 16 , display and keyboard 18 , positive displacement gear pump 20 , heater 22 , first thermocouple 24 and second thermocouple 26 . pump 20 is shown in slightly more detail in fig4 as a magnetic coupled external gear pump ( p - series - tuthill corporation , concord , calif .) that provides positive displacement non - pulsing flow of solution over the practical range of flow rates desired . main water line 28 provides the main or second flow of water from which secondary line 30 runs off to provide first water flow under the influence of pump 20 which is controlled by cpu 14 . pump 20 feeds rechargeable cartridge 32 having a chamber 34 containing iodine flakes or prill 36 , heater 22 and temperature sensors 24 , 26 . in the embodiment shown , chamber 34 contains sufficient iodine 36 to always provide a saturated iodine species solution at the pre - selected water temperature in chamber 34 , irrespective of the magnitude water flow rate passing through chamber 34 , under commercial practical conditions for a livestock operation . if necessary , in alternative embodiments a plurality of cartridges 32 may be used as desired . saturated iodine solution at about 300 ppm and 80 ° c . leaves chamber 34 and is added to line 28 at a suitable dilution factor to provide the 2 – 15 ppm iodine species concentration in the resultant drinking water provided to the livestock . small lcd screen and keyboard 18 enable the user input and output to be displayed . the water delivery system according to the invention uses a computer based controller board to sample the flow rate of the main line water . it also senses the temperature of the incoming water and the temperature of the water in the sump . based on these variables the controller determines the speed of the dc brushless motor on a gear pump to produce the desired iodine concentration in the main line . the unit displays the following variables in a 2 second rotation ; flow rate , sump temperature , and gallons of concentrate . when the recharge is spent the controller displays a warning for the user . if there are any other errors , the controller will display these with different leds and a buzzer . the temperature sensed is used to determine the amount of power required to bring the water in the sump up to 80 ° f . if below and then controls the heater to raise the temperature in the sump to 80 ° f . the user interface is done using a pda with infrared . the pda can capture all of the system variables and store them in a file to be downloaded later . the user can change the concentration of iodine by small amounts and multiples of ppm with the pda . the user can also tune the temperature sensor to get better control of the iodine concentration . the controller also has the ability to store the system variables on a flash ram to be downloaded later , to give the user a picture of the water usage , and system performance . a more detailed embodiment is , generally as 100 , in fig3 , wherein in general , mainline water flows first through a thermistor ( the “ mainline thermistor ”) and a vane - axle turbine driven flow sensor ( the “ flow sensor ”). the thermistor is a thermally sensitive resistor that is made of a semiconductor having a resistance that varies rapidly and predictably with temperature . the mainline thermistor is used to determine the amount of energy the heater ( the heater ”) in the cartridge or recharge module needs to provide in order to bring the temperature in the recharge module up to the set point . the recharge thermistor is used to determine the temperature of the iodine saturate in the recharge module . the flow sensor outputs approximately 1 , 800 pulses per gallon of water and is used to determine the flow rate and changes in flow rate of the mainline water . the mainline thermistor , the flow sensor , and the recharge thermistor are electronically connected to the microprocessor based controller ( the “ controller ”). the controller is driven by a circuit board that continuously scans the temperature and the flow rate data that it receives from the mainline thermistor , the flow sensor , and the recharge thermistor and updates the speed of the pump and the status of the heater as changes occur . the controller reads the speed of the pump from the tachometer output signal from the pump and compares it to the desired speed . the desired speed of the pump for various flow rates from ⅛ of a gallon a minute and up have been determined on a trial and error basis . the controller then increases or decreases the speed of the pump accordingly . the desired speed of the pump is determined from an algorithm that takes into account the desired concentration of the blended aqueous iodine , the mainline flow rate , the temperature of the mainline water , the temperature of the iodine saturate in the recharge module , and the concentration of the iodine saturate . the controller is programmed to adjust this ratio in response to changes in the temperature in the recharge module . when the temperature is less than 80 ° f ., the ratio increases and when the temperature is greater than 80 ° f ., the ratio decreases . the controller has an input connector that allows the controller to be connected to a computer in order for the user to change the settings on the controller . the controller also has an infrared port that allows the user to receive and input data from an infrared device , such as a pda . the controller sends a voltage signal ( 0 – 4 vdc . 1 volt dc = 1000 rpm ) to the pump that varies the speed of the pump motor in response to calculations made in accordance with the algorithm . the controller sends a voltage signal to the heater ( 120 vac ) that determines whether the heater is on or off . the controller further provides an output to the display panel that displays flow rate , recharge module temperature , and the number of gallons through the recharge module in rotating two second intervals . when the pump is activated , water flows through the delivery system based upon positive water displacement . the controller determines the speed of the pump in relation to the desired concentration of blended aqueous iodine to be achieved in the mainline . blending is gradual and continuous so that no slugs are produced and the desired concentration is established in the mainline at all times . when the pump is inactivated , no water flows though the system . two check valves are utilized to prevent back flow . the mainline check valve is used to prevent aqueous iodine from flowing backwards in the mainline water flow and into the injection system . the recharge check valve is used to prevent iodine saturate from flowing back up to the pump in a powered down situation . this prevents the iodine saturate , which is corrosive , from entering the pump and potentially damaging the metal components of the pump . the 3 - way valve is used to purge air from the recharge module . failsafe warning signals have been incorporated into the controller . for instance , when the iodine in the recharge module is spent , based on the number of gallons of iodine saturate produced , the controller displays a warning for the user signalling the requirement to replace the recharge module . the controller also has been programmed to display other error messages with different led &# 39 ; s and a buzzer . the infrared port and the input connector allow iosolutions or the user to download information from the controller at anytime , either for billing or informational purposes . updates to the firmware on the controller also can be downloaded through the infrared port and the input connector . system variables are stored on a flash ram chip that can be downloaded later through the infrared port or input connector to give the user a picture of water usage and system performance . mechanical devices : mainline check used to prevent the iodine flowing around in valve : a loop recharge check used to prevent the iodine flowing back up to valve : the pump in a powered down situation . 3 - way valve : used to purge the air from the recharge module . flow meter sensor 16 measures the flow rate of the main line water by pulse output ; thermocouple 26 measures the temperature in cartridge 32 ; thermocouple inside heater 24 measures the temperature of the heater as a safety device to prevent heater 24 from damaging cartridge 32 ; keyboard 18 allows user to adjust variables in program . the following is a list of outputs for controller 14 , which controls or measures : pump 20 by adjusting the speed of the pump under a voltage signal ( 0 – 5 vdc ). heater 24 by controlling the temperature in cartridge 32 . on / off device 120 vac controlled through a solid - state relay . display 18 shows the through cartridge 32 and the user adjustable variables . the variables considered in the process according to the invention are shown in fig2 , wherein : f m main line flow rate . pulse input from flow meter f l desired flow rate through liquor line . calculated from f m , c u1 , and c u2 . f o stored flow rate used for comparison to f m to determine if there is a large change is the flow rate . g l gallon count through liquor line . calculated from f l , k , t sp , and t c . c u1 user input constant . allows user to make small adjustments to the pump speed . c u2 user input constant . allows user to adjust the pump speed in multiples of the default speed . k constant of the flow meter manufacturer specification in pulses / gal t sp sample period for flow meter . time allotted to count pulses . t c cycle period . time from one sample to the next . t temperature reading from the thermocouple . t h temperature reading of the heater from the thermocouple inside the heater . p input voltage signal to the pump . calculated from f l , and c t . c t temperature constant adjustment for temperatures over 80 ° f . h heater status flag true if t less than 80 ° f . else false . i indicator of the usage of the recharge . 0 if 3200 − g l & gt ; 500 1 if 3200 − g l & lt ; 500 2 if 3200 − g l & lt ; 100 e h error flag on heater . true if t h & lt ; 150 ° f . liquor line flow rate is 1 / 50 ( default concentration ) of the main line flow rate plus the user &# 39 ; s small adjustment times the user &# 39 ; s multiplier . g l = g l +( f l /( k * t sp )* t c ) gallon count is a running total of the liquor line flow rate divided by the flow meter constant and sample period times the cycle period . pump speed is a function of liquor line flow minus the adjustment due temperature . x is a function of the liquor line flow to produce a voltage output signal . this is to be determined . heater failure — if the heater temperature exceeds 150 ° f . e h is turned on and the heater h is turned off and remains off until the system is reset . a warning is shown on the display . recharge empty — if the recharge indicator i changes to 1 show a warning on the display . if the indicator changes to 2 show a different warning . once the power of the controller is turned on the user has a choice of modes , selected by the use of the keyboard . the following is a detailed description of the different modes ( start - up , user input , and normal ) of operation of the controller . the user input mode allows the user to change the two variables c u1 , and c u2 . the adjustments are made through the keyboard . the values for c u1 are ± 10 . the values of c u2 are 0 . 5 , 1 , 1 . 5 , and 2 . the start - up mode is used when a new cartridge 32 is connected to the system . heater 22 is turned off and the heater error flag is reset . the user is prompted on whether to reset the water volume count to zero . pump 20 comes on in maximum output ( 4 vdc ) to fill the recharge . user input is required to stop pump 20 when cartridge 32 is full . the normal mode is the operation that controls pump 20 due to changes in the flow rate . the temperature of both thermocouples is measured . if the temperature of t h is greater than 150 ° f . the error flag e h is set to true . if the temperature of t is less than 80 ° f . heater 22 is turned on . sample the flow meter f m . determine whether there is a large change in the flow rate to the stored rate . if there was , store the new flow rate else use the stored flow rate . calculate f l and g l . check the state of the recharge , if recharge is close to empty display the appropriate warning . calculate the speed of the pump p . output p to the pump . pause for t c and repeat . to increase the capabilities of the unit for an increased flow rate another pump is required . adding the second pump requires an increase in the dc power supply to 130 w , and a second output 0 – 5 vdc signal . although this disclosure has described and illustrated certain preferred embodiments of the invention , it is to be understood that the invention is not restricted to those particular embodiments . rather , the invention includes all embodiments which are functional or mechanical equivalence of the specific embodiments and features that have been described and illustrated . | 0 |
embodiments of token assurance level based transaction processing are provided , with exemplary embodiments being discussed below in detail . payment tokenization is used in payment technology and mobile payments systems , including near field communication ( nfc ), host card emulation ( hce ), cloud based security ( se ) and mobile wallets / mobile point of sale ( mpos ) systems . payment tokenization attempts to ensure personal account number ( pan ) privacy for use cases including card present and card - not - present transactions , and aims to reduce fraud by masking real credit account numbers using tokens . however , not all tokens are created or treated equally . some tokens , while not real credit account numbers , may be stolen and temporarily used , leading to fraud and loss . payment tokenization is implemented using data substitution , i . e . substituting an anonymous token for a personal account number . the idea behind the token is to protect sensitive data , and to ensure that if the token is lost or stolen the data is preserved or uncompromised . a token may also include metadata , and various additional information may be included in token metadata , such as time of expiration or access policies . a token assurance level ( tal ) may be assigned to a token to allow the token service provider to indicate the confidence level of the binding between the payment token and the pan / cardholder . the token assurance level may be determined based on the type of identification and verification of the user that was performed by the merchant for the transaction , and based on the identity of the entity that performed the identification and verification . the token assurance level may be used to determine a processing priority of a transaction in a payment tokenization system . token assurance level based transaction processing may include tagging of payment tokens with a token assurance level based on ( for example ): the identity of token service providers and / or token requestors ; the security exposure of the token ( i . e ., based on , for example , merchant type , device finger printing , or personal identification number ( pin ) requirement ). a processing quality of service ( qos ) is assigned to the transaction based on the token assurance level , and may include prioritized queuing for token processing and validation ( for example , a higher token assurance level would not be subjected to any additional verification that might be required for a lower token assurance level ). in some embodiments , there may be four token assurance levels . a level 1 token assurance level indicates little or no confidence in the asserted identity &# 39 ; s validity . level 2 indicates some confidence in the asserted identity &# 39 ; s validity . level 3 indicates high confidence in the asserted identity &# 39 ; s validity , and level 4 indicates very high confidence in the asserted identity &# 39 ; s validity . each token assurance level may have a different assigned quality of service for processing . further , different levels and / or types of additional verification may be required from the user and / or the merchant for different token assurance levels . a payment tokenization system may include various components . a token service provider ( tsp ) is issues tokens corresponding to personal account numbers that are issued to users by an issuer , such as visa ™ or mastercard ™. a token vault provider ( tvp ) is usually the same entity as the tsp , and is an entity that keeps the tokens safe and has the original mapping of tokens to personal account numbers . a transaction processor gateway ( tpg ) is included at both the merchant and issuer , and receives the token for approval and processing . before processing the transaction by the transaction processor , the token needs to be de - tokenized , i . e ., converted back to the account number . token assurance level based transaction processing is implemented before de - tokenization in a payment tokenization system . turning now to fig1 , a payment tokenization system 100 for token assurance level based transaction processing generally shown . system 100 includes a collection point 101 which may be , in various embodiments , a point of sale system or an online payment interface belonging to a merchant . when a transaction is initiated at the collection point 101 , an account number is collected and encrypted with a public key belonging to the tokenization server 102 , and then the encrypted account number is sent from the collection point 101 to the tokenization server 102 . the tokenization server 102 generates a random token corresponding to the transaction and stores the generated token in the token database 103 with the account number . a single account number may be mapped to many tokens in the token database 103 ; however , each token may only be mapped to a single account number . the tokenization database also sends the token to the collection point 101 . the collection point 101 sends the token to the merchant &# 39 ; s application server 104 , which uses the token for processing the transaction instead of the account number . the application server 104 stores the token in an entry corresponding to the transaction in merchant database 105 , and also sends the token to the transaction processor 106 . the transaction processor 106 sends the token to back to the tokenization server 102 , which de - tokenizes the token , i . e ., converts the token back to the account number based on the entry in the token database 103 and sends the account number back to the transaction processor 106 . the transaction processor may then complete processing of the transaction based on the account number . therefore , no account numbers are stored in the merchant database 105 during processing of the transaction . however , in some embodiments , the token may be de - tokenized on the merchant side ( i . e ., in application server 104 ). tokenization server 102 includes a transaction assurance level based processing module 107 , which implements embodiments of token assurance level based transaction processing . in embodiments of token assurance level based transaction processing , the transaction is assigned a token assurance level . based on the assigned token assurance level , a transaction may receive expedited processing for de - tokenization , or may require additional information from the merchant and / or the holder of the card before de - tokenization is performed by the tokenization server 102 . the tokenization server 102 may perform the de - tokenization based on the assigned token assurance level , e . g ., transactions having a relatively high token assurance level may receive expedited processing at tokenization server 102 . fig1 is shown for illustrative purposes only ; a payment tokenization system may have any appropriate components that communicate in any appropriate manner . fig2 illustrates an embodiment of a system 200 for token assurance level based transaction processing . in system 200 , a customer 201 provides an account number 205 to a data capture system 202 , which include a point of sale system or web interface associated with a merchant . the data capture system 202 sends the account number 205 to the tokenization server 204 , and the tokenization server 204 sends a token 206 corresponding to the account number to both the data capture system 202 and to the settlement application 203 . the tokenization server 204 also stores the token with the account number . the settlement application 203 requests the account number from the tokenization server 204 using the token 206 . before the tokenization server returns the account number 205 to the data capture system 202 and settlement application 203 , the token assurance module 207 in the tokenization server 204 may determine a token assurance level for the transaction , and , based on the token assurance level may expedite processing of the transaction , or may request additional information 208 from the customer 201 and / or the data capture system 202 . fig2 is shown for illustrative purposes only ; a payment tokenization system may have any appropriate components that communicate in any appropriate manner . fig3 illustrates an embodiment of a method 300 for token assurance level based transaction processing . method 300 may be implemented in token assurance level based processing module 107 of fig1 , and / or token assurance module 207 of fig2 . in block 301 , a tokenization server , such as tokenization server 102 of fig1 or tokenization server 204 of fig2 , receives a de - tokenization request comprising a token that is associated with a transaction , in addition to metadata comprising additional data associated with the transaction . the additional data may include , but is not limited to , the identity of the token service provides , the identity of the token requestor , the identity or type of the merchant , and whether the collection point included device finger printing , biometric verification of the user , or a pin requirement in the transaction . the additional data may further include a mobile device type and a type of mobile software ( for example , applepay ™ or square ™) used for a mobile purchase . the additional information may further include whether the transaction is a card present or a card not present transaction . in block 302 , the tokenization server analyzes the additional information and determines a transaction assurance level for the transaction based on the additional information . in some embodiments , there may be four different token assurance levels . a level 1 token assurance level indicates little or no confidence in the asserted identity &# 39 ; s validity . level 2 indicates some confidence in the asserted identity &# 39 ; s validity . level 3 indicates high confidence in the asserted identity &# 39 ; s validity , and level 4 indicates very high confidence in the asserted identity &# 39 ; s validity . each token assurance level may have a different assigned quality of service for processing . further , different levels of additional verification may be required from the user and / or the merchant for different token assurance levels ; for example , for a level 1 transaction , multiple forms of additional verification may be required , while for a level 4 transaction , no additional verification may be required . further , a level 4 transaction may receive expedited processing . in block 303 , the tokenization server determines a quality of service for the transaction . the quality of service corresponds to a processing speed of the transaction , and includes whether to require additional information based on the token assurance level that was determined in block 302 before proceeding with the transaction ( i . e ., proceeding with de - tokenization ). the determination may be made based on the four levels described above with respect to block 302 in some embodiments . in further embodiments , a dollar amount of the transaction may be taking into account in block 303 . for example , either a user or a service provider may specify that additional verification will not be required for any transactions that are below a certain dollar amount , i . e ., a verification threshold . in block 303 , if additional verification is determined to be required for the transaction , the tokenization server requests the additional verification from the account holder and / or the merchant . it is further determined in block 303 what type of additional verification should be required . the additional verification may vary based on the token assurance level , and may include any appropriate type of verification . some examples of verification that may be required in block 303 are sending a pin to a mobile device of the user that must be submitted to the merchant , and then submitted from the merchant to transaction processor ; or sending a message to a mobile device of the user that requires a response . if it was determined in block 303 that additional verification is required for the transaction , then , in block 304 , it is indicated to the user and / or the merchant that the additional verification is required . then , in block 305 , based on successful completion of the additional verification , the de - tokenization of the transaction proceeds . if it was determined in block 303 that no additional verification is required , the de - tokenization of the transaction receives expedited processing in block 306 . in some embodiments of method 300 , the tokenization server may implement a weighted system that determines the tal of a particular transaction based on metadata associated with the transaction in block 302 . for example , the tokenization server may receive the following data for a transaction in block 301 : the metatags 1 to n may include any appropriate information regarding the transaction in various embodiments . the tokenization server may assign scores to the transaction based on the various pieces of metadata that are received with the token number . for example , the merchant id and metatag 1 may indicate that the merchant is a known or trusted merchant ( for example , a big name retailer ), and may rate a score of 20 . the device id and metatag 2 may indicate that the payment was made using a device running applepay with biometric verification ( e . g ., a fingerprint ), which may rate a score of 50 . metatag n may indicate that the tag was issued by a tier 1 token service provider ( for example , visa ), which may rate a score of 10 . the tokenization server may then add up the various scores assigned to the various pieces of metadata to determine an overall score for the transaction , and assign a tal based on the overall score . in this example , the total score would be 80 . the total score may be compared to one or more thresholds to determine the tal in block 302 ; for example , each level of tal may have a different respective threshold . the quality of service is then determined based on the tal . in such a weighted system , a transaction having less associated metadata would generally rate a lower overall score as compared to a transaction that has more associated metadata . however , some pieces of metadata ( for example , use of biometric verification ) may rate a relatively high overall score even in the absence of other metadata . further , for a transaction with a relatively large number of metatags that were populated by unknown or high risk entities , the transaction may rate a relatively low overall score . entities ( e . g ., merchants ) may be added or removed from a trusted list over time , or may have their ratings changed based on their security practices . fig4 illustrates an example of a computer 400 which may be utilized by exemplary embodiments of token assurance level based transaction processing . various operations discussed above may utilize the capabilities of the computer 400 . one or more of the capabilities of the computer 400 may be incorporated in any element , module , application , and / or component discussed herein . the computer 400 includes , but is not limited to , pcs , workstations , laptops , pdas , palm devices , servers , storages , and the like . generally , in terms of hardware architecture , the computer 400 may include one or more processors 410 , memory 420 , and one or more i / o devices 470 that are communicatively coupled via a local interface ( not shown ). the local interface can be , for example but not limited to , one or more buses or other wired or wireless connections , as is known in the art . the local interface may have additional elements , such as controllers , buffers ( caches ), drivers , repeaters , and receivers , to enable communications . further , the local interface may include address , control , and / or data connections to enable appropriate communications among the aforementioned components . the processor 410 is a hardware device for executing software that can be stored in the memory 420 . the processor 410 can be virtually any custom made or commercially available processor , a central processing unit ( cpu ), a digital signal processor ( dsp ), or an auxiliary processor among several processors associated with the computer 400 , and the processor 410 may be a semiconductor based microprocessor ( in the form of a microchip ) or a macroprocessor . the memory 420 can include any one or combination of volatile memory elements ( e . g ., random access memory ( ram ), such as dynamic random access memory ( dram ), static random access memory ( sram ), etc .) and nonvolatile memory elements ( e . g ., rom , erasable programmable read only memory ( eprom ), electronically erasable programmable read only memory ( eeprom ), programmable read only memory ( prom ), tape , compact disc read only memory ( cd - rom ), disk , diskette , cartridge , cassette or the like , etc .). moreover , the memory 420 may incorporate electronic , magnetic , optical , and / or other types of storage media . note that the memory 420 can have a distributed architecture , where various components are situated remote from one another , but can be accessed by the processor 410 . the software in the memory 420 may include one or more separate programs , each of which comprises an ordered listing of executable instructions for implementing logical functions . the software in the memory 420 includes a suitable operating system ( o / s ) 450 , compiler 440 , source code 430 , and one or more applications 460 in accordance with exemplary embodiments . as illustrated , the application 460 comprises numerous functional components for implementing the features and operations of the exemplary embodiments . the application 460 of the computer 400 may represent various applications , computational units , logic , functional units , processes , operations , virtual entities , and / or modules in accordance with exemplary embodiments , but the application 460 is not meant to be a limitation . the operating system 450 controls the execution of other computer programs , and provides scheduling , input - output control , file and data management , memory management , and communication control and related services . it is contemplated by the inventors that the application 460 for implementing exemplary embodiments may be applicable on all commercially available operating systems . application 460 may be a source program , executable program ( object code ), script , or any other entity comprising a set of instructions to be performed . when a source program , then the program is usually translated via a compiler ( such as the compiler 440 ), assembler , interpreter , or the like , which may or may not be included within the memory 420 , so as to operate properly in connection with the o / s 450 . furthermore , the application 460 can be written as an object oriented programming language , which has classes of data and methods , or a procedure programming language , which has routines , subroutines , and / or functions , for example but not limited to , c , c ++, c #, pascal , basic , api calls , html , xhtml , xml , asp scripts , fortran , cobol , perl , java , ada , . net , and the like . the i / o devices 470 may include input devices such as , for example but not limited to , a mouse , keyboard , scanner , microphone , camera , etc . furthermore , the i / o devices 470 may also include output devices , for example but not limited to a printer , display , etc . finally , the i / o devices 470 may further include devices that communicate both inputs and outputs , for instance but not limited to , a nic or modulator / demodulator ( for accessing remote devices , other files , devices , systems , or a network ), a radio frequency ( rf ) or other transceiver , a telephonic interface , a bridge , a router , etc . the i / o devices 470 also include components for communicating over various networks , such as the internet or intranet . if the computer 400 is a pc , workstation , intelligent device or the like , the software in the memory 420 may further include a basic input output system ( bios ) ( omitted for simplicity ). the bios is a set of essential software routines that initialize and test hardware at startup , start the o / s 450 , and support the transfer of data among the hardware devices . the bios is stored in some type of read - only - memory , such as rom , prom , eprom , eeprom or the like , so that the bios can be executed when the computer 400 is activated . when the computer 400 is in operation , the processor 410 is configured to execute software stored within the memory 420 , to communicate data to and from the memory 420 , and to generally control operations of the computer 400 pursuant to the software . the application 460 and the o / s 450 are read , in whole or in part , by the processor 410 , perhaps buffered within the processor 410 , and then executed . when the application 460 is implemented in software it should be noted that the application 460 can be stored on virtually any computer readable storage medium for use by or in connection with any computer related system or method . in the context of this document , a computer readable storage medium may be an electronic , magnetic , optical , or other physical device or means that can contain or store a computer program for use by or in connection with a computer related system or method . the application 460 can be embodied in any computer - readable storage medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . in the context of this document , a “ computer - readable storage medium ” can be any means that can store the program for use by or in connection with the instruction execution system , apparatus , or device . the computer readable storage medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , or semiconductor system , apparatus , or a device . more specific examples ( a nonexhaustive list ) of the computer - readable storage medium may include the following : an electrical connection ( electronic ) having one or more wires , a portable computer diskette ( magnetic or optical ), a random access memory ( ram ) ( electronic ), a read - only memory ( rom ) ( electronic ), an erasable programmable read - only memory ( eprom , eeprom , or flash memory ) ( electronic ), an optical fiber ( optical ), and a portable compact disc memory ( cdrom , cd r / w ) ( optical ). note that the computer - readable storage medium could even be paper or another suitable medium , upon which the program is printed or punched , as the program can be electronically captured , via for instance optical scanning of the paper or other medium , then compiled , interpreted or otherwise processed in a suitable manner if necessary , and then stored in a computer memory . in exemplary embodiments , where the application 460 is implemented in hardware , the application 460 can be implemented with any one or a combination of the following technologies , which are well known in the art : a discrete logic circuit ( s ) having logic gates for implementing logic functions upon data signals , an application specific integrated circuit ( asic ) having appropriate combinational logic gates , a programmable gate array ( s ) ( pga ), a field programmable gate array ( fpga ), etc . technical effects and benefits include additional security in a payment tokenization system . the present invention may be a system , a method , and / or a computer program product . the computer program product may include a computer readable storage medium ( or media ) having computer readable program instructions thereon for causing a processor to carry out aspects of the present invention . the computer readable storage medium can be a tangible device that can retain and store instructions for use by an instruction execution device . the computer readable storage medium may be , for example , but is not limited to , an electronic storage device , a magnetic storage device , an optical storage device , an electromagnetic storage device , a semiconductor storage device , or any suitable combination of the foregoing . a non - exhaustive list of more specific examples of the computer readable storage medium includes the following : a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), a static random access memory ( sram ), a portable compact disc read - only memory ( cd - rom ), a digital versatile disk ( dvd ), a memory stick , a floppy disk , a mechanically encoded device such as punch - cards or raised structures in a groove having instructions recorded thereon , and any suitable combination of the foregoing . a computer readable storage medium , as used herein , is not to be construed as being transitory signals per se , such as radio waves or other freely propagating electromagnetic waves , electromagnetic waves propagating through a waveguide or other transmission media ( e . g ., light pulses passing through a fiber - optic cable ), or electrical signals transmitted through a wire . computer readable program instructions described herein can be downloaded to respective computing / processing devices from a computer readable storage medium or to an external computer or external storage device via a network , for example , the internet , a local area network , a wide area network and / or a wireless network . the network may comprise copper transmission cables , optical transmission fibers , wireless transmission , routers , firewalls , switches , gateway computers and / or edge servers . a network adapter card or network interface in each computing / processing device receives computer readable program instructions from the network and forwards the computer readable program instructions for storage in a computer readable storage medium within the respective computing / processing device . computer readable program instructions for carrying out operations of the present invention may be assembler instructions , instruction - set - architecture ( isa ) instructions , machine instructions , machine dependent instructions , microcode , firmware instructions , state - setting data , or either source code or object code written in any combination of one or more programming languages , including an object oriented programming language such as smalltalk , c ++ or the like , and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the computer readable program instructions may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). in some embodiments , electronic circuitry including , for example , programmable logic circuitry , field - programmable gate arrays ( fpga ), or programmable logic arrays ( pla ) may execute the computer readable program instructions by utilizing state information of the computer readable program instructions to personalize the electronic circuitry , in order to perform aspects of the present invention aspects of the present invention are described herein with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ), and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer readable program instructions . these computer readable program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer readable program instructions may also be stored in a computer readable storage medium that can direct a computer , a programmable data processing apparatus , and / or other devices to function in a particular manner , such that the computer readable storage medium having instructions stored therein comprises an article of manufacture including instructions which implement aspects of the function / act specified in the flowchart and / or block diagram block or blocks . the computer readable program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other device to cause a series of operational steps to be performed on the computer , other programmable apparatus or other device to produce a computer implemented process , such that the instructions which execute on the computer , other programmable apparatus , or other device implement the functions / acts specified in the flowchart and / or block diagram block or blocks . the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods , and computer program products according to various embodiments of the present invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of instructions , which comprises one or more executable instructions for implementing the specified logical function ( s ). in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts or carry out combinations of special purpose hardware and computer instructions . the descriptions of the various embodiments of the present invention have been presented for purposes of illustration , but are not intended to be exhaustive or limited to the embodiments disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments . the terminology used herein was chosen to best explain the principles of the embodiments , the practical application or technical improvement over technologies found in the marketplace , or to enable others of ordinary skill in the art to understand the embodiments disclosed herein . | 6 |
the invention is related to olodaterol or a pharmaceutically acceptable salt thereof , for use in a method of treatment of cough . preferably for use in a method of treatment of cough concomitant to viral infection , asthma , allergen - induced asthmatic reactions , cystic fibrosis , bronchitis , chronic bronchitis , chronic obstructive pulmonary disease ( copd ), adult respiratory distress syndrome ( ards ), chronic pulmonary inflammation , rhinitis , allergic rhinitis , upper respiratory tract inflammatory disorders ( urid ), ventilator induced lung injury , silicosis , talcosis , pulmonary sarcoidosis , idiopathic pulmonary fibrosis ( ipf ) or bronchopulmonary dysplasia . specific types of coughs which may be treated by compounds of the present invention , include , but are not limited to dry cough , wet cough , croupy cough , or chest cough . preferred for the above mentioned use is a pharmaceutically active salt of olodaterol , especially olodaterol hydrochloride . accordingly , in a further aspect , the present invention provides a method for treating cough in a patient comprising administering olodaterol to said patient . in a further aspect , the administration of olodaterol does not cause addiction or arrhythmia in said patient . in a further aspect , the heart rate of the patient is not increased . in a further aspect , the present invention provides a method of treating a disease treatable by a bronchoprotective medicament comprising identifying a patient in need of said medicament and at risk of arrhythmia and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating a disease treatable by a bronchoprotective medicament comprising determining that a patient in need of said medicament is also at risk of arrhythmia and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating copd in a patient comprising determining that said patient is at risk of arrhythmia and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating copd in a patient comprising identifying a patient in need of said treatment and at risk of arrhythmia and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating copd in a patient comprising determining that said patient is at risk of increased heart rate and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating copd in a patient comprising identifying a patient in need of said treatment and at risk of increased heart rate and administering olodaterol to said patient . in a further aspect , a full effective dose of olodaterol is administered to said patient . in a further aspect olodaterol is administered to said patient based on the recognition of the safety margin of olodaterol . in a further aspect , olodaterol is administered to said patient based on the ratio dose inducing side - effect / bronchoprotective fed of olodaterol . olodaterol is known as combination partner of tiotropium salts , especially tiotropium bromide , from ep 1781298 . additionally tiotropium bromide is also available for the use as a medicament for the treatment of cough ( see lung . 2008 , 186 : 369 - 74 ). thus , another aspect of the invention is olodaterol or a pharmaceutical acceptably salt thereof in combination with tiotropium or a pharmaceutical acceptable salt thereof , preferably tiotropium bromide , for use as a medicament for the treatment of cough . whereas the application of the combination can be occur as a fixed dose combination or as free dose combination simultaneously or sequentially . in the preferred use for the treatment of cough according to the invention it is particularly preferred to use preparations or pharmaceutical formulations which are suitable for inhalation . inhalable preparations include inhalable powders , propellant containing metered - dose aerosols or propellant free inhalable solutions . within the scope of the present invention , the term propellant free inhalable solutions also include concentrates or sterile ready - to - use inhalable solutions . the formulations which may be used within the scope of the present invention are known from the above mentioned prior art . the dose range of olodaterol applicable per day is usually from 0 . 01 to 50 μg , preferably from 0 . 05 to 25 μg , more preferably from 1 to 10 μg , most preferably 1 , 2 . 5 , 5 or 10 μg . olodaterol fully effective dose in human in watery solution by inhalation with respimat ( see ep1809293 ) is comprised between 2 . 5 and 10 μg / day . a once daily application of the full effective dosage of olodaterol or a salt thereof is preferred . accordingly , in one aspect of the present invention , 5 μg of olodaterol is administered daily to the patient , for example through 2 actuations from the mouthpiece of a delivery device , each actuation containing 2 . 7 μg olodaterol hydrochloride , equivalent to 2 . 5 μg olodaterol . nevertheless a dosage unit may also contain half of the fully effective dose , then a once daily treatment by sequenced application of this half dose unit is preferred . accordingly , in another aspect of the present invention , only one actuation from the mouthpiece containing 2 . 7 μg olodaterol hydrochloride , equivalent to 2 . 5 μg olodaterol , is administered to a patient daily . alternatively , in a further aspect of the present invention two actuations from the mouthpiece each containing 1 . 35 μg olodaterol hydrochloride , equivalent to 1 . 25 μg olodaterol , are administered to a patient daily . in combination with tiotropium salts the dose range of olodaterol is the same than above and the dose range of the tiotropium salt , e . g . tiotropium bromide applicable per day is usually from 1 to 50 μg , preferably from 1 to 30 μg , more preferably from 1 to 20 μg , most preferably 1 , 2 . 5 , 5 , 10 or 18 μg . tiotropium fully effective dose in combination by inhalation of a powder formulation ( e . g . handyhaler from ep 1940349 ) is 18 μg / day and in watery solution by inhalation with respimat ( see ep1940349 ) is between 2 . 5 and 5 μg / day . olodaterol fully effective dose is the same than above . a once daily application of the full effective dosage of olodaterol and tiotropium or salts thereof according to the above description is preferred . nevertheless a dosage unit may also contain half of the fully effective dose , then a once daily treatment by sequenced application of this half dose unit is preferred . the actual pharmaceutically effective amount or therapeutic dosage will of course depend on factors known by those skilled in the art such as age and weight of the patient , route of administration and severity of disease . in any case the combination will be administered at dosages and in a manner which allows a pharmaceutically effective amount to be delivered based upon patient &# 39 ; s unique condition . other features and advantages of the present invention will become apparent from the following more detailed examples which illustrate , by way of example , the principles of the invention . animals — male albino dunkin - hartley guinea pigs ( 350 - 550 g ; charles river wiga gmbh , sulzfeld , germany ) were used . the animals were housed in groups of 6 in solid floor cages and allowed free access to water and standard food . the guinea pigs were kept in rooms maintained at a constant temperature ( 22 ° c .± 2 ° c .) and humidity ( 60 %± 15 %), with a 12 h light cycle . the experiments were approved by the ethical committee regierungspräsidium tübingen , germany . ova asthma model — on days 1 and 2 , the guinea pigs were immunised by subcutaneous injection of 0 . 5 ml per animal of a solution of ovalbumin ( ova ) ( 40 μg / ml ) and aluminium hydroxide [ al ( oh ) 3 ]. on day 14 , these sensitised guinea pigs were challenged with ova by exposure to an ova aerosol ( 1 . 25 mg / ml ) for 5 minutes , using a dräger inhalette ® ( dräger medical ag & amp ; co . kgaa , lübeck , germany ). 30 minutes prior to the challenge , pyrilamine maleate ( 2 mg / kg i . p .) was administered to protect the animals against bronchospasm . on day 15 , the citric acid challenge was given to induce cough . 2 hours before the challenge , the test compound or vehicle ( saline ) was delivered by intratracheal ( i . t .) administration ( 0 . 5 ml / kg ) under anaesthesia with isoflurane ( forene ®, abbott gmbh and co . kg , wiesbaden , germany ). tested compounds were : codeine : 1 , 3 , 10 , and 30 mg / kg i . t . ( codeine was used as gold standard for the validation of the experiment ) olodaterol : 0 . 01 , 0 . 03 , 0 . 1 , 0 . 3 , 1 , and 3 μg / kg i . t . formoterol : 1 , 3 , and 10 μg / kg i . t . indacaterol : 3 , 10 , and 30 μg / kg i . t . cough recording — two hours after i . t . application , the citric acid challenge was performed . a whole body plethysmograph manufactured for guinea pigs ( buxco research systems , wilmington , n . c ., usa ) was used for the experiments . conscious animals were individually placed , unrestrained , into a whole body plethysmograph chamber . a solution of citric acid ( 0 . 4 m ) was nebulised using the aerosol delivery system ( buxco ) and administered to the animals at a rate of nebulisation of 0 . 18 ml / min for 15 min . during the challenge , airflow in the chamber was recorded by the buxco system and analysed for the transient increase in airflow produced by cough , in which rapid inspiration is followed by rapid expiration . the system was able to distinguish coughs from other expiratory responses , and the number of coughs was counted . data analysis — data from the treatment groups were compared with the vehicle group . data are expressed as mean ± sem of coughs produced by guinea pigs within each group during a 15 minutes citric acid aerosol exposure . mean values were statistically analyzed by one - way analysis of variance ( anova ) followed by the dunnett &# 39 ; s multiple comparisons test to evaluate significant differences between groups with p & lt ; 0 . 05 being considered significant . animal — male and female dunkin - harley guinea pigs were obtained from the experimental animal breeding centre of harlan winkelmann ( germany ). after fasting overnight , but with free access to drinking water , animals with body weight of 400 - 500 g are used . anesthesia and preparation — the anesthesia was induced by intraperitoneal injection of 50 mg / kg pentobarbital . anesthesia was prolonged by intravenous infusion of pentobarbital ( 15 mg / kg / h ) via the jugular vein . a tracheal cannula was introduced after tracheotomy for artificial ventilation . the internal jugular vein was cannulated for acetylcholine injection . instrumentation — bronchospasm was recorded with a modified version of the method of konzett - röβler described by walland et al , 1997 . the animals were ventilated by means of a piston pump ( starling ventilator , hugo sachs elektronik , germany ) at a stroke volume of 1 ml / 100 g body weight and at a rate of 60 strokes per min the tubing which connected the tracheal cannula with the ventilator was provided with a branch leading to the bronchospasm transducer ( bronchospasm transducer 7020 , ugo basile , italy ). lung resistance was measured as ml of overflow and was recorded , amplified and saved under notocord files ( notocord - hem , notocord , france ). blood pressure and heart rate were monitored from a carotid artery in order to check the anesthesia and the variability of the preparation . experimental protocol — 2 hours before acetylcholine challenge , guinea pigs were given the test compound or its vehicle intra - tracheally under a slight isoflurane anesthesia . 30 minutes before acetylcholine challenge , lung resistance and blood pressure were measured under anesthesia . at t : 0 , acetylcholine was injected intravenously at a fixed dose of 14 μg / kg . compounds were tested at doses of : olodaterol : 0 . 01 , 0 . 03 , 0 . 1 , 0 . 3 , and 1 μg / kg formoterol : 0 . 1 , 0 . 3 , 1 , and 3 μg / kg indacaterol : 3 , 10 , and 30 μg / kg at the end of the experiment , animals were euthanized by an overdose of pentobarbital ( 100 mg / kg i . v .). data analysis — data from the treatment groups were compared with the vehicle group . data are expressed as mean ± sd of ml of overflow . bronchoprotection was expressed as percentage of inhibition of the bronchoconstriction recorded with acetycholine at 14 μg / kg i . v . mean values were statistically analyzed by one - way analysis of variance ( anova ) followed by the dunnett &# 39 ; s multiple comparisons test to evaluate significant differences between groups with p & lt ; 0 . 05 being considered significant . in the following the heart rate is expressed as a percentage of the pre - value ( heart beats per minute ) preceding the drug administration . the increase in heart rate expressed in percent corresponds to the difference of heart rate between the vehicle group and the treated group recorded 20 minutes after drug instillation . an increase in heart rate of at least 10 % or more in the treated group compared to the vehicle group is considered to be relevant as a systemic pharmacological activity ( arrhythmia ), while an increase of less than 10 % is not considered relevant . dose inducing side - effect ( increase in heart rate ) is the first dose increasing heart rate of at least 10 % or more compared to the vehicle group recorded 20 min after administration of the drug : olodaterol : 30 μg / kg (+ 13 %); formoterol : 10 μg / kg (+ 21 %); indacaterol : 100 μg / kg (+ 15 %). anti - tussive : cough reflex is a defensive reflex aiming to expel foreign particles , therefore 20 % of the cough reflex should be maintained . fed is the first dose without side - effect and displaying 70 to 80 % efficacy : olodaterol : 0 . 1 μg / kg (+ 79 %); formoterol : 3 μg / kg (+ 71 %); indacaterol has no anti - tussive activity . bronchoprotection : bronchoconstriction is a deleterious pulmonary reaction that should be abolished completely . fed is the first dose without side - effect and displaying 80 to 100 % efficacy : olodaterol : 0 . 3 μg / kg (+ 89 %); formoterol : 3 μg / kg ( 89 %); indacaterol : 10 μg / kg ( 84 %). olodaterol : the first side - effects ( increased heart rate ) were measured at a dosage of 30 μg / kg ( 13 % increase from baseline , dose inducing side - effect ). antitussive fully effective dose ( fed ): 0 . 1 μg / kg bronchoprotective fed ( see above ): 0 . 3 μg / kg ratio dose inducing side - effect / antitussive fed : 300 ratio dose inducing side - effect / bronchoprotective fed : 100 formoterol : the first side - effects ( increased heart rate ) were measured at a dosage of 10 μg / kg ( 21 % increase from baseline , dose inducing side - effect ). antitussive fed : 3 μg / kg bronchoprotective fed : 3 μg / kg ratio dose inducing side - effect / antitussive fed : 3 . 3 ratio dose inducing side - effect / bronchoprotective fed : 3 . 3 indacaterol : the first side - effects ( increased heart rate ) were measured at a dosage of 100 μg / kg ( 15 % increase from baseline , dose inducing side - effect ). no antitussive effect bronchoprotective fed : 10 μg / kg ratio dose inducing side - effect / antitussive effect : ratio dose inducing side - effect / bronchoprotective fed : 10 thus , olodaterol does not increase the heart rate ( less than 10 % increase ) at doses including its full effective dose for bronchoprotection and at doses showing the anti - tussive effect . an increase in heart rate was observed at a dose 300 times higher than the antitussive fully effective dose ( fed ) and 100 times higher than the bronchoprotective fed ( ratios dose inducing side - effect / antitussive fed and dose inducing side - effect / bronchoprotective fed of 300 and 100 , respectively ). the high ratios shown above for olodaterol indicate that there is a high safety margin against side effects at fed for olodaterol , especially in comparison with formoterol . for indacaterol , which has no anti - tussive effect , the side effect risk in view of bronchoprotection seems to be better than formoterol but , the safety margin is nevertheless 10 times less than for olodaterol . | 0 |
write driver circuits are used to write data into the cells of a memory array . like conventional wwtm circuit , a write driver is normally operably connected to a column of cells across the bit and not bit lines for differentially writing a value into a cell . the present invention takes advantage of the preexistence of a write driver for any memory array by incorporating into the already - existing driver the capability to also perform a weak write operation . fig2 shows a conventional write driver circuit 80 . driver circuit 80 has bit and not bit lines for connection to the corresponding bit / not bit lines of a column of memory cells . it also has a datain input , which receives a “ 0 ” or a “ 1 ” and causes it to be applied at the bit / not bit outputs for writing to the memory cell column . write driver 80 generally includes pmos transistors m 11 and m 14 , nmos transistors m 12 , m 13 , m 15 and m 16 , and inverter u 11 . transistors m 11 and m 12 are connected in a conventional static inverter gate configuration — as are m 14 and m 13 — forming driver gates for providing the write driver output signal . the gates of the m 11 and m 12 fets are jointly connected forming the input for the m 11 / m 12 driver gate . their drains are also jointly connected forming its output . likewise , the gates of the m 13 and m 14 fets are jointly connected forming the input for them 13 / m 14 driver gate , and their drains are jointly connected to form its output . the sources of m 11 and m 14 serve as the supply inputs for their respective driver gates . these supply inputs are connected to v dd . alternatively , the sources of m 12 and m 13 serve as the supply outputs for the driver gates . accordingly , they are both connected to ground . pass gate transistors m 15 and m 16 are connected between the outputs of the m 11 / m 12 and m 13 / m 14 driver gates on the one hand , and the bit and not bit outputs on the other hand , respectively . their gates are each connected to a write signal for activating the write driver by passing the differential driver gate outputs to the bit / not bit outputs . the data input node is at the input of the m 13 / m 14 driver gate , and inverter u 11 is connected between the data node and the input of the m 11 / m 12 driver gate , which causes the driver gates to generate a differential output across their outputs . in operation , when a “ 0 ” value is applied at the data node , the output of the m 11 / m 12 driver gate ( which is an inverter ) is “ 0 ”, and the output of the m 13 / m 14 driver gate is “ 1 ”. if the write input is active ( e . g ., high ), pass gates m 15 and m 16 turn on and pass these values through to the bit and not bit outputs for differentially applying a “ 0 ” at a memory cell . conversely , when a “ 1 ” is at the data input , a “ 1 ” ( or high value ) is generated at the m 11 / m 12 driver gate output , and a “ 0 ” ( low value ) is generated at the m 13 / m 14 driver gate output . if the write input is active , pass gates m 15 and m 16 turn on to pass these values through to the bit and not bit outputs for differentially applying a “ 1 ” at the memory cell . fig3 shows one embodiment of a wwtm mode capable write driver circuit 100 of the present invention . like write driver circuit 80 , circuit 100 has data and write inputs and bit and not bit outputs for either writing a data value into or weak write testing a memory cell . circuit 100 also has a not wwtm input for setting circuit 100 either to wwtm or to normal write mode . write driver circuit 100 generally includes pmos transistors m 21 and m 24 , nmos transistors m 22 , m 23 , and m 25 through m 28 , and inverter u 21 . transistors m 21 - m 26 and inverter u 21 are similarly arranged and function equivalently as their respective counterparts , m 11 - m 16 and u 11 from circuit 80 . however , rather than being connected directly to ground , the supply outputs ( m 22 and m 23 sources ) of the driver gates ( m 21 / 22 and m 23 / m 24 ) are connected to a bias node . parallel configured first and second bias transistors , m 27 and m 28 , are connected between the bias node and ground . the not wwtm input is at the gate of the first bias transistor m 27 . in contrast , the gate of the second transistor , m 28 , is connected to v dd to keep m 28 turned on . the amount of resistance between the bias node and ground proportionally affects the strength of the driver gates and thereby so affects the strength of the output signal at bit / not bit for writing or weak write testing data into a memory cell . accordingly , m 28 is designed to be very weak because it will be the only pathway to ground from the bias node when driver 100 is in weak write mode . in this way , the output signal when in weak write mode is sufficiently weak for implementing a weak write test . m 28 can have a value corresponding to that of the pull - down transistor , mb , from fig1 b . conversely , m 27 is designed to be strong ; it will be enabled when circuit 100 is in a normal write mode . in this way , the output signal is bolstered for the write mode when data is to be written into a healthy cell . for a normal write operation , the not wwtm input is active ( high ) so that both m 27 and m 28 are on . in this way , the bit and not bit lines are pulled down strongly in order to perform a write operation . alternatively , when the not wwtm input is inactive ( low ), m 27 is turned off and only the relatively weak m 28 transistor remains on . this results in a weaker bit / not bit output for performing a wwtm operation . the actual size of the strong first transistor , m 27 , is not so critical . it simply must be strong enough to allow circuit 100 to implement a write operation . however , the size of the second ( wwtm ) weak transistor , m 28 , should be selected or tweaked for a particular design so that the bit / not bit signal is strong enough to write over data in a faulty cell but weak enough to not override data in a healthy cell . the actual size of m 28 will vary from design to design depending upon the parameters of the particular circuit and associated memory array . persons of ordinary skill will recognize that any suitable devices for controllably changing the resistive path between the bias node and ground may be used . such devices could include but are not limited to transistors , pass gates , resistors , current sources and combinations thereof . in addition , with use of a controllably variable resistive pathway ( e . g ., a removably selectable strong pathway in parallel with a nominal weak path ) for controlling the drive strength of a driver gate ( s ) in a driver circuit , almost any write driver design can be modified to allow it to do both write and weak write test operations . this controllably variable pathway may be implemented in any suitable place within the circuit including within the supply input path , as well as within the supply output path . the wwtm circuitry of circuit 100 adds only two additional nmos transistors to the write driver of circuit 80 . this is a negligible addition in terms of the whole array size . the design of circuit 100 takes advantage of the fact that ma from wwtm circuit 60 does not nee to be rigorously sized . in fact , its function is the same as the function of the pmos transistors in the write circuit 80 , thus allowing the same pfet to be used in both purposes . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps . | 6 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.