text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
plants to which the plant - root growth promoting agent of the present invention is to be applied can be those plants at large which have clearly differentiated roots , stems and leaves , and specific examples thereof include leaf vegetables , fruit vegetables , root vegetables , flowers , fruit trees and grains . inosine does not necessarily need to be a purified product . insofar as it is free from side effects , an inosine product can be an inosine fermentation broth per se . also , it can take the form such as a concentrate or concentrated and dried product of an inosine fermentation broth , a crude product of inosine separated from an inosine fermentation broth , an inosine - containing intermediate treatment fraction upon the preparation of a nucleic - acid related substance ( nucleotide , nucleoside , nucleic acid base , etc .) by the decomposition of nucleic acid , an inosine - containing fraction of a processed inosine fermentation broth or the like . it is needless to say that in the case where the application of inosine is carried out by adding it to hydroponic water , for the purpose of preventing it from contaminating the hydroponic water , thereby causing putrefaction thereof , is preferred the application of inosine in the form free from impurities which may cause pollution or putrefaction . it is possible that the plant - root growth promoting agent containing inosine as the effective ingredient can be formed into a liquid preparation in which the agent has been dissolved or dispersed in a suitable solvent such as water so as to carry out its application through soil or hydroponic water conveniently or can be formed into a powder or granular preparation by using a proper extender or binder . from the viewpoints of preventing putrefaction or increasing inosine solubility , it is preferred to form inosine into its alkaline aqueous solution which has been added with an inorganic alkali such as alkali metal hydroxide , e . g ., naoh or koh , alkaline earth metal hydroxide , e . g ., mg ( oh ) 2 , or a basic amino acid such as lysine or arginine . incidentally , when a k - containing compound such as koh is used , the k component is also considered to have a good influence on the growth of the roots . examples of the application method of such a plant - root growth promoting agent include applying the agent to the soil in advance , then followed by sowing it with plant seeds , and adding the agent to hydroponic water to dissolve the former in the latter in the case of hydroponic cultivation . in addition , the agent can be useful for the purpose of recovering a fruit vegetable such as strawberry or melon from the exhaustion attributed to fruit bearing , or preventing the fruit bearing exhaustion . and , other examples of the application method include applying the agent at a proper time during cultivation , for example , by adding to the soil at the roots of the fruit vegetable or by adding it to the hydroponic water when the symptoms of bearing exhaustion are observed or when bearing exhaustion is expected even if there are no actual symptoms thereof observed . proper application amounts vary with the time of application , the kind or cultivation density of the plant , growth or cultivation stage , or the like . anyway , it is to be noted in this connection that the plant - root growth promoting agent according to the present invention is used in an amount which permits rooting ( i . e ., root germination ) or root growth superior to those of a plant cultivated under the same conditions except that the plant - root growth promoting agent of the present invention has not been applied . this amount can be determined by some preliminary comparison test which is feasible by those skilled in the art . in the case of soil before sowing , for example , the concentration of the inosine moiety can be as low as 5 to 50 g per 100 tons of soil ( 0 . 05 to 0 . 5 ppm ). in the case of hydroponic cultivation , the concentration of inosine can be set at 0 . 1 to 2 ppm per hydroponic water , different from the case of the application to soil . the agent of the present invention therefore exhibits plant rooting action or plant - root growth promoting action at such low concentrations . gibberellin which is one of representative plant hormones causes disorders in the plant when the concentration is set wrongly , that is , set at too high a concentration , at the using time , while it has no effects when the concentration is insufficient . this is commonly said about plant hormones . in japanese patent publication kokoku no . 16310 / 1974 referred to above , for example , harms brought by the application of a plant hormone are described as follows : chlorophenoxyacetic acid - based and β - naphthoxyacetic acid - based compounds are known as so - called plant hormones and application of them to , for example , fruit vegetables , is effective for the growth promotion or fruit time acceleration of the fruit ; on the other hand , however , there is a fear of these plant hormones causing various physiological disorders of crops ; such physiological disorders include abnormal bending of the stems or leaves , shrinkage of the leaves , generation of callus on the stems , leaves or peduncles , deformity of fruit , and frequent generation of hollow fruit . it is also described in the above literature that the object of the invention concerned is to provide a fruit - vegetable growth regulator useful in agricultural management , based on the findings that the generation of the above - described physiological disorders can be reduced and at the same time expected effects can be heightened by the mixed use of chlorophenoxyacetic acid - based and / or β - naphthoxyacetic acid - based compound ( s ) and nucleic acid or decomposition product ( s ) thereof . compared with this , inosine is not a plant hormone , can be used at various application concentrations , does not cause any particular disorders of the plant even used in an excess amount , is made use of by soil microorganisms soon after application and does not cause any obstacles but becomes useful for the soil improvement . the present invention will hereinafter be described in detail by examples . in the preparation of strawberry seedlings , it is very important to keep their roots sound during a high - temperature summer season , because the strawberry seedlings are allowed to grow in pots for a long time during this season . any disorder or putrefaction of the roots has an adverse effect on the subsequent growth after the seedlings are transplanted to the garden , so farmers are most nervous about and also interested in the preparation of potted seedlings out of all their strawberry cultivating works . water was sprayed onto potted seedlings of strawberry so as not to allow the water in the pots to run out . upon spraying , spraying of water having inosine dissolved therein in an amount to give a concentration of 0 . 05 to 0 . 5 ppm definitely contributed to the promotion of the growth of the roots ( compared with those pots to which inosine - free water was sprayed ). described specifically , when roots are in direct contact with a water - impermeable vinyl or the like at the bottoms of the pots , putrefaction or disorders and blackening thereby of the roots are often observed . the supply of inosine at the above concentration obviously reduced the damage and allowed many new white roots to appear . thus , a marked difference was recognized compared with the case where inosine had not been administered . about three months after the harvesting of strawberries ( i . e ., strawberry fruit ) was started , symptoms showing bearing - attributed exhaustion were observed . inosine was therefore applied as a solution thereof in aqueous potassium hydroxide ( ph 10 . 5 ) to the strawberry plants at their base ( i . e ., to the strawberry roots ), together with a large amount of water to give a concentration of 20 g per 10 ares ( about 100 tons of soil ). as a result , the strawberries put forth new buds and leaves after several days , while the fruit buds of the strawberries approaching their thickening stage started steady growth . although the kind of the strawberries tested has a tendency to very strong color development , shortage in coloring matter was not observed . after that , the harvesting of strawberries was continued favorably . supported by the sufficient development of leaves , the harvesting of strawberries could be continued until the beginning of june . in addition , until the end of july , runners were obtained from the above parent plants . even in that season , the strawberries kept their leaves sound with brisk runners . after the first crop of melons named &# 34 ; prince melon &# 34 ; ( registered trade mark ) grown in a green house , an aqueous solution having inosine dissolved therein was administered to the melons at their base ( i . e ., to the melon roots ) to give a concentration of 20 g / 10 ares . only three days after , a number of new white roots were observed to come to appear on the surface when the mulching was uncovered ( compared therewith , in a plot where inosine had not been applied , new white roots were hardly even observed when the mulching was turned up ). after that , new buds started to show marked growth , floral buds were put forth , and the flowers developed by pollination into fruit buds started thickening . such phenomena were also observed from melons grown outdoors . by the administration of inosine to the plot where the melon vines did not creep favorably due to the low temperatures , the melons revived and put forth many floral buds . besides , thickening of the fruit was satisfactory . small - sized lily bulbs are cheap but put forth only one or two flowers per bulb when grown , while large - sized ones are expensive but put forth as many as four or five flowers per bulb . so , some lily flower cultivators purchase small - sized lily bulbs from lily bulb cultivators , and rear them into large - sized bulbs by cutting off flower buds from lily trees grown from such small - sized bulbs . in the following year , the lily flower cultivators plant such large - sized bulbs , and ship the lily flowers put forth by the large - sized bulbs . one year , small - sized bulbs of a lily named &# 34 ; rureibu &# 34 ; ( trade mark ) were planted . a solution of inosine was administered in an amount of 20 g per 10 ares to the seedling roots , in order to make up for a little delay in permanent planting and also to promote the growth of the seedlings . the seedlings showed a favorable growth and their stems reached a sufficient height . contrary to expectation , they put forth as many as four floral buds on the average , which were by two more than the ordinary case . the flowers were large and magnificent . in the soil to which inosine had been administered in each amount as shown in table 1 below , brassica rapa var . pervidis , a kind of chinese cabbage , was planted and 37 days after , it was harvested . the weight of the roots was weighed after heat - drying . to the control plot , no inosine was added . incidentally , the soil was prepared by sifting a soil called kanumatsuchi through a 4 - mesh sieve and then adding &# 34 ; esusan fertilizer &# 34 ;, an amino - acid based , commercial fertilizer , ex ajinomoto co ., inc ., to the sifted soil of all the test plots , in an amount of 1200 mg per 400 g - soil . measurement results of the weight of the roots are shown together in the table . table 1______________________________________administered weight of the ratioamount ( ppm ) roots ( g ) (%) ______________________________________0 ( control plot ) 0 . 19 1000 . 05 0 . 28 1470 . 1 0 . 27 1420 . 2 0 . 33 1740 . 3 0 . 29 1530 . 5 0 . 45 237______________________________________ as shown in table 1 , the roots of brassica rapa var . pervidis showed a marked growth by the administration of inosine in an amount of at least 0 . 05 ppm , preferably 0 . 5 ppm , relative to the soil . a photograph of the water - washed roots of brassica rapa var . pervidis harvested as described above was taken . although this photograph does not clearly show the difference in the growth of the above - ground parts of brassica rapa var . pervidis between the inosine - added plots and the control plot , the growth in the test plots was superior to that of the control plot in the subterranean parts , more specifically , superior in the length and the number of the roots and moreover , in the quality of the above - ground parts ( leaf part ) as leaf vegetable . thus , it has been found that the addition of inosine was effective even in an amount of only 5 to 20 g per 100 t of soil . in the case where late - autumn netted melon is subjected to fix planting in early september in a warm district such as kyushu , japan , it cannot endure the thickening of the fruit in november or so at the harvest time and often experiences damping - off in a moment . the damping - off causes awful damage and , for example , it usually damages all the melons in a green house within as few as 2 to 3 days . the damping - off is presumed to occur because if cultivation is continued without sufficient extension of the roots at the warm time , demand for nutrients or water more than expected occurs at the thickening time of the fruit but the roots cannot meet the demand . in each of an inosine - applied plot and an inosine - free control plot of the same field , 10 seedlings of an earls series netted melon were planted . in the inosine - applied plot , 20 g per 10 ares ( corresponding to about 100 t of soil ) of inosine were applied to the melon roots several times , as an aqueous solution adjusted to ph 10 . 5 with potassium hydroxide , together with a large amount of water at an early stage of cultivation , and the melons were allowed to grow . as a result , 20 to 30 % of the melon trees experienced damping - off . they did not , however , show complete death but partial death in their leaves . the melons kept alive with withered leaves and 10 melons were harvested from the 10 trees . on the other hand , in the control plot to which inosine had not been applied , many melon trees experienced damping - off . six trees damped off completely , and harvested therefrom were four melons , which were less than half of the melons in the inosine - applied plot . concerning the growth of the roots , the inosine - applied plot (( a )) was superior to the control plot (( b ): inosine - free plot ( control plot )) in the thickness of the roots . the inosine - applied plot was also higher in the sweetness degree ( i . e ., sugar contents or brix degree ) of the fruit . described specifically , three delicious - looking , fine - shaped melons were selected from the melons harvested from each of the inosine - applied plot and the inosine - free plot , and their sweetness degree was evaluated by 10 people . as a result , all the members evaluated that the melons from the inosine - applied plot had stronger sweetness and were delicious compared with those from the control plot . the cultivation test of a chrysanthemum coronarium ( a new root - spread , medium - sized leaved chrysanthemum coronarium ) was conducted by japan fertilizers and foods association . seedling raising pots ( size : 9 × 7 . 5 cm , made of polyethylene ) were filled with soil to be tested , followed by the addition of a common fertilizer and water to artificially prepare a garden condition . when rooting was recognized after the seed sowing of the chrysanthemum coronarium , a predetermined amount of an inosine solution was applied and the application effects on roots , above - ground parts such as stems and leaves were studied . ( 1 ) a 2 % solution of inosine was applied after dilution with pure water . the application amount of each test plot is shown in table 2 below . table 2______________________________________test administered amountplot ( per 100 t - soil ) ______________________________________standard amount 5 ( g ) 2 - fold amount 104 - fold amount 206 - fold amount 3010 - fold amount 50______________________________________ ( 2 ) the progress including field husbandry is shown in table 3 below . table 3______________________________________events date______________________________________pots filled with soil december 1 , 1996fertilized and watered december 1 , 1996sowing ( 10 seeds per pot ) december 1 , 1996thinning out the seedlings december 10 1996to threeinosine administered december 15 , 1996end of test , observation january 13 , 1997______________________________________ incidentally , to all the test plots , aqueous solutions of monoammonium phosphate , ammonium sulfate and potassium chloride were added in amounts each corresponding to 20 mg in terms of n , p 2 o 5 and k 2 o . cultivation was carried out in a heated green house . at the application time of inosine , the seedlings had two leaves and reached a plant length of 5 cm . the cultivation was conducted for 44 days in total , including 25 days after the application of inosine . table 4__________________________________________________________________________ above - ground parts ( stems and leaves ) subterranean parts ( roots ) test pots no . weight ( g ) ( ratio ) weight ( g ) ( ratio ) __________________________________________________________________________inosine administration standard 1 3 . 5 0 . 7 amount 2 3 . 4 1 . 0 3 3 . 4 0 . 8 average 3 . 43 ( 103 ) 0 . 83 ( 108 ) 2 - fold 1 4 . 1 1 . 1 amount 2 4 . 1 0 . 9 3 3 . 7 1 . 2 average 3 . 97 ( 119 ) 1 . 07 ( 139 ) 4 - fold 1 4 . 6 1 . 0 amount 2 4 . 3 1 . 4 3 4 . 4 1 . 3 average 4 . 43 ( 133 ) 1 . 23 ( 160 ) 6 - fold 1 3 . 9 1 . 1 amount 2 4 . 2 1 . 1 3 4 . 4 1 . 1 average 4 . 17 ( 125 ) 1 . 10 ( 143 ) 10 - fold 1 3 . 6 1 . 2 amount 2 3 . 8 0 . 9 3 3 . 9 1 . 0 average 3 . 77 ( 113 ) 1 . 03 ( 134 ) non - administered pot 1 3 . 5 0 . 8 ( control pot ) 2 3 . 0 0 . 7 3 3 . 5 0 . 8 average 3 . 33 ( 100 ) 0 . 77 ( 100 ) __________________________________________________________________________ it is apparent that application effects of inosine are recognized in the growth of the roots and foliar ( above - ground ) parts of chrysanthemum coronarium . in this example were employed pots and a bed soil exclusively used for raising seedlings , which were to show the application effects of inosine clearly . &# 34 ; sakata &# 39 ; s cell pots ( exclusively used for raising seedlings )&# 34 ; and a bed soil exclusively used for cell pots , the filled amount being 17 g per pot , were employed as the pots and the bed soil . neither the test plots nor the control plot were subjected to fertilization . inosine was applied three days after the beginning of germination . the seeds were sown on sep . 19 , 1996 , inosine was applied on september 23 , and the investigation on the harvest was carried out on october 1st . table 5______________________________________test plots administration of inosine______________________________________control plot -- 5 g inosine - per - 10 - are plot 8 . 5 ml of a 0 . 01 mg / dl solution20 g inosine - per - 10 - are plot 3 . 4 ml of a 0 . 1 mg / dl solution30 g inosine - per - 10 - are plot 5 . 1 ml of a 0 . 1 mg / dl solution50 g inosine - per - 10 - are plot 8 . 5 ml of a 0 . 1 mg / dl solution______________________________________ results are shown in table 6 below . concerning each plot , the above - ground parts ( height and weight ) and subterranean parts ( root weight ) of 8 cucumber seedlings were measured and the average values were calculated , which are shown in table 6 below . incidentally , the roots were weighed after dried . table 6______________________________________ check items above - ground parts subterranean partstest plots height ( ratio ) weight ( ratio ) root weight ( ratio ) ______________________________________control plot 8 . 44 ( 100 ) 0 . 91 ( 100 ) 0 . 023 ( 100 ) 5 g inosine - per - 10 - are 10 . 96 ( 130 ) 0 . 97 ( 107 ) 0 . 031 ( 135 ) plot20 g inosine - per - 10 - 12 . 10 ( 143 ) 1 . 06 ( 116 ) 0 . 033 ( 143 ) are plot30 g inosine - per - 10 - 11 . 72 ( 139 ) 1 . 13 ( 124 ) 0 . 026 ( 113 ) are plot50 g inosine - per - 10 - 10 . 68 ( 127 ) 1 . 02 ( 112 ) 0 . 027 ( 117 ) are plot______________________________________ height unit : cm weight unit : g per sample root weight unit : g per sample it can be seen from the above table that the inosine - applied plots were superior to the control plot ( inosine - application - free plot ) in every item . application of inosine in an amount of 20 to 30 g / 10 ares is presumed to be the most effective . peas were subjected to the cultivation test in the same manner as in example 8 . supposing that the weight of the combined vine and foliar weight and that of the roots of the control peas ( application - free plot ) were 100 each , the vine and foliar weights were 107 and 120 and the root weights were 120 and 120 when inosine was applied in amounts of 30 g / 10 ares and 50 g / 10 ares , respectively . thus , application effects of inosine were recognized . the present invention has made it possible to carry out plant - root growth promotion easily and , in turn , to carry out rearing or thickening of leaves , floral buds , fruit bearing , or fruit easily . | 0 |
referring now again to the drawings and specifically to fig1 thereof , there is illustrated the wheelchair lift apparatus , designated generally at 1 , of the present invention . as shown , the apparatus 1 is installed for use with a conventional vehicle v , such as a recreational van or the like . as shown , the lift apparatus 1 is disposed within the side - door opening d of the vehicle adapted for rotational movement about a generally vertical axis , as shown by the arrows , at 4 . accordingly , the lift apparatus is adapted to swing inwardly and outwardly within the opening d of the van to provide ingress and egress to the user , such as an invalid . specifically , this pivotal movement about the vertical axis , as at 4 , is illustrated in fig6 which illustrates the lower drive mechanism , designated generally at 19 , for the lift apparatus 1 . as best seen in fig3 the lift apparatus 1 is mounted on the floor f of the vehicle chassis c . more specifically , the lift apparatus 1 includes a carriage assembly , designated generally at 8 , which is mounted on the floor f of the chassis c as aforesaid . in the form shown , the carriage assembly 8 includes a column support mechanism 10 which comprises a vertically disposed column member 12 ( fig3 ) which is mounted on a base plate 14 ( fig3 and 6 ) which , in turn , is mounted on the floor f of the chassis . as shown , the lower end of the column 12 is fixly attached to a driven segment gear 16 for rotation about a vertical axis . specifically , it will be seen that the base plate 14 is disposed in the same general plane as the surface of the floor f chassis . the segment gear 16 is disposed in vertically spaced relation above the base plate 14 and is fixably attached , as at 18 , to the column 12 ( fig6 ) as to rotate the column 12 vertically about its axis upon activation of a motor drive mechanism , designated generally at 20 . the segment gear 16 is driven by a drive gear 13 ( fig3 ) via a drive gear 15 actuated by drive motor 20 , as seen in fig6 . preferably , the segment gear 16 is of a generally 90 ° configuration so as to impart a corresponding full 90 ° rotation of the column 12 about its vertical axis and so as to correspondingly rotate the lift apparatus 1 through 90 ° inwardly and outwardly of the door opening d . in operation , as best seen in fig6 the segment gear is shown in solid line so that the lift apparatus 1 is swung outwardly completely 90 ° to its full open position . as shown , this would be at right angles in respect to the door opening d whereas , the illustration in perspective view of fig1 illustrates the lift apparatus 1 disposed generally at approximately 45 °. in fig6 the lift apparatus 1 is in the full open or 90 ° position to receive the user . in this position , an inclined cam surface 22 ( fig6 ) activates the limit switch 24 ( fig6 ) which de - activates the motor 20 to enable the user to lower the lift apparatus 1 vertically to the ground position , as seen in dotted line at g in fig3 . in the reverse operation , the lift apparatus 1 is raised vertically upon actuation of the motor 20 via lever l , which raises the lift apparatus 1 vertically , as illustrated by the arrow 26 to the solid line position illustrated in fig3 . the user then actuates another lever l2 so as to pivot the lift apparatus 1 inwardly about a generally horizontal plane upon rotational movement of the column 12 about its vertical axis . this rotational movement brings the segment gear 16 through a rotation of approximately 90 ° so as to engage another limit switch 28 ( fig6 ) which then again deactivates the motor 20 which seats the lift apparatus carrying the user in grounding engagement with the floor f of the chassis of the vehicle , as illustrated in broken line in fig3 . in the form shown , the control includes the lever l , which activates the control circuit ( not shown ) for raising the lift apparatus 1 vertically , as illustrated by the arrow 26 in fig3 . the lever l2 actuates the control circuit ( not shown ) for rotating the lift apparatus 1 into and out of the van about a generally horizontal plane . in accordance with the invention , the column assembly 10 includes the column member 12 which , as illustrated in cross - section at fig4 is of a polygonal , such as square - cross - sectional configuration . specifically , the column 12 has four generally planar sides , as at 30 , connected by generally flat edge portions , as at 32 . in the invention , it is to be understood that the surfaces 32 could be other than flat so as to include some degree of radius , as desired . preferably , the column 12 includes an interior strengthening plate 34 which preferably extends transversely between the flats , as at 32 . preferably , the plate 34 may extend throughout the full vertical length of the column 12 or less than such length , as desired . now in the invention , there is employed a plurality of bearing members , designated generally at 38 , for friction rolling engagement on the column member 12 . preferably , the roller bearing arrangement is structured and arranged so as to provide relief areas , as at 40 , to enable full surface - to - surface engagement between the confronting surface , as at 40 , of the column 12 ( fig4 ) with the corresponding confronting surface , as at 42 , of the respective rollers 44 and 46 . in the form shown in fig3 the rollers 44 are mounted upwardly on a roller housing assembly 48 and the rollers 46 are mounted downwardly of the assembly 48 , as best seen in fig2 . it will be seen that the upper rollers 44 include two individual generally frusto - conical rollers 45 and the lower rollers 46 include two individual generally frusto - conical rollers 45 and the lower rollers 46 include two individual generally frusto - conical rollers 47 which engage , by rolling , the column 12 , as best seen in fig4 . as best seen in fig4 the roller assembly 38 incorporates with each of the four ( 4 ) wheels 45 and 47 an adjustment device , designated generally at 50 , which are of identical construction . each adjustment device 50 includes a mounting block 52 fixably attached to the roller assembly 48 . an adjustment screw 54 ( fig4 ) is threadably connected to an axle 56 which rotatably mounts the respective rollers 45 and 47 of the respective roller assemblies . the axle 56 is provided at its opposite ends with bearing surfaces , as at 58 , which are disposed for sliding movement within slots , as at 60 , provided in the mounting blocks 52 for limiting axle adjusting movement of the screw within the block 52 . preferably , the screws are axially adjustable via fasteners , such as nuts 64 , so as to provide selective adjustment of the rollers 45 and 47 . this adjustment enables full surface - to - surface engagement at a generally 45 ° orientation of the respective rollers 45 and 47 with the confronting planar surfaces 30 of the column 12 . preferably , each of the wheels 45 and 47 is provided with an internal anti - friction bearing mechanism , designated generally at 70 . each of the mechanisms 70 include a bearing member which is commercially available . this bearing member is press - fit within the respective rollers 45 and 47 and maintained against axial movement by a retainer ring 74 . as best seen in fig2 and 5 , the lift apparatus 1 includes an upper drive assembly , designated generally at 80 , for moving the lift apparatus 1 horizontally on the column assembly 10 . as shown , this upper drive assembly 80 includes a drive motor 82 fixably mounted on a top support plate 84 which is fixably attached to the upper end of the column 12 . the drive motor 82 ( fig3 ) is operably connected to a drive screw 86 via a pair of drive pulleys 88 and 90 ( fig5 ) connected by two ( 2 ) belts 87 and 89 to the input drive end 92 ( fig3 ) of the drive screw . the drive screw 86 is mounted at one end to a bracket 98 which is fixably attached to the roller assembly 48 . the lower end of the drive screw 86 is mounted for rotation within a bearing , as at 100 , which , in turn , is attached to a bracket member 102 ( fig3 ) fixably attached to the segment gear 16 . preferably , the bearing 100 is of a plastic , such as teflon material , or the like . as best seen in fig3 the bracket 98 is illustrated in solid line when the lift apparatus is in the full vertically oriented &# 34 ; up &# 34 ; position and in dotted line in the full vertically oriented &# 34 ; down &# 34 ; position . in the invention , the lift apparatus 1 comprising the carriage assembly 8 includes a frame structure , designated generally at 101 , which is of a generally inverted u - shaped configuration as best illustrated in fig3 . more specifically , the structure 101 includes a generally planar ramp or platform 102 which is carried by a pair of oppositely disposed side columns 104 and 106 which are interconnected at their top ends by a cross member 108 . as shown , the outerward support column 106 is inclined to provide an offset portion as at 110 to provide sufficient clearance for the wheelchair user . the members 108 and 106 are interconnected by a strengthening gusset , as at 112 , to provide rigidity between the component parts . similarly , the parts 104 and 108 are provided with another gusset , as at 114 , for the same purpose . as shown the inner column 104 is provided with a brace member 116 which is fixably attached at its lower end to the platform 102 . as best illustrated in fig3 the cross member 108 is provided at its inner end with a control box , designated generally at 118 , which mounts the controls l1 and l2 , as aforesaid . as best seen in fig7 the platform 102 is provided with a pair of oppositely disposed strengthening side plates 122 which are made integral with and are disposed in generally vertically upstanding relation in respect to the platform 102 . as shown , the inner side plate 120 ( fig7 ) is fixably connected , as by weldments , to the inner column member 104 and to the brace member 116 . also , the side plate member 120 includes an integral flange 124 which provides a support for a freely rotatable pulley 186 , as will be hereinafter more fully described . as shown , the other outer side plate 122 ( fig3 ) includes a further gusset , as at 126 , for strengthening the inner connection between the side plate member 122 and the outer column member 106 . it will be seen , therefore , that the frame structure defined by the columns and cross members 104 , 106 and 108 define a generally inverted u - shaped configuration which is disposed substantially in the same general vertical plane with the support column member 12 which mounts the roller housing assembly 48 . similarly , the drive screw 86 is disposed in a generally vertical parallel relationship in respect to the support column 12 , as best illustrated in fig2 and 3 . in the invention , this parallel relationship between the component parts is achieved by a mounting bracket , as at 130 , which is fixably attached at one end , as at 132 to the distal end of the support column 12 ( fig1 and 5 ) and at the other end via a flange 134 secured , such as by screws and the like , to the column 136 of the vehicle . this bracket provides a structural support for maintaining the parallel relationship between the parts and the perpendicular relationship of these parts in respect to the floor f of the vehicle chassis . as best illustrated in fig7 and 8 , the platform 102 of the frame structure 8 includes a forward stop mechanism , designated generally at 140 , disposed for horizontal reciprocal movement on the platform member 102 . more specifically , this mechanism includes a support plate 142 which has an upturned end , as at 144 , adapted to prevent forward rolling movement of the wheelchair when installed thereon . the support plate 142 includes a pair of oppositely disposed integral flanges 146 and 148 of generally inverted l - shaped configuration . each of the flanges mounts a pair of rollers 150 and 152 adapted for rolling engagement within correspondingly shaped u - shaped channel members 154 and 156 fixably attached to the platform 102 . the guide channels 154 and 156 each include a pair of stop elements 160 , which serve to limit and provide a stop for the rollers and hence , forward movement of the mechanism 140 as illustrated by the arrow 162 in fig7 and 8 . more specifically , the stopping movement occurs when the rollers 152 are brought into abutment with the stops 160 . the opposite end of the guide members 154 and 156 are provided with elastomeric stop members ( rubber ) 164 which served to provide a cushion upon resilient retracting movement of the mechanism 140 . the retracting movement of the mechanism is automatically accomplished by a pair of oppositely disposed extension spring elements 166 which are attached at one end , as at 168 , to flanges 169 on the respective guide members 154 and 156 and at the other end to the side flanges 146 and 148 , as best seen in fig8 . by this arrangement , the forward stop mechanism 140 is disposed for reciprocal movement in a generally horizontal plane parallel to the general plane of the platform 102 so as to enable the wheels ( not shown ) of the wheelchair to engage the stop 144 so as to drive the assembly forward throughout its full through ( dotted line fig7 ) so that the rearwardmost ends of the flanges 146 and 148 are disposed generally at the center - line , as at 171 , of the oppositely disposed column member 104 and 106 . in this position , it has been determined that the wheels of the wheelchair can be supported by and transferred forwardly to a point sufficient such that the center of gravity , i . e . the load , of the wheelchair user including the wheelchair , is disposed slightly forward of the generally vertical plane defined by the generally inverted u - shaped structure 102 of the frame . preferably , this load distribution is disposed at such center line or forward of the same so as to prevent accidental rolling movement of the wheelchair rearwardly and off of the lift platform during normal use thereof . as best seen in fig7 a rear stop mechanism , designated generally at 170 , is provided to prevent inadvertent rearward rolling movement of the wheelchair off of the platform 102 . as shown , the mechanism includes a rear stop plate member 172 which is pivotably attached to the platform 102 via an elongated piano - type hinge spring 174 which is fixably attached , as by weldments , to the platform 102 and the stop 172 . as best seen in fig7 this spring hinge biases the stop plate 172 forwardly or in a counter - clockwise direction , as illustrated by the arrow 176 . the stop plate 172 is actuated by means of the cable 178 which is fixably attached by a turn buckle , as at 180 , and then threaded through a guide roller 182 and then around a guide roller 186 fixably mounted on the flange 124 . at this juncture , the cable takes a 90 ° turn and extends vertically upwardly generally parallel to the inner column member 104 and attached at its free end to a pivotal link 188 . the link 188 is pivotally attached at one end , as at 190 , ( fig2 ) to a cross member 192 which is integrally connected between the roller assembly 148 and the inner column member 104 . as shown , the free end of the cable 178 is attached , as at 194 , adjacent the free end of the cable 178 is attached , as at 194 , adjacent the free end of the pivot link 188 . as best seen in fig3 another cable member 196 is fixably attached , as at 198 , to the pivot link 188 generally intermediate its ends . the cable 196 is fixably attached at its other end , as at 202 , to a ball screw assembly 204 which receives the drive screw 86 for raising and lowering the carriage lift assembly 48 in a generally vertical direction . the operation of stop mechanism 170 can be illustrated with reference to fig3 and 7 . as shown , in the full - up or solid line position illustrated in fig3 the pivot link 188 is disposed in a generally 45 ° orientation . in this condition , the upper cable 196 is held in a taut condition by means of the upward force exerted by the ball screw assembly 204 , whereas , the lower cable 178 is only under sufficient tension so as to maintain the stop member 172 in the upward position , as illustrated in fig7 so as to override the biasing force of the piano spring hinge 174 thereby to hold the stop member 172 in a generally 45 ° opientation in relation to the platform 102 . upon actuation of the outer lever l1 the carriage lift assembly 8 is vertically lowered with the cables 196 and 178 maintained in a relatively constant load condition until platform 102 bottoms out with the ground . after grounding , continued actuation of the outer lever l1 acts to overdrive the upper drive motor 82 which , in turn , drives roller drive screw 204 downwardly . this movement causes the upper cable 196 to slack and the lower cable 178 to become under tension due to the resilient biasing of the piano spring hinge 174 . this causes pivotal movement of the pivot link 188 in a generally clockwise direction ( fig2 ) which enables the stop plate member 172 to pivot downwardly , as shown by the arrow 176 ( fig7 ) into the general plane of the platform member 102 . in this position , a limit switch 210 mounted on the cross member 192 is contacted which stops further vertical downward movement of the ball screw 204 . in the invention , the cable 178 has a 2000 p . s . i . at test capability and the stop plate 172 has a 1600 p . s . i . force capability . the lift platform 102 has a lifting capacity of 960 pounds and a stationary load capacity of 2000 pounds . the upper motor 82 has a 3000 r . p . m . and draws 28 amps at a 400 lbs . loading capacity on the platform . in the invention , there is at least a 2 to 1 safety factor in respect to the v . a . recommended lift capacity at 400 lbs . in a technical operation , with the user then positioned on the platform 102 , he merely actuates the switch lever l1 which actuates motor 82 via cables 88 and 90 to rotate the screw 86 in the stationary ball screw 204 which is fixably attached to the support column 12 . this raises the platform 102 to the desired height , as illustrated in solid line in fig3 whereupon the lift will stop automatically upon actuation of a suitable limit switch ( not shown ) being utilized to automatically de - energize the motor 82 . at this position , the user then actuates the other control lever l2 which activates drive motor 20 ( fig6 ) so as to rotate the lift to the door d into the van . he then again actuates control l1 so as to automatically lower the lift and platform 102 to the floor f of the van . automatic operation of the forward stop mechanism 140 and the rear stop mechanism 170 operate during this sequence of this steps , as aforesaid . accordingly , reversal of the above steps enables the user to readily discharge himself from the van once again to ground level , all accomplished automatically under his own control in accordance with the advantages of the present invention . | 8 |
fig3 illustrates a subimage sequence generated in order to render images b ( k ), b ( k + 1 ) of the image sequence of fig1 using sequential color rendition . in this example , it is assumed that the individual images can be rendered by three monochromatic subimages , for example subimages in the colors red , green and blue , so that in order to render an image three monochromatic subimages are rendered in temporal succession . immediately successive subimages differ in color , and in fig3 , distinct rendition planes are chosen for the individual colors in the direction perpendicular to the time axis . in order to characterize distinct colors in the black - and - white representation of fig3 , distinct hatching patterns are chosen for the individual colors . in fig3 , b 1 (.) denotes the subimages of the subimage sequence in the first color , for example red ; b 2 (.) denotes the subimages of the second color , for example blue ; and b 3 (.) denotes the subimages of the third color , for example green . the subimage sequence is motion - compensated , which is equivalent to the fact that moving objects rendered by the subimage sequence are rendered correctly in respect of motion at the temporal position of the respective subimage in the subimage sequence . the position of a moving object , that is , an object that has a first position in a first image b ( k ) of the rendered image sequence and a second position different from the first position in a subsequent second image b ( k + 1 ) of the image sequence , changes from subimage to subimage in the direction of motion . in the example of fig1 , the direction of motion of the object 10 runs in the horizontal direction of the image from the left image margin to the right image margin . correspondingly , the position of the object in the subimage sequence changes from subimage to subimage in the direction toward the right image margin . the subimage sequence in the illustrated example is generated in such fashion that the position of the object 10 in subimages b 1 ( k ), b 1 ( k + 1 ) of the first color corresponds to the position of the object in images b ( k ), b ( k + 1 ) of the image sequence to be rendered . the subimages of the second color and the third color , respectively b 2 ( k ), b 3 ( k ) and b 2 ( k + 1 ), b 3 ( k + 1 ), lying temporally between subimages b 1 ( k ), b 1 ( k + 1 ) of the first color are subimages interpolated in motion - compensated fashion . referring to fig4 , the content of the three monochromatic subimages , respectively b 1 ( k ), b 2 ( k + ⅓ ), b 3 ( k + ⅔ ) and b 1 ( k + 1 ), b 2 ( k + 1 + ⅓ ), b 3 ( k + 1 + ⅔ ), which are generated in association with an image b ( k ) and b ( k + 1 ) respectively , are rendered in superimposed fashion in one image . as can be seen , the outlines of the objects , each monochromatic , of the individual subimages are not in register because of the generation of a motion - compensated subimage sequence , 10 ( k ), . . . , 10 ( k + 1 + ⅔ ) denoting the objects in the individual subimages of the subimage sequence . the outlines of the monochromatic objects instead lie offset relative to one another along the direction of motion of the object . when the physiology of human vision is taken into consideration , however , this offset of the position of the objects , each rendered monochromatically , from subimage to subimage leads to the object rendered by the subimage sequence being perceived as an object in a uniform color , without interfering color fringes being perceived at the edges of the object . the color of the object results from blending of the colors of the objects in the three monochromatic subimages . fig5 illustrates a first embodiment of a system for image rendition using a subimage sequence with monochromatic subimages whose color varies cyclically . b ( z ) denotes an image sequence to be rendered , which can be a conventional video image sequence and , indeed , both a frame sequence with line - interlaced frames and a full - image sequence . the image frequency at which individual images of this image sequence b ( z ) are available is f = 1 / t . two temporally successive images b ( k ), b ( k + 1 ) of this image sequence b ( z ), which in the example correspond to the images rendered in fig1 with a moving round object , are illustrated in fig7 . here t 1 = k · t denotes a first time point t 1 at which a first image b ( k ) of this image sequence is available , and t 2 =( k + 1 )− t denotes a second time point at which second image b ( k + 1 ) of this image sequence is available . the input image sequence b ( z ) is supplied to an interpolator 21 that generates from motion - compensated intermediate image interpolation , an image sequence b ( i ) having an image frequency three times that of the input image sequence b ( z ). the motion - compensated image sequence b ( i ) is illustrated in fig6 . with reference to fig7 , the interpolator 21 generates in motion - compensated fashion , for two temporally successive images b ( k ), b ( k + 1 ) of the input image sequence b ( z ), two intermediate images b ( k + ⅓ ) and b ( k + ⅔ ). the image sequence b ( i ) thus comprises the images of the input image sequence b ( z ) as well as two additional motion - compensated intermediate images for each image of the input image sequence . the individual images of this motion - compensated image sequence b ( i ) are preferably uniformly spaced in respect of time . the temporal interval of the two intermediate images b ( k + ⅓ ), b ( k + ⅔ ) associated with images b ( k ), b ( z + 1 ) of input image sequence b ( z ) is taken into account in previously known fashion in intermediate image interpolation . in relation to the illustrated example in which the object is located at a first position in the first image b ( k ) and at a second position in the second image b ( k + 1 ), this means that the position of the object in first intermediate image b ( k + ⅓ ), which is rendered at a time point t 1 + ⅓ · t , is offset relative to the position in the image b ( k ) by ⅓ of the distance between the first image position and the second image position . in the further interpolated intermediate image b ( k + ⅔ ), which is rendered at a time point t 1 + ⅔ · t , the object is located at a position that is offset relative to the position in the image b ( k ) by ⅔ of the distance between the first position and the second position in the direction of motion . apparatuses for motion - compensated intermediate image interpolation corresponding to the interpolator 21 are well known , and shall not be discussed in detail herein , in the interest of brevity . for example , such an interpolator is described for example in schröder and blume , ibid ., pages 315 - 363 . the motion - compensated image sequence b ( i ) is supplied to a filter 22 , which splits the image sequence b ( i ) into monochromatic image sequences b ( i ), b 2 ( i ), b 3 ( i ). from these monochromatic motion - compensated subimage sequences b 1 ( i ), b 2 ( i ), b 3 ( i ), subimage sequence tb ( i ) produced for rendition is formed by a multiplexer 23 . the subimage sequence tb ( i ) represents the respective temporally successive subimages of distinct colors . the multiplexer 23 passes cyclically , in time with a clock signal clk whose frequency corresponds to the frequency of the motion - compensated image sequence b ( i ), one of the three subimage sequences b 1 ( i ), b 2 ( i ), b 3 ( i ) to its output in order to generate subimage sequence b ( i ) to be rendered . the subimage sequence tb ( i ) is supplied to a display 25 , for example a so - called dlp processor , which projects onto a projection screen 26 the images represented by the subimage sequence tb ( i ). fig6 a is a simplified schematic illustration of a dlp projector , which has as its central element a dlp integrated circuit 253 to which the subimage signal tb ( i ) is supplied . the dlp integrated circuit is fashioned to reflect selectively at its surface , as dictated by the subimage signal tb ( i ), a light beam delivered from a light source 251 and propagated through an optical system 254 in order to generate a reflected light beam having a light / dark pattern dependent on the subimage signal tb ( i ). the light beam reflected from the dlp integrated circuit 253 is received by a projection apparatus 255 and projected onto projection screen 26 . a color wheel 252 , which is inserted into the beam path between the light source 251 and the dlp integrated circuit 253 , and which has three distinct color filter regions 252 a , 252 b , 252 c as shown in fig6 b , rotates in synchronization with clock signal clk . in this way a light beam is generated in synchronization with the subimages represented by the subimage signal tb ( i ) and containing in each case only the video information for one color component of the image , which light beam is reflected by the dlp integrated circuit . with reference to fig8 , it is also possible to split the incoming image signal b ( z ) before a motion - compensated image sequence is generated , using a filter 32 corresponding to the filter 22 ( fig5 ), in order to generate three subimage sequences or subimage signals b 1 ( z ), b 2 ( z ), b 3 ( z ). the system of fig8 comprises three intermediate image interpolators 33 , 34 , 35 that , from monochromatic image sequences b 1 ( z ), . . . , b 3 ( z ), generate motion - compensated subimage sequences b 1 ( i ), . . . , b 3 ( i ) having a frequency three times that of input image sequence b ( z ). in the manner already explained with reference to fig5 , these subimage sequences are supplied to the multiplexer 23 and further processed . the subimage sequences to be processed are thus first broken down into their color components before motion compensation takes place . next the motion - compensated color subimages are sequentially passed through to the device to the display . as described , the color component currently being passed through must correspond to the filter currently located in the optical beam path . in each of the systems of fig5 and fig8 , more subimages are generated than are necessary for the subimage sequence tb ( i ), which ultimately serves for image rendition . it should be pointed out that the intermediate image interpolators 33 , 34 and 35 of fig8 can also be fashioned such that these generate , by suitable intermediate image interpolation from monochromatic subimage sequences b 1 ( z ), . . . , b 3 ( z ), only the monochromatic subimages that are necessary for the subimage sequence tb ( i ). the frequency of image rendition can also be a ( possibly not whole - number ) multiple of the input image frequency . in this case the color wheel rotates more than once per input image or has more than three subdivisions . although the present invention has been illustrated and described with respect to several preferred embodiments thereof , various changes , omissions and additions to the form and detail thereof , may be made therein , without departing from the spirit and scope of the invention . | 7 |
the present invention is susceptible of embodiment in many different forms . while the drawings illustrate and the specification describes certain preferred embodiments of the invention , it is to be understood that such disclosure is by way of example only . there is no intent to limit the principles of the present invention to the particular disclosed embodiments . in one preferred embodiment of the invention , a set of blocks includes four different styles of blocks , a full set including multiple copies of each style . as shown in fig1 the four exemplary styles include a stooping man style block 10 , a cup style block 12 , a tripod style block 14 , and a tooth style block 16 . as will be seen , each of these pieces has one - half of a mechanical interfitting connection at one end and one - half of a magnetic coupling at the other end so that the pieces may be joined together in countless combinations and configurations , limited only by the child &# 39 ; s imagination and creativity . the man block 10 comprises an abstractly shaped body having a flat base 18 at one end , a trunk 20 projecting upwardly from base 18 , a reduced dimension neck 22 projecting from trunk 20 , and a head or bulb 24 located at the distal end of neck 22 . trunk 20 tapers very gradually toward neck 22 and is provided with a pair of generally flat opposite sides 26 and 28 , a slightly rounded back 30 , and a slightly rounded front 32 . neck 22 slopes upwardly and forwardly at an oblique angle from the upper end of trunk 20 so as to dispose bulb 24 in forwardly overhanging relationship to the front 32 of the body . bulb 24 is somewhat teardrop - shaped , having its largest width at the upper outboard end thereof while its lower inboard end tapers somewhat symmetrically inwardly to a reduced diameter at the junction with neck 22 . bulb 24 comprises one - half of a mechanical connection formed when bulb 24 is interfitted into a mating component as will be discussed below . the body of man block 10 is integrally molded from a suitable synthetic resinous material such as toy grade polyvinyl chloride , the characteristics and composition of such material being well understood by those of ordinary skill in this art . advantageously , the block 10 may be injection molded and provided with a smooth , solid , yet slightly resilient body . a suitable pigment may be added for increased appeal . a recess 34 in base 18 ( fig2 ) fixedly receives a disc magnet 36 that is secured in place by a suitable layer of bonding material 38 . disc magnet 36 is flush with the exposed surface of base 18 and comprises one - half of a magnetic coupling formed when the bases of two of the blocks are brought into face - to - face engagement with one another . although the magnetic coupling can take several different forms including , for example , a simple magnet in one - half of the coupling and a ferrous metal component in the other half , in one preferred form of the invention the coupling comprises two magnets having mutually opposite polarities . thus , as illustrated in fig7 and 8 , two of the disc magnets 36 a and 36 b comprise the separate halves of a magnetic coupling and are of mutually opposite polarity , each of the magnets having a suitable indication of its polarity such as , for example , a dot 37 on the magnet 36 a and a smooth dot - free surface on the magnet 36 b . it is to be understood that , in accordance with one preferred embodiment of the invention , a number of the man blocks 10 will be provided with magnetic bases that are of one polarity , while another group of the man blocks 10 will be provided with bases of opposite polarity . thus , a pair of the man blocks 10 may be magnetically coupled together at their bases , provided only that one of the bases is positive and the other is negative . depending upon the strength of the magnets used , it may be necessary or desirable to somewhat reduce the weight of the block 10 . this may be accomplished , for example , by providing a void or hollow space ( not shown ) internally of the block , such as within its trunk adjacent the recess 34 . the size and shape of any such recess must be such as to avoid adversely impacting the structural integrity and strength of the product , however . desirably , the strength of the magnets is such as to permit young children to easily disconnect the magnets from one another and yet securely hold a pair of the blocks together . a second piece in the set is the cup block 12 which , like the man block 10 , has one half of a magnetic coupling at one end and one half of a mechanical connection at another end . cup block 12 has a flat base 40 , a trunk 42 projecting upwardly from base 40 that takes the form generally of an asymmetrical cone , a neck 44 of reduced dimensions projecting upwardly from the upper end of trunk 42 , and a cup 46 disposed at the upper distal end of neck 44 . although the surface of trunk 42 is substantially arcuate throughout a full 360 ° degrees thereof , trunk 42 still presents a pair of opposite sides 48 and 50 , a back 52 , and a front 54 . it will thus be seen that the body of cup block 12 leans slightly toward side 48 as neck 44 projects upwardly from trunk 42 at a slight lean angle from side - to - side . additionally , neck 44 leans slightly forwardly at an oblique angle so as to position cup 46 out into overhanging relationship with the front 54 of trunk 42 . cup 46 has a socket 56 that is configured to complementally and matingly receive a connecting bulb such as bulb 24 of man block 10 ( see fig2 , for example ). the configuration of socket 56 is such that bulb 24 is snugly received and held therein when man block 10 and cup block 12 are interconnected , yet bulb 24 is free to rotate within socket 56 such that the rotative positions of the two blocks can be varied with respect to one another . preferably , when bulb 24 is inserted into socket 56 , there is a slight snap fit , achieved in part by the relative configurations of bulb 24 and socket 56 and in part by the nature of the material from which the blocks are constructed . in this respect , it is desirable that such material be slightly compressively resilient so that the walls of cup 46 can yield slightly as necessary to accommodate the bulb 24 as it is inserted into place . like the man block 10 , cup block 12 is integrally molded from a suitable synthetic resinous material such as polyvinyl chloride and has a magnet bonded within a recess such as the magnet 36 and recess 34 . also like the man block 10 , cup block 12 is preferably provided in multiples within a set of the blocks , certain of those cup blocks having magnetic bases of one polarity and others having magnetic bases of the opposite polarity . thus , pairs of the cup blocks 12 can be attached together at their bases 40 when the bases are of opposite polarity . a third style is the tripod block 14 , which has one - half of a magnetic coupling at one end and one - half of a mechanical connection at the other end . the body of tripod block 14 includes a flat base 58 , a generally symmetrically conical trunk 60 projecting upwardly from base 58 , a neck 62 projecting from the upper end of trunk 60 , and a tripod 64 projecting from the distal end of neck 62 . three legs 66 , 68 and 70 diverge from the upper end of neck 62 toward outermost ends that are configured in the shape of bulbs 72 , 74 and 76 respectively . each of the bulbs 72 , 74 and 76 is configured complementally to the socket 56 of cup 46 of cup block 12 such that any selected one of the bulbs 72 , 74 and 76 may be releasably snapped into cup 46 ( see , for example , fig2 ). it will be seen , therefore , that bulbs 72 , 74 and 76 are substantially of the same configuration as the bulb 24 of man block 10 . the two legs 68 and 70 of tripod 64 are offset from one another approximately 180 ° degrees . on the other hand , the third leg 66 is offset from legs 68 and 70 by only approximately 90 ° degrees . moreover , leg 66 is somewhat longer than legs 68 and 70 and projects from neck 62 at a shallower angle than legs 68 and 70 . notwithstanding the fact that leg 66 is longer than legs 68 , 70 and projects at a shallower angle , the outermost ends of bulbs 72 , 74 and 76 lie in a common plane that is close to being parallel with the plane of base 58 . consequently , when tripod block 14 is inverted with its base 58 up and the bulbs of the tripod 64 resting upon a level supporting surface , the base 58 is likewise almost or at least substantially level so as to provide a convenient and stable platform from which to erect variously shaped structures that rise from base 58 . like the previously described blocks , tripod block 14 has a recess in its base that fixedly receives a magnet to which other blocks having bases of an opposite polarity may be attached . it is contemplated that multiples of the tripod blocks 14 will be included in each set of blocks , some having bases of one polarity and others of the opposite polarity such that a pair of the tripod blocks can be magnetically attached together at their bases when opposite polarities are selected . in one preferred form of the invention , legs 66 , 68 and 70 are so configured that tripods 64 of adjacent tripod blocks may be mutually interconnected as shown in fig1 and 27 wherein the legs of one tripod are interdigitated between the legs of the other . preferably , webbing 78 between the various tripod legs is configured , arranged and dimensioned such that when the legs of the two tripods are interdigitated , there is a relatively snug fit therebetween without excessive looseness or relative rotation permitted . the enlarged nature of bulbs 72 , 74 and 76 at the outer ends of legs 66 , 68 and 70 relative to the somewhat narrower inner ends of such legs is helpful in obtaining a light snap fit when the two tripod blocks are forced axially into interfitting engagement with one another . as with the previously described blocks , the tripod style block 14 is preferably integrally molded from a synthetic resinous material such as polyvinyl chloride . in one preferred form , tripod block 14 , like the others , is essentially solid , except perhaps for certain void areas ( not shown ) which may be provided adjacent or at the trunk to provide weight control . the slightly compressively resilient nature of tripod legs 66 , 68 and 70 , coupled with the nature of the material used for tripod block 14 , helps in establishing a snap fit interconnection of a pair of tripods into one another . while in a preferred form of the invention the tripods can be interengaged in any selected one of three rotative positions , it will be appreciated that when the tripods are interengaged with the long legs 66 diametrically opposed to one another , the flat bases 58 of the two interengaged blocks become disposed in substantially parallel relationship to one another . this provides a number of benefits and construction opportunities . the fourth style of block in the set is the symmetrical tooth block 16 which , like the other previously described blocks , is adapted for magnetic coupling at one end and mechanical connection at the other end . the body of tooth block 16 includes a flat base 80 , a generally cylindrical trunk 82 projecting upwardly from base 80 , and a group of axially extending , symmetrical , laterally spaced apart , tapered teeth 84 at the upper end of trunk 82 . in one preferred form of the invention , fourteeth are provided at substantially equally spaced intervals about the circumference of trunk 82 . each tooth 84 tapers to a generally pointed tip 86 that is rounded off or blunted to avoid the presence of a sharp comer . each tooth is somewhat prism - shaped , having an outermost curved face 88 and a pair of generally flat , triangular , upwardly converging inner faces 90 and 92 . notches 94 are defined between the spaced apart teeth 84 . like the previously described blocks , tooth blocks 16 are preferably integrally molded from a synthetic resinous material such as polyvinyl chloride and are substantially solid throughout . furthermore , each is provided with an inset magnet , with certain of the tooth blocks having magnets of one polarity and others having magnets of the opposite polarity so that a pair of the tooth blocks can be attached together magnetically at their bases . in addition , a pair of the tooth blocks can be mechanically interconnected at their opposite ends by inserting the teeth 84 of one block into the notches 94 of the other . in one preferred embodiment , the teeth and notches are so configured that the two blocks do not lock up against axial displacement ; however , they do preclude relative rotation of the blocks due to the interfitting nature of the teeth and notches . various polymeric based compositions are suitable for making the blocks of the present invention . particularly suitable is a composition containing approximately 67 . 00 % by weight suitable polyvinyl chloride resin , approximately 24 . 00 % by weight suitable plasticizer , approximately 3 . 50 % by weight suitable stabilizer , approximately 3 . 50 % by weight suitable epoxy , approximately 1 . 00 % by weight suitable processing addivitves , approximately 0 . 50 % by weight suitable lubricant , and approximately 1 . 00 % by weight suitable modifier . one particularly preferred polyvinyl chloride resin is available from shin - etsu chemical co ., ltd . of tokyo , japan under the trade designation tk - 1000 . one particularly preferred plasticizer is phthalate , such as available under the trade designation jayflex dinp from exxon chemical company . a particularly preferred stabilizer is mark cz 123 available from witco vinyl additives gmbh of lampertheim , germany . a particularly preferred epoxy is epoxidised soya bean oil available from ciba - geigy corporation of tarrytown , n . y . under the trade designation irgaplast 39 or from witco vinyl additives gmbh of lampertheim , germany under the trade designation drapex 39 . the processing additives , lubricant and modifier may be selected from a wide variety of brands and sources , as well known to those skilled in the art . preferably , the material from which the blocks are made has a shore hardness of about 90 to about 95 durometer on the a scale . the abstractly shaped blocks of the present invention can be combined in any number of creative ways to allow and encourage children to express themselves freely . animals , creatures , people , and structures of various shapes and sizes can all be formed , limited only by the imagination . one very simple structure , representing no entity in particular , is illustrated in fig2 to provide but one example of how the blocks of the present invention can be mechanically interconnected or magnetically coupled together , or both . although preferred forms of the invention have been described above , it is to be recognized that such disclosure is by way of illustration only , and should not be utilized in a limiting sense in interpreting the scope of the present invention . obvious modifications to the exemplary embodiments , as 3 hereinabove set forth , could be readily made by those skilled in the art without departing from the spirit of the present invention . the inventor ( s ) hereby state ( s ) his / their intent to rely on the doctrine of equivalents to determine and assess the reasonably fair scope of his / their invention as pertains to any apparatus not materially departing from but outside the literal scope of the invention as set out in the following claims . | 0 |
embodiments of a performance analysis program and a method for generating the same according to the present invention will be described below with reference to the attached drawings . fig1 is a block diagram showing a configuration of an information processor in which a performance analysis program of the present invention is installed . the information processor 100 is exemplified by a general - purpose computer , a personal computer , a workstation and so on . the information processor 100 includes a cpu 10 and a memory 20 . the cpu 10 controls respective units of the information processor 100 and executes various programs . the memory 20 stores a compiler 30 . also , the memory 20 stores a source program 40 and a performance analysis program 50 when a performance analysis is executed . the compiler 30 is the software ( program ) basically for converting a source program ( source code ) into object code . the source program is described through a programming language by a human . the object code is a program which can be executed by the computer . in the present invention , the compiler 30 not only converts the source program 40 into object code , but also adds commands or routines to execute a performance analysis . then , the compiler 30 outputs a performance analysis program 50 . the commands or routines are added before or after the conversion . the performance analysis program 50 is the program of the object code , which can execute the performance analysis . the compiler 30 executed by the cpu 10 generates the performance analysis program 50 from the source program 40 . the compiler 30 has a procedure judging unit 31 , a measurement routine embedding unit 32 and a time measurement command embedding unit 33 . these units are intended to embed the processes ( commands or routines ) necessary for the performance analysis , when the source program 40 is compiled . incidentally , the routine implies the set of the program codes having the function for executing a particular process . also , although it is not independent as the individual program code , if several lines to several tens of lines of codes are set to carry out the particular process , that portion can be referred to as the routine . the routine is roughly classified into two elements , depending on the roles in the program . the routine , which is firstly called in starting the program , for managing the progress of the entire program , is referred to as “ a main routine ”. the routine , which is called from the other routine during the execution of the program and operated , is referred to as “ a subroutine ”. the procedure judging unit 31 judges whether or not a statement under the process is a call statement for calling the subroutine or function , in the process for compiling the source program 40 inputted to the compiler 30 , and then returns its result . incidentally , the statement implies one completed command for carrying out a process inside the program . the program is constituted by the sets of such statements . the measurement routine embedding unit 32 embeds the call statement for calling a measurement start routine , into a head of the subroutine or function under the process , in the process for compiling the source program 40 . further , the measurement routine embedding unit 32 embeds the call statement for calling a measurement end routine , into an end of the subroutine or function under the process . the time measurement command embedding unit 33 embeds a time measurement command before and after the call statement for calling the measurement start routine embedded by the measurement routine embedding unit 32 . moreover , the time measurement command embedding unit 33 embeds the time measurement command before and after the call statement for calling the measurement end routine embedded by the measurement routine embedding unit 32 . fig2 is a flowchart showing an operation of an embodiment of a method for generating a performance analysis program according to the present invention . this operation is the embedding process for the measurement routine in compiling the source program 40 . at first , the compiler 30 sets one of the statements of the source program 40 that as the first examination target of the performance analysis , in the compiling process of the source program 40 , and then starts the examination ( step s 201 ). next , the compiler 30 judges whether or not the examination of all the statements is ended . here , the all the statements are included in the source program 40 that is the examination target ( step s 202 ). based on the judgment result , if the examination of all of the statements has been ended ( step s 202 : yes ), the compiler 30 ends this process . based on the judgment result , if the examination of all the statements is not ended ( step s 202 : no ), next , the compiler 30 calls the procedure judging unit 31 . the procedure judging unit 31 judges whether or not the statement under the examination is the procedure ( the subroutine or function ) ( step s 203 ). if the procedure judging unit 31 judges that the statement is the subroutine or function , the compiler 30 uses the measurement routine embedding unit 32 and executes embedding the measurement routine ( step s 204 ). after the execution of the measurement routine embedding at the step s 204 , the compiler 30 uses the time measurement command embedding unit 33 and executes the embedding the time measurement command ( step s 205 ). finally , the compiler 30 executes a process for advancing the statement of the examination target by one ( step s 206 ). after that , the compiler 30 returns to the process for judging whether or not all the statements have been examined ( step s 202 ). fig3 is a flowchart showing the operation of the step s 203 of the procedure judgment process . in the procedure judgment process , the procedure judging unit 31 judges whether or not the statement under the process is the subroutine or function ( step s 301 ). based on the judgement result , if the statement under the process is the subroutine or function , the procedure judging unit 31 returns a value indicating a key word “ yes ” as a return value ( step s 302 ). based on the judgement result , if the statement is not the subroutine nor function , the procedure judging unit 31 returns a value indicating a key word “ no ” as the return value ( step s 303 ). fig4 is a flowchart showing the operation of the step s 204 of the measurement routine embedding process . at first , the measurement routine embedding unit 32 embeds the call statement for calling the measurement start routine , into the head of the procedure under the process ( step s 401 ). then , the measurement routine embedding unit 32 embeds the call statement for calling the measurement end routine , into the end portion of the procedure under the process ( step s 402 ). fig5 is a flowchart showing an operation of the step s 205 of the time measurement command embedding process . at first , the time measurement command embedding unit 33 embeds the time measurement command before and after the call statement for calling the measurement start routine ( step s 501 ). then , the time measurement command embedding unit 33 embeds the time measurement command before and after the call statement for calling the measurement end routine ( step s 502 ). next , the embodiment of the performance analysis program of the present invention will be described below by comparing the flowchart with that of the conventional performance analysis program . here , as an example , both of the conventional and the present invention &# 39 ; s performance analysis program are executed on the information processor 100 having the cpu 10 . in this case , cpu 10 executes the performance analysis program . however , the this execution environment is only the example for the explanation . actually , the execution environment of the performance analysis program in the present invention is not limited to on the above - mentioned information processor . at first , the conventional performance analysis program will be described below . fig6 is an example of the flowchart showing the conventional performance analysis program . in the conventional performance analysis program , if the call for the measurement routine is carried out during the execution of a original function , it proceeds to the process for the measurement routine ( step s 601 ). when the process for the measurement routine is started , the prologue process is executed based on the linkage rule ( step s 602 ). here , the prologue process is exemplified by the reservation of a stack region and the saving of data in registers . the conventional performance analysis program is the method such that the time measurement is ended after the execution of the prologue process for the measurement routine . the time obtainment command is executed , and then , the time measurement is ended ( step s 603 ). incidentally , if the measurement routine under the execution is the measurement start routine , this corresponds to the process for ending the time measurement with regard to the original functions executed between the portion immediately before the epilogue process of the last measurement end routine and the portion immediately after the prologue process of the measurement start routine . if the measurement routine under the execution is the measurement end routine , this corresponds to the process for ending the time measurement with regard to the subroutines executed between the portion immediately before the epilogue process of the last measurement start routine and the portion immediately after the prologue process of the measurement end routine . after the time measurement is ended , the process for specifying the original function , which calls the measurement routine under the execution , is executed ( step s 604 ). by specifying the function , it is possible to relate the function to the result of the performance analysis , to collect the performance data for each function and to manage the performance data through table storage . after the original function is specified , the calculation of the performance analysis and the other processes are executed ( step s 605 ). in the conventional performance analysis program , after the execution of the above - mentioned and other processes , the time measurement is started . here , this executes the time obtainment command and starts the time measurement ( step s 606 ). incidentally , if the measurement routine under the execution is the measurement start routine , this corresponds to the process for starting the time measurement with regard to the subroutines to be executed between the portion immediately before the epilogue process for the measurement start routine and the portion immediately after the prologue process of the measurement end routine . if the measurement routine under the execution is the measurement end routine , this corresponds to the process for starting the time measurement with regard to the original functions to be executed between the portion immediately before the epilogue process for the measurement end routine and the portion immediately after the prologue process of a next measurement start routine . after the start of the time measurement , the epilogue process based on the linkage rule is executed ( step s 607 ). here , the epilogue process is exemplified by the open of the stack and the recovery of the register data . when the measurement routine is ended , among the values obtained from the process for the measurement routine , the value required from the original function and the value necessary for the performance analysis process are returned as the return value ( step s 608 ). after the measurement routine is ended , the execution of the original function is resumed ( step s 609 ). incidentally , if the process for again calling the measurement routine is executed during the execution of the original function , it proceeds to the process at the step s 601 . in the conventional performance analysis program , the measurement time is measured through the above process . however , there is a problem that in the measurement routine , a cache miss and a branch prediction miss are generated which results in the fluctuation in the execution time for each execution . the cache miss implies the fact that a desirable data cannot be found out in spite of the access to a cache in which data is a transiently stored . next , the performance analysis program of the present invention will be described below . fig7 is an example of the flowchart showing the performance analysis program of the present invention . the performance analysis program of the present invention is the method such that the time measurement is ended immediately before the measurement routine is called . then , the time obtainment command is executed , and the time measurement is ended ( step s 701 ). incidentally , if the measurement routine under the execution is the measurement start routine , this corresponds to the process for ending the time measurement with regard to the original function executed between the portion immediately after the end of the last measurement end routine and the portion immediately before the start of the measurement start routine . if the measurement routine under the execution is the measurement end routine , this corresponds to the process for ending the time measurement with regard to the subroutine executed between the portion immediately after the end of the last measurement start routine and the portion immediately before the start of the measurement end routine . in the performance analysis program of the present invention , after the process for ending the time measurement , the call for the measurement routine is executed ( step s 702 ). thus , the measurement routine is called , and the process for the measurement routine is started . when the process for the measurement routine is started , the prologue process is executed based on the linkage rule ( step s 703 ). the prologue process is exemplified by the reservation of the stack region and the saving of data in the registers . the process for specifying the original function , which calls the measurement routine under the execution , is executed ( step s 704 ). by specifying the function , it is possible to relate the function to the result of the performance analysis , to collect the performance data for each function and to manage the performance data through the table storage . after the original function is specified , the calculation of the performance analysis and the other processes are executed ( step s 705 ). after the start of the time measurement , the epilogue process is executed based on the linkage rule ( step s 706 ). the epilogue process is exemplified by the open of the stack and the recovery of the register data . when the measurement routine is ended , among the values obtained from the process for the measurement routine , the value required from the original function and the value necessary for the performance analyzing process are returned as the return value ( step s 707 ). after the measurement routine is ended , the execution of the original function is resumed ( step s 708 ). in the performance analysis program of the present invention , after the resumption of the execution of the original function , the time measurement is started . here , the time obtainment command is executed , and the time measurement is started ( step s 709 ). the present invention can reduce the error in the time which exists between the time measurement command and the call for the measurement routine in the conventional process , by carrying out the partial in - line process of the time measurement in immediately before or immediately after the call statement for calling the measurement routine . fig8 is an example of the conventional performance analysis program . fig9 is an example of the performance analysis program of the present invention . in fig8 , “ call measuring_start ( )” is the call statement for calling the measurement start routine , and “ call measuring_end ( )” is the call statement for calling the measurement end routine . “ subroutine measuring_start ” is the measurement start routine . “ subroutine measuring_end ” is the measurement end routine . in the conventional performance analysis program , the time obtainment command is executed immediately after the prologue process within the routine and immediately before the epilogue process , in both of the measurement start routine and the measurement end routine . similarly to the case of fig8 , in fig9 , “ call measuring_start ( )” is also the call statement for calling the measurement start routine , “ call measuring_end ( ) ” is also the call statement for calling the measurement end routine , “ subroutine measuring_start ” is the measurement start routine , and “ subroutine measuring_end ” is the measurement end routine . in the performance analysis program of the present invention , the time obtainment command is executed before and after the call for the measurement start routine and before and after the call for the measurement end routine . in the conventional method , as shown in fig8 , the time measurement command is executed after the prologue process of the measurement routine and before the epilogue process . thus , the variation time generated at the prologue process and epilogue process cannot be accurately reflected in the measurement time . on the other hand , in the method of the present invention , as shown in fig9 , the time measurement command is inserted before and after the call statement of the measurement start routine for the performance analysis , and the time measurement command is further inserted before and after the call statement of the measurement end routine . then , by measuring the time except the time required for the prologue process and epilogue process , it is possible to attain the more precise performance analysis . the present invention , since executing the time measurement command before the call for the measurement routine , solves the problem where if the number of the calls for the measurement routine is great , the difference between the actual execution time and the measurement time becomes great , which has the severe influence on the performance analysis . also , using the present invention solves the variation time in the execution of the prologue process and the epilogue process , which cannot be conventionally analyzed , and improves so as to carry out the performance analysis more precisely . in the conventional time measuring method , the variation time included in the measurement of the execution time with regard to the subroutine or function in which the number of the call times is great becomes great , and there is the problem of a precision . however , with the application of this method , the variation time is not measured , which enables the time to be measured more precisely . that is , the time measurement command is inserted before and after a measurement start routine call statement for the performance analysis , and the time measurement command is further inserted before and after a measurement end routine call statement . thus , the more precise performance analysis becomes possible by measuring the time except the time necessary for the prologue process and epilogue process . also , according to the present invention , it can be applied to the use field for examining which of the subroutines or functions is a bottleneck in carrying out a performance tuning of a computer program . it is apparent that the present invention is not limited to the above embodiment , that may be modified and changed without departing form the scope and spirit of the invention . | 6 |
the wet - comminuted reaction mixture is fed to the two - stage washing with a residual moisture content of at least 1 % by weight , preferably at least 2 % by weight , more preferably at least 3 % by weight , even more preferably at least 4 % by weight , and most preferably at least 5 % by weight . examples of suitable aromatic dihalogen compounds are 4 , 4 ′- difluorobenzophenone , 4 , 4 ′- dichlorobenzophenone , 4 , 4 ′- dichlorodiphenyl sulfone , 4 , 4 - difluorodiphenyl sulfone , 1 , 4 - bis ( 4 - fluorobenzoyl ) benzene , 1 , 4 - bis ( 4 - chlorobenzoyl ) benzene , 4 chloro - 4 ′- fluorobenzophenone and 4 , 4 ′- bis ( 4 - fluorobenzoyl ) biphenyl . the halogen group is generally activated by a para - carbonyl or sulfonyl group . in the case of a para - carbonyl group , the halogen is chlorine or preferably fluorine ; in the case of a para - sulfonyl group , the halogen may be fluorine or chlorine , although the preferred halogen here is generally chlorine owing to sufficient reactivity and lower costs . it is also possible to use mixtures of different dihalogen compounds . examples of suitable bisphenols are hydroquinone , 4 , 4 ′- dihydroxybenzophenone , 4 , 4 ′- dihydroxydiphenyl sulfone , 2 , 2 ′- bis ( 4 - hydroxyphenyl ) propane , 4 , 4 ′- dihydroxybiphenyl , bis ( 4 - hydroxyphenyl ) ether , bis ( 4 - hydroxyphenyl ) thioether , bis ( 4 - hydroxynaphthyl ) ether , 1 , 4 -, 1 , 5 - or 2 , 6 - dihydroxynaphthalene , 1 , 4 - bis ( 4 - hydroxybenzoyl ) benzene , 4 , 4 ′- bis ( 4 - hydroxybenzoyl ) biphenyl , 4 , 4 ′- bis ( 4 - hydroxybenzoyl ) diphenyl ether or 4 , 4 - bis ( 4 - hydroxybenzoyl ) diphenyl thioether . it will be appreciated that it is also possible to use mixtures of different bisphenols . examples of suitable halophenols are 4 -( 4 ′- chlorobenzoyl ) phenol and 4 -( 4 ′- fluorobenzoyl ) phenol . with regard to the selection of the halogen , the same criteria apply as for the dihalogen compounds . it will be appreciated that it is also possible to use mixtures of different halophenols or mixtures of halophenols with a 1 : 1 mixture of aromatic dihalogen compound and bisphenol . suitable alkali metal and alkaline earth metal carbonates and hydrogencarbonates derive from lithium , sodium , potassium , rubidium , cesium , magnesium , calcium , strontium or barium . typically , in accordance with the prior art , a mixture of sodium carbonate and potassium carbonate is used . according to the prior art , the high - boiling aprotic solvent is preferably a compound of the formula where t is a direct bond , one oxygen atom or two hydrogen atoms ; z and z ′ are each hydrogen or phenyl groups . it is preferably diphenyl sulfone . where ar and ar ′ are each a divalent aromatic radical , preferably 1 , 4 - phenylene , 4 , 4 ′- biphenylene , and 1 , 4 -, 1 , 5 - or 2 , 6 - naphthylene . x is an electron - withdrawing group , preferably carbonyl or sulfonyl , while y is another group , such as o , s , ch 2 , isopropylidene or the like . in this case , at least 50 %, preferably at least 70 % and more preferably at least 80 % of the x groups should be a carbonyl group , while at least 50 %, preferably at least 70 % and more preferably at least 80 % of the y groups should consist of oxygen . in the especially preferred embodiment , 100 % of the x groups consist of carbonyl groups and 100 % of the y groups of oxygen . in this embodiment , the paek may , for example , be a polyether ether ketone ( peek ; formula i ), a polyether ketone ( pek ; formula ii ), a polyether ketone ketone ( pekk ; formula iii ) or a polyether ether ketone ketone ( peekk ; formula iv ), but other arrangements of the carbonyl and oxygen groups are of course also within the terms of the embodiments of the invention . the paek is generally partly crystalline , which is manifested , for example , by finding , in the dsc analysis , a crystal melting point t m which in most cases is in the order of magnitude of around 300 ° c . or higher . however , the teaching of the invention can also be applied to amorphous paek . in general , it is the case that sulfonyl groups , biphenylene groups , naphthylene groups or bulky y groups , for example an isopropylidene group , reduce crystallinity . owing to the given reactivity of the functional groups and the low solubility of the paek at relatively low temperatures , the reaction is typically carried out within the temperature range from approximately 200 to 400 ° c ., preference being given to the range from approximately 250 to 350 ° c . further details of the performance of the reaction can be taken from the abovementioned prior art . after performing the reaction , the reaction mixture is discharged from the reactor . the discharged reaction mixture is cooled with sprayed and / or flowing water and , after solidifying , transferred in water - moist form into a comminution apparatus . this may , for example , be a breaker , a crusher , a mill or a dispersion unit . the breakers , crushers , mills and dispersion units used may be all of those which are known to the person skilled in the art ; for example , reference is made to vauck / müller , grundoperationen chemischer verfahrenstechnik [ basic operations of chemical process technology ], 10th edition , chapter 5 . 1 . ( zerkleinern [ comminution ]), deutscher verlag für grundstoffindustrie , leipzig 1994 . for example , it is possible to use jaw crushers , round crushers , roll crushers or impact crushers for a comminution to diameter from about 0 . 5 to 50 mm , or impact mills , roll mills , hammer mills , ball mills , vibratory mills , cutting mills or jet mills or dispersion units for a comminution to from about 50 to 500 μm . the comminuted water - moist reactor effluent is optionally subsequently initially dried , for example by pressing , centrifugation , washing off some of the residual moisture with , for example , ethanol or with the aid of another suitable measure , and brought to the residual moisture content according to the embodiments of the present invention . subsequently , it is fed to the two - stage wash process . appropriately , the upper limit for the residual moisture content is 30 % by weight , 25 % by weight , 15 % by weight , 12 % by weight or 10 % by weight . in both stages of the two - stage wash process , it is possible to wash either batchwise in a stirred tank or in a stirred suction filter ( referred to hereinafter as “ slurry washing ”) or continuously in the form of a drainage wash , a compact filter cake being flowed through continuously by a solvent . in the first stage , an organic solvent , for example acetone , methyl ethyl ketone , methyl isobutyl ketone , methanol , ethanol , isopropanol , n - or iso - butanol , 2 methoxyethanol , 1 , 2 - dimethoxyethane , tetrahydrofuran , ethyl acetate , benzene , toluene , xylene and mixtures thereof is used for washing . however , it is also possible in principle to use any other suitable organic solvent . in the second stage , water is used for washing , in order to remove the salts . if washing is effected batchwise in one or in both stages , the washing is carried out from approximately 5 to 15 times in total in each case . when fewer wash steps are carried out , the purification of the product may be insufficient . when , in contrast , more washing steps are carried out , the process overall becomes very costly and inconvenient . if washing is effected at relatively high temperature under pressure , however , only a few wash steps , for example 1 , 2 , 3 or 4 wash steps , may be sufficient . according to the prior art , the water wash may include a wash with a dilute acid , for instance hydrochloric acid , sulfuric acid , orthophosphoric acid or in particular pyrophosphoric acid , polyphosphoric acid , metaphosphoric acid or phosphonic acid ( de 42 07 555 a1 ). the acid is used here in a concentration of from approximately 0 . 1 to 5 % by weight . in addition to an extraction of inorganic constituents improved even further , this achieves improved melt stability of the paek . after the wash , the paek is dried . it can then be used directly in this form , for example as a coating material , but it may also be granulated and , if desired , processed to compounds by addition of further substances , such as fillers , pigments , stabilizers , other polymers , processing assistants and the like . suitable compounds , their production and use are known to those skilled in the art . the paek obtained in accordance with the invention features a particularly low content of inorganic constituents and solvent residues . it is suitable particularly for end uses in the electronics industry , and also wherever the surface quality of moldings plays a role . the invention will be illustrated by way of examples hereinafter , although the invention is not intended to be limited to the examples . at 60 ° c ., 69 . 2 g of diphenyl sulfone , 26 . 2 kg of 4 , 4 ′- difluorobenzophenone , 13 . 2 kg of hydroquinone , 13 . 2 kg of sodium carbonate and 640 g of potassium carbonate are added successively in solid form in a jacketed reactor . the reactor was closed and inertized with nitrogen . once the jacket temperature had attained 160 ° c ., the stirrer was switched on at 50 rpm . once the internal temperature had likewise attained 160 ° c ., the reactor was heated slowly to 320 ° c . the reaction profile was observed via the torque which was determined from the power consumption by the stirrer motor . the torque rose after approximately 6 hours and , after a further about 2 hours , oscillated at a constant range approximately 55 % above the starting level . the product was discharged , cooled with water and comminuted in a crusher . the residual moisture content in the comminuted reactor effluent was approximately 20 % by weight . 5 kg of the comminuted , water - moist reactor effluent obtained above were dried to constant mass in a vacuum drying cabinet at 100 ° c . and approximately 100 mbar for 12 hours . thereafter , the dried reactor effluent was transferred into a stirred suction filter , and subjected to two - stage washing ten times with 15 liters each time of ethanol ( in each case 1 hour at 75 ° c .) and then ten times with 15 liters each time of deionized water ( in each case 1 hour at 95 ° c .). the fourth of the 10 water washes was carried out here with 15 liters of 0 . 5 % aqueous orthophosphoric acid . the resulting purified peek was dried and analyzed for the impurities with aas ( atomic absorption spectroscopy ), icp - oes ( inductively coupled plasma - optical emission spectroscopy ) and elemental analysis . 5 kg of the comminuted , water - moist reactor effluent obtained above were dried to constant mass in a vacuum cabinet at 100 ° c . and approximately 100 mbar for 12 hours . thereafter , the dried reactor effluent was transferred to a stirred suction filter . ethanol was introduced into the suction filter from the top ; the suspension was stirred at room temperature for 15 minutes . once the solid had settled out again , a total of 150 liters of ethanol were passed through the solid at 75 ° c . within 8 hours . once this first drainage wash with ethanol had been completed , the procedure was repeated with water . in this case , water was introduced into the suction filter from the top and the suspension was stirred at 40 ° c . for 15 minutes . once the solid had settled out again , first 75 liters of deionized water , then 10 liters of 0 . 5 % aqueous orthophosphoric acid and then a further 75 liters of deionized water without interruption of the elution stream were passed through the solid at 95 ° c . within a total of 9 hours . the resulting purified peek was dried and analyzed for the impurities with aas , icp - oes and elemental analysis . 5 kg of the comminuted , water - moist reactor effluent obtained above were dewatered in a centrifuge at 1000 rpm . the residual moisture content after centrifugation was approximately 5 % by weight . thereafter , the dried reactor effluent was transferred into a stirred suction filter , and subjected to two - stage washing ten times with 15 liters each time of ethanol ( in each case 1 hour at 75 ° c .) and then ten times with 15 liters each time of deionized water ( in each case 1 hour at 95 ° c .). the fourth of the 10 water washes was carried out here with 15 liters of 0 . 5 % aqueous orthophosphoric acid . the resulting purified peek was dried and analyzed for the impurities with aas , icp - oes and elemental analysis . 5 kg of the comminuted , water - moist reactor effluent obtained above were dewatered in a centrifuge at 1000 rpm . the residual moisture content after centrifugation was approximately 5 % by weight . thereafter , the dried reactor effluent was transferred to a stirred suction filter . ethanol was introduced into the suction filter from the top ; the suspension was stirred at room temperature for 15 minutes . once the solid had settled out again , a total of 150 liters of ethanol were passed through the solid at 75 ° c . within 8 hours . once this first drainage wash with ethanol had been completed , the procedure was repeated with water . in this case , water was introduced into the suction filter from the top and the suspension was stirred at 40 ° c . for 15 minutes . once the solid had settled out again , first 75 liters of deionized water , then 10 liters of 0 . 5 % orthophosphoric acid and then a further 75 liters of deionized water without interruption of the elution stream were passed through the solid at 95 ° c . within a total of 9 hours . the resulting purified peek was dried and analyzed for the impurities with aas , icp - oes and elemental analysis . 5 kg of the comminuted , water - moist reactor effluent obtained above were transferred into a suction filter and 10 liters of ethanol were poured over it , which for the most part washed off the surface moisture . subsequently , the further procedure of example 1 was followed . the resulting purified peek was dried and analyzed for the impurities with aas , icp - oes and elemental analysis . 5 kg of the comminuted , water - moist reactor effluent obtained above were transferred into a suction filter and 10 liters of ethanol were poured over it , which for the most part washed off the surface moisture . subsequently , the further procedure of example 2 was followed . the resulting purified peek was dried and analyzed for the impurities with aas , icp - oes and elemental analysis . the entire disclosure in german priority application de 10 2006 022 442 . 6 , filed may 13 , 2006 , is hereby incorporated by reference . | 2 |
the instant invention addresses the large scale cultivation of cells for the propagation of viruses , especially recombinant viruses for gene therapy , vaccine production , and so on . in particular , the instant invention addresses three aspects of large scale cultivation ; the use of bead - to - bead transfer of adherent cells to sequentially scale up the number of cells in culture , including the use of trypsin to dissociate cells from microcarriers in bioreactors , the use of fluidized bed - like separation of cells from the beads during harvest , and the use of microfiltration to disrupt cells so as to liberate virus particles . the term “ virus ” as used herein includes not only naturally occurring viruses but also recombinant viruses , attenuated viruses , vaccine strains , and so on . recombinant viruses include but are not limited to viral vectors comprising a heterologous gene . in some embodiments , a helper function ( s ) for replication of the viruses is provided by the host cell , a helper virus , or a helper plasmid . representative vectors include but are not limited to those that will infect mammalian cells , especially human cells , and can be derived from viruses such as retroviruses , adenoviruses , adeno - associated viruses , herpes viruses , and avipox viruses . adenoviral vectors are preferred . type 2 and type 5 adenoviral vectors are more preferred , with type 5 adenoviral vectors being especially preferred acn53 is a recombinant adenovirus type 5 encoding the human wild - type p53 tumor - suppressor protein and is described , for example , in published pct international patent application wo 95 / 11984 . as used herein , the term “ confluent ” indicates that the cells have formed a coherent monocellular layer on the surface ( e . g ., of the microcarrier ), so that virtually all the available surface is used . for example , “ confluent ” has been defined ( r . i . freshney , culture of animal cells — a manual of basic techniques , wiley - liss , inc . new york , n . y ., 1994 , p . 363 ) as the situation where “ all cells are in contact all around their periphery with other cells and no available substrate is left uncovered ”. for purposes of the present invention , the term “ substantially confluent ” indicates that the cells are in general contact on the surface , even though interstices may remain , such that over about 70 %, preferably over about 90 %, of the available surface is used . here , “ available surface ” means sufficient surface area to accommodate a cell . thus , small interstices between adjacent cells that cannot accommodate an additional cell do not constitute “ available surface ”. the cultivation steps in the methods of the present invention can be carried out in a bioreactor or fermentor known in the art of about 1 to 5000 l equipped with appropriate inlets for introducing the cells and microcarriers , sterile oxygen , various media for cultivation , etc . ; outlets for removing cells , microcarriers and media ; and means for agitating the culture medium in the bioreactor , preferably a spin filter ( which also functions as an outlet for media ). exemplary media are disclosed in the art ; see , for example , freshney , culture of animal cells — a manual of basic techniques , wiley - liss , inc . new york , n . y ., 1994 , pp . 82 - 100 . the bioreactor will also have means for controlling the temperature and preferably means for electronically monitoring and controlling the functions of the bioreactor . exemplary microcarriers on which the cells are allowed to grow are known in the art and are preferably specially adapted for the purpose of cell cultivation . general reference is made to the handbook microcarrier cell culture — principles & amp ; methods , published by pharmacia . however , it should be noted that some cell lines used in the present invention may not adhere strongly to the surfaces of microcarriers ; it is well within the ability of one of ordinary skill in the art to determine a suitable combination of cell line , virus ( where applicable ), microcarrier and culture conditions . the microcarrier preferably has a particle size in the range of about 100 to 250 microns , more preferably in the range of about 130 to 220 microns , and should be composed of a non - toxic material . the median of the sample size preferably falls in these ranges , such that these size ranges are preferably those of at least the middle 90 % of the microcarrier sample . in a preferred embodiment , the microcarrier consists of substantially spherical microbeads with a median particle size of about 150 to 200 microns , preferably 170 to 180 microns . the microcarrier surface may be treated to modify cell adhesion , in particular to enhance cell adhesion yet permit proliferation and spreading ; thus the microcarriers may be coated , e . g ., with collagen . preferably , the microcarriers are slightly denser than the culture medium , so that gentle agitation will keep them in suspension , whereas simple means such as sedimentation or centrifugation allows their separation . a density of 1 . 03 to 1 . 045 g / ml when the microcarriers are equilibrated with a standard solution such as 0 . 9 % nacl ( or with the culture medium ) is suitable . the present inventors have found that pharmacia &# 39 ; s cytodex - 3 microcarriers in general will meet these requirements , although the particular requirements that apply for certain cell lines or viruses may require the selection of a particular cytodex microcarrier . the cells may be those of any suitable host cell line that is able to replicate itself and in particular support the replication of the virus of interest . a particularly preferred cell line is the human embryonic kidney cell line 293 ( atcc catalog number crl 1573 ). these cells do not adhere strongly to all microcarriers , and are preferably used with pharmacia &# 39 ; s cytodex - 3 microcarriers , which are collagen - coated for better cell adhesion . cytodex - 3 microcarriers have a median particle size of about 175 microns with the middle 90 % of the sample having a size of about 140 to 210 microns ; the density of such microcarriers when equilibrated with 0 . 9 % nacl is 1 . 04 g / ml . the cells are preferably cultivated on such a microcarrier in a first step , and then loosened therefrom and transferred to additional microcarriers for a production step . stirring can conveniently be effected not only by a paddle at the bottom of the bioreactor but also by a rotating spinfilter , which preferably extends downwards from the top of the bioreactor into the bulk of the medium . the cells and microcarriers can be kept in suspension in the culture by rotation of the spinfilter ; the spinfilter may also be equipped with fine orifices that permit the removal of medium without loss of cells . the medium can be removed and replaced simultaneously or alternately ; it is frequently convenient to remove a substantial fraction ( e . g ., up to about 50 %) of the medium and then replenish it with the appropriate replacement medium while still removing medium , e . g ., through the spinfilter . typically , cells are scaled - up from a master working cell bank vial through various sizes of t - flasks , and , preferably , finally to bioreactors . a preferred flask is the cell factory ™ tissue culture flask ( cf ; nunc ), a specially designed large flask that conveniently has several internal compartments providing a large surface area to which the cells can adhere or attach and on which they can grow . after cultivation until substantially confluent , the cells can be loosened by trypsinization and isolated . the trypsinization is effected for a short period ( preferably less than 5 minutes , more preferably about 3 minutes ), and the trypsin is then neutralized by the rapid addition of serum in growth medium . if desired , the cells can be centrifuged and the trypsin - containing medium removed before the serum is added . the resulting cell suspension is then typically fed into a seed production bioreactor ( typically 20 - 30 l volume ) for further cultivation , and in some embodiments , to a larger production bioreactor ( typically 150 - 180 l volume ). the ratio of volume of the second ( larger ) bioreactor to the seed bioreactor depends upon the degree to which the cell line is propagated in the first bioreactor , but is typically from 5 : 1 to 10 : 1 , e . g ., in the range of ( 6 - 8 ): 1 . cells are detached from microcarriers by a trypsinization procedure performed in the cultivation vessel , preferably a bioreactor , while the microcarriers are suspended . the spinfilter is utilized to perform medium exchanges to reduce the serum and calcium levels in the medium , which increases the efficiency of the trypsinization while maintaining a constant volume in the bioreactor . settling steps are avoided which might cause damage to the cells on the microcarriers . the resultant cell / microcarrier suspension can then be transferred to a production bioreactor which is previously charged with culture media and microcarriers . after the transfer of cell / microcarrier suspension from the seed bioreactor , the production bioreactor ( for example , about 200 l ) is operated , e . g ., at about 37 ° c . and about ph 7 . 3 . a perfusion of fresh medium during cell propagation can then be performed in order to maintain the lactate concentration below about 1 . 0 g / l . cells are typically allowed to grow on the microcarriers for about 4 to 7 days until more than 50 % of the microcarriers are completely confluent . preferably , a virus infection process is then initiated . a vial of 40 to 50 ml viral inoculum , typically containing approximately 1 . 0 × 10 13 total viral particles is used to infect the production bioreactor . virus is allowed to replicate in the production bioreactor for about 3 to 5 days until about the time of maximum virus titer . typically , more than 90 % of cells will have detached from the microcarriers due to cytopathic effects of the virus . the final recombinant adenovirus yield from the production bioreactor is typically about 8 . 5 × 10 9 viral particles / ml . this gives a total yield of viral particles of 1 . 4 × 10 15 from each 160 - l batch . in other embodiments of the invention , the production bioreactor is inoculated with cells harvested by trypsinization and then used directly to inoculate the production bioreactor . typically 8 to 12 cell factory ™ tissue culture flasks are utilized to achieve the overall bioreactor inoculum seeding density of 0 . 6 to 1 × 10 5 cells / ml . the typical virus yield in this method ranges from about 1 . 7 to 2 . 6 × 10 10 viral particles / ml . therefore , this particular method provides a total virus particle number of about 3 to 4 × 10 15 from each 160 l batch . in some embodiments of the invention , a fluidized bed - like process is used to harvest the cells from the bioreactor . typically , the bioreactor is harvested after about 90 % of the cells detach from the microcarriers . without being limited to any one theory , the cytopathic effect of viral propagation in the host cells appears to be responsible for the cell detachment . in other embodiments , uninfected cells can be detached from microcarriers by the trypsinization method of the instant invention . after the bioreactor is harvested , the broth contains cells , microcarriers and medium . virus is present in the cells and the medium . therefore , all of this material is preferably collected for processing . the specific gravity ( density ) of the microcarriers is similar to that of the cells . preferably , the microcarriers are kept freely suspended while separating the cells from the beads , as processing steps using sedimentation causes the cells to settle with the microcarriers , which results in recovery losses . a preferred embodiment of a separation device is provided in fig1 and 2 . in some embodiments of the invention , the separation device is provided as part of a system . an exemplary system is depicted in fig2 . the system thus comprises a bioreactor 100 in which the cells are cultivated on microcarriers ; a flow path 102 from the bioreactor to the separation device 104 ; the separation device comprising a column 106 ; an outlet 108 for the collection of cells and the aqueous solution ; and a mesh screen 110 . the microcarriers are retained in suspension by an upward flow in the separation device and are retained in the separation device by the mesh screen , and the cells and aqueous solution are collected through the outlet . also provided in the system is a pump 112 , wherein the pump directs the flow of the aqueous solution from the bioreactor to the outlet . in some embodiments , a microfilter 114 and an ultrafilter 116 may be provided as components of the system . in the embodiment shown in fig1 the separation device typically comprises a column 106 , such as a chromatography column , having an inlet 114 through which an aqueous suspension of cells and microcarriers from a bioreactor 100 is introduced into the separation device 104 ; and at least one outlet 108 for the collection of cells and the aqueous solution ; and a mesh screen 110 . the microcarriers are retained in suspension in the column by an upward flow in the separation device and are retained in the separation device by a mesh screen , and wherein the cells and aqueous solution are collected through the outlet . the flow rate in the separation device is about 1 to about 3 cm / min . typically , an upward flow through the column is generated by pumping an aqueous solution , such as the cell suspension or a buffer , through the inlet , wherein the inlet is situated at the bottom of the device and the outlet is situated at the top of the device . fig2 is an expanded schematic view of a separation device 200 , depicting in more detail an outlet assembly 210 , a mesh screen assembly 212 , an inlet 214 , and a column 216 having an upper section 218 and a lower section 220 . the lower section typically comprises about 20 to 50 %, more preferably about 30 %, of the volume of the column and contains the inlet . the lower section is preferably conical , with a preferred angle of about 15 to about 45 degrees . thus , the fermentation broth from the bioreactor is pumped into the base of the column . the flow rate is regulated to provide an upward flow sufficient to keep the cells and viral particles suspended in the medium while allowing for the retention of the microcarriers within the separation device . preferably , the flow rate is approximately 1 - 2 cm / min since the cells have a specific gravity similar to that of the microcarriers . the clarified broth containing cells and virus passes through the mesh screen on the upper end of the fluidized bed - like column and is collected for microfiltration . for a 200 l scale device , the lower section of the column preferably is conical . the cone allows for a gradual reduction of the linear velocity of the fermentation broth entering the cone . the fluid velocity of the inlet line is reduced to achieve a reduced linear flow in a uniform distribution across the cross sectional area at the upper end of the cone . the walls of the cone are at an angle which allows the beads that settle on the walls to move downward to the inlet . in this way , these beads are resuspended to avoid entrapment of the cells between the settled beads . the angle of the conical walls is preferably about 30 degrees . angles less than 15 degrees provide an exceptionally long cone and angles greater than approximately 45 degrees may not disperse the inlet feed effectively . the upper section of the column functions as a zone in which the beads settle at a rate greater than the linear flow rate of the fermentation medium . this section of the column is cylindrical in shape . within this zone a boundary is formed such that the microcarriers accumulate in the lower region of the column . an end plate assembly 222 ( fig2 ) of the column functions as a collection point for the clarified fermentation media containing cells and virus . this consists of an end plate 224 fitted with a mesh screen assembly . this screen , preferably about 50 to 120 mesh , more preferably about 100 mesh , functions as a second point for removal of the microcarriers . the above - described embodiment is the preferred embodiment used in the examples herein . the column dimensions and screen mesh may be varied based upon the volume of solution to be processed , the concentration of beads , the particular microcarrier used and the media formulation ( e . g ., specific gravity of media ). a preferred column consists of a bottom cone custom fabricated out of stainless steel to be attached to two pharmacia ks370 section tubes fitted with a ks370 end assembly to which the vendor screen was replaced with a stainless steel ( ss ) mesh ( preferably about 50 to 120 mesh , more preferably about 100 mesh ). after the cells are collected , they are preferably lysed to liberate additional virus particles . homogenization or freeze - thawing may be used to liberate the virus particles . in a preferred embodiment of the invention , microfiltration is used to simultaneously lyse virus - containing cells and clarify the broth of cell debris which would otherwise interfere with viral purification . for example , the microfiltration can be performed using a prostak ( millipore ) system with a 0 . 65 micron , hydrophilic or hydrophobic membrane and at a shear rate of 7000 l / sec . the shear rate is generated by the flow of retentate through the tangential flow channels of the membrane . therefore , the cross - flow is used not only to prevent the membrane from fouling but can also be used to create enough shear for lysing the cells . the pore size of the filter should be sufficient to allow passage of virus while retaining cell debris . thus , typically the pore size range is about 0 . 2 - 0 . 65 micron . the shear rate range is typically about 2000 to 10 , 000 l / sec , more preferably about 7000 l / sec . typically , benzonase ™ endonuclease ( american international chemical , inc .) is added to the clarified broth to digest cellular nucleic acids , as viral particles can become complexed with cellular nucleic acids . in a preferred embodiment , ultrafiltration using a pellicon system ( millipore ) with a 1 million nominal molecular weight cut - off , pellicon i - regenerated cellulose membrane is used to concentrate the virus . the ultrafiltration step accomplishes two functions ; the virus is concentrated for purification and diafiltration is performed to exchange the buffer so that the virus suspension can be applied directly to a deae column . the eluate from the microfilter contains the liberated virus and is preferably concentrated e . g ., by ultrafiltration . between each cultivation step , the cells can be loosened and stripped from the microcarrier by trypsinization , e . g ., by treatment with trypsin . in the present invention it is preferred to remove the serum used in the cultivation , since the serum proteins inhibit the trypsin ; removal of the serum therefore allows a smaller amount of trypsin to be used . this is advantageous since addition of a larger amount may cause localized high concentrations of trypsin that could damage the cells . with regard to the next step , ca ++ ions are removed since the removal of these ions from the cells tends to loosen the cells and enables one to use less - trypsin . thus , loosening and stripping cells , especially of the human embryonic kidney cell line 293 , can conveniently include the following steps : i ) rapidly washing the cells to remove serum and other soluble materials ; ( ii ) removing ca ++ from the washed cells by adding a chelating agent ; ( v ) trypsinizing the cells for a short period of time ( preferably ranging from about 3 minutes to about 15 minutes ); and in step ( i ) above , the phrase “ rapidly washing ” means at a constant bioreactor volume perfusing one volume change of medium at a rate of about 1 - 3 liters per minute , more preferably about 2 liters per minute . in step ( iii ) above , the phrase “ rapidly removing the chelating agent ” means at a constant bioreactor volume perfusing one and a half volume changes of medium at a rate of about 1 - 3 liters per minute , more preferably about 2 liters per minute . in step ( iv ) above , the phrase “ rapidly adding trypsin ” means adding the appropriate volume of trypsin solution ( typically a 2 . 50 % solution ) at a rate of about 1 - 3 liters per minute , more preferably about 2 liters per minute . in step ( vi ) above the phrase “ rapidly neutralizing the trypsin by adding serum ” means adding the appropriate volume of serum at a rate of about 1 - 3 liters per minute , more preferably about 2 liters per minute . if the serum is not removed in step ( i ), then the addition of the necessary large amounts of trypsin can lead to locally high concentrations of trypsin , which can actually damage or even kill the cells rather than simply loosen them . the removal of serum in step ( i ) and of ca ++ in step ( ii ) reduces the amount of trypsin needed in steps ( iv ) and ( v ). to avoid actually damaging or even killing the cells , the treatment with the chelating agent and with the trypsin should preferably be kept short ( i . e ., long enough to detach the cells from the microcarriers , but preferably not longer ). examples of preferred chelating agents include edta ( ethylene diamine tetraacetic acid ) and egta ( ethylene - bis ( oxyethylene - nitrilo ) tetraacetic acid ). the serum is removed by a process of medium exchange ; for example , the medium can be pumped off through a spinfilter . serum - free wash medium is added to replace what was pumped off and the mixture stirred . alternatively , the addition of serum - free wash medium can be continuous with the removal of medium through the spin - filter . the process is repeated until the serum concentration has been reduced to a sufficiently low level , e . g ., less than about 1 . 0 to 0 . 20 %, preferably about 0 . 2 %. the chelating agent , preferably edta , is added in serum - free chelating medium , the mixture again stirred , and the chelating agent pumped off . alternatively , the addition of the chelating agent in serum - free medium can be continuous with the removal of the medium through the spinfilter . the trypsin is preferably used in step ( v ) to provide a concentration in the bioreactor of from about 0 . 05 to 0 . 1 %, and it is allowed to act on the cells for from 5 to 10 minutes , e . g ., preferably a trypsin concentration of about 0 . 065 % for about 8 minutes . protein , typically in the form of bovine calf serum , is preferably added to the bioreactor in a final concentration of about 10 to 20 % to inhibit the trypsin . thus the addition of serum in step ( vi ) not only prepares the cells for further cultivation but also neutralizes residual trypsin . the entire sequence of steps ( i )-( vi ) can take place in situ in the bioreactor ; in some embodiments the suspension of microcarriers and cells can be transferred to a larger bioreactor , where further microcarriers are added for the next step of the cultivation . the cells are allowed to attach to the microcarriers and then are cultivated further . once they become substantially confluent again ( e . g ., 3 - 4 days &# 39 ; cultivation at about 37 ° c . ), they can be put through the next stage , which may for example be harvesting , loosening for a further upstaging , or inoculation with virus . if the cells have been cultivated simply for harvest , then they can be harvested at this stage , e . g ., by a repetition of steps ( i ) through ( vi ) above . if they are needed for a further upstaging , then steps ( i )-( vi ) above can be repeated . if they have been cultivated for propagation of a virus , the virus can now be inoculated into the medium . the examples herein serve to illustrate but do not in any way limit the present invention . the selected vectors and hosts and other materials , the concentration of reagents , the temperatures , and the values of other variables are only to exemplify the application of the present invention and are not to be considered limitations thereof . each viral fermentation batch is started from a cell line propagated from a vial of 293 cell manufacturers working cell bank ( mwcb ). the bioreactors are inoculated with 293 cells ( atcc catalog number crl 1573 ) maintained by propagation in t - flasks and cell factory ™ using growth medium ( medium 1 ), as illustrated in table 1 below . each transfer represents a passage . typically , passage numbers of 4 to 30 are employed for inoculation of a seed bioreactor . to prepare for the transfer of cells from flask to flask during cell expansion , the spent medium is poured off and the cells in the flask are then washed with phosphate - buffered saline ( pbs ). a trypsin solution is added to the cell monolayer on the flask &# 39 ; s surface and the cells are exposed until they detach from the surface . trypsin action is then largely neutralized by adding growth medium ( medium 1 , table 1 ) containing serum ; complete neutralization is not necessary , since residual trypsin will have low activity . the cells can be recovered by centrifugation and resuspended in fresh growth medium ( medium 1 ). table 2 shows the typical volumes are used . virus inocula can be prepared by infecting mature cell factory ™ tissue culture flasks . in this procedure , 293 cells are first propagated from t - flasks to cell factory ™ tissue culture flasks . when cell factory ™ tissue culture flask cultures are mature ( typically 80 - 90 % confluent ) they are infected with an inoculum from the manufacturer &# 39 ; s working virus bank ( mwvb ). the infected cell factory ™ tissue culture flasks are incubated until the 293 cells detach from their supporting surface . the cells are collected by centrifugation and ruptured by multiple freeze - thaw cycles . after a subsequent centrifugation , the virus is recovered in the supernatant and stored as aliquots at − 20 ° c . or below . this material is the “ virus inoculum ” which is used to infect bioreactors . optionally , the virus inoculum can also be derived from the bioreactor harvest which is filter - sterilized ( see “ production bioreactor harvest ” below ). preferably , a seed bioreactor is used to prepare the 293 cell inoculum for the production bioreactor . the seed bioreactor is steam - sterilized and charged with a batch of filter - sterilized growth medium ( medium 1 , table 1 , above ) for the free cell suspension process . for the microcarrier process , however , swelled sterile microcarrier beads ( cytodex 3 or equivalent ) are preferably added at this stage . the seed bioreactor is inoculated with the 293 cells harvested from cell factory ™ tissue culture flasks . the operating conditions are set as shown in table 3 . the ph and dissolved oxygen ( do ) are controlled by sparging co 2 and oxygen , respectively . extra growth medium can be added to the bioreactor by perfusion . cell growth is monitored by microscopic examination and by measuring the lactate production and glucose consumption . typically , when the cell density in the suspension culture reaches 1 × 10 6 cells / ml in the seed bioreactor , it is ready for inoculating the production bioreactor . however , inoculation requires a few additional steps for the microcarrier process . typically , when the cells on the microcarriers are & gt ; 50 % confluent , the serum and calcium in the bioreactor medium are washed off using media described in table 1 . trypsin is then added rapidly , and when the cell detachment reaches typical level , serum is added to inactivate the trypsin . the seed bioreactor contents are now transferred to the production bioreactor . optionally , 293 cells harvested from multiple cell factory ™ tissue culture flasks can directly be used as inoculum for a production bioreactor . typically , 8 - 12 such cultures are harvested and pooled to provide an inoculum . the viral production process is exemplified in a 200 - l production bioreactor using growth medium ( medium 1 , table 1 ). in the suspension culture process , filter - sterilized medium is batched into the bioreactor . however , in the microcarrier process , microcarriers are either sterilized in situ in the production bioreactor or autoclaved externally and charged . these microcarriers are then conditioned in the growth medium ( medium 1 ) prior to inoculation with 293 cells . the production bioreactor is inoculated with the 293 cells from the seed bioreactor . the operating conditions are set as shown in table 4 . the ph and dissolved oxygen ( do ) are controlled by sparging co 2 and oxygen , respectively . optionally , extra growth medium can be added to the bioreactor by perfusion . cell growth is monitored by microscopic examination , and by measurement of lactate production and glucose consumption . cells are allowed to grow to approximately 1 × 10 6 cells / ml . the bioreactor is then inoculated with virus . preferably , a multiplicity of infection ( moi ) ratio expressed as the total viral particles per cell of 50 : 1 to 150 : 1 is used . viral titer is typically performed using the resource q hplc assay . virus is allowed to propagate until the cell viability drops to about 10 %. the type of virus and its action upon the host cells may determine whether it is necessary to detach the host cells from the microcarriers and / or lyse the cells . at about the time of maximum virus titer ( frequently when the cells start to detach from the microcarrier and some of which may lyse , so that the virus starts to escape ), the incubation can be stopped and the cells and virus can be harvested . indeed , in the microcarrier process , 80 - 90 % of the cells , sometimes even more than 90 %, may detach from the microcarriers . without being limited to any one theory , the cytopathic effect of viral propagation in the host cells appears to be responsible for cell detachment . thus , when adenovirus acn53 is used with 293 cells , the cells start to detach from the microcarriers after 3 or 4 days &# 39 ; cultivation with the virus . at harvest , the bioreactor contents have to be handled differently depending on whether the process uses free suspension or a microcarrier . in the microcarrier process , a fluidized bed column is preferably used to separate the microcarriers from cells and supernatant . an upward flow rate is maintained so as to retain the microcarriers while the cells and supernatant pass through . the fluidized bed is washed with medium or wash buffer to recover most residual cells and virus , and the washings are combined with the cells and supernatant as an eluate . the fluidized bed operation is not required for the free cell suspension process . the eluate containing cells and virus is further processed in that the cells are lysed by high shear to release virus , and the eluate is then clarified by means of a cross - flow microfiltration . typically , 0 . 65 μm durapore ( millipore ) or equivalent membranes are used . towards the end of the microfiltration , the retentate is washed with wash buffer to recover the residual virus into the permeate . after microfiltration , the permeate can be optionally treated with a nuclease such as benzonase ™ endonuclease . the permeate from the microfiltration is concentrated by ultrafiltration ( with a typically 1 million molecular weight cutoff ) and a buffer exchange is performed using the wash buffer . the concentrated and diafiltered retentate containing the virus is then passed through a final filter . the resulting filtrate is stored as “ viral concentrate ” in a freezer at − 20 ° c . or below . table 1 above lists the media used in the preparation of the viral inoculum and in the fermentation process . all these culture media are prepared by first dissolving the dry dmem powder and other reagents in purified water . after dissolving the dry powders , these media are adjusted to ph 7 . 2 - 7 . 6 with hydrochloric acid . the media are then sterilized by passing through a 0 . 2 μm filter into an appropriate storage container . the sterile media are refrigerated below 10 ° c . and discarded one month after preparation . a frozen vial of the 293 cell line containing a total of 2 × 10 7 cells was thawed in a 37 ° c . water bath . the cells were washed with 10 ml of medium 1 . the washed cells were resuspended in a total volume of 30 ml of medium 1 and placed in a 75 cm 2 tissue culture flask ( t75 ). the culture was placed in an incubator at 37 ° c . with a 5 % co 2 atmosphere and a humidity level of 100 %. this was passage 1 of the culture . the t75 culture reached a confluency level of 90 % in three days . at this time the t75 culture was trypsinized in the following manner . the 30 ml of supernatant medium was removed from the flask . a volume of 10 ml of cmf - pbs ( dulbecco &# 39 ; s phosphate buffered saline without calcium chloride and without magnesium chloride ) was used to wash the culture surface . the supernatant cmf - pbs was removed from the flask . two ml of te ( 0 . 05 % crude trypsin with 0 . 53 mm edta - 4na ) solution was added to the flask . the flask was moved so that the solution covered the entire culture surface . the cells detached from the flask surface within five minutes . ten ml of medium 1 was added to the flask immediately after the cells detached from the surface . the cell suspension was centrifuged at 1000 rpm for ten minutes at ambient temperature with the break . the supernatant was removed . the cells were resuspended in five ml of medium 1 . the cell suspension was transferred to a sterile bottle with 200 ml of medium 1 . the 200 ml cell suspension was placed in a 500 cm 2 tissue culture flask ( t500 ). the liquid in the t500 was allowed to equilibrate between chambers before placement in a horizontal position in the incubator . the culture was placed in an incubator at 37 ° c . with a 5 % co 2 atmosphere and a humidity level of 100 %. this was passage 2 of the culture . the t500 culture reached a confluency level of 90 % in four days . on the fourth day , the t500 culture was trypsinized and scaled - up in the following manner . the supernatant medium was discarded . the culture surface was washed with 25 ml of cmf - pbs . a volume of 25 ml of te was added to the flask . the flask was moved so that the te solution covered all three layers of culture surface . the cells detached from the flask surface within five minutes . after the cells detached , 50 ml of medium 1 was added to the flask . all of the surfaces were contacted with the medium by moving the flask . the resultant cell suspension was poured into a 200 ml conical centrifuge bottle . the cells were pelleted by centrifugation at 1000 rpm for ten minutes at ambient temperature with the brake . the supernatant was discarded . the cells were resuspended in 5 to 15 ml of medium 1 . the cell suspension was placed in 800 ml ( 200 ml per new t500 flask ) of medium 1 . the cell suspension was mixed . a volume of 200 ml of the cell suspension was added to each of four t500 flasks . the liquid level in each flask was allowed to equilibrate between chambers before placement in a horizontal position in the incubator . the split ratio for this passage was 1 : 4 . this was passage 3 . the culture was passaged in this manner for passages 4 through 13 . at passage 14 , four t500 cultures were trypsinized in the manner given above . the cell suspensions were pooled and placed in a bottle containing 1 . 5 liters of medium 1 . this cell suspension was added to a 6000 cm 2 cell factory ™ ( cf ) tissue culture flask . the liquid level in the cf was allowed to equilibrate between chambers before placement in a horizontal position in the incubator . 4 . scale - up and passaging of cell factory ™ tissue culture flask cultures the cf culture reached an 80 % confluency level in three days . the trypsinization was performed in the following manner for passage 15 . the 1 . 5 liters of medium 1 was drained from the cf culture . the culture surfaces were washed with 500 (± 100 ) ml of cmf - pbs . after the wash , 250 (± 50 ) ml of te solution was added to the cf culture . the cf was moved so that the te solution covered each of the surfaces . after the cells detached from the surface , 500 ml of medium 1 was added to the cf . the cf was moved so that the medium 1 contacted each of the surfaces . the resultant cell suspension was aliquotted into four , 250 ml conical centrifuge bottles . the cells were pelleted by centrifugation at 1000 rpm for ten minutes with the brake on . the supernatant medium was discarded from each centrifuge bottle . in each centrifuge bottle , the cells were resuspended in 5 ml of medium 1 . the cells suspensions were pooled into one centrifuge bottle . the three remaining centrifuge bottles were washed with an additional 5 - 10 ml of medium 1 which was added to the pooled cell suspension . this cell suspension was split equally among six bottles containing 1 . 5 liters of medium 1 . each of the six 1 . 5 liter cell suspensions was added to a cf . the liquid level of each cf was allowed to equilibrate among the chambers before the cf was placed in a horizontal position in the incubator . the culture was passaged in the same manner for passage 16 . the cf cultures reached an 80 % confluency level in five days . four of the six cf cultures were used to inoculate the seed bioreactor as follows . the 1 . 5 liters of medium 1 was drained from the cf culture . the culture surfaces were washed with 500 (± 100 ) ml of cmf - pbs . after the wash , 250 (± 50 ) ml of te solution was added to the cf culture . the cf was moved so that the te solution covered each of the surfaces . immediately after the cells detached from the surface 500 ml of medium 1 was added to the cf . the cf was moved so that the medium 1 contacted each of the surfaces . the resultant cell suspension was aliquotted into four , 250 ml conical centrifuge bottles . the cells were pelleted by centrifugation at 1000 rpm for ten minutes at ambient temperature with the brake on . the supernatant medium was discarded from each centrifuge bottle . in each centrifuge bottle , the cells were resuspended in 5 ml of medium 1 . the cells suspensions were pooled into one centrifuge bottle . the remaining three centrifuge bottles were washed with an additional 5 - 10 ml of medium 1 which was added to the pooled cell suspension . the cell suspensions from each of the four centrifuge bottles were then pooled together , yielding a total volume of 50 - 100 ml . an additional volume of medium 1 was added to bring the total volume to 1000 ml . this was the cell inoculum . the total amount of cells in the cell inoculum was 2 . 88 × 10 9 total cells and 2 . 84 × 10 9 viable cells . the 1000 ml of cell inoculum was transferred to a sterile erlenmeyer flask and inoculated into the 30 liter seed bioreactor which contained a total volume of 18 liters of medium 1 with 66 g of cytodex 3 microcarriers . 1 . preparation of cytodex 3 microcarriers for the 30 l seed bioreactor one batch of 66 grams of cytodex 3 microcarriers was prepared in the following manner . the 66 grams of cytodex 3 microcarriers was placed in a five liter , glass , erlenmeyer flask . two liters of cmf - pbs with 0 . 2 ml of tween 80 was added . the microcarriers were allowed to swell at ambient temperature for five hours and thirty minutes . after this swelling period , the supernatant cmf - pbs was decanted from the flask leaving behind the cytodex 3 microcarrier slurry . the cytodex 3 microcarrier slurry was washed with two liters of cmf - pbs then resuspended in cmf - pbs to a total volume of two liters . the batch of cytodex 3 was autoclaved in the five liter flask at 121 ° c . for three and a half hours on a liquids cycle . the sterilized cytodex 3 batch was used the next day for the 30 l seed bioreactor . on the day of the cytodex 3 addition to the 30 l seed bioreactor the following actions were performed . the supernatant cmf - pbs was decanted from the five liter flask . the microcarrier slurry was washed with two liters of medium 1 . after the wash , medium 1 was added to the flask to a final volume of two liters . the 30 l seed bioreactor which contained a spinfilter was cleaned and steam sanitized . the bioreactor was sterilized for fifty minutes at 121 ° c . one day prior to 293 cell inoculation , the 30 l seed bioreactor was filled with 18 liters of medium 1 . the two liters containing 66 grams of the cytodex 3 microcarriers with medium 1 solution was added to the 30 l bioreactor . the 30 l seed bioreactor operating conditions are listed in table 8 . the 293 cells were propagated on the cytodex 3 microcarriers for five days . the actual operating conditions in the 30 l seed bioreactor during this time period are listed in table 9 . on the fifth day of cultivation , 54 % of the microcarrier population contained greater than 50 cells / microcarrier , 38 % contained 1 - 25 cells , 8 % contained no cells , and 8 % were in aggregates of two microcarriers as determined by examination of a sample under the microscope at magnification . results are provided in table 10 . one batch of 420 grams of cytodex 3 microcarriers was prepared in the following manner . the 420 grams of cytodex 3 microcarriers was placed in a fifty liter carboy . a volume of 21 . 5 liters of cmf - pbs with 2 . 0 ml of tween 80 was added . the microcarriers were allowed to swell at ambient temperature for 17 hours . after this swelling period , the supernatant cmf - pbs was removed from the carboy leaving behind the cytodex 3 microcarrier slurry . the cytodex 3 microcarrier slurry was washed with 25 liters of cmf - pbs then resuspended in cmf - pbs to a total volume of 20 liters . the 200 l bioreactor which contained a spinfilter was cleaned and steam sanitized . the 20 liter cytodex 3 microcarrier slurry was transferred to the bioreactor . five liters of cmf - pbs was used to wash out the 50 liter carboy and transferred to the bioreactor . the bioreactor was sterilized for 50 minutes at 123 ° c . the bioreactor was maintained at 4 ° c . overnight . the next day , 120 liters of medium 1 was added to the 200 l bioreactor . the microcarrier solution was agitated at 90 rpm for ten minutes in the bioreactor . the volume was brought down to 55 liters by withdrawing liquid through the spinfilter . an additional 110 liters of medium 1 was added to the 200 l bioreactor . the microcarrier solution was agitated at 90 rpm for ten minutes in the bioreactor . the volume was brought down to 55 liters by withdrawing liquid through the spinfilter . medium 1 was added to the bioreactor to bring the volume to 125 liters . the bioreactor &# 39 ; s operating conditions were set according to table 11 . on the fifth day of cultivation of the 293 cells on the cytodex 3 microcarriers , the bead to bead transfer procedure was performed . the serum and calcium levels of the medium in the culture were reduced by perfusing 22 liters of medium 2 at a rate of 2 liters per minute using the spinfilter with a constant bioreactor volume of 20 liters . perfusion was continued with 22 liters of medium 3 at a perfusion rate of 2 liters per minute with a constant bioreactor volume of 20 liters . this reduced the serum and calcium levels further . medium 3 contained disodium ethylenediaminetetra - acetate dihydrate ( edta ) which chelates divalent cations such as magnesium and calcium . a third round of perfusion was performed using 33 liters of medium 2 which was designed to further reduce the serum and calcium levels and to reduce the concentration of edta in the medium . at this point , the medium was withdrawn through the spinfilter to reduce the total culture volume to 15 . 5 liters . a volume of 480 ml of a 2 . 5 % trypsin solution was added to the bioreactor in one minute . by microscopic observation , eight minutes after the addition of the trypsin solution , 90 % of the cells had detached from the microcarriers . at this point , four liters of serum was added to the bioreactor in two and a half minutes to inhibit the action of trypsin and to protect the cells from shear during the transfer procedure to the production bioreactor . the trypsinized cells and microcarriers were transferred to the production bioreactor by pressure . the transfer was achieved in eight minutes . immediately after the transfer , five liters of medium 1 was added to the seed bioreactor as a flush and transferred to the production bioreactor by pressure . operating conditions of the seed bioreactor during the bead - bead transfer procedure are provided in table 12 . the 293 cells were propagated on the cytodex 3 microcarriers for six days . the actual operating conditions in the 200 l production bioreactor during this time period are listed in table 13 . a total volume of 115 liters of medium 1 was perfused from days four through six . the rates were as follows ; 24 liters was perfused in one hour on day four , 40 liters was perfused in one hour on day five , and 50 liters was perfused in one hour on day six . the oxygen uptake rate measured as the decrease of the dissolved oxygen level ( percent of air saturation , % do ) per minute (% do decrease / min ) reached 1 . 65 %/ min on day six . results from microscopic exam on the sixth day of cultivation of 293 cells on cytodex 3 microcarriers in the 200 l bioreactor are provided in table 14 . the bioreactor culture was inoculated with virus on day 6 . the viral inoculum had been stored frozen at − 80 ° c . a volume of 45 ml of the viral inoculum , 2 - 2 , was thawed in a water bath at 20 °- 25 ° c . the total amount of virus added to the tank was 1 . 1 × 10 13 viral particles as measured by the resource q hplc assay . the viral inoculum was mixed and placed in a bottle with one liter of medium 4 ( 293 - 1 - r07 dulbecco &# 39 ; s modified eagle &# 39 ; s medium with l - glutamine and sodium bicarbonate ( 3 . 7 g / l )). the viral solution was filtered through a gelman maxi culture capsule into a sterile five liter addition flask . the viral suspension was added to the 200 l production bioreactor with sterile connections made via the tubing welder . production bioreactor operating conditions after infection are provided in table 15 . three days after infection , 89 % of the microcarriers did not have attached cells and the oxygen uptake rate measured was 0 . 53 %/ min . the total infected cell concentration present in the supernatant broth was 1 . 0 × 10 6 cells / ml . the total volume in the bioreactor was 162 liters . the bioreactor was harvested at this time . a volume of 400 liters of the harvest recovery buffer was prepared and filtered through a pall ultipor n66 ( 0 . 2 micron pore size ) and aliquotted into sterile vessels in the following manner . three aliquots of 210 liters , 130 liters , and 50 liters were prepared . the volume of 210 liters was used for the bioreactor wash and the fluidized bed column operation . the 130 liter aliquot was used during the microfiltration . the 50 liter aliquot was utilized during the ultrafiltration process . f . separation of cells from the microcarriers using the fluidized bed column the fluidized bed was sanitized using a caustic solution ( 0 . 1n sodium hydroxide ). a t - fitting was connected to the harvest port of the bioreactor . on one side of the t - fitting , a sanitary hose ( 15 . 9 mm id ) and valve were connected to the fluidized bed column . a peristaltic pump was placed on this line ( watson marlow model 604s ). the second side of the t - fitting was connected to a sanitary hose ( 15 . 9 mm id ) and valve leading to the buffer tank . the outlet of the fluidized bed column , through which the broth containing cells and virus passed , was connected to a tank used as the microfiltration recirculation vessel . the broth from the bioreactor was passed through the fluidized bed column at a target flow rate of 2 - 3 liters per minute . the flow rate was controlled with the peristaltic pump . agitation was maintained in the bioreactor . when the bioreactor volume was less than 100 liters the spin filter was turned off . when the bioreactor volume was less than 30 liters , the agitator was turned off . after the bioreactor contents were processed through the fluidized bed column , the bioreactor was washed with 90 liters of harvest recovery buffer . this wash material was processed through the fluidized bed column . at the end of the process , the microcarriers remained in the fluidized bed column and were discarded . data are provided in table 16 . the starting material for the microfiltration process was the broth from the fluidized bed column that was clarified of the microcarriers and contained cells and virus . during the microfiltration step , the cells were lysed due to the shear rate used , the broth was clarified of debris larger than 0 . 65 microns and the residual nucleic acids from the lysed cells was digested by benzonase ™ endonuclease ( e . g ., 0 . 5 million units per 200 l batch ), an enzymatic preparation . the microfiltration unit was a prostak system ( millipore ). it contained a durapore , 0 . 65 micron pore size , hydrophilic , membrane ( catalog number sk2p446eo ) with a surface area of 54 square feet . the feed and retentate lines of the prostak filter unit were connected to the microfiltration recirculation vessel which contained the microcarrier - clarified broth from the fluidized bed column . a line used to feed the harvest recovery buffer into the microfiltration recirculation vessel was connected . the permeate line from the prostak unit was connected to the ultrafiltration recirculation vessel . the temperature of the broth was maintained in the range of 25 °- 35 ° c . when the broth feeding into the prostak unit was reduced to a volume of 10 to 30 liters in the microfiltration recirculation vessel , 50 liters of the harvest recovery buffer was added to the vessel and the microfiltration continued . this step was repeated once . the microfiltration continued until the volume in the microfiltration recirculation vessel was reduced to 10 to 30 liters . at this time , 0 . 5 million units of benzonase ™ endonuclease was added to the clarified both in the ultrafiltration recirculation vessel . the contents of the vessel were mixed well and the broth was held for two hours before the ultrafiltration was started . data are provided in table 17 . the starting material for the ultrafiltration process in the ultrafiltration recirculation vessel was the benzonase ™ endonuclease - treated , clarified broth from the microfiltration permeate . the ultrafiltration unit was a pellicon system ( millipore ). it contained a 1 million nominal molecular weight cut - off , pellicon ii - regenerated cellulose membrane ( catalog number p2c01mc05 ) with a surface area of 40 square feet . the feed and retentate lines of the pellicon unit were connected to the ultrafiltration recirculation vessel . the ultrafiltration permeate line was connected to a waste vessel . a vessel containing the harvest recovery buffer ( 50 mm tris base , 150 mm sodium chloride , 2 mm magnesium chloride hexahydrate , and 2 % sucrose ) was connected to the ultrafiltration recirculation vessel . when the ultrafiltration retentate volume reached 5 to 10 liters , an addition of 15 liters of the harvest recovery buffer was made and the ultrafiltration was continued . this step was repeated once . the ultrafiltration was continued until the retentate volume was less than 5 to 10 liters . the retentate from the ultrafiltration contained the concentrated virus . the retentate was collected from the pellicon unit . a flush of 3 to 6 liters of the harvest recovery buffer was used to collect all of the material from pellicon unit . this flushed material was added to the ultrafilter retentate broth . this was filtered through a millipore , durapore , 0 . 45 micron pore size filter ( catalog number cvhl71pp3 ) into a sterile bag . the material in the sterile bag was stored frozen at − 80 ° c . data are provided in table 18 . all 293 cell cultures in t75 , t500 and cell factory ™ tissue culture flasks were cultivated in medium 1 in an incubator at 37 ° c ., 100 % humidity and a 5 % co 2 atmosphere . all open operations were performed aseptically under a biosafety ( laminar flow ) hood . medium fills and additions were performed through a 0 . 2 micron pore size , pall ultipor n66 , in - line filter installed on the feed port of the bioreactor which was steam sterilized for 30 minutes at 121 ° c . all other additions to the bioreactors were performed each using a sterile erlenmeyer flask with pharmed ™ tubing that was aseptically connected between the bioreactor and the addition flask by a tubing welder . all buffers used in the recovery process were filtered through a 0 . 2 micron pore size , pall ultipor n66 , in - line filter ( slk7002nfp ) installed on a port of the receiving vessel . note that for the microfiltration operations either a hydrophilic or hydrophobic membrane can be used . all publications and patent applications cited herein are incorporated by reference in their entirety to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference . modifications and variations of this invention will be apparent to those skilled in the art . the specific embodiments described herein are offered by way of example only , and the invention is not to be construed as limited thereby . | 2 |
turning to the figures , fig1 depicts an exemplary embodiment of a syringe system 5 that can be used with the extended finger flange 10 of the present disclosure . as depicted , the syringe systems 5 includes a needle guard 40 configured to receive a syringe 20 having a plunger 30 . the syringe 20 has a substantially smooth - walled cylindrical barrel 22 , a hub or distal end 24 that is the administration end , and a proximal end 26 . the proximal end 26 of the barrel 22 is configured to receive the plunger 30 . the plunger 30 comprises a stem 32 and a radial portion or thumb pad 36 . the distal end 24 of the cylindrical barrel 22 preferably comprises a needle port or luer fitting . preferably , the needle of the syringe 20 is covered with a cap 25 prior to the attachment of the extended finger flange and / or administration of the medication . the syringe 20 is preferably housed inside the needle guard 40 . although the extended finger flange 10 of the present disclosure may be used with a variety of needle guards or directly with a syringe , in an exemplary embodiment the needle guard 40 comprises a body 50 for receiving and holding the syringe 20 and a shield 60 slidably attached to the body 50 . in one exemplary embodiment , the shield 60 is a tubular member adapted to slidably fit on the body 50 and has a proximal end 62 and a distal end 64 . the shield 60 comprises a pair of finger flanges 66 . the distal surfaces 67 of the finger flanges 66 typically provide only a small surface area for the end user &# 39 ; s fingers to grip and secure the syringe system . the shield 60 can include one or more trigger fingers 68 that extend proximally from the proximal end 62 of the shield 60 . during administration of the medication , the radial portion 36 of the plunger 30 contacts the trigger fingers 68 . this action allows the shield 60 to transition from a first , retracted position to a second , extended position to cover the needle . the needle guard 40 can also include a spring mechanism coupled to the body 50 and the shield 60 for biasing the shield 60 towards an extended position when the trigger fingers 68 are deflected radially . in an exemplary embodiment , the extended finger flange device 10 fits onto the needle guard 40 of the syringe system 5 . the lateral flaps 12 of the extended finger flange 10 increase the surface area and make it easier for the end user to grip the device and administer an injection . the addition of the extended finger flange 10 makes it easier for end users that have joint pain or limited dexterity to handle and grip the device when they self - administer an injection by extending the area that they have to grip . the exact dimensions , orientation , and configuration of the lateral flaps 12 of the extended finger flange 10 can be varied to fit the requirements of the patient population served by the drug medication . for example , as shown in fig2 , the lateral flaps 12 can comprise a wide , rounded area or the lateral flaps 12 can comprise a more rectangular shape as shown in fig4 . as another example , as shown in fig3 , the finger flaps 12 can have a downward orientation to further assist the end user in holding the device . the extended finger flange 10 is generally molded from plastic , such as , polypropylene , k - resin , or polycarbonate , or the like . alternatively , the extended finger flange 10 can be manufactured using an over molded process ( fig4 ). in this embodiment , a soft durometer elastomare could be molded over a ridged core to provide support to the device and a soft spongy feel to the user that would give a better grip and reduce the pressure on the user &# 39 ; s fingers . as shown in fig3 , the extended finger flange 10 is placed onto the outside of the needle guard 40 of the syringe system 5 . the extended finger flange 10 can be coupled with the syringe system 5 in a variety of ways . as one example , the extended finger flange 10 can be coupled to the syringe system 5 using a slight press fit over the needle guard 40 . in another embodiment , the extended finger flange 10 can be coupled to the syringe system 5 through a positive snap feature 14 ( fig2 ) that couples the extended finger flange 10 and the syringe system 5 together . in this embodiment , the extended finger flange 10 comprises one or more snap features 14 that are configured to engage complimentary portions of the shield 60 of the needle guard 40 . for example , the snap features 14 on the extended finger flange 10 can be configured to engage the lateral ends 63 ( fig1 ) of the finger flange 66 on the shield 60 . in an alternative embodiment shown in fig5 , the extended finger flange 10 can be configured to slide on to the safety system 5 from the side . in this embodiment , the central portion of the extended finger flange 10 comprises a “ c ” shape . attaching the extended finger flange 10 from the side reduces the chance of damaging the needle when attaching the extended finger flange 10 to the syringe system 5 . in this embodiment , the extended finger flange 10 can be held in place by , for example , two upper snap features 18 and two side snap features 19 . the snap features 18 , 19 can engage complimentary portions of the shield 60 . for example , the side snap features 19 can interact with recesses 65 on the shield 60 , and the upper snap features 18 can interact with the lateral ends 63 of the finger flange 66 of the shield 60 . in yet another exemplary embodiment , as shown in fig6 , the extended finger flange 10 comprises one or more internal snaps 17 that press fit against the finger flange 66 of the shield 60 when the extended finger flange 10 is fully inserted onto the needle guard 40 . once fully inserted ( see fig7 a and 7b ), the snap features 17 press against the lateral edges of the finger flange 66 but not against the lateral ends 63 and , thus , does not apply pressure against the sidewall of the device . this configuration prevents the extended finger flange 10 from deforming the needle guard 40 . such deformation could cause an increase in friction between the shield 60 and body 50 of the needle guard 40 and possibly prevent the shield 60 from extending relative to the body when activated . while the invention is susceptible to various modifications , and alternative forms , specific examples thereof have been shown in the drawings and herein described in detail . it should be understood , however , that the invention is not to be limited to the particular forms or methods disclosed , but to the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the appended claims . | 0 |
fig1 is a schematic diagram for explaining the configuration of gas turbines according to first to third embodiments of the present invention described below . as shown in fig1 , a gas turbine 1 is provided with a compressor 2 , a combustor 3 , a turbine unit 4 , and a rotational shaft 5 . as shown in fig1 , the compressor 2 sucks in air to compress it and supplies the compressed air to the combustor 3 . a rotational driving force is transmitted from the turbine unit 4 to the compressor 2 via the rotational shaft 5 , and , upon being rotationally driven , the compressor 2 sucks in air and compresses it . note that any known configurations can be employed for the compressor 2 ; it is not particularly limited . as shown in fig1 , the combustor 3 mixes externally supplied fuel and the supplied compressed air , generates high - temperature gas by combusting the mixed air , and supplies the generated high - temperature gas to the turbine unit 4 . note that any known combustors can be employed as the combustor 3 ; it is not particularly limited . as shown in fig1 , the turbine unit 4 extracts rotational driving force from the supplied high - temperature gas to rotationally drive the rotational shaft 5 . note that any known configurations can be employed for the turbine unit 4 ; it is not particularly limited . a gas turbine according to a first embodiment of the present invention will now be described with reference to fig1 to 7 . note that , in this embodiment , turbine blades of the invention of the present application will be described as applied to stator blades of sixth to ninth stages in the compressor 2 of the gas turbine 1 . fig2 is a schematic diagram for explaining the configuration of a rotor disc and stator blades in a compressor of a gas turbine according to this embodiment . as shown in fig1 and 2 , the compressor 2 is provided with stator blades ( turbine blades ) 10 that are attached to a casing 6 of the gas turbine 1 and rotor blades that are disposed at a circumferential surface of a circular plate - shaped rotor disc ( not shown ) which is rotationally driven by the rotational shaft 5 . the stator blades 10 and the rotor blades are disposed in rows in the circumferential direction of the rotational shaft 5 at regular intervals and are disposed in alternating rows in the axial direction of the rotational shaft 5 . next , the stator blades 10 , which are the feature of this embodiment , will be described . fig3 is a cross - sectional view for explaining the configuration near a seal holder in the stator blade in fig2 . as shown in fig2 and 3 , the stator blades 10 are provided with an outer shroud portion 11 , airfoil portions 12 , inner shroud portions ( shroud portions ) 13 , a seal holder ( holder casing ) 14 , springs ( elastic portions ) 15 , a spacer ( pressing portion ) 16 , and a honeycomb seal 17 . as shown in fig2 , the outer shroud portion 11 is a member that forms part of wall surfaces of a flow channel in which fluid flows in the compressor 2 . furthermore , the outer shroud portion 11 is a curved plate - like member disposed at end portions of the airfoil portions 12 on the radially outer side thereof , and a single outer shroud portion 11 is disposed for a plurality of the airfoil portions 12 . in other words , the outer shroud portion 11 is formed of a cylindrical member that has been divided into a plurality of portions , and the plurality of the airfoil portions 12 are connected to an inner circumferential surface thereof . with regard to the shape of the outer shroud portion 11 and the connection method with the airfoil portions 12 , any known shapes and methods can be employed ; they are not particularly limited . as shown in fig2 , the airfoil portions 12 are members whose cross - sections extending in the radial direction of the rotational shaft 5 are formed in airfoil shapes and that , together with the rotor blades rotationally driven by the rotational shaft 5 , compress a fluid , such as air , and send it toward the combustor 3 . the airfoil portions 12 are provided with leading edges le , which are upstream - end portions relative to a flow of surrounding fluid , trailing edges te , which are downstream - end portions , negative pressure surfaces , which are surfaces curved in convex shapes , and positive pressure surfaces , which are curved in concave shapes . as shown in fig2 and 3 , the inner shroud portions 13 , as well as the outer shroud portion 11 , form part of the flow channel in which the fluid flows inside the compressor 2 . furthermore , the inner shroud portions 13 are curved plate - like members disposed at end portions of the airfoil portions 12 on the radially inner side thereof , and a single inner shroud portion 13 is disposed for a single airfoil portion 12 . in other words , the inner shroud portions 13 are formed of a cylindrical member that has been divided into a plurality of portions , and the airfoil portions 12 are connected to outer circumferential surfaces thereof . fitting grooves 13 a that fit with the seal holder 14 , extending in the circumferential direction ( direction perpendicular to the plane of the drawing in fig3 ), are provided at end portions on the leading edge le side and trailing edge te side of the inner shroud portions 13 . as shown in fig3 , the seal holder 14 is a member that is attached to the inner shroud portions 13 on the inner circumferential side thereof ( bottom side in fig3 ), that , together with the inner shroud portions 13 , forms a space for accommodating the springs 15 and the spacer 16 inside thereof , and that supports the honeycomb seal 17 . as with the outer shroud portion 11 , a single seal holder 14 is disposed for the plurality of the airfoil portions 12 and the inner shroud portions 13 . the seal holder 14 is provided with a pair of side wall portions 14 s that extend in radial directions at the leading edge le side and the trailing edge te side and a bottom plate portion 14 b which connects end portions of the pair of side wall portions 14 s at the radially inner side thereof . in other words , a groove portion is formed in the seal holder 14 , opening outward in the circumferential direction ( top side in fig3 ). the radially outer - side end portions of the side wall portions 14 s are provided with protrusions 14 a which protrude inward in the seal holder 14 , extending in the circumferential direction thereof , and fit with the fitting grooves 13 a of the inner shroud portions 13 . the bottom plate portion 14 b is provided with through - holes 14 h into which compressing bolts ( compressing portions ) 18 that press the spacer 16 together with the springs 15 are inserted . the through - holes 14 h are provided in the bottom plate portion 14 b at an equidistant position from each of the pair of side wall portions 14 s , and a plurality thereof are provided in the circumferential direction ( direction perpendicular to the plane of the drawing in fig3 ) at predetermined intervals . as shown in fig2 and 3 , the springs 15 are elastic members that bias the inner shroud portions 13 in directions that separate them from the spacer 16 and the seal holder 14 . furthermore , by sliding on the inner shroud portions 13 , the springs 15 damp the vibrations in the stator blades 10 , i . e ., the airfoil portions 12 and the inner shroud portions 13 . in this way , by having the springs 15 bias the inner shroud portions 13 in the directions that separate them from the seal holder 14 , the fitting grooves 13 a and the protrusions 14 a are pressed together , coming into close contact with each other , thereby making it possible to ensure the sealing level between the inner shroud portions 13 and the seal holder 14 . the springs 15 are substantially rectangularly formed plate springs that are formed into substantially a wave shape , and the spring force of the springs 15 is adjusted by adjusting the plate thickness of the plate springs . with regard to the material forming the springs 15 , the material is desirably capable of maintaining the required spring properties while the gas turbine 1 is in operation , that is , even if the springs 15 are heated to high temperature . the springs 15 are disposed in a space formed between the inner shroud portions 13 and the seal holder 14 , more specifically , between the inner shroud portions 13 and the spacer 16 . furthermore , a total of two springs 15 , one on the leading edge le side and another on the trailing edge te side , are disposed in a parallel arrangement . in this embodiment , descriptions will be given as applied to an example in which these two springs 15 are disposed at the same phase , in other words , an example in which peak portions of the two springs 15 come in contact with the inner shroud portions 13 or the spacer 16 at the same positions . fig4 is a schematic diagram for explaining another arrangement example of the springs . note that , the two springs 15 may be disposed at the same phase , as described above , or they may be disposed at different phases , as shown in fig4 ; it is not particularly limited . with the arrangement of the springs 15 shown in fig4 , at locations where the peak portions of the first spring 15 are in contact with the inner shroud portions 13 , the peak portions of the other spring 15 are in contact with the spacer 16 . by doing so , it is possible to make the springs 15 contact all of the inner shroud portions 13 , even when arrangement intervals of the peak portions in the first spring 15 are wider than arrangement intervals of the inner shroud portions 13 . that is , the inner shroud portions 13 with which the peak portions of the first spring 15 are not in contact are in contact with the peak portions of the other spring 15 , thereby making it possible to have all of the inner shroud portions 13 in contact with the springs 15 . the shapes of the springs 15 are determined such that the amplitude of the wave shape ( peak - to - peak distance in the radial direction ) is longer than the distance from the inner circumferential surfaces of the inner shroud portions 13 to the outer circumferential surface of the spacer 16 and so that the peak portions of the springs 15 are in contact with the inner circumferential surfaces of individual inner shroud portions 13 . more specifically , the amplitude of the wave shape in the springs 15 is determined on the basis of the frictional force for damping the vibrations of the stator blades 10 , that is , the compression level of the springs 15 required for generating the spring force . the wavelength ( peak - to - peak distance in the circumferential direction ) in the wave shape of the springs 15 is determined on the basis of the arrangement intervals of the inner shroud portions 13 , that is , the pitch thereof . as shown in fig3 , the spacer 16 , together with the compressing bolts 18 , presses the springs 15 toward the inner shroud portions 13 and is disposed between the bottom plate portion 14 b of the seal holder 14 and the springs 15 . as with the seal holder 14 , a single spacer 16 is disposed for the plurality of the airfoil portions 12 and the inner shroud portions 13 . in other words , the spacer 16 is formed of a cylindrical member that has been divided into a plurality of portions , and the springs 15 come in contact with the inner circumferential surface thereof . the spacer 16 is provided with through - holes 16 h into which the compressing bolts 18 are inserted . as shown in fig3 , the honeycomb seal 17 , together with seal fins 22 provided in a rotor 21 , suppresses leakage of the fluid that flows between the stator blades 10 and the rotor 21 . any known honeycomb seal may be used as the honeycomb seal 17 ; it is not particularly limited . next , an assembly method of the stator blades 10 having the above - described configuration will be described . fig5 is a schematic diagram for explaining attaching and detaching of the seal holder in the stator blades in fig3 . first , the springs 15 and the spacer 16 are disposed on the inner circumferential surface side in the inner shroud portions 13 , and the compressing bolts 18 are screwed onto the inner shroud portions 13 via the through - holes 16 h of the spacer 16 . then , by screwing the compressing bolts 18 further into the inner shroud portions 13 , the spacer 16 is brought closer to the inner shroud portions 13 to compress the springs 15 . at this time , the distance from the inner circumferential surfaces of the inner shroud portions 13 to the outer circumferential surface of the spacer 16 is made shorter than the distance from the inner circumferential surfaces of the inner shroud portions 13 to the outer circumferential surface of the bottom plate portion 14 b of the seal holder 14 . subsequently , the seal holder 14 is fitted to the inner shroud portions 13 . more specifically , the protrusions 14 a of the seal holder 14 are fitted to the fitting grooves 13 a in the inner shroud portions 13 . at this time , the seal holder 14 is fitted while sliding it in the circumferential direction relative to the inner shroud portions 13 . fig6 is a schematic diagram for explaining the state after the seal holder is attached to the stator blades in fig3 . then , as shown in fig6 , the compressing bolts 18 are removed from the inner shroud portions 13 via the through - holes 14 h of the seal holder 14 , and thus , attaching of the seal holder 14 is completed . the seal holder 14 is removed by carrying out the above - described steps sequentially in reverse order . note that , the compressing bolts 18 may be completely removed from the stator blades 10 as described above , or they may remain on the stator blades 10 in a state in which a predetermined level of compression is exerted on the springs 15 ; it is not particularly limited . next , a method of damping vibrations in the stator blades 10 having the above - described configuration will be described . when the gas turbine 1 is operated , vibrations are generated in the stator blades 10 due to the influence of the fluid or the like flowing in the compressor 2 . more specifically , vibrations are generated by which the airfoil portions 12 and the inner shroud portions 13 of the stator blades 10 vibrate in the circumferential direction . when the inner shroud portions 13 vibrate as described above , sliding occurs between the peak portions of the springs 15 , which are pressed against the inner shroud portions 13 , and the inner circumferential surfaces of the inner shroud portions 13 . the pressing force of the springs 15 and the frictional force in accordance with the friction coefficient between the inner shroud portions 13 and the springs 15 act between the inner shroud portions 13 and the springs 15 . the above - described sliding converts vibrational energy of the airfoil portions 12 and the inner shroud portions 13 into frictional energy , such as thermal energy and so forth , thereby damping the vibrations in the stator blades 10 . with the above - described configuration , when the airfoil portions 12 and the inner shroud portions 13 vibrate and slide relative to the seal holder 14 , the springs 15 , which have been pressing the inner shroud portions 13 in the direction away from the seal holder 14 , and the inner shroud portions 13 relatively move ; that is , the springs 15 and the inner shroud portions 13 slide . accordingly , energy associated with the vibrations in the airfoil portions 12 and the inner shroud portions 13 is converted into thermal energy ( frictional energy ) due to sliding , thereby making it possible to damp the vibrations in the airfoil portions 12 and the inner shroud portions 13 . furthermore , because the compression level of the springs 15 is adjusted by moving the spacer 16 closer to the inner shroud portions 13 , the force with which the springs 15 press the inner shroud portions 13 is adjusted . in other words , because the frictional force between the springs 15 and the inner shroud portions 13 is adjusted , it is possible to adjust the level of damping of vibrations in the airfoil portions 12 and the inner shroud portions 13 . on the other hand , the springs 15 can be easily replaced by attaching / detaching the springs 15 , together with the seal holder 14 , to / from the inner shroud portions 13 by sliding them . accordingly , even if the springs 15 become deteriorated due to wear from long - term use , the springs 15 can easily be replaced . in addition , the springs 15 are disposed inside the space surrounded by the seal holder 14 and the inner shroud portions 13 ; therefore , even if the springs 15 break , it is possible to prevent them from leaping out of the space to damage the airfoil portions 12 . furthermore , by moving the spacer 16 closer to the inner shroud portions 13 , the biasing force of the springs 15 is received by the inner shroud portions 13 and the spacer 16 . in other words , the biasing force of the springs 15 does not act on the seal holder 14 . accordingly , when moving the seal holder 14 by sliding it relative to the inner shroud portions 13 or when attaching / detaching the seal holder 14 , the frictional force that acts at contact surfaces between the inner shroud portions 13 and the seal holder 14 is reduced , thereby making it possible to facilitate the sliding movement or attaching / detaching . because the inner shroud portions 13 are independently disposed for each of the plurality of the airfoil portions 12 , the individual airfoil portions 12 and the inner shroud portions 13 readily move relative to the springs 15 , as compared with the case in which the plurality of the inner shroud portions 13 are integrally formed . in other words , the sliding distance between the inner shroud portions 13 and the springs 15 is extended . accordingly , a greater amount of energy associated with the vibrations in the airfoil portions 12 and the inner shroud portions 13 is converted into thermal energy ( frictional energy ) due to sliding , and therefore , the vibrations in the airfoil portions 12 and the inner shroud portions 13 are more readily damped . on the other hand , because a single seal holder 14 is provided for the plurality of the airfoil portions 12 and the inner shroud portions 13 , the sealing level between the upstream side and the downstream side of the stator blades 10 can be increased as compared with the case in which the seal holders 14 are disposed for each of the plurality of the airfoil portions 12 and the inner shroud portions 13 . by employing plate - like springs formed into a wave - like shape as the springs 15 , a larger pressing force can be exerted on the inner shroud portions 13 as compared with the case in which other types of springs are employed . on the other hand , by making each of the peak portions of the springs 15 individually contact the inner shroud portions 13 , the plurality of the inner shroud portions 13 can be moved , by sliding them , with respect to a single spring 15 . the spacer 16 can be moved closer to the inner shroud portions 13 using the compressing bolts 18 . accordingly , the compression level of the springs 15 is adjusted , thereby adjusting the force with which the springs 15 press the inner shroud portions 13 . in other words , because the frictional force between the springs 15 and the inner shroud portions 13 is adjusted , it is possible to adjust the level of damping of vibrations in the airfoil portions 12 and the inner shroud portions 13 . on the other hand , by moving the spacer 16 closer to the inner shroud portions 13 , the biasing force of the springs 15 is received by the inner shroud portions 13 and the spacer 16 . accordingly , when moving the seal holder 14 by sliding it relative to the inner shroud portions 13 or when attaching / detaching the seal holder 14 , the frictional force that acts at contact surfaces between the inner shroud portions 13 and the seal holder 14 is reduced , thereby making it possible to facilitate the sliding movement or attaching / detaching . fig7 is a schematic diagram for explaining yet another arrangement example of the springs in fig3 . note that , two springs 15 may be disposed between the inner shroud portions 13 and the spacer 16 , as in the embodiment described above , or , as shown in fig7 , four springs 15 may be disposed between the inner shroud portions 13 and the spacer 16 ; the number of the springs 15 is not particularly limited . furthermore , the spacer 16 may be pressed toward the inner shroud portions 13 by screwing the compressing bolts 18 onto the inner shroud portions 13 as in the above - described embodiment , or the spacer 16 may be pressed toward the inner shroud portions 13 by screwing the pressing springs 15 onto the seal holder 14 to thereby press the tip of the pressing springs 15 against the spacer 16 ; it is not particularly limited . as in the embodiment described above , the gas turbine 1 may be operated in a state in which the spacer 16 remains between the seal holder 14 and the inner shroud portions 13 , or the gas turbine 1 may be operated with the spacer 16 removed from between the seal holder 14 and the inner shroud portions 13 ; it is not particularly limited . as in the embodiment described above , the spring force of the springs 15 may be adjusted by adjusting the compression level of the springs 15 using the compressing bolts 18 or , even in a state in which the compressing bolts 18 are removed , the spring force of the springs 15 may be adjusted by adjusting only the plate thickness of the spacer 16 ; it is not particularly limited . a gas turbine according to a second embodiment of the present invention will be described with reference to fig8 to 15 . note that , in this embodiment , turbine blades of the invention of the present application will be described as applied to stator blades of first to fourth stages in the compressor 2 of the gas turbine 1 . fig8 is a schematic diagram for explaining the configuration of a rotor disc and stator blades in a compressor of a gas turbine according to this embodiment . as shown in fig1 and 8 , the compressor 2 is provided with stator blades ( turbine blades ) 110 that are attached to a casing 6 of the gas turbine 1 and rotor blades that are disposed at a circumferential surface of a circular plate - shaped rotor disc ( not shown ) which is rotationally driven by the rotational shaft 5 . the stator blades 110 and the rotor blades are disposed in rows in the circumferential direction of the rotational shaft 5 at regular intervals and are disposed in alternating rows in the axial direction of the rotational shaft 5 . next , the stator blades 110 , which are the feature of this embodiment , will be described . fig9 is a cross - sectional view for explaining the configuration near a seal holder in the stator blade in fig8 . as shown in fig8 and 9 , the stator blades 110 are provided with an outer shroud portion 111 , airfoil portions 112 , inner shroud portions ( shroud portions ) 113 , a seal holder ( holder casing ) 114 , springs ( elastic portions ) 115 , damping plates ( friction portions ) 116 , and a honeycomb seal 117 . as shown in fig8 , the outer shroud portion 111 is a member that forms part of wall surfaces of a flow channel in which fluid flows in the compressor 2 . furthermore , the outer shroud portion 111 is a curved plate - like member disposed at end portions of the airfoil portions 112 on the radially outer side thereof , and a single outer shroud portion 111 is disposed for a plurality of the airfoil portions 112 . in other words , the outer shroud portion 111 is formed of a cylindrical member that has been divided into a plurality of portions , and the plurality of the airfoil portions 112 are connected to an inner circumferential surface thereof . with regard to the shape of the outer shroud portion 111 and the connection method with the airfoil portions 112 , any known shapes and methods can be employed ; they are not particularly limited . as shown in fig8 , the airfoil portions 112 are members whose cross - sections extending in the radial direction of the rotational shaft 5 are formed in airfoil shapes and that , together with the rotor blades rotationally driven by the rotational shaft 5 , compress a fluid , such as air , and send it toward the combustor 3 . the airfoil portions 112 are provided with leading edges le , which are upstream - end portions relative to a flow of surrounding fluid , trailing edges te , which are downstream - end portions , negative pressure surfaces , which are surfaces curved in convex shapes , and positive pressure surfaces , which are curved in concave shapes . as shown in fig8 and 9 , the inner shroud portions 113 , as well as the outer shroud portion 111 , form part of the flow channel in which the fluid flows inside the compressor 2 . furthermore , the inner shroud portions 113 are curved plate - like members disposed at end portions of the airfoil portions 112 on radially inner side thereof , and a single inner shroud portion 113 is disposed for a single airfoil portion 112 . in other words , the inner shroud portions 113 are formed of a cylindrical member that has been divided into a plurality of portions , and the airfoil portions 112 are connected to outer circumferential surfaces thereof . fitting grooves 113 a that fit with the seal holder 144 , extending in the circumferential direction ( direction perpendicular to the plane of the drawing in fig9 ), are provided at end portions on the leading edge le side and trailing edge te side of the inner shroud portions 113 . as shown in fig9 , the seal holder 114 is a member that is attached to the inner shroud portions 113 on the inner circumferential side thereof ( bottom side in fig9 ), that , together with the inner shroud portions 113 , forms a space for accommodating the springs 115 and the damping plates 116 inside thereof , and that supports the honeycomb seal 117 . as with the outer shroud portion 114 , a single seal holder 114 is disposed for the plurality of the airfoil portions 112 and the inner shroud portions 113 . the seal holder 114 is provided with a pair of side wall portions 114 s that extend in radial directions at the leading edge le side and the trailing edge te side and a bottom plate portion 114 b which connects end portions of the pair of side wall portions 114 s at the radially inner side thereof . in other words , a groove portion is formed in the seal holder 114 , opening outward in the circumferential direction ( top side in fig9 ). the radially outer - side end portions of the side wall portions 114 s are provided with protrusions 114 a which protrude inward in the seal holder 114 , extending in the circumferential direction thereof , and fit with the fitting grooves 113 a of the inner shroud portions 113 . the bottom plate portion 114 b is provided with through - holes 114 h into which compressing bolts ( compressing portions ) 118 that press the damping plates 116 together with the springs 115 are inserted . the through - holes 114 h are provided in the bottom plate portion 114 b at an equidistant position from each of the pair of side wall portions 114 s and a plurality thereof are provided in the circumferential direction ( direction perpendicular to the plane of the drawing in fig9 ) at predetermined intervals . as shown in fig8 and 9 , the springs 115 are elastic members that bias the inner shroud portions 113 and the damping plates 116 in directions that separate them from the seal holder 114 . furthermore , the springs 115 , together with the damping plates 116 , damp the vibrations in the stator blades 110 , i . e ., the airfoil portions 112 , and the inner shroud portions 113 . in this way , by having the springs 115 bias the inner shroud portions 113 in the directions that separate them from the seal holder 114 , the fitting grooves 113 a and the protrusions 114 a are pressed together , coming into close contact with each other , thereby making it possible to ensure the sealing level between the inner shroud portions 113 and the seal holder 114 . the springs 115 are substantially rectangularly formed plate springs that are formed into substantially a wave shape , and the spring force of the springs 115 is adjusted by adjusting the plate thickness of the plate springs . with regard to the material forming the springs 115 , the material is desirably capable of maintaining the required spring properties while the gas turbine 1 is in operation , that is , even if the springs 115 are heated to high temperature . the springs 115 are disposed in the space formed between the inner shroud portions 113 and the seal holder 114 , more specifically , between the seal holder 114 and the damping plates 116 . furthermore , a total of two springs 115 , one on the leading edge le side and another on the trailing edge te side , are disposed in a parallel arrangement . in this embodiment , descriptions will be given as applied to an example in which these two springs 115 are disposed at the same phase , in other words , an example in which peak portions of the two springs 115 come in contact with the damping plates 16 or the seal holder 114 at the same positions . fig1 is a schematic diagram for explaining another arrangement example of the springs in fig9 . note that , the two springs 115 may be disposed at the same phase , as described above , or they may be disposed at different phases , as shown in fig1 ; it is not particularly limited . with the arrangement of the springs 115 shown in fig1 , at locations where the peak portions of the first spring 115 are in contact with the damping plates 116 , the peak portions of the other spring 115 are in contact with the seal holder 114 . by doing so , it is possible to make the springs 115 contact all of the damping plates 116 , even when arrangement intervals of the peak portions in the first spring 115 are wider than arrangement intervals of the inner shroud portions 113 and the damping plates 116 . that is , the damping plates 116 with which the peak portions of the first spring 115 are not in contact are in contact with the peak portions of the other spring 115 , thereby making it possible to have all of the damping plates 116 in contact with the springs 115 . the shapes of the springs 115 are determined such that the amplitude of the wave shape ( peak - to - peak distance in the radial direction ) is longer than the distance from the outer circumferential surfaces of the damping plates 116 to the inner circumferential surface of the seal holder 114 and so that the peak portions of the springs 115 are in contact with the inner circumferential surfaces of individual damping plates 116 . more specifically , the amplitude of the wave shape in the springs 115 is determined on the basis of the frictional force for damping the vibrations of the stator blades 110 , that is , the compression level of the springs 115 required for generating the spring force . the wavelength ( peak - to - peak distance in the circumferential direction ) in the wave shape of the springs 115 is determined on the basis of the arrangement intervals of the inner shroud portions 113 and damping plates 116 , that is , the pitch thereof . as shown in fig9 , the damping plates 116 are pressed against the inner circumferential surfaces of the inner shroud portions 113 by the springs 15 and are disposed between the inner shroud portions 113 and the springs 115 . as with the inner shroud portions 113 , one damping plate 116 is disposed for each of the plurality of the airfoil portions 112 and the inner shroud portions 113 . fig1 is a schematic diagram for explaining the configuration of the damping plates in fig9 . the damping plates 116 are provided with bolt holes 116 h into which the compressing bolts 118 are screwed and relief grooves 116 g formed on surfaces facing the inner shroud portions 113 . the bolt holes 116 h are female screw holes formed substantially at the center of the damping plates 116 and the compressing bolts 118 are screwed thereinto . first end portions of the compressing bolts 118 are screwed into the bolt holes 116 h of the damping plates 116 . second end portions of the compressing bolts 118 are inserted into the through - holes 114 h of the seal holder 114 . the nuts ( compressing portions ) 119 , which compress the springs 115 together with the compressing bolts 118 , are threaded onto the second end portions of the compressing bolts 118 . as shown in fig9 and 11 , the relief grooves 116 g are grooves formed on the surfaces ( top - side surfaces in fig9 and 11 ) of the damping plates 116 facing the inner shroud portions 113 . in addition , the relief grooves 116 g are grooves extending in the direction parallel to the direction in which the rotational shaft 5 extends ( direction perpendicular to the plane of the drawing in fig9 ), in other words , grooves extending in a direction that intersect with , more preferably a direction perpendicular to , the direction in which the damping plates 116 and the inner shroud portions 113 slide . by providing the relief grooves 116 g in this way , the surfaces of the damping plates 116 that come into contact with the inner shroud portions 113 are divided into two with the relief grooves 116 g therebetween , and each surface comes into contact with the inner shroud portions 113 . accordingly , even if the inner shroud portions 113 and the damping plates 116 slide , the inner shroud portions 113 and the damping plates 116 come into stable contact at the above - described two surfaces , thereby preventing the occurrence of problems such as partial contact or the like . as shown in fig9 , the honeycomb seal 117 , together with seal fins 122 provided in a rotor 21 , suppresses leakage of a fluid that flows between the stator blades 110 and the rotor 21 . any known honeycomb seal may be used as the honeycomb seal 117 ; it is not particularly limited . next , an assembly method of the stator blades 110 having the above - described configuration will be described . fig1 is a schematic diagram for explaining attaching and detaching of the seal holder in the stator blades in fig9 . first , the springs 115 and the damping plates 116 are disposed inside the seal holder 114 , and the second end portions of the compressing bolts 118 are inserted into the through - holes 114 h of the seal holder 114 . then , by threading the nuts 119 on the second end portions of the compressing bolts 118 , the damping plates 116 are brought closer to the bottom plate portion 114 b of the seal holder 114 , thereby compressing the springs 115 . at this time , the distance from the outer circumferential surface of the bottom plate portion 114 b to the outer circumferential surfaces of the damping plates 116 is made shorter than the distance from the outer circumferential surface of the bottom plate portion 114 b to the inner circumferential surfaces of the inner shroud portions 113 . subsequently , the seal holder 114 is fitted to the inner shroud portions 113 . more specifically , the protrusions 114 a of the seal holder 114 are fitted to the fitting grooves 113 a in the inner shroud portions 113 . at this time , the seal holder 114 is fitted while sliding it in the circumferential direction relative to the inner shroud portions 113 . fig1 is a schematic diagram for explaining the state after the seal holder is attached to the stator blade in fig9 . then , as shown in fig1 , the nuts 119 are removed from the compressing bolts 118 , and the damping plates 116 are brought into contact with the inner shroud portions 113 , thereby completing the attaching of the seal holder 114 . the seal holder 114 is removed by carrying out the above - described steps sequentially in reverse order . note that , the compressing bolts 118 may be left attached to the damping plates 116 , as described above , or they may be removed from the damping plates 116 ; it is not particularly limited . next , a method of damping vibrations in the stator blades 110 having the above - described configuration will be described . when the gas turbine 1 is operated , vibrations are generated in the stator blades 110 due to the influence of the fluid or the like flowing in the compressor 2 . more specifically , vibrations are generated by which the airfoil portions 112 and the inner shroud portions 113 of the stator blades 110 vibrate in the circumferential direction . when the inner shroud portions 113 vibrate as described above , sliding occurs between the damping plates 116 , which are pressed against the inner shroud portions 113 , and the inner circumferential surfaces of the inner shroud portions 113 . the pressing force of the springs 115 and the frictional force in accordance with the friction coefficient between the inner shroud portions 113 and the damping plates 116 act between the inner shroud portions 113 and the damping plates 116 . the above - described sliding converts vibrational energy of the airfoil portions 112 and the inner shroud portions 113 into frictional energy , such as thermal energy and so forth , thereby damping the vibrations in the stator blades 110 . with the above - described configuration , when the airfoil portions 112 and the inner shroud portions 113 vibrate and slide relative to the seal holder 114 , the damping plates 116 , which have been pressed against the inner shroud portions 113 , and the inner shroud portions 113 relatively move ; that is , the damping plates 116 and the inner shroud portions 113 slide . accordingly , energy associated with the vibrations in the airfoil portions 112 and the inner shroud portions 113 is converted into thermal energy ( frictional energy ) due to the sliding , thereby making it possible to damp the vibrations in the airfoil portions 112 and the inner shroud portions 113 . on the other hand , by moving the damping plates 116 closer to the seal holder 114 , the biasing force of the springs 115 is received by the damping plates 116 and the seal holder 114 . in other words , the biasing force of the springs 115 does not act on the inner shroud portions 113 . accordingly , when moving the seal holder 114 by sliding it relative to the inner shroud portions 113 or when attaching / detaching the seal holder 114 , the frictional force that acts at contact surfaces between the inner shroud portions 113 and the seal holder 114 is reduced , thereby making it possible to facilitate the sliding movement or attaching / detaching . furthermore , the springs 115 can be easily replaced by attaching / detaching the springs 115 , together with the seal holder 114 , to / from the inner shroud portions 113 by sliding them . accordingly , even if the springs 115 become deteriorated due to wear from long - term use , the springs 115 can easily be replaced . in addition , the springs 115 are disposed inside the space surrounded by the seal holder 114 and the inner shroud portions 113 ; therefore , even if the springs 115 break , it is possible to prevent them from leaping out of the space to damage the airfoil portions 112 . because the inner shroud portions 113 are independently disposed for each of the plurality of the airfoil portions 112 , the individual airfoil portions 112 and the inner shroud portions 113 readily move relative to the damping plates 116 , as compared with the case in which the plurality of the inner shroud portions 113 are integrally formed . in other words , the sliding distance between the inner shroud portions 113 and the damping plates 116 is extended . accordingly , a greater amount of energy associated with the vibrations in the airfoil portions 112 and the inner shroud portions 113 is converted into thermal energy ( frictional energy ) due to sliding , and therefore , the vibrations in the airfoil portions 112 and the inner shroud portions 113 are more readily damped . on the other hand , because a single seal holder 114 is provided for the plurality of the airfoil portions 112 and the inner shroud portions 113 , the sealing level between the upstream side and the downstream side of the stator blades 110 can be increased as compared with the case in which the seal holders 114 are disposed for each of the plurality of the airfoil portions 112 and the inner shroud portions 113 . by employing springs formed into a wave - like shape as the springs 115 , a larger pressing force can be exerted on the inner shroud portions 113 as compared with the case in which other types of springs are employed . on the other hand , by making each of the peak portions of the springs 115 individually contact the damping plates 116 , the plurality of the damping plates 116 are pressed against the inner shroud portions 113 by a single spring . because the compressing bolts 118 protrude from the damping plates 116 penetrating the seal holder 114 , the compressing bolts 118 and the damping plates 116 are movable in directions toward and away from the seal holder 114 , while being restricted in movement in the direction that intersects with the direction of movement toward / away from the seal holder 114 ; that is , movement in the circumferential direction of the rotational shaft 5 is restricted . accordingly , it is ensured that sliding occurs between the inner shroud portions 113 and the damping plates 116 . fig1 is a schematic diagram for explaining yet another arrangement example of the springs in fig3 . note that , two springs 115 may be disposed between the damping plates 116 and the seal holder 114 , as in the embodiment described above , or , as shown in fig1 , four springs 115 may be disposed between the damping plates 116 and the seal holder 114 ; the number of the springs 115 is not particularly limited . fig1 is a schematic diagram for explaining another configuration of the seal holder in fig9 . note that , as in the above - described embodiment , the honeycomb seal 117 may be disposed in the seal holder 114 , and the seal fins 122 may be disposed at the rotor 21 or , as shown in fig1 , seal fins 122 may be disposed in the seal holder 114 , configuring them as a labyrinth seal in which steps are provided at positions that face the seal fins 122 of the rotor 21 ; it is not particularly limited . as in the embodiment described above , the spring force of the springs 115 may be adjusted by adjusting the compression level of the springs 115 using compressing bolts 118 and the nuts 119 or , even in a state in which the nuts 119 are removed , the spring force of the springs 115 may be adjusted by adjusting only the plate thickness of the damping plates 116 ; it is not particularly limited . a gas turbine according to a third embodiment of this invention will now be described with reference to fig1 and fig1 to 19 . note that , in this embodiment , turbine blades of the invention of the present application will be described as applied to stator blades of first to third , fifth to seventeenth , or tenth to fourteenth stages in the compressor 2 of the gas turbine 1 . fig1 is a schematic diagram for explaining the configuration of a rotor disc and stator blades in a compressor of a gas turbine according to this embodiment . as shown in fig1 and 16 , the compressor 2 is provided with stator blades ( turbine blades ) 210 that are attached to a casing 6 of the gas turbine 1 and rotor blades that are disposed at a circumferential surface of a circular plate - like rotor disc ( not shown ) which is rotationally driven by the rotational shaft 5 . the stator blades 210 and the rotor blades are disposed in rows in the circumferential direction of the rotational shaft 5 at regular intervals and are disposed in alternating rows in the axial direction of the rotational shaft 5 . next , the stator blades 210 , which are the feature of this embodiment , will be described . fig1 is a cross - sectional view for explaining the configuration near a seal holder in the stator blades in fig1 . in this embodiment , the stator blades 210 will be described as applied to stator blades with fixed pitch , in other words , stator blades with fixed angles of attack with respect to the flow of the fluid flowing inside the compressor 2 . as shown in fig1 and 17 , the stator blades 210 are provided with an outer shroud portion 211 , airfoil portions 212 , inner shroud portions ( shroud portions ) 213 , a seal holder ( holder casing ) 214 , springs ( elastic portions ) 215 , and a honeycomb seal 217 . as shown in fig1 , the outer shroud portion 211 is a member that forms part of wall surfaces of a flow channel in which fluid flows in the compressor 2 . furthermore , the outer shroud portion 211 is a curved plate - like member disposed at end portions of the airfoil portions 212 on the radially outer side thereof , and a single outer shroud portion 211 is disposed for a plurality of the airfoil portions 212 . in other words , the outer shroud portion 211 is formed of a cylindrical member that has been divided into a plurality of portions , and the plurality of the airfoil portions 212 are connected to an inner circumferential surface thereof . with regard to the shape of the outer shroud portion 211 and the connection method with the airfoil portions 212 , any known shapes and methods can be employed ; they are not particularly limited . as shown in fig1 , the airfoil portions 212 are members whose cross - sections extending in the radial direction of the rotational shaft 5 are formed in airfoil shapes and that , together with the rotor blades rotationally driven by the rotational shaft 5 , compress a fluid such as air and send it toward the combustor 3 . the airfoil portions 212 are provided with leading edges le , which are upstream - end portions relative to a flow of surrounding fluid , trailing edges te , which are downstream - end portions , negative pressure surfaces , which are surfaces curved in convex shapes , and positive pressure surfaces , which are curved in concave shapes . as shown in fig1 and 17 , the inner shroud portions 213 , as well as the outer shroud portion 211 , form part of the flow channel in which the fluid flows inside the compressor 2 . furthermore , the inner shroud portions 213 are curved plate - like members disposed at end portions of the airfoil portions 212 on radially inner side thereof , and a single inner shroud portion 213 is disposed for a single airfoil portion 212 . in other words , the inner shroud portions 213 are formed of a cylindrical member that has been divided into a plurality of portions , and the airfoil portions 212 are connected to outer circumferential surfaces thereof . fitting grooves 213 a that fit with the seal holder 214 , extending in the circumferential direction ( direction perpendicular to the plane of the drawing in fig1 ), are provided at end portions on the leading edge le side and trailing edge te side of the inner shroud portions 213 . as shown in fig1 , the seal holder 214 is a member that is attached to the inner shroud portions 213 on the inner circumferential side thereof ( bottom side in fig1 ), that , together with the inner shroud portions 213 , forms a space for accommodating the springs 215 inside thereof , and that supports the honeycomb seal 217 . as with the outer shroud portion 211 , a single seal holder 214 is disposed for the plurality of the airfoil portions 212 and the inner shroud portions 213 . the seal holder 214 is provided with a pair of side wall portions 214 s that extend in radial directions at the leading edge le side and the trailing edge te side and a bottom plate portion 214 b which connects end portions of the pair of side wall portions 214 s at radially inner side thereof . in other words , a groove portion is formed in the seal holder 214 , opening outward in the circumferential direction ( top side in fig1 ). the radially outer - side end portions of the side wall portions 214 s are provided with protrusions 214 a which protrude inward in the seal holder 214 , extending in the circumferential direction thereof , and fit with the fitting grooves 213 a of the inner shroud portions 213 . as shown in fig1 and 17 , the springs 215 are elastic members that bias the inner shroud portions 213 in directions that separate them from the seal holder 214 . furthermore , by sliding on the inner shroud portions 213 , the springs 215 damp the vibrations in the stator blades 210 , i . e ., the airfoil portions 212 , and the inner should portions 213 . in this way , by having the springs 215 bias the inner shroud portions 213 in the directions that separate them from the seal holder 214 , the fitting grooves 213 a and the protrusions 214 a are pressed together , coming into close contact with each other , thereby making it possible to ensure the sealing level between the inner shroud portions 213 and the seal holder 214 . the springs 215 are substantially rectangularly formed plate springs that are formed into substantially a wave shape , and the spring force of the springs 215 is adjusted by adjusting the plate thickness of the plate springs . with regard to the material forming the springs 215 , the material is desirably capable of maintaining the required spring properties while the gas turbine 1 is in operation , that is , even if the springs 215 are heated to high temperature . the springs 215 are disposed in a space formed between the inner shroud portions 213 and the seal holder 214 , more specifically , between the inner shroud portions 213 and the seal holder 214 . furthermore , a total of two springs 215 , one on the leading edge le side and another on the trailing edge te side , are disposed in a parallel arrangement . in this embodiment , descriptions will be given as applied to an example in which these two springs 215 are disposed at the same phase , in other words , an example in which peak portions of the two springs 215 come in contact with the inner shroud portions 213 or the seal holder 214 at the same positions . fig1 is a schematic diagram for explaining another arrangement example of springs in fig1 . note that , the two springs 215 may be disposed at the same phase , as described above , or they may be disposed at different phases , as shown in fig1 ; it is not particularly limited . with the arrangement of the springs 215 shown in fig1 , at locations where the peak portions of the first spring 215 are in contact with the inner shroud portions 213 , the peak portions of the other spring 215 are in contact with the seal holder 214 . by doing so , it is possible to make the springs 215 contact all of the inner shroud portions 213 , even when arrangement intervals of the peak portions in the first spring 215 are wider than arrangement intervals of the inner shroud portions 213 . that is , the inner shroud portions 213 with which the peak portions of the first spring 215 are not in contact are in contact with the peak portions of the other spring 215 , thereby making it possible to have all of the inner shroud portions 213 in contact with the springs 215 . the shapes of the springs 215 are determined such that the amplitude of the wave shape ( peak - to - peak distance in the radial direction ) is longer than the distance from the inner circumferential surfaces of the inner shroud portions 213 to the outer circumferential surface of the seal holder 214 and so that the peak portions of the springs 215 are in contact with the inner circumferential surfaces of individual inner shroud portions 213 . more specifically , the amplitude of the wave shape in the springs 215 is determined on the basis of the frictional force for damping the vibrations of the stator blades 210 , that is , the compression level of the springs 215 required for generating the spring force . the wavelength ( peak - to - peak distance in the circumferential direction ) in the wave shape of the springs 215 is determined on the basis of the arrangement intervals of the inner shroud portions 213 , that is , the pitch , thereof . as shown in fig1 , the honeycomb seal 217 , together with seal fins 222 provided in the rotor 21 , suppresses leakage of a fluid that flows between the stator blades 210 and the rotor 21 . any known honeycomb seal may be used as the honeycomb seal 217 ; it is not particularly limited . next , a method of damping vibrations in the stator blades 210 having the above - described configuration will be described . when the gas turbine 1 is operated , vibrations are generated in the stator blades 210 due to the influence of the fluid or the like flowing in the compressor 2 . more specifically , vibrations are energized by which the airfoil portions 212 and the inner shroud portions 213 of the stator blades 210 vibrate in the circumferential direction . when the inner shroud portions 213 vibrate as described above , sliding occurs between the peak portions of the springs 215 , which are pressed against the inner shroud portions 213 , and the inner circumferential surfaces of the inner shroud portions 213 . the pressing force of the springs 215 and the frictional force in accordance with the friction coefficient between the inner shroud portions 213 and the springs 215 act between the inner shroud portions 213 and the springs 215 . the above - described sliding converts vibrational energy of the airfoil portions 212 and the inner shroud portions 213 into thermal energy , such as frictional energy and so forth , thereby damping the vibrations in the stator blades 210 . with the above - described configuration , when the airfoil portions 212 and the inner shroud portions 213 vibrate and slide relative to the seal holder 214 , the springs 215 and the inner shroud portions 213 relatively move ; that is , the springs 215 and the inner shroud portions 213 slide . accordingly , energy associated with the vibrations in the airfoil portions 212 and the inner shroud portions 213 is converted into thermal energy ( frictional energy ) due to the sliding , thereby making it possible to damp the vibrations in the airfoil portions 212 and the inner shroud portions 213 . on the other hand , the springs 215 can be easily replaced by attaching / detaching the springs 215 , together with the seal holder 214 , to / from the inner shroud portions 213 by sliding them . accordingly , even if the springs 215 become deteriorated due to wear from long - term use , the springs 215 can easily be replaced . in addition , the springs 215 are disposed inside the space surrounded by the seal holder 214 and the inner shroud portions 213 ; therefore , even if the springs 215 break , it is possible to prevent them from leaping out of the space to damage the airfoil portions 212 . because the inner shroud portions 213 are independently disposed for each of the plurality of the airfoil portions 212 , the individual airfoil portions 212 and the inner shroud portions 213 readily move relative to the springs 215 , as compared with the case in which the plurality of the inner shroud portions 213 are integrally formed . in other words , the sliding distance between the inner shroud portions 213 and the springs 215 is extended . accordingly , a greater amount of energy associated with the vibrations in the airfoil portions 212 and the inner shroud portions 213 is converted into thermal energy ( frictional energy ) due to sliding , and therefore , greater damping of the vibrations in the airfoil portions 212 and the inner shroud portions 213 is possible . fig1 is a schematic diagram for explaining yet another arrangement example of the springs in fig1 . note that , two springs 215 may be disposed between the inner shroud portions 213 and the seal holder 214 , as in the embodiment described above , or , as shown in fig1 , four springs 215 may be disposed between the inner shroud portions 213 and the seal holder 214 ; the number of the springs 215 is not particularly limited . note that , the technical scope of the present invention is not limited to the embodiments described above , and various alterations are permissible within a range that does not depart from the gist of the present invention . for example , in the above - described embodiments , turbine blades of this invention have been described as applied to stator blades of a gas turbine compressor ; however , application to stator blades of a turbine unit of a gas turbine is also possible . | 5 |
an important aspect of the invention is the release module and its manufacture . for reasons of ease and versatility of the product , using classical techniques and ordinary compressing machines , it has been possible to produce a release module having the shape of a cylindrical polymer matrix with one concave base and the other convex ( fig1 and 2 ). one of the reasons for this new geometry is that it favors the assembly of the release modules , to obtain a system that cannot be made directly , in which to change the kinetics according to the type of assembly . to increase the capacity of the release modules to remain assembled together and to control drug release , a component may be introduced into the composition such as a swelling and gelling hydrophilic polymer , generally , but not necessarily , with a high molecular weight . in this case the composition of the module is that of a hydrophilic matrix . these types of polymer are easily available on the market , for example , as illustration without limitation , hydroxypropylmethylcellulose , known by the commercial name methocel ® hydroxypropyl methylcellulose in grades k4m , k15m and k100m ( dow chemical company ); or other polymers such as xanthan gum , pectin , carrageenans , guar gum . the quantity of these polymers used to obtain the control of the release of active principle by the release module is that commonly described in the literature , and varies preferably between 20 and 60 % weight / weight referred to the total composition of the matrix which may also comprise excipients generally considered safe as well as the active principle which may be any one of the active principles contemplated by the pharmacopoeia for oral administration . with respect to the total composition , the contribution of the active principle varies preferably between 80 % and 0 . 0001 % weight / weight . the inventors of the present patent application have found that the assembly of the release modules making up the finished system (“ assembly ”) can be easily obtained , including in the release module a polymer with strong adhesive properties such as sodium carboxymethylcellulose , carboxypolymethylene , hydroxypropylcellulose , hydroxypropylmethylcellulose , methylcellulose , polymethacrylate or others . in this way , the release system can be obtained by inserting the release modules in a hard gelatine capsule , in the sequence concave face against convex face , so that they are in close contact with each other in forming the assembly . when the gelatine capsule is immersed in the gastric fluid at 37 ° c ., the gelatine component softens and dissolves , creating , around the pile of modules inserted in the capsule , a layer of sticky material which holds them together for a brief period due to the complete dissolving of the gelatine . during this period the gastric fluid also comes in contact with the modules included in the capsule . they are thus able to gel on the outside , giving rise to a sticky layer which welds them very firmly together . a cylindrical assembly is thus obtained ( with one concave base and the other convex , as in fig4 ), having the same base area as the modules of which it is composed , with a height smaller than the sum of the individual heights of the single modules . this cylinder , which possesses an unusual geometry for pharmaceutical forms , may ( in the case of polymers with a low apparent density ), but need not , show the capacity to float due to the intrinsic property of the modules of which it is composed . it is subject to a very slow phenomenon of swelling and dissolving , which guarantees slow drug release and self - destruction only at the end of the drug release period . since the individual modules are assembled to obtain various release systems , in some situations it is preferable that they are assembled in such a way as to produce an assembly in which the various individual modules are even more firmly fitted and stuck together . in this case the gluing of the modules fitted convex face into concave face ( fig4 ) is further strengthened with a solution or suspension of a biocompatible polymer such as ethylcellulose , cellulose acetate phthalate or other polymers , but also with an aqueous solution of water - soluble polymers such as high - viscosity carboxymethylcellulose . alternatively , the welding of the modules may also be obtained by means of thermal welding or ultrasound welding . moreover , the inventors of the present patent application have found that , in the case where the modules are welded two by two , concave face against concave face , the resulting assembly , due to the formation of an insulated internal cavity ( fig5 ), besides presenting a varied release kinetics , shows the immediate capacity to float in water ( that is even if the apparent density of the polymer matrix exceeds the density of water ). this gluing is achieved : by placing in contact the concave faces of the cylindrical modules , on which a small amount of adhesive polymer solution has been applied , or by means of thermal welding or ultrasound welding . the inventors of the present patent application have also discovered the possibility of creating a floating release system by combining cylindrical modules with one concave and one convex base ( or with one concave base and the other flat , or with two concave bases ), with other “ simple ” cylindrical elements with flat bases . the modules with a concave and a convex base according to the invention are intended to give floating capacity ( and therefore so - called “ auxiliary ” modules can , but need not , be used , that is to say modules without active principle , that is composed of biocompatible polymers possibly mixed with excipients generally recognized as safe ), whereas the cylindrical elements with flat bases are intended for drug release . this can be achieved by stacking the release element between two or more floating modules depending on its weight . in fact , by placing both flat faces of the release element in contact with a concave base of the floating module , two float chambers are created which are able to develop a total buoyancy able to render floating the new assembly thus obtained . in particular , for the functioning of the finished assembly the release element must be firmly glued to two or more floating modules . in this case the swelling of the two or more floating modules does not interfere with drug release , which takes place through the exposed surface of the release element . after the floating phase , the whole system is slowly destroyed . in this variation , to further strengthen the floating power , the floating module may be composed of a mixture of a hydrophilic polymer and a low - density hydrophobic component ( that is one that reduces the apparent density of the overall polymer matrix ). by contact with the gastric fluid or with water , it rapidly reaches a stable floating situation . in order to ensure the correct functioning of the floating element , the composition of the mixture that must provide the hydrostatic thrust is essential . the inventors of the present patent application have found that the maximum result can be obtained by mixing a hydrophobic substance with a hydrophilic one , so as to give the module the lowest possible true density , together with a certain hydrophobia which favors the immediate floating of the element . as a hydrophilic substance for making the floating layer it is possible to use gellable and soluble biocompatible polymers such as : polyvinylpyrrolidone , hydroxypropylmethylcellulose , carboxymethyl cellulose , hydroxypropylcellulose , hydroxyethylcellulose , carboxypolymethylene , gums such as guar gum , xanthan gum , chitosanes , gum arabic , gum tragacanth , sodium and calcium alginates , gelatine , pectins . the hydrophobic substances that can be used may be : hydrogenated oils , cetyl , myristic and stearyl alcohol , esters of fatty acids such as glyceryl mono - or distearate . to further increase the buoyancy of the floating module it is also possible to include a mixture of salts able to develop co 2 by contact with gastric fluid : in this case the swelling of the polymer determines the formation of a gelled structure which retains the bubbles of co 2 that have formed , further reducing the apparent density of the polymer matrix . the effervescent mixture may be composed of substances that produce co 2 such as : calcium carbonate , calcium bicarbonate , sodium carbonate , sodium bicarbonate , potassium carbonate , potassium bicarbonate , magnesium carbonate . lastly , as concerns the composition of the drug release element ( cylindrical or polyhedric , with flat bases / faces ), as in the case of the release modules provided by the present invention , it can be given by a mixture of active principle , possible excipients generally recognized as safe and a biocompatible polymer , preferably gellable such as polyvinylpyrrolidone , hydroxypropylmethylcellulose , carboxymethyl - cellulose , sodium and calcium alginates , gum arabic , gum tragacanth . the first example describes the manufacture and operation of a release module containing acyclovir . it is intended for the preparation of a system composed of a capsule containing various modules stacked in such a way as to give an assembly containing a total quantity of 400 mg of acyclovir . x 1 module ( mg ) acyclovir 100 hydroxypropylmethylcellulose 29 . 5 sodium carboxymethylcellulose 29 . 5 nahco 3 12 . 3 talc 6 . 2 mg stearate 1 . 8 125 g of acyclovir are blended with about 33 ml of a solution 8 % p / v of sodium carboxymethylcellulose ( blanose 7lf ). the granulate is obtained by forcing the mixture through the 500μ mesh of the net of an oscillating granulator . the granules are stove - dried with air circulating at 35 ° c . for about 8 hours . the remaining components of the formula are added to the acyclovir granulate and the whole is mixed in a turbula for about 40 minutes . the production of the module by compression is carried out with an alternative tablet press , using special punches with diameter 7 . 4 mm , the drawing of which is shown in fig3 . the weight of each module was 191 . 5 mg , the diameter 7 . 5 mm and the mean height 5 . 5 mm . the speed at which acyclovir is released from the release module was determined at 37 ° c . in artificial gastric fluid with the apparatus 2 usp 24 , vane 50 rpm . the profile of the release of acyclovir from the release module is shown in fig6 ( circles ). about 30 % of the drug was released after 120 minutes and about 70 % after 500 minutes . the kinetics of release from this module , which has one concave and one convex face , was faster than that of a cylindrical matrix with flat faces ( fig6 , rhombi ) having the same composition , prepared with a set of punches with diameter 7 . 4 mm from the same quantity of mixture . such comparative result is shown in fig6 . four release modules , prepared according to the technique described in example 1 , were stacked one on another , with the convex faces fitted into the concave faces and stuck with a 0 . 5 % hydroalcoholic solution ( 2 : 8 ) of hydroxypropylmethylcellulose phthalate ( fig4 ). the speed at which acyclovir is released from the capsule was determined at 37 ° c . in artificial gastric fluid with the apparatus 2 usp 24 , vane 50 rpm . the release of acyclovir from this stacked system of four modules is shown in fig7 ( rhombi ), in comparison with the release from the individual modules ( circles ). in the first 500 minutes the drug release from the four stacked and glued modules was slower and more linear than the release presented by the individual modules . four release modules , prepared according to the technique described in example 1 , were glued two by two , concave face against concave face , wetting the edges of these faces with a 5 % hydroalcoholic solution ( 2 : 8 ) p / v of hydroxypropylmethylcellulose phthalate and joining them with a light pressure , to form two assemblies of two modules ( fig5 ). these assemblies float immediately in the dissolving fluid . the release of acyclovir from these two assemblies ( fig7 , squares ) was faster and more linear than that obtained with the four stacked and glued modules ( fig7 , rhombi ). the example illustrates the preparation of a floating release system which contains the float modules separate from the release elements . for the preparation of 500 floating systems , the following substances are used in the quantities indicated : aluminium hydroxide 95 g polyvinylpyrrolidone 4 g magnesium stearate 1 g hydroxypropylmethylcellulose 75 g ( methocel ® k 100m ) hydrogenated castor oil ( cutina hr ) 15 g sodium carbonate 5 g tartaric acid 5 g granulate the aluminium hydroxide and the active principle with a 1 % aqueous solution of polyvinylpyrrolidone . dry , calibrate on sieve 25 # . mix with magnesium stearate and compress the mixture with a tablet press equipped with flat punches with diameter 7 . 4 mm . mix the components according to the quantities indicated in a turbula ® mixer for 15 minutes and compress the mixture with a tablet press equipped with punches with a concave and a convex face with diameter 7 . 4 mm . for the preparation of the finished assembly , rigid gelatine capsules are used , of the type snap fit ™ 00 , with internal diameter 8 mm and a total closed capsule height of 23 . 4 mm . the floating modules and the release elements are stuck together by means of a 12 . 5 % solution of cellulose acetate phthalate in acetone , before being inserted in the capsule in the following sequence : a thin film of adhesive solution is applied on the concave base of a floating module ; the flat base of the release element is stuck onto this . the gluing operation is repeated , sticking a second floating module onto the second flat base of the release element . for the preparation of 500 floating systems , the following substances are used in the quantities indicated : aluminium hydroxide 95 g polyvinylpyrrolidone 4 g magnesium stearate 1 g crospovidone ( kollidon ® cl ) 96 g tartaric acid 20 g sodium carbonate 24 g hydroxypropylmethylcellulose 54 g ( methocel ® k4m ) talc 4 g magnesium stearate 2 g let half the dose of kollidon ® cl absorb a quantity equal to its own weight of a 1 % aqueous solution of methocel ® k4m hydroxypropyl methylcellulose in which the sodium carbonate has been dissolved . let the mixture dry partly at 80 ° c . for 30 minutes , sieve it , complete drying and sieve it again . let the remaining quantity of kollidon ® cl absorb a quantity equal to its own weight of a 1 % aqueous solution of methocel ® k4m hydroxypropyl methylcellulose in which the tartaric acid has been dissolved . let the mixture dry partly at 80 ° c . for 30 minutes , sieve it , complete drying and sieve it again . to the two mixtures , add the methocel ® k4m hydroxypropyl methylcellulose , the talc and the mg stearate and mix for 20 minutes in a turbula ® mixer . compress the mixture with a tablet press equipped with punches with a concave and a convex face with diameter 7 . 4 mm . granulate the aluminium hydroxide with the active principle and with a 1 % aqueous solution of polyvinylpyrrolidone . dry , calibrate on sieve 25 # and compress the mixture with a tablet press equipped with flat punches with diameter 7 . 4 mm . for the preparation of the finished system , rigid gelatine capsules are used , of the type snap fit ™ 00 , with internal diameter 8 mm and a total closed capsule height of 23 . 4 mm . the floating modules and the release elements are stuck together by means of a 12 . 5 % solution of cellulose acetate phthalate in acetone , before being inserted in the capsule in the following sequence : a thin film of adhesive solution is applied on the base of a release element ; the concave base of the floating element is stuck onto this . the gluing operation is repeated , sticking a second floating module onto the second base of the release element . accordingly , while only a few embodiments of the present invention have been shown and described , it is obvious that many changes and modifications may be made thereunto without departing from the spirit and scope of the invention . | 0 |
a gas turbine component , especially a ceramic matrix composite ( cmc ) ring segment , is described herein with an abradable surface exposed to a hot gas flow . in contrast to prior art , no thermal barrier coating is applied to the exposed surface . instead , the cmc itself is used as its own thermal barrier , but is modified to allow for abradability . the current invention provides an array of depressions directly in the cmc surface to increase its abradability , allowing occasional brushing contact with turbine blade tips with reduced wear on the blade tips . this technology is especially applicable to cmc ring segment walls formed by laminate construction , in which cmc layers are oriented edgewise in a stacked configuration . fig1 illustrates a cmc wall structure 22 of a prior art ring segment 20 p that has a thermal barrier coating 24 such as fgi to provide an abradable gas flow sealing surface 26 . fig2 illustrates a cmc wall structure 32 of a ring segment 30 that has a sealing surface 34 with no coating , but with an array of depressions 36 according to aspects of the invention to increase the abradability of the surface 34 . the depressions 36 are unconnected to each other in order to prevent bypass of the working gas around the blade tips via the depressions . they can be formed by removal of material from the cmc surface 34 after constructing and curing the wall 32 , or they can be formed by laminate edge profiling , as next described . material removal processes may include one or more known methods , such as milling , drilling , water jet cutting , laser cutting , electron beam cutting , and ultrasonic machining . fig3 illustrates a cmc wall structure 48 formed by a stack of cmc layers ( or lamellae ) 40 - 43 with edge profiling 50 , 52 that results in a surface 44 with unconnected depressions 46 . techniques for manufacturing such a stacked lamellate assembly are known in the art , such as discussed in commonly - assigned united states patent application publications us 2006 / 0121265 and us 2006 / 0120874 , both incorporated by reference herein . each layer 40 - 43 has a respective edge that is profiled with alternating maxima 50 and minima 52 that may be formed onto the edge prior to joining of the lamellae together . the maxima 50 and minima 52 are staggered in alternating layers 40 - 43 so that the adjoining maxima 50 of one or several adjacent layers are substantially aligned with the adjoining minima 52 of one or several adjacent layers to form a plurality of unconnected depressions 46 in the surface 44 . in the embodiment of fig3 , the maxima 50 and minima 52 both define a generally rectangular shape , with the relative absolute and relative depth and length dimensions of the rectangular shapes being selectable by the designer to optimize performance in any specific application . typically , the dimensions of the depressions 46 may be 1 . 5 - 2 . 5 mm deep and up to 4 mm long ( i . e . along the longitudinal axis of the lamella ). typically the length of the exposed maxima surface segment 50 may be 5 - 7 mm . fig4 illustrates a variation of fig3 in a cmc wall structure 48 ′ formed by a stack of cmc layers 40 ′- 43 ′ with edge profiling 50 ′, 52 ′ that results in a surface 44 ′ with unconnected depressions 46 ′. each layer 40 ′- 43 ′ has a respective edge that is profiled with alternating maxima 50 ′ and minima 52 that define a generally v - shape . the dimensions of the exposed surface segment 50 ′ and the depth of the depression 46 ′ may be similar to those described for the embodiment of fig3 . fig5 illustrates a cmc wall structure 48 ″ formed by a stack of cmc layers 40 ″- 43 ″ in which a first series 40 ″ and 42 ″ of the cmc layers has maxima 50 ″ and minima 52 ″, a second series 41 ″ and 43 ″ of the layers has respective edges 53 that generally match the level of the maxima 50 ″ of the first series , and the first and second series of the layers 40 ″- 43 ″ alternates in the stack . in this embodiment the transition between the maxima 50 ″ and minima 52 ″ define a relatively smooth curved shape . the dimensions of the exposed surface segment 50 ″ and the depth of the depression 46 ″ may be similar to those described for the embodiment of fig3 . other edge profiles and arrangements are possible . for example profiles similar to those of the first series of cmc layers 40 ″ and 42 ″ of fig5 could be used in a staggered configuration as in fig3 and 4 , and vice versa . fig6 illustrates an array of unconnected depressions 36 with circular openings in a surface 34 , as may be formed by ball - end milling or other machining processes . the depressions 36 may have a spherical shape , or they may have a cylindrical shape proximate the surface 34 with a spherical bottom , or they may have a cylindrical shape throughout . embodiments wherein depressions have a cross - sectional area that decreases with depth are effective to present an increasing wear surface area as the sealing surface is worn by abrasion , thereby facilitating the wear - in of the surface . fig7 illustrates an array of unconnected depressions 46 with rectangular openings in a surface 44 formed by a stacked laminate construction as in fig3 . fig8 illustrates an array of unconnected depressions 54 with hexagonal openings in a surface 34 ′, as may be formed by laser , water jet , or electron beam machining techniques . fig9 illustrates a turbine ring segment 30 ′ with a cmc wall 32 ′ formed by bonding and curing of stacked cmc lamellae 56 . a gas sealing surface 34 ″ on the wall 32 ′ is subsequently machined with an array of depressions 36 according to the invention as in fig2 and 6 or in other shapes such as illustrated in fig3 - 5 , 7 and 8 . behavior of cmc exposed to high temperatures shows reduction in strength over long periods ; however such a reduction in strength should not be limiting for the present invention because strength is not the material property of primary concern for a wear surface . since a cmc surface 34 , 44 in this invention is directly exposed to the hot working gas , it will be exposed to temperatures over 1200 ° c . this will reduce its strength but will also increase its hardness . the increase in hardness will beneficially reduce erosion of the surface . the surface may be allowed to age during operation of the gas turbine engine , or it may be pre - aged prior to being placed into operation . a thin , hard ceramic coating , for example alumina , may be applied to the cmc edges as temporary erosion protection until cmc hardening occurs . the present invention eliminates the need for an abradable thermal barrier coating such as fgi , thus eliminating the associated bond joint and avoiding any concern about differential elasticity between the two materials . accordingly , the invention is expected to provide improved component reliability and durability and reduced manufacturing expense compared to prior art coating methods . while various embodiments of the present invention have been shown and described herein , it will be obvious that such embodiments are provided by way of example only . numerous variations , changes and substitutions may be made without departing from the invention herein . accordingly , it is intended that the invention be limited only by the spirit and scope of the appended claims . | 5 |
in general , a communication system includes a transmitter and a receiver . the transmitter and the receiver can be called a transceiver for simultaneously performing a transmitting function and a receiving function . for ease of description , a first part for providing a femto data service will be defined to be a transmitter and a second part for entering a service area covered by the transmitter and receiving the femto data service will be called a receiver . the transmitter can be referred to as a base station ( bs ) or an advanced base station ( abs ), and the receiver as a mobile station ( ms ) or an advanced mobile station ( ams ). throughout the specification , a femto service indicates a data service that is provided distinctively according to a subscription type to the femtocell . embodiments of the present invention will be described with reference to accompanying drawings . fig1 shows a configuration of a communication network according to embodiments of the present invention . the communication network of fig1 provides a macrocell service and a femtocell service . a transmitter for the macrocell will be referred to as a macro base station 100 and another transmitter for the femtocell will be called a femto advanced base station 200 . the femto advanced base station 200 uses an air interface overlapped on the macro base station 100 to exchange a control message . the femto advanced base station 200 registers itself and the macro base station 100 to the network to directly receive radio link configuration information from the network . a mobile station 300 enters the network of the macro base station or that of the femto advanced base station depending on a subscription state to the femtocell service and a support state of the femtocell service . the femto advanced base station 200 supports at least one of the following subscription types , and can simultaneously support two or more . a ) closed subscriber group - closed femto advanced base station ( csg - closed femto abs ): provides high - speed data service to a limited subscriber group . b ) closed subscriber group - open femto abs : provides low - speed data service to a limited subscriber group . c ) open subscriber group femto abs : provides a data service regardless of service registration and provides the same with the lowest - quality data service . the femto advanced base station 200 broadcasts information on femto service subscription types provided by the femto advanced base station 200 to the mobile stations 300 in the serving cell , or unicasts it according to a request from the mobile station 300 . the mobile station 300 providing the femto service receives a femtocell information list ( e . g ., csg white list ) from the femto advanced base station 200 , and attempts to enter the network of the corresponding femto advanced base station 200 when it is found that the mobile station 300 has subscribed to the femto service . fig2 shows a data flowchart among a macro base station , a femto advanced base station , and a mobile station for entering a femtocell network . when the mobile station is turned on , it enters an initialization state . while in the initialization state , radio interface parameters are configured and time and frequency are synchronized . in the initialization state , the mobile station receives various control information from the macro base station through a preamble sequence . particularly , a primary advanced ( pa ) preamble sequence and a secondary advanced ( sa ) preamble sequence are used to control the downlink . fig3 shows a data structure of a superframe including a - preambles . referring to fig3 , a first symbol of a frame is specified as an a - preamble symbol . the pa - preamble is positioned at the first symbol of the second frame in a superframe , and the sa - preamble is positioned at the first symbol of three other frames . the sa - preamble sequences are divided into a plurality of partitions that are dedicated to the base stations including the macrocell abs , the macro hot zone abs , and the femto abs . for example , the femto advanced base station can be allocated to be dedicated to the 3rd sub - partition ( sp3 ) of an s - sfh . the base stations except the macrocell base station are called non - macro base stations . at the phy level , non - macro base station information can be broadcast in a hierarchical configuration formed with a secondary - superframe header ( s - sfh ) of the sa - preamble sequence and an advanced air interface_system configuration descriptor ( aai_scd ) message . here , the s - sfh is a non - macro base station cell type and is partitioned for a public base station or a csg femto advanced base station , and the aai_scd message is partitioned for the public base station and csg femto advanced base station . the public base station can be classified as a hot zone , a relay , and an osg , and the csg femto advanced base station can be classified as a csg - closed femto advanced base station and a csg - open femto advanced base station . the mobile station identifies the femto advanced base station at the phy level , and can also identify the femto advanced base station at a mac level . that is , at the mac level , non - macro base station information can be provided to the mobile station by use of a femtocell information list ( e . g ., csg white list ). the femtocell information list can be broadcast to the mobile stations in the cell , and it can also be provided according to a request of the mobile station . the femtocell information list displays types of the femto services provided by the femto advanced base station . the mobile station receives the femtocell information list from the femto advanced base station , and checks whether the femto service to which the mobile station is registered is included in the femtocell information list . if included , the mobile station enters the network of the corresponding femto advanced base station , and if not , it enters the network of the macrocell base station . fig4 shows a configuration of a femto advanced base station 200 according to an embodiment of the present invention . referring to fig4 , the femto advanced base station 200 includes a channel encoder 210 , a mapper 220 , a modulator 230 , a receiving circuit 240 , a memory 250 , and a controller 260 . the channel encoder 210 encodes streams of information bits according to a predetermined coding scheme to generate coded data . the mapper 220 maps the coded data output by the channel encoder 110 on symbols that are represented with the positions following the constellation of the amplitude and the phase . the modulation scheme includes the m - quadrature phase shift keying ( m - psk ) and the m - quadrature amplitude modulation ( m - qam ). the modulator 230 modulates the mapped unicast symbols according to a predetermined multiple access modulation . the multiple access modulation scheme includes single - carrier modulation schemes such as the cdma and the multi - carrier modulation schemes such as the ofdm . the receiving circuit 240 receives the unicast signals from the receiver through an antenna , generates them into digital signals , and transmits them to the controller 260 . the memory 250 stores system information for operating the femto advanced base station 200 and the femtocell information list . the controller 260 controls the femto advanced base station 200 , and particularly it includes a femtocell information transmitting module 261 and a service providing module 262 . the femtocell information transmitting module 261 broadcasts the femtocell information list to the mobile stations in the cell , or unicasts the femtocell information list to the corresponding mobile station through the receiving circuit 240 when the mobile station requests information . the service providing module 262 provides the data service with the quality corresponding to the femto service to which the mobile station 300 is subscribed to the mobile stations 300 in the serving cell . when the femto advanced base station 200 provides a plurality of femto subscription types and the mobile stations 300 in the serving cell are subscribed to different femto services , the service providing module 262 provides the data service with different quality to the mobile stations 300 according to the multiple access modulation so that the mobile stations 300 may correspond to the subscribed femto services . the service with the different quality has quality of service ( qos ) parameters including different priority . fig5 shows a configuration of a mobile station 300 according to an embodiment of the present invention . in fig5 , the mobile station 300 includes a channel decoder 310 , a demapper 320 , a demodulator 330 , a memory 340 , a transmitting circuit 350 , and a controller 360 . the demodulator 330 , the demapper 320 , and the channel decoder 310 of the mobile station 300 perform reverse functions of the above - described modulator 230 , mapper 220 , and channel encoder 210 of the femto advanced base station 200 . that is , the signal received through the antenna is demodulated by the demodulator 330 , and is demapped by the demapper 320 to be encoded data . the encoded data are decoded by the channel decoder 310 . the demodulator 330 , the demapper 320 , and the channel decoder 310 can be called a receiving circuit ( not shown ) overall . the memory 340 stores system information required for operating the mobile station 300 and an identifier of the femto service to which the mobile station is subscribed . the transmitting circuit 350 generates the various data provided by the controller 360 into analog data , and transmits the same to the femto advanced base station 200 or the macro base station 100 through the antenna . the controller 350 controls the mobile station 300 , and includes a comparison module 351 for checking whether the femtocell subscription type information includes the identifier stored in the memory when receiving information on a plurality of femtocell subscription types from the femto advanced base station 200 , and a registration module 352 for requesting registration from the femto advanced base station 200 according to the femtocell subscription type that corresponds to the identifier stored in the memory . when the femtocell subscription type information does not include the identifier stored in the memory , the registration module 352 can request registration from the macrocell base station 100 other than the femto advanced base station 200 . while this invention has been described in connection with what is presently considered to be practical embodiments , it is to be understood that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . the embodiments of the present invention are applicable to a service providing method of a femtocell for simultaneously providing a femto service to a plurality of mobile stations , and a transmitter and receiver for the same method . the above - described embodiments can be realized through a program for realizing functions corresponding to the configuration of the embodiments or a recording medium for recording the program in addition to through the above - described device and / or method , which is easily realized by a person skilled in the art . | 7 |
with reference now to fig1 - 4 , the descriptions of the various embodiments of the present invention have been presented for purposes of illustration , but are not intended to be exhaustive or limited to the embodiments disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments . the terminology used herein was chosen to best explain the principles of the embodiments , the practical application or technical improvement over technologies found in the marketplace , or to enable others of ordinary skill in the art to understand the embodiments disclosed herein the present invention may be a system , a method , and / or a computer program product . the computer program product may include a computer readable storage medium ( or media ) having computer readable program instructions thereon for causing a processor to carry out aspects of the present invention . the computer readable storage medium can be a tangible device that can retain and store instructions for use by an instruction execution device . the computer readable storage medium may be , for example , but is not limited to , an electronic storage device , a magnetic storage device , an optical storage device , an electromagnetic storage device , a semiconductor storage device , or any suitable combination of the foregoing . a non - exhaustive list of more specific examples of the computer readable storage medium includes the following : a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), a static random access memory ( sram ), a portable compact disc read - only memory ( cd - rom ), a digital versatile disk ( dvd ), a memory stick , a floppy disk , a mechanically encoded device , such as punch - cards or raised structures in a groove having instructions recorded thereon , and any suitable combination of the foregoing . a computer readable storage medium , as used herein , is not to be construed as being transitory signals per se , such as radio waves or other freely propagating electromagnetic waves , electromagnetic waves propagating through a waveguide or other transmission media ( e . g ., light pulses passing through a fiber - optic cable ), or electrical signals transmitted through a wire . computer readable program instructions described herein can be downloaded to respective computing / processing devices from a computer readable storage medium or to an external computer or external storage device via a network , for example , the internet , a local area network ( lan ), a wide area network ( wan ), and / or a wireless network . the network may comprise copper transmission cables , optical transmission fibers , wireless transmission , routers , firewalls , switches , gateway computers and / or edge servers . a network adapter card or network interface in each computing / processing device receives computer readable program instructions from the network and forwards the computer readable program instructions for storage in a computer readable storage medium within the respective computing / processing device . computer readable program instructions for carrying out operations of the present invention may be assembler instructions , instruction - set - architecture ( isa ) instructions , machine instructions , machine dependent instructions , microcode , firmware instructions , state - setting data , or either source code or object code written in any combination of one or more programming languages , including an object - oriented programming language such as java ™ smalltalk , c ++ or the like , and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the computer readable program instructions may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer , or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). in some embodiments , electronic circuitry including , for example , programmable logic circuitry , field - programmable gate arrays ( fpga ), or programmable logic arrays ( pla ) may execute the computer readable program instructions by utilizing state information of the computer readable program instructions to personalize the electronic circuitry , in order to perform aspects of the present invention . aspects of the present invention are described herein with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ), and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer readable program instructions . these computer readable program instructions may be provided to a processor of a general purpose computer , a special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer readable program instructions may also be stored in a computer readable storage medium that can direct a computer , a programmable data processing apparatus , and / or other devices to function in a particular manner , such that the computer readable storage medium having instructions stored therein comprises an article of manufacture , including instructions which implement aspects of the function / act specified in the flowchart and / or block diagram block or blocks . the computer readable program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other device to cause a series of operational steps to be performed on the computer , other programmable apparatus , or other device to produce a computer implemented process , such that the instructions which execute on the computer , other programmable apparatus , or other device implement the functions / acts specified in the flowchart and / or block diagram block or blocks . the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods , and computer program products according to various embodiments of the present invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of instructions , which comprises one or more executable instructions for implementing the specified logical function ( s ). in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts or carry out combinations of special purpose hardware and computer instructions . reflow soldering is a process in which a plated metallurgy can be used to temporarily attach one or more electrical components to their contact pads , after which the entire assembly is subjected to controlled heat , which melts the solder , permanently connecting the joint . heating may be accomplished by passing the assembly through a reflow oven , or under an infrared lamp , or by soldering individual joints with a hot air pencil . the goal of the reflow process is to melt the solder and heat the adjoining surfaces without overheating and damaging the electrical components . during reflow , controlled collapse chip connections ( c4 ) packages can exhibit non - uniform thermal profiles , which can result in , for example , thermal stress or a difference in microstructures . embodiments of the present invention seek to provide a method , product , and system to determine the thermal profile of semiconductors . sequential steps of an exemplary embodiment of a method , product , and system for determining thermal profiles of a semiconductor structures are described below with respect to the schematic illustrations of fig1 - 4 . similar reference numerals denote similar features . fig1 is a functional block diagram illustrating an environment , generally designated 100 , in accordance with an embodiment of the present invention . environment 100 includes equipment 120 , emitter 130 , sensor 140 , and computing device 110 . in an embodiment , equipment 120 , emitter 130 , sensor 140 , computing device 110 , or any combination thereof may be depicted as a single entity . although not shown , environment 100 may include additional connections than depicted . in certain embodiments , environment 100 does not include emitter 130 . equipment 120 is in communication with computing device 110 via communications link 116 . equipment 120 deposits emitting material on the surface of semiconductor structures , in accordance with an embodiment of the present invention . in an embodiment , equipment 120 deposits one or layers of emitting material utilizing a slurry painting method or a conventional deposition process , such as chemical vapor deposition . applicable emitting material includes material capable of luminescent decay , material diffusion , ionizing radiation , temperature - based spectral shift , and temperature - dependent luminescence ( discussed further below ). in an embodiment , the emitting layer emits one or more of a luminescence , visible light , infrared light , and ions . in other embodiments , the emitting layer is capable of chemiluminescence , bioluminescence , and / or photoluminescence . in other embodiments , the emitting layer is comprises quantum dots capable of temperature - based spectral shifts . in certain embodiments , the emitting layer includes a first and second diffusion layer , wherein the first diffusion layer diffuses into the second diffusion layer at a diffusion rate that is a function of time and / or temperature . emitter 130 is in communication with computing device 110 via communications link 117 . emitter 130 is not utilized in embodiments wherein the emitting material is capable of material diffusion ( discussed below ). in an embodiment , photoluminescent material , such as material that includes erbium or ytterbium , is the emitting material . in an embodiment , applicable photoluminescent material includes phosphors . for example , phosphors , such as sralo 4 : eu 2 + , dy 3 + , are alkaline earth aluminates that are co - doped with divalent europium ( eu 2 + ) and trivalent dysprosium ( dy 3 + ) ions . alkaline earth aluminates typically have a general formula , mal 2 o 4 , wherein m may be barium ( ba ), calcium ( ca ), or strontium ( sr ). emitter 130 is a device that exudes a type of signal , such as photons or ionizing particles , and exposes emitting material to the signal . in an embodiment , emitter 130 emits photons in the 510 nm to 530 nm wavelength range . sensor 140 is in communication with computing device 110 via communications link 118 , accordance with an embodiment of the present invention . sensor 140 detects signals that are , for example , associated with luminescent decay , material diffusion , ionizing radiation , temperature - based spectral shift , and / or temperature - dependent luminescence . in an embodiment , sensor 140 is a photometer . sensor 140 can measure light by counting photons or incoming flux . photon measurements may be defined in units , such as photons / cm 2 or photons * cm − 2 . computing device 110 is used to determine thermal profiles of semiconductor structures , in accordance with an embodiment of the present invention . computing device 110 includes test data 114 and program function 112 . test data 114 are emission readings generated by sensor 140 and received via communications link 118 . program function 112 is software that determines the thermal profile of semiconductor structures , in accordance with an embodiment of the present invention . program function 112 can send instructions to equipment 120 and emitter 130 via communications links 116 and 117 , respectively . program function 112 can , via communications link 118 , receive emission readings generated by sensor 140 . program function 112 can determine the thermal profile of semiconductor structures . fig2 is a reflow profile of a semiconductor structure , in accordance with an embodiment of the present invention . specifically , fig2 illustrates a reflow profile of a semiconductor structure ( not shown ), for example , a semiconductor package comprising a first and second semiconductor structure joined by c4 , wherein the first semiconductor structure comprises an emitting layer that includes , for example , an alkaline earth aluminate is formed on the backside thereof using equipment 120 . the emitting material that comprises the emitting layer undergoes photoexcitation using emitter 130 . in this particular example , t p is the peak temperature of the package and should not exceed the maximum operating temperature of the c4 . t l is the liquidus temperature and denotes the temperature above which the c4 is in a liquid state , and t l is the time maintained above t l . in certain embodiments , program function 112 determines emission readings while the c4 is in a solid state , wherein the initial read is taken at to and the final read is taken at t k . in other embodiments , program function 112 determines emission readings while the c4 is in a liquid state , wherein the initial read is taken at t i and the final read is taken at t f . in certain embodiments , the reflow profile comprises a maximum ramp up rate of 3 ° c ./ s and a maximum ramp down rate of 6 ° c ./ s . program function 112 determines the thermal profile of the semiconductor package by determining the difference between the initial and final reads . in an embodiment , program function 112 determines a thermal profile that reflects regions of high and low temperature . in other embodiments , sensor 140 comprises a 2 - dimensional array of sensors , such as photodiodes , that can detect ultraviolet and / or infrared wavelengths , such as wavelengths in the 300 nm to 1700 nm range . program function 112 can generate a 2 - dimensional or 3 - dimensional graphic representation of the determined thermal profile . fig3 is a flowchart depicting the operational steps of program function 112 , in accordance with an embodiment of the present invention . program function 112 instructs equipment 120 to deposit one or more layers of emitting material on the backside of a semiconductor structure ( step 300 ). for example , equipment 120 deposits a layer of an emitting material that includes an alkaline earth aluminate , for example , sralo 4 : eu , dy . program function 112 takes an initial emissions reading using sensor 140 ( step 310 ). for example , program function 112 instructs emitter 130 to excite the emitting material for a predetermined time period . subsequently , program function 112 takes an initial emissions reading of two adjacent regions of the emitting material , regions a and b , for example , 75 photons / cm 2 and 75 photons / cm 2 , respectively . at the end of the reflow process , program function 112 takes a final emissions reading using sensor 140 ( step 320 ). at the end of the reflow process , program function 112 takes a final emissions reading for regions a and b using sensor 140 , 52 photons / cm 2 and 35 photons / cm 2 , respectively . program function 112 determines the thermal profile of the semiconductor package using the initial and final readings ( step 330 ). for example , region b has a lower photon count compared to region a , which is reflective that region b retained more heat , which may be reflective of reflow issues . such regional photon count comparisons can assist one in , for example , determining whether the chip was sufficiently heated to form proper interconnects , quantitating thermal load , and / or ascertaining the thermal uniformity across a substrate . additional reflow issues may be addressed using photon count comparisons . for example , during reflow of c4s , a difference in the thermal profiles of modules can result in thermal stress or a difference in the microstructures included therein . regional comparisons of photon counts can assist one in ascertaining the uniformity of the local thermal budget across each module . multiple reflows of wafers and dies may affect em performance . here , regional photon count comparisons can assist one in ascertaining a die &# 39 ; s thermal history through manufacturing . fig4 shows a block diagram of an exemplary design flow 400 used , for example , in semiconductor ic logic design , simulation , test , layout , and manufacture . design flow 400 includes processes , machines , and / or mechanisms for processing design structures or devices to generate logically or otherwise functionally equivalent representations of the design structures and / or devices described above and shown in fig1 - 3 . the design structures processed and / or generated by design flow 400 may be encoded on machine - readable transmission or storage media to include data and / or instructions that , when executed or otherwise processed on a data processing system , generate a logically , structurally , mechanically , or otherwise functionally equivalent representation of hardware components , circuits , devices , or systems . machines include , but are not limited to , any machine used in an ic design process , such as designing , manufacturing , or simulating a circuit , component , device , or system . for example , machines may include : lithography machines , machines and / or equipment for generating masks ( e . g ., e - beam writers ), computers or equipment for simulating design structures , any apparatus used in the manufacturing or test process , or any machines for programming functionally equivalent representations of the design structures into any medium ( e . g ., a machine for programming a programmable gate array ). design flow 400 may vary depending on the type of representation being designed . for example , a design flow 400 for building an application specific ic ( asic ) may differ from a design flow 400 for designing a standard component , or from a design flow 400 for instantiating the design into a programmable array , for example , a programmable gate array ( pga ) or a field programmable gate array ( fpga ) offered by altera ® inc . or xilinx ® inc . fig4 depicts a block diagram of components of server computing device 110 in accordance with an illustrative embodiment of the present invention . it should be appreciated that fig4 provides only an illustration of one implementation and does not imply any limitations with regard to the environments in which different embodiments may be implemented . many modifications to the depicted environment may be made . a non - transitory computer readable storage medium embodiment herein is readable by a computerized device . the non - transitory computer readable storage medium stores instructions executable by the computerized device to perform a method that tests integrated circuit devices to measure a voltage overshoot condition . server 110 includes communications fabric 402 , which provides communications between computer processor ( s ) 404 , memory 406 , persistent storage 408 , communications unit 410 , and input / output ( i / o ) interface ( s ) 412 . communications fabric 402 can be implemented with any architecture designed for passing data and / or control information between processors ( such as microprocessors , communications and network processors , etc . ), system memory , peripheral devices , and any other hardware components within a system . for example , communications fabric 402 can be implemented with one or more buses . memory 406 and persistent storage 408 are computer readable storage media . in this embodiment , memory 406 includes random access memory ( ram ) 414 and cache memory 416 . in general , memory 406 can include any suitable volatile or non - volatile computer readable storage media . program function 112 and test data 114 are stored in persistent storage 408 for execution and / or access by one or more of the respective computer processor ( s ) 404 via one or more memories of memory 406 . in this embodiment , persistent storage 408 includes a magnetic hard disk drive . alternatively , or in addition to a magnetic hard disk drive , persistent storage 408 can include a solid - state hard drive , a semiconductor storage device , a read - only memory ( rom ), an erasable programmable read - only memory ( eprom ), a flash memory , or any other computer readable storage media that is capable of storing program instructions or digital information . the media used by persistent storage 408 may also be removable . for example , a removable hard drive may be used for persistent storage 408 . other examples include optical and magnetic disks , thumb drives , and smart cards that are inserted into a drive for transfer onto another computer readable storage medium that is also part of persistent storage 408 . communications unit 410 , in these examples , provides for communications with other data processing systems or devices . in these examples , communications unit 410 includes one or more network interface cards . communications unit 410 may provide communications through the use of either or both physical and wireless communications links . program function 112 may be downloaded to persistent storage 408 through communications unit 410 . i / o interface ( s ) 412 allows for input and output of data with other devices that may be connected to server 110 . for example , i / o interface ( s ) 412 may provide a connection to external device ( s ) 418 such as a keyboard , a keypad , a touch screen , and / or some other suitable input device . external device ( s ) 418 can also include portable computer readable storage media such as , for example , thumb drives , portable optical or magnetic disks , and memory cards . software and data used to practice embodiments of the present invention , e . g ., program function 112 and test data 114 , can be stored on such portable computer readable storage media and can be loaded onto persistent storage 408 via i / o interface ( s ) 412 . i / o interface ( s ) 412 also connects to a display 420 . display 420 provides a mechanism to display data to a user and may be , for example , a computer monitor . the programs described herein are identified based upon the application for which they are implemented in a specific embodiment of the invention . however , it should be appreciated that any particular program nomenclature herein is used merely for convenience and , thus , the invention should not be limited to use solely in any specific application identified and / or implied by such nomenclature . | 6 |
approx . 1 . 5 liters of water for injection purposes are prepared in a suitable glass vessel . 210 g water for injection purposes are prepared in another glass vessel and 91 . 17 g acetic acid are added . the amount of cetrorelix acetate calculated ( 1 . 62 - 1 . 695 g , depending on the content of the batch used ) is dissolved in the prepared 30 % acetic acid with stirring . this solution is transferred to the glass vessel with 1 . 5 liters of water for injection purposes , 82 . 2 g mannitol are added , dissolved and made up to 3039 g with water for injection purposes . the solution is sterilized by filtration through an appropriate membrane filter ( pore size 0 . 2 μm ) under aseptic conditions . 100 ml first runnings should be discarded . the filters should be sterilized with superheated steam before sterile filtration . cetrorelix freeze - dried solution should be protected from recontamination during storage . the solution is immediately filled into colorless injection bottles din 2r , hydrolytic class i under aseptic conditions and provided with sterile freeze - drying stoppers . the nominal filling amount is 2 . 0 ml = 2 . 026 g . the 2 ml injection bottles were rinsed in an injection bottle washing machine , dried with hot air and sterilized . the cleaned , freeze - drying stoppers were autoclaved . the closed injection bottles were transferred to a freeze - drying installation and frozen at a plate temperature of − 40 ° c . drying was carried out using a drying program with a plate temperature of − 40 ° c . rising to + 20 ° c . the installation is then flooded with sterile nitrogen , the bottles are closed in the installation and the stoppers secured with crimped caps . the injection bottles are checked visually for faulty closures and outer faults . faulty injection bottles are removed and destroyed . cetrorelix lyophilizate 1 mg is a white , solid , freeze - dried cake in a colorless 2 ml injection bottle which is closed with gray freeze - drying stoppers and yellow flip - off crimped caps . 420 g water for injection purpose are prepared in a suitable vessel and 121 . 56 g acetic acid are added . the amount of the nonapeptide ( about 3 . 783 g , depending on the content of the batch used ) is dissolved in the prepared 20 % acetic acid and with stirring . 82 ., 2 niannitol are added and dissolved . this solution is sterilized by filtration through an appropriate membrane filter ( pore size 0 . 2 μm ) under aseptic conditions . the same membrane filter is used for the water for injection purpose to make up the solution to 3064 g . the filters should be sterilized with superheated steam . the solution should be protected from recontamination during storage . the solution is filled in to sterile colorless injection bottles din 2 r , hydrolytic class i under aseptic conditions and provided with sterile freeze - drying stoppers . the nominal filling amount is 1 . 0 ml = 1 . 022 g . the 2 ml injection bottles were rinsed in an injection bottle washing machine , dried with hot air and sterilized . the cleaned freeze - drying stoppers were autoclaved . the injection bottles were transferred to a freeze - drying installation and frozen at a plate temperature of − 40 ° c . drying was carried out using a drying programme with a plate temperature of − 40 ° c . rising to + 20 ° c . the installation is then flooded with sterile nitrogen , the bottles are closed in the installation and the stoppers are sealed with crimped caps . the injection bottles are checked visually for faulty closures and outer faults . faulty injection bottles are removed and destroyed . the lyophilisate of the nonapeptide ( 1 mg ) is a white , solid , freeze - dried cake in a colorless 2 ml injection bottle which is closed with grey freeze - drying stoppers and flip - off crimped caps . 143 . 5 g water for injection purpose are prepared in a suitable vessel and 61 . 5 g acetic acid are added . the amount of the protirelin acetate calculated ( equivalent to 800 mg of the peptide base ) is dissolved with stirring . this solution is transferred to another vessel with approximately 1 l water for injection purpose . 109 . 6 g mannitol are added , dissolved and made up to 2048 g with water for injection purposes . the solution is filled in to sterile colorless injection bottles din 2 r , hydrolytic class i under aseptic conditions and provided with sterile freeze - drying stoppers . the nominal filling amount is 1 . 0 ml = 1 . 024 g . the 2 ml injection bottles were rinsed in an injection bottle washing machine , dried with hot air and sterilized . the cleaned freeze - drying stoppers were autoclaved . the injection bottles were transferred to a freeze - drying installation and frozen at a plate temperature of − 40 ° c . drying was carried out using a drying programme with a plate temperature of − 40 ° c . rising to + 20 ° c . the installation is then flooded with sterile nitrogen , the bottles are closed in the installation and the stoppers are sealed with crimped caps . the injection bottles are checked visually for faulty closures and outer faults . faulty injection bottles are removed and destroyed . the protireline lyophilizate ( 0 . 4 mg ) is a white , solid , freeze - dried cake in a colorless 2 ml injection bottle which is closed with grey freeze - drying stoppers and flip - off crimped caps . 245 g water for injection purpose are prepared in a suitable vessel and 61 . 5 g acetic acid are added . the amount of somatostatine acetate calculated ( 0 . 52 - 0 . 66 g , dependent on the content of the batch used ) is dissolved with stirring . this solution is transferred to another vessel with approximately 1 l water for injection purpose . 109 . 6 g mannitol are added , dissolved and made up to 2049 g with water for injection purposes . the solution is filled in to sterile colorless injection bottles din 2 r , hydrolytic class i under aseptic conditions and provided with sterile freeze drying stoppers . the nominal filling amount is 1 . 0 ml = 1 . 024 g . the 2 ml injection bottles were rinsed in an injection bottle washing machine , dried with hot air and sterilized . the cleaned freeze - drying stoppers were autoclaved . the injection bottles were transferred to a freeze - drying installation and frozen at a plate temperature of − 40 ° c . drying was carried out using a drying programme with a plate temperature of − 40 ° c . rising to + 20 ° c . the installation is then flooded with sterile nitrogen , the bottles are closed in the installation and the stoppers are sealed with crimped caps . the injection bottles are checked visually for faulty closures and outer faults . faulty injection bottles are removed and destroyed . the lyophilizate ( 0 . 25 mg somatostatine acetate ) is a white , solid , freeze - dried cake in a colorless 2 ml injection bottle which is closed with grey freeze - drying stoppers and flip - off crimped caps . | 8 |
before describing the workings of fig1 and 2 , it should be understood that when a telephone is on hook about 48 volts will appear across the line . when a telephone is on hold about 18 volts can be made to appear across the line . when the telephone is off hook , i . e . actively in use , from 4 to 9 volts will appear across the line . the circuits of fig1 and 2 will detect these voltages and give an indication as to whether a line is in use , on hold or available . referring now specifically to fig1 an incoming telephone line is indicated at 1 . the incoming line 1 goes through a full wave rectifier 2 and the output on lines 6a and 8a goes to a voltage divider which includes resistors 3 and 4 and a zener diode 5 , scr 6 and diode 7 . contacts 8 across scr 6 go to the hold contacts of a selector switch , described in detail later . a zener diode 10 having a cutoff voltage of 15 volts is in series with a voltage divider made up of resistors 12 and 14 . line 16 from the center of the divider leads to the source of fet 18 while the gate 21 is connected to the negative line 8 . fet 18 is of the depletion type which means that it is normally on but that a negative voltage turns the fet off . if the full line voltage is across the lines 6a and 8a , i . e . the phone is on the hook , the gate voltage 21 on fet 18 would be negative with respect to the source 16 so that the fet 18 will be non - conducting . similarly , the 30 v zener 22 keeps fet 30 turned off . however , if the telephone is placed on hold by shorting contacts 8 , this will trigger scr 6 , causing the line voltage to drop to about 18 v and be held there by zener 5 despite variations in line voltage . this will cause fet 18 to conduct , turning on the opto coupler 20 . line 6a also leads to a second zener 22 which has a voltage rating of 30 . this is in series with the voltage divider 24 and 26 , the center of which is connected to the source 28 of a depletion mode fet 30 . the drain of fet 30 is connected to a second opto coupler 32 . the gate of 30 is connected to the negative line 8a . fets 34 and 36 are of the enhancement mode type which means that they are normally off and a positive voltage turns them on . when the line is on hold , i . e . about 18 volts , the second zener 22 stops conducting which allows fet 30 to turn on which turns on opto coupler 32 . this turns on fet 36 which causes led flasher 40 to go into intermittent operation causing the led 42 to flash on and off . this indicates to the user that the line is on hold . now if one takes the phone off the hook , the voltage across line 6a - 8a drops to about 4 to 9 volts which turns both zeners 10 and 22 off which permits the fets 18 and 30 to turn on . when opto coupler 20 turns on , fet 34 starts conducting which shorts out the led flasher 40 causing the led 42 to glow constantly . this indicates to the user that the line is in use . this circuit is completely adequate for private systems and also systems which do not require an extremely high resistance when the phone is on hook . fig2 shows a more complicated circuit which accomplishes the same result but which has an extremely high resistance (& gt ; 10mω ) so that is meets all fcc requirements and is usable in any country . in this circuit a single quad cmos comparator or 2 dual cmos comparators are employed having four sections designated 44 , 46 , 48 and 50 . the incoming line 52 and 54 goes through a full wave rectifier 56 so that it is immaterial which side of the line is positive . thus , the output from the rectifier will always be positive on line 58 and negative on line 60 . to meet the on hook minimum resistance requirements specified in fcc rules and regulations , part 68 of 10mω and to divide the line voltage to a convenient value , a voltage divider network consisting of resistors 61 , 62 , 64 and 66 is employed . this supplies one - third of the line voltage to sections 44 and 46 of the comparator and one - fifteenth of the voltage to section 50 of the comparator . to prevent the cross talk between lines , which proved a serious problem in previous attempts to build an all electric system , each line condition detector circuit is supplied with its own d . c . to d . c . converter power supply 68 which is run from a common 12 v d . c . supply and which gives a 10 volt well regulated (± 1 %) output to comparator 44 and by means of resistive voltage dividers , 5 volts to comparator 46 and 6 volts to comparator 50 . the d . c . to d . c . converter operates at a frequency of about 60 khz and so there is no coupling at audio frequencies between the lines . the power supply also supplies the voltage for running the four comparators . section 48 is used as a hold flashing oscillator operating through opto coupler 70 to actuate led 72 . comparator 44 is biased in such a way that it conducts if the voltage in line 58 is less than 30 v . this indicates a hold condition and this actuates comparator 48 through opto coupler 70 causing led 72 to flash . fets 74 and 76 are both enhancement mode devices and , when a voltage of less than 15 v is sensed by comparator 46 , fet 74 is actuated , shutting off comparator 48 so that led 72 now stops flashing and has a steady glow , indicating that the phone is off hook and in use . comparator 50 compares the plus 10 voltage from the power supply 68 with the voltage developed between resistors 62 and 64 so that this comparator is turned on only when there is a very high voltage on the line , i . e . the ringing current which is in the range of 75 - 105 volts of 20 cycle a . c . when this voltage appears on the line , the electronic ringer 78 is activated . in fig3 a practical circuit is shown which might be completely contained within a telephone instrument . it will be seen that only three incoming lines are shown , namely , line 1 , line 2 and line n but that a large number of lines might be employed . it will also be noted in this circuit that there is a relatively small number of incoming wires , namely , one pair for each line , plus one pair for intercom , plus one pair for the supply voltage . switch 80 or hold button is a double pole double throw switch that normally would be in the lefthand position and would be thrown to the right only by pressing the hold button down . switch 82 and the switches immediately below it are four pole double throw switches and are of a type wherein if one button is depressed , the others are released . thus , if a call comes in on a particular line , the button for that particular switch is depressed releasing the others . also , it is possible by activating the switch 80 to place that particular line on hold . the line condition indicators 84 , 86 and 8n can be either of the type indicated in fig1 or fig2 . obviously one complete indicator is employed for each incoming line . also , an intercom circuit can be employed which is shown in fig3 for the sake of completeness but which is of fairly simple design , using the telephone instrument speech circuits for audio communication and utilizing the touch tone pad buttons to signal the desired office instrument . the dtmf signals are decoded in each instrument by a two stage phase locked loop decoder which can be set by means of a 7 section dip switch to decode any of the 12 pad numbers ( 0 - 9 * #). | 7 |
the present invention will now be described more specifically with reference to the following embodiments . it is to be noted that the following descriptions of preferred embodiments of the invention are presented herein for purpose of illustration and description only ; it is not intended to be exhaustive or to be limited to the precise form disclosed . the present invention will now be described more specifically with reference to the following embodiments . please refer to fig4 - 1 and fig4 - 2 . fig4 - 1 is a front view and fig4 - 2 is a back view , showing the dust cover according to a preferred embodiment of the present invention . the dust cover 5 includes a fixed portion 53 and a movable portion 50 . the flexible portion 57 connects the fixed portion 53 with the movable portion 50 . in the embodiment shown in fig4 - 1 and fig4 - 2 , the flexible portion 57 is defined by the recess slot 55 and formed integrally with the fixed portion 53 and the movable portion 50 . according to fig4 - 2 , the recess slot 55 is formed and being recess towards three directions , two lateral sides . because the thickness of the recess slot 55 is relatively much thinner than the thickness of the fixed portion 53 and the movable portion 50 , when the external force applied to the movable portion 50 , the flexible portion 57 will be bended . therefore , the plugging hole is uncovered ( please refer to fig3 ). according to the fig4 - 1 , the present invention further has a receptacle 59 for exchangeablely receiving the label therein . accordingly , the label can be easily replaced by being drawn out from the receptacle 59 . and the drawback in the conventional dust cover that the label is easily torn down can be avoided . please refer to fig4 - 2 . the fixed portion 53 further has a fixing block 51 for fixing the fixed portion 53 on the socket 2 ( fig3 ). furthermore , the movable portion 50 has a protruding element 52 for being inserted into the plugging hole 23 ( fig3 ) so as to keep the movable portion 50 firmly covering the plugging hole 23 and avoiding the dust . please refer to fig4 - 1 . the receptacle 59 has a insertion slot 54 for the label 59 a being inserted therein . furthermore , for preventing the label 59 a from slipping out from the receptacle 59 accidentally , a stopper 56 is disposed corresponding to the opening of the insertion slot 54 . therefore , the label 59 a will not fall off from the receptacle 59 by accidental external force . please refer to fig4 - 3 and fig4 - 4 . fig4 - 3 is a side view fo the dust cover according to a preferred embodiment of the present invention . and fig4 - 4 is a top view of the dust cover according to a preferred embodiment of the present invention . the fixing block 51 and the protruding element 52 are disposed at the back of the dust cover 5 and the receptacle 59 is disposed in front of the dust cover 5 . the flexible portion 57 formed by the recess slot 55 connects the fixed portion 53 with the movable portion 50 . one side of the stopper 56 , which faces to the receptacle 59 , is inclined or an arc for the label 59 a easily drawn out by a conscious external force . please refer to fig5 . fig5 is a schematic view showing the dust cover combined with the socket according to the present invention . the socket 2 has a fixing aperture 21 ′ for fixed the fixing block 51 of the dust cover 5 therein . certainly , the fixing block 51 can be as same as the holders 31 of the fig2 , and the fixing aperture 21 ′ also can be as same as the locking hole 21 of the fig2 . furthermore , the fixed portion 53 can be stuck , screwed , or welded by the high frequency welding machine when being fixed engaged with the socket 2 . please refer to fig6 . fig6 is a schematic view showing the dust cover according to another preferred embodiment of the present invention . the fixed portion 53 has a first pivotal join portion 53 ′, while the movable portion 50 has a second pivotal join portion 55 ′ pivotally connected to the first pivotal join portion 53 ′ through a shaft 57 ′. therefore , the first pivotal join portion 53 ′, the second pivotal join portion 55 ′ and the shaft 57 ′ have the same functions as the flexible portion 57 described above , and further , the possible breakage near the flexible portion 57 shown in fig5 can be avoided . please refer to fig7 . fig7 is a schematic view showing the dust cover according to yet another preferred embodiment of the present invention . fig7 shows that a socket 6 having a dust cover 50 ′ thereon . the dust cover 50 ′ is formed integrally with the body 60 of the socket 6 . the socket 6 has a plugging hole 66 for the plug 4 ( fig3 ) plugged therein so as to form an electrical connection . a slot 64 is disposed in the plugging hole 66 and has a cavity 64 a for being engaged with the incline 41 a . the dust cover 50 ′ is connected to the body 60 through the connecting portion 57 a . the connecting portion 57 a is bendable and the thickness thereof is much thinner than the dust cover 50 ′. therefore , when the external force is applied , the dust cover 50 ′ will move flexibly away from the plugging hole 66 . the dust cover 50 ′ also has the receptacle 59 as shown in fig4 - 1 . please refer to fig8 . fig8 is a schematic view showing the dust cover according to still another preferred embodiment of the present invention . the socket 7 has a dust cover 50 ″ directly pivotally connected with the body 70 of the socket 7 , but not through the fixed portion 53 as shown in fig6 . the body 70 has a pivotal join portion 72 pivotally connected to the shaft 71 a of the dust cover 50 ″. the socket 7 also has the slot 64 and the cavity 64 a disposed therein as shown in fig7 . the usage of the pivotal join portion 72 is to prevent the possible breakage near the connecting portion 57 a . the dust cover 50 ″ also has the receptacle 59 as shown in fig4 - 1 . therefore , it is clear that the receptacle which exchangeablely receives the label therein makes the label exchanging easy and avoid the drawbacks of using the paster label 39 a ( fig3 ). and the motion mechanism of the movable portion is achieved by the bendable connecting portion or the pivotal join mechanism . furthermore , the dust cover is able to be formed integrally with the socket and the process of connecting the socket and the dust cover is spared . thus the efficacy of the dust cover is increased . while the invention has been described in terms of what is presently considered to be the most practical and preferred embodiments , it is to be understood that the invention needs not be limited to the disclosed embodiments . on the contrary , it is intended to cover various modifications and similar arrangements included within the spirit and scope of the appended claims which are to be accorded with the broadest interpretation so as to encompass all such modifications and similar structures . | 7 |
the following definitions of the general terms used in the present description apply irrespective of whether the terms in question appear alone or in combination . it must be noted that , as used in the specification and the appended claims , the singular forms “ a ”, “ an ,” and “ the ” include plural forms unless the context clearly dictates otherwise . the term “ alkyl ” denotes a straight - chain or branched saturated hydrocarbon residue with 1 to 6 carbon atoms , preferably with 1 to 4 carbon atoms , such as methyl , ethyl , n - propyl , i - propyl , i - butyl , t - butyl , and the like . the term “ alkoxy ” denotes a lower alkyl residue as defined above bound via an oxygen atom . examples of “ lower alkoxy ” residues include methoxy , ethoxy , isopropoxy and the like . the terms “ alkyl substituted by one or more halogen atoms ” and “ haloalkyl ” each denotes an alkyl residue as defined above wherein at least one hydrogen atom has been replaced with a halogen atom . the terms “ alkoxy substituted by one or more halogen atoms ” and “ haloalkoxy ” each denotes an alkoxy residue as defined above wherein at least one hydrogen atom has been replaced with a halogen atom . examples of lower alkoxy substituted by one or more halogen include 2 , 2 , 2 - trifluoroethoxy groups . the term “ alkenyl ” used in the present description denotes straight - chain or branched unsaturated hydrocarbon residues with 2 - 6 , preferably 2 - 4 carbon atoms , such as ethenyl , 2 - propenyl , isobutene - 1 - yl , and those specifically exemplified in the instant patent application . the term “ aryl ” represents an aromatic carbocyclic group consisting of one individual ring , or one or more fused rings in which at least one ring is aromatic in nature . preferred aryl groups are phenyl or naphthyl . the term “ heteroaryl ” refers to an aromatic group having 5 to 12 ring atoms and containing one or more heteroatoms selected from nitrogen , oxygen and sulphur . in a certain embodiment , the heteroaryl groups contain one or more nitrogen atoms . preferred heteroaryl groups have 5 or 6 ring atoms . examples of such heteroaryl groups are pyridinyl , pyrazinyl , pyrimidinyl or pyridazinyl . the term “ cycloalkyl ” means a cycloalkyl group containing 3 to 12 , preferably 3 to 8 and still more preferably 3 to 6 , carbon atoms , such as cyclopropyl , cyclobutyl , cyclopentyl or cyclohexyl . cycloalkyl containing 3 to 4 carbon atoms are the most preferred . the term “ a heterocyclic group having 5 to 12 ring atoms ” denotes a heterocyclic ring having 5 to 12 , preferably 5 to 9 as still more preferably 5 or 6 , ring members containing at least one nitrogen atom as ring members , and none , 1 , 2 or 3 additional heteroatom ring members selected from n , o and s , the remaining ring members being carbon atoms . examples of 5 or 6 heterocyclic ring include but are not limited to 1h - tetrazole ; 2h - tetrazole ; 1 , 2 , 3 - and 1 , 24 - triazole ; imidazole ; pyrrole ; 1 , 2 , 3 -, 1 , 3 , 4 - or 1 , 2 , 5 - thiadiazine ; 1 , 4 - oxazine ; 1 , 2 - or 1 , 4 - thiazine ; 4 - morpholinyl ; 1 - pyrrolidinyl ; 1 - piperazinyl , preferably 4 - morpholinyl ; 1 - pyrrolidinyl or 1 - piperazinyl . substituents for such 5 or 6 membered heterocyclic ring include but are not limited to halo , amino , nitro , cyano , hydroxy , c 1 - 6 - alkyl optionally substituted by hydroxy , c 1 - 6 - alkoxy , c 2 - 6 - alkenyl , c 3 - 8 - cycloalkyl , or cf 3 , and preferably c 1 - 6 - alkyl ; or cf 3 . “ pharmaceutically acceptable ,” such as pharmaceutically acceptable carrier , excipient , etc ., means pharmacologically acceptable and substantially non - toxic to the subject to which the particular compound is administered . the term “ pharmaceutically acceptable addition salt ” refers to any salt derived from an inorganic or organic acid or base . “ therapeutically effective amount ” means an amount that is effective to prevent , alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated . the present invention provides pyrrazolo - pyrimidine derivatives of the general formula ( i ): r 1 is h , halo , c 1 - 6 - alkoxy , c 1 - 6 - alkyl , c 1 - 6 - haloalkyl , or c 1 - 6 - haloalkoxy ; r 3 is c 1 - 6 - alkyl optionally substituted by hydroxy ; or is nr b r c wherein r b and r c are each independently selected from the group consisting of h , c 3 - 8 - cycloalkyl , aryl , heteroaryl having from 5 to 12 ring atoms , and c 1 - 6 - alkyl which is optionally substituted by one or more substituent ( s ) selected from the group consisting of halo , hydroxy , c 3 - 8 - cycloalkyl , aryl , heteroaryl having from 5 to 12 ring atoms and — nr b ′ r c ′ , wherein r b ′ and r c ′ are each independently selected from the group consisting of h and c 1 - 6 - alkyl ; or r b and r c can , together with the nitrogen atom to which they are attached , form an optionally substituted heterocyclic group having 5 to 12 ring atoms , wherein the substituents are selected from the group consisting of halo , hydroxy , c 1 - 6 - alkyl and c 1 - 6 - haloalkyl ; and r 4 is h , straight c 1 - 6 - alkyl , c 1 - 6 - haloalkyl or c 3 - 4 - cycloalkyl ; the invention includes all racemic mixtures , all their corresponding enantiomers and / or optical isomers . the compounds of formula ( i ) can also be used in form of their prodrugs . examples are esters , n - oxides , phosphate esters , glycoamide esters , glyceride conjugates and the like . the prodrugs can add to the value of the present compounds containing compounds of the invention and a pharmaceutically acceptable carrier . the advantages in absorption , pharmacokinetics in distribution and transport to the brain . r a is h , halo , preferably cl , or c 1 - 6 - alkyl , preferably methyl ; r 1 is h , halo , preferably cl ; c 1 - 6 - alkoxy , preferably meo or eto ; c 1 - 6 - alkyl , preferably methyl ; c 1 - 6 - haloalkyl , preferably chf 2 or cf 3 ; c 1 - 6 - haloalkoxy , preferably cf 3 ch 2 o ; r 2 is halogen , preferably cl , or c 1 - 6 - haloalkyl , preferably cf 3 ; r 3 is nr b r c wherein r b and r c are each independently selected from the group consisting of h , c 1 - 6 - alkyl , preferably methyl , ethyl , i - propyl , or t - butyl , each of which is optionally substituted by one or more substituent ( s ) selected from the group consisting of hydroxy and — nr b ′ c ′ , wherein r b ′ and r c ′ are each independently selected from the group consisting of h and c 1 - 6 - alkyl , preferably methyl ; and r 4 is c 1 - 6 - haloalkyl , preferably chf 2 or cf 3 , or c 3 - 4 - cycloalkyl , preferably cyclopropyl ; r 1 is h , cl , meo , eto , methyl , chf 2 , cf 3 , or cf 3 ch 2 o ; r 3 is nr b r c wherein r b and r c are each independently selected from the group consisting of h , methyl , ethyl , i - propyl , or t - butyl , each of which is optionally substituted by one or more substituent selected from the group consisting of hydroxy and — nr b ′ c ′ , wherein r b ′ and r c ′ are each independently selected from the group consisting of h and methyl ; and r 4 is chf 2 , cf 3 , or cyclopropyl ; also encompassed by the compounds of formula ( i ) are those of formula ( ia ): wherein r a , r 1 , r 2 , r 3 and r 4 are as defined hereinabove for formula ( i ), and pharmaceutically acceptable salts thereof . 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 2 - chloro - 5 - sulfamoyl - thiophen - 3 - yl )- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 2 - chloro - 5 - sulfamoyl - thiophen - 3 - yl )- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 5 -( 4 - chloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 2 - chloro - 5 - sulfamoyl - thiophen - 3 - yl )- amide ; 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 2 - chloro - 5 - sulfamoyl - thiophen - 3 - yl )- amide ; 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 2 - chloro - 5 - sulfamoyl - thiophen - 3 - yl )- amide ; 5 -( 4 - chloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 5 -[ 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - phenyl ]- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 5 -( 3 - chloro - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 - hydroxymethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 - hydroxymethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid { 5 -[ bis -( 2 - hydroxy - ethyl )- sulfamoyl ]- 2 - chloro - thiophen - 3 - yl }- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid { 5 -[ bis -( 2 - hydroxy - ethyl )- sulfamoyl ]- 2 - chloro - thiophen - 3 - yl }- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 2 - methyl - 5 - sulfamoyl - thiophen - 3 - yl )- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 2 - methyl - 5 - sulfamoyl - thiophen - 3 - yl )- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 2 - methyl - thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 2 - methyl - thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - dimethylamino - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - dimethylamino - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 5 -( 4 - chloro - phenyl )- 7 - cyclopropyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - amino - ethylsulfamoyl )- 2 - chloro - thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [( rs )- 2 - chloro - 5 -( 3 - hydroxy - pyrrolidine - 1 - sulfonyl )- thiophen - 3 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [( rs )- 2 - chloro - 5 -( 3 - hydroxy - pyrrolidine - 1 - sulfonyl )- thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid { 2 - chloro - 5 -[( 2 - hydroxy - ethyl )- methyl - sulfamoyl ]- thiophen - 3 - yl }- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 4 - methyl - piperazine - 1 - sulfonyl )- thiophen - 3 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 4 - methyl - piperazine - 1 - sulfonyl )- thiophen - 3 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid { 2 - chloro - 5 -[( 2 - hydroxy - ethyl )- methyl - sulfamoyl ]- thiophen - 3 - yl }- amide ; and 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - amino - ethylsulfamoyl )- 2 - chloro - thiophen - 3 - yl ]- amide . also encompassed by the compounds of formula ( i ) are those of formula ( ib ): wherein r 1 , r 2 , r 3 and r 4 are as defined hereinabove for formula ( i ), and pharmaceutically acceptable salts thereof . examples of compounds of formula ( ib ) include also encompassed by the compounds of formula ( i ) are those of formula ( ic ): wherein r a , r 1 , r 2 , r 3 and r 4 are as defined hereinabove for formula ( i ), and pharmaceutically acceptable salts thereof . examples of compounds of formula ( ic ) include 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 5 -( 4 - chloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 5 -( 4 - chloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 5 -( 3 - chloro - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 5 -( 3 , 4 - dichloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 5 -[ 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - phenyl ]- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 5 -( 3 - chloro - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 5 -( 3 , 4 - dichloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 5 -[ 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - phenyl ]- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 4 - methyl - 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 2 - chloro - 5 -( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethylsulfamoyl )- thiophen - 3 - yl ]- amide ; 7 - difluoromethyl - 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid { 5 -[ bis -( 2 - hydroxy - ethyl )- sulfamoyl ]- 4 - methyl - thiazol - 2 - yl }- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid { 5 -[ bis -( 2 - hydroxy - ethyl )- sulfamoyl ]- 4 - methyl - thiazol - 2 - yl }- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 5 - sulfamoyl - thiazol - 2 - yl )- amide ; 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - dimethylamino - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - dimethylamino - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiazol - 2 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- thiazol - 2 - yl ]- amide ; 5 -( 4 - chloro - phenyl )- 7 - cyclopropyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 , 1 - dimethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 - hydroxymethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 5 -( 2 - hydroxy - 1 - hydroxymethyl - ethylsulfamoyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 4 - methyl - 5 -( 4 - methyl - piperazine - 1 - sulfonyl )- thiazol - 2 - yl ]- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [ 4 - methyl - 5 -( 4 - methyl - piperazine - 1 - sulfonyl )- thiazol - 2 - yl ]- amide ; 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid { 5 -[( 2 - hydroxy - ethyl )- methyl - sulfamoyl ]- 4 - methyl - thiazol - 2 - yl }- amide ; 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid { 5 -[( 2 - hydroxy - ethyl )- methyl - sulfamoyl ]- 4 - methyl - thiazol - 2 - yl }- amide ; ( rs )- 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [( rs )- 5 -( 3 - hydroxy - pyrrolidine - 1 - sulfonyl )- 4 - methyl - thiazol - 2 - yl ]- amide ; and 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid [( rs )- 5 -( 3 - hydroxy - pyrrolidine - 1 - sulfonyl )- 4 - methyl - thiazol - 2 - yl ]- amide . also encompassed by the compounds of formula ( i ) are those in which r 3 is c 1 - 6 - alkyl optionally substituted by hydroxyl . in another embodiment are encompassed compounds of formula ( i ) in which r 3 is nr b r c wherein r b and r c are independently selected from the group consisting of : h , c 3 - 8 - cycloalkyl , aryl , heteroaryl having from 5 to 12 ring atoms , and c 1 - 6 - alkyl which is optionally substituted by one or more substituent ( s ) selected from the group consisting of halo , hydroxy , c 3 - 8 - cycloalkyl , aryl , heteroaryl having from 5 to 12 ring atoms and — nr b ′ r c ′ , wherein r b ′ and r c ′ are each independently selected from the group consisting of h and c 1 - 6 - alkyl ; or r b and r c can , together with the nitrogen atom to which they are attached , form an optionally substituted heterocyclic group having 5 to 12 ring atoms , wherein the substituents are selected from the group consisting of halo , hydroxy , c 1 - 6 - alkyl and c 1 - 6 - haloalkyl . of these , compounds wherein r b and r c are hydrogen are preferred . alternatively , preferred compounds in this embodiment are those in which r b and r c are each independently c 1 - 6 - alkyl , optionally substituted by one or more substituent ( s ) selected from the group consisting of halo , hydroxy , and c 3 - 8 - cycloalkyl . as another alternative within this group are those compounds in which r b and r c are each independently c 1 - 6 - alkyl , optionally substituted by — nr b ′ r c ′ , wherein r b ′ and r c ′ are each independently selected from the group consisting of h and c 1 - 6 - alkyl . as yet another alternative within this group are those compounds in which r b and r c together with the nitrogen atom to which they are attached , form an optionally substituted heterocyclic group having 5 to 12 ring atoms , wherein the substituents are selected from the group consisting of halo , hydroxy , c 1 - 6 - alkyl and c 1 - 6 - haloalkyl . the compounds of the invention can be prepared according to a process comprising reacting a compound of formula ( vi ): wherein a , r 1 , r 2 , r 3 and r 4 are as defined in formula ( i ) above ; to obtain the compound of formula ( i ), and if desired converting the compound of formula ( i ) into its pharmaceutically acceptable addition salt . the pharmaceutically acceptable addition salts can be manufactured readily according to methods known per se and taking into consideration the nature of the compound to be converted into a salt . inorganic or organic acids such as , for example , hydrochloric acid , hydrobromic acid , sulphuric acid , nitric acid , phosphoric acid or citric acid , formic acid , fumaric acid , maleic acid , acetic acid , succinic acid , tartaric acid , methanesulphonic acid , p - toluenesulphonic acid and the like are suitable for the formation of pharmaceutically acceptable salts of basic compounds of formulae ( i ), ( ia ), ( ib ) and ( ic ). the synthesis of the intermediate compounds of formula ( vi ) above can be carried out in accordance with the following general procedure i which procedure is outlined below in scheme 1 . as for the reaction of the compound of formula ( vii ) with the compound of formula ( vi ), it can be carried out for example in accordance with the following general procedure ii which procedure is outlined below in scheme 2 . in these schemes , a , r 1 , r 2 , r 3 and r 4 are as defined hereinabove . procedures i and ii are applicable for the preparation of all the compounds according to formulae ( i ), ( ia ), ( ib ) and ( ic ). to a stirred solution of compound of formula ( iii ) in an organic solvent ( e . g . tert - butyl - methyl - ether ) is added at room temperature a solution of sodium methanolate in methanol followed by a solution of compound of formula ( ii ) in an organic solvent ( e . g . tert - butyl - methyl - ether ). the reaction mixture is stirred at room temperature for about 19 h , cooled , acidified and extracted ( e . g . with diethyl ether ). the combined organic layers are washed and dried ( e . g . mgso 4 ) and evaporated to give crude the compound of formula ( iv ) which can be used without further purification . a stirred mixture of commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole ( compound of formula ( v )) and compound of formula ( iv ) in an organic acid ( e . g . acetic acid ) is heated under reflux conditions for about 1 . 5 h . the reaction mixture is evaporated and the crude product is dissolved in a mixture of a concentrated base ( e . g . koh in methanol and water ). the reaction mixture is stirred at about 60 ° c . for about 1 . 5 h , cooled , acidified and concentrated . the precipitate is collected by filtration and further purified ( e . g . by crystallization from diethylether / methanol ) to give the compound of formula ( vi ). to a stirred solution of compound of formula ( vi ) in a solvent ( e . g . thf ) is added at room temperature dmf , the solution is cooled to about 0 ° c . and oxalylchloride is added . the reaction mixture is stirred at room temperature for about 3 h and evaporated to dryness . the precipitate is dissolved in pyridine and , while stirring at room temperature , 4 - dimethylaminopyridine and a compound of formula ( vii ) are added . the reaction mixture is allowed to stir at room temperature for about 16 h , evaporated to dryness and the crude product purified ( e . g . by flash chromatography on silica gel ) to yield the product , which can be further purified ( e . g . by crystallization from methanol / hexane ). the present invention also provides pharmaceutical compositions containing compounds of the invention , for example compounds of formula i and their pharmaceutically acceptable acid addition salts , and a pharmaceutically acceptable carrier . such pharmaceutical compositions can be in the form of tablets , coated tablets , dragées , hard and soft gelatine capsules , solutions , emulsions or suspensions . the pharmaceutical compositions also can be in the form of suppositories or injectable solutions . the pharmaceutical compounds of the invention , in addition to one or more compounds of the invention , contain a pharmaceutically acceptable carrier . suitable pharmaceutically acceptable carriers include pharmaceutically inert , inorganic and organic carriers . lactose , corn starch or derivatives thereof , talc , stearic acids or its salts and the like can be used , for example , as such carriers for tablets , coated tablets , dragées and hard gelatine capsules . suitable carriers for soft gelatine capsules are , for example , vegetable oils , waxes , fats , semi - solid and liquid polyols and the like . depending on the nature of the active substance no carriers are , however , usually required in the case of soft gelatine capsules . suitable carriers for the production of solutions and syrups are , for example , water , polyols , glycerol , vegetable oil and the like . suitable carriers for suppositories are , for example , natural or hardened oils , waxes , fats , semi - liquid or liquid polyols and the like . in addition , the pharmaceutical compositions can contain preservatives , solubilizers , stabilizers , wetting agents , emulsifiers , sweeteners , colorants , flavorants , salts for varying the osmotic pressure , buffers , masking agents or antioxidants . they can also contain still other therapeutically valuable substances . as mentioned earlier , medicaments containing a compound of formula ( i ) or a pharmaceutically acceptable salt thereof and a therapeutically inert excipient are also an object of the present invention , as is a process for the production of such medicaments which comprises bringing one or more compounds of formula ( i ) or pharmaceutically acceptable salts thereof and , if desired , one or more other therapeutically valuable substances into a galenical dosage form together with one or more therapeutically inert carriers . the compounds of formula ( i ) and their pharmaceutically acceptable salts are metabotropic glutamate receptor antagonists and can be used for the treatment or prevention of acute and / or chronic neurological disorders , such as psychosis , schizophrenia , alzheimer &# 39 ; s disease , cognitive disorders and memory deficits . other treatable indications are restricted brain function caused by bypass operations or transplants , poor blood supply to the brain , spinal cord injuries , head injuries , hypoxia caused by pregnancy , cardiac arrest and hypoglycaemia . further treatable indications are acute and chronic pain , huntington &# 39 ; s chorea , als , dementia caused by aids , eye injuries , retinopathy , idiopathic parkinsonism or parkinsonism caused by medicaments as well as conditions which lead to glutamate - deficient functions , such as e . g . muscle spasms , convulsions , migraine , urinary incontinence , nicotine addiction , psychoses , opiate addiction , anxiety , vomiting , dyskinesia , depression and glioma . the dosage at which the compounds of the invention can be administered can vary within wide limits and will , of course , be fitted to the individual requirements in each particular case . in general , the effective dosage for oral or parenteral administration is between 0 . 01 - 20 mg / kg / day , with a dosage of 0 . 1 - 10 mg / kg / day being preferred for all of the indications described . the daily dosage for an adult human being weighing 70 kg accordingly lies between 0 . 7 - 1400 mg per day , preferably between 7 and 700 mg per day . the compounds of the present invention are group ii mglu receptor antagonists . the compounds show activities , as measured in the assay described below , of 0 . 150 μm or less , typically 0 . 030 μm or less , and ideally of 0 . 010 μm or less . in the table below are described some specific ki values of representative compounds . ex . no . 2 3 8 35 k i mglu2 ( μm ) 0 . 0069 0 . 142 0 . 0025 0 . 027 cdna encoding the rat mglu2 receptor protein in pbluescript ii was subcloned into the eukaryotic expression vector pcdna i - amp from invitrogen ltd ( paisley , uk ). this vector construct ( pcd1mgr2 ) was co - transfected with a psvneo plasmid encoding the gene for neomycin resistance , into cho cells by a modified calcium phosphate method described by chen & amp ; okayama ( 1988 ). the cells were maintained in dulbecco &# 39 ; s modified eagle medium with reduced l - glutamine ( 2 mm final concentration ) and 10 % dialysed foetal calf serum from gibco - invitrogen ( carlsbad , calif ., usa ). selection was made in the presence of g - 418 ( 1000 ug / ml final ) and mcpg ??. clones were identified by reverse transcription of 5 μg total rna , followed by pcr mglu2 receptor specific primers 5 ′- atcactgcttgggtttctggcactg - 3 ′ and 5 ′- agcatcactgtgggtggcataggagc - 3 ′ in 60 mm tris hcl ( ph 10 ), 15 mm ( nh4 ) 2 so 4 , 2 mm mgcl 2 , 25 units / ml taq polymerase with 30 cycles annealing at 60 ° c . for 1 min ., extention at 72 ° c . for 30 s , and 1 min . 95 ° c . denaturation . cells , cultured as above , were harvested and washed three times with cold pbs and frozen at − 80 ° c . the pellet was resuspended in cold 20 mm hepes - naoh buffer containing 10 mm edta ( ph 7 . 4 ), and homogenised with a polytron ( kinematica , ag , littau , switzerland ) for 10 s at 10 000 rpm . after centrifugation for 30 min . at 4 ° c ., the pellet was washed once with the same buffer , and once with cold 20 mm hepes - naoh buffer containing 0 . 1 mm edta , ( ph 7 . 4 ). protein content was measured using the micro bca method from pierce - perbio ( rockford , ill ., usa ) using bovine serum albumin as standard . after thawing , the membranes were resuspended in cold 50 mm tris - hcl buffer containing 2 mm mgcl 2 ( ph 7 ) ( binding buffer ). the final concentration of the membranes in the assays was 25 μg protein / ml . inhibition experiments were performed with membranes incubated with 10 nm [ 3 h ]- ly354740 at room temperature , for 1 hour , in presence of various concentrations of the compound to be tested . following the incubations , membranes were filtered onto whatmann gf / b glass fiber filters and washed 5 times with cold binding buffer . non specific binding was measured in the presence of 10 μm dcg iv . after transfer of the filters into plastic vials containing 10 ml of ultima - gold scintillation fluid from perkin - elmer ( boston , mass ., usa ), the radioactivity was measured by liquid scintillation in a tri - carb 2500 tr counter ( packard , zürich , switzerland ). the inhibition curves were fitted with a four parameter logistic equation giving ic 50 values , and hill coefficients . almost all of the starting materials used in the general procedures i and ii are commercially available . the non - commercially available starting materials have been prepared according to the procedures as outlined hereafter and unless otherwise specified , the intermediate compounds described therein are novel compounds . other starting materials useful in the general procedures i and ii can be prepared taking into account the following examples of preparation and using known methods . to a stirred and cooled ( 0 ° c .) solution of potassium tert .- butanolate ( 1 . 39 g , 12 mmol ) in dmso ( 3 ml ) was added diethyl malonate ( 1 . 9 ml , 12 mmol ) and the reaction mixture was stirred for 20 min at room temperature . to the white suspension was added at room temperature 4 - fluoro - 3 - trifluoromethyl - acetophenone ( 1 g , 5 mmol ) and dmso ( 2 ml ). the reaction mixture was stirred for 6 h at 60 ° c . and for 16 h at room temperature . the reaction mixture was cooled ( 0 ° c . ), a solution of potassium hydroxide ( 1 . 09 g , 19 mmol ) in water ( 2 ml ) was added and the mixture was stirred at 100 ° c . for 23 h . the mixture was poured into ice / water ( 40 ml ) and extracted with diethyl ether ( 2 × 40 ml ). the combined organic layers were washed with water ( 3 × 30 ml ), brine ( 30 ml ), dried ( mgso 4 ) and evaporated . the crude product ( 0 . 92 g ) was further purified by column chromatography on silica gel ( heptane / ethyl acetate 3 : 1 ) to give the title compound ( 0 . 76 g , 77 %) as a light yellow liquid . ms ( ei ) 202 . 0 [ m ]. to a stirred suspension of potassium ethanolate ( 2 . 36 g , 27 mmol ) in ethanol ( 30 ml ) was added at room temperature a solution of 4 - fluoro - 3 - trifluoromethyl - acetophenone ( 2 . 5 g , 12 mmol ) in ethanol ( 10 ml ). the reaction mixture was stirred at 60 ° c . for 2 h and evaporated . ice / 2 n hcl ( 50 ml ) was added and the water layer was extracted with diethylether ( 2 × 100 ml ). the combined organic layers were washed with ice - water ( 50 ml ), brine ( 50 ml ), dried ( mgso 4 ) and evaporated to give the title compound ( 2 . 9 g , 98 %) as a brown solid , which was used without further purification . ms ( ei ) 232 . 1 [ m ]. to a stirred solution of 4 - fluoro - 3 - trifluoromethyl - acetophenone ( 2 . 5 g , 12 mmol ) in dmso ( 15 ml ) was added at room temperature 2 , 2 , 2 - trifluoroethanol ( 1 . 7 g , 17 mmol ) and potassium hydroxide ( 1 . 74 g , 27 mmol ). the reaction mixture was stirred for 30 min at 40 ° c ., ice / 2n hcl ( 50 ml ) was added and the water layer was extracted with diethylether ( 2 × 100 ml ). the combined organic layers were washed with ice - water ( 50 ml ), brine ( 50 ml ), dried ( mgso 4 ) and evaporated to give the title compound ( 3 . 6 g , 98 %) as a brown solid , which was used without further purification . ms ( ei ) 286 . 1 [ m ]. under argon atmosphere , a suspension of potassium tert - butanolate ( 71 . 6 g , 625 mmol ) in dmso ( 150 ml ) was placed in a 1 . 5 l flask , fitted with a mechanical stirrer . then diethyl malonate ( 97 . 9 ml , 625 mmol ) was added drop wise at 20 - 30 ° c . under ice bath cooling . to the thick white suspension was the added solid commercially available 5 - chloro - 2 - nitro - 4 - trifluoromethyl - phenylamine [ cas - no . 35375 - 74 - 7 ] ( 60 . 14 g , 250 mmol ) in one portion , the mixture was diluted with dmso ( 100 ml ) and the red solution warmed up to 60 ° c . and stirred for 20 h at 60 ° c . the mixture was cooled to 23 ° c . and a solution of potassium hydroxide ( 85 %, 65 . 24 g , 1 mol ) in water ( 100 ml ) was added drop wise . the mixture was then heated to 100 ° c . and stirred for further 4 h . the mixture was cooled to 23 ° c ., diluted with water ( ca . 1000 ml ), acidified with 37 % hcl 3 to ph 3 , and extracted three times with tert - butyl methyl ether ( tbme ) the organic layers were washed with brine , dried over mgso 4 and evaporated to give a brown solid , which was triturated with hot heptane , filtered off and washed with heptane to give the title compound as a brown solid ( 50 . 0 g , 91 %), which was used without further purification . ms ( isn ) 218 . 9 [ m − h ]. to a rapidly stirred mixture of tert - butyl nitrite ( 45 . 33 ml , 382 mmol ) and copper ( ii ) bromide ( 76 . 1 g , 341 mmol ) in acetonitrile ( 450 ml ) at 65 ° c . was added cautiously solid 5 - methyl - 2 - nitro - 4 - trifluoromethyl - phenylamine from step 1 ( 50 . 0 g , 227 mmol ). after the addition was complete , stirring was continued for further 1 h at 65 ° c . the mixture was cooled to 23 ° c . and poured into 1 n hcl ( 1000 ml ), extracted twice with tbme , the organic layer was washed with brine , dried over mgso 4 . removal of the solvent in vacuum left a brown oil , which was purified by silica gel column chromatography with heptane / ethyl acetate 9 : 1 to give the title compound as a yellow liquid ( 49 . 8 g , 77 %). ms ( ei ) 283 . 0 [ m ] and 285 . 0 [ m + 2 ]. a mixture of 1 - bromo - 5 - methyl - 2 - nitro - 4 - trifluoromethyl - benzene from step 2 ( 49 . 80 g , 175 mmol ) and copper ( i ) cyanide ( 16 . 5 g , 184 mmol ) in 1 - methyl - 2 - pyrrolidone ( nmp ) ( 180 ml ) was heated up to 150 ° c . and stirred for 30 min under nitrogen atmosphere . the mixture was cooled to 23 ° c . and poured into 1 n hcl , extracted with tbme , washed with brine and dried over na 2 so 4 . removal of the solvent in vacuum left a brown oil , which was purified by silica gel column chromatography with heptane / ethyl acetate 4 : 1 -& gt ; 2 : 1 to give the title compound as a light yellow solid ( 35 . 48 g , 88 %). ms ( ei ) 230 . 1 [ m ]. iron powder ( 37 . 42 g , 670 mmol ) was added in small portions to a stirred suspension of finely grinded 5 - methyl - 2 - nitro - 4 - trifluoromethyl - benzonitrile from step 3 ( 34 . 58 g , 150 mmol ) in methanol ( 75 ml ) and 37 % hcl ( 93 ml ). the internal temperature was kept between 40 and 60 ° c . by external water bath cooling . the resulting brown solution was stirred for 1 h at 50 ° c ., giving a green suspension . the mixture was poured into ice cold water ( 600 ml ), the precipitated solid was filtered off and washed with water to give a green solid , which was dissolved in boiling ethanol ( 700 ml ), activated carbon ( ca . 10 g ) was added and the mixture was refluxed for 1 h . the hot solution was filtered and the solvent was evaporated in vacuum to leave the title compound as a brown - yellow solid ( 23 . 55 g , 78 %), which was used without further purification . ms ( ei ) 200 . 1 [ m ]. to a solution of 2 - amino - 5 - methyl - 4 - trifluoromethyl - benzonitrile from step 4 ( 23 . 34 g , 117 mmol ) in dry thf ( 350 ml ) was added isoamyl nitrite ( 34 . 3 ml , 257 mmol ) and the mixture was refluxed for 20 h . additional isoamyl nitrite ( 16 . 6 ml , 129 mmol ) was added and the mixture was refluxed for further 20 h . the mixture was cooled to 23 ° c . and diluted with tbme , the organic layer was washed with 1 n hcl , sat . nahco 3 - sol . and brine , dried over na 2 so 4 . removal of the solvent in vacuum left a brown oil ( 25 . 82 g ), which was purified by bulb to bulb distillation to give a yellow liquid ( 20 . 11 g ), which was finally purified by distillation to give the title compound as a yellow liquid ( 17 . 10 g , 79 %; bp 38 - 42 ° c . at 0 . 8 mbar ). ms ( ei ) 185 . 1 [ m ]. a mixture of 3 - methyl - 4 - trifluoromethyl - benzonitrile from step 5 ( 16 . 25 g , 88 mmol ) and 3 n naoh ( 88 ml , 264 mmol ) in dioxane ( 90 ml ) was refluxed for 18 h . the mixture was cooled to 23 ° c ., diluted with tbme , acidified with 1 n hcl to ph 1 and extracted twice with tbme . the combined organic layers were washed with brine , dried over mgso 4 . removal of the solvent in vacuum left the title compound as an off white solid ( 14 . 46 g , 81 %), %), which was used without further purification . ms ( isn ) 203 . 1 [ m − h ]. to a suspension of 3 - methyl - 4 - trifluoromethyl - benzoic acid from step 6 ( 14 . 1 g , 69 . 1 mmol ), n , o - dimethylhydroxylamine hydrochloride ( 10 . 78 g , 111 mmol ), n - methylmorpholine ( 12 . 14 ml , 111 mmol ) and 4 - dmap ( 844 mg , 691 mmol ) in dcm ( 230 ml ) at 0 ° c . were added 1 -( 3 - dimethylaminopropyl )- 3 - ethylcarbodiimide hydrochloride ( edc ) ( 15 . 98 g , 82 . 9 mmol ) and dmf ( 85 ml ). the mixture was warmed up to 23 ° c . and was stirred for 18 h under nitrogen atmosphere . the mixture was diluted with tbme , washed with water and twice brine , dried over na 2 so 4 . removal of the solvent in vacuum left the title compound as a brown oil ( 16 . 92 g , 99 %), which was used without further purification . ms ( isp ) 248 . 0 [ m + h ]. to a solution of n - methoxy - 3 , n - dimethyl - 4 - trifluoromethyl - benzamide from step 7 ( 16 . 90 g , 68 . 36 mmol ) in thf ( 280 ml ) at − 5 ° c . was added a 3 m methylmagnesium bromide solution in diethyl ether ( 45 . 6 ml , 136 . 7 mmol ). the mixture was stirred at 0 ° c . for 1 h , then was warmed up to 23 ° c . and stirring was continued at 23 ° c . for further 1 . 5 h under nitrogen atmosphere . then 1 n hcl ( 100 ml ) was added drop wise to the mixture and stirring was continued for 30 min . the mixture was diluted with etoac and the aqueous layer was separated , the organic layer was washed with brine and dried over mgso 4 . removal of the solvent in vacuum left the title compound as a light brown liquid ( 12 . 87 g , 93 . 1 %), which was used without further purification . ms ( ei ) 202 . 1 [ m ]. to etoh ( 500 ml ) was added potassium metal ( ca . 21 g , ca . 537 mmol ) and the vigorous reaction had to be cooled with an ice bath . stirring was continued until all potassium metal was dissolved . solid commercially available 5 - chloro - 2 - nitro - 4 - trifluoromethyl - phenylamine [ cas - no . 35375 - 74 - 7 ] ( 57 . 74 g , 240 mmol ) was added in one portion and the resulting dark red mixture was stirred at 55 - 60 ° c . for 4 days . the warm reaction mixture was slowly poured into h 2 o ( ca . 2000 ml ), adjusted ph with conc . hcl to ph 2 , the yellow precipitate was filtered off , washed with h 2 o and dried in air at 60 ° c . to give a yellow solid ( 57 . 81 g , 96 %), which was used without further purification . ms ( isn ) 249 [ m − h ]. solid 5 - ethoxy - 2 - nitro - 4 - trifluoromethyl - phenylamine from step 1 ( 57 . 81 g , 231 mmol ) was added slowly over 15 min to a rapidly stirred mixture of tert - butyl nitrite ( 45 . 8 ml , 347 mmol ) and anhydrous copper ( ii ) bromide ( 77 . 4 g , 347 mmol ) in acetonitrile ( 462 ml ), which was heated to 65 ° c . in an oil bath . stirring at 65 ° c . was continued for 30 min , the reaction mixture was cooled to 23 ° c ., poured into 1 n hcl , saturated with solid nacl , extracted with tbme , dried over mgso 4 . removal of the solvent in vacuum left a dark brown oil ( 74 . 5 g ). silica gel column chromatography with heptane / etoac 4 : 1 gave the title compound as a yellow solid ( 63 . 03 g , 87 %). ms ( ei ) 313 . 0 [ m ] and 315 . 0 [ m + 2 ]. a mixture of 1 - bromo - 5 - ethoxy - 2 - nitro - 4 - trifluoromethyl - benzene from step 2 ( 61 . 81 g , 197 mmol ) and cucn ( 18 . 51 g , 207 mmol ) in nmp ( 197 ml ) was heated to 150 ° c . for 30 min . cooled to 23 ° c ., poured into 1 n hcl , extracted with tbme , washed with brine , dried over na 2 so 4 . removal of the solvent in vacuum left a brown oil . silica gel column chromatography with heptane / etoac 4 : 1 gave the title compound as a yellow solid ( 46 . 73 g , 91 %). ms ( ei ) 260 . 1 [ m ]. iron powder ( 40 . 96 g , 733 mmol ) was added in small portions over 5 min to a stirred suspension of finely grinded 5 - ethoxy - 2 - nitro - 4 - trifluoromethyl - benzonitrile from step 3 ( 42 . 79 g , 164 . 5 mmol ) in meoh ( 85 ml ) and conc . hcl ( 102 ml ) with water bath cooling keeping the internal temperature at 40 - 50 ° c . the resulting mixture was stirred for further 1 h at ca . 50 ° c . and then poured into ice cold h 2 o ( 700 ml ). the precipitate was filtered , washed with water , dried , and dissolved in boiling etoh ( 800 ml ), activated carbon ( ca . 10 g ) was added , the mixture was refluxed for 45 min , the hot solution was filtered and evaporated to dryness to leave a yellow solid ( 31 . 81 g , 84 %), which was used without further purification . ms ( ei ) 230 . 1 [ m ]. to a solution of 2 - amino - 5 - ethoxy - 4 - trifluoromethyl - benzonitrile from step 4 ( 31 . 62 g , 137 . 4 mmol ) in dry thf ( 410 ml ) was added isoamyl nitrite ( 40 . 4 ml , 302 mmol ) and the mixture was refluxed for 16 h . the solvent was removed in vacuum to give an orange oil , which was dissolved in sat . nahco 3 - sol ., extracted three times with diethyl ether . the combined organic layers were washed with 1 n hcl and brine , dried over na 2 so 4 . removal of the solvent in vacuum left an orange oil , which was purified by double kugelrohr distillation ( up to 160 ° c . bath temperature at 1 . 5 mbar ) to give the title compound as a light yellow solid ( 25 . 06 g , 85 %). ms ( ei ) 185 . 1 [ m ]. to a solution of 3 - ethoxy - 4 - trifluoromethyl - benzonitrile from step 5 ( 5 . 00 g , 23 . 2 mmol ), copper ( i ) bromide ( 100 mg , 0 . 7 mmol ), tert .- butyldimethylchlorosilane ( 4 . 20 g , 27 . 9 mmol ) in dry thf ( 30 ml ) at − 70 ° c . was drop wise added a 3 m methylmagnesium bromide solution in diethyl ether ( 13 . 2 ml , 39 . 6 mmol ). the mixture was stirred at − 70 ° c . for 10 min , then was warmed up to 0 ° c . and stirring was continued at 0 ° c . for further 2 h under nitrogen atmosphere . poured the reaction mixture onto ice and sat . nh 4 cl - sol ., extracted three times with diethyl ether , washed the combined organic layers with brine , dried over mgso 4 . removal of the solvent in vacuum left a brown oil , which was purified by silica gel column chromatography with heptane / etoac 4 : 1 to give the title compound as a yellow liquid ( 1 . 84 g , 34 %). ms ( ei ) 232 [ m ]. commercially available 5 - chloro - 2 - nitro - 4 - trifluoromethyl - phenylamine [ cas - no . 35375 - 74 - 7 ] ( 72 . 2 g , 300 mmol ) was dissolved in dmso ( 600 ml ) and 2 , 2 , 2 - trifluoroethanol ( 270 ml ) were added at 23 ° c ., the slightly exothermic reaction was cooled with a ice bath . koh ( 85 %, 99 . 0 g , 1500 mmol ) were added slowly and the dark red reaction mixture was stirred at 23 ° c . for 4 days . transferred into a 3 l flask and 1500 ml h 2 o were added under ice bath cooling , acidified with 3 n hcl and stirred at 23 ° c . for 3 h , filtered off the yellow precipitate , washed with h 2 o and dried in air at 60 ° c . to give the title compound as a yellow solid ( 89 . 47 g , 98 %). ms ( isn ) 303 . 1 [ m − h ]. solid 2 - nitro - 5 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - phenylamine from step 1 ( 24 . 28 g , 80 mmol ) was added slowly over 15 min to a rapidly stirred mixture of tert - butyl nitrite ( 14 . 23 ml , 120 mmol ) and anhydrous copper ( ii ) bromide ( 26 . 75 g , 120 mmol ) in acetonitrile ( 160 ml ), which was heated to 65 ° c . in an oil bath . stirring at 65 ° c . was continued for 2 h , the reaction mixture was cooled to 23 ° c ., poured into 1 n hcl , saturated with solid nacl , extracted with tbme , dried over mgso 4 . removal of the solvent in vacuum left a dark brown oil ( 35 . 57 g ). silica gel column chromatography with heptane / etoac 4 : 1 gave the title compound as an orange solid ( 30 . 54 g , 104 %), which was used without further purification . ms ( ei ) 367 [ m ] and 369 [ m + 2 ]. a mixture of 1 - bromo - 2 - nitro - 5 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - benzene from step 2 ( 30 . 54 g , 83 . 0 mmol ) and cucn ( 7 . 80 g , 87 . 1 mmol ) in nmp ( 83 ml ) was heated to 150 ° c . for 30 min . cooled to 23 ° c ., poured into 1 n hcl , extracted with etoac , washed with brine , dried over na 2 so 4 . removal of the solvent in vacuum left a dark brown oil ( 33 . 9 g ). silica gel column chromatography with heptane / etoac 9 : 1 -& gt ; 4 : 1 gave the title compound as a yellow solid ( 22 . 05 g , 85 %). ms ( ei ) 314 [ m ]. iron powder ( 15 . 80 g , 283 . 0 mmol ) was added in small portions over 5 min to a stirred suspension of finely grinded 2 - nitro - 5 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - benzonitrile from step 3 ( 19 . 93 g , 63 . 4 mmol ) in meoh ( 32 ml ) and conc . hcl ( 40 ml ) with water bath cooling keeping the internal temperature at 25 - 35 ° c . the resulting mixture was stirred for further 1 h at ca . 30 ° c . and then poured into ice cold h 2 o ( 400 ml ). the precipitate was filtered , washed with water , dried , and dissolved in boiling etoh ( 400 ml ), activated carbon ( ca . 10 g ) was added , the mixture was refluxed for 45 min , the hot solution was filtered and evaporated to dryness to leave a dark green solid ( 15 . 96 g , 84 %), which was further purified by silica gel column chromatography with heptane / etoac 4 : 1 to give the title compound as a yellow solid ( 14 . 56 g , 81 %). ms ( isn ) 283 [ m − h ]. to a solution of 2 - amino - 5 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - benzonitrile from step 4 ( 14 . 47 g , 50 . 9 mmol ) in dry thf ( 153 ml ) was added isoamyl nitrite ( 15 . 0 ml , 112 . 0 mmol ) and the mixture was refluxed for 20 h . the solvent was removed in vacuum to give an orange oil , which was dissolved in tbme , washed with 1 n hcl , sat . nahco 3 - sol . and brine , dried over na 2 so 4 . removal of the solvent in vacuum left a brown solid ( 15 . 05 g ), which was purified by kugelrohr distillation ( up to 155 ° c . bath temperature at 1 . 2 mbar ) to give the title compound as a light yellow solid ( 10 . 83 g , 79 %). ms ( ei ) 269 [ m ]. a mixture of 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - benzonitrile from step 5 ( 8 . 75 g , 33 mmol ) and 3 m naoh ( 3 . 9 g , 98 mmol in 33 ml h2o ) in dioxane ( 33 ml ) was refluxed for 7 . 5 h . poured onto ice , acidified with conc . hcl to ph 1 , saturated with solid nacl , extracted with tbme , dried over mgso 4 . removal of the solvent in vacuum left the title compound as an off - white solid ( 9 . 22 g , 98 %), %), which was used without further purification . ms ( isn ) 286 . 9 [ m − h ]. to a mixture of 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - benzoic acid from step 6 ( 9 . 22 g , 32 mmol ), n , o - dimethylhydroxylamine hydrochloride ( 5 . 00 g , 51 mmol ), n - methylmorpholine ( 5 . 62 ml , 51 mmol ) and 4 - dmap ( 391 mg , 3 . 2 mmol ) in dcm ( 100 ml ) and dmf ( 20 ml ) at 0 ° c . was added 1 -( 3 - dimethylaminopropyl )- 3 - ethylcarbodiimide hydrochloride ( edc ) ( 7 . 36 g , 38 mmol ) and the mixture was stirred at 23 ° c . for 18 h . poured onto ice cold 1 n hcl , extracted with tbme , washed with sat . nahco 3 - sol . and brine , dried over na 2 so 4 . removal of the solvent in vacuum left the title compound as a brown oil ( 10 . 555 g , 100 %), %), which was used without further purification . ms ( ei ) 331 . 0 [ m ]. to a solution of n - methoxy - n - methyl - 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - benzamide from step 7 ( 10 . 467 g , 32 mmol ) in thf ( 100 ml ) at − 5 ° c . was added methylmagnesium bromide ( 3 m in et 2 o , 21 . 1 ml , 64 mmol ). the mixture was stirred at 0 ° c . for 15 min , then warmed up to 23 ° c ., stirring was continued for further 1 . 5 h at 23 ° c . cooled to 0 ° c ., 1 n hcl ( 150 ml ) was added dropwise , stirring was continued at 23 ° c . for 15 min , the mixture was diluted with tbme , the phases were separated , the organic layer was washed with water and brine , dried over mgso4 . removal of the solvent in vacuum left a yellow solid ( 9 . 021 g , 100 %), which was used without further purification . ms ( ei ) 286 . 1 [ m ]. hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonamide [ cas - no . 61714 - 46 - 3 ; commercially available ] ( 1 . 13 g , 4 . 66 mmol ) in methanol ( 140 ml ) on raney - nickel ( 1 . 13 g ) for 3 h at room temperature yielded after removal of the catalyst by filtration , evaporation and column chromatography on silica gel ( ethyl acetate / hexane ) the title compound as a light brown solid . ms ( isp ) 211 . 0 [( m − h ) − ], mp 138 ° c . a ) to a stirred solution of 2 - amino - 2 - methyl - 1 - propanol ( 0 . 75 g , 8 . 39 mmol ) in dioxane ( 21 ml ) was added at room temperature 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 2 . 0 g , 7 . 63 mmol ) and triethylamine ( 1 . 17 ml , 8 . 39 mmol ). the light yellow suspension was stirred at room temperature for 17 h , poured into water ( 100 ml ) and extracted with dichloromethane ( 3 × 75 ml ). the combined organic layers were washed with water ( 100 ml ) and brine ( 70 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by column chromatography on silica gel ( heptane / ethyl acetate 1 : 1 ) and subsequent crystallization from ethyl acetate / hexane to yield 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( 0 . 73 g , 30 %) as a light brown solid . ms ( isp ) 313 . 1 [( m − h ) − ], mp 136 ° c . b ) hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( 0 . 66 g , 2 . 1 mmol ) in methanol ( 70 ml ) on raney - nickel ( 0 . 66 g ) for 3 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by column chromatography on silica gel ( ethyl acetate / hexane ) followed by crystallization from ethyl acetate / hexane the title compound ( 0 . 41 g , 69 %) as a light brown solid . ms ( isp ) 282 . 8 [( m − h ) − ], mp 113 ° c . a ) to a stirred solution of 2 - amino - 2 - methyl - 1 - propanol ( 1 . 14 g , 13 mmol ) in dioxane ( 20 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methylthiazole - 5 - sulfonyl chloride ( 2 . 95 g , 12 mmol ) and triethylamine ( 1 . 78 ml , 13 mmol ). the light yellow suspension was stirred at room temperature for 17 h , poured into water ( 100 ml ) and extracted with dichloromethane ( 2 × 10 ml ). the combined organic layers were washed with sat . nahco 3 solution ( 2 × 70 ml ) and brine ( 70 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by column chromatography on silica gel ( ethyl acetate / meoh 9 : 1 ) and subsequent crystallization ( ethyl acetate / meoh / heptane ) to yield 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( 1 . 15 g , 32 %) as a light brown solid . ms ( isp ) 306 . 1 [( m − h ) − ]; mp 194 ° c . b ) a stirred suspension of 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( 1 . 15 g , 3 . 58 mmol ) in 6n hydrochloric acid ( 14 ml ) was heated for 2 h at 80 ° c ., evaporated ., and saturated nahco 3 solution ( 30 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 30 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by column chromatography on silica gel ( dichloromethane / meoh / nh 4 oh 80 : 10 : 1 ) to yield the title compound ( 0 . 68 g , 71 %) as a white solid . ms ( isp ) 264 . 0 [( m − h ) − ]; mp 146 ° c . a ) to a stirred solution of 2 - amino - 1 , 3 - propanediol ( 0 . 5 g , 5 . 49 mmol ) in water ( 2 ml ) was added at room temperature magnesium oxide ( 1 . 11 g , 27 . 5 mmol ) and thf ( 6 ml ). the suspension was stirred at room temperature for 30 min and a solution of 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 2 . 88 g , 10 . 9 mmol ) in thf ( 2 ml ) was added . the light yellow suspension was stirred at room temperature for 1 h and , after filtration on dicalit , evaporated . water ( 60 ml ) was added and the mixture was extracted with ethyl acetate ( 3 × 50 ml ). the combined organic layers were washed with brine ( 70 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by column chromatography on silica gel ( heptane / ethyl acetate 1 : 1 ) and subsequent crystallization from ethyl acetate / hexane to yield 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( 0 . 76 g , 44 %) as a light yellow solid . ms ( isp ) 314 . 9 [( m − h ) − ], mp 142 ° c . b ) hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( 0 . 67 g , 2 . 12 mmol ) in methanol ( 67 ml ) on raney - nickel ( 0 . 67 g ) for 2 . 5 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by column chromatography on silica gel ( dichloromethane / meoh ) followed by crystallization from ethyl acetate / hexane the title compound ( 0 . 47 g , 77 %) as a light brown solid . ms ( isp ) 286 . 8 [( m + h ) + ], mp 132 ° c . a ) to a stirred solution of diethanolamine ( 1 . 16 g , 11 mmol ) in water ( 4 ml ) was added at room temperature magnesium oxide ( 2 . 22 g , 55 mmol ) and thf ( 16 ml ). the suspension was stirred at room temperature for 30 min and a solution of 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 3 . 46 g , 13 . 2 mmol ) in thf ( 4 ml ) was added . the light yellow suspension was stirred at room temperature for 1 h and , after filtration on dicalit , evaporated . water ( 60 ml ) was added and the mixture was extracted with ethyl acetate ( 3 × 50 ml ). the combined organic layers were washed with brine ( 70 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by flash chromatography on silica gel ( heptane / ethyl acetate ) to yield 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( 0 . 48 g , 13 %) as a yellow solid . ms ( isp ) 331 . 2 [( m + h ) + ], mp 113 ° c . b ) hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( 0 . 40 g , 1 . 21 mmol ) in methanol ( 40 ml ) on raney - nickel ( 0 . 40 g ) for 4 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by flash chromatography on silica gel ( dichloromethane / meoh ) the title compound ( 0 . 19 g , 52 %) as a yellow solid . ms ( isp ) 301 . 0 [( m + h ) + ], mp 96 ° c . a ) to a stirred solution of ethanolamine ( 0 . 67 g , 11 mmol ) in water ( 4 ml ) was added at room temperature magnesium oxide ( 2 . 22 g , 55 mmol ) and thf ( 12 ml ). the suspension was stirred at room temperature for 30 min and a solution of 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 3 . 46 g , 13 . 2 mmol ) in thf ( 4 ml ) was added . the light yellow suspension was stirred at room temperature for 1 h and , after filtration on dicalit , evaporated . water ( 60 ml ) was added and the mixture was extracted with ethyl acetate ( 3 × 50 ml ). the combined organic layers were washed with brine ( 70 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by flash chromatography on silica gel ( heptane / ethyl acetate ) and subsequent crystallization from ethyl acetate / hexane to yield 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - ethyl )- amide ( 1 . 39 g , 44 %) as a yellow solid . ms ( isp ) 284 . 8 [( m − h ) − ], mp 99 ° c . b ) hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( 1 . 28 g , 4 . 46 mmol ) in methanol ( 120 ml ) on raney - nickel ( 1 . 28 g ) for 4 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by flash chromatography on silica gel ( dichloromethane / meoh ) the title compound ( 0 . 78 g , 68 %) as a yellow solid . ms ( isp ) 254 . 9 [( m − h ) − ], mp 100 ° c . a ) to a stirred solution of 2 - amino - 2 - methyl - 1 , 3 - propanediol ( 0 . 44 g , 4 . 2 mmol ) in thf ( 10 ml ) was added at room temperature 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 1 . 0 g , 3 . 82 mmol ) and triethylamine ( 0 . 58 ml , 4 . 2 mmol ). the light yellow suspension was stirred at room temperature for 17 h , poured into water ( 100 ml ) and extracted with dichloromethane ( 3 × 75 ml ). the combined organic layers were washed with water ( 100 ml ) and brine ( 70 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by flash chromatography on silica gel ( heptane / ethyl acetate ) and subsequent crystallization from ethyl acetate / hexane to yield 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( 0 . 25 g , 20 %) as a light brown solid . mp 133 ° c . b ) hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( 0 . 25 g , 0 . 76 mmol ) in methanol ( 30 ml ) on raney - nickel ( 0 . 26 g ) for 5 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by flash chromatography on silica gel ( ethyl acetate / heptane ) followed by crystallization from ethyl acetate / hexane the title compound ( 0 . 16 g , 68 %) as a light brown solid . ms ( isp ) 299 . 1 [( m − h ) − ], mp 136 ° c . a ) to a stirred solution of diethanolamine ( 1 . 24 g , 11 . 8 mmol ) in dioxane ( 20 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonyl chloride ( 1 . 0 g , 3 . 93 mmol ) and triethylamine ( 0 . 6 ml , 4 . 32 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by flash chromatography on silica gel ( dichloromethane / meoh ) and subsequent crystallization ( dichloromethane / meoh / hexane ) to yield 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( 0 . 74 g , 58 %) as a white solid . ms ( isp ) 324 . 0 [( m + h ) + ]; mp 204 ° c . b ) a stirred suspension of 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( 0 . 7 g , 2 . 16 mmol ) in 6n hydrochloric acid ( 8 ml ) was heated for 2 h at 80 ° c ., evaporated ., and saturated nahco 3 solution ( 50 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 30 ml ) and dried ( mgso 4 ). the crude product was further purified by crystallization ( hexane ) to yield the title compound ( 0 . 45 g , 74 %) as a white solid . ms ( isp ) 281 . 9 [( m + h ) + ]; mp 141 ° c . a ) to a stirred solution of 2 - amino - 2 - methyl - 1 , 3 - propanediol ( 1 . 86 g , 17 . 7 mmol ) in dioxane ( 20 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methylthiazole - 5 - sulfonyl chloride ( 1 . 5 g , 5 . 89 mmol ) and triethylamine ( 0 . 9 ml , 6 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by flash chromatography on silica gel ( ethyl acetate / meoh ) and subsequent crystallization ( dichloromethane / meoh / hexane ) to yield 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( 0 . 33 g , 17 %) as a white solid . ms ( isp ) 322 . 2 [( m − h ) − ]; mp 201 ° c . b ) a stirred suspension of 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( 0 . 33 g , 1 . 02 mmol ) in 6n hydrochloric acid ( 4 ml ) was heated for 2 h at 80 ° c ., evaporated ., and saturated nahco 3 solution ( 30 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 30 ml ) and dried ( mgso 4 ). the crude product was further purified by crystallization ( dichloromethane / meoh / hexane ) to yield the title compound ( 0 . 11 g , 38 %) as a white solid . ms ( isp ) 280 . 0 [( m − h ) − ]; mp 170 ° c . a ) to a stirred solution of ethanolamine ( 1 . 08 g , 17 . 7 mmol ) in dioxane ( 20 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methylthiazole - 5 - sulfonyl chloride ( 1 . 5 g , 5 . 89 mmol ) and triethylamine ( 0 . 9 ml , 6 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by flash chromatography on silica gel ( ethyl acetate / meoh ) and subsequent crystallization ( dichloromethane / meoh / hexane ) to yield 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - ethyl )- amide ( 1 . 0 g , 61 %) as a white solid . ms ( isp ) 278 . 0 [( m − h ) − ]; mp 211 ° c . b ) a stirred suspension of 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - ethyl )- amide ( 0 . 95 g , 3 . 4 mmol ) in 6n hydrochloric acid ( 13 ml ) was heated for 2 h at 80 ° c ., evaporated , and saturated nahco 3 solution ( 20 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 50 ml ) and dried ( mgso 4 ). the crude product was further purified by crystallization ( dichloromethane / meoh / hexane ) to yield the title compound ( 0 . 51 g , 63 %) as a white solid . ms ( isp ) 236 . 0 [( m − h ) − ]; mp 151 ° c . a ) to a stirred solution of 5 - methyl - 4 - nitrothiophene - 2 - sulfonyl chloride [ cas no . 61714 - 77 - 0 ] ( 1 . 0 g , 4 . 14 mmol ) in thf ( 20 ml ) was added at 0 ° c . ( ice water bath ) ammonium hydroxide solution ( 25 %, 5 ml ). the reaction mixture was stirred at room temperature for 1 h , evaporated , poured into water ( 30 ml ) and extracted with ethyl acetate ( 2 × 50 ml ). the combined organic layers were washed with brine ( 2 × 30 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by crystallization from ethyl acetate / hexane to yield 5 - methyl - 4 - nitro - thiophene - 2 - sulfonamide ( 0 . 75 g , 82 %) as a brown solid . ms ( isp ) 221 . 0 [( m − h ) − ], mp 120 ° c . b ) hydrogenation of a stirred solution of 5 - methyl - 4 - nitro - thiophene - 2 - sulfonamide ( 0 . 50 g , 2 . 25 mmol ) in methanol ( 15 ml ) on raney - nickel ( 0 . 5 g ) for 16 h at room temperature yielded after removal of the catalyst by filtration , evaporation and crystallization ( methanol / diethyl ether / hexane ) the title compound as a light brown solid . ms ( isp ) 191 . 0 [( m − h ) − ], mp 175 ° c . a ) to a stirred solution of 2 - amino - 2 - methyl - 1 - propanol ( 1 . 11 g , 12 . 4 mmol ) in dioxane ( 20 ml ) was added at 0 ° c . ( ice water bath ) 5 - methyl - 4 - nitrothiophene - 2 - sulfonyl chloride [ cas no . 61714 - 77 - 0 ] and triethylamine ( 0 . 63 ml , 4 . 56 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by column chromatography on silica gel ( ethyl acetate / meoh ) and subsequent crystallization ( ethyl acetate / heptane ) to yield 5 - methyl - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( 0 . 71 g , 58 %) as a light brown solid . ms ( isp ) 293 . 0 [( m − h ) − ]; mp 126 ° c . b ) hydrogenation of a stirred solution of 5 - methyl - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( 0 . 60 g , 2 . 04 mmol ) in methanol ( 20 ml ) on raney - nickel ( 0 . 6 g ) for 7 h at room temperature yielded after removal of the catalyst by filtration , evaporation and crystallization ( diethyl ether / hexane ) the title compound as an off - white solid . ms ( isp ) 262 . 9 [( m − h ) − ], mp 118 ° c . a ) to a stirred solution of 2 - amino - 2 - methyl - 1 - propanol ( 1 . 11 g , 12 . 5 mmol ) in dioxane ( 20 ml ) was added at 0 ° c . ( ice water bath ) 2 - acetamido - thiazole - 5 - sulfonyl chloride [ cas no . 69812 - 30 - 2 ; commercially available ] ( 1 . 0 g , 4 . 15 mmol ) and triethylamine ( 0 . 64 ml , 4 . 57 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by column chromatography on silica gel ( ethyl acetate ) to yield 2 - acetamido - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( 0 . 72 g , 59 %) as a white solid . ms ( isp ) 292 . 1 [( m − h ) − ]; mp 206 ° c . b ) a stirred suspension of 2 - acetamido - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( 0 . 68 g , 2 . 32 mmol ) in 6n hydrochloric acid ( 20 ml ) was heated for 2 h at 80 ° c ., evaporated ., and saturated nahco 3 solution ( 30 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 30 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by column chromatography on silica gel ( dichloromethane / meoh / nh 4 oh 80 : 10 : 1 ) to yield the title compound ( 0 . 42 g , 72 %) as a colorless oil . ms ( isp ) 250 . 0 [( m − h ) − ]. a ) to a stirred solution of n , n - dimethylethylenediamine ( 0 . 67 g , 7 . 6 mmol ) in dioxane ( 25 ml ) was added at room temperature 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 2 . 0 g , 7 . 64 mmol ) and triethylamine ( 1 . 17 ml , 8 . 4 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by flash chromatography on silica gel ( dichloromethane / methanol ), and subsequent crystallization from ethyl acetate to yield 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - dimethylamino - ethyl )- amide ( 1 . 16 g , 48 %) as a light brown solid . ms ( isp ) 312 . 0 [( m − h ) − ], mp 178 ° c . b ) hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid bis -( 2 - dimethylamino - ethyl )- amide ( 1 . 09 g , 3 . 47 mmol ) in methanol ( 100 ml ) and tetrahydrofurane ( 30 ml ) on raney - nickel ( 1 . 1 g ) for 5 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by crystallization ( ethyl acetate / meoh ) the title compound ( 0 . 64 g , 65 %) as a brown solid . ms ( isp ) 282 . 0 [( m − h ) − ], mp 184 ° c . a ) to a stirred solution of n , n - dimethylethylenediamine ( 1 . 04 g , 11 . 8 mmol ) in tetrahydrofurane ( 14 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methylthiazole - 5 - sulfonyl chloride ( 1 . 0 g , 3 . 93 mmol ) and triethylamine ( 0 . 6 ml , 4 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by column chromatography on silica gel ( dichloromethane / meoh / nh 4 oh 80 : 10 : 1 ) and subsequent crystallization ( dichloromethane / hexane ) to yield 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - dimethylamino - ethyl )- amide ( 1 . 07 g , 89 %) as a white solid . ms ( isp ) 305 . 1 [( m − h ) − ]; mp 143 ° c . b ) a stirred suspension of 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - dimethylamino - ethyl )- amide ( 1 . 0 g , 3 . 26 mmol ) in 6n hydrochloric acid ( 13 ml ) was heated for 2 h at 80 ° c ., and 2n nahco 3 solution ( 100 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 50 ml ) and dried ( mgso 4 ). the crude product was further purified by crystallization ( ethyl aceate ) to yield the title compound ( 0 . 68 g , 79 %) as a white solid . ms ( isp ) 262 . 9 [( m − h ) − ]; mp 153 ° c . a ) to a stirred solution of 2 - amino - 1 , 3 - propanediol ( 2 . 15 g , 23 . 6 mmol ) in thf ( 26 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methylthiazole - 5 - sulfonyl chloride ( 2 . 0 g , 7 . 85 mmol ) and triethylamine ( 1 . 2 ml , 8 . 64 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by column chromatography on silica gel ( dichloromethane / meoh / nh 4 oh 80 : 10 : 1 ) to yield 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( 1 . 46 g , 60 %) as a light yellow solid . ms ( isp ) 308 . 1 [( m − h ) − ]; mp 217 ° c . b ) a stirred suspension of 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( 1 . 45 g , 4 . 69 mmol ) in 6n hydrochloric acid ( 22 ml ) was heated for 2 h at 80 ° c ., evaporated , and saturated nahco 3 solution ( 50 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 50 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by crystallization ( dichloromethane / meoh / hexane ) to yield the title compound ( 0 . 55 g , 44 %) as an off - white solid . ms ( isp ) 266 . 0 [( m − h ) − ]. a ) to a stirred solution of tert - butyl n -( 2 - aminoethyl )- carbamate ( 0 . 46 g , 2 . 87 mmol ) in thf ( 6 ml ) was added at 0 ° c . ( ice water bath ) 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 0 . 5 g , 1 . 91 mmol ) and triethylamine ( 0 . 29 ml , 2 . 1 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by flash chromatography on silica gel ( ethyl acetate / heptane ), and subsequent crystallization from ethyl acetate / hexane to yield [ 2 -( 5 - chloro - 4 - nitro - thiophene - 2 - sulfonylamino )- ethyl ]- carbamic acid tert - butyl ester ( 0 . 53 g , 72 %) as a light yellow solid . ms ( isp ) 384 . 1 [( m − h ) − ], mp 147 ° c . b ) hydrogenation of a stirred solution of [ 2 -( 5 - chloro - 4 - nitro - thiophene - 2 - sulfonylamino )- ethyl ]- carbamic acid tert - butyl ester ( 0 . 47 g , 1 . 22 mmol ) in methanol ( 40 ml ) on raney - nickel ( 0 . 47 g ) for 5 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by crystallization ( dichloromethane / meoh ) the title compound ( 0 . 38 g , 88 %) as a light brown solid . ms ( isp ) 354 . 1 [( m − h ) − ], mp 116 ° c . a ) to a stirred solution of ( rs )- 3 - pyrrolidinol ( 0 . 75 g , 8 . 6 mmol ) in thf ( 18 ml ) was added at room temperature 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 1 . 5 g , 5 . 72 mmol ) and triethylamine ( 0 . 88 ml , 6 . 3 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by column chromatography on silica gel ( ethyl acetate ), and subsequent crystallization from dichloromethane / meoh / hexane to yield ( rs )- 1 -( 5 - chloro - 4 - nitro - thiophene - 2 - sulfonyl )- pyrrolidin - 3 - ol ( 0 . 65 g , 36 %) as a yellow solid . ms ( ei ) 312 . 0 [( m ) + ], mp 96 ° c . b ) hydrogenation of a stirred solution of ( rs )- 1 -( 5 - chloro - 4 - nitro - thiophene - 2 - sulfonyl )- pyrrolidin - 3 - ol ( 0 . 92 g , 2 . 94 mmol ) in methanol ( 90 ml ) on raney - nickel ( 0 . 92 g ) for 7 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by flash chromatography ( ethyl acetate / heptane ) and subsequent crystallization ( dichloromethane / meoh / hexane ) the title compound ( 0 . 30 g , 36 %) as a yellow solid . ms ( ei ) 282 . 0 [( m ) + ], mp 156 ° c . a ) to a stirred solution of 1 - methylpiperazine ( 1 . 18 g , 11 . 8 mmol ) in thf ( 24 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methylthiazole - 5 - sulfonyl chloride ( 2 . 0 g , 7 . 85 mmol ) and triethylamine ( 1 . 2 ml , 8 . 6 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by column chromatography on silica gel ( dichloromethane / meoh 9 : 1 ) and subsequent crystallization ( dichloromethane / meoh / hexane ) to yield 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 4 - methylpiperazinyl )- amide ( 1 . 85 g , 74 %) as a white solid . ms ( isp ) 319 . 0 [( m + h ) + ]; mp 245 ° c . b ) a stirred suspension of 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 4 - methylpiperazinyl )- amide ( 1 . 73 g , 5 . 43 mmol ) in 6n hydrochloric acid ( 22 ml ) was heated for 2 h at 80 ° c ., evaporated , and saturated nahco 3 solution ( 75 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 50 ml ), dried ( mgso 4 ) and evapoarted . the crude product was further purified by crystallization ( ethyl acetate / meoh / hexane ) to yield the title compound ( 1 . 14 g , 76 %) as a white solid . ms ( isp ) 277 . 0 [( m + h ) + ]; mp 188 ° c . a ) to a stirred solution of 2 -( methylamino )- ethanol ( 0 . 44 g , 5 . 86 mmol ) in thf ( 12 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methylthiazole - 5 - sulfonyl chloride ( 1 . 0 g , 3 . 92 mmol ) and triethylamine ( 0 . 6 ml , 4 . 32 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by flash chromatography on silica gel ( dichloromethane / meoh ) and subsequent crystallization ( dichloromethane / meoh / hexane ) to yield 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - ethyl )- methyl - amide ( 0 . 93 g , 81 %) as a white solid . ms ( isp ) 294 . 0 [( m + h ) + ]; mp 189 ° c . b ) a stirred suspension of 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - ethyl )- methyl - amide ( 0 . 85 g , 2 . 9 mmol ) in 6n hydrochloric acid ( 13 ml ) was heated for 2 h at 80 ° c ., evaporated , and saturated nahco 3 solution ( 50 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 50 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by crystallization ( dichloromethane / meoh / hexane ) to yield the title compound ( 0 . 49 g , 67 %) as a white solid . ms ( ei ) 251 . 1 [( m ) + ]; mp 118 ° c . a ) a suspension of 2 -( methylamino )- ethanol ( 0 . 29 g , 3 . 86 mmol ) and magnesium oxide ( 0 . 77 g , 19 . 1 mmol ) in thf ( 4 ml ) and water ( 1 . 4 ml ) was allowed to stir at room temperature for 30 min , 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 1 . 0 g , 3 . 81 mmol ) dissolved in thf ( 1 . 6 ml ) was added drop wise at room temperature over a period of 1 h and the reaction mixture was allowed to stir for an additional hour . filtration over decalite and evaporation yielded the crude product which was further purified by flash chromatography on silica gel ( ethyl acetate / heptane ) to yield 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - ethyl )- methyl - amide ( 0 . 4 g , 35 %) as a yellow solid . ms ( ei ) 300 . 0 [( m ) + ], mp 62 ° c . b ) hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - ethyl )- methyl - amide ( 0 . 58 g , 1 . 93 mmol ) in methanol ( 50 ml ) on raney - nickel ( 0 . 58 g ) for 6 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by flash chromatography ( dichloromethane / meoh ) the title compound ( 0 . 15 g , 29 %) as a yellow oil . ms ( isp ) 270 . 9 [( m + h ) + ]. a ) a suspension of 1 - methyl - piperazine ( 0 . 38 g , 3 . 79 mmol ) and magnesium oxide ( 0 . 38 g , 9 . 43 mmol ) in thf ( 2 . 1 ml ) and water ( 0 . 7 ml ) was allowed to stir at room temperature for 30 min , 5 - chloro - 4 - nitrothiophene - 2 - sulfonyl chloride ( 0 . 5 g , 1 . 91 mmol ) dissolved in thf ( 0 . 7 ml ) was added drop wise at room temperature over a period of 1 h and the reaction mixture was allowed to stir for an additional hour . filtration over decalite and evaporation yielded the crude product which was further purified by flash chromatography on silica gel ( dichloromethane / meoh ) to yield 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 4 - methyl - piperazinyl )- amide ( 0 . 14 g , 23 %) as a yellow solid . ms ( isp ) 326 . 3 [( m + h ) + ], mp 180 ° c . b ) hydrogenation of a stirred solution of 5 - chloro - 4 - nitro - thiophene - 2 - sulfonic acid ( 4 - methyl - piperazinyl )- amide ( 0 . 39 g , 1 . 2 mmol ) in methanol ( 40 ml ) on raney - nickel ( 0 . 39 g ) for 4 h at room temperature yielded after removal of the catalyst by filtration , evaporation and purification of the crude product by flash chromatography ( dichloromethane / meoh ) the title compound ( 0 . 26 g , 73 %) as a yellow solid . ms ( isp ) 296 . 0 [( m + h ) + ], mp 91 ° c . a ) to a stirred solution of ( rs )- 3 - pyrrolidinol ( 0 . 51 g , 5 . 85 mmol ) in thf ( 12 ml ) was added at 0 ° c . ( ice water bath ) commercially available 2 - acetamido - 4 - methylthiazole - 5 - sulfonyl chloride ( 1 . 0 g , 3 . 93 mmol ) and triethylamine ( 0 . 6 ml , 4 . 32 mmol ). the light yellow suspension was stirred at room temperature for 17 h , and evaporated . the crude product was further purified by flash chromatography on silica gel ( dichloromethane / meoh ) and subsequent crystallization ( dichloromethane / meoh / hexane ) to yield ( rs )- 1 -( 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonyl )- pyrrolidin - 3 - ol ( 0 . 82 g , 68 %) as a white solid . ms ( isp ) 306 . 3 [( m + h ) + ]; mp 241 ° c . b ) a stirred suspension of ( rs )- 1 -( 2 - acetamido - 4 - methyl - thiazole - 5 - sulfonyl )- pyrrolidin - 3 - ol ( 0 . 82 g , 2 . 68 mmol ) in 6n hydrochloric acid ( 13 ml ) was heated for 2 h at 80 ° c . evaporated , and saturated nahco 3 solution ( 20 ml ) was added . the mixture was extracted with ethyl acetate ( 3 × 50 ml ), the combined organic layers washed with brine ( 50 ml ), dried ( mgso 4 ) and evaporated . the crude product was further purified by crystallization ( dichloromethane / meoh / hexane ) to yield the title compound ( 0 . 62 g , 88 %) as a white solid . ms ( isp ) 263 . 8 [( m + h ) + ]; mp 165 ° c . some of the intermediates compounds , e . g . the pyrazolo - pyrimidine carboxylic acids derivatives which can be used according to the general procedures i and ii are commercially available . however some of said intermediates have been prepared from acetophenones according to the procedures as outlined hereafter and unless otherwise specified , these compounds are novel . the person skilled in the art will be able to prepare other pyrazolo - pyrimidine carboxylic acids derivatives useful in the general procedures i and ii taking into account the following examples of preparation : a ) to a stirred solution of ethyl difluoroacetate ( 5 . 0 ml , 21 mmol ) in tert - butyl - methyl - ether ( 30 ml ) was added at room temperature a 5 . 4m solution of sodium methanolate in methanol ( 4 . 65 ml , 25 mmol ) followed by a solution of commercially available 4 - trifluoromethyl - acetophenone ( 4 . 0 g , 21 mmol ) in tert - butyl - methyl - ether ( 10 ml ). the reaction mixture was stirred at room temperature for 19 h , poured into ice / water ( 50 ml ), acidified with 2n hcl ( 40 ml ) and extracted with diethyl ether ( 2 × 100 ml ). the combined organic layers were washed with brine ( 2 × 50 ml ), dried ( mgso 4 ) and evaporated to give crude 4 , 4 - difluoro - 1 -( 4 - trifluoromethyl - phenyl )- butane - 1 , 3 - dione ( 5 . 87 g ) as a yellow liquid , which was used without further purification . b ) a stirred mixture of commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole ( 3 . 38 g , 22 mmol ) and 4 , 4 - difluoro - 1 -( 4 - trifluoromethyl - phenyl )- butane - 1 , 3 - dione ( 5 . 8 g , 22 mmol ) in acetic acid ( 45 ml ) was heated under reflux conditions for 1 . 5 h . the reaction mixture was evaporated and the crude product ( yellow solid , 8 . 5 g , 22 mmol ) was dissolved in a mixture of 2m koh in methanol ( 176 . 5 ml , 0 . 35 mol ) and water ( 85 ml ). the reaction mixture was stirred at 60 ° c . for 1 . 5 h , poured into ice / water ( 200 ml ), acidified with 3n sulfuric acid ( ph = 4 ) and stirred at room temperature for 30 min . the precipitate was collected by filtration and further purified by crystallization from diethylether / methanol to give the title compound ( 4 . 51 g , 57 %) as an off - white solid . ms ( isp ) 356 . 1 [( m − h ) − ]; m . p . 261 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , commercially available 4 - trifluoromethyl - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . the title compound was prepared from commercially available ethyl difluoroacetate , commercially available 4 - chloro - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 322 . 2 [( m − h ) − ]; mp 232 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , commercially available 4 - chloro - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 340 . 0 [( m − h ) − ]; mp 238 ° c . the title compound was prepared from commercially available ethyl difluoroacetate , 3 - methyl - 4 - trifluoro - acetophenone ( example a . 4 ) and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 370 . 1 [( m − h ) − ]; mp 217 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , commercially available 4 - chloro - 3 - methyl - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 354 . 0 [( m − h ) − ]; mp 243 ° c . the title compound was prepared from commercially available ethyl difluoroacetate , commercially available 3 , 4 - dichloro - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 356 . 0 [( m − h ) − ]; mp 263 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , 3 - methyl - 4 - trifluoro - acetophenone ( example a . 4 ) and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 388 . 1 [( m − h ) − ]; mp 250 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , commercially available 3 , 4 - dichloro - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . light yellow solid . ms ( isp ) 374 . 1 [( m − h ) − ]; mp 264 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , 3 -( 2 , 2 , 2 - trifluoroethoxy - 4 - trifluoro - acetophenone ( example a . 6 ) and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 471 . 9 [( m − h ) − ]; mp 264 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , 3 - ethoxy - 4 - trifluoro - acetophenone ( example a . 5 ) and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 418 . 0 [( m − h ) − ]; mp 264 ° c . the title compound was prepared from commercially available ethyl difluoroacetate , 3 - ethoxy - 4 - trifluoro - acetophenone ( example a . 5 ) and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . yellow solid . ms ( isp ) 400 . 2 [( m − h ) − ]; mp 247 ° c . the title compound was prepared from commercially available ethyl difluoroacetate , commercially available 4 - chloro - 3 - methyl - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . light yellow solid . ms ( isp ) 336 . 0 [( m − h ) − ]; mp 238 ° c . the title compound was prepared from commercially available ethyl difluoroacetate , 3 -( 2 , 2 , 2 - trifluoroethoxy - 4 - trifluoro - acetophenone ( example a . 6 ) and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . off - white solid . ms ( isp ) 454 . 2 [( m − h ) − ]; mp 261 ° c . the title compound was prepared from commercially available ethyl difluoroacetate , 3 - chloro - 4 - trifluoromethyl - acetophenone [ cas - no . 129322 - 80 - 1 ] and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . light red solid . ms ( isp ) 390 . 2 [( m − h ) − ]; mp 216 ° c . the title compound was prepared from commercially available ethyl difluoroacetate , commercially available 3 - fluoro - 4 - trifluoromethyl - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . light brown solid . ms ( isp ) 374 . 1 [( m − h ) − ]; mp 233 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , 3 - chloro - 4 - trifluoromethyl - acetophenone [ cas - no . 129322 - 80 - 1 ] and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . light yellow solid . ms ( isp ) 408 . 0 [( m − h ) − ]; mp 244 ° c . the title compound was prepared from commercially available ethyl trifluoroacetate , commercially available 3 - fluoro - 4 - trifluoromethyl - acetophenone and commercially available 3 - amino - 4 - ethoxycarbonyl - pyrazole according to the general procedure i . light yellow solid . ms ( isp ) 392 . 0 [( m − h ) − ]; mp 212 ° c . a ) a mixture of ethyl 3 -( 4 - chloro - phenyl )- 3 - oxo - propionate ( 18 . 1 g , 0 . 080 mol ) and ethyl 5 - amino - 1h - pyrazole - 4 - carboxylate ( 13 . 7 g , 0 . 088 mol ) was stirred at 160 ° c . for 3 h . acoet ( 40 ml ) and hexane ( 40 ml ) were successively added to the cooled mixture and stirring was continued at 0 ° c . for 0 . 5 h . the crystals were isolated by filtration and the solid was triturated for 1 . 2 h with 0 . 2 n hcl ( 80 ml ). the solid was filtered off , washed with water and dried to give ethyl 5 -( 4 - chloro - phenyl )- 7 - hydroxy - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylate ( 13 . 3 g , 52 %). white solid . ms ( isn ) 316 . 3 [( m − h ) − ]; mp 190 - 192 ° c . b ) a mixture of 5 -( 4 - chloro - phenyl )- 7 - hydroxy - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylate ( 9 . 53 g , 0 . 03 mol ), phosphorous oxychloride ( 11 . 0 ml , 0 . 12 mol ), and n , n - dimethylaniline ( 1 . 3 ml , 0 . 01 mol ) was stirred for 2 h at 100 ° c . the mixture was evaporated in vacuo and the residue was partitioned between water and dichloromethane . the organic phase was washed with water , dried ( na 2 so 4 ) and evaporated in vacuo . the remaining solid was crystallized from acoet / hexane to give 7 - chloro - 5 -( 4 - chloro - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine ( 6 . 80 g , 67 %). pale - yellow solid . ms ( isp ) 336 . 0 [( m + h ) + ]; mp 133 - 135 ° c . c ) to a solution of 7 - chloro - 5 -( 4 - chloro - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine ( 4 . 0 g , 12 . 0 mmol ), tetrakis ( triphenylphosphin ) palladium ( 1 . 15 g , 1 . 0 mmol ) in thf ( 20 ml ) was added at 20 ° c . 0 . 25 m cyclopropylzinc chloride / thf suspension ( ca . 192 ml , 48 mmol ; freshly prepared by stirring a mixture of 96 ml of 0 . 5 m cyclopropylmagnesium bromide / thf and 96 ml of 0 . 5 m zinc chloride / thf ( 96 ml ) for 1 h at 0 ° c . followed by 1 h at 20 ° c .) and the mixture was refluxed in an atmosphere of argon for 2 . 5 h . after the slow addition at 0 ° c . of sat . aqueous nh 4 cl solution ( 30 ml ), the mixture was partitioned between acoet and 10 % sodium chloride solution . the organic layer was evaporated in vacuo and the residue was chromatographed on silica gel using acoet / cyclohexane ( 1 : 4 v / v ) as eluent to give after crystallization from acoet the title compound ( 2 . 54 g , 62 %). off - white solid . ms ( isp ) 342 . 1 [( m + h ) + ]; mp 141 - 143 ° c . d ) a mixture of ethyl 5 -( 4 - chloro - phenyl )- 7 - cyclopropyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( 0 . 95 g , 2 . 8 mmol ) and 2 n naoh solution ( 5 . 6 ml ) in meoh ( 35 ml ) was heated to 80 ° c . for 0 . 5 h . the mixture was cooled , diluted with water ( 150 ml ) and washed with diethyl ether . the aqueous layer was acidified by the addition of 3n hcl to ph 2 . the precipitate formed was isolated by filtration , washed with water , and dried to give the title compound ( 0 . 75 g , 86 %). off - white solid . ms ( isn ) 312 . 3 [( m − h ) − ]; mp 256 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thipohene - 2 - sulfonic acid amide ( example b . 1 ) according to general procedure ii . light brown solid . ms ( isp ) 549 . 9 [( m − h ) − ]; mp 298 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thipohene - 2 - sulfonic acid amide ( example b . 1 ) according to general procedure ii . light brown solid . ms ( isp ) 567 . 9 [( m + h ) + ]; mp 275 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 5 - amino -[ 1 , 3 , 4 ] thiadiazole - 2 - sulfonic acid amide [ commercially available , cas 14949 - 00 - 9 ] according to general procedure ii . light yellow solid . ms ( isp ) 518 . 0 [( m − h ) − ]; mp 284 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 5 - amino -[ 1 , 3 , 4 ] thiadiazole - 2 - sulfonic acid amide [ commercially available , cas 14949 - 00 - 9 ] according to general procedure ii . light yellow solid . ms ( isp ) 536 . 1 [( m − h ) − ]; mp 280 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 2 ) according to general procedure ii . light yellow solid . ms ( isp ) 622 . 2 [( m − h ) − ]; mp 233 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 2 ) according to general procedure ii . light yellow solid . ms ( isp ) 640 . 1 [ ( m + h ) + ]; mp 223 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 2 - sulfonic acid amide [ cas - no . 187230 - 38 - 2 ] according to general procedure ii . light yellow solid . ms ( isp ) 531 . 0 [( m − h ) − ]; mp 284 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 2 - sulfonic acid amide [ cas - no . 187230 - 38 - 2 ] according to general procedure ii . yellow solid . ms ( isp ) 549 . 0 [( m − h ) − ]; mp 303 ° c . the title compound was prepared from 5 -( 4 - chloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 4 ) and 4 - amino - 5 - chloro - thipohene - 2 - sulfonic acid amide ( example b . 1 ) according to general procedure ii . yellow solid . ms ( isp ) 534 . 0 [( m − h ) − ]; mp 329 ° c . the title compound was prepared from 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) 4 - amino - 5 - chloro - thipohene - 2 - sulfonic acid amide ( example b . 1 ) according to general procedure ii . yellow solid . ms ( isp ) 612 . 2 [( m − h ) − ]; mp 281 ° c . the title compound was prepared from 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 8 ) and 4 - amino - 5 - chloro - thipohene - 2 - sulfonic acid amide ( example b . 1 ) according to general procedure ii . yellow solid . ms ( isp ) 581 . 8 [( m − h ) − ]; mp 283 ° c . the title compound was prepared from 5 -( 4 - chloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 4 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 2 ) according to general procedure ii . yellow solid . ms ( isp ) 605 . 8 [( m − h ) − ]; mp 272 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . yellow solid . ms ( isp ) 621 . 0 [( m − h ) − ]; mp 257 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . yellow solid . ms ( isp ) 603 . 0 [( m − h ) − ]; mp 268 ° c . the title compound was prepared from 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 2 ) according to general procedure ii . yellow solid . ms ( isp ) 684 . 3 [( m − h ) − ]; mp 234 ° c . the title compound was prepared from 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 8 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 2 ) according to general procedure ii . yellow solid . ms ( isp ) 654 . 2 [( m − h ) − ]; mp 207 ° c . the title compound was prepared from 5 -[ 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - phenyl ]- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 2 ) according to general procedure ii . yellow solid . ms ( isp ) 738 . 3 [( m − h − ]; mp 264 ° c . the title compound was prepared from 5 -( 3 - chloro - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 17 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 2 ) according to general procedure ii . yellow solid . ms ( isp ) 674 . 3 [( m + h ) + ]; mp 254 ° c . the title compound was prepared from 5 -( 4 - chloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 4 ) and 2 - amino - 4 - methyl - thiazole - 2 - sulfonic acid amide [ cas - no . 187230 - 38 - 2 ] according to general procedure ii . yellow solid . ms ( isp ) 515 . 0 [( m − h ) − ]; mp 305 ° c . the title compound was prepared from 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) and 2 - amino - 4 - methyl - thiazole - 2 - sulfonic acid amide [ cas - no . 187230 - 38 - 2 ] according to general procedure ii . yellow solid . ms ( isp ) 595 . 4 [( m + h ) + ]; mp 300 ° c . the title compound was prepared from 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 8 ) and 2 - amino - 4 - methyl - thiazole - 2 - sulfonic acid amide [ cas - no . 187230 - 38 - 2 ] according to general procedure ii . yellow solid . ms ( isp ) 563 . 3 [( m − h ) − ]; mp 309 ° c . the title compound was prepared from 5 -( 4 - chloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 4 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . yellow solid . ms ( isp ) 587 . 1 [( m + h ) + ]; mp 274 ° c . the title compound was prepared from 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . light yellow solid . ms ( isp ) 665 . 2 [( m − h ) − ]; mp 276 ° c . the title compound was prepared from 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 8 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . yellow solid . ms ( isp ) 635 . 0 [( m + h ) + ]; mp 272 ° c . the title compound was prepared from 5 -( 3 - chloro - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 17 ) and 2 - amino - 4 - methyl - thiazole - 2 - sulfonic acid amide [ cas - no . 187230 - 38 - 2 ] according to general procedure ii . light brown solid . ms ( isp ) 585 . 1 [( m + h ) + ]; mp 299 ° c . the title compound was prepared from 5 -( 3 , 4 - dichloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 9 ) and 2 - amino - 4 - methyl - thiazole - 2 - sulfonic acid amide [ cas - no . 187230 - 38 - 2 ] according to general procedure ii . yellow solid . ms ( isp ) 549 . 2 [( m − h ) − ]; mp 307 ° c . the title compound was prepared from 5 -[ 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - phenyl ]- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( example b . 4 ) according to general procedure ii . yellow solid . ms ( isp ) 649 . 1 [( m + h + ]; mp 264 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( example b . 4 ) according to general procedure ii . light yellow solid . ms ( isp ) 624 . 2 [( m − h ) − ]; mp 241 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( example b . 4 ) according to general procedure ii . yellow solid . ms ( isp ) 642 . 2 [( m − h ) − ]; mp 225 ° c . the title compound was prepared from 5 -( 3 - chloro - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 17 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . yellow solid . ms ( isp ) 655 . 1 [( m − h ) − ]; mp 274 ° c . the title compound was prepared from 5 -( 3 , 4 - dichloro - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 9 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . yellow solid . ms ( isp ) 621 . 0 [( m − h ) − ]; mp 265 ° c . the title compound was prepared from 5 -[ 3 -( 2 , 2 , 2 - trifluoro - ethoxy )- 4 - trifluoromethyl - phenyl ]- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . yellow solid . ms ( isp ) 719 . 3 [( m − h − ]; mp 275 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 5 ) and 2 - amino - 4 - methyl - thiazole - 2 - sulfonic acid amide [ cas - no . 187230 - 38 - 2 ] according to general procedure ii . yellow solid . ms ( isp ) 545 . 1 [( m − h ) − ]; mp 307 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( example b . 5 ) according to general procedure ii . light yellow solid . ms ( isp ) 640 . 3 [( m + h ) + ]; mp 216 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( example b . 5 ) according to general procedure ii . yellow solid . ms ( isp ) 658 . 4 [( m + h ) + ]; mp 217 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - ethyl )- amide ( example b . 6 ) according to general procedure ii . yellow solid . ms ( isp ) 612 . 0 [( m − h ) − ]; mp 191 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( example b . 7 ) according to general procedure ii . light yellow solid . ms ( isp ) 638 . 0 [( m − h ) − ]; mp 237 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( example b . 7 ) according to general procedure ii . yellow solid . ms ( isp ) 656 . 0 [( m − h ) − ]; mp 201 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 3 - methyl - 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 8 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . yellow solid . ms ( isp ) 617 . 2 [( m − h ) − ]; mp 271 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( example b . 8 ) according to general procedure ii . light yellow solid . ms ( isp ) 621 . 1 [( m + h ) + ]; mp 191 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid bis -( 2 - hydroxy - ethyl )- amide ( example b . 8 ) according to general procedure ii . yellow solid . ms ( isp ) 639 . 1 [( m + h ) + ]; mp 214 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( example b . 9 ) according to general procedure ii . yellow solid . ms ( isp ) 637 . 0 [( m − h ) − ]; mp 250 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( example b . 9 ) according to general procedure ii . yellow solid . ms ( isp ) 619 . 2 [( m − h ) − ]; mp 248 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - ethyl )- amide ( example b . 6 ) according to general procedure ii . yellow solid . ms ( isp ) 594 . 1 . 2 [( m − h ) − ]; mp 209 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - ethyl )- amide ( example b . 10 ) according to general procedure ii . yellow solid . ms ( isp ) 575 . 1 [( m − h ) − ]; mp 134 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - ethyl )- amide ( example b . 10 ) according to general procedure ii . yellow solid , ms ( isp ) 593 . 1 [( m − h ) − ]; mp 166 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - methyl - thiophene - 2 - sulfonic acid amide ( example b . 11 ) according to general procedure ii . yellow solid . ms ( isp ) 548 . 1 [( m − h ) − ]; mp 297 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - methyl - thiophene - 2 - sulfonic acid amide ( example b . 11 ) according to general procedure ii . yellow solid . ms ( isp ) 530 . 0 [( m − h ) − ]; mp 313 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - methyl - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 12 ) according to general procedure ii . yellow solid . ms ( isp ) 620 . 3 [( m − h ) − ]; mp 225 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - methyl - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 12 ) according to general procedure ii . yellow solid . ms ( isp ) 602 . 2 [( m − h ) − ]; mp 180 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - thiazole - 5 - sulfonic acid amide [ cas - no . 63735 - 95 - 5 ] according to general procedure ii . yellow solid . ms ( isp ) 535 . 2 [( m − h ) − ]; mp 309 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - thiazole - 5 - sulfonic acid amide [ cas - no . 63735 - 95 - 5 ] according to general procedure ii . light yellow solid . ms ( isp ) 517 . 2 [( m − h ) − ]; mp 311 ° c . the title compound was prepared from 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - 1 - methyl - ethyl )- amide ( example b . 9 ) according to general procedure ii . light yellow solid . ms ( isp ) 681 . 2 [( m − h ) − ]; mp 220 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - dimethylamino - ethyl )- amide ( example b . 14 ) according to general procedure ii . yellow solid . ms ( isp ) 623 . 1 [( m − h ) − ]; mp 162 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - dimethylamino - ethyl )- amide ( example b . 14 ) according to general procedure ii . yellow solid . ms ( isp ) 639 . 1 [( m − h ) − ]; mp 198 ° c . the title compound was prepared from 5 -( 3 - ethoxy - 4 - trifluoromethyl - phenyl )- 7 - trifluoromethyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 10 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - ethyl )- amide ( example b . 6 ) according to general procedure ii . light yellow solid . ms ( isp ) 656 . 0 [( m − h ) − ]; mp 250 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - dimethylamino - ethyl )- amide ( example b . 15 ) according to general procedure ii . yellow solid . ms ( isp ) 602 . 1 [( m − h ) − ]; mp 217 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - dimethylamino - ethyl )- amide ( example b . 15 ) according to general procedure ii . yellow solid . ms ( isp ) 620 . 2 [( m − h ) − ]; mp 235 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 13 ) according to general procedure ii . yellow solid . ms ( isp ) 607 . 0 [( m − h ) − ]; mp 292 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 13 ) according to general procedure ii . yellow solid . ms ( isp ) 589 . 2 [( m − h ) − ]; mp 280 ° c . the title compound was prepared from 5 -( 4 - chloro - phenyl )- 7 - cyclopropyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 19 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 2 ) according to general procedure ii . pale - yellow solid . ( isn ) 580 . 0 [( m − h ) − ]; mp 238 - 241 ° c . the title compound was prepared from 5 -( 4 - chloro - phenyl )- 7 - cyclopropyl - pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 19 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 , 1 - dimethyl - ethyl )- amide ( example b . 3 ) according to general procedure ii . pale - yellow solid . ms ( isn ) 559 . 0 [( m − h ) − ]; mp 293 - 294 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( example b . 16 ) according to general procedure ii . light yellow solid . ms ( isp ) 604 . 8 [( m − h ) − ]; mp 217 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - 1 - hydroxymethyl - ethyl )- amide ( example b . 16 ) according to general procedure ii . light yellow solid . ms ( isp ) 623 . 1 [( m − h ) − ]; mp 215 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and [ 2 -( 4 - amino - 5 - chloro - thiophene - 2 - sulfonylamino )- ethyl ]- carbamic acid tert - butyl ester ( example b . 17 ) according to general procedure ii and subsequent removal of the protecting group with trifluoroacetic acid in dichloromethane at 0 ° c . for 3 h . orange solid . ms ( isp ) 595 . 0 [( m + h ) + ]; mp 150 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and ( rs )- 1 -( 4 - amino - 5 - chloro - thiophene - 2 - sulfonyl )- pyrrolidin - 3 - ol ( example b . 18 ) according to general procedure ii . yellow solid . ms ( isp ) 622 . 2 [( m + h ) + ]; mp 274 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and ( rs )- 1 -( 4 - amino - 5 - chloro - thiophene - 2 - sulfonyl )- pyrrolidin - 3 - ol -( example b . 18 ) according to general procedure ii . yellow solid . ms ( isp ) 640 . 2 [( m + h ) + ]; mp 270 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - methyl - 5 -( 4 - methyl - piperazine - 1 - sulfonyl )- thiazol - 2 - ylamine ( example b . 19 ) according to general procedure ii . yellow solid . ms ( isp ) 616 . 2 [( m + h ) + ]; mp 269 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - methyl - 5 -( 4 - methyl - piperazine - 1 - sulfonyl )- thiazol - 2 - ylamine ( example b . 19 ) according to general procedure ii . yellow solid . ms ( isp ) 634 . 1 [( m + h ) + ]; mp 273 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - ethyl )- methyl - amide ( example b . 20 ) according to general procedure ii . light yellow solid . ms ( isp ) 591 . 1 [( m + h ) + ]; mp 216 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - amino - 4 - methyl - thiazole - 5 - sulfonic acid ( 2 - hydroxy - ethyl )- methyl - amide ( example b . 20 ) according to general procedure ii . yellow solid . ms ( isp ) 609 . 0 [( m + h ) + ]; mp 266 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - ethyl )- methyl - amide ( example b . 21 ) according to general procedure ii . light brown solid . ms ( isp ) 607 . 8 [( m − h ) − ]; mp 231 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - chloro - 5 -( 4 - methyl - piperazine - 1 - sulfonyl )- thiophen - 3 - ylamine ( example b . 22 ) according to general procedure ii . yellow solid . ms ( isp ) 635 . 3 [( m + h ) + ]; mp 293 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 2 - chloro - 5 -( 4 - methyl - piperazine - 1 - sulfonyl )- thiophen - 3 - ylamine ( example b . 22 ) according to general procedure ii . yellow solid . ms ( isp ) 653 . 3 [( m + h ) + ]; mp 301 ° c . the title compound was prepared from 7 - difluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and ( rs )- 1 -( 2 - amino - 4 - methyl - thiazole - 5 - sulfonyl )- pyrrolidin - 3 - ol ( example b . 23 ) according to general procedure ii . light yellow solid . ms ( isp ) 603 . 0 [( m + h ) + ]; mp 286 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and ( rs )- 1 -( 2 - amino - 4 - methyl - thiazole - 5 - sulfonyl )- pyrrolidin - 3 - ol ( example b . 23 ) according to general procedure ii . light yellow solid . ms ( isp ) 621 . 0 [( m + h ) + ]; mp 300 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and 4 - amino - 5 - chloro - thiophene - 2 - sulfonic acid ( 2 - hydroxy - ethyl )- methyl - amide ( example b . 21 ) according to general procedure ii . yellow solid . ms ( isp ) 628 . 1 [( m + h ) + ]; mp 221 ° c . the title compound was prepared from 7 - trifluoromethyl - 5 -( 4 - trifluoromethyl - phenyl )- pyrazolo [ 1 , 5 - a ] pyrimidine - 3 - carboxylic acid ( example c . 1 ) and [ 2 -( 4 - amino - 5 - chloro - thiophene - 2 - sulfonylamino )- ethyl ]- carbamic acid tert - butyl ester ( example b . 17 ) according to general procedure ii and subsequent removal of the protecting group with trifluoroacetic acid in dichloromethane at 0 ° c . for 3 h . yellow solid . ms ( isp ) 611 . 0 [( m − h ) − ]; mp 195 ° c . tablets of the following composition are produced in a conventional manner : tablets of the following composition are produced in a conventional manner : the active ingredient having a suitable particle size , the crystalline lactose and the microcrystalline cellulose are homogeneously mixed with one another , sieved and thereafter talc and magnesium stearate are admixed . the final mixture is filled into hard gelatine capsules of suitable size . | 2 |
a detailed description of the preferred embodiments according to the present invention will now be given referring to the accompanying drawings . first , the first embodiment of an ophthalmic apparatus for precisely measuring a refractive power of an eye to be measured will be described . here , in the apparatus , though various optical systems such as the observing optical system , the alignment optical system , the projecting optical system for fixation target and the like are arranged , each optical system will be explained in the fourth embodiment hereinafter . in fig1 numeral 1 indicates two light sources ( 1a and 1b ) each of which emits rays with a wavelength in an infrared region . the light source 1a is arranged on a optical axis and the light source 1b is arranged distant from the optical axis . the light source 1b is arranged so that it can rotate around the optical axis . numeral 2 is a condenser lens and the light sources 1a , 1b are positioned at a front focal point of the condenser lens 2 existing at the side of the light sources 1a , 1b . numeral 3 is a spot diaphragm which is arranged so as to be movable to a position conjugated with the fundus of an eye 6 to be examined . numeral 4 indicates an objective lens and numeral 5 indicates a beam splitter . and numeral 7 is an objective lens , numeral 8 is a reflecting mirror and numeral 9 , 11 are relay lenses . numeral 10 indicates a cornea reflecting rejection mask which is arranged at a position conjugated with the cornea of the eye 6 and , as shown in fig2 the cornea reflecting rejection mask 10 has two light shading portions 10a and 10b which shade the reflecting light from the cornea corresponding to the light sources 1a , 1b , respectively . numeral 12 indicates a movable lens which is moved synchronous with the spot diaphragm 3 and numeral 13 indicates an imaging lens . and numeral 14 indicates a light receiving device for measurement which is arranged so as to be rotatable around the optical axis synchronous with both the light source 1b and the cornea reflecting rejection mask 10 . next , electric block diagram will be described with reference to fig3 . in fig3 the light signal received by the light receiving device 14 is output to an a / d converter 21 and converted into digital signal through the a / d converter 21 . the converted digital signal is input to a microcomputer 22 . the microcomputer 22 controls a dc motor driver 23 and a dc motor 24 so that the spot diaphragm 3 is conjugated with the fundus of the eye 6 based on the light signal received by the light receiving device 14 , thereby the movable lens 12 and the spot diaphragm 3 are moved along the optical axis . a potentiometer 25 detects a voltage value corresponding to the position of the spot diaphragm 3 when the spot diaphragm 3 is moved by the dc motor 24 . the detected signal ( voltage value ) is input to the microcomputer 22 after being converted into the digital signal by the a / d converter 21 . thereby , the spherical refractive power of the eye in the meridional direction is calculated by the microcomputer 22 . numeral 26 indicates a pulse motor driver and numeral 27 indicates a pulse motor through which the light source 1b , the cornea reflecting rejection mask 10 and the light receiving device 14 are rotated , thereby the axial angles thereof are changed . numeral 28 is a display device on which the measured result is displayed under control by the microcomputer 22 . next , operation of the above constructed apparatus will be described hereinafter . the luminous flux emitted from the light sources 1a , 1b , which are alternately turned on , is irradiated on the spot diaphragm 3 through the condenser lens 2 . the measuring light passed through the spot diaphragm 3 is condensed at near position from the cornea of the eye 6 and thereafter an image of the spot diaphragm 3 is formed on the fundus . the measuring light reflected from the fundus is reflected by the beam splitter 5 and the reflecting mirror 8 and passed through the cornea reflecting rejection mask 10 . thereby , the fundus image is formed on the light receiving device 14 through the imaging lens 13 . on the other hand , the luminous flux , which is emitted from the light source 1a and passed in a region of the visual axis , forms the image of the spot diaphragm 3 onto the fundus on the visual axis . this image of the spot diaphragm 3 becomes a standard position . the light receiving device 14 detects both the spot diaphragm image by the light source 1a and the spot diaphragm image by the light source 1b , respectively . and based on the detected result by the light receiving device 14 , the microcomputer 22 moves the spot diaphragm 3 and the movable lens 12 until the spot diaphragm 3 is positioned at a position conjugated with the fundus of the eye 6 in the meridional direction . further , the potentiometer 25 detects the moved position of the spot diaphragm 3 as the voltage value and the detected signal of the voltage is input to the microcomputer 22 through the a / d converter 21 . the microcomputer 22 conducts calculation processing to convert the positional signal of the spot diaphragm 3 into the refractive power value , thereby the refractive power value in the meridional direction is obtained . thereafter , the pulse motor 27 rotates the light source 1b , the cornea reflecting rejection mask 10 and the light receiving device 14 around the optical axis with predetermined steps ( for example , steps corresponding to 5 degrees ) and the refractive power in the meridional direction from the optical axis is measured . by repeating such operation in succession , the refractive power data can be obtained in all meridional directions of 360 degrees . next , displaying methods by which the thus obtained refractive power data displayed on the display device 28 will be described hereinafter . in fig4 the refractive power data obtained according to the above is plotted corresponding to each of the meridional lines and the distance from the center gives an extent of refractive ametropy . here , if the distance from the center is long , refractive ametropy is heavy and if the distance from the center is short , refractive ametropy is light . and in order to be able to visually understand , the maximum values of refractive ametropy are plotted on the outer circle and the minimum values thereof are plotted inner circle which has a 1 / 2 radius of the outer circle . for instance , fig4 ( a ) shows the refractive power data obtained from the eye 6 having irregular astigmatism and fig4 ( b ) shows the refractive power data obtained from the eye 6 having simple astigmatism . as shown in fig4 ( b ), when the ellipse with symmetry is obtained , the spherical refractive power values , the cylindrical refractive power value and the cylindrical axial angle are calculated and displayed on the display device 28 . further , fig5 shows another displaying method in which the refractive power values are displayed every angle ( degrees ) in utilizing color classification on the color display . here , in the color classification , the color is , for instance , classified into 15 stages by combining a hue such as red , orange , yellow , green , blue , indigo blue and purple and a gradation thereof . according to this method , in case that the refractive power in each stage is defined as 0 . 5 d ( diopter ), the refractive power values can be relatively displayed in a range of + 3 . 5 d ˜- 3 . 5 d if the spherical equivalent value ( se value ) is used as the standard value . and for example , the refractive ametropy may be absolutely displayed based on that hypermetropia is colored in blue direction and myopia is colored in red direction while emmetropia eye is used as the standard point . here , though the step for color classification is essentially determined as 0 . 5 d , it is desirable that changing means is arranged in the apparatus so that such step can be changed . and it will be effective if the graphs in both fig4 and 5 can be mutually displayed by changing them . next , the ophthalmic apparatus of the second embodiment will be given hereinafter , according to fig6 . here , in fig6 the same element as in the first embodiment is indicated by the same numeral . in the second embodiment , the luminous flux from the light source 1b is optically rotated , though in the first embodiment the light source 1b is directly rotated around the optical axis . that is , in the second embodiment , the light source 1b is fixed on the optical axis and a parallel glass 15 is rotatably arranged between the light source 1b and the condenser lens 2 . thereby , the luminous flux emitted from the light source 1b is deviated through the parallel glass 15 and as a result , the same effect in the first embodiment that the light source 1b is positioned distantly from the optical axis can be obtained . and the measuring light source 1a is arranged so that the luminous flux emitted therefrom is reflected by a half - mirror 16 and the main light thereof becomes coaxial with the projecting optical axis . as mentioned above , in the second embodiment , the parallel glass 15 is rotated around the optical axis synchronous with the cornea reflecting rejection mask 10 and the measuring light receiving device 14 , instead that the measuring light source 1b is rotated in the first embodiment . in addition to the above , the ophthalmic apparatus of the third embodiment will be described according to fig7 . although the refractive power is obtained by projecting the spot target onto the fundus of the eye 6 , the refractive power is obtained in the ophthalmic apparatus according to the third embodiment , as follows . in fig7 numerals 30 , 39 indicate infrared light sources which emit infrared rays with a wavelength in the infrared region and numerals 31 , 40 indicate condenser lenses . numeral 32 is a conical prism , numeral 33 is a diaphragm which has a ring hole therein , numeral 41 is a spot diaphragm and numerals 34 , 42 are relay lenses . and numeral 35 is a hole mirror having a hole in the center thereof , numeral 43 is a half - mirror , numeral 37 is a imaging lens and numeral 38 is a - two - dimensional image pick - up element such as ccd camera . here , the diaphragm 33 is arranged at a position conjugated with the fundus of the eye 6 and the spot diaphragm 41 is also arranged at a position conjugated with the fundus of the eye 6 . and the fundus is conjugated with the two - dimensional image pick - up element 38 . further , not only both the infrared light source 30 and the hole mirror 35 but also both the hole mirror 35 and the pupil of the eye 6 , are mutually arranged with a conjugation relationship therebetween , respectively . in the above construction , the luminous flux emitted from the infrared light source 30 is irradiated on the diaphragm 33 through the condenser lens 31 and the conical prism 32 . the luminous flux passed through the diaphragm 33 is reflected by the hole mirror 35 while passing through the relay lens 34 and thereafter forms an image of the diaphragm 33 onto the fundus of the eye 6 after passing through the objective lens 36 . the reflected luminous flux from the fundus is passed through the hole of the hole mirror 35 and forms the fundus image on the element 38 through the imaging lens 37 . on the other hand , the luminous flux emitted from the infrared light source 39 , which is passed through the region of the visual axis , is reflected by the half - mirror 43 and forms an image of the spot diaphragm 41 onto the fundus on the visual axis . in the ophthalmic apparatus of the third embodiment , the ring pattern image of the diaphragm 33 is picked up by the element 38 ( ccd camera ) from the center portion of the eye 6 and the image of the diaphragm 41 , which gives the center image of the eye 6 , is picked up by the element 38 , thereby the refractive power is obtained by calculating the distance between each of the ring patterns and the canter image of the eye 6 . next , the ophthalmic apparatus according to the fourth embodiment will be described hereinafter . the apparatus is constructed from various systems such as a projection optical system for projecting the measuring target onto the cornea to measure the cornea curvature , a detection optical system for detecting the measuring target to measure the cornea curvature , a projection optical system for projecting the measuring target onto the fundus to measure the eye refractive power , a detection optical system for detecting the measuring target to measure the eye refractive power , a projection optical system for fixation target , an alignment display optical system and a control system . each system will be described in succession hereinafter . in fig8 numeral 51 is a placido - plate which has a hole in the center thereof . in the placido - plate 51 , as shown in fig9 a plurality of ring pattern portions 51a through which light can pass , each ring pattern portion 51a having a predetermined width , and a plurality of ring pattern portions 51b by which light is shaded , each ring pattern portion 51b having a predetermined width , are concentrically formed around the optical axis . on the back side of the ring pattern portions 51a , a plurality of light sources 52 such as led elements by which the ring pattern portions 51a are uniformly irradiated . each light source 52 emits near infrared rays . the ring pattern formed by irradiating the ring pattern portions 51a through the light sources 52 is projected onto the cornea of the eye e to be examined . at that time , since the front side of the placido - plate 51 is entirely covered by a film 53 which cuts the visible rays and passes the infrared rays , the person who is examined cannot see the ring pattern . here , in the fourth embodiment , as the light sources 52 for irradiating the placido - plate 51 , the light sources emitting near infrared rays are utilized only to avoid miosis of the eye e when the refractive power is measured subsequently . therefore , as the light sources for irradiating the pattern of the placido - plate 51 , the other light sources emitting red rays can be utilized without being limited to the infrared light sources . and it is conceivable to use a ring fluorescent tube as the light source to irradiate the placido - plate 51 and to arrange a reflector near the ring fluorescent tube . in this case , the light from the ring fluorescent tube is reflected by the reflector and is irradiated to the pattern of the placido - plate 51 . the reflected light from the cornea which has the ring pattern according to the placido - plate 51 is reflected through a beam splitter 54 and thereafter forms the cornea reflecting image of the ring pattern on a picture pick - up plane of a ccd camera 57 through a picture pick - up lens 55 and a mirror 56 . numeral 60 indicates a pair of light sources emitting rays with a wavelength in the near infrared region . the light sources 60 are arranged near a focal point of a condenser lens 61 existing at the side of the light sources 60 . in this fourth embodiment , the light sources 60 are symmetrically positioned against the optical axis and are rotated with 180 degrees around the optical axis . however , in order to obtain more detailed information of the refractive power , it is conceivable that one of the light sources 60 is arranged on the optical axis and the other thereof is arranged so as to rotate with 360 degrees around the optical axis . and numeral 82 is a measuring target plate which has a measuring target ( spot hole ) and is movable so as to set to a position conjugated with the fundus of the eye e . numeral 63 is a projecting lens and the projecting lens 63 projects the target plate 62 onto the fundus of the eye e . numeral 64 indicates a objective lens , numeral 65 indicates a beam splitter and numeral 66 indicates a mirror . and numeral 67 and 68 are relay lenses , numeral 69 is a cornea reflecting rejection mask shaped as a band , which is arranged at a position conjugated with the cornea of the eye e , numeral 70 is a movable lens moved synchronously with the target plate 62 , numeral 71 is an imaging lens . numeral 72 is a divided light receiving device which is rotated around the optical axis synchronously with the light sources 60 and the cornea reflecting rejection mask 69 . numeral 80 indicates the first relay lens which is utilized for fogging the eye e by being moved along the optical axis and numeral 81 indicates the second relay lens . and numeral 82 is a fixation target arranged at a focal point of the second relay lens 81 , numeral 83 is a condenser lens and numeral 84 is a illumination lamp . numeral 90 is an illumination lamp embedded in the placido - plate 51 , the lamp 90 emitting rays with a wavelength in the near infrared region and irradiating the anterior portion of the eye e . and the lamp 90 is utilized for illuminating the eye e to pick up the anterior image of the eye e . the anterior image of the eye e is picked up by the ccd camera 57 in the above mentioned detection optical system . the image picked up by the ccd camera 57 is displayed on the display device 91 . the displayed image is utilized for roughly aligning the optical axis of the apparatus and the eye e . numeral 92 is an alignment light source such as led , the alignment light source 92 emitting rays with a wavelength in the near infrared region . and the alignment light source 92 is arranged to a focal point of the objective lens 64 through the half - mirror 93 and the beam splitter 65 in the projection optical system for fixation target . the light from the alignment light source 92 forms the cornea reflection image and is adjusted to an alignment marker ( not shown ) for alignment with a predetermined relationship therebetween . the measurement result and the anterior image of the eye e are alternately displayed on the display device 91 by exchanging thereof . as the display device 91 , a color liquid crystal display is adopted so as to be able to display color graphics . the control system of the apparatus will be described with reference to fig1 . the signal from the ccd camera 57 is converted to digital signal by a a / d converter 100 and is input to a frame memory 102 synchronous with the clock signal from a timing generator 101 . the image data stored in the frame memory 102 is input to a synthesizing circuit 104 under control by the first microcomputer 103 and screened on the display device 91 . to the synthesizing circuit 104 , a video graphic adaptor 105 which can form video graphics and characters is connected . the video graphic adaptor 105 displays video graphic images or synthesized images of both the image picked up by a ccd camera 57 and the characters on the display device 91 . numeral 106 is an image processing circuit which conducts image processing to the placido - ring image stored in the frame memory 102 and stores the processing result in a memory 107 . numeral 108 is a printer , numeral 109 is a driver for controlling the printer 108 . and numeral 110 is the second microcomputer connected to the first microcomputer 103 . the second microcomputer 110 mainly controls measurement operation . numeral 111 is a start switch to start measurement , numeral 112 is a control switch having various switches such as a mode exchanging switch for exchanging a cornea shape measurement mode and a refractive power measurement mode . numeral 113 is a driver for driving a refractive power measurement system 114 , numeral 115 is a driver for driving a projection optical system for fixation target 116 , numeral 117 is a driver for turning on and off of the light sources 52 , numeral 118 is a driver for driving the illumination lamp 90 and numeral 119 is a driver for driving the alignment light source 92 . and numeral 120 is a floppy disk device and numeral 121 is a driver for driving the floppy disk device 120 . next , operation of the above constructed apparatus will be described with reference to flowcharts in fig1 to 13 . first , the mode exchanging switch in the control switch 112 is selected and the measurement item is determined . here , operation in a case that a continuous measurement mode where the cornea shape measurement mode and the refractive power measurement mode are successively conducted , will be described hereinafter . when the continuous measurement mode is selected by the mode exchanging switch , the illumination lamp 90 and the alignment light source 92 are turned on ( s1 ). and the anterior image of the eye e is picked up by the ccd camera 57 and the picked up image is screened on the display device 91 through the frame memory 102 and the synthesizing circuit 104 ( s2 ). the examiner adjusts the anterior image of the eye e , the luminescent point and the alignment mark ( not shown ) through a well - known sliding mechanism while seeing the display device 91 , so that a predetermined relationship is formed among the anterior image of the eye e , the luminescent point and the alignment mark ( s3 ). and when the start switch 111 is pushed after the alignment is completed ( s4 ; yes ), the illumination lamp 90 and the alignment light source 92 are turned off ( s5 ) and the light sources 52 of the placido - ring are turned on for a predetermined time interval ( s6 ). thereby , the placido - plate 51 is projected on the eye e through the light sources 52 and the placido - ring image is formed on the cornea of the eye e . the placido - ring image is picked up by the ccd camera 57 and the image data thereof is stored in the frame memory 102 ( s7 ), thereby the placido - ring image is displayed on the display device 91 ( s8 ). at that time , the examiner examines whether the placido - ring image displayed on the display device 91 satisfactorily picked up or not . if the image is unsatisfactorily picked up ( s9 ; no ), a cancel switch in the control switch 112 is pushed and the measurement is conducted again ( s1 ). on the contrary , if the image is satisfactorily picked up ( s9 ; yes ), a save switch in the control switch 112 is pushed . when the save switch is pushed , the edge detection process is conducted through the image processing circuit 106 and the processed image data is stored in the memory 107 by the first microcomputer 103 ( s10 ). and at the time that the processed image data is stored in the memory 107 , the cornea shape measurement mode is changed to the refractive power measurement mode . first , in this mode , the illumination lamp 90 and the alignment light source 92 are turned on ( s11 ) and the alignment is done by the same procedure as in the cornea shape measurement mode ( s12 , s13 ). when the alignment is completed , the start switch 111 is pushed ( s14 ). the second microcomputer 110 operates both the refractive power measurement system 114 and the projection optical system for fixation target 116 based on the signal from the start switch 111 . the measurement light from the light source 60 is passed through the condenser lens 61 , the target plate 62 and the projecting lens 63 and is condensed near the cornea of the eye e . thereafter , the light is reached to the fundus of the eye e . the light reflected on the fundus is passed through the beam splitter 54 and the light path thereof is changed . and the light from the beam splitter 54 is reflected by the mirror 66 and passed through the relay lenses 67 , 68 . as a result , the light is irradiated on the light receiving device 72 through the imaging lens 71 . further , based on the signal received by the light receiving device 72 , the second microcomputer 110 moves both the movable lens 70 and the target plate 62 so that they are arranged at a position conjugated with the fundus of the eye e . next , after both the fixation target 82 and the the fundus of the eye e are mutually positioned at the conjugated position through the first relay lens 80 , the fixation target 82 is further moved by a suitable diopter so as to fog the eye e . after fogging of the eye e , the light source 60 , the cornea reflecting rejection mask 69 and the light receiving device 72 are rotated step by step ( for example , every 1 degree ) with 180 degrees around the optical axis . while rotating thereof , the target plate 62 and the movable lens 70 are moved according to the signal from the light receiving device 72 , thereby the refractive power value in the meridional direction is obtained every rotational step based on quantity of movement of the target plate 62 and the movable lens 70 ( s15 , s16 ). the above measurement of the refractive power is repeated for predetermined several times ( s17 ) and the measurement result is averaged . the averaged data is transmitted to the memory 107 and stored therein ( s18 ). here , as the measurement data of the refractive power value , the refractive power data in each meridional direction is stored in addition to the spherical refractive power , the cylindrical refractive power and the cylindrical axis . and similar to the above , the measurement of the cornea shape and the refractive power of the other eye e is conducted ( s19 ). the measurement data of the cornea shape and the refractive power is processed as follows and the displaying data thereof is obtained . first , the first microcomputer 103 reads the cornea shape data ( s21 ) and the cornea curvature is calculated every the predetermined angle based on the edge point of each of the rings ( s21 ). next , calculation method will be described with reference to fig1 . in fig1 , supposed that the image i of the point light source p , which is located at a position distant from the cornea by the distance d on the optical axis and distant from the optical axis by the height h by the convex cornea , is formed at a position distant from the vertex of the cornea by the distance 1 and distant from the optical axis by the height h , the equation ( 1 ) is materialized . ## equ1 ## next , if the image i is imaged by the lens l on the two dimensional plane , the height is detected as the height h &# 39 ;. therefore , the magnification m of the optical system in the apparatus is represented by the equation ( 2 ). ## equ2 ## here , if the curvature radius of the cornea is r , the focal length f of the cornea as the convex mirror is represented by the equation ( 3 ). ## equ3 ## and if it exists a relationship according to the equation ( 4 ) between the focal length f and the distance d , a relationship between the distance 1 and the focal length f is represented by the equation ( 5 ). thus , according to the equations ( 2 ), ( 3 ) and ( 5 ), the equation ( 1 ) is rewritten into the equation ( 6 ). ## equ4 ## that is to say , the distance d , the height h and the magnification m are inherent values for the apparatus . therefore , if the height h &# 39 ; is obtained , the curvature radius r of the cornea in the region where the image is observed can be obtained . here , in case that the curvature radius of the cornea in the small region is calculated , for example , every one degree in the meridional direction against light and shade edges of each placido - ring according to the above equations , it is necessary to calculate for several thousands points . as a result , the processing time becomes longer . in order to avoid this problem , it is conceivable to use the following calculation method to calculate the curvature radius r of the cornea . here , supposed that the curvature in the region where the j th ring is projected is defined as the curvature radius r j , the constant determined by the height of the jth ring , the distance to the eye and the image magnification in the apparatus is k j and the image height on the screen is h j , the above equations are simply represented as the equation ( 8 ). in the equation ( 8 ), the constant k j can be obtained as the inherent value of the apparatus by beforehand measuring a plurality of the spherical eye models , each having the known curvature , which cover the measurement range of the apparatus . the thus obtained constant k j is stored in the non - volatile memory of the apparatus . and when the curvature radius of the eye is measured , the curvature can be easily and quickly calculated by reading the constant k j from the non - volatile memory and calculating the curvature radius according to the equation ( 8 ). further , at this time , manufacturing error of the apparatus can be corrected . by conducting the above calculation , the cornea curvature is obtained every the predetermined angle at edge in each ring image . the obtained cornea curvature is stored . here , the calculation process of the cornea curvature is conducted by the first microcomputer 103 , and thus while such processing by the first microcomputer 103 , it is conceivable that the eye refractive power is measured by the second microcomputer 110 . the cornea curvature data and the eye refractive power data which are obtained according to the above , are displayed on the display device 91 ( s22 ). at that time , display contents can be selected by the switch in the control switch 112 . next , the display contents about the cornea curvature data and the eye refractive power data will be described with reference to fig1 and 16 . fig1 shows a display example using color map by converting the curvature radius of the cornea into the corneal refractive power through a well - known calculating method and classifying the distribution thereof in each color ( s23 ). in such color classification , the color is , for instance , classified into 15 stages by combining a hue such as red , orange , yellow , green , blue , indigo blue and purple and a gradation thereof , and the red shows the maximum refractive power , the purple shows the minimum refractive power . according to this , the refractive power value between the maximum refractive power and the minimum refractive power is divided into 15 stages and each stage of the color classification ( 15 stages ) is corresponded to each refractive power value . in fig1 , the inner circle in the color map is displayed so that the circle is superposed over the pupil position of the eye . fig1 shows a graph in which the eye refractive power data is plotted corresponding to each meridional line . in fig1 , the extent of the refractive ametropy is indicated by the distance from the center . and in order to visually understand , the maximum value of the refractive ametropy is plotted on the outer circle and the minimum value of the refractive ametropy is plotted on the inner circle which has a 1 / 2 radius of the outer circle ( s23 ). fig1 shows an example of color map in which the refractive power data is indicated corresponding to each angle . the color classification is conducted in 15 stages as in the case of fig1 . according to this method , in case that the refractive power in each stage is defined as 0 . 5 d ( diopter ), the refractive power values can be relatively displayed in a range of + 3 . 5 d ˜- 3 . 5 d if the spherical equivalent value ( se value ) is used as the standard value ( s23 ). and for example , the refractive ametropy may be absolutely displayed based on that hypermetropia is colored in blue direction and myopia is colored in red direction while emmetropia eye is used as the standard point . next , a method to display the remaining astigmatism based on the cornea curvature data and the eye refractive power data will be described referring to fig1 . fig1 shows an example of color map in which the remaining astigmatism ( defined by the difference between the total astigmatism and the cornea astigmatism ) calculated based on the cornea refractive power data derived from the cornea refractive power data in the pupil area as shown in fig1 corresponding to each measurement region and the eye refractive power data ( the data converted to the refractive power when the vertex of the cornea is selected as the standard ). in fig1 , the same color classification as in the fig1 may be conducted ( s23 ). here , the total astigmatism substantially equals to sum of the cornea astigmatism and the astigmatism in the crystalline lens . thus , the data obtained based on the cornea curvature data ( the cornea refractive power data ) and the eye refractive power data may be effectively used for correction of the cornea in the refractive ametropy . further , in addition for the cornea correction , the above data will be effectively used in a case that a silicon gel type iol ( intra ocular lens ) by which the focal point is changeable is practiced instead of the intraocular lens implant which has a fixed focal point . here , as in the first embodiment , it is conceivable that one of the light sources 60 is arranged on the optical axis and the other is arranged so as to rotate 360 degrees around the optical axis , thereby the refractive power is obtained in all directions of 360 degrees . in this case , the color map display of the cornea refractive power can be more suitably conducted . such construction will be omitted since it is apparent from fig1 . the display data is printed by the printer 108 through the driver 109 if necessary ( s24 , s25 ) and is stored in the floppy disk device 120 through the driver 121 if necessary ( s26 , s27 ). next , the fifth embodiment will be described hereinafter with reference to fig1 . here , in fig1 , the same elements in the aforementioned fourth embodiment is numbered by the same numbers . in the fourth embodiment , the light path through which the luminous flux of the target for measuring the eye refractive power is secured in the placido - plate 51 by opening the hole in the center of the placido - plate 51 . however , in this case , more information about the cornea shape in the center of the cornea cannot be obtained . in order to improve this point , measurement of the cornea curvature in the cornea center can be done in the fifth embodiment . in fig1 , numeral 130 is the second plane placido - plate arranged at the focal point of the objective lens 64 and on the upper surface of the second placido - plate 130 , transparent portions which is able to pass light are formed at the center and concentrically in a form of plurality of ring patterns , and further light shading portions are concentrically formed in a form of plurality of ring patterns . numeral 131 is the second illumination light for illuminating the second placido - plate 130 , the illumination light 131 emitting rays in near infrared region . the second illumination light 131 uniformly irradiates the second placido - plate 130 through a condenser lens 132 and projects the ring pattern image onto the cornea of the eye e through the objective lens 64 . here , if the focal length of the objective lens 64 is f 1 , the image formed by the cornea having the curvature radius r is formed at the focal point of the objective lens 64 with a size of ( r / 2 )/ f 1 . according to this , the distribution of the cornea curvature can be obtained by detecting the ring pattern image on the plane that the image is picked up and conducting calculation process as in the fourth embodiment . as mentioned above , in the apparatus of the fifth embodiment the detailed information about the cornea center region can be obtained , therefore such apparatus would be very useful for operation to correct the refractive ametropy in which it is necessary to know the information about the cornea center region . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details can be made therein without departing from the spirit and scope of the invention . | 0 |
fig1 illustrates a one - line block diagram of an exemplary embodiment of an electrical system ( system ) 100 . the system 100 includes a direct current ( dc ) power source 102 that may include , for example , an array of solar cells , a wind turbine , or other type of generator or power source . a switch box 104 is electrically connected to the dc power source 102 and an inverter 108 . the inverter 108 is operative to invert dc power into ac power . the inverter 108 is electrically connected to a load 110 and an ac grid 112 . while the electrical system 100 is depicted in fig1 as a one - line block diagram , it will be appreciated by one skilled in the art that such a depiction also represents a multi - phase electrical distribution system , such as a three - phase or three - phase with switching neutral electrical system , for example . the switch box 104 includes a fuse 116 that may include any type of fuse such as , for example , a photovoltaic ( pv ) fuse that is electrically connected to the dc power source 102 and the inverter 108 . the switch box 104 includes a switch 114 that is electrically connected to the fuse 116 and the dc power source 102 . the arrangement of the switch 114 allows the fuse 116 to be electrically isolated from the dc power source 102 when the switch 114 is in an open position or state . the electrical connection between the inverter 108 and the ac grid 112 , and in some instances , the connection between the inverter and the load 110 , may result in a “ back feeding ” state where a voltage may be present at the fuse 116 even if the fuse 116 is isolated from the dc power source 102 ( i . e ., the switch 114 is in an open position or state ). thus , prior to accessing the fuse 116 during installation , maintenance , or troubleshooting , a technician should determine whether a voltage is present at the fuse 116 . if a voltage is present at the fuse , the technician should not access the fuse 116 until the source of the voltage is isolated from the fuse . the embodiments described below include an obstructive member between the fuse 116 and an access opening of the switch box 104 that will allow a technician to test the fuse 116 to determine whether voltage is present while the obstructive member remains in position . in operation , once the technician has tested the fuse 116 and ensured that no voltage is present at the fuse 116 , the technician may remove or reposition the obstructive member to gain physical access to the fuse 116 . in this regard , fig2 illustrates an exemplary embodiment of a switch box ( connection box ) 202 . the switch box 202 is arranged to be used in a multi - phase power system . though the switch box 202 of the illustrated embodiment is arranged to be used in a three - phase power system , alternate embodiments may include similar arrangements that may be used in , for example , a single - phase power system or a multi - phase power system having any number of phases . the switch box 202 includes a housing portion 204 having a rear panel 206 , and side panels 208 that define a cavity 210 having an access orifice 211 defined in an embodiment by exposed edges 217 of the side panels 208 , the housing portion 204 includes a front panel 212 that encloses the cavity 210 and the access orifice 211 when arranged in a closed position . the front panel 212 may be secured to the side panels 208 of the housing portion with , for example , fasteners , a hinge arrangement , a combination of a hinge arrangement and fasteners , or any suitable combination of hooks , clasps , or clips . switches 214 are arranged in the cavity 210 . the switches 214 are connected to an actuating lever 216 with a mechanical linkage arrangement such that the movement of the actuating lever 216 changes the position or state of the switches 214 . each of the switches 214 includes a terminal that may be connected to an electrical cable or line . the switches 214 are electrically connected to corresponding fuse holder assemblies 219 . the each of the fuse holder assemblies 219 includes a first fuse holder portion 220 and a second fuse holder portion 222 . the first fuse holder portion 220 secures a first end of a fuse 224 and is electrically connected to a corresponding switch 214 . the second fuse holder portion 222 secures a second end of the fuse 224 and is electrically connected to a terminal that may be electrically connected to an electrical cable or line . an electrical path is defined by the terminals of a switch 214 , the switch 214 contacts , the first fuse holder portion 220 , the fuse 224 , the second fuse holder portion 222 , and terminals of the second fuse holder portion 222 . as discussed above , in operation , a voltage may be present in the fuses 224 and the fuse holder assemblies 219 during a back feeding state even if the switches 214 are in an open position or state . it is desirable to encourage a technician to determine whether a voltage is present in the fuses 224 and the fuse holder assemblies 219 prior to performing installation , maintenance , or troubleshooting tasks . fig2 illustrates a partially transparent view of an exemplary embodiment of a cover 225 that is arranged in the cavity 210 between the access orifice 211 and the second fuse holder portions 222 . in the illustrated embodiment , the cover 225 is fabricated from a non - conductive or insulating material such as , for example , a plastic , nylon , composite , or other type of non - conductive material . the cover 225 of the illustrated embodiment is fabricated from a single sheet of semi - rigid material however , alternate embodiments are not limited to being fabricated from a single sheet of material , and may be fabricated and assembled from any number or combination of parts and components that many include , for example , rigid , flexible , or semi - rigid materials . fig3 illustrates a perspective view of an exemplary embodiment of the cover 225 . the cover 225 includes a front cover panel portion 302 and side cover panel portions 304 that are connected to the front cover panel portion 302 . the side cover panel portions 304 are connected to extension portions 306 . in the illustrated embodiment , the extension portions 306 include at least one orifice 308 that is operative to receive a fastener such as , for example , a bolt or a screw ( not shown ). the front cover panel portion 302 includes probe orifices 311 that are sized and shaped to allow a voltage or other type of testing probe to be inserted through the probe orifices 311 . the probe orifices 311 of the illustrated embodiment are formed in a circular shape and are sized such that a testing probe may pass through one of the probe orifices 311 , but other tools that are larger than the diameter of the probe orifices 311 or parts of a human body such as , a finger may not pass through the probe orifices 311 . thus , the front cover panel portion 302 partially obscures portions of the fuse holder assemblies 219 when viewed by a technician via the access orifice 211 ( of fig2 ). fig4 illustrates a front view of the exemplary embodiment of the cover 225 of fig3 as described above . fig5 illustrates a top partially cut - away view of the cover 225 along the line 5 ( of fig2 ). the cover 225 is secured to the rear panel 206 of the switch box 202 with fasteners 504 and 505 that pass through the orifices 308 ( of fig3 ). the fasteners 504 and 505 may be similar or dissimilar . in one embodiment , the fastener 505 includes a “ one - way ” screw head that makes removal of the fastener 505 difficult without special tools , while the fastener 504 includes a traditional screw head such as , for example , a slotted screw head . thus , a technician is discouraged from removing the fastener 505 and is encouraged to remove the fastener 504 . such an arrangement helps to ensure that the cover 225 may not be completely removed by a technician and discarded . the probe orifices 311 are arranged to align with corresponding test contact points 502 on the second fuse holder portions 222 such that each of the probe orifices 311 and the corresponding test contact points 502 define lines substantially normal to the front cover panel portion . the test contact points 502 are electrically connected to the fuses 214 and the terminals of the second fuse holder portions 222 . the test contact points 502 may include any conductive portion of the second fuse holder portions 222 that are electrically connected to the terminals of the second fuse holder portions 222 . the front cover panel portion 302 is arranged such that the planar surfaces of the front cover panel portion 302 are substantially parallel to the planar surfaces of the rear panel 206 . in the illustrated embodiment , the planar surfaces of the side cover panel portions 304 are substantially perpendicular to the planar surfaces of the front cover panel portion 302 and the planar surfaces of the extension portions 306 are substantially parallel to the rear panel 206 . in alternate embodiments , the planar surfaces of the cover 225 may be arranged in any suitable alternative arrangement relative to each other , or the switch box 202 , and are not limited to the arrangements described above . the line 501 illustrates a plane partially defined by the by exposed edges 217 of the side panels 218 ( of fig2 ), the cover 225 is disposed between the plane partially defined by the by exposed edges 217 of the side panels 218 and the second fuse holder portions 222 . fig6 illustrates another top partially cut - away view of the cover 225 along the line 5 ( of fig2 ). fig6 illustrates the use of a test probe 602 that is electrically connected to a test device 604 , such as , for example , a voltmeter device . the test probe 602 is shown passing through a probe orifice 311 of the cover 225 to contact a corresponding test contact point 502 of the second fuse holder portions 222 . the diameter ( d ) of the probe orifice 311 is between about 2 . 5 mm to 4 mm and greater than the diameter ( d ′) of the test probe 602 such that the test probe 602 may pass through the probe orifice 311 . fig6 also illustrates a finger 606 that has been placed adjacent to a probe orifice 311 , the diameter ( d ) is less than the approximate diameter ( d ″) of the finger 606 , thus preventing the finger 606 or other objects from passing through the probe orifice 311 and contacting conductive portions of the second fuse holder portions 222 . fig7 illustrates a top view of the cover 225 along the line 5 ( of fig2 ). in fig7 , the fastener 504 ( of fig5 ) has been removed , and the cover 225 has been moved to provide access to the second fuse holder portions 222 and the fuses 224 . in the illustrated embodiment , the cover 225 has been deformed to flex about the region 702 . the region 702 of the cover 225 may include a crease or scored portion to reduce the resistance to the deformation . the fastener 505 secures the extension portion 306 of the cover 225 to the rear panel 206 of the switch box 202 . fig8 illustrates a front view of the switch box 202 with the cover 225 arranged in a closed position . the cover 225 obscures portions of the second fuse holder portions 222 ( of fig2 ) and the fuses 224 . the cover 225 is secured to the rear panel 206 of the switch box 202 with the fasteners 504 and 505 , however any number of fasteners or other fastening means such as , for example , clips , pins , brackets or tabs may be used in alternate embodiments . fig9 illustrates a front view of the switch box 202 with the cover 225 arranged in an open position . the fastener 504 has been removed , and the cover 225 has been positioned to expose and to allow access to the second fuse holder portions 222 and the fuses 224 . though the embodiments of the switch box 202 ( of fig2 ) include switches 214 , in alternate embodiments the switch box 202 may be a connection box that does not include the switches 214 , but includes the fuse holder assemblies 219 and the cover 225 arranged in a similar manner as discussed above . while the invention has been described in detail in connection with only a limited number of embodiments , it should be readily understood that the invention is not limited to such disclosed embodiments . rather , the invention can be modified to incorporate any number of variations , alterations , substitutions or equivalent arrangements not heretofore described , but which are commensurate with the spirit and scope of the invention . additionally , while various embodiments of the invention have been described , it is to be understood that aspects of the invention may include only some of the described embodiments . accordingly , the invention is not to be seen as limited by the foregoing description , but is only limited by the scope of the appended claims . | 7 |
the process of the invention provides for the removal of solvents from an inlet solvent laden air ( sla ) path utilizing an adsorbent . there is shown schematically in fig1 a preferred process according to the invention . the sla enters an adsorber 10 through a sla inlet path 12 . the flow of inlet sla is controlled by an sla inlet valve 16 . the sla is passed through an adsorbent , preferably a bed of activated carbon . solvents in the air stream are adsorbed by the adsorbent . purified air leaves the adsorber 10 through an air exit path 20 controlled by a valve 21 and can usually be vented . when the adsorbent becomes saturated with solvents , the adsorbent is regenerated . the adsorbent is preferably regenerated when desorption equilibrium is attained or nearly attained , or when environmental limits of solvent particles are reached in the air leaving the adsorber . the process of the invention preferably provides for essentially closed loop regeneration of the adsorbent . the regenerating gas , steam , is passed to the adsorber 10 through a steam inlet path 24 controlled by a valve 25 to strip solvents from the adsorbent . steam condenses as the adsorbent heats , and the adsorber condensate is transported to a water tank 28 through an adsorber condensate exit 30 controlled by a valve 31 . the steam and solvent vapors are transported from the adsorber 10 by an adsorber steam exit path 34 , which is controlled by a steam exit valve 36 . the steam and solvent vapors exiting the adsorber are preferably between 200 degrees f . and about 230 degrees f . the steam and solvent vapors exiting the adsorber 10 are passed to a condenser 40 . the condenser 40 is supplied with cooling means such as water which enters the condenser by a condensor water inlet path 42 and exits the condenser by a condensor water outlet path 44 . the temperature of the cooling water that is required depends on process parameters , and particularly on the solvents being condensed . condensed water and solvents exit the bottom of the condenser through a condenser liquid exit path 48 and are transported to a decanter 52 . non - condensibles leave the condenser 40 through a condenser vapor exit path 54 , which preferably returns the non - condensibles to another adsorber for adsorption . the temperature of the fluids leaving the condenser 40 will depend on the particular solvents being removed and other process parameters . the decanter 52 separates the liquid product from the condenser into a solvent rich fraction and a water layer fraction . the water layer fraction may , for example , form at the bottom of the decanter 52 and exit through a heavy fraction exit path 56 to the water storage tank 28 . the solvent rich fraction , which forms at the top of the decanter 52 , leaves the top of the decanter 52 through a decanter light fraction exit path 64 and is passed to a solvent tank 65 . the solvent tank 65 receives the solvent rich fraction from the path 64 . it is desirable that the solvents from this fraction be processed and reused , if possible . otherwise , these products must be disposed by suitable processes and according to acceptable standards . the water layer fraction which , in this embodiment , leaves the bottom of the decanter 52 , may be sufficiently free of solvent that it may be used directly for further steam generation . where solvents that are miscible with water are encountered , however , it may be necessary to further process this stream to reduce the concentration of these contaminants to acceptable levels . the dashed lines in fig1 indicate the exit and return paths to one such further separation process , in this embodiment , distillation . a control valve 74 can be utilized to direct the flow of the water layer fraction from the heavy fraction exit path 56 to a distillation inlet path 78 . the bottoms of the distillation column 82 are heated by a circulation path 84 . a heat exchanger 88 heats the bottoms circulated through the path 84 . the heat exchanger 88 can receive heat through a steam inlet path 90 , which steam exits through a steam outlet path 94 . the solvent product from the distillation will normally exit the top of the distillation column 82 , as through a solvent exit path 98 . a portion of the solvent exiting through the path 98 can be returned to the column 82 through a return line 100 . a portion of the substantially contaminant free regenerating fluid ( here water ) in the recirculation path 84 is passed to the water storage tank 28 through a distillation column water outlet path 104 . the concentrations in the different vapor and liquid phases will be determined , at the limit , by equilibrium conditions for the compounds that are present and operating parameters such as temperature and inlet concentrations . the equilibrium condition will be disrupted by the constant withdrawal of compounds from the process . a dynamic equilibrium may be attained , but must be calculated or determined empirically on a case by case basis . data of solubilities for many binary and ternary systems is available in the literature . data for complex mixtures must be established in the laboratory . the water layer tank 28 is a holding tank for the water . the water is pumped by a pump means 62 as needed to a steam generator 66 through a steam generator inlet path 70 . the steam is generated by heat which may be provided by electricity , high pressure steam , or the combustion of a fuel . a high pressure steam enters the steam generator 66 through a high pressure steam inlet path 74 and exits the steam generator 66 through a high pressure steam exit path 78 . the high pressure steam is preferably at least 40 psig and condenses on the tube side of the steam generator . steam leaving the steam generator 66 is transported by the steam inlet path 24 to the adsorber 10 to regenerate the adsorbent . where the bulk of the solvents and contaminants in the process stream are miscible with water , decantation will normally be inappropriate . solvents such as ethanol , propanol , tetrahydrofuran and others , which are miscible in water , do not separate into two phases . these solvents will not separate by decantation and must be separated by another process . fig2 illustrates another embodiment of the invention wherein the condensation product is separated by distillation . an adsorber 120 receives sla from a sla inlet path 124 controlled by a valve 125 . purified air exits through the air exit path 128 controlled by a valve 129 . the adsorbent is periodically regenerated by a flow of regenerating fluid , preferably steam , which is received from an adsorber steam inlet path 130 . initial steam passed through the adsorbent will condense as the adsorbent heats , and this condensation is passed through an adsorber condensate outlet path 132 controlled by a valve 133 to a water storage tank 136 . steam and solvents exit the adsorber 120 through an adsorber solvent exit path 140 , which flow is controlled by an adsorber solvent exit path valve 144 . the steam and solvents are passed to a condenser 148 , which can be cooled by suitable means known in the art . the condenser 148 can receive cooling liquid from a cooling liquid inlet path 152 . the cooling liquid exits the condenser 148 through a cooling liquid exit path 156 . the condensate product leaves the condenser 148 through a condensate exit path 160 . non - condensibles leave the condenser 148 through a non - condensibles condenser exit path 162 , which preferably returns the non - condensibles to the another adsorber for readsorption . the condensate leaving the condenser 148 is passed to a condensate storage tank 166 . a pump 170 can be used to transport condensate from the condensate tank 166 through a distillation column inlet path 174 to a distillation column 176 . the distillation column 176 is adapted to separate the miscible solvents from the regenerating fluid , here water . the bottoms of the distillation column 176 are recirculated through a recirculation path 180 . a heat exchanger 182 heats the bottoms flowing through the recirculation path 180 . the heat exchanger 182 receives heat from suitable means , such as the steam inlet path 184 , which steam exits the heat exchanger 182 through a steam exit path 186 . the solvents will normally exit the top of the column through a solvent exit path 190 . a portion of the exiting solvents are returned to the column 176 through a reflux path 192 . a portion of the bottoms is withdrawn through a distillation column product outlet path 194 and is passed to the water storage tank 136 . water in the storage tank 136 can be pumped by a pump 200 through a steam generator inlet path 202 to the steam generator 204 . the steam generator 204 can be heated by suitable means known in the art such as high pressure steam , which can enter the steam generator 204 through a high pressure steam inlet path 206 , and which can exit through a high pressure steam outlet path 210 . steam generated in the steam generator 204 exits through the adsorber steam inlet path 130 . flow through the adsorber steam inlet path 130 is controlled by a control valve 212 . should the contaminants form azeotropes with water , further processing may be required to dehydrate the solvents . the ph of the water can be neutralized , as needed , in the water tank 136 . toluene used in a coating operation must be separated from an air stream before the air stream can be vented to the atmosphere . a toluene laden air path is passed through an adsorbent wherein the toluene is adsorbed on the adsorbent . the adsorbent is regenerated when needed by passing steam through the adsorbent . the toluene and steam vapor exiting the adsorber are condensed . the condensate is transported to a decanter for separation . in the decanter two phases form wherein the lighter , top layer contains most of the toluene and the lower , heavier layer contains mostly water . the light fraction leaving the top of the decanter and containing the toluene is transported to a storage tank . the solubility of water in toluene is slight , on the order of about 500 ppm , and the toluene product may therefore be reused in most applications without further processing . the water layer leaving the decanter contains about 600 ppm of toluene , and usually cannot be released without further treatment . the water is therefore passed to a water layer tank and is then used to generate steam for further regeneration . high pressure steam at about 40 psig is used to vaporize this water in the steam generator . the steam generated in the steam generator and passed to the adsorbers is at about 20 psig . solvents such as ethanol , propanol , tetrahydrofuran and other solvents which are miscible in water do not separate into two or more layers and these solvents must be separated from water by distillation . solvent laden air ( sla ) is passed through the adsorbent bed where the solvents are adsorbed on the carbon . the solvents are then desorbed using steam . the solvents and steam are condensed and flow to the condensate tank . the homogenous mixture of solvent and water is pumped to the distillation column where the solvents are concentrated and removed overhead from the column . the water is removed from the base of the column and flows to a water holding tank where it is treated and filtered before recycling to the steam generator . as in the case of example 1 , the water used in this system is recovered and recycled so that there is no waste water to sewer . there are also other combinations of solvents having varying degrees of solubilities in water . in such cases it may be necesary to distill the water layer from decantation to remove some solvent which remains in the water layer before the water can be recycled to steam generator . the process of the invention can be utilized to remove a number of solvents in different proportions from the sla path . although steam is a preferred regenerating fluid , the principles disclosed herein could apply to other regenerating fluids . particular selection , sizing and precise layout of the process equipment must , of course , depend upon the operation parameters and conditions . the number , type , dimension and design of the adsorbers , decanters , pumps , columns , tanks , exchangers , condensers , and generators , for example , can vary . these process characteristics must be selected according to known process design principles . accordingly , this invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof , and reference should therefore be made to the following claims , rather than the foregoing specification , as indicating the scope thereof . | 2 |
referring more particularly to fig1 - 4 , wherein like numbers refer to similar parts , a rodent trap 20 is shown in fig1 . the rodent trap is economically assembled of six parts : a metal spring 22 and five molded plastic parts . the spring 22 is received within a recessed channel 24 formed in the projecting platform 26 of a plastic base 28 . the base 28 has an upwardly protruding side wall 30 . the side wall 30 has a front opening 32 and a number of barb - receiving ledges 34 . a plastic lid 36 has protruding barbs 38 which engage with the barb - receiving ledges 34 to fix the lid to the base and to close off the trap 20 and define a trap interior 40 . a trigger 42 is mounted within the base interior 40 , and a slidable strike member 44 provides access to the base interior . as shown in fig1 , the base has an encircling interior wall 46 which extends around the interior . a stub wall 48 projects from the interior wall 46 rearwardly of the strike member 44 , and is aligned with a lower barrier wall 50 which projects upwardly from the floor 52 of the base 28 . recessed beneath the floor 52 are two parallel guide tracks 54 which receive track - following flanges 56 which extend downwardly from the side walls 58 of a tunnel element 60 of the strike member 44 . the tunnel element side walls 58 are joined to a tunnel top wall 62 and a tunnel end wall 64 to define an enclosed passageway which communicates with the trap interior 40 . each tunnel element side wall 58 has portions defining an arched opening or entryway 66 , as shown in fig2 , which allows a rodent to enter from either side of the tunnel element . the tunnel element travels along the guide tracks under the urging of the spring when released from the trigger . the direction of tunnel element travel defines an axis , which is defined equidistant between the two side walls 58 . as shown in fig1 , the spring 22 has a forward loop 68 and a rear loop 70 . the forward loop 68 is engaged by a hook 72 which extends downwardly from the end wall 64 of the tunnel element 60 . the rear loop 70 of the spring 22 engages a spring hook 71 which protrudes downwardly from the base floor 52 adjacent the end of the spring channel 24 . the spring 22 biases the strike member 44 into a retracted configuration , acting to accelerate the strike member towards a rodent within the trap 20 when the trigger 42 is tripped . the lid 36 has a short stub wall 76 which extends downwardly close to the base stub wall 48 , as well as an upper barrier wall 78 which extends near the base lower barrier wall 50 . the lid and base stub walls 76 , 48 and the lid and base barrier walls 78 , 50 , serve to define an entrance compartment 80 of the interior through which the tunnel element 60 extends , and a trigger compartment 82 within which is mounted the trigger 42 . a shallow tunnel stop 84 extends downward from the lid in a position rearward of the tunnel element 60 . the tunnel stop 84 serves to limit the rearward travel of the strike member 44 by engaging the top wall 62 of the tunnel element as it moves rearwardly . as shown in fig2 , the trigger 42 is pivotably mounted to an upstanding pin 86 which , as best shown in fig1 , is supported on a platform 88 which extends from the base floor 52 . the trigger 42 is a molded plastic piece having two brackets 90 ( only the top one being shown in fig1 - 3 ) with pin holes 92 through which the base pin 86 extends . the upper end of the pin 86 is supported against deflection in the direction of strike member movement by a protruding arc segment 94 which extends from the lid 36 adjacent the pin . the trigger 42 has a lower clearance wall 96 joined by a horizontal shelf 98 to a protruding upper wall 100 , shown in fig1 and 2 . the trigger 42 may be reinforced by outside ribs 102 running parallel to the shelf 98 as shown in fig4 . a tab 104 extends downwardly from the trigger clearance wall 96 near the end away from the brackets 90 , and is received within a tab guide hole 106 formed in the floor 52 of the base 28 . a spring 108 is integrally molded to protrude from the base interior wall 46 which has a free end 110 , shown in fig1 , which engages the exterior of the trigger 42 and urges the trigger toward the strike member . the integral spring 108 may be formed with an upper lead - in ramp 112 to aid directing the trigger into place during assembly . the upper wall 100 of the trigger 42 extends into the trigger compartment 82 to narrow the compartment to increase the likelihood that a rodent passing through the compartment will engage the trigger . as shown in fig2 , the strike member has a trigger engaging member 114 which projects from the strike member tunnel element 60 towards the trigger 42 . the trigger engaging member 114 has a horizontal wall 116 which extends from the tunnel element 60 side wall 58 towards the trigger 42 , and which joins a vertical wall 118 . the vertical wall 118 extends downwardly along the entire inside edge of the horizontal wall 116 , and extends upwardly to define a barrier wall 120 . a clearance gap 122 is thus defined between the barrier wall 120 and the trigger upper wall 100 . through this gap 122 a rodent may detect the bait 124 contained within a removable bait cup 126 , best shown in fig1 and 3 . the bait cup 126 is positioned between the tunnel element 60 and the trigger 42 . it is the bait which draws the rodent into the trigger compartment where it will not only activate the trigger , but also be best positioned for being struck in such a way as to be killed by portions of the strike member 44 . a catch 128 protrudes from the trigger lower wall 96 near the free end 130 of the trigger 42 . the free end 132 of the vertical wall 118 of the trigger engaging member 114 abuts against the trigger catch 128 , thereby holding the strike member 44 in its set position , with the tunnel element 60 extending from the trap interior 40 as shown in fig2 . in the set position , the strike member 44 is held against the force of the spring 22 which is urging the strike member towards its retracted configuration . as best shown in fig4 , the trigger engaging member 114 is principally connected to the tunnel element 60 side wall 58 by the horizontal wall 116 . an upper slot 134 and a lower slot 136 defined between the barrier wall 120 and the tunnel side wall 58 provide clearance for the upper barrier wall 78 and the lower barrier wall 50 as the strike member moves along the guide tracks 54 . the lower clearance wall 96 of the trigger is recessed back from the trigger upper wall 100 to provide clearance for the trigger engaging member 114 as the strike member moves from its set configuration to a striking engagement with a captured rodent . the strike member 44 has a vertical wall which acts as a strike plate 138 which extends in the direction of the strike member motion towards the rear of base 28 . the strike plate 138 extends the full height of the barrier wall 120 . as shown in fig3 , the strike plate 138 extends parallel to the rear barrier wall 48 but offset towards the trigger a small amount , for example about ⅛ inch . the strike plate 138 is an off - axis wall which extends towards the interior , and which is configured to strike portions of the rodent outside the tunnel element 60 when the trap 20 is triggered . the operation of the trap 20 is illustrated in fig1 and 2 . the user removes the bait cup 126 from the base 28 by rotating it to disengage the bait cup projecting flanges 140 from their engagement with the base floor 52 surrounding a bait cup opening 142 located within the trigger compartment 82 . the user then places rodent bait 124 , for example peanut butter , in the bait cup 126 , and returns it to its position within the base 28 . because the bait cup 126 is removed and introduced through the underside of the base 28 , the user need not remove the lid 36 from the trap . to set the trap , the user grips and pulls on the sidewardly projecting flanges 144 of the tunnel element 60 of the strike member 44 which are accessible exterior to the base 28 . the tunnel element 60 is thus extended to reveal the two entryways 66 and the trigger engaging member 114 is brought forward until the integral spring 108 urges the trigger 42 to engage with the trigger engaging member , and thereby hold the strike member 44 in the set position as shown in fig2 . one of the sidewardly projecting flanges 144 may have a protruding pointer 145 , as shown in fig1 , which is always positioned outside the base interior and which extends over indicia 152 placed on the platform 26 of the base alongside one of the guide tracks 54 . the indicia 152 may be molded into the base , or may be applied such as on an adhesive - backed label . the indicia include a region indicating that the trap is “ set ” as shown in fig2 , and another region , closer to the side wall 30 indicating that the trap has been activated and that a rodent has been “ caught ” as shown in fig3 . the words “ set ” and “ caught ” are spaced from each other in the axial direction of travel of the tunnel element 60 , so that when the trap is in a position with the tunnel element extracted , the pointer 145 is near the indicium “ set ”, and when the tunnel element is retracted substantially within the interior , the pointer is near the indicium “ caught ”. in the set position , the only access to the bait for a mouse 146 is through the entryways 66 and thence through a passageway 148 defined by the tunnel element 60 , the lower barrier wall 50 , the upper barrier wall 78 , the lid 36 and the interior wall 46 on the entrance compartment 80 side of the base 28 . when the mouse 146 enters the passageway 148 , it must progress through the tunnel and then make a turn into the trigger compartment 82 . as shown in fig4 , when the mouse looks into the trigger compartment the bait 124 is directly ahead , but shielded by the wall 118 of the trigger engaging member . the gap 122 presents a route to the bait 124 . as the mouse moves towards the gap 122 , it will engage against and displace sidewardly the upper wall 100 of the trigger 42 , thereby causing the trigger to pivot about the pin 86 and releasing the trigger catch 128 from the free end of the 132 of the trigger engaging member 114 of the strike member 44 . once released from the trigger , the spring 22 accelerates the strike member along the axial path defined by the guide tracks 54 towards the rear of the base 28 . as shown in fig3 , this rapid retraction of the strike member brings the vertical wall 118 and the strike plate 138 into contact with the mouse 146 and forcibly displaces it towards the rear of the base . because the mouse &# 39 ; s head was within the trigger compartment when the trigger was engaged , it is likely that the strike plate 138 will crush the torso of the mouse 146 between the strike plate 138 and the wall 48 at the rear of the base , usually causing death . the tunnel element 60 may be a little more than 3 inches long . because the mouse is partially within the trigger compartment when struck , there is adequate space within the trap to entirely contain the rodent &# 39 ; s remains so that none will project beyond the trap interior . the retracted tunnel element 60 gives an easily perceived signal to the user that a mouse has been caught . the trap 20 and the mouse therein may then be disposed of by the user without the need to ever come directly in contact with the mouse remains . it is understood that the invention is not limited to the particular construction and arrangement of parts herein illustrated and described , but embraces all such modified forms thereof as come within the scope of the following claims . | 0 |
fig1 is a flow diagram 100 showing interactions between a device 110 , a content source 112 , a speech recognition data source 114 , and a speech recognition data store 116 . when content is provided to the device 110 corresponding speech recognition data for the content is also provided , which alleviates a need for device 100 to internally generate the speech recognition data . in one embodiment , the speech recognition data associated with the content can be automatically provided without an explicit user selection . in another embodiment , an entire recognition grammar used by the device 110 , which includes the speech recognition grammar , can be generated / acquired by the content source 112 and conveyed to the speech enabled device 110 . providing a complete recognition grammar can offload a task of grammar compilation , which can be resource intensive , to the content source 112 . compiling a recognition grammar can require a list of items for the grammar be maintained by the content source 112 and / or be conveyed to the content source 112 from the device 110 . it should be appreciated that many speech enabled devices 110 can be resource limited devices , such as mobile phones and mp3 players , ill suited for a burden of generating speech recognition data and / or of compiling a recognition grammar . as shown by diagram 100 , the device 110 can convey a content request 120 to content source 112 . an optional set of speech recognition preferences 122 can also be conveyed . the content source 112 can then locate the requested content 124 . if the content is not located , an error message can be conveyed to the device 110 and the process can terminate . additionally , although not shown in diagram 100 , device 110 may have to provide authentication information before receiving content from source 112 . for example , source 112 can be a source for music downloads , where device 110 must either include a payment artifact for the requested music downloads or show proof that the requested music was previously purchased through the content source 112 . once the content source 112 locates a set of items that satisfy the request 120 , identifiers for the content item ( s ) can be conveyed 126 to a speech recognition data source 114 . each item can include multiple identifiers in one embodiment , each representing a means for identifying that content item via speech input . for example , if an item is a song , identifiers can be conveyed for the song title , for the artist name , and / or for the album name associated with the item . the speech recognition data source 114 can determine if speech recognition data for the requested content item ( s ) already exists in a speech recognition data store 116 . this determination can be made by first querying 132 the data store , which results in a query response 134 . when a pre - existing entry for an item exists , a request for the associated speech recognition data 136 can be conveyed to the data store 116 , which provides the data 138 in response . when no pre - existing speech recognition data exists for a content item , the speech recognition data source 114 can create speech recognition data 140 . created speech recognition data 140 can be conveyed 142 to data store 116 where it can be used to satisfy similar future requests thereby saving source 114 a need to create the speech recognition data each time requests are received . separate queries and process can be made for each content item , as shown by branching decision block 144 . once speech recognition data has been generated for each content item , this data can be conveyed 146 to the content source 112 . the content source 112 can then convey the content item ( s ) and the speech recognition data for the item ( s ) 148 to the device 110 . upon receipt , the device 110 can add 150 the content items to a list of available items . for example , a new music item can be added to a music player &# 39 ; s content list or the added item can simply be added to a local memory space of the device 110 . after adding the content item ( s ), the device 110 can add speech recognition data to an internal speech recognition grammar 152 and associated those grammar items with a suitable context for the content items . for instance , the device 110 can include multiple context sensitive grammars , and the speech recognition data can be added to appropriate ones of the grammars . after the speech recognition grammar has been updated , the device 110 can speech recognize input associated with the newly added content items and can perform appropriate programmatic actions upon recognizing the speech input . fig2 is a system 200 diagram showing a speech enabled device 210 able to acquire content along with speech recognition data in accordance with an embodiment of the inventive arrangements disclosed herein . specific components 110 - 116 shown in diagram 100 can be implemented in accordance with specifics detailed for corresponding components described in system 200 . for example , the device 110 can be an instance of speech enabled device 210 . in system 210 , a speech enabled device 210 can request 260 content from a content source 240 . the request 260 may or may not explicitly specify that speech recognition data is to be provided to the speech enabled device 210 depending upon implementation specifics . the content source 240 can convey identifiers 264 for the requested content to a speech recognition data source 250 . the speech recognition data source 250 can either generate speech recognition data 266 for the identifier or retrieve the data 266 from a data store 252 . the content source 240 can receive the speech recognition data 266 , which it can convey along with requested content from data store 242 to device 210 within response 262 . the device 210 can add the received content as a new content item 232 of a content data store 230 . the speech recognition data can be added to a suitable recognition grammar 228 of a grammar data store 226 . in one implementation , the response 262 can include an entire compiled speech recognition grammar 228 to be placed in the data store 226 , which includes entries for the newly acquired content as well as pre - existing entries . this alleviates a need for the device 210 to compile the recognition grammar 228 , which can be a resource intensive operation . in one configuration , the content source 240 can maintain a list in data store 242 of items to be included in the compiled recognition grammar 228 . in another configuration , a list of content items can be conveyed within the request 260 to the content source 240 . in another implementation , data store 252 can represent a data store for aggregating speech recognition data from one or more speech recognition data sources 250 able to generate this data 266 from identifiers 264 . in this way data store 252 can represent a continuously updated database of speech recognition data for identifiers 264 , which saves the contributing / accessing speech recognition data source ( s ) 250 from having to generate new speech recognition data 266 for each request 260 . in a music context , for example , the pronunciation database can quickly be populated with song title , album , artists , and genre pronunciations for popular songs . as shown in system 200 , the content source 202 can be any computing device or set of computing devices able to provide digital content to the device 210 upon request 260 . the content source 240 can , for example , be a network server . in one embodiment content source 240 can be a web server , which communicates with a browser of device 210 through standard web protocols ( e . g ., http messages ). in another embodiment , the content source 240 can be a desktop computer to which device 210 is linked , such as through a usb connection . the speech recognition data source 250 can be any computing device or set of computing devices able to provide speech recognition data 266 that is associated with a set of items 264 upon request . the speech recognition data source 250 can be implemented as a stand - alone server , as part of a cluster of servers , within a virtual computing space formed from a set of one or more physical devices , and the like . in one embodiment , functionality attributed to the speech recognition data source 250 and the content source 240 can be incorporated within a single machine . for example , an ability to generate speech recognition data 266 can be a software enhancement able to be added to a content source 240 . in another embodiment , the speech recognition data source 250 can deliver speech recognition data 266 as part of a web service . for example , the speech recognition data source 250 can be a turn - based speech recognition engine implemented as part of a middleware solution , such as websphere , which provides speech recognition data as a web service to a set of content providing web servers ( source 240 ). the speech recognition data 266 can include phonetic representations of content items , which can be added to a speech recognition grammar 228 of device 210 . the speech recognition data can conform to a variety of grammar specification standards , such as the speech recognition grammar specification ( srgs ), extensible multimodal annotation markup ( emma ), natural language semantics markup language ( nlsml ), semantic interpretation for speech recognition ( sisr ), the media resource control protocol version 2 ( mrcpv2 ), a nuance grammar specification language ( gsl ), a java speech grammar format ( jsgf ) compliant language , and the like . additionally , the speech recognition data can be in any format , such as an augmented backus - naur form ( bnf ) format , an extensible markup language ( xml ) format , and the like . different devices 210 can be designed to handle different formats of speech recognition data 266 , which can be specified in preferences conveyed within the request 260 . source 250 can tailor or customize a format of the speech recognition data 266 to interoperate with a format desired by / compatible with the request 260 issuing device 210 . additionally , the speech recognition data source 250 can optionally customize the speech recognition data 266 to speech characteristics ( e . g ., accent , dialect , gender , etc .) of a user of device 210 to improve recognition accuracy of a speech recognition engine 220 used by device 210 . user specific characteristics upon which a user specific customization is based can be conveyed within request 260 or can be maintained within a data store 242 of a content source 240 in a user specific record . the speech enabled device 210 can be any computing device able to accept speech input and to perform programmatic actions in response to the received speech input . the device 210 can , for example , include a speech enabled mobile phone , a personal data assistant , an electronic gaming device , an embedded consumer device , a navigation device , a kiosk , a personal computer , and the like . the speech enabled device 210 can include a network transceiver 212 , an audio transducer 214 , a content handler 216 , a user interface 218 , and a speech recognition engine 220 . the network transceiver 212 can be a transceiver able to convey digitally encoded content with remotely located computing devices . the transceiver 212 can be a wide area network ( wan ) transceiver or can be a personal area network ( pan ) transceiver , either of which can be configured to communicate over a line based or a wireless connection . for example , the network transceiver 212 can be a network card , which permits device 210 to connect to content source 240 over the internet . in another example , the network transceiver 212 can be a bluetooth , wireless usb , or other point - to - point transceiver , which permits device 210 to directly exchange content with a proximately located content source 240 having a compatible transceiving capability . the audio transducer 214 can include a microphone for receiving speech input as well as one or more speakers for producing speech output . the content handler 216 can include a set of hardware / software / firmware for performing actions involving content 232 stored in data store 230 . for example , in an implementation where the device 210 is an mp3 player , the content handler can include codecs for reading the mp3 format , audio playback engines , and the like . the user interface 218 can include a set of controls , i / o peripherals , and programmatic instructions , which enable a user to interact with device 210 . interface 218 can , for example , include a set of playback buttons for controlling music playback ( as well as a speech interface ) in a digital music playing embodiment of device 210 . in one embodiment , the interface 218 can be a multimodal interface permitting multiple different modalities for user interactions , which include a speech modality . the speech recognition engine 220 can include machine readable instructions for performing speech - to - text conversions . the speech recognition engine 220 can include an acoustic model processor 222 and / or a language model processor 2244 , both of which can vary in complexity from rudimentary to highly complex depending upon implementation specifics and device 210 capabilities . the speech recognition engine 220 can utilize a set of one or more grammars 228 . in one embodiment , the data store 226 can include a plurality of grammars 228 , which are selectively activated depending upon a device 210 state . accordingly , grammar 228 to which the speech recognition data 266 is added can be a context dependent grammar , a context independent grammar , a speaker dependent grammar , and a speaker independent grammar depending upon implementation specifics for system 200 . each of the data stores 226 , 230 , 242 , 252 can be physically implemented within any type of hardware including , but not limited to , a magnetic disk , an optical disk , a semiconductor memory , a digitally encoded plastic memory , a holographic memory , or any other recording medium . each data store 226 , 230 , 242 , 252 can be stand - alone storage units as well as a storage unit formed from a plurality of physical devices , which may be remotely located from one another . additionally , information can be stored within the data stores 226 , 230 , 242 , 252 in a variety of manners . for example , information can be stored within a database structure or can be stored within one or more files of a file storage system , where each file may or may not be indexed for information searching purposes . fig3 is a flow chart of a method 300 for acquiring content along with speech recognition data to a speech enabled device in accordance with an embodiment of the inventive arrangements disclosed herein . the method 300 can be performed in the context of a system 200 or similar speech recognition system . method 300 can begin in step 305 , where a speech enabled device can connect to a remotely located content source over a network . in step 310 at least one item to acquire from the content source to the speech enabled device can be selected , such as through a web browser . in step 315 , speech recognition preferences can be optionally conveyed form the device to the content source . speech recognition preferences are only needed when the speech recognition data ultimately provided to the speech enabled device is customized and / or formatted for a specific user or device . other embodiments exist , where the speech recognition data provided to the device is uniform across requesting devices , which makes caching speech recognition data more efficient . even when customized speech recognition data is required , this data need not be provided by the device in step 315 . in a different configuration , for instance , the content source or other network element can store user / device specific preferences that include speech recognition preferences . assuming a user logs into the content source or otherwise identifies themselves , it is a simplistic task to identity and match a user / device with stored preferences . in another implementation , speech preferences can be automatically extracted / determined from speech input provided by a user , which assumes that speech samples are either captured within the device and conveyed to the content source or that interactions with the content source are through a speech interface . once the content source determines an availability of the requested item ( s ), it can determine textual identifiers for the item ( s ). a textual identifier can be any identifier used to reference the content items , such as a name of the item . these identifiers can be conveyed along with any available speech recognition preferences to a speech recognition data creator , as shown by step 320 . in step 325 , a phonetic representation of the textual identifiers can be generated / received . in step 325 , the phonetic representation can be written to a speech recognition data file in a device compatible format . this data file can be conveyed to the content requesting device along with the content items in step 335 . in step 340 , the speech recognition data can be added to a recognition grammar of the speech enabled device and the content items can be added to a device memory . in step 345 a speech command for an operation involving one of the new content items can be received . in step 350 , this speech command can be speech recognized by a speech recognition engine of the device . a programmatic action can execute based upon the speech recognized command that involves the content item . the present invention may be realized in hardware , software or a combination of hardware and software . the present invention may be realized in a centralized fashion in one computer system or in a distributed fashion where different elements are spread across several interconnected computer systems . any kind of computer system or other apparatus adapted for a carrying out methods described herein is suited . a typical combination of hardware and software may be a general purpose computer system with a computer program that , when being loaded and executed , controls the computer system such that it carries out the methods described herein . the present invention also may be embedded in a computer program product , which comprises all the features enabling the implementation of the methods described herein , and which when loaded in a computer system is able to carry out these methods . computer program in the present context means any expression , in any language , code or notation , of a set of instructions intended to cause a system having an information processing capability to perform a particular function either directly or after either or both of the following : a ) conversion to another language , code or notation ; b ) reproduction in a different material form . | 6 |
the present invention is a multilevel data encoding and modulation technique for the transmission of digital data either over a transmission line or by wireless transmission . fig1 a shows an exemplary baseband signal 12 a encoded according to the technique of the present invention . as used herein , the term baseband signal refers to a signal of single frequency in the range from zero hertz upward , which has not been modulated onto a carrier . fig1 a shows a sample bit stream , or data stream , in this case the binary stream 1100101001 , encoded according to the technique of the present invention . fig1 b – 1d show the same binary stream encoded according to three multilevel encoding schemes known in the art for comparison purposes , resulting in the corresponding encoded signals 12 b , 12 c , and 12 d , respectively . the multilevel encoding technique of the present invention utilizes two pairs of complementary line or logic levels . in the most basic implementation , each pair of complementary line levels consists of a binary set of logic levels , having a first logic level corresponding to a mark , or binary 1 , and a second logic level corresponding to a space , or binary 0 , for a total of four distinct logic levels . as shown more clearly in fig2 , the logic level spectrum has a median level 14 ( labeled “ skew - level ” in fig2 for a purpose described below ). in a recommended implementation of the technique of the present invention , the space in the first pair 16 of complementary logic levels is offset from the median in a positive direction by a slight magnitude , while the mark is offset from the median by a more strongly positive magnitude . preferably the mark is offset from the median by twice the magnitude of the offset of the space , or other integral proportional ratio , although this is not required . by contrast , the space in the second pair 18 of complementary logic levels is offset from the median in a negative direction by a slight magnitude , while the mark is offset from the median by a more strongly negative magnitude . the logic levels will usually be the amplitude or voltage of the signal , although conceptually the logic levels may refer to variations of frequency about a median frequency . the present invention may be implemented using bipolar devices wherein the median logic level 14 would be equivalent to a ground potential . the present invention may also be implemented using monopolar device such as fiber optic and other transmission media incapable of reversing the polarity of the signal 12 a about ground by applying a bias potential thereby raising the negative range to or just above the zero level . in the encoding technique of the present invention , the bits in the input bit stream are divided into odd - numbered bits and even - numbered bits , so that the first bit in the stream is an odd bit , the second bit is an even bit , the third bit is an odd bit , etc . it is a rule of the encoding technique of the present invention that the odd - numbered bits is associated with one pair of complementary logic levels , while the even - numbered bits are associated with the other pair of complementary logic levels . in the drawings , the odd - numbered bits are associated with the first , or positive , pair 16 of mark and space levels , while the even - numbered bits are associated with the second , or negative , pair 18 of mark and space levels , although the reverse convention is equivalent and within the scope of the present invention . thus , in fig2 a negative mark or space never appears above an odd - numbered bit ( symbolized by the letter o between the scale ticks on the time axis ), and a positive mark or space never appears above an even - numbered bit ( symbolized by the letter e between the scale ticks on the time axis ). referring back to fig1 a , it will be seen that since the first bit in the binary stream 1100101001 is a binary 1 , the signal 12 a is encoded with a positive mark . the second bit is also a 1 , and since the bit is even numbered , the signal 12 a is encoded with a negative mark . the third bit is a 0 , and since the bit is odd - numbered , the signal 12 a is encoded with a positive space , etc . each bit has alternating polarity so that the frequency of the signal 12 a is constant , although the amplitude of the bits varies . by contrast , fig1 b shows the same bit stream encoded with a conventional quaternary technique in which the period of each bit is the same as in signal 12 a , but each bit encodes two bits of data instead of one , so that the resulting signal 12 b has the same symbol rate as signal 12 a , but transmits information at twice the rate as signal 12 a . thus the first two digits of the input data stream , 11 , are encoded by the uppermost logic level , the next two bits , 00 , are encoded by the lowest logic level , the third pair of bits , 10 , are encoded by the upper one of the two intermediate levels , etc . the plateau in signal 12 b opposite logic level “ 10 ” should be compared to the same bits as they are encoded in signal 12 a . the flat plateau in signal 12 b at logic level “ 10 ” encodes the sequence 1010 . this plateau , in essence , doubles the period of the mark , and means that signal 12 b encompasses a range of frequencies , thereby increasing the bandwidth of frequencies transmitted compared to signal 12 a . if enough binary “ 10 ” pairs appear in succession , the receiver may interpret the plateau as a d . c . voltage level , thereby resulting in a bit error . alternatively , if a binary “ 10 ” in the input stream is either immediately preceded by or followed by a binary “ 11 ”, the transition between symbol logic levels is low compared to signal 12 a , leading to poorer discrimination in logic levels . fig1 c illustrates another quaternary level encoding technique of the prior art in which the same input bit stream is encoded at the same information rate as signal 12 a . it will be apparent by inspection that the period of each logic level in signal 12 c is twice that of signal 12 b , so that the frequency , and hence the bandwidth , is half that of signal 12 b . the same observations with respect to the comparison of signal 12 b with 12 a apply here , i . e ., the signal 12 c encompasses a range of frequencies , the receiver may interpret a plateau in the signal 12 c as a d . c . voltage , and transitions between successive symbol states or logic levels may be so short that discrimination in the receiver is poor . fig1 d shows a ternary level signal according to an encoding technique conventionally known as alternate mark inversion . in this technique a space is always at the median level 14 and alternating marks have their polarity inverted . while this technique exhibits a sharp transition between mark and space , and between consecutive marks , consecutive spaces are at the same logic level with resulting plateaus . consequently this technique also suffers from a range of frequencies in the encoded baseband signal 12 d , as well as poor discrimination from d . c . caused by extended plateaus in the signal 12 d . the alternating polarity of the signal 12 a encoded according to the present invention ensures that the encoded baseband signal 12 a is constant in frequency . since the frequency is constant , it is unnecessary to transmit a range of frequencies , thereby conserving bandwidth . the theoretical bandwidth of a signal encoded according to the multilevel data encoding and modulation technique of the present invention is thereby minimized to a single frequency which is half that of the frequency of the encoded data . as a practical matter , the bandwidth will be limited by the quality of the transmission medium and filtering devices . this efficiency of bandwidth utilization permits multiple signals to be transmitted in the bandwidth which would otherwise be occupied using conventional encoding techniques . for example , a 500 bps ( bits per second ) signal could be transmitted at 250 hz , while simultaneously a 498 bps signal is transmitted at 249 hz , a 496 bps signal is transmitted at 248 hz , etc . the encoding technique of the present invention may be further combined with other developing techniques , such as dense wave divided multiplexing ( dwdm ), to achieve increases in throughput which are three to six orders of magnitude higher than existing technologies . fig3 illustrates a five level encoding technique , which i refer to as quinque - synch modulation ( qsm ) ( qsm is used loosely to refer to either a four level or five level signal encoded according to the present invention , although quinque is derived from the latin word for “ five ”). the fifth logic level in qsm is at the median logic level 14 , and is referred to as the skew - level . according to the technique of the present invention , the skew - level is used to slightly shift the frequency of the output bit stream by stuffing bits into the bit stream at predetermined intervals . as shown in fig3 , the preferred method requires two skew bits 20 separated by one or more 22 mark logic levels . by being able to skew the frequency of the output bit stream , multiple bit streams may be added to a single transmission medium , each bit stream having its own monofrequency timing ( mft ). in addition , by virtue of the fact that mark bits represent the maximum voltage excursion in either the positive or negative direction , skew - level implementation provides means to implement automatic gain control ( agc ) on the receive side to ensure consistent level discrimination . fig4 shows a block diagram of a data transmission system for carrying out the multilevel data encoding and modulation technique of the present invention . a conventional data terminal equipment device ( dte not shown ), e . g ., a computer , supplies one or more bit streams 24 as input to the system . if frequency division multiplexing ( fdm ) or time division multiplexing ( tdm ) is used with the data encoding technique of the present invention , a plurality of input bit streams 24 will be supplied to an asynchronous framing module ( afm ) 26 to frame the bit streams using conventional multiplexing techniques . the amplitude modulator and polarity inverter 28 , receiving input from either the afm 26 or directly from an input bit stream 24 , splits the incoming bit stream into even - numbered and odd - numbered bits . the voltage level of each output bit is offset according to its logic level and the even - numbered bits are inverted into the opposite polarity from the odd - numbered bits . the levels may be a mark and space in a simple binary encoding scheme , or may be multiple levels in a tokenized encoding scheme where two or more bits are encoded in a single timing interval . frequency skewing the signal for fdm implementation may be performed on the bit stream prior to the amplitude modulator and polarity inverter 28 or as part of this step as described in the discussion above relative to qsm and fig3 . the two opposing polarity bit streams are then recombined to form a single encoded bipolar baseband signal 12 a , which is fed into a narrow band filter 30 which removes all odd harmonics from the square wave signal to form a sinusoidal waveform of fundamental frequency . the sinusoidal waveform is transmitted through the transmission media 31 , which may be fiber optic cable , microwave radio , copper wire , or other data transmission media as known in the communications art . when the remote receiver receives the signal from the transmission media , the signal is processed by a narrow band filter 32 to remove noise and to ensure that only the frequency of interest is demodulated and decoded . if the baseband data had been multiplexed using fdm , the filter 32 provides frequency isolation from the fdm aggregate . fig5 a shows a representative waveform 36 after processing the bit stream 12 a shown in fig1 a by the filter 32 . the filtered signal 36 shown in fig5 a is then processed by a bit recovery module 34 to recreate the original signal by correlating a preceding decoded bit value with the absolute value of the voltage gain 38 between adjacent half - cycle peaks according to table 1 . table 1 is straightforward and may be easily interpreted by one skilled in the art . for example , referring to the first row , if the previous bit had a value of binary 1 ( a mark ), and the magnitude of the voltage change from the previous half - cycle peak to the current half - cycle peak ( of the opposite polarity ) 38 is two times the absolute value of the voltage offset 40 of a binary 1 measured from the median 14 , then the current bit has a value of binary 1 ( a mark ). the remaining rows are interpreted in similar fashion . table 1 may be easily extrapolated to include multilevel encoding schemes such as the signal 12 b shown in fig1 b . it will be noted that the absolute gain always has a magnitude greater than the offset of a space from the median 14 and that the polarity of the received signal always alternates with successive bits . the combination of these two factors combine to provide improved discrimination of mark and space , thereby improving noise and interference immunity . if multiplexing is utilized , the output of the bit recovery module 34 is processed by an afm 44 which removes skew bits if introduced by the afm 26 and demultiplexes the signal to fan out a plurality of output signals 46 identical to the input signals 24 ; otherwise the bit recovery module 34 outputs a single signal identical to the input signal . the filtered signal 42 shown in fig5 b represents the waveform generated as a result of the bit stream with skew bits implemented as shown in fig3 . for wireless transmission , the system may use conventional techniques for modulating the output of the narrow band filter 30 onto a carrier frequency by amplitude modulation , frequency modulation , phase modulation , and other conventional modulation techniques . it is to be understood that the present invention is not limited to the sole embodiments described above , but encompasses any and all embodiments within the scope of the following claims . | 7 |
neural interfaces are implanted within the nervous systems of animals and humans to record , stimulate , and treat neural tissue activity . typically , this occurs within animal research of a variety of fields ( e . g . neurological disorders and basic nervous system function ) as well as clinical diagnosis and therapy ( e . g ., epilepsy ). neural interfaces are implanted through a variety of methods , and are held during insertion by a variety of means including vacuum , mechanical lock , adhesive , dissolvable adhesive , and momentary impulse contact . the most pervasive form of holding microscale devices for insertion is a stiff engagement of some kind with a separate device such as a micro - positioner . it can be advantageous as it keeps delicate microscale devices stiff during insertion into dynamic tissue and allows a range of insertion speeds . impulse insertion is also popular for microscale devices with large number of shanks . impulse inserters are most commonly formed from metal and polymer components and powered using pneumatics . the procedure of impulse insertion positions a cabled microscale device over targeted tissue . the impulse inserter is then placed over the microscale device . the impulse inserter then receives a pneumatic pulse that actuates the insertion mechanism , striking the microscale device at a high rate of speed and sending it into the neural tissue . unfortunately , the impulse process requires a high degree of skill to position the microscale device and impulse inserter as well as actuate the inserter at the appropriate time . the average researcher is incapable of using the technique without significant training and often relies on an outsider with special expertise in impulse insertion . mechanically locked insertion is a poor solution for implanting microscale devices for chronic experiments or periods . microscale devices meant for chronic implantation often have cables to implanted structures . these cables are both delicate and resilient ; they are easy to plastically deform to the point of damage , and if deflected too far during insertion can apply a residual force on the implanted microscale device , resulting in damage to tissue over time . basic assembly to microscale devices with cables is also challenging during surgeries as the cables leading out of microscale devices terminate in large connectors which are affixed to tissue ; the microscale devices are then adjusted with small deflections of the cable until positioned over the target tissue . this process leaves little room for additional deflection of the cable , increasing the requirement for flexibility of the insertion device or insertion technique . these limitations prevent the implantation of chronic neural interfaces in a wide variety of situations . this reduces the amount of data acquired as well as limiting current and future therapies . current insertion techniques also limit the visibility of the electrode for the researcher . accordingly , in some embodiments , disclosed herein is an insertion and extraction device that manipulates micro - scale devices , and provides unlimited degrees of freedom for placing and removing micro - scale devices . in some embodiments , the insertion and extraction device may have a tensional hook for engaging with micro - scale devices . it can also be advantageous to have a tensional loop . by using a loop , the corresponding hook on an implanted micro - scale device might be easier to extract after a lengthy implantation that encapsulated the device in tissue . in some embodiments , the insertion and / or retraction device may have a spring and dampening system to compensate for deflection of tissue during respiration . in other embodiments , the insertion and / or retraction device is actively positioned to follow the motion of tissue . in some embodiments , the insertion and / or retraction device uses a computer to monitor the motion of the tissue and adjusts the speed and deflection of the mechanical device accordingly within a closed loop feedback system . an insertion and / or retraction device capable of interfacing with a flexible baseplate ( e . g ., joining body ) can also be advantageous in some embodiments as it allows customization of placement within the nervous system and increased conformity to anatomical variations for research and clinical applications . in some embodiments , the joining body is configured to be flexible enough to bend around the outer curvature of neural tissue ( e . g ., sulcus surface of cortex , circumference of a nerve , or surface of a plexus ). in some embodiments the joining body is configured to be flexible enough to bend with the motion of neural tissue due to respiration or containing body acceleration and deceleration . in some embodiments , disclosed herein is an insertion and / or retraction device to manipulate various devices , including but not limited to implantable medical devices . the device to be inserted and / or removed can be a micro - scale device in some embodiments , but is not necessarily limited to devices to be inserted and / or retracted of a particular size . in some embodiments , the devices to be inserted and / or removed with systems and methods as disclosed herein can have a device total volume of about or less than about , for example , 100 mm 3 , 50 mm 3 , 25 mm 3 , 10 mm 3 , 5 mm 3 , 2 mm 3 , 1 mm 3 , 0 . 5 mm 3 , 0 . 25 mm 3 , 0 . 1 mm 3 , 0 . 05 mm 3 , or less . in some embodiments . the device to be inserted and / or removed could be , for example , an implantable neural interface device . in some embodiments , the device to be inserted has dimensions of about 1 mm × 1 mm × 1 mm or smaller . neural interface devices as referred to herein could involve brain or spinal cord devices , but also peripheral nerve devices including sympathetic and parasympathetic nerves , as well as devices that monitor and / or treat cardiac and other tissues . the insertion and / or retraction device can interface with various types of micro - scale devices , including but not limited to neural interfaces that act as recording or stimulation electrodes , optical fibers , or as hollow tubes for media , e . g ., fluid delivery . in other embodiments , the insertion and / or retraction device can interface with biological sensors or stimulators for placement within organisms . in still other embodiments , the insertion and / or retraction device can interface with sensors or stimulators for placement within organisms . in some embodiments , the insertion and / or retraction device can interface with micro - scale devices for placement within movably positioned sheets , gels , foams , liquids , soil , artificial organisms , organic material , composites , mixtures , and other shapes of substrate . in other embodiments , the body of the insertion and / or retraction device can be shaped into advantageous configurations for manipulation and various treatment modalities including recording , stimulating , magnetic stimulation , magnetic monitoring , fluid delivery , temperature control , optical stimulation , optical monitoring , video monitoring , and chemical irrigation of neural tissue . in some embodiments , the body that includes the tether could also serve as a delivery device for a drug , such as an antithrombotic agent , an antibiotic , an anti - inflammatory , an anti - epileptic , viral vectors , or a chemotherapeutic agent , for example . in some embodiments , the insertion and / or retraction device can place an implantable neural or non - neural interface device within any tissue within the body dependent upon the desired research or clinical result ; including nervous , muscle , connective , epithelial , cardiac , lung , renal , gastrointestinal , and bone tissues . in some embodiments , the tissue is a body lumen , such as within a lumen or luminal wall of an artery or vein for example . in some embodiments , the tissue is not within a lumen and / or luminal wall . in some embodiments , an insertion device can also be used as a retraction device , and a retraction device can also be used as an insertion device . however , in some embodiments , a first device can be used for insertion , and a second device can be used for retraction . the first device and the second device can be the same or substantially the same size , shape , etc . as each other , or be different in other embodiments . in some embodiments , the device to be inserted or retracted have a compressed or low - crossing profile configuration for delivery and removal and an expanded configuration when implanted in the body . in some embodiments , the device to be inserted or retracted has the same configuration for both delivery , removal , and when implanted in the body . in some embodiments , the insertion and / or retraction device can be interfaced with the implantable neural interface device to diagnosis and / or treat epilepsy , a movement disorder ( e . g ., parkinson &# 39 ; s disease ), a psychiatric disorder ( e . g ., clinical depression ), the result of a stroke , alzheimer &# 39 ; s disease , a cognitive disorder , an anxiety disorder , an eating disorder , an addition or craving , restless leg syndrome , a sleep disorder , tourette &# 39 ; s syndrome , a stress disorder , coma , autism , a hearing disorder , a vision disorder , blindness , retinal degeneration , age related macular degeneration , cortical injury , optic nerve injury , dry eye syndrome , a speech disorder , amblyopia , headaches , temporomandibular joint disorder , pain ( e . g ., phantom limb pain and chronic pain ), urinary incontinence , erectile dysfunction , bone disease , arthritis , tendonitis , the result of ligament or tendon damage , and paralysis ( e . g ., facial nerve paralysis and spinal paralysis ). in some embodiments , the device system can be used to provide control of a prosthetic such as a limb or an external computer . in some embodiments , the device system may wirelessly communicate with a system that is connected to a network or cloud of data . in other embodiments , the device system is connected to a biological interface to monitor tissue . in some other embodiments , the device system is connected to a biological interface to modulate tissue . in still other embodiments , the device system is connected to a biological interface to monitor and modulate tissue . in other embodiments , the biological interface can include an implantable camera . in other embodiments , the device system can insert and / or retract a biological interface to study , diagnose , and / or treat cardiovascular conditions such as heart failure , rheumatic heart disease , hypertensive heart disease , ischemic heart disease , angina , coronary artery disease , cerebral vascular disease , stroke , atherosclerosis , cerebrovascular disease , cardiomyopathy , pericardial disease , valvular heart disease , inflammatory heart disease , congenital heart disease , and peripheral arterial disease . in still other embodiments , the device system can insert and / or retract a biological interface to study , diagnose , and / or treat cancers , including leukemia , lymphoma , myeloma , bladder cancer , lung cancer , brain cancer , melanoma , breast cancer , non - hodgkin lymphoma , cervical cancer , and ovarian cancer . in other embodiments , the device system can insert and / or retract a biological interface to study , diagnose , and / or treat type 1 and type 2 diabetes . in some embodiments , the device system can include a biological interface to study , diagnose , and / or treat orthopedic conditions , including osteoarthritis , rheumatoid arthritis , bone fractures , lower back pain , neck pain , and a herniated disk . in other embodiments , the device system can insert and / or retract a biological interface to study , diagnose , and / or treat eye conditions , including glaucoma , cataracts , age - related macular degeneration , amblyopia , diabetic retinopathy , retinal detachment , retinal tearing , and dry eye syndrome . in still other embodiments , the device system can insert and / or retract a biological interface to study , diagnose , and / or treat hearing conditions , including hearing loss , meniere &# 39 ; s disease , malformation of the inner ear , autoimmune inner ear disease , tinnitus , and vertigo . in other embodiments , the device system can insert and / or retract a biological interface to study , diagnose , and / or treat tactile disorders , including impaired sensitivity to pressure applied to the skin , elevated two - point discrimination thresholds ( i . e . impaired spatial acuity ), loss of vibratory sense , and deficits in proprioception . in other embodiments , the device system can insert and / or retract biological interface to study , diagnose , and / or treat taste , taste impairing conditions , smell , and smell impairing conditions . in still other embodiments , the device system can be movably engaged within one , two , or more body tissues , regions , or organ systems including but not limited to the scalp , skin , muscle , bone , neural tissue , heart , lungs , trachea , bronchi , diaphragm , liver , pancreas , kidneys , bladder , urethra , spleen , esophagus , stomach , intestine , penis , testes , uterus , or ovary . in some embodiments , the insertion or removal tool need not necessarily be located within a body lumen , and can be used , for example , outside of a blood vessel such as an artery or the vein . in some embodiments , about or at least about 50 %, 60 %, 70 %, 80 %, 90 %, or more of a length of the insertion and / or removal tool is outside of the body or a body lumen such as a blood vessel during the insertion or removal process . in some embodiments , systems and methods as disclosed herein can modulate neural tissue , and have a stimulatory or inhibitory effect . neural tissue is specialized for the conduction of electrical impulses that convey information or instructions from one region of the body to another . about 98 % of neural tissue is concentrated in the brain and spinal cord , which are the control centers for the nervous system . neurons transmit signals as electrical charges which affect their cell membranes . a neuron has a cell body ( soma ) that contains a nucleus . the stimulus that results in the production of an electrical impulse usually affects the cell membrane of one of the dendrites , which then eventually travels along the length of an axon , which can be a meter long . axons are often called nerve fibers with each ending at a synaptic terminal . neuroglia are cells of the cns ( central nervous system ) and pns ( peripheral nervous system ) that support and protect the neurons . they provide the physical support for neural tissue by forming myelin sheaths , as well as maintaining the chemical composition of the tissue fluids and defending the tissue from infection . schwann cells are specialized pns cells that form myelin sheaths around neurons . neurons ( nerve cell ) include a cell body that contains the nucleus and regulates the functioning of the neuron . neurons also include axons that are cellular process ( extension ) that carry impulses away from the cell body . neurons also include dendrites that are cellular process ( extension ) that carry impulses toward the cell body . a synapse is a space between axon of one neuron and the dendrite or cell body of the next neuron — transmits impulses from one neuron to the others . neurotransmitters are chemicals released by axons and transmit impulses across synapses . in some embodiments , provided is a closed loop control system for stimulating and monitoring neural activity . to meet this objective , microfilaments are embedded in various body configurations with six degrees of freedom to provide many system options for interacting with neural tissue . as an example , this would enable the data collected from a first recording microfilament ( or external source ) to help guide the output of a second stimulating microfilament . the approximate diameter of circular microfilaments for conducting electrical current is between 1 μm and 250 μm , such as no more than about 25 μm , 50 μm , or 75 μm . for electrical stimulation , larger sites up to 50 μm would be advantageous to achieve surface areas that meet useful stimulation current requirements without a coating . the approximate diameter of circular microfilaments for conducting or monitoring light is between is 0 . 1 μm to 250 μm , such as no more than about 25 μm , 50 μm , or 75 μm . the approximate diameter of circular microfilament tubes for delivering or circulating gases , fluids , and mixtures in some embodiments is between 1 μm to 100 μm , or no more than about 50 μm , 75 μm , 100 μm , or 150 μm . microfilaments can also be placed within a packed geometry that allows for a tapering of the penetrating area cross sections to reduce the cross sectional area and thus long term adverse neural tissue response . in some embodiments , the microfilaments can extend outward from the body &# 39 ; s surface ; these sites can be formed ( e . g ., bent or flattened ) to provide desired functional characteristics . the array body can take multiple forms including penetrating structures with microfilament sites and joining sections to optimize placement within the nervous system . an approximate cross sectional area of a penetrating array body in some embodiments is 1 μm 2 to 0 . 2 mm 2 , preferably up to approximately 7850 μm 2 . for large area coverage as in electrocorticography , larger body areas up to approximately 100 cm 2 or more would be advantageous to collect more data from the outer surface of a neural tissue section . in some embodiments , insertion and / or retraction devices can be used to insert or remove neural interface devices such as those disclosed in u . s . pat . no . 9 , 095 , 267 to halpern et al ., which is hereby incorporated by reference in its entirety . the array body can also take on non - linear shapes , which allow novel insertion techniques into difficult areas to access within surgery . a curved shape can be rotated into position where a linear angle of attack is unavailable . the array body can also have a curve located at different positions ( e . g ., proximal , midportion , or distal ) to aid in anchoring to neural tissue or bone , while there may be a linear segment distal to , and / or proximal to the curved segment . one advantage of the insertion and / or retraction device in some embodiments is the wide range of materials and components available to improve insertion conditions and long term performance of a microscale device within a nervous system . the components of the device can be formed from , for example , one , two , or more of gold , platinum , platinum iridium , carbon , stainless steel , steel , titanium , niobium , aluminum , conductive polymers , polymers , ceramics , organic materials or any other material depending on the desired clinical result . a three - dimensional view of an example of an insertion and / or retraction device 50 is shown in fig1 . some embodiments of the device 50 can include , for example , a tether 120 , and a continuous body 105 surrounding all or a portion of the tether 120 . the continuous body can have a width of , for example , between about 5 μm and 100 μm , or no more than about 500 μm , 1000 μm , 1500 μm , 2000 μm , 2500 μm , 5000 μm , 7500 μm , or 10 , 000 μm . the continuous body can also have a length of between about 1 mm and 10 mm , or no more than about 25 mm , 50 mm , 75 mm , 100 mm , or 200 mm . in some embodiments , the tether 120 includes an engagement hook 130 at one end for engagement with microscale devices . in still other embodiments , an engagement loop could be positioned at one end , the tether can be integrally formed , or formed as part of a plurality of bodies joined together , so long as it is physically continuously connected together as a whole . in some embodiments , a device 50 could include an adjustable hook that can be movable to create different sized openings for engagement . in still other embodiments , the distal end of the device 50 can be shaped to provide stiffness to a flexible or hinged microscale device . in some embodiments , the continuous body 105 can be an elongate tubular member , and / or be assembled to a robotic manipulator that adjusts position based upon the movement of the targeted tissue . in still other embodiments , a control knob 180 with tracking pin feature 182 or other feature such as a wheel , lever , or the like can , for example , slide and rotate between the slot 184 communicating with or near the proximal end of the device and the tension stop 186 that relax and tension the tether 120 respectively . in some embodiments , the elasticity of the tether 120 allows for a degree of stretch sufficient for the user to pull the control knob 180 back against before rotating to a new position and allowing it to rest in a slot or track 184 . in some embodiments , the slot or track 110 and / or the slot or track 184 has an axial length that is between about 1 % and 50 %, such as between about 1 % and 20 %, or between about 1 % and 10 % of the axial length of the continuous body 105 , or in some embodiments about or less than about 50 %, 40 %, 30 %, 20 %, 10 %, 5 %, or less , or ranges encompassing any two of the foregoing percentages . in other embodiments , a flap 140 can have a shape that is easier to grab by tweezers or other implements . in some other embodiments , the end effector 130 can have an automated mechanism to grab a microscale device . in still other embodiments , near the distal end of the continuous body 105 can be shaped to engage with microscale devices of different shapes . in some other embodiments , the width of the end effector can be between about 1 μm and 50 μm , or no more than about 100 μm , 500 μm , 1000 μm , 1500 μm , 2000 μm , 2500 μm , 3000 μm , or 5000 μm . in still other embodiments , the width of the opening of the end effector can be between about 1 μm and 50 μm , or no more than about 100 μm , 500 μm , 1000 μm , 1500 μm , 2000 μm , 2500 μm , 3000 μm , or 5 , 000 μm . in other embodiments , the width of an automated end effector can be between about 1 μm and 50 μm , or no more than about 100 μm , 500 μm , 1000 μm , 1500 μm , 2000 μm , 2500 μm , 3000 μm , or 5000 μm . in still other embodiments , the continuous body can be shaped to encourage the sliding of the tether 120 when it is movably displaced . in some other embodiments , the cross - section of tether 120 can have a shape that prevents some rotations within the continuous body 105 . in other embodiments , the end effector can be any desired shape , including a shape that is threaded through an aperture on a micro - scale device . in still other embodiments , the tether can be elastic or inelastic . in some other embodiments , the aperture of the microscale device can be elastic or inelastic . in some embodiments , the tether has sufficient column strength to push the device to be inserted or removed distally . in other embodiments , an automated or non - automated end effector can operably engage and disengage with movable jaws , a movable clamp , a movable multi - headed hook , a movable anchor , a vacuum , a movable air nozzle , a movable cable , a movable loop , a movable net , a movable cup , a movable collet , a movable snake ( e . g ., an articulating flexible member , akin to a flexible endoscope or device used to unclog pipes ), a movable coil , a movable barb , a movable snap - fit arm , a movable prong , a movable sheet , a movable strap , a movable threaded rod , a movable threaded hole , a movable anchor , a movable rod , a movable magnet , and a movable nozzle that dispenses dissolvable material . fig1 shows an isometric view of an insertion device 50 with a tether 120 housed within , and completely or partially encircled by the continuous body 105 , which can be a tubular member within a central lumen configured to house the tether 120 as shown . the distal end of the tether 120 can be looped around / tied to an aperture near the proximal end of the end effector 130 as shown . the flap 140 can extend radially outwardly of a slot 110 extending proximally a distance from the distal end of the sidewall of the continuous tubular body 105 . the proximal end of the tether 120 joined by a mechanical lock 122 to the control knob 180 partially housed by the continuous body 105 . the control knob 180 has a tracking pin 182 that slides within track 184 extending distally a distance from the proximal end of the sidewall of the continuous tubular body 105 . the slot 110 can be circumferentially in line with , or circumferentially offset from the slot or track 184 in some embodiments . the tracking pin 182 can be movably positioned to rest in tension stop 186 to apply tension to tether 120 . fig1 a illustrates an isometric view of an insertion device 50 with a tether 120 housed within , and encircled by the continuous body 105 , which can be a tubular member within a central lumen configured to house the tether 120 as shown . the distal end of the tether 120 can be looped around / tied to an aperture near the proximal end of the end effector 130 as shown . the isometric view shows a tether 120 with wall thicknesses between about 1 μm and 25 μm , or no more than about 50 μm , 75 μm , 100 μm , 150 μm , 250 μm , 500 μm , 1000 μm , or 2000 μm in some embodiments . a pair of tweezers 150 , jaws , or other tool are guiding an end effector , e . g ., engagement hook 130 by grasping a hook flap or tab 140 , which can extend laterally from the body of the engagement hook 130 as shown , or at other desired locations . the flap 140 can extend radially outwardly of a slot 110 extending proximally a distance from the distal end of the sidewall of the continuous tubular body 105 . beneath the insertion device distally is a microscale device 160 with shanks 164 extending substantially orthogonal to a baseplate 161 and suspended by its cable 162 above target tissue 170 . the baseplate 161 has a loop 165 that can be integral to the baseplate or joined to its surface . fig1 b illustrates an isometric view of an insertion device with the end effector , e . g ., engagement hook 130 engaged with a microscale device 160 and tensioned against the distal end of a continuous body 105 . the engagement hook flap 140 extends radially outwardly of slot 110 . in other embodiments the end effector could take the form of a multi - headed hook , a magnet , a vacuum nozzle , a bayonet lock mechanism , a snap fit mechanism , a press fit , and a shape for threading through an aperture on a micro - scale device for example . fig1 c illustrates an isometric view of the insertion device 50 of fig1 engaged with a microscale device 160 that has been inserted into tissue 170 . fig1 d illustrates an isometric view of the insertion device 50 of fig1 engaged with a microscale device 160 that has been inserted into tissue 170 . tweezers 150 grasping hook flap 140 are disengaging engagement hook 130 from a loop or other hook - engaging element on , e . g ., the proximal end of the microscale device 160 in preparation for removal of the insertion device 50 . fig1 e illustrates an isometric view of an insertion device 50 retracted from , and disassociated with a microscale device 160 inserted in tissue 170 . the steps illustrated in fig1 b - 1e could be performed in reverse order to retract a microscale device 160 previously inserted within tissue . fig2 illustrates a side view of the distal end of an insertion device 200 above a microscale device 250 with an engagement loop 252 configured to reversibly attach to an end effector of the insertion device . in some embodiments , the device 200 includes a pivotable engagement hook 230 and a guide rod 220 having a distal end connected to the pivotable engagement hook 230 . the engagement hook 230 has fixed jaws as shown , although movable jaws are possible in other embodiments . in other embodiments the engagement hook could take the form of , for example , a four bar linkage , a sliding component , grasping jaws , a multi - headed hook , a magnetic lock , a vacuum head , a bayonet lock mechanism , a snap fit mechanism , an actuated press fit , and an articulated snaking mechanism . fig2 a illustrates a side view of the insertion device 200 of fig2 with a pivotable engagement hook 230 engaged with an engagement loop 252 due to the displacement of guide rod 220 . fig2 b illustrates a side view of the insertion device 200 of fig2 with an engagement hook 230 on a pivot and engaged with an engagement loop 252 . in some embodiments , a guide rod 220 has retracted an inner housing 210 , such as an inner tubular member , to tension a microscale device 250 against the distal end of the insertion device 200 ( e . g ., the distal end of the continuous body outer housing ). in some embodiments , the microscale device 250 could be flexible . in still other embodiments , the microscale device could include a single shank . in other embodiments , the microscale device could be a device that emits energy , including light and / or magnetic fields . fig3 illustrates a side view of an insertion device 300 with a tether member 310 encircled within a lumen of the continuous body 305 . the side view shows tether 310 with thicknesses between about 1 μm and 25 μm , or no more than about 50 μm , 75 μm , 100 μm , 150 μm , 250 μm , 500 μm , 1000 μm , or 2000 μm in some embodiments . an end effector , e . g ., engagement hook 320 is connected near its proximal end via an aperture or other connection to the distal end of the tether 310 , such as via a loop in the tether . the insertion device 300 is shown extended above a microscale device 360 suspended by its cable 365 . in some embodiments , microscale device 360 can be without a cable 365 . fig3 a illustrates a side view of the insertion device 300 of fig3 with a tether 310 encircled by , and the distal end of the tether 310 is extending distally with respect to the continuous body 305 . the side view shows a pair of tweezers 350 , jaws , or other tool grasping a hook flap or tab 330 which can extend laterally from the body of the engagement hook 320 as shown , or at other desired locations and guide an engagement hook 320 . the tool 350 can actuate the tab 330 in a desired direction in order to move the engagement hook 320 in an appropriate direction . beneath the insertion device is a microscale device 360 suspended by or otherwise attached to its cable 365 . in some embodiments , the microscale device 360 has hinges 370 for flexibility . fig3 b illustrates a side view of the insertion device 300 of fig3 with a tether 310 encircled by a continuous body 305 . the side view shows an engagement hook 320 inserted within engagement loop 380 , aperture , or other complementary connector on the microscale device 360 , such as on a proximal baseplate of the microscale device 360 . a tether 310 can tension the microscale device 360 against the distal end of continuous body 305 . in some embodiments , the distal end of the continuous body 305 engages the hinges 370 of the microscale device , stiffening the microscale device 360 for insertion into tissue . in still other embodiments the distal end of the continuous body 305 has bosses that insert into holes in a flexible microscale device . in other embodiments , the insertion device mechanically stiffens the microscale device by engaging it from one or more sides . in still other embodiments the insertion device uses a vacuum or magnetic attraction to engage a microscale device . although certain embodiments of the disclosure have been described in detail , certain variations and modifications will be apparent to those skilled in the art , including embodiments that do not provide all the features and benefits described herein . it will be understood by those skilled in the art that the present disclosure extends beyond the specifically disclosed embodiments to other alternative or additional embodiments and / or uses and obvious modifications and equivalents thereof . in addition , while a number of variations have been shown and described in varying detail , other modifications , which are within the scope of the present disclosure , will be readily apparent to those of skill in the art based upon this disclosure . it is also contemplated that various combinations or sub - combinations of the specific features and aspects of the embodiments may be made and still fall within the scope of the present disclosure . accordingly , it should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another in order to form varying modes of the present disclosure . thus , it is intended that the scope of the present disclosure herein disclosed should not be limited by the particular disclosed embodiments described above . for all of the embodiments described above , the steps of any methods need not be performed sequentially . the ranges disclosed herein also encompass any and all overlap , sub - ranges , and combinations thereof . language such as “ up to ,” “ at least ,” “ greater than ,” “ less than ,” “ between ,” and the like includes the number recited . numbers preceded by a term such as “ approximately ”, “ about ”, and “ substantially ” as used herein include the recited numbers ( e . g ., about 10 %= 10 %), and also represent an amount close to the stated amount that still performs a desired function or achieves a desired result . for example , the terms “ approximately ”, “ about ”, and “ substantially ” may refer to an amount that is within less than 10 % of , within less than 5 % of , within less than 1 % of , within less than 0 . 1 % of , and within less than 0 . 01 % of the stated amount . | 0 |
in the following discussion , numerous specific details are set forth to provide a thorough understanding of the present invention . however , those skilled in the art will appreciate that the present invention may be practiced without such specific details . in other instances , well - known elements have been illustrated in schematic or block diagram form in order not to obscure the present invention in unnecessary detail . additionally , for the most part , details concerning network communications , electromagnetic signaling techniques , and the like , have been omitted inasmuch as such details are not considered necessary to obtain a complete understanding of the present invention , and are considered to be within the understanding of persons of ordinary skill in the relevant art . it is further noted that , unless indicated otherwise , all functions described herein may be performed in either hardware or software , or some combination thereof . in a preferred embodiment , however , the functions are performed by a processor , such as a computer or an electronic data processor , in accordance with code , such as computer program code , software , and / or integrated circuits that are coded to perform such functions , unless indicated otherwise . turning to fig1 , disclosed is a prior art sram 100 having an sram cell 110 . the sram 100 does not have a continuous blc . the sram cell 100 has a true node 112 and a complementary node 114 coupled to a local true bitline ( lblt ) 106 and a local complementary bitline ( lblc ) 107 , respectively . the sram cell 110 is also coupled to a wordline 105 through the gate of a first and second transistor 111 , 113 . a precharge line 115 is coupled to a first precharge circuit 131 and a second precharge circuit 133 through their respective gates . in fig1 , the first and second precharge circuits 131 , 133 use positive field effect transistors ( pfets ). as is understood by those of skill in the art , a pfet functions as a short when a low value is applied to its gate , and an open when a high voltage is applied to its gate . the lblt 106 is coupled to an lblt node 118 , and the lblc 107 is coupled to a lblc node 119 . the lblt node 118 is coupled to the drain of the first precharge circuit 131 . the lblc node 119 is coupled to the drain of the second precharge circuit 133 . the source of the precharge circuits 131 , 133 are both coupled to a high voltage source 157 . the lblt node 118 is further coupled to a local evaluator 120 , which is coupled to a second stage evaluator 122 . coupled to the lblt and lblc nodes 118 , 119 are the drains for a first write circuit 136 and a second write circuit 138 , respectively . the sources of the write circuits 136 , 138 are coupled to ground . in fig1 , the first and second write circuits 136 , 138 have negative field effect transistors ( nfets ). as is understood by those of skill in the art , a nfet functions as an open when a low value is applied to its gate , and a short when a high voltage is applied to its gate . the gates of the write circuits 136 , 138 are coupled to a writet line 141 and a writec line 143 , respectively . the writet line 141 and writec line 143 are coupled to the respective outputs of a write predriver circuit 150 . the write predriver circuit 150 has a data in line 153 and a write enable line 156 . to either read from the sram cell 110 or write to the sram cell 110 , the wordline 105 is asserted from a default logical low state to a logical high state . furthermore , when reading from the true node 112 of the sram cell 110 at the coupled local evaluator 120 , the value on the writet and writec 141 , 143 lines are zero . because the write - lines 141 , 143 values are zero , the write circuit 136 , 138 are turned off during a read . therefore , there is an open circuit between the lbl nodes 118 , 119 and ground . furthermore , when reading from the lblt line 106 through the local evaluator 120 , the precharge line input 115 transitions from a zero to a one , which turns off the precharge circuit 131 , thereby opening the connection between the lblt node 118 and high voltage source ( vbb ) 157 . however , the write circuit 136 is still open , as writet 141 is inputting a zero value into the write circuit 136 nfet . therefore , the voltage on the lblt node 118 is floating . in floating , an entity , such as the lblt node 118 , is not being driven by an applied voltage . for example , when the writet line 141 is on , the lblt node 118 is driven to ground . however , if the lblt line 141 is off , the lblt node 118 is floating , if the precharge circuit 131 is also an open . in fig1 , whether the true node 112 is at ground or high is read by the local evaluator 120 . in fig1 , during a read , if the true node 112 of the sram cell 110 stored voltage value is zero , the floating voltage of the lblt node 118 discharges to ground into the sram cell 110 . the resulting ground lblt node 118 voltage is read by the local evaluator 120 . alternatively , if the true node 112 of the sram cell 110 stored voltage value is high , the lblt node voltage 118 value stays substantially the same as a high voltage . in any event , the lblt node 118 voltage value is proportional to the voltage of the t node 112 of the sram cell 110 . in fig1 , during a read , both the writet 141 and the writec 143 lines are zero , which means that the lblc node 119 voltage value is floating at the precharge value high voltage value . as complementary voltages are not being applied to both the of the t and c nodes 112 , 114 of the sram cell at the same time , the values stored in the sram cell 110 do not change as a function of being read . the value of writeenb on line 156 is a “ one ” if not writing to the sram cell 110 , and a value of a “ zero ” if a value is being written to the sram cell 110 . the value of datain on line 153 is a “ zero ” or a “ one ,” as appropriate . if writing , the writeenb 156 value is zero . if writing , the wordline 105 value and the precharge 115 value are also raised to a one . before being driven by the writet and writec values , a floating voltage is created at both the lblt 118 and the lblc 119 nodes . if writing , the writeenb 156 value is zero , which means that the writet 141 and the writec 143 values will complement one another . therefore , then the writec 143 and writet 141 values come to drive the voltages at the lblt 118 and the lblc 119 nodes . when either the writet 141 or writec 143 value is low , the corresponding nfet write circuit 133 , 138 stays open , and the corresponding lbl node 118 , 119 starts off as a floating high voltage . however , the high floating value of the lbl node voltage discharges to ground when the corresponding nfet write circuit turns on for the non - zero writet 141 or writec 143 values . this means that both the lblt node 118 and the lblc node 119 become driven complements of one another , and these complementary voltages are then stored in the t and c nodes 112 , 114 of the sram cell 110 , as one value is floating high , but the other one is driven to ground by either write circuit 133 , 138 being turned on ( that is , going to ground ). this means that the lblt 106 values and the lblc 106 values can be written to the sram cell 110 , as both the writet 141 and writec 143 lines are complementary , which means that either the write circuit 136 or the write circuit 138 drives the true node 112 or complement node 114 to ground . turning now to fig2 , disclosed is an sram cell system 200 with a continuous bit_line 260 and a simplified configuration of precharge circuits . generally , sram cell 200 allows for the elimination of one of the precharge circuits of fig1 . in the system 200 , a continuous blc 260 is coupled to a plurality of sram cells 210 ( not shown ). when attempting a write , all coupled sram cells 210 receive the same continuous blc 260 value . however , through the use of a selected wordline 205 , only the selected sram cell 210 is written to . in the sram cell 200 , the continuous blc 260 does not have a precharge circuit . in one aspect , a portion of the circuitry and functionality of a precharge circuit 133 can be found in predriver circuit 290 for use with the continuous blc 260 . however , those of skill in the art understand that other logic circuits that have the same functionality as the write predriver circuit 290 can be substituted for the write predriver circuit 290 . in the system 200 , a precharge 215 is coupled to a portion of a second precharge circuit 272 . the portion of the second precharge circuit 272 can be a pfet . the drain of the second pfet 272 is coupled to the lblt node 270 , and the source of the second pfet 272 is coupled to the drain of the first precharge circuit 271 . the writet 241 is coupled to the gate of the first precharge circuit 271 . the source of the precharge circuit 271 is coupled to a system high voltage ( vbb ) 257 . in the system 200 , whenever a read is occurring , the write_enb 256 value is one . this is inverted to a zero by a predriver inverter 257 . the zero value is input into a predriver nand 259 . therefore , the value output of the nand 259 , and hence the write predriver circuit 290 , is a high voltage , and therefore the continuous blc 260 is high during a read . during a read , the writet 241 value is low . as the writeenb 256 input is a high , this high value is input into the predriver nor 258 , which is output as a low . therefore , the writet 241 output of the write predriver circuit 290 is a low during a read . during the read of the sram 210 , the true node 212 of the sram cell 210 is read . during the read function , there is a low signal on the writet 241 ( as a function of the writeenb signal 256 ), so the lblt node 270 voltage is not connected to ground , as the nfet write circuit 280 is open . furthermore , the precharge 215 value is transitioned to one , which turns off ( opens ) the second precharge pfet 272 , thereby creating a floating lblt 270 node . during a read , the sram true node 212 , if it has stored within it a low value , will function as a sink for the floating node lblt 270 value , thereby taking the value of the floating lblt node 270 to zero , and read by an evaluator 220 . in a further emobodiment , a nand gate is used within the local evaluator 220 , instead of an inverter . the sram true node 212 , if it has stored within it a high voltage value , drives a high voltage on the lblt node 270 , which is also read by the evaluator 220 . in the system 200 , the values in the sram stored within the true node 212 and the complementary node 214 of the sram cell 210 are not changed during a read , because complementary voltages are not being driven on the true node 212 and complementary node 214 simultaneously when wordline 205 is on . in the system 200 , during a read , both the lblt node 270 and the continuous blc 260 start out coupled to a high voltage . during a read , the sram cell 210 true node 212 and complementary node 214 values do not change . during the write function , the wordline 205 is turned on , but the precharge 215 is kept at a zero , unlike the transition of the precharge 115 in fig1 . during a write , therefore , the second pfet 272 functions as a short between the drain of the first pfet 271 and the write circuit 280 . the voltage at the lblt node 270 is therefore driven either to high source voltage 257 or to ground , as either the first pfet 271 or the write circuit 280 nfet is a short , as a function of the writet 241 value . as is also understood by those of skill in the art , although nfets and pfets are disclosed in fig2 , other nfets are within the scope of the present invention . the writet 241 value is used to input a high charge or a low charge to the nodes 212 and 214 of the sram cell 200 , depending upon the polarity of the writet function 241 , which is in turn a function of the data in . if the writet 241 value is high , the nfet write circuit 280 is turned on . furthermore , the first pfet 271 is turned off . the lblt node 270 is therefore drained to zero voltage value , which is written into the true node 212 of the sram cell 210 . this value is written to the true node 212 of the sram cell 210 due to the driving of the high voltage through the continuous blc 260 and the driving of a grounded voltage at the lblt 270 , as opposed to applying a high voltage through the continuous blc 260 , but floating a voltage at lblt node 270 during a read . however , if the writet 241 value is zero , the first pfet 271 coupled to the writet 241 is turned on ( shorts ), as zero input turns on the first pfet 271 . the nfet write circuit 280 , however , is off , and the lblt node 270 voltage value is driven to the source voltage value 257 . furthermore , the complementary value of the writet 241 is found in the continuous blc 260 . this also occurs during the writing to the sram 210 . for instance , if the writet 241 value is one in a write , the continuous blc 260 value is zero . because two complementary voltages are driven into the sram t and c nodes 212 , 214 , the sram 210 accepts these complementary voltages and stores them within the sram 210 . in the system 200 , during a write , the precharge does not transition voltage states from a zero to a one . this can lead to power savings , as power consumption and heat production can be proportional to the frequency of voltage switching . furthermore , in the system 100 , the wordline 105 and the precharge 115 during the write signal all transitioned at approximately the same time , which can create timing difficulties to implement . if the transitions of the precharge 115 and the wordline 105 did not occur at the proper time in the system 100 , a short could occur between the high voltage 157 and ground . in the system 200 , however , during a write , the pfet 271 and 272 and the nfet 280 are configured so that there will not be a short between the voltage high 257 and the ground during the write at the same time . it is understood that the present invention can take many forms and embodiments . accordingly , several variations may be made in the foregoing without departing from the spirit or the scope of the invention . the capabilities outlined herein allow for the possibility of a variety of programming models . this disclosure should not be read as preferring any particular programming model , but is instead directed to the underlying mechanisms on which these programming models can be built . having thus described the present invention by reference to certain of its preferred embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature and that a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . many such variations and modifications may be considered desirable by those skilled in the art based upon a review of the foregoing description of preferred embodiments . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention . | 6 |
as generally described above , the present invention is directed to the formation of metallic silicide films of relatively low resistivity values on heated silicon substrates by direct ion beam deposition . the silicide films are produced by the chemical interaction of the metal ions with silicon atoms diffused from the substrate . the ion beam is maintained at a relatively low energy level so as to inhibit losses by sputtering and to prevent the penetration of the ions into the substrate beyond a distance of only a few monolayers . as the metal ions from the ion beam initially accumulate in the near - surface region of the substrate as a continuous metal film , any metallic silicide formation present with the substrate at a temperature in the range of about room temperature to about 300 ° c . would most likely occur at the film - silicon substrate interface due to the finite range of the ions . this formation of the metallic silicide at the interface of the film and the substrate is due to the energy level of the metal ions contacting the substrate . however , with the deposit of metal ions which interact with the silicon atoms to form metallic silicide layer reaching a depth of about 2 nm , the metallic silicide forming reaction rapidly diminishes due to silicon depletion so that essentially only metal ions are deposited on the metallic silicide layer . applicants have discovered that by heating the substrate during the irradiation thereof with the metal ions that diffusion of a sufficient concentration of silicon atoms will occur from the substrate through the substrate - film interface and any formed portions of the metallic silicide film to provide an adequate level of interaction between the silicon atoms and the metal ions to provide a film with stoichiometric properties throughout the entire film thickness . in practicing the present invention the metallic silicide film is formed from the surface or near surface of the substrate outwardly until the desired thickness of the metallic silicide film is achieved . the mechanism for forming the metallic silicide film by the direct ion deposition onto the heated substrate depends upon both thermal and athermal ( ion impact ) processes . it is believed that the metallic silicide phases form athermally at the surface of the substrate as a result of ion impact with the ion energy being redistributed among the silicon atoms on the substrate surface in the area contiguous to ion impact to provide the energy necessary to activate the silicide phase formation . to sustain this silicide phase formation the supply of silicon atoms to the surface of the film as it is being formed is maintained by thermal diffusion at elevated temperature . the silicon substrates may be of any suitable type . for example , single crystal wafers with the & lt ; 100 & gt ; axis oriented perpendicular to the surface upon which the ion beam contacts or in any other orientation have been found to be satisfactory . other silicon crystal structures such as polycrystalline may be use with similar results . also , the substrates may be doped with n - or p - type dopants for use in selected electronic applications . further , the substrate may be formed of silicon alloyed with another material such as germanium . in accordance with the present invention the metallic silicide films are formed for metal - silicon systems in which silicon is the dominant diffusing element , i . e ., that is the metal atom is less mobile in the silicide . in the use of ion beam deposition the range of the metal ions in the silicides is less than two nm for all anticipated energy - ion combinations , so that any movement of the reactants necessary for forming the metallic silicide films must be made by diffusion . thus , in accordance with the present method , with the silicon being the dominant diffuser , the silicon atoms diffuse from the substrate through the growing metallic silicide film to the near surface region of the film where they athermally interact with the incident energetic metal ions to form metallic silicides . the ion beam energies utilized in practicing the present invention are in the range of about 10 to 1000 ev with current densities in the range of about 1 to about 10 micro - amps / cm 2 . the ion beams within this energy range are sufficient for forming metal silicide films of a thickness in the range of about 1 to 300 nm . the use of these relatively low ion beam energies is sufficient to effect the athermal formation of a metallic silicide on the surface of the silicon substrate and any previously formed portion of the metallic silicide film layer without causing undesirable ion implantation below the near surface regions of the substrate . as pointed out above , with these low beam energies the metal ions only penetrate a few monolayers into the substrate so that essentially all reactions incident to the metallic silicide film formation are essentially surface reactions . since the penetration depth of the ions into the substrate is small , as required for a surface technique , then at the relatively low temperatures used herein , the reaction will stop after the silicide grows sufficiently thick ( in the order several monolayers ) to isolate the silicon substrate from the newly arriving atoms . in order to provide the silicon atoms necessary for forming the stoichiometric metallic silicide films the substrate is heated to a temperature which is sufficient to effect diffusion of an adequate number of silicon atoms through the silicide film as it is being formed to interact with the metal ions at the surface of the growing metallic silicide film . it has been found that for the formation of stoichiometric metallic silicide films with a thickness in the aforementioned range that heating the silicon substrate to the temperature in the range of about 400 ° to 600 ° c . is required . with the substrate heated to temperatures less then about 400 ° c . it is believed that there will be an insufficient concentration of silicon atoms to produce a uniformly stoichiometric silicide throughout the film thickness . also , with temperatures greater than about 600 ° c . no beneficial increase in the diffusion of silicon atoms is realized and deleterious diffusion and / or volatilization of the dopants from the substrate starts to occur and increases with increasing temperature . the maximum temperature utilized for practicing the present invention is at least about 100 ° c . less than that required for practicing the physical and chemical deposition technique previously utilized and is at least 200 ° c . less than that required for the annealing procedures heretofore required to reduce the resistivity of the metallic silicide to the desired value . the various metals which are usable for forming the beam of metal ions in the present invention are those metals which , as noted above , are slower diffusers or less mobile in metallic silicides than the silicon atoms . these metals include titanium , tungsten , iron , vanadium , tantalum , and molybdenum . of these various metals , titanium is believed to be the most desirable for many electronic applications since the titanium disilicide formed from practicing present invention has the lowest resistivity values . prior to providing the silicon substrate with the metallic silicide film , it may be preferable to clean the surface of the substrate . satisfactory cleaning can be provided by rinsing the substrate in ethanol , distilled water , and dilute hf prior to mounting the substrate in the vacuum chamber utilized for the ion beam deposition . the surfaces of the substrates can also be cleaned while in the vacuum chamber immediately before initiating the ion beam deposition by bombarding the substrate with a low - energy beam of chlorine ions at a dose of about 1 × 10 17 / cm 2 while the substrate is heated to temperature of about 500 ° c . this ion beam cleaning procedure is similar to reactive ion etching and provides surfaces which are conducive to good epitaxilial growth on silicon . the ion beam deposition may be carried out in a suitable chamber or deposition chamber evacuated to a pressure in the range of about 1 × 10 - 7 to 1 × 10 - 10 torr . the ion beam deposition and the heating of the substrate is maintained until the metallic silicide film reaches the desired thickness . normally , with ion beam energies in the aforementioned range a metallic silicide film growth rate in the order of about 1 nm / min is provided . with such a growth rate a reaction duration of about 1 minute to about 5 hours would be required for forming a metallic silicide film with a thickness in the range of about 1 to 300 nm . in order to provide a more facile understanding of the present invention several examples relating to the formation of metallic silicide films on silicon substrates using different metal ions are set forth below . in these examples the silicon substrates are single crystal wafers with the & lt ; 100 & gt ; axis oriented perpendicularly to the surface contacted by the ion beam . all substrates used were electronic grade n - or p - type si doped respectively with p and b to resistivities of 5 to 10 ohms - cm . the particular concentration and / or type of dopants is not critical to the formation of high purity metallic silicide films since the temperatures employed are insufficient to cause any deleterious diffusion of the dopants from the substrate . in the following examples the metallic silicide films were produced by the direct deposition of low energy ( 40 to 200 ev ) metal ions onto the silicon substrates . the metal ion beam was produced at the minimum extraction energy of 35 kev in a commercially available ion implantation accelerator ( extrion 200 - 1000 ) using a freeman ion source . in these examples the 35 kev beam was magnetically mass analyzed and passed through three stages of liquid - nitrogen trapped differential pumping and a seven - degree neutral trap . the beam entering the deposition chamber was decelerated in a four - element deceleration lens system to the desired final energy . the pressure in the deposition chamber was in the 10 × 10 - 10 torr range . the silicon substrates were each held in a 14 mm diameter holder containing a resistance heater capable of heating the substrate surface to a temperature of about 900 ° c . a faraday cup was used for positioning and laterally profiling the beam . the films produced were characterized by conventional rutherford backscattering and ion channelling with 2 - mev he at a scattering angle of 160 degrees to measure stoichiometry of the metallic silicide films , film thickness and degree of epitaxy . details on the micro structure of the metallic silicide films were obtained by transmission electron microscopy of cross - sectionally thinned specimens by using a commercially available philips em400t transmission electron microscope operating at 100 kev . sheet resistance measurements were made with a standard 4 - point probe and were converted to electrical resistivities using the film thicknesses determined from the rutherford backscattering measurements . a cleaned , single - crystal silicon wafer was mounted in the ion beam deposition chamber and subjected to a beam of titanium ions at a energy of 100 ev . during this ion bombardment the substrate was heated to 550 ° c . a film of titanium disilicide was formed on the surface of the wafer in a deposit area of approximately 3 cm 2 at a growth rate of about 1 nm / min . the film growth was continued to a thickness of 200 nm and when analyzed exhibited low bulk - like resistivity of 15 - 20 micro - ohms - cm this resistivity value compares favorably to the 13 - 25 micro - ohms - cm values for thin titanium disilicide films formed by using previously known techniques and annealed at temperatures in excess of 800 ° c . a 55 - nm thick polycrystalline film of tungsten disilicide film was formed on a single - crystal silicon wafer heated to a temperature of 500 ° c . with an incident ion beam energy of 200 ev . the growth rate of the film was similar to that of the titanium . the uniform height of scattering from both the tungsten and the silicon in the film as provided by a 2 - mev he ion backscattering spectrum indicated that a constant ratio of silicon to tungsten was present throughout the thickness of the film while the relative heights of the two regions indicated that the ratio of silicon to tungsten was 2 to 1 or stoichiometric throughout the thickness of the film . the large lattice mismatch for this tungsten disilicide film prevented epitaxial growth during the film formation . an iron disilicide film was formed on a single crystal silicon wafer at an ion beam energy of 40 ev while the substrate was heated to 550 ° c . the film growth rate was approximately 1 nm / min . analysis of the 200 nm - thick film indicated that the film was of uniform stoichiometry throughout the thickness of the film with the ratio of silicon to iron being 2 , which is iron disilicide . the resistivity measurement of this film was approximately 850 ohms - cm , which compares favorably with resistivity values previously achieved for iron disilicide films sintered at temperatures greater than 700 ° c . it will be seen that the metallic silicide films formed by practicing the method of the present invention possess resistivities which are comparable to the lowest values achieved by practicing any of the previously known techniques and which are achieved at temperatures significantly lower than heretofore usable so as to significantly reduce the thermal budget and greatly reduce the redistribution and / or volatilization of dopants . the ion beam deposition of the present invention can be accomplished with a magnetically analyzed beam that is elementally and isotopically pure so as to provide metallic silicide films of high purity without oxygen or nitrogen contaminants and which are homogeneous and uniformly stoichiometric with relatively large grains . | 7 |
hereinafter , embodiments according to the present invention will be described in detail with reference to the accompanying drawings . fig1 is a configuration diagram illustrating a whole storage battery recycle system according to an embodiment of the present invention . the storage battery recycle system in this embodiment includes storage battery relocation assistance server 1 , a plurality of vehicles 100 , a plurality of houses 200 , a plurality of buildings 300 , a plurality of factories 400 , collected - battery warehouse 500 , and network 600 utilized for data transmission . in fig1 , one each of the plurality of vehicles 100 , houses 200 , buildings 300 and factories 400 is illustrated by one representative element . in these configurations , storage battery relocation assistance server 1 corresponds to an embodiment of the storage battery relocation assistance apparatus according to the present invention , and vehicle 100 , house 200 , building 300 , and factory 400 correspond to an embodiment of a plurality of facilities using a storage battery . storage battery relocation assistance server 1 is a computer including , for example , a cpu ( central processing unit ) as an arithmetic unit , a ram ( random access memory ) and a hard disk as storing section 20 , a communication apparatus , a display or a printer as an information output section , and an input apparatus for inputting an operational command from an operator . in storage battery relocation assistance server 1 , a software module read from the hard disk is expanded on the ram and is executed by the cpu to implement a plurality of functional modules . more specifically , storage battery relocation assistance server 1 includes , as the plurality of functional modules , in - use battery state collection section 11 , in - use battery deterioration prediction section 12 , input section 13 for inputting information on use destinations , relocation determination section 14 , reporting section 15 , collected - battery deterioration prediction section 16 , and collected - battery state collection section 17 . storing section 20 in storage battery relocation assistance server 1 includes in - use battery information storing section 21 , in - use battery deterioration prediction information storing section 22 , use - destination - information storing section 23 , unused - battery deterioration prediction information storing section 24 , collected - battery deterioration prediction information storing section 25 , and collected - battery information storing section 26 . this plurality of storing sections 21 to 26 stores and manages predetermined information according to predetermined formats . in - use battery information storing section 21 corresponds to an embodiment of the battery information management section according to the present invention , and use - destination - information storing section 23 corresponds to an embodiment of the requirement information management section according to the present invention . in - use battery state collection section 11 collects information ( referred to as battery information ) representing a state of a plurality of storage batteries used in the plurality of vehicles 100 , the plurality of houses 200 , the plurality of buildings 300 , and the plurality of factories 400 , and stores the information in in - use battery information storing section 21 . the battery information is collected always or periodically . in - use battery state collection section 11 is capable of exchanging data with the communication sections of the plurality of vehicles 100 , the plurality of houses 200 , the plurality of buildings 300 , and the plurality of factories 400 through a communication apparatus connected to network 600 . the collected in - use battery information will be described below in detail . in - use battery deterioration prediction section 12 predicts future deterioration of each storage battery on the basis of the battery information on an in - use storage battery , and stores this prediction result ( referred to as deterioration prediction information ) in in - use battery deterioration prediction information storing section 22 . this deterioration prediction information will be described below in detail . input section 13 receives information , which is inputted by an operator according to a predetermined input format through the input apparatus , on each facility ( referred to as use - destination - information ) of the plurality of vehicles 100 , the plurality of houses 200 , the plurality of buildings 300 , and the plurality of factories 400 . input section 13 then stores the inputted use - destination - information in use - destination - information storing section 23 . the content of this use - destination - information will be described below . collected - battery state collection section 17 collects information representing a state of a plurality of storage batteries kept in collected - battery warehouse 500 , and stores the information in collected - battery information storing section 26 . collected - battery state collection section 17 is capable of exchanging data with a communication section of collected - battery warehouse 500 through a communication apparatus connected to network 600 . the collected information in this case is almost the same as information collected by in - use battery state collection section 11 . collected - battery deterioration prediction section 16 predicts future deterioration of the plurality of storage batteries kept in collected - battery warehouse 500 , and stores information on the prediction result in collected - battery deterioration prediction information storing section 25 . the details of this deterioration prediction will be described later as a supplement for prediction of deterioration of an in - use storage battery . unused - battery deterioration prediction information storing section 24 is a storing section for beforehand storing , as deterioration prediction information , information on the future deterioration property of an unused storage battery that is kept while being unused . relocation determination section 14 reads , from storing section 20 , the deterioration prediction information on an in - use storage battery , the deterioration prediction information on an unused storage battery , the deterioration prediction information on a collected storage battery , and the use - destination - information on each facility . based on the above - described deterioration prediction information and information on predetermined relocation requirements for a storage battery , relocation determination section 14 then performs an optimization process and determines the optimal relocation time and relocation destination of each storage battery . that is , relocation determination section 14 determines the optimal relocation schedule for each storage battery . reporting section 15 extracts , for example , a relocation schedule involving relocation time close to the present time from among the optimal relocation schedules for respective storage batteries determined in relocation determination section 14 , and lists these information items on the display or on a printout . based on these information items , an operator sets the schedule for relocation exchange for storage batteries in the plurality of vehicle 100 , the plurality of house 200 , the plurality of building 300 , the plurality of factory 400 , and collected - battery warehouse 500 , and advances a procedure of relocation of the storage batteries . that is , the operator and a worker , for example , report to a contractor , an exchange of a storage battery , and then perform exchange maintenance of a storage battery on the basis of the schedule for a relocation exchange . vehicle 100 includes storage battery b , charger 101 , battery control section 102 , in - vehicle communication section 103 , and socket 104 . storage battery b supplies electric power to a running motor ( not illustrated ) of vehicle 100 to drive the vehicle . socket 104 is connected to external cable 211 for the input of an external power source and transmission and reception of data . charger 101 charges storage battery b with the external power source inputted from socket 104 . battery control section 102 controls necessary electric power supplied to the running motor from storage battery b . battery control section 102 measures and monitors , for example , the voltage , input and output currents , a temperature , a state of charge ( soc ), and a deterioration state ( soh : state of health ) of storage battery b , and transmits these information items to storage battery relocation assistance server 1 through in - vehicle communication section 103 . if cable 211 serving as a communication path is connected to socket 104 , in - vehicle communication section 103 performs data communication through cable 211 . otherwise , in - vehicle communication section 103 is connected to network 600 through radio communication and performs data communication . here , the state of charge ( soc ) is the ratio of a residual capacity to a fully charged capacity , and the deterioration state ( soh : state of health ) is a value representing a state of deterioration of a storage battery calculated from the internal resistance value of the storage battery . house 200 includes , for example , storage battery b , battery control section 201 , electric load 202 , and in - house communication section 203 . for example , storage battery b is charged with electric power from a commercial power source ( also referred to as a common power source ) in the time zone when an electricity price is low , and supplies electric power to electric load 202 in the time zone when the electricity price is high or when electricity is deficient . electric load 202 is one of various kinds of electric appliances used in house 200 . battery control section 201 measures and monitors , for example , the voltage , input and output currents , a temperature , a state of charge ( soc ), and a state of health ( soh ) of storage battery b , and transmits these information items to storage battery relocation assistance server 1 through in - house communication section 203 . in - house communication section 203 can be connected to network 600 to perform data communication . each of building 300 and factory 400 also includes storage battery b , a battery control section , an electric load , and a communication section similarly to house 200 . when relocation use ( also referred to as reuse ) of storage batteries b is performed between the facilities which are vehicle 100 , house 200 , building 300 , and factory 400 , collected - battery warehouse 500 is a facility for keeping storage batteries b temporarily collected from any of the facilities . collected - battery warehouse 500 includes collected storage battery b , battery management section 501 , and communication section 502 . battery management section 501 controls storage battery b so as to be maintained in an appropriate state of charge , or control storage battery b so as to appropriately charge and discharge , in order to delay the progression degree of deterioration of storage battery b . battery control section 501 measures the voltage , input and output currents , a temperature , a state of charge ( soc ), and a state of health ( soh ) of storage battery b , and transmits the measurement result to storage battery relocation assistance server 1 through communication section 502 . fig2 is a data table illustrating an example content of the in - use battery information stored in in - use battery information storing section 21 . in - use battery information storing section 21 stores a plurality of respective information items representing states of a plurality of storage batteries used in the plurality of facilities . to these information items , the information collected by in - use battery state collection section 11 is sequentially added . the in - use battery information stored in in - use battery information storing section 21 includes , for example , a model number , a present use place , the history of past use places , an initial capacity , a voltage log , a current log , a temperature log , a state of charge ( soc ), a state of health ( soh ), and charge / discharge allowable electric power ( also referred to as an sop : state of power ( prediction electric power ability )). these information items are independently stored for all the registered storage batteries . information on the voltage log , the current log , and the temperature log is stored as the series of data representing the voltage , current , and a temperature at a plurality of time points ( ti ), respectively . information on the state of charge , the state of health , and charge / discharge allowable electric power is also stored as the series of data representing the respective values at a plurality of time points . here , the charge / discharge allowable electric power ( sop ) represents the maximum charge electric power and the maximum electric discharge electric power estimated from , for example , the voltage and the internal resistance of the storage battery . in - use battery state collection section 11 collects , from each facility , respective information items on the voltage log , the current log , the temperature log , the state of charge ( soc ), the deterioration state ( soh ), and the charge / discharge allowable electric power ( sop ) among the items in the data table of fig2 . in - use battery state collection section 11 then adds the collected information items to the in - use battery information items and stores the resultant information items . collected - battery information storing section 26 also stores respective collected - battery information items including the items in the data table of fig2 . collected - battery state collection section 17 collects , from collected - battery warehouse 500 , respective information items on the voltage log , the current log , the temperature log , the state of charge ( soc ), the deterioration state ( soh ), and the charge / discharge allowable electric power ( sop ). collected - battery state collection section 17 then adds the collected information items to the collected - battery information items and stores the resultant information items in collected - battery information storing section 26 . fig3 is a data table illustrating an example of the deterioration prediction information stored in in - use battery deterioration prediction information storing section 22 . as illustrated in fig3 , in - use battery deterioration prediction information storing section 22 stores a plurality of pieces of curvilinear data of deterioration states predicted according to various relocation models for each storage battery . the relocation model is a model representing at which time and to which facility a target storage battery is relocated . the relocation model will be described below in detail . as illustrated in fig9 a to 9d , 9m and 9q , various relocation models are set so as to include various relocation patterns possible for relocation of storage batteries in reality . the curvilinear data of deterioration states will be described below in detail . as illustrated in fig1 , the curvilinear data is data representing a time variation in a deterioration state ( referred to as soh or “ the residual capacity of a battery ”). fig4 is a data table illustrating an example of the use - destination - information stored in use - destination - information storing section 23 . the use - destination - information includes , as information representing each facility , use destination data for identifying the facility , contractor data for identifying a contractor , and use destination category data for representing the category ( for example , a vehicle , a house , a building , and a factory ) of the facility , for example . the use - destination - information includes , as requirement information to the storage battery , information on contract electric power demand representing the maximum electric power which can be supplied from the storage battery , information on a contract battery capacity representing the minimum capacity of the storage battery , and information on an installation space for installing the storage battery , for example . use - destination - information storing section 23 stores the above - described use - destination - information for all facilities receiving service of the supply of the storage batteries . when a contractor is added , information representing the facility of the contractor is inputted from input section 13 , and use - destination - information concerning the new contractor is added to use - destination - information storing section 23 . here , the action and the advantageous effects of the relocated and used storage battery will be explained . fig5 is a graph illustrating a time variation in the discharge capacity of the same storage battery charged and discharged repeatedly with a predetermined current amount . respective three graph lines in fig5 indicate the cases of high , middle , and low charge / discharge currents . as illustrated in the graph of fig5 , the storage battery deteriorates and gradually decreases the discharge capacity ( also referred to as a battery capacity ) by repeating charge and discharge . the magnitude of a charge / discharge current for the storage battery , i . e ., the severity of use of the storage battery also varies the rate of deteriorating the storage battery . for example , a higher charge / discharge current increases the rate of the deterioration , and a lower charge / discharge current decreases the rate of the deterioration . the graph line for the high charge / discharge current in fig5 indicates an example case used for a vehicle . storage battery b of vehicle 100 outputs a large current in the case of running , and rapidly charges in the case of charging . therefore , the use conditions for the storage battery in vehicle 100 are very severe in comparison with the other facilities . moreover , since vehicle 100 is required to have a high storage battery performance , the storage battery performance reaches the lower limit of the required performance of vehicle 100 at a stage at which the deterioration degree of the storage battery does not progress so much . the graph line for the middle charge / discharge current in fig5 indicates an example case used for a house . storage battery b in house 200 or building 300 charges and discharges relatively moderately . furthermore , in house 200 or building 300 , the installation space for storage battery b is large in comparison with vehicle 100 , and many storage batteries can be used in parallel . therefore , in house 200 or building 300 , the use conditions required for storage battery b are moderate in comparison with vehicle 100 . moreover , since the use conditions are moderate , the storage battery performance required for house 200 or building 300 is low in comparison with that for vehicle 100 . the graph line for the low charge / discharge current in fig5 indicates an example case used for a factory . in factory 400 , storage battery b charges and discharges in a further planned and stable manner . moreover , in factory 400 , the installation space for storage battery b is further large in comparison with house 200 and building 300 , and an enormous number of storage batteries can be used in parallel . therefore , the use conditions for storage battery b in factory 400 are moderate in comparison with the use conditions for house 200 and building 300 . moreover , since the use conditions are moderate , the storage battery performance required for factory 400 is low in comparison with those for house 200 and building 300 . therefore , as illustrated in fig5 in many cases , the progression degree of deterioration is large in the storage battery used in vehicle 100 , and decreases in the storage batteries used in house 200 ( or building 300 ) and factory 400 in this order . even if vehicles 100 are of the same type , respective vehicles 100 involve different progression degrees of deterioration since , for example , users use vehicles 100 at different frequencies . in the other facilities , the progression degrees of deterioration also differ in the respective facilities similarly . moreover , as illustrated in fig6 a to 6c , the storage battery performance required for each application is the highest in vehicle 100 , and decreases in the order of house 200 ( or building 300 ) and factory 400 . fig6 a to 6c are graphs illustrating changes in deterioration curves in the case of relocation use of the storage battery . fig6 a to 6c illustrate deterioration curves of storage batteries when a storage battery used for a certain period in a vehicle continues being used in the vehicle and when the storage battery used for the certain period is relocated to and used in a house or a factory , as an example . as illustrated in fig6 a to 6c , the deterioration curve of a storage battery variously changes depending on to which facility the storage battery is relocated for use and depending on when the storage battery is relocated . moreover , assuming that the time point of the storage battery performance reaching the lower limit of the performance required for each facility is defined as a storage battery life , as can be seen from comparison in fig6 a to 6c , the relocation use of a storage battery can lead to a longer storage battery life of the storage battery . fig7 is a configuration diagram illustrating the details of storage battery b . storage battery b as an object to be provided in a system of the present embodiment is composed of , for example , a lithium ion secondary battery . storage battery b is provided by being packaged in a form of battery pack bp which can readily be mounted on each facility . moreover , battery pack bp includes a plurality of battery modules bm bundled in order to provide predetermined output and capacity . moreover , each battery module bm has a plurality of battery cells bc mounted therein . the collection and management of the battery information and the relocation use of the storage battery described above can be performed in units of battery packs bp , and also in units of battery modules bm or in units of battery cells bc . next , a storage battery deterioration prediction process performed by in - use battery deterioration prediction section 12 will be explained . fig8 is a flow chart illustrating the procedure of the storage battery deterioration prediction process . fig9 is an explanatory diagram illustrating the various relocation models subject to deterioration prediction . fig1 a to 10c are graphs illustrating the outline of the deterioration prediction curves of the storage battery in one relocation model . fig1 a to 11c are graphs illustrating the outline of the deterioration prediction curves of the storage battery in another relocation model . for example , at a time when an execution instruction is inputted from an operator , or at predetermined time intervals , in - use battery deterioration prediction section 12 starts this storage battery deterioration prediction process . if the process starts , in - use battery deterioration prediction section 12 first reads in - use battery information from the in - use battery information storing section in step s 11 . next , in step s 12 , in - use battery deterioration prediction section 12 sequentially selectively sets one relocation model for relocating a storage battery in the plurality of facilities from among the various relocation models . as illustrated in fig9 a to 9d , 9m and 9q , the various relocation models include a plurality of relocation patterns in which a storage battery is first used for vehicle 100 having severe use conditions and is then relocated to house 200 , building 300 , or factory 400 in order of the gradually loosened use conditions . as illustrated in fig9 b to 9d , the various relocation models also include relocation patterns involving the skip of one or more of house 200 , building 300 , and factory 400 . moreover , the various relocation models also include patterns based on changing storage battery relocation time . for example , the relocation models in fig9 a to 9m have patterns in which a storage battery is relocated when the storage battery performance reaches the lower limit of the required performance for the facility using the storage battery . on the other hand , the relocation model in fig9 q has a pattern in which a storage battery is relocated a little earlier ( for example , a storage battery is relocated when the storage battery performance reaches a higher level by a predetermined amount than the lower limit of the required performance ). moreover , as illustrated in fig9 d and 9m , the various relocation models also include patterns in which a relocation destination is set to another house 200 , another building 300 , or another factory 400 in the same category . even in a facility in the same category ( for example , house ), a storage battery is severely utilized in some place and less severely utilized in another place , and the progression degree of deterioration is not necessarily the same . in consideration of this , the relocation model in fig9 m involves relocation destinations changed independently . in the case of an enormous number of facilities , if relocation models for relocating storage batteries are prepared for all the facilities , the number of relocation models increases significantly . therefore , in the case of an enormous number of facilities , in the same facility category , a facility model may be prepared so as to have a standard progression degree of deterioration , a plurality of facility models may be prepared so as to have progression degrees of deterioration shifted from the standard degree at a plurality of levels , and these facility models may be combined to thereby prepare relocation models . next , in step s 13 , in - use battery deterioration prediction section 12 predicts deterioration of the storage battery according to the relocation model set in step s 12 . for example , the graphs in fig1 a to 10c illustrate the case of a relocation model in which a storage battery used in vehicle 100 is used down to the lower limit of the required performance in each facility and is sequentially relocated to house 200 and then factory 400 . in this case , in - use battery deterioration prediction section 12 predicts the deterioration prediction curve in vehicle 100 in fig1 a , for example , from the time transition data of the deterioration state ( soh ) in the in - use battery information . alternatively , in - use battery deterioration prediction section 12 can calculate a deterioration prediction curve from the data of the voltage log , the current log , and the temperature log in the in - use battery information , assuming that the same use situation continues . in - use battery deterioration prediction section 12 also calculates the deterioration prediction curve in house 200 in fig1 b , on the basis of the in - use battery information on another storage battery used in house 200 . that is , a deterioration prediction curve is calculated from the data of the time transition data of the deterioration state ( soh ) or the voltage log , the current log , and the temperature log included in the in - use battery information , assuming that the storage battery is used in the same situation . furthermore , in - use battery deterioration prediction section 12 similarly calculates the deterioration prediction curve of factory 400 in fig1 c , on the basis of the in - use battery information on another storage battery used in factory 400 . next , another example of a deterioration prediction step will be explained . the graphs of fig1 a to 11c illustrate the case of a relocation model for sequentially relocating a storage battery presently used in vehicle 100 to house 200 and factory 400 in a stage involving a higher level by 10 % than the lower limit of the required performance in each facility . in this relocation model , in - use battery deterioration prediction section 12 calculates a deterioration prediction curve by setting the relocation time for a storage battery to the time when the storage battery performance reaches a higher value by a predetermined ratio than the lower limit of the required performance of each facility . in - use battery deterioration prediction section 12 also summarizes and calculates prediction of the progression degree of deterioration in each facility on the basis of the in - use battery information also in this relocation model similarly to the case of the relocation model in fig1 . in - use battery deterioration prediction section 12 may also read the use - destination - information from use - destination - information storing section 23 to acquire information on the storage battery required performance in each facility . through such deterioration prediction , in - use battery deterioration prediction section 12 obtains the deterioration prediction curve of the storage battery for one relocation model , as illustrated in fig1 a to 10c or 11a to 11c . next , in step s 14 , in - use battery deterioration prediction section 12 accumulates the prediction result data representing the deterioration prediction curve obtained in step s 13 , into in - use battery deterioration prediction information storing section 22 . through a process loop of steps s 12 to s 15 , in - use battery deterioration prediction section 12 then repeats the deterioration prediction and accumulation of the prediction result data for all the relocation patterns . through a process loop of steps s 11 to s 16 , in - use battery deterioration prediction section 12 also repeats the deterioration prediction and accumulation of the prediction result data for all the storage batteries . through such a storage battery deterioration prediction process , as illustrated in fig3 , in - use battery deterioration prediction information storing section 22 accumulates therein the data of the deterioration curve in the case of the relocation use in the various relocation models for each storage battery . collected - battery deterioration prediction section 16 predicts deterioration of the plurality of storage batteries b that would occur if they are continued to be kept in the collected - battery warehouse , and stores the data of the predicted deterioration curve in collected - battery deterioration prediction information storing section 25 . this deterioration curve can be predicted and calculated from the time transition data of the deterioration state ( soh ) or the data of the voltage log , the current log , and the temperature log stored in collected - battery information storing section 26 , assuming that the deterioration progresses in the same situation . additionally , collected - battery deterioration prediction section 16 may also predict deterioration of a collected battery used by relocation , for example , to the house , the building , or the factory similarly to in - use battery deterioration prediction section 12 , and may store the deterioration curve in collected - battery deterioration prediction information storing section 25 . next , a relocation determination process performed by relocation determination section 14 will be described . fig1 is a flow chart illustrating a procedure of the relocation determination process . fig1 is a table illustrating determination requirements for relocating a storage battery . relocation determination section 14 starts this relocation determination process in response to an instruction from an operator or at predetermined time interval . if the process is started , relocation determination section 14 first reads , in step s 21 , the data of predicted deterioration curve ( also referred to as “ deterioration prediction information ”) of each storage battery from in - use battery deterioration prediction information storing section 22 , unused - battery deterioration prediction information storing section 24 , and collected - battery deterioration prediction information storing section 25 . next , in step s 22 , relocation determination section 14 reads use - destination - information from use - destination - information storing section 23 . then , in step s 23 , relocation determination section 14 determines the combination of the optimal relocation time and relocation destination ( referred to as “ relocation schedule ”) for each storage battery on the basis of the read data , by performing a calculation process ( for example , optimization process ) for comprehensively improving the sufficiency level of a plurality of predetermined determination requirements . as illustrated in fig1 , the determination requirements for relocating storage batteries include , for example , a requirement of maintaining the contract electric power demand in each use destination , a requirement of maintaining the contract battery capacity in each use destination , and a requirement of setting relocation time in a way that makes the relocation time close to a time when the storage battery performance comes near the lower limit of the required performance in each facility . moreover , the determination requirements include , for example , a requirement of decreasing the number of new storage batteries to be supplied , a requirement of reducing a variation in the deterioration degrees of storage batteries simultaneously used in each facility , and a requirement of decreasing the reserved quantity of collected batteries . moreover , the determination requirements include a requirement of increasing the usage rate of the installation space for storage batteries in each facility . the respective determination requirements are assigned with weighting factors λ 1 , λ 2 , . . . . in step s 23 , relocation determination section 14 performs a calculation process so as to better satisfy a requirement having a larger weighting factor , and determines the relocation schedule for each storage battery . through such a relocation determination step , for example , when the storage battery of certain house 200 approaches the lower limit of the required performance , the optimal storage battery which can be relocated from vehicle 100 to this house 200 is extracted to display this information on the relocation schedule . similarly , when the storage battery of certain factory 400 approaches the lower limit of the required performance , the optimal storage battery which can be relocated from the plurality of vehicles 100 , houses 200 , or buildings 300 to this factory 400 is extracted to display this information on the relocation schedule . moreover , when abnormality or a sign of failure is found in several storage batteries in a certain facility , information representing that the several storage batteries need to be replaced is displayed on the relocation schedule . moreover , through the above - mentioned relocation determination step , the calculation process for comprehensively improving the sufficiency level of each determination requirement calculates a relocation schedule for storage batteries , the relocation schedule surely satisfying a requirement of maintaining the contract electric power demand in each use destination and a requirement of maintaining the contract battery capacity in each use destination . moreover , the relocation schedule for each storage battery is calculated to set relocation time in a way that makes the relocation time as close as possible to a time when a storage battery comes near the lower limit of the required performance in each facility and so as to minimize the number of new storage batteries to be supplied . moreover , the relocation schedule is calculated so as to minimize a variation in the deterioration degrees of storage batteries simultaneously used in each facility and so as to minimize the reserved quantity of collected batteries . moreover , the relocation schedule is calculated so as to relocate many progressively deteriorated storage batteries to a facility having a large installation space to increase the usage rate of the large installation space . the relocation schedule is calculated according to other determination requirements that are set variously . next , in step s 24 , relocation determination section 14 distinguishes a relocation schedule involving relocation time close to the present time ( for example , within one month from the present time ) from among the determined relocation schedules . then , if relocation determination section 14 finds a relocation schedule close to the present time , relocation determination section 14 outputs information on the relocation schedule to reporting section 15 , in step s 25 . thereby , the information on the relocation schedule is reported from reporting section 15 to an operator . through such a relocation determination process , the optimized relocation schedule , which can better satisfy the determination requirements for relocation , for the storage battery is determined to display information on this relocation schedule for an operator . based on the information on this relocation schedule , an operator sets the schedule for relocation exchange for storage batteries in the plurality of vehicle 100 , the plurality of house 200 , the plurality of building 300 , the plurality of factories 400 , and collected - battery warehouse 500 in reality , and can advance a procedure of relocation of the storage batteries . that is , the operator and a worker , for example , report an exchange of a storage battery and perform exchange maintenance of a storage battery for a contractor according to the schedule for a relocation exchange . fig1 a to 16 are explanatory diagrams of an example of repacking for relocating a storage battery . as illustrated in fig1 a and 14b , instead of relocation of a storage battery , battery pack bp 1 , without modification , the storage battery may be relocated after repacking battery pack bp 1 into other battery packs bp 2 and bp 3 according to conditions of a relocation destination or the battery state in battery pack bp 1 . alternatively , a storage battery may be relocated in units of battery modules bm 1 . alternatively , as illustrated in fig1 , a storage battery may be relocated after such repacking that the deterioration degrees of a plurality of battery modules bma and bmb in battery packs bp 2 and bp 3 are uniform . then , battery packs bp 2 a and bp 3 a repacked so as to have uniform deterioration degrees may also be relocated . alternatively , as illustrated in fig1 , when only one or more battery cells bc 1 in battery module bm 1 have deteriorated significantly , a storage battery may be relocated after replacing this battery cell bc 1 with battery cell bc 2 deteriorated in a similar degree to the other cells . then , battery module bm 1 a partially replaced may be relocated . in the above - described relocation determination process , relocation determination section 14 can also determine a relocation schedule in units of battery modules bm or in units of battery cells bc to thereby display information on combination for repacking battery packs and information on combination for uniforming non - uniform deterioration degrees . as described above , according to storage battery relocation assistance server 1 and the storage battery recycle system in this embodiment , the in - use battery information representing the states of the plurality of storage batteries used in the plurality of facilities is collected in storage battery relocation assistance server 1 . furthermore , in - use battery deterioration prediction section 12 in storage battery relocation assistance server 1 predicts deterioration of storage batteries in the case of relocating the storage batteries in the plurality of facilities , on the basis of these information items . therefore , this deterioration prediction result can assist determination of the optimal relocation time and relocation destination of a storage battery . according to storage battery relocation assistance server 1 in this embodiment , relocation determination section 14 determines the combination of the optimal relocation time and relocation destination for each storage battery , on the basis of the deterioration prediction result in the case of relocating each storage battery among the plurality of facilities and the use - destination - information . storage battery relocation assistance server 1 then outputs information on the relocation schedule of the determination result to the exterior . therefore , on the basis of the information on this relocation schedule , an operator or a worker can set the schedule for relocating storage batteries in reality among the plurality of facilities and can cause the plurality of storage batteries to be relocated and used in the plurality of facilities . this can contribute to a comprehensive cost reduction for the life cycle from manufacturing to recycling of a storage battery . the embodiment of the present invention has been described thus far . the above - described embodiment has been described in an example case where in - use battery state collection section 11 collects battery information through communication network 600 . however , the battery information may also be collected after a delay of one week to several months , instead of real - time collecting of the battery information . therefore , for example , the battery information may be accumulated in the facility during a predetermined period , and in - use battery state collection section 11 may collect this battery information through a storage medium , such as a record disk , a memory card , or a usb ( universal serial bus ) memory . specifically , the storage medium having battery information written in the facility may be sent to the manager of storage battery relocation assistance server 1 , and the manager may read battery information from this storage medium to send the battery information to in - use battery state collection section 11 . the embodiment has been described above with an example which involves one kind of storage battery , i . e ., a lithium ion secondary battery . however , storage battery relocation assistance server 1 may handle a plurality of kinds of storage batteries ( for example , a lithium ion secondary battery and a nickel hydrogen secondary battery ). storage battery relocation assistance server 1 then performs a relocation schedule for relocating , to a facility using a first kind of storage battery , and using a second kind of storage battery . the embodiment has been described using specific examples for the contents of the in - use battery information , use - destination - information , and the determination requirement for relocation . however , the in - use battery information , the use - destination - information , and the determination requirement for relocation are not limited to the contents described in the embodiment . the relocation model which is set for predicting deterioration of a storage battery can also be modified appropriately by , for example , adding a relocation model having a collection period in midstream . the disclosure of japanese patent application no . 2011 - 266774 , filed on dec . 6 , 2011 , including the specification , drawings and abstract , is incorporated herein by reference in its entirety . the present invention can be utilized for the storage battery comprehensive management service for relocating and using a storage battery among the plurality of facilities . | 8 |
in fig1 to 3 of the accompanying drawings there is schematically depicted the core components of a print engine assembly , showing the general environment in which the laminated ink distribution structure of the present invention can be located . the print engine assembly includes a chassis 10 fabricated from pressed steel , aluminium , plastics or other rigid material . chassis 10 is intended to be mounted within the body of a printer and serves to mount a printhead assembly 11 , a paper feed mechanism and other related components within the external plastics casing of a printer . in general terms , the chassis 10 supports the printhead assembly 11 such that ink is ejected therefrom and onto a sheet of paper or other print medium being transported below the printhead then through exit slot 19 by the feed mechanism . the paper feed mechanism includes a feed roller 12 , feed idler rollers 13 , a platen generally designated as 14 , exit rollers 15 and a pin wheel assembly 16 , all driven by a stepper motor 17 . these paper feed components are mounted between a pair of bearing moldings 18 , which are in turn mounted to the chassis 10 at each respective end thereof . a printhead assembly 11 is mounted to the chassis 10 by means of respective printhead spacers 20 mounted to the chassis 10 . the spacer moldings 20 increase the printhead assembly length to 220 mm allowing clearance on either side of 210 mm wide paper . the printhead construction is shown generally in fig4 to 8 . the printhead assembly 11 includes a printed circuit board ( pcb ) 21 having mounted thereon various electronic components including a 64 mb dram 22 , a pec chip 23 , a qa chip connector 24 , a microcontroller 25 , and a dual motor driver chip 26 . the printhead is typically 203 mm long and has ten print chips 27 ( fig1 ), each typically 21 mm long . these print chips 27 are each disposed at a slight angle to the longitudinal axis of the printhead ( see fig1 ), with a slight overlap between each print chip which enables continuous transmission of ink over the entire length of the array . each print chip 27 is electronically connected to an end of one of the tape automated bond ( tab ) films 28 , the other end of which is maintained in electrical contact with the undersurface of the printed circuit board 21 by means of a tab film backing pad 29 . the preferred print chip construction is as described in u . s . pat . no . 6 , 044 , 646 by the present applicant . each such print chip 27 is approximately 21 mm long , less than 1 mm wide and about 0 . 3 mm high , and has on its lower surface thousands of mems inkjet nozzles 30 , shown schematically in fig9 a and 9b , arranged generally in six lines — one for each ink type to be applied . each line of nozzles may follow a staggered pattern to allow closer dot spacing . six corresponding lines of ink passages 31 extend through from the rear of the print chip to transport ink to the rear of each nozzle . to protect the delicate nozzles on the surface of the print chip each print chip has a nozzle guard 43 , best seen in fig9 a , with microapertures 44 aligned with the nozzles 30 , so that the ink drops ejected at high speed from the nozzles pass through these microapertures to be deposited on the paper passing over the platen 14 . ink is delivered to the print chips via a distribution molding 35 and laminated stack 36 arrangement forming part of the printhead 11 . ink from an ink cassette 37 ( fig2 and 27 ) is relayed via individual ink hoses 38 to individual ink inlet ports 34 integrally molded with a plastics duct cover 39 which forms a lid over the plastics distribution molding 35 . the distribution molding 35 includes six individual longitudinal ink ducts 40 and an air duct 41 which extend throughout the length of the array . ink is transferred from the inlet ports 34 to respective ink ducts 40 via individual cross - flow ink channels 42 , as best seen with reference to fig7 . it should be noted in this regard that although there are six ducts depicted , a different number of ducts might be provided . six ducts are suitable for a printer capable of printing four color process ( cmyk ) as well as infra - red ink and fixative . air is delivered to the air duct 41 via an air inlet port 61 , to supply air to each print chip 27 , as described later with reference to fig6 to 8 , 20 and 21 . situated within a longitudinally extending stack recess 45 formed in the underside of distribution molding 35 are a number of laminated layers forming a laminated ink distribution stack 36 . the layers of the laminate are typically formed of micro - molded plastics material . the tab film 28 extends from the undersurface of the printhead pcb 21 , around the rear of the distribution molding 35 to be received within a respective tab film recess 46 ( fig2 ), a number of which are situated along a chip housing layer 47 of the laminated stack 36 . the tab film relays electrical signals from the printed circuit board 21 to individual print chips 27 supported by the laminated structure . the distribution molding , laminated stack 36 and associated components are best described with reference to fig7 to 19 . fig1 depicts the distribution molding cover 39 formed as a plastics molding and including a number of positioning spigots 48 which serve to locate the upper printhead cover 49 thereon . as shown in fig7 , an ink transfer port 50 connects one of the ink ducts 39 ( the fourth duct from the left ) down to one of six lower ink ducts or transitional ducts 51 in the underside of the distribution molding . all of the ink ducts 40 have corresponding transfer ports 50 communicating with respective ones of the transitional ducts 51 . the transitional ducts 51 are parallel with each other but angled acutely with respect to the ink ducts 40 so as to line up with the rows of ink holes of the first layer 52 of the laminated stack 36 to be described below . the first layer 52 incorporates twenty four individual ink holes 53 for each of ten print chips 27 . that is , where ten such print chips are provided , the first layer 52 includes two hundred and forty ink holes 53 . the first layer 52 also includes a row of air holes 54 alongside one longitudinal edge thereof . the individual groups of twenty four ink holes 53 are formed generally in a rectangular array with aligned rows of ink holes . each row of four ink holes is aligned with a transitional duct 51 and is parallel to a respective print chip . the undersurface of the first layer 52 includes underside recesses 55 . each recess 55 communicates with one of the ink holes of the two centre - most rows of four holes 53 ( considered in the direction transversely across the layer 52 ). that is , holes 53 a ( fig1 ) deliver ink to the right hand recess 55 a shown in fig1 , whereas the holes 53 b deliver ink to the left most underside recesses 55 b shown in fig1 . the second layer 56 includes a pair of slots 57 , each receiving ink from one of the underside recesses 55 of the first layer . the second layer 56 also includes ink holes 53 which are aligned with the outer two sets of ink holes 53 of the first layer 52 . that is , ink passing through the outer sixteen ink holes 53 of the first layer 52 for each print chip pass directly through corresponding holes 53 passing through the second layer 56 . the underside of the second layer 56 has formed therein a number of transversely extending channels 58 to relay ink passing through ink holes 53 c and 53 d toward the centre . these channels extend to align with a pair of slots 59 formed through a third layer 60 of the laminate . it should be noted in this regard that the third layer 60 of the laminate includes four slots 59 corresponding with each print chip , with two inner slots being aligned with the pair of slots formed in the second layer 56 and outer slots between which the inner slots reside . the third layer 60 also includes an array of air holes 54 aligned with the corresponding air hole arrays 54 provided in the first and second layers 52 and 56 . the third layer 60 has only eight remaining ink holes 53 corresponding with each print chip . these outermost holes 53 are aligned with the outermost holes 53 provided in the first and second laminate layers . as shown in fig9 a and 9b , the third layer 60 includes in its underside surface a transversely extending channel 61 corresponding to each hole 53 . these channels 61 deliver ink from the corresponding hole 53 to a position just outside the alignment of slots 59 therethrough . as best seen in fig9 a and 9b , the top three layers of the laminated stack 36 thus serve to direct the ink ( shown by broken hatched lines in fig9 b ) from the more widely spaced ink ducts 40 of the distribution molding to slots aligned with the ink passages 31 through the upper surface of each print chip 27 . as shown in fig1 , which is a view from above the laminated stack , the slots 57 and 59 can in fact be comprised of discrete co - linear spaced slot segments . the fourth layer 62 of the laminated stack 36 includes an array of ten chip - slots 65 each receiving the upper portion of a respective print chip 27 . the fifth and final layer 64 also includes an array of chip - slots 65 which receive the chip and nozzle guard assembly 43 . the tab film 28 is sandwiched between the fourth and fifth layers 62 and 64 , one or both of which can be provided with recesses to accommodate the thickness of the tab film . the laminated stack is formed as a precision micro - molding , injection molded in an acetal type material . it accommodates the array of print chips 27 with the tab film already attached and mates with the cover molding 39 described earlier . rib details in the underside of the micro - molding provides support for the tab film when they are bonded together . the tab film forms the underside wall of the printhead module , as there is sufficient structural integrity between the pitch of the ribs to support a flexible film . the edges of the tab film seal on the underside wall of the cover molding 39 . the chip is bonded onto one hundred micron wide ribs that run the length of the micro - molding , providing a final ink feed to the print nozzles . the design of the micro - molding allow for a physical overlap of the print chips when they are butted in a line . because the printhead chips now form a continuous strip with a generous tolerance , they can be adjusted digitally to produce a near perfect print pattern rather than relying on very close toleranced moldings and exotic materials to perform the same function . the pitch of the modules is typically 20 . 33 mm . the individual layers of the laminated stack as well as the cover molding 39 and distribution molding can be glued or otherwise bonded together to provide a sealed unit . the ink paths can be sealed by a bonded transparent plastic film serving to indicate when inks are in the ink paths , so they can be fully capped off when the upper part of the adhesive film is folded over . ink charging is then complete . the four upper layers 52 , 56 , 60 , 62 of the laminated stack 36 have aligned air holes 54 which communicate with air passages 63 formed as channels formed in the bottom surface of the fourth layer 62 , as shown in fig9 b and 13 . these passages provide pressurised air to the space between the print chip surface and the nozzle guard 43 whilst the printer is in operation . air from this pressurised zone passes through the micro - apertures 44 in the nozzle guard , thus preventing the build - up of any dust or unwanted contaminants at those apertures . this supply of pressurised air can be turned off to prevent ink drying on the nozzle surfaces during periods of non - use of the printer , control of this air supply being by means of the air valve assembly shown in fig6 to 8 , 20 and 21 . with reference to fig6 to 8 , within the air duct 41 of the printhead there is located an air valve molding 66 formed as a channel with a series of apertures 67 in its base . the spacing of these apertures corresponds to air passages 68 formed in the base of the air duct 41 ( see fig6 ), the air valve molding being movable longitudinally within the air duct so that the apertures 67 can be brought into alignment with passages 68 to allow supply the pressurized air through the laminated stack to the cavity between the print chip and the nozzle guard , or moved out of alignment to close off the air supply . compression springs 69 maintain a sealing inter - engagement of the bottom of the air valve molding 66 with the base of the air duct 41 to prevent leakage when the valve is closed . the air valve molding 66 has a cam follower 70 extending from one end thereof , which engages an air valve cam surface 71 on an end cap 74 of the platen 14 so as to selectively move the air valve molding longitudinally within the air duct 41 according to the rotational positional of the multi - function platen 14 , which may be rotated between printing , capping and blotting positions depending on the operational status of the printer , as will be described below in more detail with reference to fig2 to 24 . when the platen 14 is in its rotational position for printing , the cam holds the air valve in its open position to supply air to the print chip surface , whereas when the platen is rotated to the non - printing position in which it caps off the micro - apertures of the nozzle guard , the cam moves the air valve molding to the valve closed position . with reference to fig2 to 24 , the platen member 14 extends parallel to the printhead , supported by a rotary shaft 73 mounted in bearing molding 18 and rotatable by means of gear 79 ( see fig3 ). the shaft is provided with a right hand end cap 74 and left hand end cap 75 at respective ends , having cams 76 , 77 . the platen member 14 has a platen surface 78 , a capping portion 80 and an exposed blotting portion 81 extending along its length , each separated by 120 °. during printing , the platen member is rotated so that the platen surface 78 is positioned opposite the printhead so that the platen surface acts as a support for that portion of the paper being printed at the time . when the printer is not in use , the platen member is rotated so that the capping portion 80 contacts the bottom of the printhead , sealing in a locus surrounding the microapertures 44 . this , in combination with the closure of the air valve by means of the air valve arrangement when the platen 14 is in its capping position , maintains a closed atmosphere at the print nozzle surface . this serves to reduce evaporation of the ink solvent ( usually water ) and thus reduce drying of ink on the print nozzles while the printer is not in use . the third function of the rotary platen member is as an ink blotter to receive ink from priming of the print nozzles at printer start up or maintenance operations of the printer . during this printer mode , the platen member 14 is rotated so that the exposed blotting portion 81 is located in the ink ejection path opposite the nozzle guard 43 . the exposed blotting portion 81 is an exposed part of a body of blotting material 82 inside the platen member 14 , so that the ink received on the exposed portion 81 is drawn into the body of the platen member . further details of the platen member construction may be seen from fig2 and 24 . the platen member consists generally of an extruded or molded hollow platen body 83 which forms the platen surface 78 and receives the shaped body of blotting material 82 of which a part projects through a longitudinal slot in the platen body to form the exposed blotting surface 81 . a flat portion 84 of the platen body 83 serves as a base for attachment of the capping member 80 , which consists of a capper housing 85 , a capper seal member 86 and a foam member 87 for contacting the nozzle guard 43 . with reference again to fig1 , each bearing molding 18 rides on a pair of vertical rails 101 . that is , the capping assembly is mounted to four vertical rails 101 enabling the assembly to move vertically . a spring 102 under either end of the capping assembly biases the assembly into a raised position , maintaining cams 76 , 77 in contact with the spacer projections 100 . the printhead 11 is capped when not is use by the full - width capping member 80 using the elastomeric ( or similar ) seal 86 . in order to rotate the platen assembly 14 , the main roller drive motor is reversed . this brings a reversing gear into contact with the gear 79 on the end of the platen assembly and rotates it into one of its three functional positions , each separated by 120 °. the cams 76 , 77 on the platen end caps 74 , 75 co - operate with projections 100 on the respective printhead spacers 20 to control the spacing between the platen member and the printhead depending on the rotary position of the platen member . in this manner , the platen is moved away from the printhead during the transition between platen positions to provide sufficient clearance from the printhead and moved back to the appropriate distances for its respective paper support , capping and blotting functions . in addition , the cam arrangement for the rotary platen provides a mechanism for fine adjustment of the distance between the platen surface and the printer nozzles by slight rotation of the platen 14 . this allows compensation of the nozzle - platen distance in response to the thickness of the paper or other material being printed , as detected by the optical paper thickness sensor arrangement illustrated in fig2 . the optical paper sensor includes an optical sensor 88 mounted on the lower surface of the pcb 21 and a sensor flag arrangement mounted on the arms 89 protruding from the distribution molding . the flag arrangement comprises a sensor flag member 90 mounted on a shaft 91 which is biased by torsion spring 92 . as paper enters the feed rollers , the lowermost portion of the flag member contacts the paper and rotates against the bias of the spring 92 by an amount dependent on the paper thickness . the optical sensor detects this movement of the flag member and the pcb responds to the detected paper thickness by causing compensatory rotation of the platen 14 to optimize the distance between the paper surface and the nozzles . fig2 and 27 show attachment of the illustrated printhead assembly to a replaceable ink cassette 93 . six different inks are supplied to the printhead through hoses 94 leading from an array of female ink valves 95 located inside the printer body . the replaceable cassette 93 containing a six compartment ink bladder and corresponding male valve array is inserted into the printer and mated to the valves 95 . the cassette also contains an air inlet 96 and air filter ( not shown ), and mates to the air intake connector 97 situated beside the ink valves , leading to the air pump 98 supplying filtered air to the printhead . a qa chip is included in the cassette . the qa chip meets with a contact 99 located between the ink valves 95 and air intake connector 96 in the printer as the cassette is inserted to provide communication to the qa chip connector 24 on the pcb . | 1 |
the present is a technique that is useful for marking or coating glass capillary outer diameters or lumen , glass fibers and organically coated fibers and capillaries . the technique according to the present invention uses a metallorganic material to “ paint ” or coat ( or mark ) strands , in the draw line , after the strand has been drawn in a draw tower . the coated strands are then heated to a temperature that is sufficient to degrade the metallorganic and drive off the organic portions , thereby leaving a metal coating behind . preferably , the heating is performed in a draw tower after the strand has been drawn . alternately , the strand may be premanufactured and coated and heated separately . it is preferable that the heating of the metallorganic coated strand be done with an infrared ( ir ) heater , but it has been found that laser curing the metallorganic materials also works as does convective heating , in limited cases . when heating an organically precoated strand using an ir heater , it is most preferred to use an ir band in which the organic precoat does not substantially absorb . this helps ensure that the integrity of the organic precoat is not compromised during the “ curing ” process . not only can the body and ends of the strands be coated with metals , but the strands may be selectively marked , such as in precisely spaced bands , either by precise application of the “ paint ” or , more interestingly , by painting the entire section and “ curing ” with precise location of the laser focus . the uncured material is then either retained or washed away with solvent . in one embodiment , a laser would be located in a draw tower , with the laser beam split to several spots spaced at regular intervals , such as 0 . 5 mm . the “ paint ” is applied on the bare glass and then either flash cured into lines or the laser is moved in step with the strand draw for slower cures . the marked strand is then passed through a solvent to remove the uncured material and coat the finished product with standard polymers . this could be done in intervals such as 5 cm to offer new rulings in reprocessed fiber . finally , this manufacturing technique could be done continuously . gc and ce dimensioned capillary was coated with gold containing metalorganic material during the draw manufacturing process . the coated capillary was placed in a furnace at 450 ° c . along with control fibers of the same material coated with only polyimide . after ½ hour , the uncoated polyimide failed , but the gold coated polyimide did not . within about 8 hours , the uncoated polyimide samples ( controls ) were bare glass and the gold coated polyimide remained intact . in this application , it appears that the gold blocks oxygen from the polyimide . while , polyimide can take very high temperatures in the absence of oxygen , it fails at about 375 ° c . in the presence of oxygen . in the petroleum industry , gc separations are done at temperatures that often exceed the upper continuous use temperature of the polyimide coating , e . g ., 425 ° c ., and capillary gc columns are essentially disposable as a result . thus , the metal coated silica strands manufactured according to the present invention can provide high temperature gc capillaries , high temperature optical fibers , and capillaries that are resistant to chemicals that normally would attack the underlying polyimide coating , such as strong acids and bases . also , the gold may be soldered , so one can make simple hermetic seals on fiber and capillary . further , one can transmit electricity down a fiber or capillary or establish a static electrical field around the fiber or capillary , which might lead to applications in sensors and perhaps even in ce related methods and biotechnology applications . a possible application for this process is the manufacture a surgical fiber , particularly one using long wavelengths where gold is at least partially reflective and where the “ bare ” fiber is made visible in x - ray and in endocscopic procedures where saline flush is used . currently , the fiber almost disappears in the aqueous environment , making placement of the tip very difficult . rulings on the fiber tip would be useful to the surgeon in gauging the dimensions of target tissues , e . g ., urinary calculi . this method would be useful because normally the fiber or choice for such applications has a secondary ( 2 °) numerical aperture ( na ), due to the low index polymer coating on the outside diameter ( od ) of fluorine doped glass cladding . in bending stresses , evanescent field energy leaks into the glass cladding , as cladding modes . when the bends become sharp enough to exceed the secondary na , the polymer coating ( 2 ° cladding ) burns and the fiber fails , often damaging costly endoscopic equipment , causing injury to the patient or even surgical personnel . while gold is not an excellent reflector until about 3 μm wavelength , it does reflect at 2 . 1 μm , so it should function as a reflective - type containment of the cladding modes . different metals used in the method according to the present invention include , but are not limited to , gold , silver , platinum , palladium , and the like , which would permit use of fiber ( if directly coated on glass thickly enough ) at up to 1000 ° c . finally , additional polymer coatings may be applied over the metallic coatings or markings in order to provide physical protection to the coated materials for handling and additional processing . the preferred embodiment of the invention is described above in the description of preferred embodiments . while these descriptions directly describe the above embodiments , it is understood that those skilled in the art may conceive modifications and / or variations to the specific embodiments shown and described herein . any such modifications or variations that fall within the purview of this description are intended to be included therein as well . unless specifically noted , it is the intention of the inventors that the words and phrases in the specification and claims be given the ordinary and accustomed meanings to those of ordinary skill in the applicable art ( s ). the foregoing description of a preferred embodiment and best mode of the invention known to the applicant at the time of filing the application has been presented and is intended for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and many modifications and variations are possible in the light of the above teachings . the embodiment was chosen and described in order to best explain the principles of the invention and its practical application and to enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . | 2 |
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . referring to fig1 , there is shown a system 10 for changing the angle of a nose of a bullet , relative to the body , while the bullet is in flight to control the trajectory of the bullet . in general , the nose of the bullet is rotated in accordance with a generally constant nose angle , smoothly relative to the bullet body , with a rotation rate equal to but in opposite direction as the rotation rate of the bullet . this enables the bullet to appear to have a bent nose that is constant in its orientation relative to air stream through which it flies , and thus can be used to control the trajectory of the bullet after it leaves the barrel of weapon . in fig1 , the system 10 involves the use of a projectile 12 having a body portion 14 , a nose 16 , and a reduced diameter portion 18 for supporting the nose 16 from the body portion 14 . the reduced diameter portion 18 is preferably made from a material that is slightly flexible , such as high strength steel . an electronic subsystem 22 is located within a central portion 20 of the body portion 14 for controlling a wobbling motion ( i . e ., deflection ) of the nose 16 as the projectile 12 is in flight . in one form the projectile 12 may comprise a bullet , for example a . 50 caliber round of ammunition that is fired from a rifle , automatic weapon , or any other suitable weapon . the system 10 is not limited to use with any one caliber of projectile , but rather may be incorporated into larger or smaller caliber projectiles . however , with the long useable range of . 50 caliber bullet , which may extend for one mile or longer , the accuracy provided by the present system 10 is expected to significantly enhance the effectiveness of such a projectile and its corresponding weapon . the projectile 12 may be substantially enclosed within a conventional casing 23 before being fired from a weapon 25 . with further reference to fig1 , the nose 16 is also supported by three electrically responsive components 24 a , 24 b and 24 c . in one embodiment the electrically responsive components 24 a - 24 c may comprise piezoceramic actuators , however , any form of electrically responsive materials may be used , provided they have the ability to alter their shape in response to an electrical signal . for convenience , the electrically responsive components 24 a - 24 c will be referred to throughout the following discussion simply as “ piezoceramic actuators ” 24 a - 24 c . the piezoceramic actuators 24 a - 24 c each may be shaped like a beam . each is further coupled at a first end 26 to an associated coupling element 28 , and at a second end 30 to a coupling element 32 . the coupling elements 28 and 30 are fixedly secured either by suitable adhesives or mechanical fasteners to the nose 16 and body portion 14 respectively . as shown in fig2 , the piezoceramic actuators 24 a - 24 c are further arranged so that they spaced apart preferably about 120 degrees from one another around the circumference of the nose 16 . as will be described in more detail in the following paragraphs , the piezoceramic actuators 24 a - 24 c are controllably actuated to cause the nose 16 to be tilted ( or deflected ) away from the axial center 34 of the projectile 12 during flight . this is highly useful in controlling the trajectory of the projectile 12 . as will be appreciated , a projectile such as a bullet typically exits the barrel of the weapon from which it was fired with a high degree of spin . the rate of spin may be up to 15 , 000 rpm or even higher . typically the nose of a bullet will begin to “ wobble ” slightly as it flies through the atmosphere after leaving the barrel . by “ wobble ”, it is meant that the axial center of the nose of the bullet moves through and around the generally linear path that the bullet is travelling . as the bullet travels towards its intended target the amount of wobble of the nose typically gets worse . depending on the distance to the target and the atmospheric conditions present , such as wind , rain , snow , etc ., the wobble may become significantly pronounced . eventually , the bullet may actually begin tumbling end over end before it reaches its intended target . obviously , the greater the degree of wobble of the nose during flight , generally the greater the loss of accuracy of the bullet that will be experienced . with brief reference to fig3 , for example , when piezoceramic actuator 24 a is actuated , it bows or “ buckles ”, causing it to pull the nose 16 of the projectile 12 away from the axial center 34 of the projectile 12 . depending which one piezoceramic actuator 24 ( or pair of actuators 24 ) is actuated , the nose 16 will be deflected in an intended direction . this controlled deflection or controlled wobble of the nose 16 is used to effectively cancel the wobble that the nose 16 of the projectile 12 would otherwise experience during flight if the piezoceramic actuators 24 a - 24 c were not being used . selectively actuating specific ones of the piezoceramic actuators 24 a - 24 c allows the nose 16 of the projectile to be kept in a constant orientation , relative to a reference surface ( e . g ., a ground surface ). this can significantly enhance the accuracy of the projectile 12 . it will also be appreciated that while the piezoceramic actuators 24 a - 24 c are shown in linear orientations in fig1 and 2 , that the actuators could just as readily be configured so that they assume a normally bowed or buckled shape . then , straightening out any given one of the piezoceramic actuators 24 a - 24 c , either by applying a suitable electrical signal or removing an electrical signal , could achieve the desired deflection of the nose 16 described above . it will also be appreciated that while three piezoceramic actuators 24 a - 24 c are illustrated , that a greater or lesser plurality of actuators could be employed . the number of piezoceramic actuators 24 used will affect the degree of precision by which the nose 16 can be deflected . however , the greater the number of actuators 24 used the greater the complexity and cost of the signal processing electronics that will likely be required . referring now to fig4 , a more detailed illustration of one embodiment of the electronic subsystem 22 of the system 10 is shown . initially , it will be appreciated that the system 10 includes an external signal source 36 for supplying a wireless signal that may be used by the system 10 in implementing control of the piezoceramic actuators 24 a - 24 c . the wireless signal is preferably an electromagnetic wave signal ( e . g ., an rf signal ). a projectile launch sensor 38 is physically attached to the weapon that is used to fire the projectile 12 so that the recoil of the weapon can be sensed , and the approximate instant that firing occurs can be detected . the launch sensor 38 may be a strain gauge or any other suitable form of sensor , for example a sensor formed from a piezoelectric polymer such as a polyvinylidene fluoride ( pvdf ). such a sensor is commercially available from ktech corporation of albuquerque , n . mex . alternatively it be an electrically isolated section of the piezoceramic material or the bimorph beam itself which is able to detect the firing ( i . e ., recoil ) of the projectile . the electronic subsystem 22 includes an antenna , which is also shown in fig3 . the antenna , as shown in fig3 , is preferably orientated perpendicular to the axial center of the projectile 12 . the signal being emitted from the external signal source 36 may be a polarized signal , for example a vertically polarized signal . thus , the strength of the signal received by the antenna 40 will vary significantly , and in a cyclic manner , as the physical orientation of the projectile 12 changes when the projectile spins during flight . this is because the physical orientation of the antenna 40 will be continuously changing such that a signal of increasing strength , and then decreasing strength , will be received , in an alternating fashion . the frequency of cyclic signal will also be in accordance with the spin rate of the projectile 12 . the antenna 40 may comprise a patch antenna that is linearly polarized . alternatively , a magnetic sensor may be used in place of the antenna 40 and external rf signal 36 . the magnetic sensor may sense the earth &# 39 ; s magnetic field as it spins and generate a sinusoidally varying output waveform that is referenced to the spin rate , and also to the roll angle , of the projectile 12 . the electronic subsystem 22 may include a roll angle reference oscillator 42 , a phase lock loop subsystem 44 , a flight command processor 46 , a nose angle sensor 48 , a three phase signal generator 50 , an amplitude control subsystem 52 , an acceleration command generator 54 , and an actuator drive subsystem 56 . the roll angle reference oscillator 42 receives the varying output signal from the antenna 40 and the launch signal from the launch sensor 38 . upon receiving the launch signal , the roll angle reference oscillator 42 begins generating a sinusoidally varying ( i . e ., oscillating ) reference signal having a frequency that is tied to the spin rate of the projectile 12 , and which is also indicative of the roll angle of the projectile 12 . thus , if the spin rate of the projectile 12 as the projectile leaves the weapon is 150 , 000 rpm , then the frequency of the output signal from the roll angle reference oscillator 42 may be 2 . 5 khz . also , since one revolution of the projectile 12 will represent one cycle of the oscillator &# 39 ; s 42 signal , this sinusoidal signal forms a measure of the projectile roll angle at any given instant . the nose angle sensor 48 supplies signals relating to the angle of the nose wobble at any given instant to the flight control processor 46 . one implementation is to electrically isolate a small section of the piezoceramic material located on each piezoceramic actuator 24 , thus forming a strain sensor that measures the deflection of the piezoceramic actuator 24 , and hence the angle between the nose 16 and the bullet body portion 14 . the angle of wobble of the nose 16 of the projectile 12 is relative to the axial center of the body portion 14 . the output of the roll angle reference oscillator 42 is fed to an input of the phase lock loop ( pll ) subsystem 44 . the pll subsystem 44 also receives an output from the flight command processor 46 and from the actuator drive subsystem 54 . the flight command processor 46 provides the phase offset commands that are used by the pll subsystem 44 to generate the needed phase control signals to the three phase generator 50 . put differently , the signal output from the flight control processor 46 represents the desired phase difference ( i . e ., offset ), at a given time , between are the phase angle of the sinusoidal output from the roll angle reference oscillator 42 and the projectile nose wobble output from the nose angle sensor 48 . essentially , the direction command subsystem 46 provides an input signal to the pll subsystem 44 that tells the pll subsystem what is the offset phase of the electrical signals that that need to be generated to offset the wobble of the nose 16 and to maintain the nose at a desired angle relative to a reference surface . for example , in fig3 , the desired angle 34 a of the nose 16 may be preselected to be 20 degrees . the flight control processor 46 would then be programmed to provide the offset needed to maintain the nose at the desired 20 degree angle . the precise angle selected may depend on various factors , including the type of projectile ( e . g ., caliber ) being used , or possibly even the environment in which the projectile is being used ( e . g ., in windy , rainy weather ). an option is a remote flight control processor 46 a . a remote flight control processor would receive wireless signals , for example wireless rf signals , from the nose angle sensor 48 and the acceleration command generator 54 , and send wireless phase offset signals back to the pll subsystem 44 to control angular orientation of the nose 16 of the projectile 12 . the remote flight control processor 46 a could be located on a mobile platform or at a stationary location , such as a nearby command facility . returning to fig4 , the pll subsystem 44 generates the phase control signals that the three phase signal generator 50 uses to generate the three phase electrical signals that are used for controlling the piezoceramic actuators 24 a - 24 c . the output signals from the three phase signal generator 50 are modified by the amplitude control subsystem 52 , based on the desired normal acceleration of the nose 16 . the amplitude control subsystem 52 output signals may be generated by a suitable guidance algorithm used therewith . thus , when the acceleration of the projectile 12 is at a maximum value , and the wobble of the nose 16 is expected to be at its lowest magnitude , the acceleration command generator may not attenuate the signals output from the three phase generator 50 at all . but as the projectile 12 flies along it path of travel , the acceleration command generator 54 may signal to the amplitude control subsystem 52 to slightly increase the magnitudes of the output signals being provided to the actuator drive subsystem 56 . this allows the amplitude of the drive signals to be tailored to the speed of the projectile 12 . referring further to fig4 , the actuator drive subsystem 56 can be seen to include switching elements 58 a , 58 b , 60 a , 60 b , and 62 a - 62 b . an inductor 64 is disposed between the two switching elements 58 a and 58 b . a second inductor 66 is disposed between the two switching elements 60 a and 60 b , and a third inductor 68 is disposed between the switching elements 62 a and 62 b . the inductors 64 , 66 and 68 take the switching signals from the amplitude control subsystem 52 and help to provide sinusoidal electrical switching signals to the piezoceramic actuators 24 a - 24 c . the output signals from the amplitude control subsystem 52 control the switches associated with each of the piezoceramic actuators 24 a - 24 c . in effect , the switching signals applied to the switches 60 a , 60 b will be 120 degrees out of phase ( e . g ., advanced ), from those applied to switches 58 a , 58 b . the signals applied to switches 62 a , 62 b will be 120 out of phase ( e . g ., advanced ) from those applied to switches 60 a , 60 b . referring briefly to fig5 a - 5c , one example of the switching signals is shown . switching signal 70 may be applied to piezoceramic actuator 24 a , switching signal 72 to piezoceramic actuator 24 b and switching signal 74 to piezoceramic actuator 24 c . signal 72 is advanced 120 degrees in phase from signal 70 , and signal 74 is advanced 120 degrees in phase from signal 72 . referring to fig6 , a flowchart 100 is shown illustrating exemplary operations that the system 10 may perform in controlling the flight of the projectile 16 . initially , at operation 102 , the launch of the projectile 12 is first detected . at operation 104 the roll angle and spin rate of the projectile 12 is sensed . at operation 106 the roll angle and spin rate are used by the roll angle reference oscillator 42 to generate the roll angle reference signal . at operation 108 the needed flight control information is obtained from the flight control processor 46 . at operation 110 the pll subsystem 44 generates the pll signals that are used by the three phase generator 50 . at operation 112 the magnitude of the three phase switching signals from the three phase generator 50 are adjusted in relation to the acceleration of the projectile 16 . at operation 114 the amplitude adjusted switching signals are applied to the piezoceramic actuators 24 a - 24 c . the system 10 and method of the present disclosure enables the attitude of the nose of a projectile to be maintained at a desired attitude over the course of its flight , relative to some external reference line , for example a ground surface , over which the projectile is travelling . this can significantly increase the accuracy of the projectile . while various embodiments have been described , those skilled in the art will recognize modifications or variations which might be made without departing from the present disclosure . the examples illustrate the various embodiments and are not intended to limit the present disclosure . therefore , the description and claims should be interpreted liberally with only such limitation as is necessary in view of the pertinent prior art . | 6 |
the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which a preferred embodiment of the invention is shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , this embodiment is provided so that this disclosure will be thorough and complete and will fully convey the scope of the invention to those skilled in the art . referring now to the drawings , there is shown in fig1 and 2 , an embodiment of the present invention , which is a monopod , generally designated 10 that is lightweight and portable . it provides support to the camera 11 and enhances user control throughout the slotted length of its permitted travel along the hollow shaft 12 , and the up and down tilting of the camera . the slotted length is defined by a hollow shaft slot 13 that runs along a part of the length of the hollow shaft 12 . the hollow shaft 12 has an upper end 7 and lower end 9 , and comprises the primary mechanism of the embodiment of the present invention and is able to stand alone or on an assortment of bases such as a foot plug 14 . also shown is a support leg 16 that is joined to the hollow shaft 12 in order to extend the gross working vertical length of the monopod 10 , as well as a camera mount and tilt mechanism 79 , which facilitates the retention and control of a camera . the hollow shaft 12 incorporates the primary mechanism of the monopod 10 , and has a hollow shaft head 19 to which capsules 30 , 30 ′ are attached and a hollow shaft foot 18 that enables the monopod to either stand alone or on an assortment of bases . the hollow shaft 12 is connected at its hollow shaft foot 18 to a support leg 16 by means of a connector plug 14 to thereby extend the gross working vertical height of the monopod 10 . the connector plug 14 is generally cylindrical and formed so that its end forms an interference fit with the internal surface of the hollow shaft 12 and support leg 16 , and is over sized in the middle to form a connector plug spacer 15 to prevent damage to the hollow shaft and support leg . the support leg 16 may be any one of a variety of tubes , stands , and tripods ; alternatively , if an extension is desired , the foot plug 17 at the base of the support leg 16 can be replaced by a variety of tubes , stands , and tripods to broaden the versatility of the present invention across an increased range of photographic opportunities and environments . alternatively , the foot plug can also be supplied with a spiked end to enable placement of the monopod on the ground . referring also now to fig3 , shown is an enlarged view of the constant force spring mechanism which comprises constant force helical springs 20 , 20 ′ that are connected to a movable plug 50 by pin 25 that fits into helical spring retaining hole 52 . more specifically , the constant force helical springs 20 , 20 ′ sit at the top of the hollow shaft 12 . the movable plug 50 travels inside the cavity of the hollow shaft 12 as a result of its attachment to collar 60 which the user photographer causes to move . movable plug 50 is attached to the collar 60 and collar sleeve 61 via collar pin 62 , which fits into plug retaining hole 53 through slot 13 . since collar 60 travels along the outside of the hollow shaft 12 in tandem with the movable plug 50 , it therefore contributes to maintaining the mechanical integrity of the hollow shaft 12 by preventing its walls from buckling inward or outward . the collar 60 also supports a camera mount plate 80 upon which camera mount bracket 89 rests and provides for an up / down camera tilt feature . collar sleeve 61 interfaces between the collar 60 and hollow shaft 12 and is selected from materials that ensure that it is slideably connected to the hollow shaft 12 and is intended to minimize friction as it slides along the length of the hollow shaft 12 . constant force helical springs 20 , 20 ′ act as counterweight force means and are selected to counteract the loading force of the movable plug 50 and the other elements attached to the movable plug 50 , as well as in accordance with the specific desire of the photographer user . constant force helical spring 20 , 20 ′ are mounted with internal diameters tightly wrapped around drums 21 , 21 ′ that ride on bearings 22 , 22 ′ which are in turn held in place by axles 23 , 23 ′ that are further retained by capsules 30 , 30 ′. constant force helical springs 20 , 20 ′ will have the tendency to force the top of the capsules 30 , 30 ′ away from each other . in order to hold capsules 30 , 30 ′ in the positions shown in fig3 , container box 40 is used to counteract the forces . those skilled in the art will realize that there are numerous means to hold or mechanically bond capsules 30 , 30 ′ together . the free ends of the constant force springs attached to the loading force , which is the movable plug 50 , etc . the movable plug 50 also has a slot 51 to receive the constant force helical spring ends 24 and a hole 52 through which the spring ends 24 are secured by a pin 25 . in other embodiments , the load capacity can be increased by using a plurality of constant force springs mounted in tandem on top of each other . turning now to fig4 and 5 , in addition to height adjustment , the present invention includes means to mount and control the camera &# 39 ; s vertical attitude ( up and down tilt ) by a camera and tilt mechanism 79 that is mounted onto the collar 60 . tapped holes in collar 60 receive coves 63 , 63 ′ that convert one side of collar 60 into a flat plane . spacer screws 64 , 64 ′ retain coves 63 , 63 ′ and the rear pressure plate 70 against the hollow shaft 12 . the camera mount and tilt mechanism 79 includes a rear pressure plate 70 and front pressure plate 70 ′ and corresponding friction pads 81 , 81 ′, which are used to sandwich a rotating camera mount plate 80 . a camera mount spindle 82 extends from the rotating mount plate 80 through to the front pressure plate 70 ′ and is mechanically attached to the camera mount tongue 83 using splines , screws , welding , chemical bonding or similar means . an element of the camera mount and tilt mechanism 79 is that the center of gravity of the camera is generally near the centerline of spindle 82 . tightening pressure plate adjustment screw 72 , 72 ′ forces friction pads 81 , 81 ′ against rotating camera mount plate 80 thereby restricting its rotational movement . this permits the user to control the up and down tilt of the camera 11 from its free tilt position and further so that when the photographer is satisfied with the tilt angle and aim he can release the camera without changing the pre - adjusted camera tilt angle . the pressure can be adjusted according to the camera &# 39 ; s size and weight . furthermore , the moment produced by the weight of the camera 11 causes the collar 60 to tighten against the hollow shaft 12 and this enables both the collar 60 and the moveable plug 50 to which it is connected to hold fast against the monopod . turning now to fig6 , 7 and 8 , there is shown a camera mount bracket 89 and elements thereof . the camera mount bracket 89 comprises of a vertical mount bracket arm 90 and horizontal mount bracket arm 91 and are held together by bracket reinforcement screws 94 , 94 ′ and is further configured to mate with and be attached to the base of the camera 11 by means of mounting bolt 95 , whose travel is limited to the length of the slot 93 , which is sized in order to adjust to a variety of cameras . in the usual upright , vertical position , the female dovetail groove 96 of the camera mount bracket 89 slides over the mating male dovetail camera mount tongue 83 of fig5 . for the horizontal position , longitudinally formed dovetail groove 92 is also formed to slide over mating male dovetail camera mount tongue 83 in a similar manner . | 6 |
a receptacle which forms an embodiment of the invention comprises a receptacle front member 10 , a pair of power blade connector straps 12 and 14 , a receptacle body 16 , a ground blade connector strap 18 and a yoke 20 . the receptacle front member 10 comprises a front cover of generally rectangular shape and designated 10a , a pair of power contact side covers generally designated 10b and 10c , respectively , and a ground contact side cover generally designated 10d . the front cover 10a has two sets of apertures or slots extending perpendicularly therethrough to accommodate the various conductive blades of one or two male plugs inserted into the receptacle . the number of apertures and their configurations will , of course , depend upon the particular application or use to which the receptacle is to be put . the receptacle as illustrated has two sets of power blade apertures , designated 11a and 11b , respectively ; two sets of neutral blade apertures designated 13a and 13b , respectively , and two sets of ground blade apertures , designated 15a and 15b , respectively , to accommodate conventional three - blade plugs . if the receptacle is not a grounding type , the ground apertures 15a and 15b may be omitted and only two apertures provided in each set ; a power and a neutral aperture oriented in substantially parallel alignment . the entire receptacle front member is integrally molded with the side covers hinged to the front cover by means of &# 34 ; live &# 34 ; or web hinges . the ground connector strap 18 and yoke 20 are assembled into a unit by means of rivets 22 and 24 which pass through respective openings 26 and 28 in the yoke 20 and through respective openings 30 and 32 in the ground connector strap 18 and have their ends peened over to fixedly secure the strap 18 and yoke 20 together in good electrical contact . the receptacle further comprises a pair of side cover assembly screws 34 and 36 and a ground contact assembly screw 35 which , as described below , assist in the assembly and wiring of the receptacle . to assemble the receptacle , the ground blade connector strap 18 is placed inside the yoke 20 and riveted together and the sub - assembly is inserted into the receptacle body 16 from the bottom thereof as seen in fig1 . a dovetail 40 of the yoke 20 fits within a mating guide slot 42 in the receptacle body to secure this end of the yoke to the receptacle body . in this position , a pair of projections 44 and 46 fit within pocket or cavity 48 in the receptacle body 16 , another pair of projections 50 and 52 fit closely around the outside of the side walls forming another pocket 54 in the receptacle body 16 , a pair of grounding blades 56 and 58 forming one of the ground contacts fit and are thereby housed within the pocket 48 in the receptacle body 16 , toward the left - hand side of that pocket as seen in fig1 . the grounding strap 18 includes a tong 60 having at its top a threaded wallplate screw hole 62 aligned with wallplate aperture 62a . the tong 60 positioned against the inside surface of the projection 46 is , along with projection 46 , housed by the pocket 48 . to render greater stability to the cantilevered end of the tong bearing the screw hole 62 , tip portion 63 of the tong may be shouldered to seat against the opposite inwardly inclined edges 44b of the projection 44 , fig4 . in any event , the screw opening 61 of greater diameter than the screw 36 is substantially aligned with a threaded opening 47 in the projection 46 to permit unimpeded inward axial movement of the screw 36 through the opening 47 upon rotation of the screw during cover closure . another pair of ground contact blades 64 and 66 , forming another ground contact of the ground connector strap 18 fit within and are thereby housed by the pocket 54 . the guide slot 42 and pockets 48 and 54 in the receptacle body 16 extend through the entire receptacle body and are open at their bottom ends , which are not visible in fig1 . the power connector strap 14 is inserted into the receptacle body 16 , by dropping it into the body 16 from the top thereof as seen in fig1 such that its blades forming a power contact , generally indicated at 68 , fit within a pocket 70 in the receptacle body 16 and its blades forming another power contact generally indicated at 72 fit within another pocket 74 in the receptacle body 16 , its pair of legs 76 and 78 , which define a generally v - shaped insulation - displacement slot 80 therebetween , fit between abutments 82 and 84 of the receptacle body 16 and over a land 86 having a u - shaped slot 88 which is large enough to accommodate the largest conductor to be wired into the receptacle , and legs 90 and 92 defining between them a generally v - shaped insulation - displacement slot 94 fit between similar abutments 96 and 98 over a similar land 100 having a similar slot 102 . when so positioned , a break - off tab 157 is located over a cavity 138 behind an upstanding land 97 extending between the abutments 84 and 96 . tabs 79 and 89 are positioned to abut the land 97 and thereby limit outward movement of the slots 80 and 94 in a direction perpendicular to the longitudinal axis of the device 10 whether the tab 157 is broken off or not . the land 97 also serves as a fulcrum for the blade of a screwdriver which may be inserted in a slot 155 to bend and thus break the tab 157 from its supporting tabs 79 and 89 , respectively . as will be apparent , the outer edges of the legs 76 , 78 and 90 , 92 will bear against abutment 82 , 84 and 96 , 98 , respectively , to restrain the contacts 90 and 94 , respectively , against movement in directions parallel to the longitudinal axis of the device 10 . the inward edges 81 and 95 of the respective contacts 80 and 94 bear against the surfaces of the pocket 48 adjoining the lands 86 and 100 , respectively . the power blade connector strap 12 , which is a mirror image of the strap 14 , fits similarly in the receptacle body 16 such that its power blades generally indicated at 104 and 106 fit within pockets 108 and 110 , respectively , of the receptacle body 16 , an its insulation - displacement slots fit between similar abutments and over similar lands . the front member 10 is fitted to the thusly assembled components by aligning the tops of the projections 44 , 46 , 50 and 52 , which protrude above the top of the receptacle body 16 , with matching rectangular slots 112 , 114 , 118 and 116 , respectively , formed in the back of the front cover 10a of the front member 10 , fig2 . the projections 44 , 46 , 50 and 52 each have a plurality of sharp barbs on the outer edges of their top ends and are spaced apart far enough to bite into the opposite ends of the plastic walls defining the corresponding slots 112 - 118 in the front cover 10a . these barbs engaging the slot walls thereby secure together , with an interference fit , the entire assembly made up of the front cover 10a , the power blade connector straps 12 and 14 , the receptacle body 16 , the ground blade connector strap 18 and the yoke 20 . the slots 112 and 114 receiving the barbed ends of the projections 44 and 46 , respectively , are partially visible in fig2 and may be positioned on opposite sides of the wall plate aperture 62a . the front cover 10a includes integrally molded projections 120 and 122 positioned and dimensioned such that projection 120 , which is generally u - shaped in section with the open side facing outwardly , presses the legs 76 and 78 defining the slot 80 onto the land 86 and the projection 122 , of generally u - shape in section , similarly presses the legs 90 and 92 defining the insulation - displacement slot 94 against the land 100 . the free ends of the projections 120 and 122 press against the legs defining the respective insulation - displacement slots to resist bending and deformation of the respective legs by forces applied in directions transverse to the plane of the legs when conductors are pushed into the insulation - displacement slots . the projections also provide a three - sided insulated housing around the edges defining each slot . the open side of each housing is wide enough to accommodate the end of an insulation - covered wire which is forced into an underlying insulation - severing slot . similar projections 124 and 126 , of generally u - shaped in section , press the insulation - displacement slots of the power connector strap 12 against similar lands and between similar abutments , and another projection 128 fits over the surfaces of two legs 130 , 132 which define a ground conductor insulation - displacement slot 134 . the two legs 130 , 132 are is located inwardly of two integrally formed , opposed legs 142 and 143 which define therebetween a u - shaped slot 145 dimensioned to accept the heaviest ground conductor for which the receptacle is designed . when so assembled , the receptacle is ready to be wired . the unstripped ends of power and ground conductors are placed at the respective power and ground insulation - displacement slots , as illustrated in fig4 and 5 , and the side covers are pivoted toward the receptacle body 16 , initially by hand and then with the assistance of the assembly screws 34 , 35 and 36 . referring as an example to fig4 the unstripped end of a power conductor 130 is placed at the insulation - displacement slot 94 , which is visible in fig4 and the power side cover 10c is pivoted toward the receptacle body 16 such that the slot 131 in the cover 10c and the pusher block 134 on the inside of the side cover 10c engage the insulated sheath of the conductor 130 . the web portion 135 of the pusher block 134 is aligned with the slot 94 and can freely enter it . the power assembly screw 34 passes through the opening 38 , fig2 . the screw 34 also passes freely through the u - shaped insulating barrier 136 in the receptacle body and is threaded into the threaded opening 44a in the projection 44 of the yoke 20 . upon tightening the power blade assembly screw 34 , the conductor 130 is pushed progressively into the insulation - displacement slot 94 until the slot cuts through the insulation and makes electrical contact with the underlying conductor wire 130a . it is noted that the pusher block 134 , web 135 and the edges of the slot 131 engage a length of the insulated sheath of the conductor 130 , pressing it against mating parts of the receptacle body 16 , to provide a degree of strain relief against tensile forces applied to the conductor . any other power conductor and the ground conductor are wired similarly and are similarly held to provide strain relief . a separate side cover 10d and a separate assembly screw 35 , extending through opening 39 in side cover 10d and threaded in the opening 51 of projection 50 , are used in a similar manner to wire the ground conductor . as illustrated in fig4 assembly screw 36 passes through opening 37 ( fig1 ) in side cover 10b and threads into opening 47 of projection 46 , with any protruding part of the screw tip extending through opening 61 in the grounding strap 18 and into the open area between the projection 44 and the tong 60 of the grounding strap . the terminal action is not adversely affected by the offset loading produced by only one conductor each in the hot and neutral terminal . to use the receptacle as a split circuit receptacle , the tab 157 ( fig1 ) in the power connector 14 and the tab 161 in the power connector 12 can be broken off with the screwdriver used to effect wiring and installation of the receptacle . to facilitate manufacture of the receptacle , the ground strap 18 and the yoke 20 could be made as a single integral metal part rather than two individual parts connected by the rivets 22 and 24 . in addition , the projections 44 and 46 could be positioned at the end of the yoke 20 opposite that from which the projections 50 and 51 depend and the housing 16 recessed to receive these projections to depend therefrom in the same way as the projections 50 and 51 depend from their end of the yoke . other similar changes could be made to the receptacle without departing from the scope of the invention . as will be appreciated , when assembled and wired , the insulated housing of the receptacle fully encloses all electrically live parts to thereby reduce danger of electrical shock . the orientation of the elements of the receptacle has been described for the usual case , that is , the receptacle is mounted with the front cover 10a extending along a vertical plane and being the &# 34 ; front &# 34 ; of the receptacle . as will be understood , it is possible to mount the receptacle in other orientations without departing from the spirit of the invention . | 7 |
referring now to fig1 the device - under - test ( dut ) power supply of the present invention , generally designated 30 , is adaptable for use by automatic test equipment , generally designated 10 . the power supply implements on - tester load circuitry 36 ( fig2 and 3 ) to minimize calibration and validation process times . by providing on - tester load circuitry available to the dut power supply , costly hardware modifications for calibration / validation procedures are avoided . further referring to fig1 the automatic test equipment , or ate 10 , generally includes a computer workstation 12 that couples to a test head 14 via a cable bundle 16 . the test head houses a plurality of channel cards ( not shown ) and power supply boards 30 ( only one board shown ) in relative close proximity to the dut 40 . the dut mounts to a production device - interface - board ( dib ) 18 , that interfaces with the test head via a tester interface ( not shown ). the tester interface provides an interconnection of signal , ground and power paths between the ate and the dut . with reference to fig2 one specific embodiment of the dut power supply 30 that employs the internal calibration / validation circuitry of the present invention includes digital circuitry 32 , power circuitry 34 , internal load circuitry 36 and amplifier circuitry 50 . the digital circuitry 32 provides a digital - to - analog control interface between the tester and the dut power supply . the power circuitry 34 , in one embodiment , takes the form of a low - noise switching dc - dc converter , as more fully set forth in co - pending u . s . application ser . no . 09 / 718 , 780 , titled switching dc - dc converter with noise suppression circuitry , filed nov . 22 , 2000 , assigned to the assignee of the present invention , and expressly incorporated herein by reference . further details of the amplifier circuitry 50 are found in co - pending u . s . patent application ser . no . 09 / 797 , 511 , titled “ high current and high accuracy linear amplifier ”, filed mar . 1 , 2001 , assigned to the assignee of the present invention , and expressly incorporated herein by reference . referring to fig2 and 3 , the digital circuitry 32 , power circuitry 34 and amplifier circuitry 50 of fig2 may be thought of collectively as one embodiment of a power generation circuit 60 ( in phantom ) for purposes of the present invention . with continued reference to fig3 coupled to the power generation circuit is a current measurement unit 62 for providing accurate and precise current output information to the power circuitry to effect proper regulation under varying loads and operating conditions . further referring to fig3 the on - tester load circuitry 36 preferably includes internal calibration circuitry in the form of an active load 70 , and internal validation circuitry comprising an ac load 80 and a capacitive load 82 . in one embodiment , the active load includes a plurality of fet transistors fc 1 - fcn coupled in parallel . each transistor is regulated by a control circuit c 1 - cn to maintain consistent and stable operation through varying temperatures and other parameters . switching circuitry in the form of a plurality of switches sw 1 - sw 5 selectively substitutes the dut 40 for the active load 70 across the power circuitry output in response to software - driver commands . in a preferred embodiment , the active load 70 , the ac load 80 and the capacitive load 82 are coupled to a nist - traceable current source i . to calibrate the power supply current measurement unit 62 , the active load 70 is first calibrated using the nist - traceable current source i . the precise value of the current source is stored in a non - volatile ram memory 64 . the precise known current value , for example 1 . 000 amperes , is applied to each fet of the active load in sequence . voltage measurements are taken , for example at the terminals t 1 and t 2 ( by nist traceable voltage measuring circuitry , not shown ) and combined with the known current in accordance with ohms law to determine the precise resistance value for each fet transistor . once the active load resistances for fets fc 1 - fcn are known , they may then be activated individually , or in combination , as calibration loads for the current measurement unit 62 . for any given known load , voltage measurements may be taken ( again , using voltage measurement circuitry , not shown ) to determine the output current ( using basic ohms law ). this measurement is taken in addition to the readings from the current measurement unit itself . the measured current values are then compared . calibration offsets and gain factors are then calculated , and stored in a calibration memory ( not shown ) for future current measurements made by the power supply circuitry during normal device testing . this combination of circuitry and process achieves a nist - traceable calibration of the power supply current measurement unit 62 without having to undock the tester ( or test head ) from a prober or a handler during its normal operating conditions . with continued reference to fig3 the ac load 80 and the capacitive load 82 emulate the dynamic load currents presented to the power supply by the activity of the dut and the bulk capacitance usually present on the dib to minimize voltage droop by supplying instantaneous current to the dut . by switching different numbers of load fet switches on and off in a dynamic fashion , the varying load of the dut can be emulated . by switching different numbers of capacitors on , the ability of the power supply to drive the different load capacitances is verified . validation procedures are highly desirable prior to placing the tester in a production environment . the ac load 80 preferably comprises a set of dynamic loads including resistors r 1 - rn to set current levels and fets fv 1 - fvn that are selectively activated to provide a path from the power supply to the load resistors . by implementing several resistors / fets in parallel , the current level may be varied . similarly , the capacitive load 82 includes a plurality of fets f 2 v 1 - f 2 vn that selectively switch - in respective capacitors c 1 - cn . use of these two circuits in combination allows the load to emulate a wide range of dut and dib test conditions , with a wide range of currents and load impedances . one of the challenging aspects with having the load circuitry 36 within the ate test head , as described above , is that unlike external dib - based validation schemes , the actual interface parasitics to a dib are not in the validation load path . as a result , the performance of the ate supply when driving a load through the in - tester parasitics may not be fully validated . further , the quality of the path from the ate power supply to the dut may not be verified fully . the inventor has addressed these potential challenges with a unique modification as described below . referring now to fig4 the challenges above are alleviated by providing an ate power supply 100 comprising two power supply units , power supply a 90 and power supply b 92 . the supplies may be operated individually or in parallel . respective internal loads 94 and 96 are provided for each supply . the loads are similar in construction to the selectively switched ac and capacitive loads described earlier , and warrant no further description . with continued reference to fig4 both supplies are interconnected to the dut 40 via separate paths 91 , 93 ( for power supply a 90 ) and 95 , 97 ( for power supply b 92 ). the connections allow driving the paths to the dib 18 from one power supply ( for example , power supply a ) and connecting the load 96 associated with the other supply ( power supply b ) to that supply &# 39 ; s path to the dib . at that point , the path from the overall combined power supply to the load includes the parasitics from the first supply to the dib and also the parasitics from the dib back to the load associated with the second power supply . thus , the interconnection parasitics and the ability of the power supply to properly supply power through those parasitics may be verified . following calibration and validation , the calibration and validation loads 70 , 80 and 82 ( fig3 ) are deactivated by the switching circuitry swa - swe , and the dut 40 switched into the power supply circuit . at this point , the power supply is ready for device testing , where accurate current measurement capability is critically important . those skilled in the art will appreciate the numerous benefits and advantages afforded by the present invention . of particular importance is the in - tester load circuitry that enables the elimination of any undocking procedures associated with the calibration and validation process . by eliminating the undocking steps , substantial savings in throughput and time associated with calibration and validation are realized by the semiconductor device manufacturer . while the invention has been particularly shown and described with reference to the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention . for example , while the present invention has been described in detail for use in packaged - device level applications , minor modifications could be made to employ the power supply in wafer - probe applications . in such applications , device boards take the form of probecards . moreover , implementation of fet transistors are specifically identified for use in the in - tester load circuits of the present invention . while fets are preferred , it is to be understood that any type of in - tester loads are within the scope of the present invention , including discrete resistors and other forms of transistor technologies . additionally , the description herein often refers to “ in - tester ” as being within the testhead . while this is considered within the scope of the present invention , the “ in - tester loads ” may be placed anywhere in the tester , including the mainframe and / or the power supply housing . | 6 |
according to the present invention , marine cuttings are treated , preferably in situ , to minimize their environmental impact upon discharge . the treatment forms a cutting mixture which will not result in oxygen depletion of marine sediment . in a preferred method , free hydrocarbons in the cuttings are converted into “ isolated hydrocarbons ,” defined herein as hydrocarbons which are unavailable to organically enrich surrounding marine sediment in an amount sufficient to induce oxygen depletion of the marine sediment . for purposes of the present application , the term “ oxygen depletion ” is defined to mean depletion of oxygen in marine sediment to a level below that required to sustain a typical community of benthic aerobic organisms . without limiting the invention , typical healthy marine sediments are believed to have an oxygen content of from about 2 mg o 2 / liter to about 8 mg o 2 / liter of sediment . isolated hydrocarbons may be formed in a number of ways , including but not necessarily limited to encapsulation of the free hydrocarbons with a suitable encapsulating material . in a preferred embodiment , free hydrocarbons in the drilled cuttings are encapsulated with an encapsulating material which renders the hydrocarbons wholly or partially inaccessible to biological degradation for a prolonged period of time . in a preferred embodiment , hydrocarbons in the drilling mud are non - toxic and biodegradable , and the encapsulating material allows some release of the hydrocarbons into the seawater at a rate which is sufficiently low as to allow the microorganisms in the surrounding environment to degrade the hydrocarbons without oxygen depletion of the marine sediment . the drilled cuttings may be treated using any suitable system of equipment . after separation from the drilling mud , the contaminated cuttings typically pass through a holding bin into an inlet hopper . the cuttings preferably are treated directly in a batch mixer equipped with an appropriate inlet for the relevant solutions and an apparatus for low shear mixing , such as a paddle mixer . in a preferred embodiment , the cuttings are sprayed with an emulsifyng solution effective to transform the free hydrocarbons in the cuttings into an emulsion . the emulsion thereafter is treated with an encapsulating material to encapsulate the emulsified hydrocarbons . the composition of the emulsifying solution will vary depending upon the type of free hydrocarbons found in the drilling mud , and may be similar to the emulsifiers used in u . s . pat . no . 5 , 076 , 938 , incorporated herein by reference . however , the following emulsifiers were found are superior to those described in u . s . pat . no . 5 , 076 , 938 because of ( a ) environmental compatibility , and ( b ) stability of the emulsion . the emulsifying solution may be a blend of organic acids , inorganic acids , and emulsifiers . the emulsifier ( s ) may have any ionic nature , including non - ionic , anionic , and cationic . preferred emulsifying solutions are as non - toxic as possible , and preferably comprise either a non - ionic emulsifier ( where the drilling mud comprises paraffins ) or , a combination of at least a non - ionic surfactant and most preferably a non - ionic and an anionic emulsifier ( where the drilling system does not comprise paraffins ). although the compounds called “ emulsifiers ” herein typically are referred to as surfactants , their function in the present invention is to act as emulsifiers . the emulsifying solution lowers the interfacial tension between the oil and water to produce a sufficiently small droplet size , from about 3 microns to about 20 microns , preferably about 10 microns or less in diameter . preferred emulsifying solutions comprise : from about 15 wt % to about 45 wt %, preferably about 20 wt % phosphoric acid , or another acidic composition with similarly low toxicity ; about 5 wt % to about 90 wt %, preferably about 65 wt % emulsifiers ; and water . in order to achieve the desired small droplet size , it is necessary to use emulsifiers with the correct hydrophilic / lipophilic balance ( hlb ). the required hlb will differ depending upon the oil being emulsified . in a preferred embodiment , the required hlb is achieved using a non - ionic emulsifier . preferred non - ionic emulsifiers include , but are not necessarily limited to polyoxyethylene alcohols comprising from about 8 to about 30 , preferably about 8 to about 20 carbon atoms and comprising about 3 to about 50 moles , most preferably about 3 to about 20 moles ethylene oxide . the following are preferred hlb &# 39 ; s for non - ionic emulsifiers when the drilling mud contains the following oils : polyalphaolefins and paraffins — hlb 12 . 5 ; esters — hlb - 15 . 4 ; synthetic iso - paraffins — hlb 10 . 9 . blends of both non - ionic and anionic emulsifiers have been found to decrease droplet size in most instances . where such a blend is used , a preferred ratio of non - ionic to anionic emulsifier is about 5 / 95 to about 95 / 5 , preferably about 70 / 30 to about 95 / 5 . any suitable , non - toxic anionic emulsifier may be used in such blends . preferred anionic emulsifiers include , but are not necessarily limited to those selected from the group consisting of : alkane sulfates and alkane sulfonates comprising about 8 to about 18 carbon atoms , preferably about 8 to about 12 carbon atoms . the following are preferred emulsifying blends for use with the specified type of drilling muds . the drilling muds indicated by brand name are available from baker hughes inteq , and the brand name represents a proprietary trademark of baker hughes inteq ): for use with a driling mud comprising polyalphaolefins ( syn - teq ) ( blend of emulsifiers with hlb 12 . 5 ): ratio of ( isodecyl alcohol ethoxylate with 6 moles of eo ) to ( secondary alkanesulfonate of sodium or sodium octyl sulfate )= 85 : 15 for use with an ester - containing drilling mud ( blend of emulsifiers with hlb 15 . 4 ) ratio of ( oleyl alcohol ethoxylate with 20 moles of eo ) to sodium octyl sulfate = 90 : 10 for use with a synthetic isoparaffin - containing mud ( blend of emulsifiers with hlb 10 . 9 ) an excess of the emulsifier solution is added to the cuttings , preferably in the inlet hopper . the amount of emulsifier added will depend upon the concentration of free hydrocarbons m the cuttings as measured by any suitable means , such as “ retort ,” or distillation and measurement of the oil content . after addition of the emulsifyng solution , the wt / wt ratio of emulsifing blend in the cuttings should be about 0 . 2 wt % to about 5 wt % for cuttings contaminated with from about 2 wt % to about 18 wt % free hydrocarbons , respectively . the cuttings and emulsifying solution may be agitated so that substantially all of the free hydrocarbons are removed from the cuttings and emulsified or dispersed in the emulsifier solution . thereafter , the encapsulating material is added . the encapsulating material may be substantially any encapsulating material that surrounds the emulsified hydrocarbon droplets and solidifies . suitable encapsulating materials include , but are not necessarily limited to silicates and polymeric microencapsulating materials . a preferred encapsulating material is a silicate solution . the amount of silicate solution that is added to the emulsified solution preferably is about 1 to about 2 times the amount of emulsifying solution added . the emulsifier rapidly and substantially completely disperses the free hydrocarbons in the cuttings into small droplets . application of the silicate solution to the emulsified oil converts the emulsified oil into a thick gel , which can be water - washed off of the cuttings , leaving a substantially clean surface . when allowed to dry , the gel is even more amenable to subsequent removal by water - washing . because the emulsifier removes hydrocarbons ( hydrophobic materials ) from the cuttings and because the emulsifing solution is very hydrophilic , the wettability of the cuttings is changed from oil wettable to water wettable . the more hydrophilic cuttings have less tendency to agglomerate , and tend to more widely disperse , both in the seawater as they travel toward the ocean floor , and eventually in the marine sediment . the combination of ( a ) encapsulation of free hydrocarbons from the cuttings ( which decreases accessibility to the hydrocarbons over time ), and ( b ) change in the wettability of the cuttings from oil wet to water wet ( which results in greater spatial dispersion of the hydrocarbons ) greatly minimizes the organic load on the marine sediment and helps to prevent oxygen depletion . persons of skill in the art will appreciate that many modifications may be made to the embodiments described herein without departing from the spirit of the present invention . accordingly , the embodiments described herein are illustrative only and are not intended to limit the scope of the present invention . | 8 |
there is shown in fig1 in accordance with the improved assembly of special novelty effects apparatus of the present invention , at reference number 1 , a block reference to synthesizer circuit means 1 having as component parts or inclusions thereof , microprocessor circuit means and memory chip circuit means or alternatively , flash drive circuit means , suitable to insertion of selected memory chip or flash card devices , or alternatively , with the microprocessor circuit means memory chip circuit means of predetermined novelty sounds or lighting effects programmed therein . the synthesizer circuit means 1 with its associated microprocessor circuit means and memory chip circuit means , can be programmed or preprogrammed to provide such sound effects as a 1000 cc motorcycle , music , air - horn or air - brakes or engine noises of a semi - trailer truck , a 747 airplane taxing down the runway or taking off , all of which are novelty sounds emitting from a bicycle . tailpipe replica plate means are provided at 2 as shown in fig1 , mounted to extend toward the rear direction as shaped in the bell shaped figure of a customary tailpipe , and may be mounted to one - side or both sides of a carrier frame . tailpipe lighting devices or means 3 are mounted , fig1 , to the free end or rearmost section of the tailpipe means 2 and are activated to simulate tailpipe emissions during throttling or take - off movements . rear mounted speaker devices or means 4 are mounted , fig1 , approximate to the free end or rearmost section of the tailpipe means 2 and are effective to emit sounds determined by the selected track of the synthesizer circuit means 1 , such as the sound effects of the motorcycle , or other appropriate selected or predetermined tailpipe noises . for example , other tailpipe noises may be the beeping noise of a vehicle made to indicate or warn of backing movements . it would not be desirable to simulate or provide for emergency siren sounds of emergency vehicles , however . headlight or front lighting device or means 5 including side light signal devices are provided to be mounted to the front as shown in fig1 and 2 of the drawings , and may be provisioned to include one or more light bulbs to simulate the front lighting devices customarily associated with a motorcycle . when the headlight 5 is turned to the “ on ” position , the front and rear lights stay on unless interrupted by another overriding lighting function that is not inclusive of front lighting . generator sensor device or means 6 are provided to be engaged to turn with movement of the bicycle 12 . the bicycle 12 is illustrated in the drawings to be comprised of or include front handlebars 12 a , seat 12 b , front and rear wheels 12 c and a frame 12 d . the generator sensor means 6 is mounted to engage the front wheel and be moved thereby to generate the energy to power all the electrical components or to just generate a signal to control the operating frequency of the electrical components when the bicycle 12 is moving . when the bicycle 12 is moving , the generator sensor means 6 sets the frequency for the lights flashing and the simulated or replicate sound of a vehicle moving . battery power means not shown in the drawings but included in the synthesizer circuit means 1 are required to be used with or without the use of the generator sensor 6 . push button signal devices or means 7 provide left or right directional turn signals and are mounted to or proximate of the front handlebars 12 a . when the appropriate left or right directional signal push button device 7 is pushed or activated , the same side lighting means 5 and 3 are activated to start flashing and the other side is deactivated so as not to flash , providing left or right directional turn signals , respectively . the flashing is preset for a determined time duration , such as 15 seconds , after which the frontal light device 5 and the rearward light device 3 will return to their preset positions or states . when the headlight device 5 is switched on , the tail light device 3 will operate off the turn signals . synthesizer switch device or means 8 is provided best shown in fig1 , and serves as a multi - positional selector switch for the multi - functions of the synthesizer circuit means 1 , being mounted preferably proximate to the synthesizer circuit means 1 and having positions as follows : i ) off position ; ii ) motorcycle simulations sounds and lighting effects position ; iii ) truck sound effects ; iv ) airplane sound effects ; and v ) other desired sound or lighting effects , including emergency parking lights or backing warning . the positions of the synthesizer switch means 8 are obviously varied to the desire of the multiplicity of simulations to be provided by the associated synthesizer circuit means 1 . there is shown in fig2 , potentiometer throttle device or means 9 provided on the selected free end portion of the handlebars 12 a of the bicycle 12 . the potentiometer means 9 is provided to be a pivotable throttle portion extending on the handlebars 12 a to provide the simulation of a motorcycle throttle , which when turned or rotated in the same or similar manner as rotating the throttle of a motorcycle provides the sounds of a motorcycle engine through the circuit connections to the rear mounted speaker device ( s ) 4 mounted on or proximate to the simulated tailpipe plate means 2 . simultaneously , the tailpipe light means 3 flash to simulate burning of gas emitting from the tailpipe ( s ) 2 . when the potentiometer device 9 is further positioned by rotation , as the bicycle moves forward , the rear speaker ( s ) 4 emit the sounds of a motorcycle moving forward , or in an alternative position of the switching device 8 , emits the sounds of a truck or alternative position , the sounds of an airplane . in the music position , the speaker devices 4 or 11 as provided on the front of the bicycle 12 shown in fig1 , provide same associated sound effects , including air - horn for frontal movement . the potentiometer device 9 does not replace the front handle bars but is added to a selected end thereof , and is readily pivotable by hand strength of a child . engine simulated cover plate means is provided at 10 and attached to the frame 12 d of the bicycle 12 by a variety of fasteners including screws or clips for ease of removal . the engine plate means 10 is not essential to the present invention but is intended to add to the image effects of simulation of a motorcycle . the front speaker device 11 is used primarily to provide music and sound of a truck air - horn or air - brakes . however , the front speaker device 11 can be made to emit any desired sound effect as is downloaded into the memory of the synthesizer circuit device 1 . gas tank simulated cover plate means is provided at 13 of fig1 , and serves as the enclosure or mounting plate for the synthesizer circuit device 1 and the synthesizer switch device 8 and like the engine plate means 10 , plate means 13 can be attached by a variety of fasteners including screws or clips for ease of removal . the cover platen means 13 is provided with a decal image of a gasoline tank to simulate the gas tank of a motorcycle . another switch means 14 is provided on and operative to switch on or off the headlight device 5 as shown in fig1 . when the switch 14 is in the on position , all lights front and back remain on , except when the left or right directional turn signals 7 are pushed . thereupon , the opposite side tail light 3 is turned off and the same side tail light 3 flashes for a predetermined time period such as the 15 seconds previously stated , after which the lights 5 and 3 return to the on position . a battery device 15 in fig1 provides power supply required for the operations of circuitry including the synthesizer circuit means 1 and its associated microprocessor and memory circuit or flash drive . in summary , the present invention provides special novelty effects apparatus for a wheeled device such as a bicycle 12 , comprising in combination , synthesizer circuit means 1 including microprocessor circuit means and memory circuit means for providing predetermined programs for different sound effects for simulation of selected sounds atypical to the wheeled device 12 on which the synthesizer circuit means is mounted ; synthesizer switch means 8 including multiple switch settings , each one of the switch settings responsive to select from the synthesizer circuit means 1 a different predetermined program of sound effects ; tailpipe cover plate means 2 including tailpipe speaker device 4 responsive to a selected one of the synthesizer circuit means 1 predetermined programs to provide predetermined sound effect atypical to the sound of the wheeled device 12 on which mounted ; and potentiometer throttle means 9 pivotable to a predetermined throttle position to activate a corresponding throttle sound effect provided by the synthesizer circuit means 1 when the synthesizer switch means 1 is set to cause the synthesizer circuit means 1 to select the throttle sound effect desired . other circuit control means that are needed to interconnect the component parts of this invention and its novelty effects apparatus are not further described in this specification or illustrated in the drawing , nor is any electric schematic provided , as this provision is thought to be unnecessary and readily available to the practitioner of the pertinent art . associated power source such as a battery not shown can be used economically as a power source in the present invention . other equally equivalent embodiments of the present invention are readily apparent and are intended to be included in the detailed description made herein . minor modifications , changes in dimensions or materials or sizes and configurations of component parts , and means of attachment to the bicycle 12 or its frame 12 d are intended to be included herein . the entirety of the special novelty effects apparatus described and set forth in this specification as the present invention can be provided to the consumer by kit form . | 1 |
a particularly useful class of base glass - ceramic compositions suitable for treatment according to the invention are the aluminosilicate and lithium aluminosilicate compositions characterized by the presence of beta - spodumene and / or beta quartz solid solutions as principal crystal phases . this base glass composition area includes compositions consisting essentially , in weight percent on the oxide basis as calculated from the batch , of about 55 - 80 % sio 2 , 14 - 35 % al 2 o 3 , 0 - 5 % li 2 o , 0 - 7 % tio 2 , 0 - 10 % zro 2 , 3 - 13 % total of tio 2 + zro 2 , and 0 - 3 % f , to which may be added a total of 0 . 1 - 10 % of transition metal oxide additives . suitable transition metal oxide additives include one or more oxides selected in the indicated proportions from the group consisting of 0 - 5 % mno 2 , 0 - 5 % fe 2 o 3 , 0 - 3 % coo , 0 - 2 % cuo , 0 - 2 % cr 2 o 3 , 0 - 3 % v 2 o 5 , and 0 - 10 % nio . minor amounts of other compounds may , of course , be included within these compositions as aids in melting , to modify properties , or for other known purposes . examples of additives which have been employed are la 2 o 3 , nb 2 o 5 , bao , b 2 o 3 , p 2 o 5 , mgo , cao , zno , na 2 o , k 2 o , ta 2 o 5 , cl , br , as 2 o 3 , and sb 2 o 3 . the total amount of these additives , however , is generally held to not more than about 10 % by weight , so that the basic constituents sio 2 , al 2 o 3 , li 2 o , tio 2 , zro 2 , f , and transition metal oxides will comprise at least about 90 % by weight of the glass - ceramic composition . glass - ceramic compositions within the above described composition range may be compounded and melted in accordance with conventional glass - making practice , and thereafter formed into glass articles by conventional means such as pressing , rolling , casting , spinning or the like . the batch materials may consist of oxides or may comprise any other compounds which will decompose at melting temperatures to yield molten batches having calculated oxide compositions within the aforementioned range . for these compositions , melting typically requires temperatures in the range of about 1600 °- 1650 ° c . for times in the range of about 6 - 16 hours . glass articles formed from the above compositions may be converted by crystallization in situ into semi - crystalline glass - ceramic articles according to processes conventional for beta - spodumene and beta - quartz - containing glass - ceramics . such processes comprise exposure of the articles to temperatures in the range of about 700 °- 800 ° c . for times in the range of about 1 - 4hours to obtain nucleation of the glass , followed by exposure to temperatures in the range of about 800 °- 1200 ° c . for times in the range of about 1 - 8 hours to obtain crystallization of the glass . following crystallization , the semicrystalline glass - ceramic articles are subjected to further heat treatment under reducing conditions to promote the development of an exuded surface phase comprising active transition metal oxide compounds thereon . exuded films formed in the described composition system include one or more crystalline compounds selected from the group consisting of co 3 o 4 , mn 3 o 4 , fe 3 o 4 , nial 2 o 4 , coal 2 o 4 , mnal 2 o 4 , feal 2 o 4 , val 2 o 4 , cucr 2 o 4 , nife 2 o 4 , cofe 2 o 4 , mnfe 2 o 4 , cotio 3 , mntio 3 , fetio 3 , co 2 tio 4 and comn 2 o 4 . these may be found alone , in combination with each other , or in solid solution or combination with mgal 2 o 4 , valo 4 , cual 2 o 4 , cral 2 o 4 , mncr 2 o 4 and fecr 2 o 4 . the film - producing heat treatments suitably comprise heating at temperatures in the range of about 500 °- 1000 ° c . in a reducing atmosphere . preferred atmospheres include hydrogen and hydrogen - containing atmospheres such as forming gas ( h 2 , n 2 ). these atmospheres may contain additional constituents such as water vapor , co , co 2 , cl 2 or sulfur . of course , other conventional reducing atmospheres such as hexane , methane , ammonia or the like may also be employed if desired . typical treatment times range from at least about 1 / 2 hour up to about 10 hours or more . longer treatment times may be employed , if desired , but long treatments are of no practical benefit and are commercially undesirable . after sufficient growth of the transition metal oxide film has been attained in accordance with the above - described treatment , it may be desirable to further treat the article to modify the properties of the surface film for certain applications . leaching is sometimes useful to remove residual glassy phases and / or to modify the porosity of the film . supplemental oxidizing and / or reducing treatments may also be employed to modify the oxidation states of certain of the film constituents . the precise nature of the supplemental treatment employed , if any , will depend on the properties desired in the film and the nature of the use for which the article is intended . examples of thermally - crystallizable glass compositions suitable for forming beta - spodumene and beta - quartz glass - ceramics having exuded surface films containing transition metal oxide compounds according to the invention are set forth in table i below . compositions are given in parts by weight on the oxide basis as calculated from the batch . these compositions were batch melted in platinum crucibles at 1625 ° c . for 16 hours , and then poured into steel molds to form 4 inches × 4 inches × 1 / 2inches slabs and annealed at 650 ° c . most of the compositions shown also include minor amounts of as 2 o 5 as a fining agent ; however , the amount remaining in the glass after melting is negligible and is therefore not reported . table i__________________________________________________________________________composition 1 2 3 4 5 6 7 8__________________________________________________________________________sio . sub . 2 63 . 2 % 60 . 9 % 58 . 7 % 61 . 2 % 59 . 3 % 71 . 7 % 71 . 7 % 71 . 7 % al . sub . 2 o . sub . 3 20 . 5 20 . 9 19 . 5 20 . 5 20 . 5 15 . 0 15 . 0 15 . 0li . sub . 2 o 3 . 5 3 . 5 3 . 8 3 . 5 3 . 5 4 . 5 4 . 5 4 . 5tio . sub . 2 4 . 8 4 . 8 4 . 9 4 . 8 4 . 8 5 . 5 5 . 5 5 . 5zro . sub . 2 -- -- -- 0 . 1 0 . 1 -- -- -- mgo 1 . 7 1 . 7 -- 1 . 7 1 . 7 -- -- -- zno 1 . 2 1 . 2 2 . 8 1 . 2 1 . 2 -- -- -- na . sub . 2 o 0 . 6 0 . 6 0 . 6 0 . 6 0 . 6 -- -- -- k . sub . 2 o 0 . 3 0 . 3 0 . 3 0 . 2 0 . 2 -- -- -- p . sub . 2 o . sub . 5 1 . 2 1 . 2 2 . 6 1 . 2 1 . 2 -- -- -- b . sub . 2 o . sub . 3 0 . 4 0 . 4 -- -- -- -- -- 5 . 0f 0 . 1 0 . 1 0 . 1 -- -- -- -- -- br -- -- 0 . 4 -- -- -- -- -- mno . sub . 2 -- -- 0 . 4 -- -- -- -- 0 . 6fe . sub . 2 o . sub . 3 1 . 6 3 . 0 4 . 0 3 . 0 3 . 0 -- 1 . 3 -- coo -- -- 0 . 9 0 . 6 2 . 4 2 . 6 -- 2 . 7nb . sub . 2 o . sub . 5 -- -- -- -- -- 3 . 5 -- -- __________________________________________________________________________ the thermally - crystallizable glass articles in table i , produced as above described , are thereafter treated as set forth below in table ii in order to produce glass - ceramic articles having beta - spodumene and / or beta - quartz solid solutions as principal crystalline phases and exuded surface films containing transition metal oxide compounds . table ii reports the crystallizing heat treatments employed to convert each thermally - crystallizable glass article to the semi - crystalline state , the principal crystal phase present in the articles after ceramming , the reducing heat treatments employed to promote the growth of transition metal oxide compounds present in the exuded surface films , the appearance of the articles after the growth treatments , and the dominant properties of the exuded films . the principal crystalline phases listed are generally solid solutions rather than specific compounds . in instances where forming gas is used as the reducing atmosphere , a gas consisting of 8 % h 2 and 92 % n 2 by volume was employed . typical film thicknesses over the range of growth treatments employed range about 0 . 1 - 2 microns . table ii__________________________________________________________________________ 1 2 3 4__________________________________________________________________________nucleation treatment 2 hours - 780 ° c . 2 hours - 780 ° c . 2 hours - 780 ° c . 2 hours - 780 ° c . crystallizaton 6 hours - 1080 ° c . 2 hours - 1100 ° c . 2 hours - 1100 ° c . 2 hours - 1100 ° c . treatmentprincipal crystal β - spodumene , ana - β - spodumene , ana - β - spodumene , ana - β - spodumene , phases tase , mgal . sub . 2 o . sub . 4 tase , mgal . sub . 2 o . sub . 5 tase , zral . sub . 2 o . sub . 4 anatasefilm growth treatment 2 hours - 500 ° c . 2 hours - 500 ° c . 2 hours - 500 ° c . 2 hours - 500 ° c . h . sub . 2 h . sub . 2 h . sub . 2 forming gassurface appearance purple metallic black black metallic grey blackexuded crystal phases feal . sub . 2 o . sub . 4 fe . sub . 3 o . sub . 4 , feal . sub . 2 o . sub . 4 , fe . sub . 3 o . sub . 4 , coal . sub . 2 o . sub . 4 , coal . sub . 2 o . sub . 4 , fe . sub . 3 o . sub . 4 mn . sub . 3 o . sub . 4 , mnfe . sub . 2 o . sub . 4surface properties magnetic - good magnetic - good magnetic - good magnetic - good hysteresis loop hysteresis loop hysteresis loop hysteresis loop 5 6 7 8__________________________________________________________________________nucleation treatment 2 hours - 780 ° c . 2 hours - 780 ° c . 2 hours - 780 ° c . 2 hours - 780 ° c . crystallizaton 2 hours - 1080 ° c . 2 hours - 1100 ° c . 2 hours - 1100 ° c . 2 hours - 1100 ° c . principal crystal β - spondumene , β - spodumene , β - spodumene , β - spodumene , cotio . sub . 3 , phases anatase cotio . sub . 3 , co . sub . 2 tio . sub . 4 cotio . sub . 3 co . sub . 2 tio . sub . 4film growth treatment 2 hours - 500 ° c . 2 hours - 500 ° c . 2 hours - 500 ° c . 2 hours - 500 ° c . forming gas forming gas forming gas forming gassurface appearance grey black black black blackexuded crystal phases coal . sub . 2 o . sub . 4 , co . sub . 3 o . sub . 4 , co . sub . 3 o . sub . 4 , co . sub . 2 tio . sub . 4 , fe . sub . 3 o . sub . 4 , tife . sub . co . sub . 3 o . sub . 4 , mn . sub . 3 o . sub . 4 , comn . sub . 2 o . sub . 4 , fe . sub . 3 o . sub . 4 , cofe . sub . 2 o . sub . 4 cotio . sub . 3 cotio . sub . 3surface properties magnetic - good active catalyst active catalyst very active catalyst , hysteresis loop c . sub . 6 h . sub . 8 oxidation co oxidation co oxidation , c . sub . 6 h . sub . 8 c . sub . 6 h . sub . 8 oxidation oxidation__________________________________________________________________________ from the foregoing examples it is readily apparent that a broad range of aluminosilicate and lithium aluminosilicate glass - ceramic compositions containing transition metal additives may be treated according to the invention to provide exuded transition metal spinel films thereon having a variety of uses . compositions which are utilized for producing transition metal films having desirable magnetic and electrical properties are titania - nucleated lithium aluminosilicate compositions consisting essentially , in weight percent on the oxide basis as calculated from the batch , of about 58 - 64 % sio 2 , 19 - 21 % al 2 o 3 , 2 - 5 % li 2 o , 2 - 7 % tio 2 , 0 - 1 % zro 2 , 3 - 7 % total of tio 2 + zro 2 , 0 - 1 % f , and 1 - 6 % total of transition metal additives , essentially including iron , selected in the indicated proportion from the group consisting of 1 - 5 % fe 2 o 3 , 0 - 5 % mno 2 , 0 - 5 % coo and 0 - 3 % nio . exuded transition metal films produced from articles of these compositions typically include one or more compounds of spinel structure selected from the group consisting of co 3 o 4 , fe 3 o 4 , mn 3 o 4 , mnal 2 o 4 , feal 2 o 4 , coal 2 o 4 , mnfe 2 o 4 , nife 2 o 4 , and cofe 2 o 4 , essentially including at least one iron compound . example i of table i represents the presently preferred composition for producing a film having particularly desirable magnetic properties according to the invention . compositions which are utilized for producing glass - ceramic articles having exuded transition metal oxide films demonstrating useful catalytic activity consist essentially , in weight percent on the oxide basis as calculated from the batch of about 68 - 74 % sio 2 , 14 - 19 % al 2 o 3 , 0 - 5 % li 2 o , 0 - 6 % tio 2 , 0 - 3 % zro 2 , 5 - 9 % total tio 2 + zro 2 , 0 - 5 % b 2 o 3 , 0 - 3 % f , and 1 - 10 % total of transition metal additives selected in the indicated proportion from the group consisting of 0 - 5 % fe 2 o 3 , 0 - 5 % coo , 0 - 5 % mno 2 , 0 - 2 % cuo , 0 - 2 % cr 2 o 3 , and 0 - 3 % nio . exuded transition metal films produced on articles of these compositions typically contain one or more compounds selected from the group consisting of cotio 3 , co 2 tio 4 comn 2 o 4 , co 3 o 4 , mn 3 o 4 , cofe 2 o 4 , coal 2 o 4 , mntio 3 , and fetio 3 . example 8 of table i represents the presently preferred composition for producing a catalytically - active oxide film in this system . types of glass - ceramic articles other than alumino - silicate and lithium aluminosilicate beta - quartz and beta - spodumene articles are also useful in providing exuded transition - metal - containing films according to the invention . another useful composition area is found to include somewhat diverse silicate , aluminosilicate , and boroaluminate base compositions wherein manganese is a major constituent , comprising at least about 10 % by weight of the compositions . the operative composition area includes compositions consisting essentially , in weight percent on the oxide basis , as calculated from the batch , of about 10 - 60 % mno 2 , at least one oxide selected in the indicated proportion from the group consisting of 10 - 70 % sio 2 , 13 - 43 % al 2 o 3 , and 0 - 35 % b 2 o 3 , essentially including at least about 5 % b 2 o 3 and 20 % al 2 o 3 , when sio 2 is absent , not exceeding about 5 % b 2 o 3 when al 2 o 3 is absent , and not exeeding about 10 % b 2 o 3 when both sio 2 and al 2 o 3 are present , the sum total of mno 2 + sio 2 + al 2 o 3 + b 2 o 3 comprising at least about 60 % by weight of the composition , 0 - 30 % nb 2 o 5 , 0 - 20 % tio 2 , 0 - 5 % fe 2 o 3 , 0 - 10 % nio , 0 -- 3 % cr 2 o 3 , 0 - 10 % zro 2 , 0 - 35 % la 2 o 3 , 0 - 10 % ta 2 o 5 , 0 - 15 % bao , 0 - 10 % sno 2 , 0 - 3 % coo , 0 - 4 % zno and 0 - 10 % k 2 o . minor amounts of other compounds may , of course , be included within these compositions as aids in melting , to modify properties and so forth , including , for example , li 2 o , na 2 o , wo 3 , p 2 o 5 , mgo , cl , f , mno 3 , cu 2 o , v 2 o 5 , as 2 o 3 , and sb 2 o 3 . glass - ceramic compositions within the aforementioned composition range may be melted according to conventional practice , typically at temperatures in the range of about 1500 - 1600 ° c . for times on the order of about 6 - 16 hours . the molten glasses may be formed into glass articles by conventional means such as pressing , rolling , casting , drawing or the like . batch materials for these glasses may comprise oxides or other compounds which will decompose at melting temperatures to yield molten batches having oxide compositions within the aforementioned range . glass articles formed from the above compositions may be converted by crystallization in situ into glass - ceramic articles by heat treatment at temperatures in the range of about 600 °- 1200 ° c . for times in the range of about 4 - 24 hours . useful crystallization treatments comprise a nucleation step wherein the article is heated at temperatures in the range of about 600 °- 800 ° c . for times on the order of 1 - 4 hours . principal crystal phases in these composition systems include mnal 2 o 4 , mn 3 o 4 , mn 2 al 2 ( sio 4 ) 2 and mnsio 3 depending somewhat on the composition of the mno 2 -( b 2 o 3 , al 2 o 3 , sio 2 ) base glass . following crystallization , the growth of transition - metal - containing oxide films on the surface of these glass - ceramic articles is promoted using reducion heat treatments substantially the same as those above described for beta - spodumene and beta - quartz - containing articles . such treatments typically comprise heating to temperatures in the range of about 500 °- 1000 ° c . in a reducing atmosphere , preferably an atmosphere comprising hydrogen or nitrogen - hydrogen forming gas , for treatment times in the range from about 1 / 2 hour up to about 10 hours , or more . again , longer treatments may be employed if desired , but these are not deemed of practical benefit . transition - metal - containing exuded films which may form in this composition system include mn 3 o 4 , fe 3 o 4 , mnal 2 o 4 , nial 2 o 4 , nife 2 o 4 , mnfe 2 o 4 , mncr 2 o 4 , mnnb 2 o 6 ninb 2 o 6 , mn 2 al 2 ( sio 4 ) 2 , and ti 2 nb 10 o 29 . the compounds in this system may be found either alone or in solid solution or combination with other crystalline species such as mnsio 3 and zro 2 . residual glassy phases may also be present . whereas the transition metal oxide films produced in these systems typically differ in composition from the interior of the article , it is possible that in certain cases the predominant surface compound is also one which predominates in the article as a whole . nevertheless treatment according to the invention is effective to increase crystal formation in the surface layers of the article such that improved surface properties are obtained . examples of thermally - crystallizable glass compositions suitable for forming silicate , aluminosilicate , and boroaluminate glass - ceramics having exuded surface films containing transition metal oxide compounds according to the invention are set forth in table iii below . compositions are given in parts by weight on the oxide basis as calculated from the batch . the compositions were batch melted in platinum crucibles at 1600 ° c . for about 6 hours , and then poured into steel molds to form 3 / 8 × 5 × 5 inch slabs and annealed at about 600 ° c . a few of the compositions additionally contained minor amounts of as 2 o 5 as a fining agent , but the amount remaining in the glass after melting is small and is therefore not reported . table iii__________________________________________________________________________compositon 9 10 11 12 13 14 15 16__________________________________________________________________________mno . sub . 2 43 . 0 % 31 . 8 % 45 . 0 % 60 . 0 % 51 . 5 % 21 . 0 % 40 . 0 % 30 . 0 % b . sub . 2 o . sub . 3 -- -- 30 . 0 5 . 0 -- -- -- -- al . sub . 2 o . sub . 3 20 . 6 15 . 1 25 . 0 20 . 0 13 . 3 43 . 0 25 . 0 20 . 0sio . sub . 2 35 . 4 19 . 7 -- -- 22 . 2 34 . 0 25 . 0 30 . 0la . sub . 2 o . sub . 3 -- 33 . 5 -- -- -- -- -- -- nb . sub . 2 o . sub . 5 -- -- -- -- 13 . 0 -- -- -- ta . sub . 2 o . sub . 5 -- -- -- -- -- 5 . 0 -- -- tio . sub . 2 10 . 0 -- -- -- -- -- -- -- sno . sub . 2 -- -- -- -- -- -- -- 10 . 0k . sub . 2 o -- -- -- -- -- -- -- 10 . 0bao -- -- -- 15 . 0 -- -- -- -- zno -- -- -- -- -- 2 . 0 -- -- cr . sub . 2 o . sub . 3 -- -- -- -- -- 1 . 0 -- -- fe . sub . 2 o . sub . 3 -- -- -- -- -- 3 . 0 -- -- coo -- -- -- -- -- 1 . 0 -- -- nio -- -- -- -- -- 3 . 0 10 . 0 -- __________________________________________________________________________ the thermally - crystallizable glass articles of table iii , produced as above described , are thereafter treated as set forth below in table iv in order to produce glass - ceramic articles having exuded surface films containing transition metal oxide compounds . table iv reports the crystallization heat treatments employed to obtain bulk crystallization in situ of the articles , the principal crystalline phases present in the articles after ceramming , the reducing heat treatments employed to promote the growth of transition metal spinel films on the articles , the transition metal spinels present in the exuded surface films , the appearance of the articles after growth treatment , and the dominant properties of the exuded films . film dielectric constant ( k &# 39 ;) and loss tangent ( tan δ ) are reported where determined on individual samples . in instances where forming gas is reported as present in the reducing atmosphere , a gas consisting of 8 % h 2 and 92 % n 2 by volume was employed . typical film thicknesses for these exuded films over the range of growth treatments employed range about 0 . 1 - 4 microns . table iv__________________________________________________________________________ 9 10 11 12__________________________________________________________________________nucleation treatment 4 hours - 650 ° c . 4 hours - 650 ° c . 4 hours - 700 ° c . 4 hours - 650 ° c . crystallization 2 hours - 800 ° c . 4 hours - 800 ° c . 4 hours - 800 ° c . 2 hours - 1000 ° c . treatment 4 hours - 1000 ° c . 4 hours - 1000 ° c . principal crystal mnsio . sub . 3 , mnsio . sub . 3 mn . sub . 3 o . sub . 4phases mn . sub . 2 al . sub . 2 ( sio . sub . 4 ). sub . 2film growth 4 hours - 1000 ° c . 4 hours - 800 ° c . 2 hours - 500 ° c . 2 hours - 700 ° c . treatment h . sub . 2 forming gas forming gas forming gassurface appearance liver color liver color brown grey brownexuded crystal phases mn . sub . 3 o . sub . 4 , mnal . sub . 2 o . sub . 4 mnal . sub . 2 o . sub . 4 , mn . sub . 3 o . sub . 4 mn . sub . 3 o . sub . 4 , mnal . sub . 2 o . sub . 4 mnal . sub . 2 o . sub . 4 , mn . sub . 3 o . sub . 4surface properties ferromagnetic ferromagnetic ferromagnetic ferromagnetic k &# 39 ; = 15 . 5 k &# 39 ; = 14 . 0 k &# 39 ; = 8 . 7 k &# 39 ; = 14 . 8 tanδ = 0 . 042 tanδ = 0 . 002 tanδ = 0 . 06 tanδ = 0 . 53 13 14 15 16__________________________________________________________________________nucleation treatment 4 hours - 650 ° c . 4 hours - 650 ° c . 4 hours - 780 ° c . 4 hours - 650 ° c . crystallization 2 hours - 1000 ° c 4 hours - 1000 ° c . 4 hours - 1000 ° c . 2 hours - 700 ° c . treatmentprincipal crystal mnsio . sub . 3 mnal . sub . 2 o . sub . 4 mnsio . sub . 3phasesfilm growth 2 hours - 700 ° c . 2 hours - 800 ° c . 2 hours - 1000 ° c . 2 hours - 500 ° c . treatment forming gas forming gas forming gas forming gassurface appearance brown black black brown greyexuded crystal mn . sub . 2 al . sub . 2 ( sio . sub . 4 ). sub . 2 , mn . sub . 3 o . sub . 4 , mnal . sub . 2 o . sub . 4 mn . sub . 3 o . sub . 4 , mnal . sub . 2 o . sub . 4 , mn . sub . 3 o . sub . 4 , mnal . sub . 2 o . sub . 4phases mnnb . sub . 2 o . sub . 6 nial . sub . 2 o . sub . 4surface properties ferromagnetic ferromagnetic ; ferromagnetic ; ferromagnetic active catalyst active catalyst ( co , c . sub . 6 h . sub . 8 oxida - ( co , c . sub . 6 h . sub . 8 oxida - tion ) tion ) k &# 39 ; = 14 . 8 k &# 39 ; = 12 . 4 k &# 39 ; = 12 . 0 tanδ = 0 . 038 tanδ = 0 . 016 tanδ = 0 . 01__________________________________________________________________________ while the foregoing examples indicate that a broad range of manganese - containing compositions may be treated according to the invention to provide exuded crystalline films thereon , the best film properties are produced over a somewhat narrower range of composition . among the aluminosilicate glass - ceramic compositions amenable to treatment according to the invention , those consisting essentially , in weight percent on the oxide basis as calculated from the batch , of about 19 - 40 % sio 2 , 13 - 43 % al 2 o 3 , and 15 - 50 % mno 2 , optionally including 0 - 4 % zno , 0 - 10 % tio 2 , 0 - 10 % zro 2 , 0 - 10 % sno 2 , 0 - 10 % nio , 0 - 5 % fe 2 o 3 , and 0 - 30 % nb 2 o 5 , are preferred . these compositions may provide exuded films containing at least one of mn 3 o 4 , fe 3 o 4 , mnal 2 o 4 , nial 2 o 4 , mnfe 2 o 4 , nife 2 o 4 , mnnb 2 o 6 , mn 2 al 2 ( sio 4 ). sub . 2 and ti 2 nb 10 o 29 , many of which provide desirable electrical , magnetic and / or catalytic properties . preferred boroaluminate glass - ceramic compositions according to the invention are those consisting essentially , in weight percent on the oxide basis as calculated from the batch , of about 20 - 35 % al 2 o 3 , 5 - 35 % b 2 o 3 , and 28 - 60 % mno 2 , optionally including 0 - 15 % bao and 0 - 35 % la 2 o 3 . these compositions provide mn 3 o 4 and / or mnal 2 o 4 - containing films of good quality having desirable electrical properties . from the foregoing description it is apparent that a large number of exuded transition metal oxide films may be provided on glass - ceramic base articles according to the invention to impart a variety of useful properties thereto . thus articles having configurations suitable for use as magnetic memories , such as discs , may be conventionally formed , crystallized and provided with flat surfaces , and thereafter heat treated to exude magnetic transition metal oxide films thereon . similarly glass - ceramic tubes , honeycombs , or the like may be formed , heat treated to exude catalytically - active films thereon , and incorporated into catalytic reactors to provide stable , durable active elements . of course , these examples are merely illustrative of the numerous applications for glass - ceramic articles having integral exuded films which may be practiced within the scope of the present invention as defined by the appended claims . | 7 |
with reference to the drawings for purposes of illustration , the present invention is embodied in a hypodermic syringe assembly 20 ( fig1 ) that includes a cartridge 22 hollow to form a cylindrical storage chamber 23 ( fig2 ) and a piston 24 moveable within the chamber 23 to cause the withdrawal or retrieval of viscous or gaseous medical material within the chamber . the cartridge 22 is disposed for activation of the piston 24 in a delivery device 26 having a magnet assembly 28 moveably attached to the delivery device 26 to move in the direction indicated by line 30 and controlled by an actuator 32 . advantageously , the cartridge piston 24 is magnetically coupled to the magnet assembly 28 and is moveably responsive to the magnet assembly 28 for travel within the chamber 23 in the direction indicated by line 30 . it will be appreciated that this configuration thus eliminates the need for a piston rod as featured in conventional , manually operated syringes that utilize a plunger formed from a piston and piston rod . the delivery device 26 includes a cartridge nest 34 for securely holding the cartridge 22 when in use . the cartridge nest 34 is further defined by a material transfer interface 36 that allows for attachment of the cartridge to a transfer device 38 ( fig2 ). a transfer device 38 of the type suitable for this purpose , but without limitation , is a hypodermic needle , tube , nipple or the like . an adjustable guard 40 or tensioning member secures the cartridge 22 within the cartridge nest 34 against the transfer interface 36 . the guard 40 may incorporate tensioning means for holding the cartridge 22 in place against the transfer interface 36 . tensioning means of the type suitable for this purpose may include , but is not limited to , a spring , rubber or elastomeric material . the guard 40 is preferably adjustable in the direction indicated by line 30 to accommodate different lengths of cartridges 22 ; however , other embodiments may include a stationary guard in which the cartridges are of uniform size or the different lengths can be maintained by the tensioning means . an actuator drive train 42 ( fig2 ) that connects the actuator 32 to the moveable magnet assembly 28 is shown for exemplary purposes within a housing 44 below the cartridge nest 34 . the actuator drive train 42 ( fig2 ) may be configured in any form to accommodate manual movement by an individual into a linear transfer of the magnet assembly 28 along the length of the cartridge nest 34 . for exemplary , purposes the delivery device 26 is shaped as a gun with the actuator 32 forming a pivotally movable trigger 46 and grip 48 alongside the cartridge nest 34 . the trigger 46 is preferably spring biased away from the grip 48 and geared when pulled toward the grip 48 to rotate a rod slotted as a screw drive 50 . the magnet assembly 28 is coupled conventionally to the slots that are carved to enable the magnet assembly 28 to move linearly in both directions . to facilitate usage , the trigger 46 is preferably calibrated with the screw drive 50 such that one pull of the trigger 46 causes the magnet assembly 28 to move the complete length of a path along the cartridge nest length . this eliminates the need to “ pump ” the trigger multiple times to move the magnet assembly completely in one direction . this allows for in mass vaccination situations for the delivery device to be operated quickly and reloaded with new needles and cartridges for repeated use . the delivery device housing 44 and drive train 42 may be manufactured from plastic or metal as required for intended use , manufacturing cost and durability . the magnet assembly 28 , sized and shaped to surround the cartridge 22 with a magnetic field and attach to the actuator drive train 42 , includes a magnetic field , formed from one or more magnets , sufficient to move the magnetically responsive piston 24 when aligned with the piston 24 within the cartridge 22 along the length of the cartridge chamber 23 . factors to consider when selecting the magnetic field strength of the magnet assembly include the thickness of the cartridge wall , material used for cartridge manufacturing , magnets , materials used for the piston , friction between the wall and the piston inside the cartridge chamber , resistance of the body to injection within tissue and veins from blood pressure , relevant pharmaceutical requirements and the viscosity of the medical material to be transferred . for purposes of this invention medical material may include , but is not limited to , gas , powder or liquid material or other material typically delivered to or withdrawn from a living body . furthermore the term “ medical material ” is used to promote and facilitate understanding of the invention &# 39 ; s operation in terms of conventional syringe uses , but is not intended to be limiting and can refer to any chemical material or be used in applications not associated with a living body . it will be appreciated that the plunger - less design of the present invention allows for the placement of the manual actuator to be located alongside the chamber or in another location more appropriate for the ergonomic design and handling of the device rather than rearward of the storage chamber as required by mechanical requirements when working with a plunger drive mechanism . furthermore , the overall size of the delivery device can be adapted to be more compact without the need to accommodate a withdrawn plunger rod . with reference now to fig3 , an exemplary cartridge 22 generally includes a cylindrical casing 60 made of conventional materials for storing medical material and depending upon the application may include , but is not limited to , glass , plastic , ceramic or metal . the cartridge chamber 23 formed by the casing includes a magnetically responsive piston 24 sized and shaped to move easily through the chamber 23 while providing a sufficient seal between the piston 24 and cartridge casing 60 to inhale or expel medical material when coupled with a transfer device without allowing the medical material to pass to the other side of the piston 24 . the piston 24 may include any magnetically responsive material or may be magnetic itself depending upon the application . furthermore , in instances where the medical material is reactive to the piston material , the piston may be coated with a cover material that is inert to or non - reactive with the medical material . a rubber stopper 62 is provided to secure the medical material in the chamber , but may be penetrated with sufficient ease to permit connection to a transfer device when connected to a transfer interface within a delivery device . an air evacuation slot 64 is provided in the casing to allow for ambient air to fill or expel from the empty portion of the cartridge chamber 23 . while enlarged in the drawing for purposes of illustration , it will be appreciated by those skilled in the art that the air slot diameter need only be large enough to permit the free flow of air when the piston 24 is moved . unlike conventional syringe cartridges that are designed to accommodate contact of a piston rod with the piston , the air slot of the present invention can easily be covered and sealed to prevent exposure of medical material with ambient air thereby increasing the shelf life capability of the cartridge . with reference to fig4 where like reference numerals refer to like structures , an exemplary cartridge design for extended storage is shown wherein the cartridge 22 includes a knob 70 or ball of excess casing material covering the air slot 64 . where the casing 60 is manufactured from glass , plastic , ceramic or the like , a break - away or cutaway knob 70 or ball made of like casing material or material that readily adheres to the casing material is provided to seal the air slot 64 . when the cartridge 22 is selected for use to dispense the medicine , the knob 70 or ball of material is broken or cut away from the hole . it will be appreciated by those skilled in the art that the guard 40 ( fig1 and 2 ) of the dispensing device 26 may be adapted with a sharp edge that that upon insertion of the cartridge 22 ( fig4 ) into the dispensing device , the knob 70 is pressed against the guard and is broken or cut off of the casing 60 . with reference now to fig5 where like reference numerals refer to like structures , an exemplary cartridge design for extended storage is shown wherein the cartridge 22 includes a cap 80 sealing engaged over the end of the cartridge 22 with the air slot 64 . this embodiment provides extended shelf life for the medical material with more options for use than in fig4 , as the cap 80 can be used with cartridges intended for the dispensing of drugs as well as cartridges intended for the withdraw of samples from a living body . those skilled in the art will appreciate that the increased contact surface area of the cap 80 with the casing 60 about the air slot 64 provides a better sealing engagement than can be obtained with conventional syringe cartridges . in yet another embodiment , fig6 where like reference numerals refer to like structures a cartridge 22 is illustrated with a cap 80 covering an opening filled with a membrane material 90 that is selected with application specific features . the membrane 90 can provide one - way withdrawal or inhalation of ambient air . where this configuration is used for the storage of a drug the membrane can operate once the piston 24 is pulled away to allow air into the chamber 23 , but would otherwise prevent air from entering while the piston remains in contact with the membrane . such a membrane of this type may be a rubber stopper and flap forming a bellows valve or the like . furthermore , the membrane may be adapted to allow for the passage of only certain gases and in certain directions to address thermal changes or other factors during storage while reducing contamination with ambient air . with the benefits of a piston - less syringe and cartridges usable for the long term storage of drugs and an improved delivery device that can be easily adapted ergonomically for different applications and without reliance on electrical or battery power for use , the savings to the medical community in manufacture , storage and transportation of drugs and drug delivery devices may be fully realized by understanding that ampoules or vials are now conventionally delivered with disposable syringes at any facility supplying injections . the syringe and ampoule are manufactured under sterile conditions and must be transported and stored at the local facility increasing storage costs , transportation and manufacturing costs . by using a cartridge as the drug storage vehicle as it is designed to handle long term storage or storage periods that make better economic sense and are consistent with logistical and strategic purchasing strategies , the ampoule is eliminated from transport and storage . the cartridges are more compact and can be stored more efficiently . transfer devices such as needles can be stored with the cartridges rather than requiring the storage of entire syringes . various reusable delivery devices can be stored in limited numbers on site , substantially reducing the storage space now used for disposable syringes . cartridges can be used in other dosing devices decreasing the need for specialized drug dispensing equipment . the improved seal of the cartridges allows for the contemplation of gaseous medical material to be stored in the cartridge , which was not possible in conventional cartridge designs . also the bi - directional movement of the piston allows for powders to be stored and used in the cartridge in which a liquid is drawn into the cartridge at the time of use to reconstitute the powder for injection in a liquid form . thus , utilizing a system in which : 1 . a trigger mechanism that uses magnets and magnetic energy to inject and withdraw eliminating plunger mechanism is provided . 2 . all dosages come in a completely sealed cartridges placed into a trigger mechanism . these have a shelf life limited only by the stability of the drug and could be estimated in for storage periods believed to be similar to ampoules or vials . 3 . this cartridge forms a syringe and a storage vessel at the same time , as ampoules and vials are eliminated . 4 . this cartridge can operate to store liquid , gas and powder . 1 . the process increases shelf life of the drug and decreases storage space . 2 . the costs of injection are reduced by eliminating ampoules , vials , syringes , pre - filled syringes , short shelf life cartridges , simplification of the drug manufacturing process , reduction in the fda controlled inspection steps , less packaging , shipping and handling . 3 . a small , compact and easy to use design and construction is provided . 4 . the trigger mechanism and the cartridge are light weight and can be used for liquid , gas and powder drugs and chemicals . 5 . this device works in both directions and , therefore , is capable of incretion and extraction . 6 . this product when widely adapted in a facility will standardize inventory even more reducing the unnecessary varieties of syringes and cutting the cost of injection even further . 7 . pre - measured doses reduce human error and increase compliance during injection . 8 . using cartridges in different pre - measured quantities and reusable delivery devices reduces the waste of drugs and materials ; it will be appreciated by those skilled in the art that the benefits and features of a magnetically actuated piston that allows for varying placement of the actuator may be used in syringe type device with or without a removable cartridge . furthermore , it will be appreciated the removable cartridges while described for use in a manual syringe type device may used in any type of device including computer controlled automated dispensing and sampling systems . while the exemplary embodiment utilizes a natural magnet design , the magnet assembly may include electromagnetic solenoids for providing the magnetic actuation of the piston by an electrical switch . it will be apparent to those skilled in the art that various modifications and variations can be made to the container and method of the present disclosure without departing from the scope of the invention . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only . | 0 |
the invention is described more fully hereinafter with reference to the accompanying drawings , in which exemplary embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the exemplary embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . in the drawings , the size and relative sizes of layers and regions may be exaggerated for clarity . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . embodiments of the invention are described herein with reference to illustrations that are schematic illustrations of idealized embodiments ( and intermediate structures ) of the invention . as such , variations from the shapes of the illustrations as a result , for example , of manufacturing techniques and / or tolerances , are to be expected . thus , embodiments of the invention should not be construed as limited to the particular shapes of regions illustrated herein but are to include deviations in shapes that result , for example , from manufacturing . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein . fig1 is a perspective view of a display case having a transparent lcd 200 . generally , the display case includes a housing 105 , to which a door frame assembly 100 is fastened . in this embodiment , a cavity 110 is provided below the door frame assembly 100 where various electronic devices 111 for operating the transparent lcd assembly 200 can be located . the electrical devices 111 may include any or all of the following : power modules , timing and control board ( tcon ), video player , hard drive / electronic storage , microprocessor / cpu , wireless transmitter / receiver , cellular data transmitter / receiver , and internet connectivity . at least some of the electrical devices 111 are in electrical communication with the transparent lcd 200 . fig2 is a perspective view of the display case of fig1 where the door has been opened . the transparent lcd 200 is preferably sandwiched between a front glass 225 and rear glass 205 . also preferably sandwiched between the front and rear glass 225 / 205 is an upper plate 216 and a lower plate 215 , each of which are preferably attached to the rear glass 225 such that heat from the plates can be conductively transferred to the rear glass 225 and removed by natural or forced convection . in an exemplary embodiment , the upper and lower plates are preferably bonded to the rear glass 205 through adhesive transfer tape . an exemplary adhesive transfer tape for this purpose would be 468 mp , available commercially from 3m ™ of st . paul , minn . www . 3m . com / converter in order to illuminate the transparent lcd 200 , one or more printed circuit boards ( pcbs ) each containing a plurality of leds is preferably in conductive thermal communication with either the upper , lower , or both plates . in this way , heat that is generated by the leds can be transmitted to the pcb and eventually transferring to the rear glass 205 where the heat can dissipate through natural or forced convection . fig3 is a perspective view of the display case of fig1 showing the cavity for electronic devices 111 as well as the location of detail a . fig4 is a front view of detail a shown in fig3 . here , a wireless transmitter / receiver 450 is shown within the cavity 110 and included with the electrical devices 111 . fig5 is a perspective view showing a lower mounting plate 215 and various electronic devices 400 in electrical communication with the lcd 200 . a second wireless transmitter / receiver 455 is also preferably positioned on the lower mounting plate 215 and may communicate electronically with the wireless transmitter / receiver 450 shown within the cavity 110 . a plurality of different signals can be transmitted between the two wireless devices 450 / 455 including but not limited to : image / video data , visual alerts , image inspection / test patterns , temperature of the display case , and feedback data from the lcd 200 such as brightness , color saturation , color temperature , gamma , and contrast ratio . as noted above , preferably the electronic devices 400 are in conductive thermal communication with the plate 215 which is preferably bonded to and in conductive thermal communication with the rear glass 205 so that heat generated by the electronic devices 400 can be removed . similarly , fig6 is a perspective view showing an upper mounting plate which can also be used to mount various electronic devices and is also preferably bonded to and in conductive thermal communication with the rear glass 205 . the wireless devices 450 / 455 can operate under any form of wireless networking technology , including but not limited to : wpan , wlan , a wireless mesh network , or gan . specifically regarding the architecture for a wlan network , these could include but are not limited to stations , basic service set , extended service set , and a distribution system . further regarding the types of wireless lans , these could include but are not limited to peer - to - peer , bridge , and a wireless distribution system . any form of general encryption method can be used with the exemplary embodiments herein . in a preferred embodiment , the lower plate 215 would extend horizontally as far as possible , preferably to the same horizontal width as the lcd 230 and may extend 4 - 14 inches in vertical width , depending on the application . although shown attached to the lower plate 215 , electrical devices 400 could also be mounted to the upper plate 216 . in a preferred embodiment , the upper plate 216 would extend horizontally as far as possible , preferably to the same horizontal width as the lcd 200 . the upper plate 216 may also extend 4 - 14 inches in vertical width , depending on the application . while not required , it is also preferred that the lower plate 215 and the upper plate 216 are within 15 % of the same surface area . in other words , it is preferred that the plates 215 / 216 are substantially the same surface area . this is not required however , as some embodiments may require a larger surface area for the plate which would contain the electrical devices 400 , or a larger surface area for the top plate 216 as compared to the bottom plate 215 . it is preferred that the plates are both metallic , and most preferably aluminum , but they can be any material that has good thermal conductivity . fig7 is a perspective view of a partially assembled exemplary embodiment of a sealed transparent lcd assembly 200 . here , the front glass 225 has been removed to show the interior of the sealed assembly 200 . this view shows the rear glass 205 with the spacer 300 attached around the perimeter of the glass 205 . the various electronic devices 400 as well as the second wireless transmitter / receiver 455 are shown attached to the bottom plate 215 and sealed between the rear glass 205 and front glass 225 ( not shown here ). fig8 is a perspective view of the sealed transparent lcd assembly 200 of fig1 - 2 . generally speaking , the assembly includes a spacer 300 which is sandwiched between a front glass 225 and rear glass 205 . these components are preferably sealed together with an inert gas filling the sealed enclosure . the components are preferably gaseously sealed so that outside gas cannot penetrate into the assembly and any gas sealed within the assembly cannot substantially escape . although not required for every embodiment , argon gas has been found to be preferred as the gas sealed within the assembly . for gaseously sealing these components together , it is preferable to use a hot melt polyurethane . preferably , the spacer 300 is the super spacer ® standard from quanex in cambridge , ohio www . quanex . com . in an exemplary embodiment , the spacer 300 would be a flexible foam that contains a desiccant and has a pressure sensitive acrylic adhesive on the front and back edges of the spacer which would be used to bond with the front and rear glass . the embodiments of the wireless communication and transparent lcd system described herein can be used with any number of display case designs , either temperature controlled or not , and with doors that open or glass that remains stationary . although shown here with a transparent lcd , the wireless system could be used with a traditional backlit lcd as well . having shown and described a preferred embodiment of the invention , those skilled in the art will realize that many variations and modifications may be made to affect the described invention and still be within the scope of the claimed invention . additionally , many of the elements indicated above may be altered or replaced by different elements which will provide the same result and fall within the spirit of the claimed invention . it is the intention , therefore , to limit the invention only as indicated by the scope of the claims . | 7 |
as shown in fig1 a vehicle drive system includes a main drive shaft 10 which is connected through a known type of differential gear 11 to driving wheels 12 of the vehicle . drivingly coupled to the shaft 10 is the rotor of an electric motor 13 which can be energised by a battery 14 by way of a control circuit 15 . the speed of the motor 13 is adjustable by a suitable control 16 . an internal combustion engine 20 has an output shaft 25 which can be coupled to the shaft 10 by means of an electro - magnetic clutch 21 . a non - slipping belt and pulley arrangement 22 is coupled to a further shaft 23 . a three - phase alternator 24 is drivingly coupled to the shaft 23 . the arrangement 22 includes a pulley 32 which is loose on the shaft 25 . a plate 33 is drivingly coupled to the shaft 25 . a stationary electromagnet 34 surrounds the pulley 32 and plate 33 and is energisable to urge the plate 33 and pulley 32 into frictional driving engagement . the pulley 32 , plate 33 and electromagnet 34 combine to provide a further clutch 35 . output current from the alternator 24 is supplied to a rectifier circuit 26 whose output is connected across the battery 14 . the battery 14 comprises eighteen 12 volt battery units , providing 216 volts . a dc / dc converter 27 is connected across the output of the battery 14 for maintaining a charge on an auxiliary 12 volt battery 28 which can supply , inter alia , the starter and ignition circuits of the engine 20 , through a switch 29 . in its fully clockwise position the switch 29 supplies current to a starter ( not shown ) of the engine 20 through a switch 36 . a battery charging circuit 30 is also connected across the terminals of the battery 14 and can be connected to a 240 volt mains supply through terminals 31 . a transducer 40 is coupled to the shaft 10 and provides , on a line 41 , a signal nd corresponding to the speed of the shaft 10 . a further transducer 42 is coupled to the shaft 25 and provides , on a line 43 a signal ne corresponding to the speed of the engine 20 . a limit detecting circuit 46 is responsive to the engine speed signal ne on line 43 to provide a signal on a line 45 when the signal ne exceeds a predetermined low value . a circuit 44 is shown in detail in fig4 to 6 and acts to regulate the field current of the alternator 24 , and thereby the load imposed by the alternator 24 on the engine 20 when the clutch 35 is operated . the propulsion system can be operated in at least five modes : 1 . with the clutch 21 disengaged and the motor 13 energised by the battery 14 to drive the shaft 10 . 2 . with the clutch 21 disengaged , the battery 14 energising the motor 13 to drive the shaft 10 , the engine 20 running and the clutch 35 engaged to drive the alternator 24 and thereby to maintain the charge of the battery 14 and to provide at least part of the current supply to the motor 13 . 3 . with the engine 20 running , clutch 21 engaged , clutch 35 disengaged and the motor 13 de - energised by means of its control circuit 15 . in this condition the engine 20 is driving the shaft 10 directly and the rotor of the motor 13 acts , effectively , as a flywheel . 4 . with the engine 20 running , the clutch 21 engaged and the motor 13 energised to drive the shaft 10 . in this condition the engine 20 is supplementing the power output of the motor 13 . 5 . with the engine 20 running , the clutch 21 engaged and the motor 13 acting as a generator to charge the battery 14 . in any of operating modes 3 , 4 or 5 above , the speed of the engine 20 is controlled in a conventional manner by a throttle operated by a pedal . operation in modes 3 , 4 and 5 will usually be commenced when the vehicle is moving at a substantial speed . it is therefore necessary to match the speed of the engine 20 with that of the shaft 10 before the clutch 21 is engaged . speed matching is effected by engaging the clutch 35 while the engine 20 is stationary , starting the engine , opening the engine throttle sufficiently to enable its speed to be raised to a level at which the clutch 21 can be operated , and varying the load applied by the alternator 24 to the engine 20 , to cause operation of the clutch 21 by circuits 50 , 51 shown in detail in fig2 and 3 respectively . as shown in fig2 the circuit 50 includes a relay r1 having normally - closed contacts r1a and normally open contacts r1b . a further relay r2 has normally open contacts r2a and normally closed contacts r2b . a third relay r3 has normally closed contacts r3a and normally open contacts r3b . a fourth relay r4 has normally open contacts r4a and a fifth relay r5 has normally closed contacts r5a . when the engine ignition switch 29 ( fig1 ) is in its central , normally - running position a signal is provided on a line 52 to the circuit 50 . the line 52 is connected to the clutch 35 through a line 53 , by way of the relay contacts r4a . the line 52 is also connected to the line 53 through a series arrangement of the contacts r1a , contacts r2b , diodes 54 , 55 connected cathode to cathode and the contacts r5a . the relay r4 is connected in parallel with a rc delay circuit 56 to the junction between the diodes 54 , 55 . the line 45 is connected through a diode 57 and a resistor 58 to a line 59 connected to the ignition circuit of the engine 20 . a series arrangement of two diodes 60 , 61 connected cathode to cathode , the contacts r2a and contacts r1a are also connected between the line 45 and the line 52 . the relay r2 is connected between earth and the junction of the diodes 60 , 61 . the relay r3 can be energised from the line 52 through the contacts r1b and a switch 65 arranged in series . the switch 65 is operable by a signal on a line 66 from the circuit 51 ( fig1 ). the line 52 can be connected to the relay r1 by means of a manually operable switch 67 . energisation of relay r1 closes contacts r1b and the relay r1 is thereafter maintained energised through a diode 68 . the relay r5 is energisable from the line 52 through a series arrangement of the contacts r1b , r3b and a diode 73 . the relay r5 is also energisable from the line 52 when the contacts r1b and the switch 65 are both closed . a line 69 to the clutch 21 ( fig1 ) communicates with the line 52 when the contacts r1b and r3b are both closed . indicator devices 70 , 71 are energised when signals are present on the lines 53 , 69 respectively . a further indicator device 72 is energised when the relay r1 is latched on through the contacts r1b and diode 68 . as shown in fig3 the circuit 51 includes a differential amplifier 80 which is responsive to the signals nd , ne on lines 41 , 43 respectively . an output signal from the amplifier 80 is supplied to a zero - level detecting circuit 81 which provides a signal on the lines 66 to the circuit 50 when the speeds of the drive shaft 10 and engine 20 are substantially equal . an alternative form of the device 81 provides a signal when a difference between these speeds is less than a predetermined amount . for example a signal may be provided on lines 66 when the speed of the engine 20 is less than one or two hundred rpm above or below that of the shaft 10 . output signals from the amplifier 80 are also supplied to a proportional plus integral amplifier 82 whose output is connected through a switch 83 and a resistor 84 to the inverting input of a further differential amplifier 85 . the switch 83 is ganged with the switch 67 in the circuit 50 ( fig2 ) and the switch 36 in the line to the engine starter ( fig1 ), so these switches are operated at the same time and that when the switches 67 , 83 are closed , the switch 36 is open . the inverting input of the amplifier 85 is also supplied , through a resistor 86 , with an engine speed demand signal on a line 87 from a selector device 88 ( fig1 ). the non - inverting input of the amplifier 85 is supplied with the engine speed signal ne on line 43 . the output of the amplifier 85 forms a field current demand signal which is supplied on a line 89 to the control circuit 44 ( fig1 ) for the alternator 24 , to regulate the alternator field current , and thereby the load imposed by the alternator 24 on the engine 20 when the clutch 25 is engaged . if the propulsion system is operating in mode 1 above , and it is required to couple the engine 20 to the shaft 10 to operate in any of modes 3 , 4 or 5 , the switch 29 applies and maintains a signal on line 52 and subsequently starts the engine 20 . return of the switch 29 to its central position maintains the signal on the line 52 . this signal passes through contacts r1a , r2b and diode 54 to operate the relay r4 and close the contacts r4a , the resulting voltage on line 53 energising the clutch 35 to couple the engine 20 to the alternator 24 . when the engine speed signal ne exceeds a predetermined low value limit detection circuit 46 provides a signal on line 45 which is applied through the diode 57 and resistor 58 to the line 59 , to supply the ignition circuit of the engine 20 . at the same time the control circuit 44 provides a field current to the alternator 24 , thereby imposing a load on the engine 20 . the signal on line 45 energises the relay r2 ( fig2 ), opening the contact r2b and shutting the contacts r2a . since contacts r4a have been shut , relay r4 is maintained energised through the normally - closed contacts r5a and the diode 55 . closure of contacts r2a maintains the relay r2 energised through the diode 61 . the switch 67 is now operated to energise relay r1 from the supply on line 52 , closing contact r1b and opening contact r1a . relay r2 is nevertheless maintained energised by the signal on line 45 and relay r4 by the latch provided by contacts r4a , r5a . closure of contacts r1b energises the indicating device 72 through the normally - closed contacts r3a , providing an indication that driving connection between the engine 20 and the shaft 10 has been selected , but has not yet occurred . when the speed of the engine 20 is substantially equal to that of the shaft 10 the switch 65 is closed , energising relay r3 and closing the contacts r3b . the voltage signal on line 52 is then applied through line 69 to energise the clutch 21 . closure of contacts r3b also energises relay r5 through the diode 73 , opening contacts r5a and de - energising relay r4 . contacts r4a open after a delay imposed by the circuit 56 , causing the clutch 35 to be disengaged . the alternator 24 is , however , no longer required to load the engine 20 , since speed matching has already occurred . indicator device 72 is de - energised and device 71 is energised to show that the clutch 21 is engaged . after the ganged switches 67 , 83 in circuits 50 , 51 respectively have been closed , but before the switch 65 is closed the speed of the engine 20 is varied by adjusting the load of the alternator 24 thereon , by means of the signal on line 87 from the speed selector device 88 ( fig1 ). as shown in fig3 the engine speed signal ne and the shaft speed signal nd on lines 43 , 41 respectively are applied to the amplifier 80 and any speed error is subjected to proportional plus integral amplification before being applied through the switch 83 and resistor 84 to the inverting input of the amplifier 85 , to which input the signal on line 87 is also applied . the engine speed signal ne is also applied to the non - inverting input of amplifier 85 . the effect is that a required increase in engine speed results in the signal on line 89 being applied to the circuit 44 to reduce the field current of the alternator 24 , and hence the load of the latter on the engine 20 . when the speed signals ne , nd are equal , the resulting zero output from the amplifier 80 is detected by the circuit 81 and provides a signal on the line 66 to operate the switch 65 , resulting in energisation of the clutch 21 , as described above . after the clutch 35 has been disengaged it is necessary to prevent the clutch 21 from being disengaged while the engine 20 is running , since the engine would then be unloaded and could overspeed . this requirement is met by the arrangement described , since if switch 67 ( fig2 ) is opened while the engine is running the relay r1 nevertheless remains energised through the contacts r1b and the diode 68 . the contacts r3b are thus maintained shut by relay r3 and the clutch 21 remains energised . additionally , since relay r1 remains energised the contacts r1a are open . contacts r4a are also open and the clutch 35 cannot be re - engaged with the engine 20 running . in order to de - energise the relay r1 and disengage the clutch 21 it is necessary to operate the switch 29 to remove the voltage supply from line 52 . if , with the switch 67 open the switch 29 is first operated to remove the voltage on line 52 , de - energisation of relay r1 closes contacts r1a and opens contacts r1b . relay r3 is de - energised , contacts r3a close and contacts r3b open , and clutch 21 is disengaged . if switch 29 is subsequently shut while the speed ne of the engine 20 is above that required to provide the signal on line 45 , relay r2 remains energised and contacts r2b are open . relay r4 cannot therefore be energised through contacts r1a and the clutch 35 cannot be engaged while the engine speed ne is above its predetermined low value . the switch 36 , being ganged to the switches 67 , 83 , prevents the engine 20 from being started when the switch 67 is closed , since if this occurred the clutch 21 would be engaged while the engine 20 was running unloaded by the alternator 24 , by way of the clutch 35 . as described above the control circuit 44 controls the field current of the alternator 24 in accordance with the magnitude of the signal online 89 . the circuit 44 comprises well - known circuit arrangements which operate in a known manner , and which do not of themselves form part of the invention . the circuit 44 will therefore be described only insofar as to enable its operation to be understood . as shown in fig4 and 6 the circuit 44 may be considered as comprising parts 44a , 44b and 44c . part 44a is an amplifier stage responsive to the signal on line 89 from the circuit 51 ( fig3 ) and to the ignition voltage on line 59 ( fig1 ). two amplifier . circuits 100 , 101 respond to the signal on line 89 to provide a signal on a line 102 . a semiconductor switch arrangement 103 is responsive to the ignition voltage signal on line 59 , absence of this signal connecting the line 102 to an earth rail 104 . a buffer circuit 105 is responsive to the signal on line 102 to supply a signal on a line 106 to the part 44b ( fig5 ). as shown in fig5 the signals on line 106 is applied to the inverting input of an amplifier 95 whose other input is connected to a feedback line 122 . the amplifier 95 forms one element of an integrated circuit of the type available from motorola under the designation mc3301 , the numerals adjacent the amplifier indicating the terminals to which respective connections are made . the amplifier 95 has associated externally connected components to provide an integrating term and its output is supplied on a line 96 to an oscillator circuit 97 which also forms an element of the aforementioned motorola integrated circuit . the frequency of the output of oscillator 97 is dependent on the magnitude of the signal on line 96 and typically is in the range of 100 hz to 1 khz . the oscillator output is applied to the base of a npn transistor 110 , through a resistor 98 which forms part of a resistor - capacitor network 99 connected between a + 12 v rail 111 and an earth rail 112 , and provides a suitable bias at the output of oscillator 97 . the transistor 110 is connected between the rails 111 , 112 through a + 8 v regulating circuit 107 and the arrangement is such that a negative signal on the base of transistor 110 results in a positive voltage on a line 113 . a diode , resistor and capacitor network 114 acts as a voltage pulse shaping circuit for the signals on line 113 . the signals on line 113 are applied through a potential divider 115 to a line 116 to the base of npn transistor 117 which is connected between the rails 111 , 112 so that a positive signal on its base results in a low level signal on the base of a pnp transistor 118 . transistor 118 is connected between the rails 111 , 112 so that in response to the low level signal on its base it provides a positive signal on the base of a npn transistor 119 , causing the latter to conduct . the transistor 119 is connected between the rails 11 , 112 in series with the primary of a transformer 120 . the transistors 117 , 118 , 119 and their associated capacitors and resistors comprise a voltage to current switching circuit which provides current pulses in the primary of the transformer 120 , these pulses having the frequency of the oscillator circuit 97 . a capacitor 130 and resistor 131 in series between the transformer primary and the rail 112 act to suppress voltage spikes . the secondary winding of the transformer 120 is centre - tapped and is connected to a network 132 of resistors , diodes and zener diodes which shape the transformer output current pulses to provide drive pulses to the base of a power transistor 133 , and also provide protection against excessive voltage on the base of the transistor 133 . the transistor 133 is connected through the primary winding of a transformer 134 between the negative terminal of the 216 volt battery 14 ( fig1 ) and a lead 135 to the field winding of the alternator 24 . a second lead 136 from the field winding is connected to the positive terminal of the battery 14 . a diode 137 is connected between the lines 135 , 136 so as to be reverse biased with respect to the dc voltage on these lines , and acts as a so - called &# 34 ; free - wheel &# 34 ; diode to maintain the field current during intervals when the transistor 133 is switched off . as described the primary winding of the transformer 134 is connected in the - 216 volt line . switching of the transistor 116 in response to the pulses on line 115 results in current pulses through the primary of the transformer 120 . these pulses have the frequency of the output of the oscillator 109 and are detected by the secondary of the transformer 134 . a resistor , capacitor and diode network 138 forms a compensated peak - to - peak detection circuit which provides a feedback signal on the line 122 , this signal comprising a dc level proportional to the peak - to - peak magnitude of the current pulses through the primary of the transformer 134 . the arrangement is such that the magnitude of the signal on line 122 is dependent on the magnitude of the field current . an increase in the field current demand signal on line 106 results in an increase in frequency of the field current , and a signal corresponding to the increased current is fed back to the amplifier 95 on the line 122 to provide a new steady - state condition . | 1 |
parts which correspond to one another are provided with the same reference symbols in all the figures . referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown an electrical plug connector 1 having a contact carrier part 2 illustrated in a perspective view . the contact carrier part 2 has socket contact openings 3 at the end side and conductors 4 leading to the socket contact openings 3 . a housing half - shell 5 has a latching opening 6 and a latching hook 7 lying radially opposite the latter . the latching hook 7 latches with the latching opening 6 of a complementary , second housing half - shell 5 ( not illustrated here ). the housing half - shells 5 accommodate the contact carrier part 2 between them and in the assembled state they form , in conjunction with the contact carrier part 2 , the housing of the electrical plug connector 1 . in this context , cylindrical shell sections 8 of the housing half - shells 5 enclose a carrier shaft 10 of the contact carrier part 2 while bearing against a securing collar 9 of the contact carrier part 2 . a further latching hook 11 , which faces the shell section 8 and is spaced apart from the other latching hook 7 , latches with a latching window 12 ( not visible here ) of the respective other housing half - shell 5 . on the end side , lying opposite the socket contact openings 3 , of the plug connector 1 , the housing half - shells 5 accommodate an adaptor part 13 . the adaptor part 13 contains two flange - like circumferential collars 14 which are spaced apart from one another . the latter engage in two complementary housing grooves 15 , on the inside of the housing , of the housing half - shells 5 . the adaptor part 13 therefore has on the outside an outer contour which is matched to the inner contour of the housing half - shells 5 . in addition , the outer diameter of the adaptor part 13 is matched to the inner diameter of the housing in the region of the enclosed housing half - shells 5 . the adaptor part 13 therefore lies in a form - locking fashion in the housing 5 of the electrical plug connector 1 . the adaptor part 13 encloses a sleeve line ( conduit ) 16 which is a coiled or a corrugated - tube - shape in the exemplary embodiment , the sleeve line 16 in turn enclosing the conductors 4 . fig2 illustrates in perspective the plug connector 1 with the socket contact openings 3 , the conductors 4 , the housing half - shell 5 , the latching opening 6 and the latching hooks 7 , 11 . the adaptor part 13 has here merely a securing element 13 a . the latter is provided with a continuous slot 17 through which a grounding contact 18 engages . the securing element 13 a supports or forms the securing collar 14 which engages in the housing groove 15 facing the socket contact openings 3 . the securing element 13 a in turn engages around the sleeve line 16 and rests on the sleeve line 16 on the end side . as is comparatively clearly apparent in fig3 to 5 , a contact lug 19 of the grounding contact 18 projects beyond the securing element 13 a of the adaptor part 13 , and on the side facing away from the sleeve line 16 the contact lug 19 projects into the housing 5 of the electrical plug connector 1 . the grounding contact 18 has comb - like securing and / or contact claws 20 . these are provided at the contact end , lying opposite the contact lug 19 , of the grounding contact 18 . with each second contact claw 20 , the grounding contact 18 engages in corresponding corrugation valleys 21 , while the securing claws 20 which alternate with the latter rest on corrugation peaks 22 of the sleeve line 16 , preferably while applying a pressure force . the grounding contact 18 permits an electrically conductive connection of the then electrically conductive sleeve line 16 , which is embodied , for example , as a metal tube for this purpose , with a grounding contact 23 ( fig1 ) and / or with the then metallic or electrically conductive housing half - shells 5 ( fig2 ) of the electrical plug connector 1 . as a result of the locking of the securing or contact claws 20 of the grounding contact 18 in the corresponding surface structure of the sleeve line 16 , the sleeve line 16 is also secured against rotation . the adaptor part 13 has two adaptor half - shells 13 b and 13 c . the latter are coupled in an articulated fashion to the securing element 13 a via film hinges 13 d ( fig4 and 5 ) and therefore , as is shown in fig3 to 5 , they can be pivoted against the sleeve line 16 and latched to one another in the closed state . for this purpose , the cylindrical half - shells 13 b , 13 c of the adaptor part 13 have latching hooks 24 and corresponding latching webs 25 on the opposite side . in the latched state according to fig5 , the latching hook 24 of the one half - shell 13 b engages behind the latching web 25 of the other half - shell 13 c . the latching hooks 24 of the half - shell 13 b engages correspondingly behind the latching web 25 of the half - shell 13 b . the securing element 13 a is embodied with corresponding flat sides onto which the film hinges 13 d and the adaptor half - shells 13 b and 13 c are integrally formed . the adaptor half - shells 13 b , 13 c and therefore the adaptor part 13 itself have circumferential webs 26 which run around on the inside . in the assembled state according to fig5 , the circumferential webs 26 engage in the corrugation valleys 21 of the sleeve line 16 . as a result , the inner structure of the adaptor part 13 is matched to the outer structure of the sleeve line 16 . in addition , the inner diameter of the adaptor part 13 is matched as free of play as possible to the outer diameter of the sleeve line 16 when the adaptor half - shells 13 b , 13 c are closed . the formation of the form - locking connection between the adaptor part 13 and the sleeve line 16 by the circumferential webs 26 on the inside causes the sleeve line 16 to be reliably secured by the adaptor part 13 . as a result of the form - locking securement of the adaptor part 13 in the housing 5 of the electrical plug connector 1 , the sleeve line 16 is securely held on the adaptor part 13 , wherein the adaptor part 13 is effective as a tensile strain relief . the adaptor part 13 is always the same in terms of its outer diameter and its outer structure . for the purpose of adaption to different sleeve lines 16 with different outer diameters and outer structures , the adaptor part 13 is merely embodied in a correspondingly different way on the inside . therefore , for different sleeve lines 16 all that is necessary is to make available correspondingly matched adaptor parts 13 , while the electrical plug connector 1 is otherwise always the same . the further embodiment illustrated in fig6 to fig1 shows the adaptor part 13 without the contact carrier part 2 . this embodiment is also to be understood such that in order to implement the electrical plug connector the adaptor part 13 is in turn inserted into the contact carrier part 2 . the adaptor part 13 which is illustrated in fig6 has outer ribs 27 on its outer casing . the adaptor part 13 has a hollow - cylindrical accommodation space 28 . a supporting cylinder 29 projects into the hollow - cylindrical accommodation space 28 . in a radial direction 30 of the adaptor part 13 , the supporting cylinder 29 is at a lateral distance from the inner face of an outer wall 31 of the adaptor part 13 . this lateral distance in the radial direction 30 between the outer face of the supporting cylinder 29 and the inner face of the outer wall 31 of the adaptor part 13 serves to form an accommodation pocket 32 for the sleeve line 16 in the adaptor part 13 . in order to assemble the adaptor part 13 according to fig6 to fig1 , the sleeve line 16 is first inserted into an accommodation pocket 32 in the axial direction 33 of the adaptor part 13 . as soon as the sleeve line 16 lies completely in the accommodation pocket 32 ( fig8 - 10 ), a fork - like securing clamp 34 is inserted in the radial direction 30 into the adaptor part 13 through a continuous slot 17 ′ in the outer wall of the adaptor part 13 . the fork projections 35 of the fork - like securing clamp 34 engages , in the final assembled state , in one of the corrugation valleys 21 of the sleeve line 16 which is configured as a corrugated tube . the fork - like securing clamp 34 also has the contact lug 19 which is bent over in an angled shape in the axial direction 33 away from the fork projections 34 . in the case of a metallic sleeve line 16 , the contact lug 19 serves at the same time as a grounding contact , as do the fork projections 35 which engage on the sleeve line 16 . the sleeve line 16 is secured in a form - locking fashion to the adaptor part 13 with the aid of the fork projections 35 of the securing clamp 34 which engages in the corrugation valley 21 which is aligned with the fork projections 35 in the radial direction 30 . in this context , the supporting cylinder 29 increases the rigidity of the sleeve line 16 from the inside and forms a collar - like securing flange for the sleeve line 16 on the adaptor part 13 . | 7 |
the features of the inventions will be described in sections . we begin with a hardware design that the invention was designed to be used with so that the parts of that system can be discussed with reference to how the invention functions . then we describe various configurations available in user hardware that provide some complications . next , we describe the concept of priority , which was mentioned in the background section . following that we begin to discuss two main branches of the invention , tailored scope queues , and virtual queues . after a general discussion about these designs and their implementations , we explain what a data sharing group is , and how it is used by tailored scope queues to accomplish the goal of efficacious task assignment in accord with the user &# 39 ; s desires . variations on this theme are then considered and explained in terms of various embodiments . then we discuss how the two branches of the invention respond to user &# 39 ; s system configuration and / or user &# 39 ; s application mix with dynamic configuration . one form of a multiprocessor computer system 100 which could take advantage of this invention is described with reference to fig1 . larger versions , which employ the invention , can be built in a modular manner using more groups of components similar to the ones shown , but for purposes of this discussion a 16 - processor version suffices . ( we have established the principles of this invention in a 32 processor configuration and larger systems should also be able to use the principles taught herein ). in the system illustrated there is a central main memory 101 having a plurality of memory storage units msu 0 - 3 . these can be configured to form a long contiguous area of memory or organized into many different arrangements as is understood in this industry . the msus are each connected to each of the two crossbars 102 , 103 , which in turn are connected to the highest level of cache in this exemplary system , the third level caches ( tlcs ) 104 – 107 . these tlcs are shared cache areas for all the instruction processors ( ips ) underneath them . data , instruction and other signals may traverse these connections similarly to a bus , but advantageously by direct connection through the crossbars in a well - known manner . the processors ip 0 – 15 in the currently preferred embodiment are instruction processors of the “ 2200 ” variety in a cellular multiprocessing ( cmp ) computer system from unisys corporation in the preferred embodiment but could be any processors . a store - through cache is closest to each instruction processor ( ip ), and since it is the first level cache above the instruction processor , it is called for a first level cache ( flc ). the second level caches and third level caches are store - in caches in the preferred embodiment computer systems . the second level caches ( slcs ) are next above the flcs , each ip has its own slc as well as a flc . note that the blocks 110 – 125 , each containing a flc , slc and ip , are connected via a bus to their tlc in pairs and that two such pairs are connected to each tlc . thus the proximity of the slcs of ip 0 and ip 1 is closer than the proximity of ip 2 and ip 3 to the slcs of ip 0 and ip 1 . ( the buses are illustrated as single connecting lines ; example : tlc 105 connected by bus 130 to blocks 117 and 116 ). each of these buses is an example of the smallest and usually most efficient multiprocessor cache neighborhood in this embodiment . two threads that share data will execute most efficiently when confined to one of these cache neighborhoods . also , the proximity of ip 0 – 3 to tlc 104 is greater than the proximity of any of the other ip &# 39 ; s to tlc 104 . by this proximity , a likelihood of cache hits for processes or tasks being handled by most proximate ips is enhanced . thus , if ip 1 has been doing a task , the data drawn into slc 131 and tlc 104 from main memory ( the msus 101 ) is more likely to contain information needed for that task than are any of the less proximate caches ( tlcs 105 , 106 , 107 and their slcs and flcs ) in the system 100 . tasks that require 3 or 4 processors will execute most efficiently in a tlc cache neighborhood , called a subpod . note that we may use the following terminology to refer to various neighborhoods by size . a pod would consist of the caches under a crossbar 102 , 103 , consisting of two tlcs and the lower level caches underneath them . a subpod would be those cache memory areas subsidiary to and including a tlc . in fig1 a tlc 104 has the subpod indication shown . a bus neighborhood consists of the cache memories of two ips , illustrated on fig1 as including the caches of ips 4 and 5 . the pod attached to crossbar 103 is indicated to include tlcs 106 and 107 . it is also productive to mention at this juncture that where choices need to be made between neighboring ips within a cache neighborhood for purposes of stealing for load balancing , “ buddy lists ” may be kept to minimize the overhead of choosing . this will be discussed in appropriate detail later , and reference may be made to u . s . patent application ser . no . 09 / 920 , 023 &# 39 ; s filed on aug . 1 , 2001 , and its fig4 and accompanying discussion for background information , although at that time such neighboring ips were not called “ buddies .” it should be noted that this system 100 describes a 16 ip system , and that with two additional crossbars , the system could be expanded in a modular fashion to a 32 ip system , and that such systems can be seen for example in the unisys corporation cmp cs7802 computer system , and could also be applied to the unisys es7000 computer system with appropriate changes to its os , in keeping with the principles taught herein . it should also be recognized that neither number of processors , nor size , nor system organization is a limitation upon the teachings of this disclosure . for example , any multiprocessor computer system , whether numa ( non - uniform memory architecture ) architected or uma ( uniform memory architecture ) as in the detailed example described with respect to fig1 could employ the teachings herein to improve performance as described in the background section above . this computer system 100 serves to illustrate the multi - processing ( mp ) factor referred to in this document . the mp factor is a commonly - used measure of the efficiency of a multi - processing system . for example , a 4 processor system which has a work capacity equivalent to 3 . 8 single processors is said to have a 0 . 95 ( 3 . 8 / 4 ) mp factor . the overhead of accessing a relatively slow shared memory and of managing data integrity across all the memory caches does not grow linearly , so the mp factor usually declines as the number of processors increases . for example , a 16 processor system may only have a work capacity equivalent to 12 single processors , an mp factor of 0 . 75 . in this example system , and on many other systems with a complex bus and cache structure , there are some distinct performance steps in the mp factor as the number of processors increases . for example , the mp factor of the four processors within a subpod is markedly better than the mp factor for the 5 – 8 processors in a pod . by dedicating data - sharing groups to the processors of the smaller cache neighborhoods , this invention seeks to take advantage of the greater efficiencies of those neighborhoods . in an idealized example , four applications could each be dedicated to a 4 - processor subpod and achieve a much higher total mp factor than would be available in a 16 processor system without dedication . the applications would have the advantage of the high mp factor of a 4 processor system , yet still be able to share the network and database resources of the full 16 processor system . the user &# 39 ; s system may be a subset ( or a superset ) of the configuration shown in fig1 . for example , an 8 processor system may have been delivered to the user , with two tlcs ( 104 and 106 ) and 8 processors ( 110 – 113 and 118 – 121 ). that configuration can be split by the user into two partitions , each of which is under the control of a separate instance of the os . of the processors ( 110 – 113 ) within tlc 104 &# 39 ; s cache neighborhood , any could be marked down ( disabled ) because of a hardware failure or because the user only contracted for , say , a 3 - processor software key . any of those circumstances could subsequently change and cause the os to dynamically add the processors back into the configuration . in the current hardware series , a superset is already available having 32 processors and larger systems with 64 or even more processors may also be created . for reasons detailed in our previous patent application ser . no . 09 / 920 , 023 , a single switching queue , commonly used in multiprocessor systems , becomes inefficient when the computer operating system supports processor affinity . if there is a single switching queue per system then processors scanning the queue for work must ignore tasks with affinity to other processors , extending the time required for the scan . the scan is typically performed with the switching queue &# 39 ; s data under a lock ( and thus unavailable to any other processors while locked ). passing over other processors &# 39 ; tasks extends the time that the single switching queue must be locked and this can be a severe performance impact , particularly on a system with many processors . for efficiency , the design described in the &# 39 ; 023 patent application described using a switching queue per processor rather than a single shared queue . in that design , a processor &# 39 ; s switching queue only holds tasks with affinity for that processor and consequently contention for the single processor &# 39 ; s switching queue &# 39 ; s lock is minimized . however , departing from the commonly used single switching queue means that the design must compensate for the loss of the automatic system - wide load - balancing and execution priority that comes with using a single queue . load - balancing is handled in the &# 39 ; 023 patent application &# 39 ; s design by allowing idle processors to steal work from the queues of processors that are busier on average . that design , which takes into account the impacts of cross - cache memory requests , is described in detail in the above - referenced &# 39 ; 023 patent application . in the invention described here , the execution priority ( i . e ., the preferred order in which tasks are executed ) is handled according to the needs of the user &# 39 ; s applications . in the computer industry , many systems function well with only a non - preemptive priority mechanism . “ non - preemptive ” means that the dispatcher will not preempt a currently executing task with one of higher priority unless the task voluntarily gives up control of the processor or its assigned time - slice ends . in such systems the use of priority is relatively simple , ensuring , for example , that transactions will have execution priority over batch processing and program development . in the &# 39 ; 023 patent application , such non - pre - emptive use of priority is used in the individual processor queues . at the system level , the effects of priority are not as uniform , as there are cases where one processor will run a low priority task from its own queue when there are higher priority tasks queued to other processors , but this is considered a reasonable trade - off against the performance benefits of processor affinity under most circumstances . there are , however , some applications that are designed to make explicit use of the system &# 39 ; s priority mechanisms . these are typically “ real time ” applications , which must respond with an output message to an external stimulus such as an input message within a time constraint . for example , the application may have medium priority “ producer ” tasks that generate output messages and put them onto an output queue ; and the application may have high priority “ consumer ” tasks that are responsible for taking output messages from the queue and sending them over the network . such an application will need to rely on the dispatcher to apply the priorities rigorously so that , for example , it does not have consumer tasks queued behind producer tasks causing it to overflow the space it has for waiting output messages . two alternative mechanisms are provided in this invention for more rigorous application of execution priorities . the first , a “ tailored scope queues ” design , involves the replacement of the concept of individual processor switching queue with shared switching queues tailored to cache neighborhoods , and the second , a “ virtual queue ” design , involves the use of an additional system - wide or application - wide virtual queue . in the first , the “ tailored scope queues ” design , instead of having a switching queue per processor there is a single shared queue for all the processors ( the processor group ) within a cache neighborhood . thus , within such a caching neighborhood , the priority can be easily maintained , as there is a single queue and the high priority tasks will always be taken first from that queue . even in a system with multiple caching neighborhoods , there are also more processors available to execute a high priority task on each of the queues . for a complete solution , though , it may be necessary to dedicate all the tasks of a priority - sensitive application to the cache neighborhood , and have a single queue shared by all the processors in that neighborhood , so that all the application &# 39 ; s tasks are guaranteed to be on the single queue . ( dedication of tasks to queues is discussed later in this document .) this tailored scope queues design is a trade - off against performance , as the tasks now have affinity to the processor group , rather than to a single processor , thus limiting the likelihood of advantage from the potential benefit from reusing any cache residue within the processor &# 39 ; s immediate cache . therefore such a tailored scope switching queue design is usually preferable for use by small cache neighborhoods such as a bus or a subpod , but not for large neighborhoods such as a pod where up to 8 processors share the switching queue . turn now to fig2 a and 2b , in which highly simplified conceptual models of computer systems are illustrated in diagrams 50 a and 50 b , respectively . ( we will refer to fig2 c later for the discussion of virtual queue embodiments .) inside computer system 51 a there is a dispatcher program , usually a piece of re - entrant code , an instance of which runs each of the dispatcher queues ( sq 0 – sqx ) to accomplish the tasks for the dispatcher queues . in computer system 51 a , there is a single switching queue to each instruction processor . thus , in this figure , there are n switching queues , sq 0 – sqn − 1 . in computer system 51 b , again all the dispatcher queues run the dispatcher 52 a , but here there are asymmetries between the number of dispatcher queues and the instruction processors . switching queue 1 ( sq 1 ) has four ips at its disposal , sq 2 has three , sq 3 has one , and sqx has one ( ipn − 1 ). typically , it is more difficult to arrange the multiprocessor computer system into switching queues with differently - sized scopes , but it is possible . more typically , each switching queue will have a same number of ips servicing it . this simplification makes the message a user needs to send to the operating system ( called the “ exec ” in unisys cs7802 computer systems ) simpler . identifying merely the number of switching queues or their scope forces an automatic division of the processors . it is preferable too to order the split along natural dividing lines ( i . e ., neighborhoods ) within the system . thus , processors within a group that shares a bus and / or higher - level cache should be assigned to the same switching queue to take advantage of the inherent efficiencies available to such an organization in cache sharing and processor / cache communications simplicity . it is convenient in some preferred embodiments to maintain a pair of tables that allow for easy allocation of switching queues to hardware configuration and tasks to switching queues . in fig4 a and 4b such tables are illustrated . in the table of fig4 a , the first column identifies the ips by number , 0 – 15 in the sixteen processor system . the bus neighborhoods are defined in the second column , and there are buses 0 – 7 , each having two processors . the third column identifies which bus neighborhoods and processors correspond to which processors , and there are four tlc neighborhoods , 0 – 3 . a tlc neighborhood identifies a subpod . the pod neighborhoods , of which there are two , pod 0 , and pod 1 in a 16 - processor system are identified in the next column . the switching queues are identified by number in the right side of the table of fig4 a . they correspond to pod neighborhoods ( sq 0 , sq 1 ) and subpod / tlc neighborhoods sq 2 – sq 5 , bus neighborhoods ( sq 6 – sq 13 ) and processor switching queues ( sq 14 – sq 29 ). broken down in this way , with 29 switching queues provides for an easy way to manage switching queues . on a machine with this table , one could designate for examples , sq 0 and any combination of switching queues from the bottom half of the table to fill the processor resources , but one could not use sq 2 , sq 3 , sq 6 – 9 or sq 14 – 21 , because they overlap on the resources designated for sq 0 . with reference to the computer system of fig1 , this set of efficiencies becomes apparent . any four ips that share a tlc ( a subpod neighborhood ) will be better suited to sharing a switching queue because they share the same tlc and will reuse code and data from the shared tlc rather than getting it from an msu or other tlc in many instances . this becomes even more likely as the user dedicates particular tasks that share the same data resources to a switching queue using this tlc . thus , while it is possible to split up the assignment of adjacent ips across switching queues , it is not recommended . therefore we have focused on various methodologies for ensuring that even with some enhanced user control , the more efficient allocation of switching queues will be adopted on our computer systems . the table of fig4 b is an example record of tasks and runids identified to specific switching queue as numbered in fig4 a . in the initial embodiment , we allow a computer system administrator ( a user ) to control the number of ips servicing a switching queue . therefore , we produced a new dynamic configuration parameter which we gave a static name “ swqafflvl ” as a mnemonic for “ switching queue affinity level .” swqafflvl is defined as a user addressable parameter that specifies the affinity level desired for a dispatching queue . in the preferred embodiment the allowable values are : the lower the affinity number , the greater the improvement in the multi - processing ( mp ) factor because data is shared across smaller cache neighborhoods with higher performance . ( the system can have up to four pods in our current computer system designs , but it should be recognized that in other computer systems different , analogous ip / memory architectures of larger or smaller sizes as well should be able to take advantages of the teachings provided herein ). these swqafflvl values are based on the current unisys hardware and the number of processors at a given level may change in the future because of a different hardware organization . a similar parameter can be used with alternate hardware architectures as one of ordinary skill in this field will easily appreciate . also , multiple swqaffvl parameters may be used to enhance flexibility and provide for various sized groups of processors handling various sized loads simultaneously , as one of ordinary skill in this art can easily appreciate . in our initial embodiment we use only one swqaffvl parameter for simplicity . the user &# 39 ; s swqafflvl changes only take effect on a reboot in current systems , but as per earlier discussion , it is possible to configure the operating system to handle on - the - fly changes to the sizes and number of switching queues using this invention . the system will be released with this configuration parameter set to 0 ( zero ) as the default because that provides the best performance for most environments that do not need to rigorously enforce preemptive priority . in the initial embodiment then , the user who needs preemptive priority will modify the swqafflvl parameter , to say 2 ( subpod ), to modify the number of switching queues , and this modification will take place on reboot . in other preferred embodiments , the user will send a message to the operating system with the request to modify swqafflvl and the os will handle the change , cutting over the switching queues as needed and handling the extant queues as described in the later section on the dynamic configuration of tailored scope queues . the second , virtual queue design employs an additional virtual queue for the range of task priorities that are being used explicitly within an application . ( typically , the range would encompass the highest application priorities in the system but this is not essential .) the “ application ” could be all the threads in a run , or any other group of tasks as a user may wish to aggregate or otherwise organize them . instead of having a physical queue that would result in contention , each processor in the system has its own queue ( sq 0 – sqn − 1 ) and records the value of the highest priority within the range for the application whenever it updates the queue . the set of these values constitutes the “ virtual queue 58 , as shown in fig2 c . whenever a processor has reason to look at its own switching queue for the next task to execute , it first looks at the priority values recorded by the other processors in the virtual queue . if one of those has a higher priority value , then it attempts to “ pluck ” the higher priority task from the other processor &# 39 ; s switching queue and execute it . “ plucking ” involves locking the other processor &# 39 ; s switching queue and finding and removing the highest priority task . ( there are as many ways to lock a queue and find data on it as there are multiprocessor computer operating systems , at least , and these are known to those of ordinary skill in this art ). if this is successful ( i . e ., a higher priority task is plucked from another processor &# 39 ; s switching queue ) then the dispatcher dequeues the task from the other processor &# 39 ; s queue and moves it to the processor that was looking for work and plucked it . the “ looking ” is a low overhead mechanism performed without a lock , so it is possible that some other processor may pluck the task first , in which case the processor can either ignore the task and continue dispatching from its own queue , or return to checking the virtual queue for another high priority task . there can be various optimizations of the virtual queue design , both in further reducing the overheads of scanning the virtual queue and in preferring to pluck a task that is queued nearby ( similar to the design we described for stealing in the background above ) where there is a choice of tasks needing processor resources at a given priority level . for example , in a large multi - processor system , it may be sufficient for each processor to scan only a subset of the processors , as described in the “ stealing ” algorithm of the &# 39 ; 023 patent application , relying on other processors to scan the remainder using a pre - set “ buddy ” system . the “ buddy ” system associates each processor with a buddy at each level of the cache hierarchy . for example , a processor has one buddy on the bus , another on the other bus within the subpod , another on the pod &# 39 ; s adjacent subpod , etc . it only looks at these buddies , and always in order of closeness to itself . each processor has a buddy list and each processor is in at least one other processor &# 39 ; s list . in this manner , the overheads of looking and choosing are minimized . generally , if there are significant overheads required to access distant cache neighborhoods , then the subset of the processors that are scanned can be organized so that the processor that is looking for work will prefer to pluck tasks that are queued to processors that are in nearby cache neighborhoods and so reduce the performance impacts of loading the plucking processor &# 39 ; s cache with the task &# 39 ; s data . this virtual queue design is also a trade - off of rigorous priority over performance , as the task would probably have executed more efficiently if left where it was . unlike the first , tailored scope queues , a shared switching queue design , this virtual queue design is a complete solution without the need for dedication . ( see more details about “ dedication ” below ). in addition , it can operate with less overhead for an application that is dedicated to a cache neighborhood , as there is no need for a processor to look at the priority values for processors outside the neighborhood unless the neighborhood is allowed to execute non - dedicated tasks . fig1 illustrates virtual queue processing with flowchart 150 . each time an ip switching queue ( sq ) has a task put on its list , or at least each time one is added of higher priority than any existing tasks , the new task or tasks will be recorded 151 on the virtual queue . a simple mask or data matrix 156 is used at step 152 to show which tasks have highest priority on each of the processor &# 39 ; s switching queues . in this example , sixteen processors have spaces allocated . processor one ( second from the left ) has the highest priority task ( an “ a ” level task ), the next is processor three ( fourth from the left ), with a “ c ” level priority task , and two other processors have recorded tasks of priority “ e ” level with no other processors having recorded tasks . a processor when looking for a task will check for tasks on the virtual queue to determine if there is one of some priority listed and then attempt to take it from the processor on whose individual queue the task is also listed . one could develop a system where the processor looks to its own switching queue first and only take tasks of higher priority than those on that processor &# 39 ; s switching queue , but we believe it more efficient to check the virtual queue first . the purpose of the virtual queue is to find the highest priority task in the system and the switching queues are ordered by priority . therefore we only care about one task per ip . if that task is selected and dequeued then the next task on the ip &# 39 ; s queue sets the priority value that goes into the virtual queue . based on whether or not under rules described elsewhere which define buddy processors and switching queue availability for plucking , a processor can pluck tasks from the identified processors with high priority tasks , the flow chart is followed through steps 153 – 155 , and if under those rules it is acceptable it will attempt to take the task from the ip having the highest priority task . also , ( 157 will only record if the buddy has a higher priority task , not one of equal priority , so if the original ip had a task of priority a and there were bs and other as , then the only recording will be done in 151 , and we &# 39 ; ll select the original ip .) after the task is recorded 157 , 158 , the task is plucked from the switching queue of the processor that originally had it 159 . if another processor has already taken the task from the switching queue then either the task is ignored and the processor continues , dispatching from its own switching queue , or the processor can revisit the virtual queue , looking for another high priority task . ( although this “ plucking ” algorithm and the “ stealing ” algorithm previously described are described in terms of processor queues , i . e ., the situation where each processor has its own queue , they can be generalized to handle processor groups . if the processors in a processor group share a switching queue , then a processor in the group becomes “ idle ” when the queue is empty and it may choose to steal work from the queue of another processor group that is busier than some threshold . it may also choose to pluck and execute the highest priority task that is queued to some other group instead of a lower priority task on its own group &# 39 ; s queue .) the user determines which applications share data extensively based on their known design or based on instrumentation of the system . the user identifies each group of such applications to the os by defining them as belonging to a data - sharing group . the parameters that define the declaration by a system administrator of data - sharing groups can be quite simple . they should preferably be able to fit into a single message the user can send to the operating system ( os ). with reference to fig3 , a block of memory or a message 20 should have components including the data - sharing group id 21 , and a list 22 of software entities , having repeated entries of entity type 23 and entity id 24 . ( a pair of entity type and entity id is identified by a paired numeral 23 / 24 a – x ). in format , the message to the os need merely contain the data - sharing group id and the data - sharing group membership list , and the os can look up the entity type and entity id from the pointers in the data - sharing group list ; or the message could contain all the information if preferred . additionally , the user will have to supply a list of dedications 30 , such as is illustrated in fig3 , ( unless he uses a default condition ). here , the list of messages 30 will describe the features of handling for each task or userid or whatever dedication unit moniker is employed . when the user applies this list , the os should have some kind of security check to determine that these dedications are permitted and authorized by / for the system administrator . in the preferred embodiment , the messages or units on the list have seven data components 31 – 37 , and the list can be as long as needed . ( a – x ). an additional description of how this is used is found in the section below on dedicating data - sharing group ( s ) to cache neighborhoods , but a brief description of the data component parts follows . with reference to fig3 , each of the messages a – x should have components including the data - sharing group id 31 , previously declared by the system administrator and an indication of the processing resources required . the resources can be expressed as processor group id 32 that identifies the group of processors to which the work should be assigned . the resources can also be expressed as processing power parameter 33 that indicates the number of processors required for this particular data sharing group ( if the os is to select a processor group based on the power required .). more than one data - sharing group can be dedicated to a processor group if sufficient processor power is available . the exclusive assignment indicator 34 , if set , instructs the os that no other data - sharing groups may dedicate to this processor group . the processor group is permitted , however , to execute tasks that have not been dedicated , if the “ non - dedicated work permitted ” indicator 35 is set . this permission is subject to the overload thresholds 36 l and 36 u , as described by the state diagram in fig1 . in the event of an overload condition , where dedicated tasks drive the processor group to a degree of busy - ness that exceeds the threshold 36 u , the user ( operations staff ) can be notified according to the control 37 . the messages in the list are preferably ordered by the system administrator with the first assignments having precedence . the os processes all the messages , even if some of the assignments cannot be satisfied because of resource conflicts or absences , or for other reasons . for example , the system may be running with fewer processors than normal , or the system may not have all the resources requested . in the initial basic embodiment , there is only one data - sharing group , so it is unnamed . it provides limited control for up to ten batch / demand run ids ( i . e . tasks or applications or parts or groups thereof as selected by a user ) that the user can dedicate to a single processor group . the runs themselves are specified with a set of dynamic configuration parameters we call dedicated_runid1 through dedicated_runid10 . these configuration parameters take effect when the parameter is changed . tasks of runids currently executing are switched to the processor group as soon as possible . in the initial embodiment as soon as possible means when they next become candidates for execution . ( see dedication process sections below for further information on this topic ). in the preferred embodiment , the user can define as many data - sharing groups as are required for various combinations of applications and the like . the data structures described in fig3 would preferably be used to define these but any user interface that supports such data structures can be used . in the system that is the preferred embodiment , probable entity types are runs , application groups , and subsystems . the performance of all these types can potentially benefit by being confined to a limited cache neighborhood . the run type is valuable for large application programs with many control threads , all of which share data spaces . it may also be used for multiple runs that share common data spaces . the application group type is useful to describe all the transactions that update a common shared data space . the subsystem type describes shared code and data callable by many runs or transactions . a user wishes to optimize the performance of the applications in the data - sharing groups by dedicating the groups to the smallest , and hence the highest - performing , cache neighborhoods that can support the applications . ( the highest - performing neighborhoods are those with the highest multi - processor factor .) to be more precise , the user actually dedicates the data - sharing group to the processor group that services the cache neighborhood . for each data - sharing group the user either names a specific processor group ( identified in block 32 in fig3 , based on id from fig4 tables ) or tells the os the number of processors required ( 33 in fig3 ) and the os chooses the optimum processor group . although the user will typically only request dedications for which there are sufficient processors available , the system may be running with a reduced configuration , so the user submits a list of dedications to the os in order of precedence . thus , in either manner , the user submits all the dedication requests he desires and the system accommodates those that it is capable of accomplishing . for example , if a user asks for an 8 - way ( that is , an eight processor neighborhood ) dedication and a 4 - way dedication and the system has 11 processors , what happens depends on how the processors are arranged . if there is an 8 - way pod with a missing processor and a separate , complete 4 - way subpod then the 4 - way application dedication would be allocated to the subpod and the other would run non - dedicated either across all 11 processors or the remaining 7 processors of the 8 - way pod , depending on whether the 4 - way definition allows non - dedicated work . if there is a full 8 - way pod , then the 8 - way dedication would be successful and the 4 - way dedication would fail and would run non - dedicated unless the user requested the 4 - way dedication have higher precedence . as can be seen in the data structures 32 and 33 , two methods of assignment are available in the preferred embodiments , one where the user explicitly specifies processor groups and one , more automated , where the user specifies the processor power needed and the system chooses the processor groups . with the explicit specification method , the size of the processor groups is defined by the swqafflvl parameter defined above ( section on tailored scope queues — initial embodiment ). for each data - sharing group , the user specifies which processor group is to be used by naming one of the processors in that processor group ( 32 ). for example , with swqafflvl set to 2 ( meaning one queue per 4 processor subpod ), a data - sharing group nominating processor 8 would be dedicated to the four processors 8 , 9 , 10 , and 11 , i . e ., the processor group for the subpod . the user is notified if an assignment cannot be satisfied , for example , if the processor group &# 39 ; s processors are not available . the data - sharing group , preferably after an os system notice to the user , then runs non - dedicated . in preferred embodiments it is the user &# 39 ; s responsibility to submit an alternative assignment , although the os could wait and recheck for more satisfactory conditions if desired . in the automated method , the user specifies the processing power required by a data - sharing group , and this power parameter is used by the os to decide the size of the processor group that is required , and to pick one . for example , a data - sharing group that requires 6 processors , running on a system that has 1 , 2 , 4 , and 8 processor cache neighborhoods would be assigned to an 8 processor group . if the next request is for 3 processors for another data - sharing group then it would be assigned to a 4 processor group . with this method , processor groups can be different sizes to match the user &# 39 ; s application needs . the swqafflvl parameter would still apply , but only to processors that are not part of one of the assigned processor groups . the expectation is that the parameter would be set to 0 ( a queue per processor ) but not necessarily so . if an assignment cannot be satisfied then the user is notified and the data - sharing group will run non - dedicated . as with explicit dedication , either the user may choose to change the assignment messages , ( for example to reduce the number of processors requested , and resubmit the messages ), or the os can support the dedication on the occurrence of acceptable conditions . dedicated tasks may only execute within the confines of the assigned processor group . this is why we chose to call this dedication . preferably , the tasks are tagged with a mask of master bits , described in fig1 , one bit per possible processor in the system &# 39 ; s design , that indicates which processors may execute the task . tasks are initially queued to a switching queue that is serviced by one of the allowed processors . the tasks are kept within the confines of the processor group by restricting the “ stealing ” and “ plucking ” of the tasks . no processor outside the group may steal or pluck a dedicated task , though the processors inside the group may steal from each other &# 39 ; s queues to maintain a balanced load or pluck from each other &# 39 ; s queues to honor the user &# 39 ; s needs for preemptive priority . with both methods of dedication , non - dedicated tasks may run on any processor , subject to any limitations 35 ( fig3 ) specified by the user when dedicating data - sharing groups . non - dedicated tasks are those that are either not part of a data - sharing group or are part of a data - sharing group that has not been dedicated to a processor group . the user can prevent an assigned processor group from running non - dedicated tasks using the “ non - dedicated work permitted ” indicator 35 . if allowed by the “ non - dedicated work permitted ” indicator 35 , the processors can take on non - dedicated work either through the round robin selection when tasks are created or through stealing from other queues . idle processors that are not in an assigned processor group can steal non - dedicated work at any time . idle processors within an assigned processor group can steal any work from each other and can steal non - dedicated work from processors outside the group subject to the controls in 35 and 36 . the user can control the performance effects of the dedication and any interference from the execution of non - dedicated tasks with the overload thresholds 36 . these include an upper threshold 36 u and a lower threshold 36 l . ( values are set for these thresholds in accord with the user &# 39 ; s understanding of the system . for example , an upper threshold of 95 % busy and a lower threshold of 50 % busy might be a setting , but the values used internally could be in terms of operations per fraction of a second or clock cycle if those are the kinds of data the computer system housekeeping functions records .) as shown in the state diagram in fig8 , if the processor group is taking on non - dedicated work and it becomes busier than the upper threshold 36 u then it stops taking on that work . it will resume taking on work if the processor group becomes less busy then the lower threshold . if the upper threshold 36 u is exceeded again even though no work is being taken on , then the processor group dequeues all non - dedicated work and redistributes it to the other eligible dispatching queues , so that it is only doing dedicated work . thereafter , dropping below the lower threshold 36 l causes it to begin taking on non - dedicated work again . although dedication to a cache neighborhood can improve performance of a task , there is a risk that the cache neighborhood will become overloaded . for example , the user may have dedicated the data - sharing group to a processor group that has enough capacity , but the processor group may become overloaded due to additional application load or the failure of a processor . the user can set thresholds to detect overload conditions and take appropriate action . ( overload conditions are determined by housekeeping and monitoring functions of the os which are common in many large computer systems . these functions can be adapted to provide data on the busyness parameters when selected within the ordinary skill of those in this field .) if the processor group becomes busier than the upper threshold 36 u and is not processing any non - dedicated work , then the user is notified of the overload event as required by 37 . the user can choose to modify the data - sharing group definitions or the assignment list in response to the event . for example , the assignment list could be modified so that a data sharing group now specifies a larger cache neighborhood , or so that two data sharing groups that shared a cache neighborhood are now assigned to separate neighborhoods , or some subset of tasks can be removed from the dedication list . this response can be automated by an auto - answering message system built into the os itself to handle circumstances where such an overload is an anticipated event . in the initial embodiment , there is only one , unnamed , data - sharing group , and the group is automatically assigned to the default processor group ; that with the highest numbered processor in the configuration . as i / o interrupts are directed to the lowest numbered processors on these systems , this enables the data - sharing group and its dedicated tasks to avoid the load caused by i / o interrupt processing . the number of processors in the processor group is governed by the swqafflvl parameter . if this is set to 2 , for example , the data - sharing group will run in the highest numbered subpod , and i / o interrupts will be handled by the lowest numbered subpod . the runs specified by the dedicated - runid parameters will be executed using the processor group with the highest numbered ip at the time the parameter is modified . using the processor group with the highest ip number reduces the impact from i / o interrupts in the inventors &# 39 ; computer systems , and application of this invention to other computer systems may use different ip numbers for various reasons including avoiding i / o processing on dedicated processor groups . having removed the load of i / o interrupts , the runs the user dedicates to the highest numbered processor group will be the only runs to execute using those processors . refer now to fig5 a , a first stage in the two - stage description when taken together with fig5 b to describe the functioning of the system . initially in fig5 a , without any dedication assignments , the system 40 a exhibits an operating system ( os ) 41 having at least the security check 42 , application run handler 43 , and affinity assignment block 44 available to the system , and likely in main or disk memories are applications app 1 – 4 , 60 – 63 , respectively . the hardware is configured into three switching queues , sq 0 , sq 2 , and sq 3 . sq 0 has six ips , sq 2 has four ips and sq 3 has four ips . as mentioned previously , typical configurations will have a uniform number of ips per switching queue , but it is reasonable to allocate the ips in other ways such as is illustrated with respect to system 40 a . a user 50 , who wants to run an application app 2 61 , will send a message 51 to the operating system 41 , which will direct the message to the security check 42 . the security check will , if the message is appropriate , direct the run app function 43 to get and run the application . the application will spawn several tasks , here taske , taskf and taskg . the run app function will also have identified this application app 2 61 to the affinity assignment function 44 , which will assign the affinity of these tasks to the various processors in accordance with the round - robin mechanisms . in this heuristic example without the dedication being used , this could have meant that taske was assigned to switching queue sq 0 , taskf to sq 2 and taskg to sq 3 . in the inventors &# 39 ; systems an identical dispatcher is used by all switching queues , but that is not important for the functioning of this invention . each could have an unique dispatcher if desired . in fig5 b the time is shortly later than in fig5 a , and the system is called 40 b . the system administrator 50 wants to use dedication to dedicate a single application app 1 60 to a processor group . the system administrator preferably sends a first message 52 to the security check 42 defining a data - sharing group dsg 1 with a single member app 1 , and then a second message 53 to the security check after the request to dedicate data - sharing group dsg 1 to processor group sq 0 , and to give data - sharing group dsg 1 exclusive use of sq 0 . thus tasks a , b , c , and d will be dedicated to sq 0 as they seek ip resources , and task e will be reassigned to sq 2 . once this dedication has happened , any request message to run the application app 1 60 will cause a dedicator function 45 within the operating system 41 carrying the identification information from message 30 ( fig3 ). this information is incorporated into the affinity assignment function 44 , so that when the message to run app 1 60 is sent by the run app function 43 to the affinity assignment function 44 , all of the tasks spawned by program app 1 60 are assigned to switching queue sq 0 . additionally , in the preferred embodiments , non - dedicated tasks already on the switching queue in switching queue 0 ( sq 0 ) will be moved to one of the other switching queues sq 2 and sq 3 . this move can be done with additional code within the switching queue &# 39 ; s management code , preferably . alternatively the operating system can handle it by a routine in the affinity assignment function . the sending of the messages 52 and 53 should alter the functioning of the affinity assignment function to send all tasks from the identified application to the identified switching queue , and any other tasks to other switching queues . in the preferred embodiments , the dedication process involves the application of a user - supplied dedication list ( 30 in fig3 ) against the user &# 39 ; s system configuration . as a result of that process , the os builds a set of controls that govern the execution of tasks , the treatment of priority , and the scope of load balancing . where the handling of priority is based on the tailored - scope queue design , the controls are queues specifically built to handle the dedications . where priority is handled by a virtual queue design , the controls are masks , wherein each processor is assigned an array position within the mask . note that with the virtual queue design for dedication the actual use of the virtual queue and the plucking the highest priority tasks are optional . if the user &# 39 ; s applications function well with the limitations of non - preemptive and processor - local priority then the user can dedicate tasks but disable the virtual queue . fig1 is a flowchart of how the dedication list ( again , fig3 , item 30 ) is used to generate the tailored - scope switching queues for the assigned cache neighborhoods , and for those that handle non - dedicated tasks . the flowchart 160 is applicable either to the initial application of the dedication list 160 a , or to any subsequent change 160 b or 160 c , so it also shows the dequeuing of tasks from the previous queues and their enqueuing to new ones created . finally in 160 d it addresses the initial assignment of a newly created task to either the switching queue its data sharing group is dedicated 160 d 1 , or to one of the unassigned switching queues 160 d 2 . the flowchart does not show the dispatcher &# 39 ; s actions in processing a solitary one of these switching queues , as handling of a single priority - based queue by multiple processors with some kind of inherent load balancing is well understood in the industry . note that the step “ notify operations ” 160 a 1 is an indication to the operations staff that the dedication has been unsuccessful . also in block 160 a 2 , if there is a non - exclusive dedication , an os can permit more than one data sharing group to be dedicated to a single cache neighborhood and switching queue . the remainder of the figure is self explanatory . the flowchart 170 of fig1 has a similar flowchart structure to that of fig1 , however it handles the priority requirements with a virtual queue rather than creating new switching queues for cache neighborhoods . the chart shows how the dedication list is used in the virtual queue design to generate steal - from / pluck - from masks for the processors and stealable / pluckable masks for the tasks . for this design , the dispatcher actions are shown in some detail , as the dedication of a data sharing group to a processor group has implications on both virtual queue processing ( for systems that support preemptive priority ) and on load balancing . the relationship between these functions is illustrated in the flow chart 120 of fig9 , which describes the processing that occurs when a processor is looking for work to do . in fig9 , four dispatcher states are illustrated with three active states 121 , 122 , and 123 , and an idle state 124 . an instruction processor will always be in one of these processing states unless it is actually executing a task . transitions from states 121 , 122 , 124 and 124 occur as indicated . for example , if a virtual queue processing state 121 exists when a processor finds no task eligible in the priority range on the virtual queue , it transitions to a state 122 or 123 or 124 , in the illustrated sequence . thus , for support of preemptive priority ( an option ), the processor must first look for and “ pluck ” the highest priority eligible task queued to any processor . this virtual queue processing 121 is described in detail below . if there are no such eligible tasks , then the processor looks for the highest priority task on its own switching queue 122 , and executes that task . if there is no task on the queue , then the processor is in idle state 124 . however , if a load balancing algorithm 123 is available , the processor looks for another processor that is significantly busier ( on average ) and that has a queue of tasks ready for execution . if it finds such a processor , it will “ steal ” the highest priority task and execute it , as described in detail below or else it will transition to idle state 124 . the control information for virtual queue processing ( plucking ) and load balancing ( stealing ) is shown in fig1 . the controls are shown as conceptual array , with the first array element describing state for ip 0 , the second for ip 1 , etc . in the preferred embodiment , these arrays are implemented as bit maps within a 36 - bit word for efficiency , but many other implementations are possible . a stealing order array , one per processor , described conceptually in the 09 / 920 , 023 patent application incorporated herein by this reference . we still prefer to use this concept to determine which other processors this one should look at ( its “ buddies ”) and the order in which it should look at them . an example is array 131 , showing stealing order relative to one of sixteen processors in an example computer system . the array is used to limit the overheads of both the virtual queue processing and load balancing algorithms . the steal - from mask , also known as the pluck - from mask , ( examples illustrated as masks 132 – 134 ) one per processor , indicates which other processors this one is allowed to steal ( or pluck ) from . the masks are related . array or masks 132 – 4 express permissions ; in other words , whether one ip can pluck / steal from another ip . mask 131 describes a preferred order to look at them ( for efficiency ). in a system without any dedications ( as one having mask 132 ), this would be set to allow any processor to steal from any other , with the stealing order established by the stealing order mask , unique to each processor . however , if this processor is assigned to be part of a dedication that does not permit the execution of non - dedicated work , then the mask will indicate that the processor may only steal or pluck within the confines of the dedication . the mask 133 is an example of the mask for a processor that is a member of an assigned subpod that is not allowed to do undedicated work . this mask only allows it to pluck or steal from the four processors within the subpod . each task in the system is also given a “ stealability ” mask . for a non - dedicated task , this mask ( like mask 135 ) would be set to allow any processor to steal or pluck it . for a dedicated task , only those processors within the scope of the dedication are allowed to steal or pluck it ( example , mask 136 only allows the last four processors to steal this task . the virtual queue processing proceeds according to the flowchart in fig1 . each processor is required to record its highest priority queued task ( within the defined range of priorities , typically those known as “ real - time ”). in the example shown in 156 in fig1 , only 4 processors have queued tasks within the defined range . a processor looking for the highest priority task to dispatch first looks at the other processors according to the order in the stealing order array 156 . driven by the masks described above , it only looks at processors that it is allowed to pluck from and only considers tasks that it may pluck . if it finds such a task and the task has higher priority than any on its own queue , then it will pluck the task from the other processor ( i . e ., dequeue it from the other processor &# 39 ; s queue ) and execute the task . note that , for performance reasons , the search for the task is performed without a lock , so it is possible that some other processor will pluck this task , so this processor &# 39 ; s plucking will fail , causing the virtual queue processing to be repeated . if there is no pluckable task , then the processor will service its own queues according to normal dispatching algorithms . a load balancing mechanism was described in the earlier referenced ser . no . 09 / 020 , 023 patent application incorporated herein by this reference , but modification is required to handle the dedication of tasks . fig1 &# 39 ; s flowchart 140 shows how an idle processor uses the steal - from mask to determine whether it is permitted to steal work from the processors in the stealing - order array . it starts by checking each buddy ip 141 and proceeds until it finds a task 142 or goes idle 143 . for example , if an instruction processor is assigned to be part of a dedication that does not permit the execution of non - dedicated work then the steal - from mask will only permit stealing within the scope of the dedication . one additional check is also necessary . when selecting a task from the stolen - from processor &# 39 ; s queue , the stealing processor must find the highest priority task that is allowed to be stolen by this processor . for example , the stealing processor must not be allowed to steal dedicated tasks if it is not part of the dedication . a check against the stealable mask of the task provides the needed information . dynamic configuration responsive to user &# 39 ; s system configuration and / or user &# 39 ; s application mix ( terms from background chart ) the dedication of data - sharing groups to switching queues must be reevaluated automatically whenever the processor configuration is reduced or when the user applies the list of data - sharing group dedication requests , and this should be done by the os routine responding to the change in configuration . the user may reapply the dedication list 25 ( from fig3 ) either to match a hardware configuration or because the list has been changed to reflect an operational or application change . the action may also be automated to occur at some specific time of day or when a particular task finishes or starts . the list of dedication messages is ordered , with the most important messages first , and a list is always submitted in its entirety , because the os will use it to replace the previous list . the results of reapplying the list may range from no changes at all to the queues , to a complete restructuring . in principle , a completely new set of switching queues is generated to match the switching queues that are required to satisfy the data - sharing groups &# 39 ; dedications . the dispatching algorithms begin using these new switching queues for the tasks that are currently executing , all newly created tasks , and those that had previously been waiting on other resource queues . tasks on the prior queues are moved to the new queues , based on the new dedications . once a queue is emptied of tasks , the emptied queues are discarded . any embodiment of the invention can choose to accelerate this queue replacement process by recognizing when a queue change is minor and simply re - naming or re - assigning a queue , but such accelerations are neither required nor forbidden in accord with our invention . the parameters discussed above ( swqafflvl and dedicated_runidx ) and the alternative data - sharing group definition 20 and assignment list 25 in fig3 can be modified at any time . when one of the parameters is modified , the system re - evaluates what queue should be used for processing the dedicated runs . if there are not at least 2 switching queues with “ up ”( that is , running ) ips , the update will be rejected , and all memory copies of the dedicated runids will be cleared to spaces to indicate that there are no dedicated runs . this will also occur if a dynamic dn ( change of the ip state from running to not - running ) of an ip results in only 1 switching queue . the dynamic dn of an ip that results in a new switching queue having no ips to process it when there are still at least 2 switching queues will result in the operating system re - evaluating what queues should be used for processing the dedicated runs . the dynamic up ( change of the ip state from not - running to running ) of an ip will not cause the re - evaluation of dedicated run processing . resetting one of the dedicated_runidx parameters will cause the re - evaluation after the dynamic up if this up was done to provide a better environment for the dedicated runs . in the initial embodiment , there is only one data - sharing group ( defined by the dedicated_runidx parameters ) and one size of switching queue ( set by swqafflvl ). the data - sharing group is dedicated to the highest numbered switching queue , and the assignment is exclusive and does not permit the execution of non - dedicated tasks . all remaining tasks run in the lower numbered switching queues . this is a much simpler environment as the number and size of the switching queues can only be changed at reboot time , but the reevaluation principles are the same as for the preferred embodiment . the configuration is reevaluated whenever the last processor of a switching queue is removed or a dedicated_runidx is modified . if a processor is added then the system waits for the user to change or reaffirm a dedicated_runidx before reevaluating the configuration . consider the 16 processor example in block 300 in fig7 a with subpods 301 – 304 . if the system has sqwafflvl set to 2 ( subpod ), then it has fixed switching queues sq 1 – sq 4 ( 310 – 313 ). the os dedicates the single data - sharing group dsg 1 306 to the subpod 304 with the highest numbered processor ( ip 15 ) and uses the single switching queue sq 4 313 for processors ip 12 – ip 15 . in this initial embodiment , assignments are exclusive and do not permit the execution of non - dedicated tasks , so all other tasks are queued , using a round - robin mechanism , to sq 1 , sq 2 , and sq 3 , ( 310 – 312 ), running on processors ip 0 – ip 11 . consider changes to the data - sharing group dsg 1 306 and to the hardware configuration of fig7 a . if the list of tasks within the data - sharing group is increased then the os will move the additional tasks to queue sq 4 313 . the reverse will happen if the list of tasks in the data - sharing group is reduced . in this initial embodiment , the os will reevaluate the dedications whenever a hardware configuration change reduces a switching queue to zero processors . if , say , processors 12 – 15 are to be removed as in block 300 a in fig7 b , then the os will reevaluate the situation when the last of these processors is removed . provided the system still has at least two switching queues with at least one processor each then the os will apply the dedications of the data - sharing group dsg 1 306 a . in this case , there are three populated switching queues left and the data - sharing group dsg 1 306 a will be moved to switching queue sq 3 312 a and processors ip 8 – ip 11 . in this initial embodiment , a dedication to a switching queue implies an exclusive assignment of the queue , so the remaining tasks are now confined to sq 1 310 a and sq 2 311 a and processors ip 0 – ip 7 . as there are no queues to create and delete in this initial embodiment , this movement of tasks can happen automatically as tasks become eligible for execution following interruption . if there had been only one switching queue left there would have been no dedications . the os will not permit the assignment of the only switching queue . for an example of this dynamic reconfiguration , consider the preferred embodiment , a 16 processor system shown in block 200 of fig6 a with four subpods 201 – 204 and three switching queues sq 1 , sq 2 and sq 3 , assigned four , four , and 8 ips , respectively . the user has declared three data - sharing groups dsga , dsgb , dsgc , ( 210 – 212 ) in decreasing order of precedence , requiring , let us say 6 , 3 , and 3 ips , respectively . for optimal performance , these dedications are rounded up to the next available size of cache neighborhood . thus , the 6 - processor dedication requires an entire pod of 8 ips and the 3 - processor dedications each require a subpod of 4 ips . the os creates switching queue sq 1 ( 217 ) with 8 processors ( ip 8 – ip 15 ) for dsga , and sq 2 ( 216 ) ( ip 4 – ip 7 ) and sq 3 ( 215 ) ( ip 0 – ip 3 ) with 4 processors each for dsgb ( 211 ) and dsgc ( 212 ), respectively . the remainder of the system &# 39 ; s tasks are queued to any of switching queues 215 – 217 , depending on the current load balancing situation . moving on to fig6 b , we have a situation in which the third subpod 203 a processors 8 – 11 must be removed from the system . this will impact data - sharing group dsga 210 and 210 a . typically , in most multiprocessor systems , four processors will not appear to leave at the same time , and the system will actually see four changes , losing one processor at a time . losing the first two processors will cause a reevaluation but have no impact as switching queue sq 1 217 will still have 6 processors , sufficient for data - sharing group dsga 210 . in such cases it is likely that the os would detect that no changes or re - queuing is required . the reevaluation following the removal of the third processor causes the os to handle the configuration as shown in block 200 a in fig6 b . subpod 203 a has been reduced to a single processor ip 11 and the two subpods 203 a and 204 a do not now have enough processing power for dsga 210 a . this time the reevaluation causes the os to select the only 8 processor pod available ( the cache neighborhood with processors ip 0 – ip 7 ) and create new switching queue nsq 4 218 with 8 processors ( ip 0 – ip 7 ) for data - sharing group dsga 210 a . it also creates new switching queue nsq 5 219 with 4 processors ( ip 12 – ip 15 ) for data - sharing group dsgb 211 a . data - sharing group dsgc &# 39 ; s 212 a dedication will fail as there are no subpods available with sufficient ip resources , and its tasks will be spread , along with all other tasks , across all the remaining queues , including the queue for the lone surviving processor ip 11 of the subpod 203 a . as ip 11 has no specific assignments it is serviced by a single queue nsq 6 220 . when that processor leaves the configuration , completing the removal of subpod 203 a , no data - sharing groups will be impacted but any tasks queued to nsq 6 220 must be redistributed to the remaining queues nsq 4 , nsq 5 ( 218 , 219 ). for a similar example of dynamic reconfiguration with the virtual queue design , consider the preferred embodiment , a 16 processor system shown in block 800 of fig1 with four subpods 801 – 804 . the user has declared three data - sharing groups dsga , dsgb , dsgc , ( 810 – 812 ) in decreasing order of precedence , requiring , let us say 6 , 3 , and 3 ips , respectively . in this example , the system is running with swqafflvl set to 0 ( processor affinity ), so each processor has its own switching queue . also , the user &# 39 ; s message indicates that the dedication of dsga must forbid the execution of any non - dedicated work by the assigned cache neighborhood . for optimal performance , these dedications are rounded up to the next available size of cache neighborhood . thus , the 6 - processor dedication requires an entire pod of 8 ips ( 803 + 804 ) and the 3 - processor dedications each require a subpod of 4 ips ( 802 and 801 ). for any tasks created within dsga ( 810 ), the os builds a “ stealable / pluckable ” mask 820 that indicates that the task may be executed only on processors within subpods 803 and 804 . similarly , the os builds masks 821 and 822 for tasks within dsgb and dsgc that limit their execution to subpods 802 and 801 respectively . the remaining tasks , not members of those data sharing groups , have no dedication and would normally be allowed to execute anywhere , but , in this example , dsga &# 39 ; s dedication did not allow the execution of non - dedicated tasks . consequently , the os builds a mask , mask 823 , for those tasks that allows them to execute only on subpods 801 and 802 . the os also builds “ steal - from ” masks for all the systems processors . these masks limit the scope of the processors &# 39 ; plucking and stealing . processors in subpods 803 and 804 are confined by dsga &# 39 ; s dedication , so mask 853 indicates that they may only pluck and steal within those subpods . subpods 801 and 802 are allowed to execute both dedicated and non - dedicated tasks so their processors &# 39 ; masks indicate that they may pluck and steal within the subpod and also from each other . the plucking and stealing of dedicated tasks will however be further limited by those tasks &# 39 ; stealable / pluckable masks 820 and 821 . now let us consider the impact of a dynamic configuration change on this example , and look at the transition from fig1 to fig1 a . as with the tailored scope queues example , we have a situation in which the third subpod 803 and 803 a must be removed from the system . this will impact data - sharing group dsga 810 and 810 a . typically , in most multiprocessor systems , four processors will not appear to leave at the same time , and the system will actually see four changes , losing one processor at a time . losing the first two processors will cause a reevaluation but have no impact as the two subpods ( 803 a + 804 a ) will still have 6 processors , sufficient for data - sharing group dsga 810 a . in such cases it is likely that the os would detect that no change to the assignments is required . however , action is required to cope with any tasks that are queued to the first two processors to be removed . as the processor is going away , the os dequeues its tasks and must requeue them to one of the processors within the scope of the dedication , using a round - robin or similar mechanism to assist load - balancing . ( in this example , there are no non - dedicated tasks as dsga &# 39 ; s dedication did not permit their execution , but if there had been , those tasks would be similarly requeued to one of the processors permitted to execute non - dedicated tasks .) the reevaluation following the removal of the third processor causes the os to handle the configuration as shown in block 800 a in fig1 a . subpod 803 a has been reduced to a single processor ip 11 and the two subpods 803 a and 804 a do not now have enough processing power for dsga 810 a . this time the reevaluation causes the os to select the only 8 processor pod available ( the cache neighborhood with processors ip 0 – ip 7 ) and create new stealable masks 820 a for the tasks in the dsga group and new steal - from masks 851 a for the processors in the pod ( 801 a + 802 a ). as part of the reevaluation , the os assigns the second data - sharing group dsgb 811 a , which requires 3 processors , to the only remaining fully - populated subpod 804 a with processors ip 12 – ip 15 . the tasks in dsgb are given stealable masks 821 a that restrict them to those four processors . the processors in subpod 804 a are given steal - from masks 853 a that allow them to steal or pluck from any processors that are allowed to execute non - dedicated tasks . data - sharing group dsgc &# 39 ; s 812 a dedication will fail as it requires 3 processors and there are no subpods available with sufficient resources , and its tasks will be spread , along with all other non - dedicated tasks , across all of the processors that can execute non - dedicated tasks . accordingly , tasks in dsgc are given stealable masks 822 a and non - dedicated tasks are given masks 823 a . the remaining processor ip 11 in the remaining subpod 803 a is given a steal - from mask 852 a that allows it to steal and pluck from any processor that can execute non - dedicated tasks . note that when the reevaluation is complete , all affected tasks must have been dequeued from their current processor queues and requeued to one of the processors described by their stealable masks . the processor is selected by the round - robin mechanism used for initial load - balancing . when ip 11 is eventually removed from the system ( as part of the removal of subpod 803 a ), all non - dedicated work will be executed on subpod 804 a . note that removal of ip 11 will not cause a reevaluation as no data - sharing groups are impacted , and there is still one subpod 804 a that can execute non - dedicated tasks . it will , however , be necessary to dequeue ip 11 &# 39 ; s tasks and redistribute them to processors within subpod 804 a . there will , of course , be other housekeeping that is needed for the removal ( or addition ) of a processor , but this housekeeping is not described here as it is well understood within operating systems that support the dynamic addition and removal of processors . | 6 |
the invention , as represented by fig1 , and 3 is a beam stop ( 10 ) comprises two main elements -- a cell or cuvette ( 12 ), hereinafter referred to generically as a cell , and an absorbing fluid ( 14 ) contained within the cell , the absorbing fluid ( 14 ) consisting of a solvent or carrier liquid and an absorbing species dissolved in the solvent or suspended within the carrier liquid . the cell must be made of material that is transparent through the wavelength of the laser of interest . therefore , one would choose the material based on the wavelength of laser used . the preferred materials are glass , plastic , and fused silica quartz , due to its transparency throughout the wavelength regions . for other wavelength regions , other materials may be appropriate . for example , if the laser is in the far uv region , sapphire is preferred . an important feature of the invention is the design of the cell . as shown in fig1 and 3 , the cell ( 12 ) is constructed so that the planar face of the cell ( 18 ) upon which the incident laser beam ( 20 ) ( traveling in the direction indicated by the arrow ) is oriented at brewster &# 39 ; s angle ( 22 ) to the beam . this angle can be easily calculated depending on the polarization of the beam , the wavelength of interest , and the cell material . the purpose of orienting the cell face at brewster &# 39 ; s angle is that the laser beam passes into the cell essentially without loss of radiation and therefore with little or no specular reflection . there must also be an opening ( 24 ) in the cell for placing the absorbing fluid within the cell and preventing leakage and spillage of the fluid . preferably , this is any standard taper ground joint . most preferably , the joint is a ts - 9 pennyhead . the opening ( 24 ) should also be placed at an angle ( 26 ) as shown in fig2 so that when the laser beam stop is in use with laser beams having vertical or horizontal polarization , the fluid does not leak out . preferably , the opening is at a 45 ° angle . the absorbing species must absorb the wavelength of light emitted by the laser . preferably , the species is a dye . in addition , if one desires to both block and indicate the presence of the beam , the radiation of the beam must also be converted into visible light by the absorbing species . for lasers emitting in the ultraviolet and visible ranges preferred dyes include those used in dye lasers and other common fluroescent dyes . most preferably , the dye is selected from the group comprising fluorescein , rhodamine , and 7 - hydroxy - 4 - methyl coumarin . for laser beams in the ir range , it is preferable to use photoluminescent materials so that the ir radiation is upconverted into the visible spectrum . it is important to note that the quantum yield need not be particularly high to be useful . note that if the indicating ( fluorescent ) property is not desirable or necessary , the device can serve as a beam block in any region of the optical spectrum simply by including any absorbing species in a suitable solvent . the concentration of absorbing species within the fluid should be such as to give an optical density of about 0 . 2 or greater at the laser wavelength . this assures that all incident laser energy is absorbed within the cell . the species need not be dissolved in a solvent . for instance , if photoluminescent materials are used in the case of an ir laser , these materials can be suspended in a carrier liquid rather than dissolved . the solvent or carrier liquid for the absorbing species must be relatively transparent and able to dissolve or suspend the species . relatively transparent means that the solvent or carrier liquid should absorb less than about 1 % of the light . preferably , the solvent or carrier liquid should also be readily available , have a low vapor pressure , and be non - toxic and non - flammable . in the case of high power lasers , the solvent or carrier liquid must also have a high heat capacity so that the solvent or carrier liquid will absorb the light without getting hot . most preferably , the solvent or carrier liquid is water . having described the invention , the following examples are given to illustrate specific applications of the invention . these specific examples are not intended to limit the scope of the invention described in this application . a laser beam stop , represented in fig1 , and 3 was constructed for use in blocking and indicating a laser beam polarized vertically , hitting the cell from the left , and having a wavelength of 488 nanometers , the cell being made of fused quartz . brewster &# 39 ; s angle was calculated to be 36 degrees , 50 minutes . the stop was 3 inches long with a 1 inch outside diameter and a wall thickness of 1 / 16 inch . a solution of fluorescein in water was used as the absorbing material . the laser beam was successfully blocked by the stop with no specular reflection . | 6 |
the basic architecture for a sampled analog optical link 100 is shown in fig1 . the pulse train from a pulsed optical source 102 optically samples the incoming rf signal 103 via a mach - zehnder intensity modulator 104 . the output rf signal 105 is recovered by direct detection of the modulated optical pulse train with a photodiode 106 . from sampling theory it is well - known that , when the frequency of the rf input ( ω in / 2π ) exceeds one - half of the optical sampling rate ( ω rep / 2π ), the rf output will be aliased to a frequency of { tilde over ( ω )}= ω rep −( ω in mod ω rep ) which may also be written as { tilde over ( ω )}= nω rep − ω in where n represents the index of the alias band where the original signal resides . clearly , when no steps are taken to prevent aliasing there may be substantial ambiguity in the detected rf output of the link . in many applications , the input frequency range is limited by placing an appropriate anti - aliasing filter at the link input , thereby restricting the input frequency range and removing any ambiguity . for wideband esm applications spanning many alias bands , such filtering operations may not be applied . this clearly motivates alternative techniques for signal disambiguation . the theory of operation for our disambiguation technique is described below . it is well known that the phase power spectral density arising from fluctuations in the repetition rate ( the temporal jitter ) of a pulse train grows proportionally to n 2 in the rf power spectrum . here n = f n / f rep is an integer number representing the ratio of the n - th harmonic of the pulse train repetition rate divided by the fundamental repetition rate . when this pulsetrain is used to sample an incoming rf signal , the phase noise from the pulse train is transferred to the input rf signal . in a subsampling link architecture , i . e . where the input rf signal is not required to reside in the fundamental nyquist band ( 0 ≦ f ≦ f rep / 2 ) but the output measurement bandwidth is limited to the fundamental nyquist band , the phase noise sidebands may be used to coarsely discern the signal &# 39 ; s original center frequency . in this work we apply a well - defined jitter , or fluctuation in the repetition rate of the sampling optical pulse train , through fm modulation of the signal used to generate the sampling pulse train in an optical comb generator 200 ( fig2 ). other sources include a tunable - rate actively - modelocked laser , a mode - locked laser with a known timing jitter , and other art - recognized means . to show how the introduction of a known frequency dither ( equivalently a known timing jitter ) may be used to achieve wideband signal disambiguation , we begin by analyzing the time domain expression for the photocurrent at the output of a sampled analog optical link . the photocurrent derived from one output of the mach - zehnder intensity modulator ( mzm ) may be written as i ( t )= p ( t )[ 1 + v in ( t )* h mzm ( t )]* h pd ( t )* h 1pf ( t ) ( 1 ) where p ( t ) is the temporal power profile of the sampling pulse train , v in ( t ) is the input rf voltage applied to the mzm ( not limited to pure sinusoids , to be discussed below ), h mzm ( t ) is the impulse response of the mzm , h pd ( t ) is the impulse response of the photodiode 106 , h 1pf ( t ) is the impulse response of the low - pass filter 112 used to restrict the link output to the fundamental nyquist band , and * denotes convolution . for input signals in the small - signal regime the double - sided rf power spectrum may be written as ( for a quadrature - biased link ) here , p sp ( ω ) is the spectrum of the pulse intensity , h pd ( ω ) is the frequency response of the photodiode 106 normalized to its dc responsivity , v π ( ω ) is the frequency - dependent halfwave voltage of the mzm , and r o is the load resistance seen by the photodiode 106 . the average photocurrent at quadrature ( i avg ) is given by the product of the average optical power ( p o ) and the dc responsivity of the photodiode 106 . when the sampling optical pulse train consists of a series of identical pulses the time - domain intensity profile may be written as where { tilde over ( p )}( t ) is the intensity profile of a single pulse in the train , δ ( ) is the dirac delta function , and t is the repetition period of the pulse train — here , the pulse train is assumed to be perfectly periodic . the spectrum of the pulse intensity ( normalized to the average optical power , p o ) is then given by the fourier transform of eq . ( 3 ) here , we see the spectrum of the pulse intensity consists of an optical comb with a line spacing given by ω rep = 2π / t weighted by the fourier transform of the intensity of a single pulse in the train . it should be noted that for wideband operation it is desirable to have very short sampling pulses . in our system , the use of cascaded intensity and phase modulation results in a broad optical comb , however , the time - domain intensity immediately after the phase modulator corresponds to an approximately 50 % duty cycle square wave at the comb repetition rate . to exploit the comb bandwidth and achieve short sampling pulses requires phase - compensation of the optical comb as it is readily shown that — for a fixed optical bandwidth — the pulse duration is minimized when the spectral phase is uniform . given the dominant spectral phase variation in our apparatus is quadratic , the pulses are readily compressed using standard single - mode optical fiber . if the sampling pulse train is again assumed to consist of a series of identical pulses , however , the repetition time is allowed to vary from pulse - to - pulse the time - domain intensity of the pulse train may be written as where δt represents a small deviation from the fundamental period of the pulse train . provided the timing deviation is much smaller than the pulse period a first - order taylor expansion of eq . ( 5 ) readily yields where j ( t ) is a function of time representing the timing deviation relative to the fundamental period t . note , in this work j ( t ) is deterministic — therefore , we may perform our analysis in terms of j ( t ) and its complex spectrum s j ( ω ) directly . the complex spectrum of the pulse train intensity is found by taking the fourier transform of eq . ( 7 ) and is given by here , we see that there are two components to the complex spectrum of the intensity of the sampling pulse train . the first consists of a periodic comb of frequencies spaced by the pulse repetition rate ( ω rep / 2π = 1 / t ) and weighted by the fourier transform of a single intensity pulse in the train . the second component consists of modulation sidebands resulting from the timing deviation of the pulse train which are also weighted by the fourier transform of a single pulse in the train . these modulation sidebands grow linearly ( in complex amplitude ) with the index n of the periodic comb as predicted for phase - noise spectral growth in pulse trains exhibiting timing jitter . to illustrate how the timing deviation of the sampling pulse train may be used to disambiguate signals when the link operates in a subsampling ( downconverting ) mode we insert the complex spectrum of the pulse train p opt ( ω ) [ eq . ( 8 )] into the expression for the rf power spectrum given by eq . ( 2 ). we now consider the rf output power from the link in two cases . first , we consider the case when only the sampling pulse train is incident on the photodiode [ v in ( ω )= 0 ] and the low - pass filter is removed . in this case the rf power spectrum consists of a comb of rf tones separated by the fundamental pulse repetition rate and the corresponding modulation sidebands arising from the pulse train timing deviation [ essentially the magnitude - squared of eq . ( 8 )]. if we compare the ratio of powers of one of the modulation sidebands of the n - th order combline to the n - th - order combline — defined to be the sidelobe - to - peak ratio ( spr )— we find this ratio to be as expected , this ratio grows quadratically with the combline index n . if we now consider the case where the rf input signal is present [ v n ( ω )≠ 0 ] and a low - pass filter is used to limit the output bandwidth to the fundamental nyquist band ( 0 ≦ ω ≦ ω rep / 2 ) it is clear that signals present at the link input will be aliased at the link output . input signals within the n - th order alias band will appear at alias frequencies given by { tilde over ( ω )}= nω rep − ω in . here , we define the alias band to be a frequency range with a bandwidth equal to the fundamental pulse repetition rate centered about the n - th - order rf combline . the peak power comparison of the central component and either sideband results in the same spr given in eq . ( 9 ) for an input signal v in ( ω ) with bandwidth bw , provided the fm frequency ( ω j / 2π ) is chosen such that the spectral components of eq . ( 2 ) centered at nω rep − ω in and nω rep − ω in ± ω j are clearly resolvable . from eq . ( 2 ), if we compare the peak power of the input signal measured within the fundamental nyquist band ( i . e ., the aliased signal sampled with a perfectly periodic optical pulse train ) to the peak power of one of the modulation sidebands which appears about the input signal peak as a result of the timing deviation of the pulse train , we find it is also given by eq . ( 9 ) spr sig = spr comb =[ nω rep t | s j ( ω )|] 2 ( 10 ) for a sinusoidal frequency modulation applied to the signal generating the optical comb , the timing deviation may be written as where κ is the fm sensitivity ( khz / v ) of the synthesizer 110 driving the comb source , v j is the amplitude of the fm control voltage , and ω j / 2π = f j is the fm frequency . this yields a sidelobe - to - peak ratio given by therefore , we may directly determine the alias band from which the signal originated by measuring the spr and comparing with that computed from eq . ( 12 ). we note , a second ambiguity remains in the measured signal , that is , from which half of the alias band did the signal arise ($ ω in & lt ; nω rep or ω in & gt ; nω rep ). for many applications , such as utilizing the subsampled analog link 100 as a cueing receiver for a high - fidelity tuned superheterodyne receiver , this ambiguity is of no consequence . in cases where the spectral components are not clearly resolved , a second sampled reference signal ( without fm , or with quadrature fm ) would be required . for applications where further accuracy is required , a second sampling frequency may be used . the rf gain of the subsampling link for signals in the n - th alias band may be written as ( assuming there is no matching network internal to the photodiode ) here , ω in is the original input signal frequency , the alias frequency is given by nω rep − ω in , and r i is the input resistance of the mzm . the rf gain is seen to take a form similar to that of a conventional imdd analog link , with additional frequency - filtering terms arising from the sampling optical pulse ( intensity ) shape and the low - pass filter . as noted earlier , the rf gain uniformity between alias bands improves as the sampling pulse duration decreases . for decreasing pulsewidth | p sp ( nω rep )| 2 varies less from band - to - band . from the wiener - khintchine theorem , | p sp ( nω rep )| 2 is readily determined from the intensity autocorrelation of the optical sampling pulse . it is important to note that the photodiode bandwidth need only cover the fundamental nyquist band since the aliasing ( downconversion ) operation is the result of an optical heterodyne process . the optical modulator , however , must show high - efficiency across the rf frequency range of interest . here we illustrate our technique through disambiguation of sinusoidal signals at center frequencies ranging from 1 mhz - 40 ghz . a convenient method for generating tunable repetition - rate optical pulse trains is through cascaded eletrooptic amplitude and phase modulation schemes that produce wide - bandwidth optical frequency combs . fig2 depicts the setup used in this research for optical comb and short pulse generation . we cascade a mach - zehnder intensity modulator ( mzm ) 104 with four phase modulators 114 which are driven with large ampltidue rf signals ( relative to the modulator halfwave voltage ). the large phase modulation index enables us to obtain broad optical combs from our cw laser 111 . for this work we choose an input modulation frequency of rf in = 5 ghz , which translates into the repetition rate of the generated pulse signal and gives a nyquist band edge of 2 . 5 ghz . all modulation was true time - delay matched which allows the repetition - rate to be continuously tuned over a multi - ghz range . each phase modulator 114 is driven with 30 dbm ( 1 w ), and the mzm intensity modulator 104 is quadrature - biased and driven at roughly one - half its 5 ghz half - wave voltage ( v π ≈ 6 v ). the output pulses from the comb generator 200 are then compressed with the proper amount of standard single - mode fiber 116 , which was determined assuming a purely quadratic phase to be 1 . 57 km for this experiment . in this demonstration the root - mean - square duration of the intensity of the sampling pulses is approximately 6 ps . note , any of a number of pulsed optical sources may be employed in the sampled link architecture including actively - modelocked lasers or low - biased mach - zehnder modulators driven by a step - recovery diode . the key requirement is that the repetition - rate must be dynamically tunable at least over a small range . from eq . ( 12 ), is it evident that the spr grows as the square of the folding band → n 2 . therefore , once the spr for the n = 1 band is known , the alias band may be determined from the spr assuming this quadratic growth . in our experiment κ = 100 khz / v , v j = 50 mv , f j = 100 khz which yields [ eq . ( 12 )] spr n = 1 = 6 . 25 × 10 − 4 , or approximately − 32 db . in fig3 ( a ) we illustrate the predicted increase in spr by comparing the spr for input signals at 300 mhz ( n = 0 alias band ), 4 . 7 ghz ( n = 1 alias band ), and 34 . 7 ghz ( n = 7 alias band ). note , the measurement is taken in the fundamental nyquist band ( 0 ≦ f ≦ 2 . 5 ghz ) where all of the above signals alias to a center frequency of 300 mhz . signals that inherently fall within the fundamental nyquist band do not exhibit the 100 khz modulation sidebands , and have spr = 0 as illustrated when the input signal is 300 mhz ( bottom curve ). when the input signal frequency is such that aliasing occurs , the phase - modulation sidebands grow as illustrated for input signals at f in = 4 . 7 ghz ( middle curve ) and f in = 34 . 7 ghz ( top curve ). here , the measured spr values for 4 . 7 ghz and 34 . 7 ghz are , respectively , spr n = 1 ≈− 32 db and spr n = 7 ≈− 15 . 1 db in nearly perfect agreement with eq . ( 12 ). this measurement is repeated for input signals with center frequencies up to 40 ghz and the results are shown in fig3 ( b ). here , the measured spr for each input signal ( circles ), as well as each harmonic of the pulse train repetition rate ( triangles ) are normalized to the value corresponding to n = 1 calculated from eq . ( 12 ). for reference , the scale below the plot shows the definition of the alias bands and the corresponding nyquist bands . it is very apparent from fig3 ( b ) that the spr growth is proportional to n 2 as expected illustrating that this quantity may be readily used to determine the alias band from which a given signal originated . a plot of n 2 is overlayed showing agreement with a quadratic growth profile . fig4 ( a ) shows the optical spectrum from the comb generator 200 . the full root - mean - square ( rms ) bandwidth of the comb envelope is calculated to be δf rms ˜ 225 ghz from which the number of comb lines is determined from n = 1 + δfrms / frep , where frep is 5 ghz . within the rms bandwidth the comb exhibits 46 comblines which show about a 1 db power variation ( at full - width - at - half - maximum bandwidth , δffwhm , ˜ 93 features are obtained ). fig4 ( b ) shows the autocorrelation measurement of the compressed optical pulse from which the rms duration of the intensity pulse is determined to be approximately 6 ps . ideal pulse compression is not achieved because of the deviation from a purely quadratic phase in our apparatus as evidenced by the bat ears in our optical spectra as well as the sidelobes visible in the intensity autocorrelation trace . a more uniform comb and moderately shorter pulse durations could be tailoring the drive waveform to obtain a more pure quadratic phase . for validation of the new gain expression presented in section 2 , we start here with the rf gain performance of the subsampled analog link shown in fig1 . for this measurement , 16 different continuous - wave ( cw ) tones spanning the 300 mhz - 40 ghz range are individually applied to the rf input of the link at a power level of 10 dbm . the frequencies of these tones were chosen such that all signals are aliased to 300 mhz at the link output and so that there is one frequency per 2 . 5 ghz nyquist bin . the peak signal power at 300 mhz is then measured with an electrical spectrum analyzer . the measured link gain versus frequency is shown in fig5 ( circles ). for comparison , the link gain calculated from eq . ( 13 ) using the measured frequency - dependent halfwave voltage of the modulator and an average photocurrent of i avg = 2 . 5 ma is shown by the gray curve . in this calculation p sp ( w ) 2 is given by the fourier transform of the measured intensity autocorrelation [ fig2 ( b )] and the frequency - dependent cable loss at the link input has been included . across the 40 ghz bandwidth of the measurement the magnitude of the error is below 1 db and is limited by the system measurement accuracy . in order to show that this technique is truly capable of determining from which alias band an ambiguous signal originated , we perform an automated experiment where the input frequency to the link was randomized . this experiment utilizes a random uniform sample of 1000 different input frequencies within the range of 1 mhz to 40 ghz . the aliased baseband replicas ( i . e ., those within the fundamental nyquist band ) are measured for each random input and control code determines the spr normalized to the known spr at 5 ghz . the corresponding alias band ( index n ) is then determined from the square root of the normalized spr . the results of this measurement are shown in fig6 ; the symbols / line show the measured alias band after disambiguation and the top axis shows the input alias band , for reference . for every input signal the correct alias band was determined across the 40 ghz bandwidth of the measurement proving the technique reliable for coarse broadband rf disambiguation . obviously many modifications and variations of the present invention are possible in the light of the above teachings . it is therefore to be understood that the scope of the invention should be determined by referring to the following appended claims . | 7 |
in fig1 , the interspinal prosthesis 1 with the counterpart 6 is shown in the assembled state . the central piece 2 of the prosthesis 1 , with the inner end 7 of the prosthesis 1 , adjoins the counterpart 6 . at the outer end 8 of the prosthesis 1 , the two processes 3 are disposed perpendicularly to the central axis 4 and diametrically opposite to one another . in the embodiment shown here , the processes 3 are constructed as halves of an ellipsoid body . the also radial and diametrically opposite to one another processes 3 of the counterpart 6 are disposed symmetrically to a plane , which is orthogonal to the central axis 4 . three radial cams 17 , which are disposed symmetrically when viewed in the cross - section of the prosthesis 1 parallel to the central axis 4 , protrude at the central piece 2 at the inner end 7 of the prosthesis and engage complementary grooves 18 at the counterpart 6 , function as twisting safeguard between the prosthesis 1 and the counterpart 6 . coaxially with the central axis 4 , the central part 2 includes a depression 5 , which penetrates from the inner end 7 into the prosthesis 1 up to a depth t . the counterpart 6 has a peg 16 , which is constructed to be complementary to the depression 5 and accordingly , during the assembly of the prosthesis 1 and the counterpart 6 , can be introduced into the depression 5 . furthermore , the prosthesis 1 comprises a fixing - in - position bolt 19 with a bolt head 26 , which can be brought into contact with the outer end 8 of the prosthesis 1 . the fixing - in - position bolt can be passed coaxially with the central axis 4 through the prosthesis 1 and locked by means of a slide lock 27 in the peg 16 of the counterpart 6 , so that the prosthesis 1 can be locked detachably with the counterpart 6 . a borehole 20 , coaxial with the central axis 4 , passes through the fixing - in - position bolt 19 and the counterpart 6 , so that the prosthesis 1 and the counterpart 6 can be collapsed radially . fig2 shows a further embodiment of the prosthesis with the counterpart 6 in the assembled state . the depression 5 passes through the prosthesis 1 coaxially from the inner end 7 up to the outer end 8 . during the assembly of the prosthesis 1 and the counterpart 6 , the peg 16 at the counterpart 6 is pushed into the through depression until the inner end 7 of the prosthesis 1 comes up against the processes 3 of the counterpart 6 . moreover , a borehole 20 is drilled through the counterpart 6 between the outer end 15 and the inner end 14 . the coupling means 11 are constructed as a screwed connection , the screw 21 being passed through the depression 5 at the prosthesis 1 and through the borehole 20 at the counterpart 6 from the outer end 8 of the prosthesis 1 up to the outer end 15 of the counterpart 6 and bolted with a nut 22 . in addition , the prosthesis 1 is provided with a hollow space 12 , so that the walls 13 of the hollow space can be collapsed or , by filling the hollow space 12 with a filling material , expanded . the embodiment , shown in fig3 , differs from the embodiments described above in that the peg 16 at the counterpart 6 is passed completely through the depression 5 at the prosthesis 1 , so that the inner end 14 of the counterpart 6 aligns with the outer end 8 of the prosthesis 1 furthermore , the counterpart 6 has several boreholes 20 , which are continuous from the inner end 14 to the outer end 15 and the axes of which extend parallel to the central axis 4 . the cerclage wires 23 , by means of which the interspinal prosthesis 1 and the counterpart 6 are fixed in position , can be passed through these boreholes 21 . the embodiment , shown in fig4 , differs from those shown in fig1 owing to the fact that the coupling means 11 comprise a locking bolt 28 , which can be passed through the borehole 20 , which passes through the prosthesis 1 and the counterpart 6 coaxially with the central axis 4 . the locking bolt 28 , with its head 29 , can be brought into contact with the outer end 15 of the counter part 6 and has , at its tip , radially and elastically deformable cams 31 , which , when the prosthesis 1 and the counterpart 6 are assembled , can be locked in an eccentric relief 30 , the diameter of which is larger than the diameter of the borehole 20 , so that the prosthesis 1 and the counterpart 6 are held together . for introducing the locking bolt 28 into the borehole 20 , the cams 31 can be compressed perpendicularly to the central axis 4 by means of axially disposed slots 32 , so that the locking bolt 28 can be passed through the borehole 20 , while , in the assembled state , the cams 31 spring back elastically and latch into the eccentric relief 30 at the prosthesis 1 . a hole is drilled through the locking bolt 28 coaxially with the central axis 4 , so that a pin 25 can be passed through it , as a result of which a radial deflection of the cams 31 is prevented in fig5 , a further embodiment of the inventive prosthesis 1 with a counterpart 6 is shown . at the outer end 8 of the prosthesis 1 as well as at the outer end 15 of the counterpart 6 , the processes 3 are mounted once again perpendicularly to the central axis 4 and diametrically opposite to one another , the processes 3 in this embodiment having a semicircular cross sectional surface parallel to the central axis 4 . the depression 5 passes through the prosthesis 1 from the inner end 7 to the outer end 8 coaxially with the central axis 4 . in the depression 5 , there is an internal thread 36 with a very large pitch . adjoining the inner end 14 , the counterpart 6 once again has a peg 16 , which has an external thread 33 that is complementary to the internal thread 36 , so that the prosthesis 1 and the counterpart 6 can be fastened detachably to one another by means of this screwed connection . a first saw tooth - like system 34 is mounted at the counterpart 6 between the peg 16 and the processes 3 and can be brought into engagement with a complementary second tooth system 35 at the inner end 7 of the prosthesis 1 during the assembly of the prosthesis 1 and the counterpart 6 so that , due to the asymmetric configuration of the saw tooth systems 34 , 35 , a safeguard is provided against the unintentional detachment of the prosthesis 1 from the counterpart 6 . | 0 |
fig2 shows a representation of one embodiment of the invention . an object 200 , such as a particular employee in a corporation , has particular attributes and qualifications such as education , experience , contact details , location ( if the corporation has various offices , for instance ), title , etc . this information is stored in various data sources which can have different formats and can be in one physical location or be distributed over different machines . in this embodiment , data associated with the object 200 is located in a relational data base 202 , a structured data file 204 which could take the form of a hierarchical file system such as ldap used by sap , a data source storing free text 206 , and other data formats or sources indicated generally by reference numeral 208 . it will be appreciated that typically numerous objects with associated data are stored in the various data structures . instead of directing searches to each of the data structures in turn , the present invention reads the data by providing for interfaces to the various data structures . in one embodiment the reading simply comprises a remote function call ( rfc ) to each of the data sources . the read data is stored , as indicated by reference numeral 210 . in one embodiment , the read data is stored in an xml file which is then readable by a search engine 212 . it will be appreciated that the read data could also be stored in a different format , such as a database . however , the xml file format has the flexibility of easily allowing fields to be added , deleted or updated . the present invention thus provides an elegant way of searching attributes from numerous data sources at the same time and avoids putting additional loads on the various data sources each time a search is performed . since information stored in data sources is not always complete or also lacks the flexibility of capturing ad hoc information that is best included in free text format , the present invention , further contemplates providing means for adding free text . in one embodiment , this is done by means of a template driven user interface that defines data fields , some of which may be populated by data from one or more of the data sources , and some may be filled in by a user by any one of a number of means , e . g ., by selecting from a menu or by entering text . fig3 shows one particular implementation of the invention , which shows an application server 300 , which in this embodiment , forms part of an hr system 302 . the application server 300 includes a data storage 304 for storing incoming data in an xml file . as is shown in fig3 , the application server 300 may be part of the hr system or , alternatively , hr data may be provided from an external data source 310 . thus data is supplied both automatically from data sources such as the hr data base 310 and a hierarchical file storage 312 , as well as by manual entering of information using the user interface 320 . other data sources could additionally be integrated using remote function calls ( rfc ) interface 322 . all the data from the various data sources is transferred to the application server so that the xml file 304 can be populated and stored in the content server 330 as well as allow the corresponding fields to be visualized in a template . this is best illustrated by the embodiment of a template shown in fig4 . fig4 shows a template 400 which , in this embodiment is web based . the template 400 includes data entry fields such as firstname 410 , lastname 412 , location 414 , costcenter 416 , phone 418 , and email 420 , which are populated from the hierarchical database 310 and stored in the xml file 304 . it also includes fields that are filled out by a user , such as the fields workarea 422 and region 424 , which provide drop down menus for easy selection of entries by the user . it also includes other selection fields such as languages spoken 426 , as well as free text data entry locations 430 , 432 . the latter two fields provide the user with the flexibility of entering information that is not necessarily common to other employees but which is nevertheless relevant in identifying an employee with specific attributes . referring again to fig3 , the search engine 340 communicates with the content server 330 to extract objects ( in this case , employees ) with defined attributes . the content server , in turn interacts with the data entry system to save any additional data that is entered by a user , in the xml file . in one embodiment a separate xml file is provided for each object . however , it will be appreciated that the filing system can be set up in different ways . in one embodiment , the different fields are defined to allow searches to be conducted in specific fields only instead of searching through the full xml files . to define the various fields , tags are associated with the fields and are included as part of the data . the data fields of the template are also used to design the search interface when searching for objects . thus it prompts the user to enter the search criteria in the selected data fields that are relevant to the user , and invokes the search engine 340 to search the xml files 304 . in one embodiment the search engine 340 uses fuzzy logic to allow spelling variances , and synonyms to be picked up during a search . as yet a further refinement , in one embodiment , keys are included as part of some or all of the data to provide greater search flexibility . for example , when a user selects “ english ” in the languages spoken field 426 , this would not necessarily be picked up if this search element were typed in in german or spanish , since the word “ english ” is spelled differently in these languages and would not be recognized . however , by including a key en ( for instance , by way of a tag ) and attaching it to the field , the selection of the field automatically invokes the key notwithstanding that the field may be identified to the human user as english , englisch , or anglais . while the invention has been described with reference to particular embodiments and applications , it will be appreciated that the invention can be implemented in different ways and have different applications without departing from the scope of the invention . | 6 |
the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the disclosed embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . fig1 a illustrates different power areas within processor 102 in accordance with an embodiment of the present invention . processor 102 is divided into a core power area 126 , and a non - core power area 124 . core power area 126 includes the instruction - processing portion of processor 102 . specifically , core power area 126 includes arithmetic - logic unit 104 , register files 106 , pipelines 108 , and possibly level one ( l1 ) caches 110 . note that l1 caches 110 can alternatively be located in non - core power area 124 . arithmetic - logic unit 104 provides computational and logical operations for processor 102 . register files 106 provide source operands , intermediate storage , and destination locations for instructions being executed by arithmetic - logic unit 104 . pipelines 108 provides a steady stream of instructions to arithmetic - logic unit 104 . instructions in pipelines 108 are decoded in transit . therefore , pipelines 108 may contain instructions in various stages of decoding and execution . l1 caches 110 include data caches and instruction caches for arithmetic - logic unit 104 . l1 caches 110 are comprised of very high - speed memory to provide fast access for instructions and data . in one embodiment of the present invention , l1 caches 110 includes a write - through data cache . non - core power area 124 comprises the remaining portion of processor 102 and includes interrupt processor 112 , real - time clock 114 , clock distribution circuitry 116 , level two ( l2 ) caches 118 , cache tags 120 , and cache snoop circuitry 122 . in general , non - core power area 124 includes portions of processor 102 that are not directly involved in processing instructions , and that need to operate while instruction processing is halted . interrupt processor 112 monitors interrupts 128 and periodically interrupts the execution of applications to provide services to external devices requiring immediate attention . interrupt processor 112 can also provide a wake - up signal to core power area 126 as described below . real - time clock 114 provides time - of - day services to processor 102 . typically , real - time clock 114 is set upon startup from a battery operated real - time clock in the computer and thereafter provides time to the system . clock distribution circuitry 116 provides clock signals for processor 102 . distribution of these clock signals can be switched off or reduced for various parts of processor 102 . for example , clock distribution to core power area 126 can be stopped while the clock signals to non - core power area 124 continue . the acts of starting and stopping of these clock signals are known in the art and will not be described further . real - time clock 114 and clock distribution circuitry 116 receive clock signal 130 from the computer system . clock signal 130 is the master clock signal for the system . l2 cache 118 provides a second level cache for processor 102 . typically , an l2 cache is larger and slower that an l1 cache , but still provides faster access to instructions and data than can be provided by main memory . cache tags 120 provide an index into data stored in l2 cache 118 . cache snoop circuitry 122 invalidates cache lines base primarily on other processors accessing their own cache lines , or i / o devices doing memory transfers , even when instruction processing has been halted . l2 cache 118 , cache tags 120 , and cache snoop circuitry 122 communicate with the computer system through memory signals 132 . non - core power area 124 receives non - core power 136 and core power area 126 receives core power 134 . the voltage applied for non - core power 136 remains at a voltage that allows circuitry within non - core power area 124 to remain fully active at all times . in contrast , non - core power 136 may provide different voltages to non - core power area 124 based upon the operating mode of processor 102 . for example , if processor 102 is a laptop attached to external electrical power , the voltage provided to non - core power 136 ( and to core power 134 during instruction processing ) may be higher than the minimum voltage , thus providing faster execution of programs . the voltage applied to core power 134 remains sufficiently high during instruction processing so that core power area 126 remains fully active . however , when processor 102 receives a signal that processing can be suspended , the voltage supplied by core power 134 can be reduced . in one embodiment of the present invention , the voltage in core power 134 is reduced to the minimum value that will maintain state information within core power area 126 , but this voltage is not sufficient to allow processing to continue . in another embodiment of the present invention , the voltage at core power 134 is reduced to zero . in this embodiment , the state of core power area 126 is first saved before the voltage is reduced to zero . this state can be saved in a dedicated portion of l2 cache 118 , in main memory , or in another dedicated storage area . upon receiving an interrupt or other signal indicating that processing is to resume , the voltage in core power 134 is restored to a normal level , saved state is restored , and processing is restarted . fig1 b illustrates an alternative partitioning of power areas within processor 102 in accordance with an embodiment of the present invention . as shown in fig1 b , l2 cache 118 , cache tags 120 , and cache snoop circuitry 122 are included in core power area 126 rather than in non - core power area 124 . in this embodiment , the voltage supplied as core power 134 is reduced or set to zero as described above , however , the cache circuitry within processor 102 is also put into the reduced power mode . prior to reducing the voltage supplied to core power area 126 , data stored in l2 cache 118 is flushed to main memory . additionally , if the voltage at core power 134 is reduced to zero , the state of processor 102 is first saved in main memory . fig2 is a flowchart illustrating the process of monitoring processor load and switching to power saving modes in accordance with an embodiment of the present invention . the system starts by monitoring the processor load ( step 202 ). next , the system determines if the processor will be needed soon ( step 204 ). this determination is made based on the current execution pattern and the cost of entering and recovering from nap mode . this cost , calculated in power usage , must be less than the power wasted by not going into nap mode . if the processor will be needed soon at step 204 , the process returns to step 202 to continue monitoring the processor load . if the processor will not be needed soon at step 204 , the system determines if the processor has been taking long naps recently ( step 206 ). if not , the system enters a normal nap mode , which involves halting the processor without reducing any voltages ( step 208 ). typically , halting the processor involves removing the clock signals to the core power area of the processor . after halting the processor , the system waits for an interrupt ( step 210 ). upon receiving an interrupt or other signal requiring a restart , the system restarts instruction processing ( step 212 ). after restarting instruction processing , the process returns to step 202 to continue monitoring the processor load . if the processor has recently been taking long naps at step 206 , the system enters a deep nap mode , which involves saving the state information from the core power area ( step 214 ), halting the processor ( step 216 ), and then reducing the voltage supplied to the core power area ( step 218 ). after reducing the voltage , the system waits for an interrupt ( step 220 ). upon receiving the interrupt or other signal requiring a restart , the system restores the voltage to the core power area ( step 222 ). next , the modules within the core power area are restarted ( step 224 ). the system then restores the state information that was saved at step 214 ( step 226 ). after the processor has been restarted , the process returns to step 202 to continue monitoring the processor load . note that the above description applies when the processor is used to save and restore the state information . in cases where dedicated hardware saves and restores the state information , steps 214 and 216 , and steps 224 and 226 can be reversed . note also that if the voltage supplied to the core power area 126 is reduced but maintained at a level where modules in the core power do not lose state information , steps 216 and 224 are not required . the foregoing descriptions of embodiments of the present invention have been presented for purposes of illustration and description only . they are not intended to be exhaustive or to limit the present invention to the forms disclosed . accordingly , many modifications and variations will be apparent to practitioners skilled in the art . additionally , the above disclosure is not intended to limit the present invention . the scope of the present invention is defined by the appended claims . | 8 |
the embodiment of fig1 shows a sketch of a plan view of a micromechanical coriolis rate of rotation sensor 1 according to the invention having two driving masses 2 . the driving masses 2 are disposed parallel to a substrate , not shown here , located within the plane of the drawing . the driving masses 2 are each connected to the substrate by means of an anchor 3 and anchor springs 4 disposed thereon . the anchor springs 4 allow rotation about a z - axis in an orthogonal coordinate system . in said coordinate system , the z - axis protrudes out of the plane of the drawing , while the x - axis is disposed in the longitudinal direction of the driving masses 2 and the y - axis is disposed in the transverse direction of the driving masses 2 . the x - axis is thereby the measurement axis , meaning that the rate of rotation sensor is able to determine a rotation of the sensor or the substrate about the x - axis . the y - axis disposed orthogonal thereto and in the same plan represents the detection axis . the driving masses 2 move accordingly about the y - axis , out of the x - y plane , when the substrate is rotated about the measurement or x - axis . this takes place due to a coriolis force that arises when the driving masses 2 oscillate about the drive axis thereof or the z - axis . said displacements are made possible by the central suspension of the driving masses 2 on the anchor 3 and the anchor springs 4 disposed thereon and connected to the driving masses 2 . the anchor springs 4 are accordingly implemented such that they allow the rotary motion of the driving masses 2 about the anchor 3 in question or about the z - axis , and also allow pivoting of the driving masses 2 about the y - axis . they are rigid about the x - axis , in contrast , so that no displaceability arises here , as a rule . it should be noted here that the direction out of the plane of the drawing is referred to as the z - axis in the above description . the x - axis refers to a direction transverse to the plane of the drawing , and the y - axis refers to a direction along the plane of the drawing . this also applies for cases where the axes are shifted parallel to each other . the two driving masses 2 are connected to each other by means of a connecting element 5 and connecting springs 6 . one connecting element 5 having the associated connecting springs 6 is disposed at each end of each driving mass 2 in the x - direction . the connecting element 5 and the connecting springs 6 bring about a synchronization of the rotary motions of the driving masses 2 . this ensures that , when the two driving masses 2 oscillate in antiphase , that is , so that the two ends of the driving masses 2 facing toward each other move toward each other or away from each other , said masses oscillate at the same frequency , so that a stable system arises , wherein the deflections of the two driving masses 2 result in the same amplitude out of the x - y plane in case of detecting a rate of rotation of the sensor about the x - axis . the connecting springs 6 are thereby implemented so that they allow deflection in the x - y plane , as well as a pivoting motion of the driving masses 2 about the y - axis , wherein the motions of both connecting springs of a connecting element occur in opposite directions for a deflection out of the x - y plane , while they occur in the same direction for an antiphase motion of the driving masses 2 within the x - y plane . in order to be able to rotate the driving masses 2 about each anchor 3 or the z - axis , drive elements 7 are provided . the drive elements 7 are associated with the driving masses 2 and consist of comb electrodes , for example , that are supplied with an alternating voltage , whereby the driving masses 2 are induced to rotate about the anchor 3 . the rotary motion thereby alternates according to the polarity of the comb electrodes , that is , it oscillates , so that an oscillating motion about the anchor 3 takes place . detecting elements 8 are disposed between the substrate and the driving masses 2 . the detecting elements 8 are , for example , plate capacitors , the electrodes thereof being disposed on the substrate and , opposite thereof , on the side of the driving masses 2 facing the substrate . for a rotary motion of the driving masses 2 about the y - axis , the distance between the opposing electrodes of the detecting elements 8 changes , whereby a changed electrical signal is generated . said electrical signal is symptomatic of the deflection of the driving masses 2 and thus in turn for the rotary motion of the substrate about the x - axis . the rate of rotation of the rate of rotation sensor can thereby be determined by analyzing said electrical signal of the detecting elements 8 . a further embodiment example of the present invention is shown in fig2 . the corresponding sketch shows a rate of rotation sensor 1 constructed similarly to the embodiment of fig1 . the driving masses 2 are rotatably attached about the y - axis and the z - axis to the substrate , not shown , by means of an anchor 3 and anchor springs 4 . the driving masses 2 are driven by means of drive elements 7 and the deflection thereof out of the x - y plane is detected by means of detecting elements 8 . a difference from the embodiment of fig1 is the type of the connecting element 5 . in the embodiment of fig4 , the connecting element 5 ′ is divided in two on each side . while the connecting element 5 ′, together with the connecting springs 6 ′ disposed thereon , connects the two driving masses 2 in a manner similar to the connecting element 5 of fig1 , an additional connecting element 5 ″ is provided . the connecting element 5 ″ is attached to each of the driving masses 2 by means of connecting springs 6 ″. the connecting element 5 ″ is further attached to the substrate by means of an anchor 10 and anchor springs 11 . the anchor springs 11 are implemented for allowing a rotary motion about the z - axis as well as a rotary motion of the connecting elements 5 ′ and 5 ″ about the x - axis . such an arrangement of the connecting elements 5 ′ and 5 ″ is particularly advantageous if the driving masses 2 are drive in phase rather than in antiphase . rotary motions of the driving masses 2 are also caused thereby , leading to a tilting motion about the y - axis in case of a rate of rotation about the x - axis . because the rotary oscillations about each anchor 3 of the driving masses 2 occur in phase in this case , the deflection of the driving masses 2 due to a coriolis force can also be expected to be in phase . this means that both driving masses 2 tilt up and down about the y - axis in the same side region of the y - axis at the same time . operation of the rate of rotation according to the invention is also possible in this mode , even if the robustness of the sensor and the detection of impacts on the rate of rotation sensor is thereby not as advantageous as for the antiphase motion of the driving masses 2 . a further embodiment example of the present invention is shown in fig3 . said embodiment is , in turn , similar to the embodiment of fig1 . in addition to various differences , a detailed representation is selected in particular here . the driving masses 2 are each attached to the anchor 3 by means of four anchor springs 4 . this allows a uniform rotary motion of the driving masses 2 about the anchor 3 or the z - axis , for driving the same according to the arrows p . the driving motion of the driving masses 2 takes place in turn in the x - y plane . comb electrodes of the driving elements 7 provide the drive of the driving elements 2 . the drive electrodes 7 consist of a stationary part fixed to the substrate and a second part , wherein the comb electrodes are attached to the displaceable driving masses 2 . the two parts of the driving elements 7 engage in each other and lead to a rotary motion of the driving masses 2 about the anchor 3 . in order to be able to determine and optionally correct the rotary motions of the driving masses 2 caused by the driving elements 7 , feedback elements 12 are provided . the feedback elements 12 also consist of comb electrodes . said comb electrodes , engaging in each other , of which in turn a first part is attached to the substrate and a second part is displaced together with the driving mass 2 , determine the frequency at which the driving masses 2 oscillate about the z - axis by means of a corresponding change in the electrical voltage . if differences between the actual and target frequency are thereby determined , then the frequency of the driving masses 2 can be changed accordingly by correspondingly influencing the driving elements 7 , in order to correspond in turn to the target frequency . the feedback elements 12 are each disposed between two driving elements 7 . they thereby comprise nearly the same distance from the axis of rotation z , and can thus operate at a similar precision as the driving elements 7 . the two driving masses 2 are connected to a connecting element 5 ′″ at each end thereof , as seen in the x - direction . the connecting elements 5 ′″ are implemented in the form of cantilevers disposed fixedly on the driving mass 2 . a connecting spring 6 ′″ is disposed between the two cantilevers of the connecting elements 5 ′″. the connecting spring 6 ′″ protrudes into an intermediate space between the two driving masses 2 and is serpentine in form . the connecting elements 5 ′″, together with the connecting springs 6 ′″ allow displacement of the driving masses 2 in antiphase within the x - y plane , as well as deflection of the driving masses 2 out of the x - y plane for detecting a rate of rotation . this also occurs in antiphase . the rotary motions of the driving masses 2 out of the x - y plane are shown by means of arrow symbols s . the rotary motion also takes place in antiphase , analogous to the drive motion of the driving masses 2 . stoppers are provided in order to prevent damage to the driving masses 2 or other elements . in the embodiment of fig3 , stoppers 13 are attached to the substrate and protrude into the region of the anchor springs 4 . the anchor springs 4 would strike against the stoppers 13 in case of excessive deflection of the driving masse 2 , and thus prevent damage to the driving masses 2 or the springs 4 by excessive bending . in addition to good rotary motion of the driving masses 2 about the z - axis , good shock stability is achieved by attaching the driving masses 2 to the anchor 3 by means of four anchor springs 4 . the driving masses 2 can thereby tilt about both the x - axis and the y - axis for a corresponding impact on the sensor 1 . said motion of the driving masses 2 in the same direction in case of an impact can be determined by the detecting elements , not shown here but implemented similarly to those in fig1 and 2 . the determination is made in that , instead of the opposing approach and separation of the individual electrodes of the detecting elements 8 expected in normal operation , a separation or approach takes place in the same direction . if such is detected , then a shock condition is assumed , so that the measurement results that are supposed to determine a rate of rotation of the sensor 1 must be cleansed or discarded . a further embodiment example is shown in fig4 . the embodiment of fig4 is most suitable for being able to eliminated shock conditions , and for protecting the sensor 1 against damage . in the embodiment shown here , the two driving masses 2 are disposed at a relatively great distance from each other . the two anchors 3 are located along the y - axis and allow a rotary motion about the anchor 3 in a similar manner to the previous embodiments , together with the drive elements 7 , the feedback elements 12 , and the corresponding anchor springs 4 . when a coriolis force occurs due to a rate of rotation and acts on the sensor 1 about the x - axis , the driving masses 2 are deflected in turn about the y - axis and out of the x - y plane . said rotary motions of the driving masses 2 out of the x - y plane are shown by means of arrow symbols s . the rotary motion takes place in antiphase , analogous to the drive motion of the driving masses 2 . the driving masses 2 of said embodiment comprise connection elements 5 ″″ there between . the connecting elements 5 ″″ are connected to the driving masses 2 by means of connecting springs 6 ″″. the connecting element 5 ″″ consists of a first mass 14 and a second mass 15 . the first mass 14 encloses the second mass 15 in a frame - like manner and is connected to the driving masses 2 by means of the connecting springs 6 ″″. the first mass 14 is also connected to the second mass 15 by means of further connecting springs 16 . the connecting springs 16 allow displaceability of the first mass 14 relative to the second mass 15 in the x - y plane . displaceability of the first mass 14 in the y - direction is thereby made possible . the connecting springs 6 ″″ are rigid in the x - direction and the z - direction , so that motion of the driving masses 2 simultaneously brings about motion of the first mass 14 and of the second mass 15 by means of the connecting springs 16 . the second mass 15 is disposed on a further anchor 19 by means of springs 17 . the spring 17 is designed such that a rotary motion is possible about the x - axis . it is thus ensured that , for a deflection of the driving masses 2 out of the x - y plane , tilting of the connecting elements 5 ″″ about the anchor 18 or the x - axis can occur . detecting elements that can detect the change in distance between the driving masses 2 and the connecting elements 5 ″″, particularly the first masses 14 and the second masses 15 , are disposed between the driving masses 2 and / or the connecting elements 5 ″″ and the substrate . the corresponding rotary motion is shown by the arrow symbols s . stoppers 19 are disposed between the first mass 14 and the second mass 15 , preventing damage to the spring elements or the first or second mass in case of excessive deflection . the same applies to the stoppers 20 disposed on the exterior of the first mass 14 . said stoppers prevent the driving masses 2 and the first mass 14 , and the connecting springs 6 ″″ disposed there between , from being damaged . if a shock condition arises on sensor 1 , then the driving masses 2 do not tilt out of the x - y plane in the opposite direction , as would occur due to the driving elements 7 . rather , the two driving masses 2 tilt out of the x - y plane in the same direction . as soon as this is the case , the first mass 1 is also displaced out of the x - y plane provided therefore , while the second mass 15 remains unchanged , due to the spring characteristics of the spring 17 . the first mass 14 is thus displaced by the connecting springs 16 relative to the second mass 15 largely in parallel to the x - y plane and out of the same , and approaches or departs from the substrate . this can , in turn , be determined by a change in the electrical signals by the detecting elements 8 disposed between the first mass 14 and the substrate . the construction of the rate of rotation sensor 1 as shown provides a particularly stable and shock - resistant construction of a rate of rotation sensor 1 . false measurements due to detectable shock conditions can also be very reliably prevented . different conditions of the rate of rotation sensor 1 of fig4 are shown in fig5 a , 5 b , and 5 c . fig5 a thereby shows an antiphase motion of the driving masses 2 . it is evident that the driving masses 2 are displaced about the anchor 3 in a clockwise and counter - clockwise direction . the feedback elements 12 are disposed near the anchor 3 . the connecting elements 5 ″″ remain essentially stationary . according to fig5 b , operation of the rate of rotation sensor 1 in phase is shown . the two driving masses 2 thereby pivot in the same direction , clockwise or counterclockwise . a force is thereby exerted on the first mass 14 of the connecting element 5 ″″, so that said first mass 14 is displaced relative to the second mass 15 . the displacement of all of said elements takes place within the x - y plane . according to fig5 c , a rate of rotation about the x - axis occurs , whereby coriolis forces arise that act on the driving masses 2 . the deflection according to fig5 c takes place in the opposite direction , from which it can be concluded that the driving masses 2 are also driven in antiphase . the tilting of the driving masses 2 in opposite direction about the y - axis causes the connecting elements 5 ″″ to tilt as well . because said elements can be rotated only about the x - axis due to the anchors 18 and the springs 17 , the connecting elements 5 ″″ tilt about the x - axis along the two anchors 18 . a change in the distance from the connecting elements 5 ″″ thereby occurs with respect to the substrate located below . the detecting elements 8 disposed there between , not shown here , can detect said change in distance by means of a change in the electrical signals , and a corresponding rate of rotation of the rate of rotation sensor about the x - axis is thereby detected . the invention is not limited to the embodiments shown . in particular , the invention is not limited to the forms of the individual components shown , to the extent that said forms do not arise from the claims . changes to the scope of the disclosure and the applicable claims may be made at any time . | 6 |
the present embodiment introduces the notion of “ tiles ” to exploit the two dimensional dependencies between blocks while also supporting the exploitation of multiple processors , if available in the encoder , to simultaneously perform encoding operations on multiple tiles . the partitioning of a frame into tiles is completely specified by the numbers n and m , eliminating the need for a slice header , which is a basic requirement in conventional slice processing . here , n and m are the height and width of a tile measured in number of blocks . typically , the values of n and m are conveyed to the decoder in the sequence header or picture header resulting in negligible transmission bandwidth overhead . in addition to unilaterally transmitting the n and m numbers to the decoder in the sequence or picture header , an alternative is to have a handshaking operation between the decoding device and encoding device , where the values of n and m are exchanged , as well as perhaps the processing capabilities of the decoder . by making the dependency breaks in a n × m tile , the system exploits the possibility in images to create both vertical boundaries as well as horizontal boundaries that minimally disturbed correspondences between blocks . moreover , the content of a particular series of images may be a natural landscapes that often have horizontal dependencies ( such as horizons , etc .). on the other hand , imagery involving forests or other vertical oriented images may benefit more greatly by having a larger vertical dimension so that more blocks in the vertical dimension may be included as part of a common tile , thereby allowing for the exploitation of the dependencies between blocks in the vertical direction . the specification of the numbers n and m specifies dependency breaks at tile boundaries by implication . in a typical video encoder according to the present embodiment , at least the following dependencies are broken at tile boundaries ( other dependencies may be broken as well depending on the relevant standard defining the decoding requirements ): use of reconstructed pixels for intra prediction , use of motion vectors from neighbouring blocks for motion vector coding , use of intra direction modes from neighbour blocks . adaptive entropy coding based on previously encoded blocks . flushing of arithmetic coding bits . deblocking filter across tile boundaries , although this can be avoided if deblocking is performed as a separate pass on a single processing core . fig3 a shows an arrangement of 2 × 3 tiles ( arbitrarily choosing 2 as being the vertical component and 3 being the horizontal component of a tile , but vice versa would also be an acceptable convention ). blocks having a same letter belong to a common tile and therefore are best suitable for being processed with one processing core . therefore , supposing four processing cores are available , the “ a ” tile may be processed by one core while separate cores may handle the b , c and d tiles respectively , where all the processing is done in parallel . in a non - limiting context , the numbers in each tile of fig3 a represent an ordering of macro blocks ( or other blocks ) within the tile . for example , for tile a the first three blocks 0 - 2 are arranged in a horizontal row ( in the raster scan direction ), while a second row of blocks 3 - 5 are disposed in a row beneath the first row . thus , the blocks are arranged in a two - dimensional group of blocks where the dependencies are broken at the vertical edge between tile a and tile b , and at the horizontal edge between tile a and tile c . fig3 b shows the transmission order for the frame , which follows the raster - scan order . in order to reorder the bits from the tiles into the bits in raster scan order , a tile reformatter is used . likewise , at the decoder , if processing by tiles is chosen , a tile formatter is used to return the bits to proper block for each tile . the tile reformatter at the encoder conversion changes the tile - order ( a 0 , a 1 , a 2 , a 3 , a 4 , a 5 , b 0 , b 1 , b 2 , . . . ) as shown in fig3 a to raster - scan order ( a 0 , a 1 , a 2 , b 0 , b 1 , b 2 , a 3 , a 4 , . . . ) as shown in fig3 b . likewise , the tile formatter at the decoder performs a reordering operation from raster - scan order to tile - order . regarding this reformatting process , if the encoder processes in tiles and the bits from each tile were not reordered , the resulting bitstream would be in tile - order . in that case , the decoder would have two options could either a ) do nothing with the bitstream and decode the blocks in tile - order , or b ) convert to raster - scan order and then decode the blocks in raster - scan order . both options are alternative embodiments , although they place an extra processing burden on the decoder . on the other hand , the primary embodiment reflected in the drawings is to have the encoder place the bits in raster - scan order in turn , this minimizes the processing burden on the decoder and allows the decoder to either : a ) do nothing with the bitstream and decode the blocks in raster scan order ( i . e . no tile penalty ), or b ) convert from raster - scan order to tile - order and decode the blocks in tile - order . therefore , if the encoder processes in tiles and assumes the burden of converting from tile - order to raster - scan order the decoder are compelled to do nothing except respect the dependency breaks at the tile boundaries . in an encoder according to the present embodiment , tiles are processed in parallel on different cores . each core produces a string of compressed bits for that particular tile . in order to transmit the compressed data in raster scan order , the bits produced by different tiles / cores need to be reformatted . this is typically done on a single core . a parallel processor embodiment is illustrated in fig4 , where the dashed line indicates modules that are processed in parallel on respective cores . moreover , each core is assigned a processing task per tile ( although there is no restriction on processing multiple tiles per core ), and share memory resources to assist in sharing reference data for inter prediction between tiles and blocks . the frame memory resides in shared memory , while the tile reformatter is implemented on a single core . ( alternatively , the deblocking filter can run on a single core .) moreover , the subtractor 9 , transform 13 , quantization 15 , inverse transform 26 , blocking filter 8 , frame memory 6 , motion compensation 5 , intraprediction 3 , switch 7 and entropy coder 17 are all similar to that described earlier in fig1 . however , in this multicore embodiment that provides tile - compatible processing , a tile reformatter 18 is used to retrieve and arrange bits from respective tiles so as to place them in raster scan order so that the bit stream sent from the encoder of fig4 would be in raster scan order . likewise , a decoder would optionally employ a corresponding tile formatter if it is configured to repackage the bits into the end by end tiles before decoding . another thing to note in fig4 , is the presence of dashed lines . as discussed above , a common core may perform all the functions , for example , of the transform 13 , quantization 15 , entropy coder 17 , inverse transform 26 , deblocking filter 8 , motion compensation 5 , switch 7 and interprediction 3 . because the tile reformatter 18 and frame memory 6 are available as a common resource amongst the different cores , each used for processing different tiles , the frame memory and tile reformatter 18 are not limited to use on a single core , but rather available for interfacing between the different cores . likewise the subtractors and adders shown are implemented on a different core . the present arrangement of encoding functions on different cores is meant to be non - exhaustive . instead , one aspect of having the arrangement in tiles is that there can be a correspondence between the tiles and the number of cores made available . moreover , as discussed above , having multiple processor cores , provides available processing resources that may result in arranging a number of tiles to correspond with those cores . at the decoder side , the decoder in the handshaking process with the encoder , can specify whether the tile reformatter 18 shall be used or not ( in a tile partitioning mode or not ). the tile partitioning mode allows for the reception of bits read out from respective tiles , without reformatting , or reformatted so as to place the bits in the same order as would be provided in a raster - scan or as would be done with a conventional encoder . of course , in a more straightforward process , no handshaking is performed and the encoder and decoder always operate in the tile partitioning mode . it should be noted that when both the encoder and decoder operate in tile partitioning mode the tile reformatter ( encoder ) and tile formatter ( decoder ) are not needed since there is no need to put the bit - stream in raster scan order . thus , the tile reformatter 18 and tile formatter 25 have an internal by - pass capability for passing the bit - stream there through without manipulation . of course in fig4 and 5 the tile reformatter 18 and tile formatter 25 are also used to show the two way communication between the encoder and decoder . this connection is merely exemplary because the encoder and decoder can exchange information ( such as the values for n and m through sequence - or picture headers ) through any one of a variety of communication interfaces . moreover , the bits representing the values n and m need not be reformatted in any way , and thus by - pass the reformatting and formatting functions in the tile reformatter 18 and tile formatter 25 respectively . in this same way , other message data exchanged between the encoder and decoder use the tile reformatter and tile formatter as a communications interface , without bit reordering . fig5 is a block diagram of a decoder according to an embodiment that supports a tile portioning mode of operation , and includes parallel processing to assist in processing separate tiles . as was the case with fig4 , a dashed line indicates what decoding components are supported on a separate processing core , such that multiple cores may be used to simultaneously process tiles received from the encoder . the frame memory 6 is used as a common resource , similar to what is done at the encoder in fig4 . the tile formatter 25 initially receives the values n and m from the tile reformatter 18 from the encoder , although the tile reformatter does not perform any bit manipulation or reordering of these values . instead , from the values n and m , the tile formatter 25 recognizes the tile shapes for the data arriving from the incoming bit stream and ultimately allows the decoder components to perform a decoding operation based on the tile partitioning ( and associated dependency breaks ) introduced at the encoder . moreover , the decoder breaks the dependencies in the current frame between blocks at tile boundaries as dictated by the values n and m . it should be noted that the encoder may provide multiple pairs of n and m , indicating that each tile , or at least multiple tiles , in a frame can have a different rectangular shape . in some instances , the decoder can specify its wishes to the encoder for required / desired values of n and m or whether to use tile partitioning at all . this may be useful , for example , by the decoder informing the encoder that the decoder can support only a 720p30 display format if not in tile partitioning mode , but could support 1080p30 display format if used in a tile partitioning mode using tiles that are not larger than n × m . this two - way communication between the encoder and the decoder is represented by a double headed arrow at the tile formatter 25 in fig5 . when arranged in this way , tiles offer the advantage over conventional slices and slice groups in that no tile header is needed to identify tile boundaries . moreover , there is no overhead required on a tile - by - tile or block - by - block basis to support the identification of tile boundaries . instead , by specifying at first the shape of the tiles , or by reading the sequence or frame headers , the decoder has all the information it needs to identify tile boundaries based on the original specification of the values n and m . also , the decoder has the option of using the tiles or not . in this way , the impact on the decoder is minimal since the decoder need not perform tile processing if it chooses not to . also by allowing the encoder to specify different n × m shaped tiles , there is a large amount of flexibility with regard to arranging the number and size of the tiles to better support parallel processing and the speed with which encoding may be performed when multiple cores are available . moreover , tiles offer an advantage of decoupling the encoding process from the transmission order in which the bits are transmitted . this allows for better vertical intra prediction as opposed to conventional processes . also , by using parallel tiles allows for better parallization for analysis since there is less constraint on tile shape and no header is required . as further explanation , an advantage of breaking dependency at column boundaries ( vertical boundaries ), is that by dividing a frame vertically provides a smaller penalty on compression performance since a vertical boundary is shorter than a horizontal boundary when a 16 : 9 aspect ratio is the format for display , because motion generally tends to be performed in a horizontal direction . also , parallelization by columns reduces a delay since the data arrives one row at a time from the camera and all available cores can start to work immediately on a new row , as it arrives . thus , partitioning a frame into tiles allows for the more efficient use of available cores to begin immediate processing of data provided from a camera , as compared with conventional approaches using slices or slice groups . also , by using tiles , it is possible to be more flexible in the encoder for performing “ stitching ”. stitching is the collection of arbitrarily shaped rectangles which means that the change in spatial position of sub - pictures by manipulation in the compressed domain may be made possible . tiles also allow for more efficient packetization into ( almost ) fixed - sized packets . thus a packetizer can assemble independent shelves of compressed data ( one per column / row ) into one packet without any backwards dependency to the encoding process . this helps provide autonomy in how data is transmitted from one location to the next for both transmission over separate communication paths , as well as processing independently at the decoder side . as discussed above , allowing for parallization by columns , also provides for finer - grained parallelism and better load balancing amongst processing cores . finally , another advantage of using tiles is that by encoding by smaller widths provides the opportunity to reduce memory bandwidth and internal memory as composed to slice processing or slice groups . moreover , the reduction in memory bandwidth and internal memory may be made available even if a single - core implementation is used . as a summary , below is a list of advantages of dependency breaks at column boundaries : 1 ) dividing a frame vertically gives smaller penalty on compression performance since a vertical boundary is shorter than a horizontal boundary ( assuming 16 : 9 aspect ratio ) and because motion tends to be horizontally . 2 ) parallelization by columns reduces the delay since data arrives one row at a time from the camera , and all cores can start to work immediately as a new row arrives . 3 ) flexibility in the encoder to do “ stitching ” of arbitrarily shaped rectangles , i . e . change the spatial position of sub - pictures by manipulations in the compressed domain . 4 ) more efficient packetization into ( almost ) fixed - sized packets . the packetizer can assemble independent chunks of compressed data ( one per column / row ) into one packet without any backward dependency to the encoder process . 5 ) parallelization by columns provides finer - grained parallelism and better load balancing . 6 ) encoding by smaller widths might reduce the memory bandwidth and internal memory . this is true even for single - core implementations . fig6 is a flowchart showing a method for encoding frames using n × m tiles . the process begins in step s 1 , where a frame is portioned into blocks of pixels . the process then proceeds to step s 3 where the blocks are arranged into n × m tiles . the tiles are grouped independent of the order of transmission of the blocks . the process then proceeds to step s 5 , where the values of n and m are transmitted to the receiving device in the sequence or picture header , but not in a slice or slice group header , recognizing that avc / h . 264 does not support anything but slices or slice groups . the tiles would not be compliant with avc / h . 264 because if the encoder decided to divide the frame into tiles , the decoder would not recognize the format . in a sequence header ( before the first frame — which is part of the video stream , but after the call set up ), the encoder would send the height and width of the tile . this way the decoder would know the size of the tiles . it should be noted that there can also be a pre - assignment of tile shape to type of frame , for example i ( intra frame ), b and p frames . each tile may then be encoded in parallel in step s 7 , where each tile is optionally encoded by a separate processing core . of course a single core can process more than one tile . also , devices with only one core can process all of the tiles . the process then proceeds to step s 9 where the encoded tiles are transmitted to the receiving device . the transmission order can be in the raster scan order even though the tiles may have been encoded in a different order . once transmitted to the decoder at the receiving device , the decoder decodes the tiles in step s 11 with one or more cores . the process then repeats in step s 13 for processing the next frame . fig7 illustrates a computer system 1201 upon which an embodiment of the present invention may be implemented . the computer system 1201 may be programmed to implement a computer based video conferencing endpoint that includes a video encoder or decoder for processing real time video images . the computer system 1201 includes a bus 1202 or other communication mechanism for communicating information , and a processor 1203 coupled with the bus 1202 for processing the information . while the figure shows a signal block 1203 for a processor , it should be understood that the processors 1203 represent a plurality of processing cores , each of which can perform separate tile the computer system 1201 also includes a main memory 1204 , such as a random access memory ( ram ) or other dynamic storage device ( e . g ., dynamic ram ( dram ), static ram ( sram ), and synchronous dram ( sdram )), coupled to the bus 1202 for storing information and instructions to be executed by processor 1203 . in addition , the main memory 1204 may be used for storing temporary variables or other intermediate information during the execution of instructions by the processor 1203 . the computer system 1201 further includes a read only memory ( rom ) 1205 or other static storage device ( e . g ., programmable rom ( prom ), erasable prom ( eprom ), and electrically erasable prom ( eeprom )) coupled to the bus 1202 for storing static information and instructions for the processor 1203 . the computer system 1201 also includes a disk controller 1206 coupled to the bus 1202 to control one or more storage devices for storing information and instructions , such as a magnetic hard disk 1207 , and a removable media drive 1208 ( e . g ., floppy disk drive , read - only compact disc drive , read / write compact disc drive , compact disc jukebox , tape drive , and removable magneto - optical drive ). the storage devices may be added to the computer system 1201 using an appropriate device interface ( e . g ., small computer system interface ( scsi ), integrated device electronics ( ide ), enhanced - ide ( e - ide ), direct memory access ( dma ), or ultra - dma ). the computer system 1201 may also include special purpose logic devices ( e . g ., application specific integrated circuits ( asics )) or configurable logic devices ( e . g ., simple programmable logic devices ( splds ), complex programmable logic devices ( cplds ), and field programmable gate arrays ( fpgas )). the computer system 1201 may also include a display controller 1209 coupled to the bus 1202 to control a display 1210 , such as a cathode ray tube ( crt ), for displaying information to a computer user . the computer system includes input devices , such as a keyboard 1211 and a pointing device 1212 , for interacting with a computer user and providing information to the processor 1203 . the pointing device 1212 , for example , may be a mouse , a trackball , or a pointing stick for communicating direction information and command selections to the processor 1203 and for controlling cursor movement on the display 1210 . in addition , a printer may provide printed listings of data stored and / or generated by the computer system 1201 . the computer system 1201 performs a portion or all of the processing steps of the invention in response to the processor 1203 executing one or more sequences of one or more instructions contained in a memory , such as the main memory 1204 . such instructions may be read into the main memory 1204 from another computer readable medium , such as a hard disk 1207 or a removable media drive 1208 . one or more processors in a multi - processing arrangement may also be employed to execute the sequences of instructions contained in main memory 1204 . in alternative embodiments , hard - wired circuitry may be used in place of or in combination with software instructions . thus , embodiments are not limited to any specific combination of hardware circuitry and software . as stated above , the computer system 1201 includes at least one computer readable medium or memory for holding instructions programmed according to the teachings of the invention and for containing data structures , tables , records , or other data described herein . examples of computer readable media are compact discs , hard disks , floppy disks , tape , magneto - optical disks , proms ( eprom , eeprom , flash eprom ), dram , sram , sdram , or any other magnetic medium , compact discs ( e . g ., cd - rom ), or any other optical medium , punch cards , paper tape , or other physical medium with patterns of holes , a carrier wave ( described below ), or any other medium from which a computer can read . stored on any one or on a combination of computer readable media , the present invention includes software for controlling the computer system 1201 , for driving a device or devices for implementing the invention , and for enabling the computer system 1201 to interact with a human user ( e . g ., print production personnel ). such software may include , but is not limited to , device drivers , operating systems , development tools , and applications software . such computer readable media further includes the computer program product of the present invention for performing all or a portion ( if processing is distributed ) of the processing performed in implementing the invention . the computer code devices of the present invention may be any interpretable or executable code mechanism , including but not limited to scripts , interpretable programs , dynamic link libraries ( dlls ), java classes , and complete executable programs . moreover , parts of the processing of the present invention may be distributed for better performance , reliability , and / or cost . the term “ computer readable medium ” as used herein refers to any medium that participates in providing instructions to the processor 1203 for execution . a computer readable medium may take many forms , including but not limited to , non - volatile media , volatile media , and transmission media . non - volatile media includes , for example , optical , magnetic disks , and magneto - optical disks , such as the hard disk 1207 or the removable media drive 1208 . volatile media includes dynamic memory , such as the main memory 1204 . transmission media includes coaxial cables , copper wire and fiber optics , including the wires that make up the bus 1202 . transmission media also may also take the form of acoustic or light waves , such as those generated during radio wave and infrared data communications . various forms of computer readable media may be involved in carrying out one or more sequences of one or more instructions to processor 1203 for execution . for example , the instructions may initially be carried on a magnetic disk of a remote computer . the remote computer can load the instructions &# 39 ; for implementing all or a portion of the present invention remotely into a dynamic memory and send the instructions over a telephone line using a modem . a modem local to the computer system 1201 may receive the data on the telephone line and use an infrared transmitter to convert the data to an infrared signal . an infrared detector coupled to the bus 1202 can receive the data carried in the infrared signal and place the data on the bus 1202 . the bus 1202 carries the data to the main memory 1204 , from which the processor 1203 retrieves and executes the instructions . the instructions received by the main memory 1204 may optionally be stored on storage device 1207 or 1208 either before or after execution by processor 1203 . the computer system 1201 also includes a communication interface 1213 coupled to the bus 1202 . the communication interface 1213 provides a two - way data communication coupling to a network link 1214 that is connected to , for example , a local area network ( lan ) 1215 , or to another communications network 1216 such as the internet . for example , the communication interface 1213 may be a network interface card to attach to any packet switched lan . as another example , the communication interface 1213 may be an asymmetrical digital subscriber line ( adsl ) card , an integrated services digital network ( isdn ) card or a modem to provide a data communication connection to a corresponding type of communications line . wireless links may also be implemented . in any such implementation , the communication interface 1213 sends and receives electrical , electromagnetic or optical signals that carry digital data streams representing various types of information . the network link 1214 typically provides data communication through one or more networks to other data devices . for example , the network link 1214 may provide a connection to another computer through a local network 1215 ( e . g ., a lan ) or through equipment operated by a service provider , which provides communication services through a communications network 1216 . the local network 1214 and the communications network 1216 use , for example , electrical , electromagnetic , or optical signals that carry digital data streams , and the associated physical layer ( e . g ., cat 5 cable , coaxial cable , optical fiber , etc ). the signals through the various networks and the signals on the network link 1214 and through the communication interface 1213 , which carry the digital data to and from the computer system 1201 maybe implemented in baseband signals , or carrier wave based signals . the baseband signals convey the digital data as unmodulated electrical pulses that are descriptive of a stream of digital data bits , where the term “ bits ” is to be construed broadly to mean symbol , where each symbol conveys at least one or more information bits . the digital data may also be used to modulate a carrier wave , such as with amplitude , phase and / or frequency shift keyed signals that are propagated over a conductive media , or transmitted as electromagnetic waves through a propagation medium . thus , the digital data may be sent as unmodulated baseband data through a “ wired ” communication channel and / or sent within a predetermined frequency band , different than baseband , by modulating a carrier wave . the computer system 1201 can transmit and receive data , including program code , through the network ( s ) 1215 and 1216 , the network link 1214 and the communication interface 1213 . moreover , the network link 1214 may provide a connection through a lan 1215 to a mobile device 1217 such as a personal digital assistant ( pda ) laptop computer , or cellular telephone . ( option 1 ) obviously , numerous modifications and variations of the present disclosure are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . | 7 |
in one embodiment , as shown in fig1 , the buoy - to - sail boat distance indicator system ( system ) 100 has a buoy transmitter 200 and a boat receiver 300 . the buoy transmitter 200 has a transmitter power source 210 , a transmitter central processor unit ( cpu ) 220 , a radio transmitter 240 , an acoustic transmitter 260 , and a speed of sound calibrator 280 . the boat receiver 300 has a receiver power source 310 , a receiver cpu 320 , a radio receiver 340 , an acoustic receiver 360 , and an information display 380 . the transmitter cpu 220 controls the speed of sound calibrator 280 . the speed of sound calibrator 280 provides the transmitter cpu 220 with the speed of sound through water for the operating environment in which system 100 is being used . the speed of sound calibrator 280 , which can be implemented in many ways , measures the speed of sound for the current conditions . one way to implement a speed of sound calibrator would be to measure the temperature , water salinity , and water pressure , and then calculate the speed of sound for those conditions using the appropriate known equations . another way , somewhat more empirically , would be to measure the time for a signal to transit a known distance . the ways for measuring the speed of sound through water are well known to one of average knowledge in the art . the transmitter cpu 220 controls both the radio transmitter 240 and acoustic transmitter 260 . the transmitter cpu 220 causes the radio transmitter 240 to transmit a radio signal 140 and causes acoustic transmitter 260 to transmit an acoustic signal 160 . radio signal 140 and acoustic signal 160 should be omnidirectional signals . in the simplest embodiment transmitter cpu 220 is programmed with the range distance at which the radio signal 140 and acoustic signal 160 should simultaneously arrive . using the calibrated speed of sound , the transmitter cpu 220 computes the transmit time delay . the transmit time delay is the amount of time after sending the acoustic signal 160 at which to transmit the radio signal 140 so that both signals simultaneously arrive at a specified range distance . the transmitter cpu 220 causes the acoustic transmitter 260 to send immediately the acoustic signal 160 , and then at transmit time delay later causes the radio transmitter 240 to send immediately the radio signal 140 . just as the transmitter cpu 220 drives both radio transmitter 240 and acoustic transmitter 260 , the receiver cpu 320 listens to both the radio receiver 340 and acoustic receiver 360 . in the simplest embodiment , receiver cpu 320 observes which signal , radio signal 140 or acoustic signal 160 , arrives first . if acoustic signal 160 arrives first , receiver cpu 320 then knows the range result that boat receiver 300 is closer to buoy transmitter 200 than the specified range distance . if the radio signal 140 arrives first , receiver cpu 320 then knows the range result that boat receiver 300 is farther from buoy transmitter 200 then the specified range distance . the receiver cpu 320 displays range result on the information display 380 . in the simplest embodiment the information display could be just a light which turns on or off when the range result is that boat receiver 300 is closer to buoy transmitter 200 than the specified range distance . or the light could turn on or off when the range result is that the boat receiver 300 is farther from the buoy transmitter 200 than the specified range distance . or the information display could be two lights , a first light for when the range result is that boat receiver 300 is closer to buoy transmitter 200 than the specified range distance , and a second light for when the boat receiver 300 is farther from buoy transmitter 200 than the specified range distance . or , the information display 380 could be a text message saying “ less than ” or “ greater than ,” as appropriate . or the information display could use audio signals vice visual signals . in an alternative embodiment , the transmitter cpu 220 can use the radio transmitter 240 to send the speed of sound information to the receiver cpu 320 via radio signal 140 and radio receiver 340 . in this embodiment , receiver cpu 320 measures the received time delay between arrival of the radio signal 140 and the acoustic signal 160 . using the speed of sound and received time delay , the receiver cpu 320 can then compute the measured range distance and sign ( i . e ., plus or minus ) which the boat receiver 300 is from the specified range distance . the measured range distance can be shown on the information display 380 as appropriate . as a special case of this alternative embodiment , when the specified range distance is set to zero , the measured range distance will be the distance from the buoy transmitter 200 to the boat receiver 300 . in yet another alternative embodiment , boat receiver 300 will have a plurality of acoustic receivers 360 . by knowing the relative positions of each acoustic receiver 360 , the receiver cpu 320 can use the different arrival times for acoustic signal 160 at each acoustic receiver 360 to determine the relative direction from boat receiver 300 to buoy transmitter 200 . the details of how to do such calculations are well known to one of average knowledge in the art . the unambiguous range is the range under which , in the simplest embodiment , the two correlated signals ( radio signal 140 and acoustic signal 160 ), will have been received at the boat receiver 300 before the next radio signal 140 is received . this range is determined by the time between radio transmissions and the speed of sound for the operating environment . the rate at which the system 100 can measure the distance between transmitter 200 and receiver 300 is also determined by the time between radio transmissions . in an alternative embodiment , the concept of staggered pulse repetition intervals , well known to one of average knowledge in the art in the area of traditional radar , can be applied to this system 100 so as to provide an alternative method for either increasing the unambiguous range , or increasing rate at which the distance measurements are made , or some combination there of . transmitter power source 210 powers all other parts of buoy transmitter 200 . receiver power supply 310 powers all other parts of boat receiver 300 . transmitter power 210 and receiver power 310 can be any sort of electrical storage or generation source . in this system 100 the buoy transmitter 200 is not interrogated in any way by boat receiver 300 . one buoy transmitter 200 can service an unlimited number of boat receivers 300 . depending on the method of implementation , speed of sound calibrator 280 may or may not have parts in common with acoustic transmitter 260 . system 100 components , especially the housings for buoy transmitter 200 and boat receiver 300 , should be brightly colored such that they can be easily seen . for example , buoys normally used during sailboat races are brightly colored so that they can be easily seen . thus , for the same reasons , buoy transmitter 200 should be brightly colored . having boat receiver 300 brightly colored can facilitate people being able to see that a sailboat has a boat receiver 300 . also , for both buoy transmitter 200 and boat receiver 300 , should either fall into the water , having them brightly colored will make them easier to see by people trying to find them . because the radio signal 140 travels over the water &# 39 ; s surface and the acoustic signal 160 travels below the water &# 39 ; s surface , the operations of system 100 can be identified as radio over audio below , and abbreviated to create the word roab . a buoy - to - sailboat distance indicator system 100 for determining the distance between a buoy and a boat both floating in a common body of water , has a buoy transmitter 200 and at least one boat receiver 300 . the buoy transmitter 200 , deployed on the floating buoy , has a speed of sound calibrator 280 for producing a measurement of the speed of sound through the body of water , a radio transmitter 240 for producing a radio signal 140 transmitted through the air above the body of water , an acoustic transmitter 260 for producing an acoustic signal 160 transmitted through the body of water , and a transmitter cpu 220 . the transmitter cpu 220 receives the measurement of the speed of sound , calculates the trigger times , and triggers the radio transmitter 240 and the acoustic transmitter 260 to transmit respectively the radio signal 140 above , and acoustic signal 160 through , the body of water such that both simultaneously arrive at a predetermined distance across the body of water . a boat receiver 300 , deployed on a boat , has a radio receiver 340 for receiving the radio signal 140 transmitted through the air above the body of water , an acoustic receiver 360 for receiving the acoustic 160 signal transmitted through the water , a receiver cpu 320 for determining the relative arrival time between the radio signal 140 and the acoustic signal 160 , and determining thereby the distance of the boat from the buoy relative to the predetermined distance . an information display 380 displays the distance information about the distance of the boat receiver 300 from the buoy transmitter 200 relative to the predetermined distance . in an alternative embodiment a buoy - to - sailboat distance indicator system 100 for determining the distance between a buoy and a boat , both floating in a common body of water , has a buoy transmitter 200 and a boat receiver 300 . the buoy transmitter 200 deployed on the buoy has a speed of sound calibrator 280 for producing a measurement of the speed of sound through the body of water , a radio transmitter 240 for producing both a radio signal 140 transmitted through the air above the body of water and for transmitting the measurement of the speed of sound , an acoustic transmitter 260 for producing an acoustic signal 160 transmitted through the body of water , and a transmitter cpu 220 . the transmitter cpu 220 receives the measurement of the speed of sound , calculates the trigger times and triggers the radio transmitter 240 and the acoustic transmitter 260 to transmit respectively their radio signal 140 above , and acoustic signal 160 through , the body of water such that both simultaneously arrive at a predetermined distance across the body of water . the boat receiver 300 has a radio receiver 340 for receiving both the radio signal 140 transmitted through the air above the body of water and the transmitted measurement of the speed of sound , an acoustic receiver 360 for receiving the acoustic signal 160 transmitted through the body of water , a receiver cpu 320 for determining the relative arrival time between the radio signal 140 and acoustic signal 160 , and determining thereby the distance and sign of distance of the boat receiver 300 from the buoy transmitter 200 and from the predetermined distance . an information display 380 displays the distance and the sign of distance of the boat receiver 300 from the buoy transmitter 200 and from the predetermined distance . although various preferred embodiments of the present invention have been described herein in detail to provide for complete and clear disclosure , it will be appreciated by those skilled in the art , that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims . | 0 |
as is well known , the coronary artery branches off the aorta and is positioned along the external surface of the heart wall . oxygenated blood flows from the heart to the aorta , and on to the rest of the body , some of the blood flowing into the coronary artery . in some individuals , plaque builds up within the coronary artery , blocking the free flow of blood and causing complications ranging from mild angina to heart attack and death . in order to restore the flow of oxygenated blood through the coronary artery , bypass surgery is performed . one or more venous segments are used to join the aorta and a site in the coronary artery distal to the blockage . the inserted vascular segments act to bypass the blocked portion of the coronary artery and thus provide for a free or unobstructed flow of oxygenated blood from the heart . to perform the bypass , an incision is made through the patient &# 39 ; s sternum ( sternotomy ), and the patient is placed on a bypass pump so that the heart and surrounding vessels can be operated on while not beating . typically , a saphenous vein graft is harvested from the patient &# 39 ; s leg , and the bypass graft is anastomosed to the aorta and to the coronary artery . it should be understood , however , that other arterial or venous segments may be used to perform the bypass and that other blocked vessels may be bypassed . the term “ vascular graft ” as used herein refers to any such venous or arterial segment used in any bypass procedure . [ 0019 ] fig1 illustrates a human heart having a saphenous vein graft vg attached to the aorta ao and to the coronary artery ca at a site distal to the blockage bl in the coronary artery ca . as noted above , over time , the vein graft vg itself may become diseased , stenosed , or occluded , and intervention is necessary to once again restore the flow of oxygenated blood through the coronary artery ca . [ 0020 ] fig2 illustrates means for bypassing the blockage bl in the coronary artery , as well as in the vein graft vg . a conduit 10 is positioned in the heart wall or myocardium myo . although the bypass described herein is from the left ventricle of the heart to the coronary artery , it should be understood that this is merely exemplary . the principles of the present invention are not limited to left ventricular conduits , and include conduits for communicating bodily fluids from any space within a patient to another space within a patient , including any mammal . furthermore , such fluid communication through the conduits is not limited to any particular direction of flow and can be antegrade or retrograde with respect to the normal flow of fluid . moreover , the conduits may communicate between a bodily space and a vessel or from one vessel to another vessel ( such as an artery to a vein or vice versa ). moreover , the conduits can reside in a single bodily space so as to communicate fluids from one portion of the space to another . for example , the conduits can be used to achieve a bypass within a single vessel , such as communicating blood from a proximal portion of an occluded coronary artery to a more distal portion of that same coronary artery . in addition , the conduits and related methods can preferably traverse various intermediate destinations and are not limited to any particular flow sequence . for example , in one preferred embodiment of the present invention , the conduit communicates from the left ventricle , through the myocardium , into the pericardial space , and then into the coronary artery . however , other preferred embodiments are disclosed , including direct transmyocardial communication from a left ventricle , through the myocardium and into the coronary artery . thus , as emphasized above , the term “ transmyocardial ” should not be narrowly construed in connection with the preferred fluid communication conduits , and other non - myocardial and even non - cardiac fluid communication are preferred as well . with respect to the walls of the heart ( and more specifically the term “ heart wall ”), the preferred conduits and related methods are capable of fluid communication through all such walls including , without limitation , the pericardium , epicardium , myocardium , endocardium , septum , etc . the bypass which is achieved with certain preferred embodiments and related methods is not limited to a complete bypass of bodily fluid flow , but can also include a partial bypass which advantageously supplements the normal bodily blood flow . moreover , the occlusions which are bypassed may be of a partial or complete nature , and therefore the terminology “ bypass ” or “ occlusion ” should not be construed to be limited to a complete bypass or a complete occlusion but can include partial bypass and partial occlusion as described . the preferred conduits and related methods disclosed herein can also provide complete passages or partial passages through bodily tissues . in this regard , the conduits can comprise stents , shunts , or the like , and therefore provide a passageway or opening for bodily fluid such as blood . moreover , the conduits are not necessarily stented or lined with a device but can comprise mere tunnels or openings formed in the tissues of the patient . the conduits of the present invention preferably comprise both integral or one - piece conduits as well as plural sections joined together to form a continuous conduit . the present conduits can be deployed in a variety of methods consistent with sound medical practice including vascular or surgical deliveries , including minimally invasive techniques . for example , various preferred embodiments of delivery rods and associated methods may be used . in one embodiment , the delivery rod is solid and trocar - like . it may be rigid or semi - rigid and capable of penetrating the tissues of the patient and thereby form the conduit , in whole or in part , for purposes of fluid communication . in other preferred embodiments , the delivery rods may be hollow so as to form the conduits themselves ( e . g ., the conduits are preferably self - implanting or self - inserting ) or have a conduit mounted thereon ( e . g ., the delivery rod is preferably withdrawn leaving the conduit installed ). thus , the preferred conduit device and method for installation is preferably determined by appropriate patient indications in accordance with sound medical practices . the conduit 10 , as illustrated in fig2 preferably extends from the left ventricle lv of the heart to the coronary artery ca at a site that is distal to the site of the blockage bl . the conduit 10 is preferably made of a biocompatible material such as titanium , titanium alloys , nickel alloys , or a biocompatible polymer . if desired , the conduit 10 can incorporate a valve that allows blood to flow freely from the left ventricle lv to the coronary artery ca but prevents the backflow of blood from the coronary artery 10 to the heart . further details regarding conduits and conduit delivery systems are described in copending patent applications entitled delivery methods for left ventricular conduit [ attorney docket no . percar . 003cp1 ], designs for left ventricular conduit [ attorney docket no . percar . 013a ], left ventricular conduit with blood vessel graft [ attorney docket no . percar . 005a ], valve designs for left ventricular conduit [ attorney docket no . percar . 006a ], left ventricular conduits to coronary arteries and methods for coronary bypass [ attorney docket no . percar . 033cp1 ], and blood flow conduit delivery system and method of use [ attorney docket no . percar . 040a ], all filed on the same day as the present application , and u . s . pat . no . 5 , 429 , 144 , and u . s . pat . no . 5 , 662 , 124 , the disclosures of which are all hereby incorporated by reference in their entirety . in order to bypass the blockages in both the coronary artery ca and the vein graft vg , thereby providing for enhanced blood flow in the patient , the conduit 10 must be positioned at a site which is downstream or distal to the blockage bl in the coronary artery ca and the attachment site of the vein graft vg to the coronary artery ca . this allows oxygenated blood to flow directly from the left ventricle lv of the heart into the coronary artery ca and on to the rest of the body without encountering the blockage bl and without having to travel through the blocked vein graft vg . although some proximal flow may occur through the vein graft , it is advantageous to place the conduit in a position which completely bypasses the blockage ( s ). the preferred positioning of the conduit 10 is illustrated in fig2 . fig3 a - 3 c depict a preferred method for delivery of the conduit 10 into the myocardium myo . although the figures illustrate the delivery of the conduit 10 percutaneously , it should be appreciated that the percutaneous approach is not essential to achieve many objects of the present invention , and therefore , an open - chest or other approach can also be used . in the preferred embodiment illustrated , the conduit 10 is delivered percutaneously , through the aorta ao and through the vein graft vg , thereby ensuring that both the original blockage bl in the coronary artery ca and the vein graft vg itself are bypassed . other methods of delivery of the conduit 10 through the vein graft vg to a site in the myocardium myo past both the blockage bl in the coronary artery ca and the site of attachment of the vein graft vg are also contemplated . the conduit 10 is first mounted on the distal end of a steerable delivery catheter 12 ( fig3 a ). the catheter 12 is delivered into the patient &# 39 ; s vasculature , such as through the femoral artery in the thigh , and through the aorta ao until it reaches the site of attachment of the vein graft vg . the catheter 12 is then delivered through the vein graft vg and into the coronary artery ca . the distal end of the catheter 12 is positioned adjacent the desired insertion point in the myocardium myo . the conduit 10 is then inserted into the myocardium myo , such that one end of the conduit 10 is positioned in the left ventricle lv of the heart , and the other end is positioned in the coronary artery ca ( fig3 b ). methods of conduit delivery are described in detail in the above - referenced copending application delivery methods for left ventricular conduit [ attorney docket no . percar . 003cp1 ], and in u . s . pat . no . 5 , 429 , 144 and u . s pat . no . 5 , 409 , 019 , all of which are hereby incorporated by reference in their entirety . the conduit 10 therefore provides for the shunting of oxygenated blood directly from the left ventricle lv of the heart into the coronary artery ca . the conduit 10 can include anchoring means such as hooks , barbs , flanges or collars , or can be sutured , stapled or otherwise anchored in place to prevent conduit migration . the position of the conduit can be checked radiographically , and adjusted if necessary . as illustrated in fig3 c , after the conduit 10 has been properly positioned in the myocardium myo , the delivery catheter 12 is withdrawn from the patient . another embodiment of the present invention is illustrated in fig4 a - d . in this embodiment , an existing vascular graft is provided with a new , biocompatible lining , which allows for the free passage of blood therethrough . the lining can be formed of any biocompatible material , such as various polymers , but is preferably formed from a section of blood vessel , such as a vein , taken from the patient . the section of vein or other blood vessel harvested preferably contains one or more one - way valves , which occur naturally in the veins . in a preferred embodiment , the new vein section used to line the existing graft is obtained from the saphenous vein in the patient . of course a blood vessel taken from a human or animal donor could also be used . for example , a fetal pig or piglet could be obtained and dissected to remove a section of the pulmonary artery having a pulmonic valve therein , or a section of the aorta having an aortic valve , or any other similar vessel having a naturally occurring valve system . the vein section harvested is preferably sized so as to be approximately the same length as the original vein graft vg , but other lengths are also contemplated . the natural vein is biocompatible and therefore reduces the occurrence of problems associated with rejection and clotting . in addition , the vein section provides a natural valve system that is already in use throughout the body to prevent the backflow of blood . after the vein section has been harvested , it is mounted on the distal end of a catheter for insertion into the patient , as described below . turning now to fig4 a , there is illustrated a steerable delivery catheter 20 having an inner lumen . a vein section 22 obtained as described above is mounted on the distal end of a second catheter 24 , which is inserted through the lumen of the delivery catheter 20 . the second catheter 24 preferably has an inflatable balloon 26 mounted on its distal end , over which the vein section 22 is concentrically mounted . inflatable catheters are well known to these of skill in the art , and can be readily obtained from various commercial sources . the delivery catheter 20 and second catheter 24 are preferably delivered together into the patient &# 39 ; s vasculature , such as through the femoral artery in the thigh , and through the aorta ao until they reach the site of attachment of the vein graft vg . the second catheter 24 bearing the vein section 22 is then delivered through the vein graft vg , as illustrated in fig4 b . after the new vein section 22 , mounted on the distal end of the second catheter 24 , is delivered into the vein graft vg , the delivery catheter 20 is withdrawn , as illustrated in fig4 c . the second catheter 24 and new vein section 22 remain in position inside the vein graft vg . the balloon 26 at the distal end of the second catheter 24 is inflated as shown in fig4 d . expansion of the balloon 26 forces the new vein section 22 against the interior of the existing vein graft vg , expanding the interior lumen in both the existing graft vg and the new vein section 22 , opening a new passage for blood to flow through the vein graft vg . the balloon 26 is deflated , and the second catheter 24 is withdrawn from the patient , leaving the existing vein graft vg with a new vein lining , as illustrated in fig4 e . preferably , the new vein section 22 is attached to the existing vein graft vg or to the aorta ao at one end and to the coronary artery ca at the other end . the new vein section 22 can be attached by sutures , staples , or other attachment means . the embodiments illustrated and described above are provided merely as examples of certain preferred embodiments of the present invention . changes and modifications can be made to the embodiments presented herein by those skilled in the art without departure from the spirit and scope of the invention , as defined by the claims which follow . | 0 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig1 shows a functional view for illustrating a typical structure for mounting an antenna on a mobile vehicle , and particularly for illustrating a satellite broadcasting reception under the concept that a mobile vehicle 12 such as a moving vehicle receives signals for the satellite broadcasting or satellite communication . an antenna radome 14 receives satellite radio waves 13 from a satellite 11 . an active antenna signal processor 15 receives the satellite radio waves from the antenna radome 14 and performs a satellite tracking calculation . a satellite broadcasting receiver 16 processes the signals from the active antenna signal processor 15 and then transfers recovered information to users through tv monitor 17 . fig5 shows a structure of an active channel antenna system of a mobile comprising an antenna radome 51 and an active antenna signal processor 52 according to the present invention . the antenna radome 51 comprises m active channel sub - modules 511 , 512 , 513 and 514 divided into 4 groups , 4 signal power combiners 515 , 516 , 517 and 518 , a beam forming block 519 , a rotation power supply 520 , a tracking signal converter 521 , a beam steering control 522 , a rotation platform 530 , a rotary jointer 523 , a frequency converter 524 and a driving control 528 . the active antenna signal processor 52 comprises a satellite tracking processor 527 , an electronic compass sensor 526 and a power supply module 525 . the antenna radome 51 receives signals from the satellite and then transmits them to the m active channel sub - modules divided into 4 groups . primary beams of double beams are formed in active module channels through a reception signal low - noise amplifier , a phase delay control , a phased array and a power control . on one hand , each of the active channel sub - modules is divided into 4 groups 511 , 512 , 513 and 514 and each of the group is connected to the signal power combiners 515 , 516 , 517 and 518 respectively . the 4 signals from the signal power combiners are transmitted to the beam forming block 519 . the 4 satellite signals transmitted to the beam forming block 519 are distributed into two parts . one part of the signals forms secondary beam of the double beam through the low noise amplifier , the phase delay control , the phased array , the power control and the signal power combiner , and then transmitted to the tracking signal converter 521 . in addition , the other part of the signals is connected to the signal power combiner and then transmitted to a rotary jointer 523 . the satellite information signals transmitted to the rotary jointer 523 are converted into intermediate frequencies in the frequency converter 524 and then provided to a satellite broadcasting receiver 54 through a band pass filter . the receiver recovers the information and then provides them to users through a tv monitor 55 . the tracking signal converter 521 which receives the satellite signals transmitted together with the secondary beam detects magnitudes of the satellite tracking information signals and then transmits the information to the beam steering controller 522 . the beam steering controller 522 transmits the information to the satellite tracking processor 527 of the active antenna signal processor 52 through the rotary jointer 523 . a program in the satellite tracking processor 527 calculates the information together with information processing results of the movement of the mobile sensed through an electronic compass sensor 526 and then provides azimuth angle , elevation angle and tracking speed informations of the satellite positions . the azimuth angle and velocity information are provided to a driving controller 528 . the driving control 528 controls and monitors the azimuth angle driving motor 529 to preform one - dimensional azimuth angle control proper to the related informations . the elevation angle information is provided to the beam steering controller 522 . the beam steering controller 522 performs calculations for forming beams in order to control a desired one - dimensional elevation angle and then calculates phase delay value codes of the double beams assigned to the angular phase shifter . the assigned phase delay value codes are transmitted to the active channel sub - modules 511 , 512 , 513 and 514 and beam forming block 519 for controlling the one - dimensional elevation angle , forming beams and adjusting beam steerings . power from a vehicle power supply 53 is supplied to a power supply module 525 of the active antenna signal processor 52 and then supplied to each parts . for example , power is supplied to the rotation power supply 520 through the rotary jointer 523 and then supplied to each required parts on the rotation platform 530 . the driving motor 529 operates the rotation platform 530 , controlling the azimuth angle of the active antenna one - dimensionally . m active channel sub - modules 511 , 512 , 513 and 514 divided into 4 groups , 4 signal power combiners 515 , 516 , 517 and 518 , the beam forming block 519 , the tracking signal converter 521 , the beam steering controller 522 and the rotation power supply 520 are mounted on the rotation platform 530 . the rotary jointer 523 continuously transmits and supplies the satellite reception signals , the angular control signals and supply power without a stop in a relative rotation state of a fixed part of the antenna radome 51 and a rotating part on the rotation platform 530 . the electronic compass sensor 526 provides three axis posture informations of an absolute steering and a forward declination of the mobile at the moment that the measurement is demanded , and a side declination . fig6 shows an active channel sub - module of a mobile active channel antenna system according to the present invention . the active channel sub - module comprises n - i radiation sub - arrays 606 , 602 , 603 and 604 , n - i primary low noise amplifiers 605 , 606 , 607 and 608 , a signal power combiner 609 , a secondary low noise amplifier 613 , a phase shifter 611 , a ( phase shifter ) driver 612 and a signal power attenuator 610 , where i is 0 or a integer number smaller than n - 1 for example , n - i is 4 . the signals transferred to the antenna radome 51 of fig1 are transmitted to the radiation sub - arrays 601 , 602 , 603 and 604 of the active channel sub - module . the radiation sub - arrays 601 , 602 , 603 and 604 are fixed phased array antenna consisted of a coupling of p unit antenna elements which are in - phase delayed . the satellite signals added gains in the radiation sub - arrays 601 , 602 , 603 and 604 are amplified to low noise in primary low noise amplifiers 605 , 606 , 607 and 608 and ensure performance of antenna gains to noise constants . the amplified signals are connected to the signal power combiner 609 , losses of the signal gains are recovered in the secondary low noise amplifier 613 and then the signals are delayed in the phase shifter 611 to have required phases . the signal power attenuator 610 compensates the delayed signals for their gain differences among m active channel sub - modules . an output from the signal power attenuator 610 is provided to the signal power combiner ( 515 to 518 of fig5 ). the ( phase shifter ) driver 612 receives phase delay codes from the beam steering control ( 522 of fig5 ) and controls the phase of the phase shifter 611 to a specific value . fig7 shows a structure of a beam forming block of an active channel antenna system according to the present invention . the beam forming blocking comprises 4 low noise amplifiers 701 , 702 , 703 and 704 , 4 phase shifters 705 , 706 , 707 and 708 , 4 ( phase shifter ) drivers 709 , 710 , 711 and 712 , and 2 signal power combiners 713 and 714 . when signals from the satellite arrive at the antenna radome ( 51 of fig5 ), the active channel sub - modules 511 , 512 , 513 and 514 control phase delays of the signals in order to form a primary beam of the double beams . the signals are divided into 4 groups and then transmitted to the beam forming blocks . the signals from the signal power combiners 515 , 516 , 517 and 518 are compensated for their gain losses and distributed to low noise amplifiers 701 to 704 . first , one of the signals is phase - shifted to form a secondary beam of the double beam through the phase shifter 705 , coupled with three phase delayed satellite signals of the secondary beam from other groups through the first signal power combiner 713 and then provided as secondary beam signals 119 . on the other hand , the other distributed signals are coupled with three satellite signals from other groups through the second signal power combiner 714 and then provided as satellite broadcasting signals 716 received in the antennas . fig8 shows a functional view for illustrating a structure of a phased array according to the present invention . first , the satellite signals are excited to a radiation sub - array of the phased array structure . the radiation sub - arrays are arranged on a plane orienting to the satellite . an arrayed structure of the radiation sub - arrays are determined by the following rules on the basis of the magnitude of the antenna to be manufactured . that is , the antenna is constructed to a circle and the magnitude of the circle is determined by the gain . n radiation sub - arrays are arranged sequentially and regularly in an inside of the circle . each of the radiation sub - arrays are arrayed in a certain length 801 dx and a width 802 dy . the radiation sub - arrays of the antenna have g columns and h rows . the radiation sub - arrays are divided into 4 groups of the phased array unit areas of double beams 803a , 803b , 803c and 803d , and each groups has equal radiation sub - arrays for satisfying the rules and being included in an inside of the circle . each rows of the groups constitutes the m active channel sub - modules ( see fig6 ). the number of the radiation sub - arrays in each columns 804 , 805 , 806 , 807 and 808 of the groups satisfies n - i rule . n is equal to the number of the radiation sub - arrays of the longest column in the groups and i is an arbitrary number which makes the number n - i of the radiation sub - arrays in each column to be a maximum . fig9 shows a functional view for illustrating a method for forming a double beam according to the present invention . a primary beam of the double beam is a satellite forward steering beam and a secondary beam is a tracking beam . if satellite steering informations from a satellite tracking processor 91 are provided to a beam steering control 92 , the beam steering control 92 provides codes to the ( phase shifter ) driver of each active channel sub - modules and the signals through the phase shifter are delayed by a certain phase , forming the primary beam . if the reception magnitude of the secondary beam signal 94 is detected in a tracking signal converter 93 and satellite tracking error signals 95 are provided to the satellite tracking processor 91 through the beam steering control 92 , a program calculates them and then provides codes to the beam steering control 92 , reforming the secondary beam . the codes are transmitted to the ( phase shifter ) driver of the beam forming block and the phase of the primary beam signal transmitted through the phase shifter therefrom is additionally delayed , forming the secondary beam . fig1 shows a functional view for illustrating a secondary beam steering of an active antenna system of a mobile according to the present invention . as shown in the drawing , the secondary beam sequentially produces secondary beam steering patterns each having different steerings by assigning delay phases + 45 , + 45 , - 45 and - 45 degrees to 4 unit area of the phased array of the secondary beam and then sequentially altering them to a time interval t according to the tracking sequence . fig1 shows a functional view for illustrating a double beam pattern of an active antenna system of a mobile vehicle according to the present invention . an initial actual satellite steering is in coordinates ( uo , vo )=( o , o ) and if the primary beam has a steering effective area ( 111 ) of a db , the secondary beam having a tracking effective area of b db shifts steering center coordinates ( u , v ) of the secondary beam steering patterns 112a , 112b , 112c and 112d in a sequence illustrated in fig1 based on an a db steering effective area track of the primary beam . if the coordinates of the actual satellite are shifted to ( u &# 39 ;, v &# 39 ;), the magnitudes of the satellite signals received in the secondary beam steering patterns 112a , 112b , 112c and 112d are different . the shifted values ( u &# 39 ;, v &# 39 ;) of the satellite are calculated from the differences and the center coordinates of the primary beam are shifted from ( o , o ) to ( u &# 39 ;, v &# 39 ;). such a procedure is repeated several times for continuous satellite tracking . fig1 shows a flow chart for illustrating a satellite tracking method according to the present invention . the satellite tracking is performed by applying an electronic compass sensor using the double beam satellite tracking and absolute steering sensing , and also using a satellite initialization program , a satellite initial tracking program , an antenna measurement automatic tracking program and a satellite repeated tracking program . first , the system is initialized at a step 121 . the initialized system performs open loop tracking which applies the electronic compass sensor in an initial tracking of the satellite , and thus tracks the satellite initial position at a step 122 . it is first confirmed whether signals are detected at a step 123 . if the signals are detected and a position of the satellite is captured , the antenna measurement automatic tracking which applies the double beam satellite tracking as a closed loop tracking is repeatedly performed at a step 125 . if the signals are not detected , i . e ., if the satellite initial tracking fails for a certain time , the operation is stopped on an emergency according to the determination of the user at a step 124 . then it is secondarily confirmed whether the signals are sensed at a step 126 . if the signals are not sensed and thus the satellite tracking is failed , the satellite repeated tracking is performed as an open loop tracking which applies an electronic compass sensor at a step 127 . if the signals are detected as a result of the confirmation and thus the satellite tracking succeeds , the process proceeds to an antenna measurement automatic tracking step 125 . it is confirmed in the third time whether the signals are detected at a step 128 . if the signals are detected and thus the satellite tracking is succeeded , the step proceeds to the antenna automatic tracking step 125 . if the signals are not detected and thus the satellite tracking has failed , the process proceeds to the satellite initial tracking step 122 . as described above , there are effects according to the present invention as follows . first , both of the one - dimensional array control of an elevation angle and one - dimensional mechanical control of an azimuth angle are used , providing an economical and effective system to a two - dimensional satellite array antenna , and an improved performance of a satellite tracking velocity to a two - dimensional mechanical control antenna . second , compared with the conventional mono pulse tracking method which divides gain with a single beam pattern and then performs satellite tracking , the present invention improves tracking gain loss by using a secondary beam and thus providing a variable active high speed satellite tracking function and a secondary beam gain corresponding to a primary beam gain . third , the present invention improves inaccuracy of tracking position determination which can be occurred in an one - dimensional step tracking mode by using two - dimensional tracking with a double beam . fourth , the present invention improves the system such that it becomes an economical and effective system having the same performance by reducing the number of control elements compared with the system which controls the phase of the unit antenna elements by controlling the phase using radiation sub - array for phased array control . fifth , the present invention improves fixation of a structure of a conventional system array by applying freely the gain and magnitude of the desired antenna using a variable phased array of the radiation sub - array . sixth , the present invention prevents that the satellite tracking effects actual satellite information reception as a conventional actual satellite information reception uses the same beam in satellite tracking since the primary beam of the double beam tracks only the actual satellite information reception and the secondary beam tracks only the satellite . seventh , the present invention reduces a necessary recovering time after the failure of the initial satellite tracking and steering control which measures the relative steering from angular rate using the conventional angular rate sensor by using the electronic compass sensor which senses an absolute steering and 3 axis angle variation for satellite tracking . it will be apparent to those skilled in the art that various modification and variations can be made in a structure of an active antenna system of a mobile and a satellite tracking method with the system of the present invention without departing from the spirit or scope of the inventions . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents . the foregoing description , although described in its preferred embodiment with a certain degree of particularity , is only illustrative of the principles of the present invention . it is to be understood that the present invention is not to be limited to the preferred embodiments disclosed and illustrated herein . accordingly , all expedient variations that may be made within the scope and the spirit of the present invention are to be encompassed as further embodiments of the present invention . | 7 |
the following example describes a processing system capable of achieving the following actions : rapid depressurization to vacuum and repressurization to atmospheric or greater pressure ; rapid temperature fluctuation : and ionic cleaning . the result of these actions separates lignocellulosic fiber into its various molecular components : cellulose , hemicelluloses , and lignin . the system is consists of an ionic generator with fan 1 attached to ion reservoir 2 . the ionic generator 1 blows charged or ionized air into the reservoir 2 , which is attached to temperature manipulation vessel 4 by pipe 3 . temperature manipulation vessel 4 is capable of heating of chilling the ionized air by means of coils within the vessel . pipe 5 runs between temperature manipulation vessel 4 and vacuum reaction chamber 6 , which is supported by structural stand 7 . pipe 5 is equipped with a valve . reaction chamber 6 is attached to vacuum draw down tank 9 by pipe 8 with valve . vacuum in vacuum draw down chamber 9 is pulled by vacuum pump 10 . the system is operated in the following manner . first , ionic generator 1 is started building concentrated reserved in ion reservoir 2 and temperature manipulation vessel 4 . at the same time vacuum pump 10 is switched on to draw down vacuum tank 9 . the valves on pipes 5 and 8 are closed in order to concentrate the ions in ion reservoir 2 and create the vacuum within the vacuum draw down tank 9 . next , lignocelfulosic fiber is placed in reaction chamber 6 . the material is exposed to heat and mechanical rotation by common art . when vacuum is achieved in draw down tank 9 the valve on pipe 8 is opened rapidly creating a vacuum in reaction chamber 6 . once vacuum is achieved in reaction chamber 6 the valve on pipe 8 is closed . the vacuum is maintained in reaction chamber 6 . the rapid depressurization shocks the lignocellulosic fiber causing it to swell . the vacuum accelerates the drying process . next , the valve on pipe 5 is opened allowing the ionized air from ionic reservoir 2 and temperature manipulation vessel 4 to rapidly repressurize reaction chamber 6 . a secondary valve or pipe 8 may be opened allowing the ionized air to gradually flow through the reaction chamber for a period of time . the vacuum and repressurization process facilitates the diffusion and penetration of the ionized air into the lignocellulosic fiber . the ionized air may either be chilled or heated depending on the processing parameters . heating and chilling is controlled in temperature manipulation vessel 4 . heated air helps the transfer of ions arid facilitates the cleaning of the cellulose fiber . a rapid temperature drop through exposure to chilled air cracks the gums that surround the cellulose fiber making it more accessible to the cleaning action of the ionized air . the general process described in this invention may be repeated as many times as is necessary to achieve the desired degree of processing . when the process is completed cellulose fiber , lignin , and the various gums may be collected through a variety of methods that are commonly known . recovered cellulose fiber may be utilized for textile applications . or , the carbohydrate portion , the cellulose and hennicelluloses , may be subjected to further treatment for biofuels production . it will be understood that the previous example serves to illustrate one possible means of achieving the actions and objectives of this invention . although a few exemplary embodiments of the present invention have been shown and described , the present invention is not limited to the described exemplary embodiments . instead , it would be appreciated by those skilled in the art that changes may be made to these exemplary embodiments without departing from the principles and spirit of the invention , the scope of which is defined by the claims and their equivalents . the terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used in the description of the embodiments of the invention and the appended claims , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . unless otherwise defined , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . all publications , patent applications , patents , and other references mentioned herein are incorporated by reference in their entirety . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . it will be understood that relative terms are intended to encompass different orientations of the device in addition to the orientation depicted in the figures . moreover , it will be understood that although the terms first and second are used herein to describe various features , elements , regions , layers and / or sections , these features , elements , regions , layers and / or sections should not be limited by these terms . these terms are only used to distinguish one feature , element , region , layer or section from another feature , element , region , layer or section . thus , a first feature , element , region , layer or section discussed below could be termed a second feature , element , region , layer or section , and similarly , a second without departing from the teachings of the present invention . it will also be understood that when an element is referred to as being “ connected ” or “ coupled ” to another element , it can be directly connected or coupled to the other element or intervening elements may be present . in contrast , when an element is referred to as being “ directly connected ” or “ directly coupled ” to another element , there are no intervening elements present . further , as used herein the term “ plurality ” refers to at least two elements . additionally , like numbers refer to like elements throughout . thus , there has been shown and described several embodiments of a novel invention . as is evident from the foregoing description , certain aspects of the present invention are not limited by the particular details of the examples illustrated herein , and it is therefore contemplated that other modifications and applications , or equivalents thereof , will occur to those skilled in the art . the terms “ having ” and “ including ” and similar terms as used in the foregoing specification are used in the sense of “ optional ” or “ may include ” and not as “ required ”. many changes , modifications , variations and other uses and applications of the present construction will , however , become apparent to those skilled in the art after considering the specification and the accompanying drawings . all such changes , modifications , variations and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention which is limited only by the claims which follow . the scope of the disclosure is not intended to be limited to the embodiments shown herein , but is to be accorded the full scope consistent with the claims , wherein reference to an element in the singular is not intended to mean “ one and only one ” unless specifically so stated , but rather “ one or more .” all structural and functional equivalents to the elements of the various embodiments described throughout this disclosure that are known or later come to be known to those of ordinary skill in the art are expressly incorporated herein by reference and are intended to be encompassed by the claims . | 3 |
prior to reading the specification , it is to be noted that the directional adjectives of inner , outer , upper and lower through the whole specification are based on the direction of the annexed drawings . referring to fig1 - 3 , a seat tilt angle control device in accordance with the present invention is shown . the seat tilt angle control device comprises : a tilt unit 1 mounted in a seat back of a vehicle seat , comprising a tilt support frame set 10 ; a drive mechanism 20 adapted for tilting the tilt unit 1 within a predetermined angle , comprising a motor 21 , a linking member 22 and a connection member 23 ; a mounting assembly 30 mounted in the drive mechanism 20 , comprising a connection member 31 capped on the connection member 23 of the drive mechanism 20 , a plurality of mounting through holes 32 cut through the connection member 31 , a plurality of screw bolts b 1 mounted in the mounting through holes 32 to affix the connection member 31 to the connection member 23 of the drive mechanism 20 , an opening 33 cut through the connection member 31 , a plurality of adjustment holes 34 cut through the connection member 31 and equiangularly spaced around the opening 33 , and an indicator 35 ; a control unit 4 angularly adjustably mounted in the tilt unit 1 , comprising an adjustment member 50 for adjusting the mounting assembly 30 at the tilt unit 1 ; a switch mount 60 connected to the adjustment member 50 ; and a switch 70 mounted in the switch mount 60 and electrically coupled to the drive mechanism 20 . further , the adjustment member 50 comprises two connecting hole 51 ; the switch mount 60 comprises two connecting hole 61 respectively connected to the connecting hole 51 of the adjustment member 50 by respective screw bolts b 2 . further , the control unit 4 comprises at least one , for example , two adjustment holes 52 . these adjustment holes 52 are elongated and smoothly curved slots . further , screw bolt b 3 are respectively inserted through the adjustment holes of the control unit 4 and adjustably and selectively fastened to the adjustment hole 34 of the mounting assembly 30 to adjustably affix the adjustment member 50 to the of the mounting assembly 30 at the tilt unit 1 . in other words , the adjustment holes 52 of the control unit 4 can be fixedly fastened to the adjustment hole 34 of the mounting assembly 30 . the control unit 4 further comprises an index 53 corresponding to the indicator 35 of the tilt unit 1 . further , the switch mount 60 is inserted into the opening 33 of the mounting assembly 30 , comprising a switch mounting hole 62 . the switch 70 is mounted in the switch mounting hole 62 of the switch mount 60 . in this embodiment , the switch 70 is a mercury switch . however , mercury switch is not a limitation . when the switch 70 is in a first angle range , it drives on the drive mechanism 20 . when the switch 70 is in a second angle range , it stops the drive mechanism 20 from movement . in this embodiment , the first angle range and the second angle range are divided by the horizontal line . the main features and effects of the present invention are outlined hereinafter : as illustrated in fig3 , when in the first angle range position , the switch 70 is off and cannot control the drive mechanism 20 from not being moved , and therefore , the tilt unit 1 can be freely tilted . as illustrated in fig4 , when the tilt unit 1 is maximumly tilted , the switch 70 is shifted into the second angle range and electrically conducted to control the drive mechanism 20 from being moved , thus , the tilt unit 1 is stopped from tilting to prevent rollovers . thus , when adjusting the tilt angle adjustment range , loosen the screw bolt b 3 from the adjustment hole 52 for allowing micro adjustment of the angular position of the adjustment member 50 . alternatively , the screw bolt b 3 can be respectively affixed to respective other adjustment holes 34 of the mounting assembly 30 to largely change the angular position of the control unit 4 . thus , the mounting assembly 30 provides multiple adjustment holes 34 for the mounting of the adjustment holes 52 of the adjustment member 50 in a selective manner . further , the adjustment holes 52 are elongated and smoothly arched slots for micro adjustment . further , the indicator 35 of the tilt unit 1 mates with the index 53 of the control unit 4 for visually checking the angle being adjusted . because the seat tilt angle control device of the invention allows free adjustment of the tilt angle , it is practical for use in any of a variety of different models and types of motor vehicles . accordingly , the present invention has the advantage of saving component parts . except the aforesaid embodiment , the seat tilt angle control device of the invention can be variously embodied . for example , except the arrangement of mounting the control unit 4 in the drive mechanism 20 , control unit 4 can also be installed in the tilt support frame set 10 . or , the switch 70 can be roll ball switch instead of the aforesaid mercury switch . further , in addition to the application of being used in a seat back , the seat tilt angle control device can also be used in a seat cushion or any other different part of the vehicle seat . one or a combination of multiple of the aforesaid embodiments of the present invention can achieve the objects of the present invention . in conclusion , the seat tilt angle control device of the present invention can be controlled to accurately adjust the tilt angle adjustment range without detaching many component parts , assuring a high level of convenience and safety , and effectively achieving the objects of the present invention . although particular embodiments of the invention have been described in detail for purposes of illustration , various modifications and enhancements may be made without departing from the spirit and scope of the invention . accordingly , the invention is not to be limited except as by the appended claims . | 1 |
in the electrical power generating plant shown in fig1 a boiler 1 serves as the source of high - pressure steam , providing the motive fluid to drive a reheat steam turbine generally designated as 2 and including high - pressure ( hp ) turbine 3 , intermediate - pressure ( ip ) turbine 4 , and low - pressure ( lp ) turbine 5 . the turbine sections 3 , 4 , and 5 are coupled in tandem and to electrical generator 7 by a shaft 8 . the steam flow path from boiler 1 is through conduit 9 , from which steam may be taken to hp turbine 3 through main stop valve 10 and hp control valve 11 . a high - pressure bypass sub - system including hp bypass valve 12 and desuperheating station 13 provides an alternative or supplemental steam path around hp turbine 3 . steam flow exhausting from hp turbine 3 passes through check valve 14 to rejoin any bypassed steam , and the total passes through reheater 15 . from reheater 15 , steam may be taken through the intercept valve 16 and reheat stop valve 17 to the ip turbine 4 and lp turbine 5 which are series connected by conduit 18 . steam exhausted from the lp turbine 5 flows to the condenser 19 . a low - pressure bypass sub - system including lp bypass valve 21 , lp bypass stop valve 22 , and desuperheater 23 provides an alternative or supplemental steam path around ip turbine 4 and lp turbine 5 to condenser 19 . rotational speed and output power of the turbine 2 are related to the admission of steam by control valve 11 which , although referred to herein as a single valve for the purpose of explaining the invention , is actually a plurality of valves circumferentially arranged about the inlet to the high - pressure turbine to achieve full or partial arc admission of steam as desired . a speed and load control loop , operative to position control valve 11 , includes speed transducer 24 providing a signal indicative of actual turbine speed , a speed reference unit 25 by which the desired speed may be selected , and a first summing device 26 which compares the actual speed with the desired speed and supplies a speed error signal proportional to the difference . the error signal from summing device 26 is amplified by gain element 27 to provide one input to second summing device 28 wherein the amplified error signal is compared with a load reference r l supplied by load reference unit 29 . under steady - state conditions , the speed error signal is zero so that the output of second summing device 28 is a signal representative of the load setting . this signal , referred to as e l , is applied to cv control unit 30 . control unit 30 may include a power amplification device to operate control valve 11 in accord with e l , and may also include means to linearize the flow characteristics of the control valve 11 . the speed and load control branch of the system is substantially the same as was disclosed in the aforementioned patent , u . s . pat . no . 3 , 097 , 488 to eggenberger et al . control of the hp bypass valve 12 , the low - pressure bypass valve 21 , and the intercept valve 16 is determined by a signal indicative of turbine actual load demand ( ald ) and designated as e l &# 39 ;. e l &# 39 ; is formed by taking the product of e l ( the output of the second summing device 28 ) and p b ( the boiler pressure as measured by pressure transducer 32 ) in multiplier 33 . the ald signal e l &# 39 ; is applied to a load demand readout 34 in addition to control loops for regulating the hp bypass valve 12 , the lp bypass valve 21 , and the intercept valve 16 as mentioned above . the hp bypass control loop includes p ref hp function generator 35 , mode selector 41 , rate limiter 36 , third summing device 37 , boiler pressure transducer 32 , proportional plus integral controller 38 , manual / automatic selector 39 , and hp bypass valve 12 ; the lp bypass control loop includes p ref lp function generator 40 , fourth summing device 42 , reheater pressure transducer 43 , proportional plus integral controller 44 , manual / automatic selector 45 , and lp bypass valve 21 ; and the intercept valve control loop includes adjustable gain amplifier 46 , intercept valve 16 , and iv control unit 47 which may include means to linearize the flow characteristics of valve 16 . in the hp bypass control loop , p ref hp function generator 35 provides a reference signal , or setpoint , against which the boiler pressure p b as measured by transducer 32 is compared in third summing device 37 . the hp bypass valve 12 is positioned in accord with the output signal from summing device 37 , being caused to open more or less as p b is greater or lesser than p ref hp , the signal from function generator 35 . an example of the function produced by p ref hp function generator 35 is shown in fig2 wherein p ref hp is a function of e l &# 39 ;. in the example shown , p ref hp at low values of e l &# 39 ; is a constant equal to a minimum selected boiler pressure p b min , then is ramped upward to a second constant value p ref hp max , selected to be just greater than the rated boiler pressure , with higher values of e l &# 39 ;. function generator 35 includes adjustments 50 and 51 provided , respectively , to select p b min and the value of α , the slope of the ramped portion of the function p ref hp . in terms of valve operation , the hp bypass valve 12 is throttling at the lower values of e l &# 39 ; to maintain p b min , then is fully closed as the function p ref hp is ramped up . function generators operative as described , and as will hereinafter be described in conjunction with the lp bypass control loop , are well known in the art and may generally be of the type described in u . s . pat . no . 3 , 097 , 488 . rate limiter 36 prevents p ref hp from declining at an excessive rate with a sudden drop of e l &# 39 ; as may occur with a sudden loss of load . this prevents the occurrence of a large error signal which would tend to rapidly swing the bypass valve 12 from closed to opened , causing shock to the boiler 1 from the quick release of steam pressure . proportional plus integral controller 38 accepts the error signal from third summing device 37 to produce a signal proportional to the error and its time integral so as to position hp bypass valve 12 accordingly . the manual / automatic selector 39 provides for disengaging the hp bypass valve 12 from automatic control so that it can be manually positioned , and allows control to be readily switched from automatic to manual and vice versa . mode selector 41 allows control according to the p ref hp function ( sliding pressure ) or , by substituting a constant value for p ref hp , at a constant pressure . in the lp bypass control loop , p ref lp function generator 40 provides a reference pressure signal or setpoint based on the value of e l &# 39 ;, for example , as shown in fig3 . the function p ref lp is a constant at lower values of e l &# 39 ;, representing the minimum allowable reheat pressure p reh min , then is ramped upward with slope β as e l &# 39 ; increases . the p ref lp function generator 40 is provided with adjustment 52 to select the desired valve of p reh min , which is determined by the operating specifications of the reheater boiler 15 . the p ref lp value is compared with actual reheater pressure , as measured by transducer 43 , in fourth summing device 42 and the error signal therefrom applied to proportional plus integral controller 44 which automatically directs operation of lp bypass valve 21 to minimize the error signal . manual / automatic selector 45 allows the lp bypass valve 21 to be operated manually or automatically as was described above for the hp bypass valve 12 . the intercept control loop provides for throttling the intercept valve at reduced load to maintain the minimum allowable reheater pressure p reh min . this is achieved by passing the e l &# 39 ; signal through amplifier 46 whose gain is selected to be inversely proportional to p reh min . the output from amplifier 46 is applied to iv control unit 47 providing a proportional power signal for operating intercept valve 16 . the coordinated operation of control valve 11 with intercept valve 16 is illustrated graphically in fig4 and 5 , each figure showing the results with a different boiler pressure p b . the plots of fig4 and 5 are in normalized units covering a range of 0 to 1 . 0 representing generally , 0 to 100 % of the possible span of a particular variable . for example , a boiler pressure p b stated to be 0 . 5 units may be taken as a boiler pressure of 50 % of rated pressure . thus in referring to the plot of intercept valve opening as shown in fig4 and 5 , a normalized value of 1 . 0 indicates the valve is fully open , a value of 0 . 5 that the valve is one - half open , and so on . this permits description of the control system independent of the limiting parameters of any given system component , e . g ., boiler capacity or pressure . the graphs show that the intercept valve throttles over the range of e l necessary to maintain the minimum reheater pressure in accord with e l &# 39 ; and the steam flow through the control valve 11 , but independently of the main boiler pressure . operation of the invention can best be explained in terms of numerical values assigned to the various operating parameters to serve as illustrative examples . for that purpose , and for signal manipulation , the parameters can be expressed in terms of normalized units as was explained above . for the following description of different phases of turbine operation , reference is made to fig1 - 5 . just prior to startup of the turbine , the boiler 1 is operated at some minimum steam flow and pressure . there may , for example , be 0 . 3 units of flow at 0 . 4 units of pressure with all of the steam being bypassed through the bypass system around turbine 2 to the condenser 19 . the turbine 2 is then started by appropriately setting speed reference unit 25 and load reference unit 29 to cause steam flow through the control valve 11 and the intercept valve 16 . for example , when the load reference signal r l is increased to 0 . 3 units , assuming no speed error , e l also equals 0 . 3 and flow to the high - pressure turbine 3 is 0 . 12 units ( 0 . 3e l × 0 . 4p b = 0 . 12e l &# 39 ;). the actual load demand ( ald ) readout 34 will , at this point , display 0 . 12 units of demand , numerically equal to the steam flow into the high - pressure turbine 3 . furthermore , if the minimum allowable reheat pressure setting p reh min is 0 . 3 units , then flow through the intercept valve 16 , intermediate pressure turbine 4 , and low - pressure turbine 5 will also be 0 . 12 units ( 0 . 3p reh × 0 . 12e l &# 39 ;/ 0 . 3p reh min ). the latter parenthetical expression results from multiplying the reheater pressure by the ald signal and multiplying that product by the gain ( 1 / p reh min ) of intercept loop amplifier 46 . if , at this point , r l is increased to 0 . 7 , the ald signal will move to 0 . 28 and , from the graphs of fig2 and 3 as examples , the hp and lp bypass valves 12 and 21 will become very nearly closed with p ref hp and p ref lp on the verge of being ramped up . flow through the intercept valve 16 will be 0 . 28 units ( 0 . 3p reh × 0 . 28e l &# 39 ;/ 0 . 3p reh min ) and the valve 16 will be very nearly wide open ( 0 . 28e l &# 39 ;/ 0 . 3p reh min ≃ 1 . 0 units , where a value of 1 . 0 in the intercept control loop results in intercept valve 16 being fully open ). since the gain of the intercept loop is matched to the inverse of p reh min , coordination of the control valve 11 and intercept valve 16 is assured as illustrated by the graphs of fig4 and 5 . at higher loads the r l signal can be fixed , or held constant , and if conditions are steady - state with respect to speed , r l will equal e l . thus the control valve 11 will be fixed in position and the boiler pressure may be allowed to slide upward to satisfy increasing load demands on the turbine 2 . the ald readout 34 will display the actual load demand under all conditions , showing an increasing value as boiler pressure slides upward . above 0 . 7 units of actual load , as illustrated in the examples of fig2 and 3 , the boiler will be at full pressure and control of the turbine 2 will be as is conventional for a turbine not having a bypass valving arrangement . as load is reduced , mode selector 41 may be brought into play , permitting the boiler 1 to be operated at a constant elevated pressure . in this constant pressure mode , mode selector 41 negates the effect of a changing value of e l &# 39 ; on the output of function generator 35 by substituting a constant value for p ref hp . at constant pressure , intercept valve 16 operates in coordination with control valve 11 as load is reduced ; the hp bypass valve 12 controls the pressure of the boiler 1 at a selected constant value of p ref hp ; and the lp bypass valve , with the intercept valve , controls reheater pressure . if turbine load is reduced while in the variable pressure mode , and unless there is very sudden loss of load , operation of the system is the reverse of that obtained during the loading process , and the boiler and reheater pressures are allowed to slide down to the minimum preselected values . with a sudden loss of load , rate limiter 36 prevents a precipitous drop in the signal applied to third summing device 37 , avoiding a rapid opening of the hp bypass valve 12 and causing a sudden blowdown of the pressure of boiler 1 . while there has been shown and described what is considered to be a preferred embodiment of the invention , and there has been set forth the best mode contemplated for carrying it out , it will be understood that various modifications may be made therein . it is intended to claim all such modifications which fall within the true spirit and scope of the present invention . | 5 |
fig2 is a block diagram illustrating an embodiment of the present invention . the output compaction architecture 200 comprises a response shaper 210 which is inserted between the outputs of the scan chains 221 , 222 , . . . , 225 and the inputs of the output compactor 250 . the output compactor 250 advantageously need not be a sophisticated array of exclusive - or ( xor ) gates . in fact , the output compactor 250 can be implemented by any xor network - based compactor and even the most primitive xor tree . it is accepted that the output compactor 250 will allow some masking of faults to occur during compaction . the response shaper 210 , the operation and design of which is further described in detail herein , serves to “ reshape ” responses from the scan chains 221 , 222 , . . . , 225 in a manner that preferably minimizes the masking of faults by the output compactor 250 . fig3 through 5 illustrate the principles behind the reshaping of the scan chain responses . fig3 depicts a simple 4 - to - 1 output compactor implemented with xor gates 351 , 352 , 353 that can be used to observe four internal scan chains 321 , 322 , 323 , and 324 with one external scan chain output ( so ) 360 . assume that the four scan flip - flops ( depicted as rectangles ) s 1 , 1 , s 2 , 1 , s 3 , 1 , and s 4 , 1 in the scan chains currently hold the responses of the circuit to the previous test pattern . with reference to fig3 through 5 , the notation g / f , where g = f = 0 or 1 , inside each of the scan flip - flops denotes the good circuit and faulty circuit responses that are captured into the flip - flop . when the good circuit value of a flip - flop is opposite to its faulty circuit value , i . e ., 1 / 0 or 0 / 1 , then the flip - flop is said to capture an error . fig3 shows that flip - flops s 1 , 1 and s 3 , 1 , whose values are scanned out at the same cycles , have captured errors . values that are scanned out of each internal scan chain output will propagate through the output compactor network to the external scan chain output 360 which in turn is observed by automatic test equipment ( ate ). even though there are multiple scan flip - flops that captured errors , the good circuit value at the external scan chain output is equivalent to its faulty circuit value . the errors that are propagated to the two inputs of the second stage xor gate 353 are “ masked .” therefore , the defect that caused errors at s 1 , 1 and s 3 , 1 cannot be observed by the ate because the two errors cancel each other out when they pass through the xor network . fig4 shows another case where the error values are masked . again , a simple 4 - to - 1 output compactor is depicted with xor gates 451 , 452 , 453 that can be used to observe four internal scan chains 421 , 422 , 423 , and 424 with one external scan chain output 460 . if an error is scanned out with an unknown value at the same cycle , the error is masked and cannot be observed by the ate . in fig4 , the symbol “ u ” denotes an unknown value , i . e ., a value that can be either 0 or 1 . among the four flip - flops that are scanned out at the current shift cycle , only s 1 , 1 has an error value . however , since the good circuit value at s 2 , 1 is unknown , the error value at s 1 , 1 cannot be observed . unknown values can occur for several reasons : for example , the circuit can have flip - flops that are not scanned , the circuit can contain bus drivers whose control signals are not fully decoded , etc . normally , good circuit responses of a circuit are computed by conducting logic simulation for the circuit . limitations in simulation accuracy can also cause unknown values . fig5 illustrates how reshaping responses helps the simple output compactor depicted in fig3 and 4 detect defects . assume that scan chains 521 , 522 , 523 , 524 of a circuit capture responses as shown in fig5 a . fig5 a shows that flip - flops s 1 , 1 , s 1 , 3 , and s 3 , 3 hold errors . if the simple output compactor depicted in fig3 and 4 is used to compress output responses , then all errors are masked and no defect can be observed at the output of the output compactor . the error in s 1 , 1 is scanned out with the unknown value in s 2 , 1 and the two errors in s 1 , 3 , and s 3 , 3 are scanned at the same shift cycles . assume that a flip - flop , which is initialized to 1 / 1 before the scan shift operation starts , is inserted between s 1 , 1 and the corresponding input to the compactor to delay the first scan chain 521 by one clock cycle , as depicted in fig5 b . that is , responses captured in the scan chain 521 are “ reshaped ” by the inserted flip - flop . in fig5 b , no error value is scanned out with another error or unknown value at any shift cycle and all errors can be observed at the output of the compactor . the simple shape compactor can thereby detect defects when even number errors are scanned out and / or errors are scanned out along with unknown values at the same shift cycle . fig6 shows an implementation of a response shaper 610 for a circuit with four scan chains 621 , 622 , 623 , 624 . in accordance with an embodiment of the invention , the response shaper 610 is comprised of delay elements 615 , 616 , 617 , 618 , multiplexers 611 , 612 , 613 , 614 , and a 2 - to - 4 decoder 619 . each delay element and multiplexer is inserted between each scan chain output and the corresponding input of the output compactor 650 . the 2 - to - 4 decoder 619 generates signals that select a scan chain output that will be delayed . for example , if the input of the decoder is set to i , where i = 1 , 2 , 3 , or 4 , then responses that are scanned out of chain i are delayed before they are input to the compactor and responses from the other scan chains are input to the compactor without any delay . it should be noted that delay elements that can delay the selected scan chain by more than one cycle can be readily used , in the situation where it is anticipated that no error can be observed at the output of the compactor 650 by delaying only one shift cycle ( for example , where an error appears with an unknown value and another unknown value appears at the next cycle ). fig7 depicts an alternative embodiment which does not utilize delay elements to reshape responses of selected scan chains . the function of this response shaper 710 is similar to that of the response shaper illustrated in fig6 . again , the response shaper 710 is inserted between four scan chains 721 , 722 , 723 , 724 and the output compactor 750 . however , unlike the response shaper shown in fig6 which delays responses of the selected scan chain , responses of the selected scan chain in fig7 will be input to the compactor earlier than the other scan chains , for example by one cycle . the response shaper 710 comprises a 2 - to - 4 decoder 719 that generates signals to four multiplexers 711 , 712 , 713 , 714 which can selectively advance responses from one of the scan chains 721 , 722 , 723 , 724 . since delay elements are not used , this approach can reduce hardware overhead to implement the response shaper . fig8 shows an example of how the two different schemes can also be combined together to both delay and advance responses of selected scan chains . an extra multiplexer is provided with each element of the response shaper 810 that is inserted between each scan chain output and each corresponding input of the output compactor 850 . the extra multiplexer is responsive to a control signal that can select whether to delay or advance a scan chain in a shift cycle while the decoder 819 is still used to identify which of the scan chains 821 , 822 , 823 , 824 will be delayed or advanced . if the circuit into which the response shaper is inserted has a large number of scan chains , then the hardware overhead of the above embodiments can be reduced by selectively inserting the response shaper elements into the output compaction scheme , as illustrated by fig9 . in fig9 , the delay elements and multiplexers from the above - described response shaper embodiment are only inserted for selected scan chains to reduce hardware overhead . although the circuit has four scan chains 921 , 922 , 923 , 924 , the response shaper 910 only inserts delay elements and multiplexers for two scan chains 921 , 923 , as depicted in fig9 . fig1 is a flowchart of processing performed to generate the control signals for the above - described response shaper , in accordance with an illustrative embodiment of the invention . at step 1001 , a fault simulation is run with the pre - computed test patterns from a first test pattern p 1 to a last test pattern p n , where n is the number of pre - computed test patterns . at step 1002 , an identification is made of faults f i newly detected by each test pattern p i , where i = 1 , 2 , . . . n . this is conducted under the assumption that all scan chains are directly observed without an output compactor . at step 1003 , the masked faults for each test pattern are identified , namely those faults which can be observed without the use of an output compactor but cannot be observed if the scan chains are observed via the output compactor . these masked faults are placed into a masked fault list f mask . at step 1004 , responses are computed to each test pattern . from the last test pattern p n toward the first test pattern p 1 , responses are computed to each test pattern , r i , where i = 1 , 2 , . . . n , and the values captured in each scan flip - flop . if there is any fault in f i that is masked when the scan chains are observed via the output compactor , then search is conducted for a scan chain that allows all faults to be detected when it is delayed ( or advanced depending on the embodiment discussed above ). if there is more than one such scan chain , then a decision can be made to select the scan chain that can detect the most faults in the masked fault list f mask . as a fault is determined to be detectable by a reshaped scan chain , the fault is dropped from the fault list : an identification is made of all faults from the entire fault list that are detected when the selected scan chain is delayed ( or advanced ) and the detected faults are removed from fault list f i for every test pattern p i , where i = 1 , 2 , . . . n , and also from the masked fault list f mask . at step 1005 , the input signals for the decoder of the response shaper are generated for each test pattern using the information obtained in step 1004 . in the foregoing , if it is assumed that the response shaper will delay and / or advance only a single scan chain for entire shift cycles to scan out a response completely , then there is a need for only one set of decoder control signals for each test pattern . this advantageously minimizes the test data volume that is to be stored to control the response shaper . if , however , there are test patterns having detected faults that cannot be detected by delaying or advancing any scan chain , then it should be noted that it is possible to switch scan chains that are reshaped in the middle of scan shift operation for the response . thus , multiple sets of control signals would be generated for those test patterns . although this may increase test data volume , it could advantageously achieve the same fault coverage that can be achieved when scan chains are directly observed without the use of any output compactor — even in the presence of a large number of unknown values . while exemplary drawings and specific embodiments of the present invention have been described and illustrated , it is to be understood that that the scope of the present invention is not to be limited to the particular embodiments discussed . thus , the embodiments shall be regarded as illustrative rather than restrictive , and it should be understood that variations may be made in those embodiments by workers skilled in the arts without departing from the scope of the present invention as set forth in the claims that follow and their structural and functional equivalents . as but one of many variations , it should be understood that the response shaper described herein can be utilized with a wide variety of output compaction schemes . | 6 |
referring to the drawings in particular , a vehicle seat 1 for a motor vehicle has a seat part 3 and a backrest 4 , the inclination of which is adjustable relative to the seat part 3 . in order to adjust the inclination of the backrest 4 , a drive shaft 7 , which is arranged horizontally in the transition region between the seat part 3 and the backrest 4 , is rotated manually , for example , by means of a handwheel 5 , or in a motor - driven manner , for example by means of an electrical motor . on both sides of the vehicle seat 1 , the drive shaft 7 engages in a fitting 10 so that it is rotationally secure , in a manner which will be described later . the drive shaft 7 defines the adopted directional data of a cylinder coordinate system . the fitting 10 is in the form of a gear fitting in which a first fitting part 11 and a second fitting part 12 are connected to each other by means of a gear unit for displacement and fixing in position , to be more precise , by means of an eccentric epicyclic gear system , which in the present case is self - locking , as described , for example , in de 44 36 101 a1 , the relevant disclosure of which is expressly incorporated herein ( and corresponding u . s . pat . no . 5 , 634 , 689 is hereby incorporated by reference in its entirety ). with the mounting of the fitting 10 , the first fitting part 11 is , for example , connected tightly to the structure of the backrest 4 , i . e . it is fixed with respect to the backrest part . the second fitting part 12 is then connected tightly to the structure of the seat part 3 , i . e . it is fixed with respect to the seat part . those assignments of the fitting parts 11 and 12 are preferred when the drive shaft 7 and the backrest 4 are to have the same direction of rotation , or when the position of the drive shaft 7 relative to the backrest 4 is to be constant in order , for example , to be able to fit to the structure of the backrest 4 an electrical motor rotating the drive shaft 7 . however , the assignments of the fitting parts 11 and 12 can also be exchanged , i . e . the first fitting part 11 would then be fixed with respect to the seat part and the second fitting part 12 would be fixed with respect to the backrest . the latter assignments of the fitting parts 11 and 12 are preferred when the radial spacings of the fastening points between the fitting 10 and a relatively thin metal backrest sheet are to be as large as possible . each of the two fitting parts 11 and 12 can be approximately inscribed in a circular disk shape . the two fitting parts 11 and 12 are preferably composed of metal , in particular steel . in order to absorb the axially acting forces , i . e . in order to hold the fitting parts 11 and 12 together , an enclosing ring 13 is provided . such a method of holding parts together by means of an enclosing ring is described , for example , in u . s . pat . no . 6 , 799 , 806 a , the relevant disclosure of which is expressly incorporated herein . the preferably metal enclosing ring 13 is , with the mounting of the fitting 10 , connected tightly to the second fitting part 12 , being preferably first of all pressed on and then welded . alternatively , the enclosing ring 13 is beaded , engaging over the second fitting part 12 . at one of its end faces , the enclosing ring 13 has an edge bent radially inwards by means of which it engages radially over the outside of the first fitting part 11 , optionally with the interposition of a sliding ring , without impeding the relative movement of the two fitting parts 11 and 12 . from a structural point of view , the two fitting parts 11 and 12 therefore together form a disk - shaped unit . in order to form the gear unit , an externally toothed wheel 16 is formed on the second fitting part 12 , and an internally toothed ring 17 is formed on the first fitting part 11 , the toothed wheel and the toothed ring meshing with each other . the diameter of the tip circle of the external toothing of the toothed wheel 16 is smaller by at least the depth of one tooth ( of the toothed ring 17 ) than the diameter of the root circle of the internal toothing of the toothed ring 17 . a corresponding difference in the number of teeth of the toothed wheel 16 and the toothed ring 17 of at least one tooth permits a rolling movement of the toothed ring 17 on the toothed wheel 16 . on the side facing the toothed wheel 16 , the first fitting part 11 has , concentrically with the toothed ring 17 , a collar 19 which can be integrally formed on ( i . e . formed in one piece with ) the first fitting part 11 as a collar formation or which can be secured thereto in the form of a separate sleeve . a driver 21 is supported rotatably in the collar 19 by means of a hub 22 . the driver 21 is preferably composed of plastic material . the hub 22 of the driver 21 is provided centrally with a bore 23 for receiving the drive shaft 7 . the profile of the bore 23 is configured to fit the profile of the drive shaft 7 , in the present case a splined shaft profile . adjoining its hub 22 , the driver 21 has a covering disk 25 which is formed in one piece with the hub 22 and which has a larger diameter than the hub . supported on the collar 19 ( with their curved inner surfaces ) are two wedge segments 27 which support ( with their curved outer surfaces ) the second fitting part 12 by means of a slide bearing bush 28 which is pressed into the second fitting part 12 in a rotationally secure manner . the driver 21 has — spaced radially from the hub 22 — a driver segment 29 which engages with clearance between the narrow sides of the wedge segments 27 and which is formed in one piece with the covering disk 25 and the hub 22 . the mutually facing broad sides of the wedge segments 27 each receive , with a respective recess defined by projecting sections of material , a respective angled end finger of an omega spring 35 which presses the wedge segments 27 apart in the circumferential direction , it being possible during operation for the projecting material sections of the wedge segments 27 to touch and act on each other . the driver 21 is secured axially to the outside of the first fitting part 11 by a clipped - on securing ring 43 . provided on the outside of the second fitting part 12 , between the radially outer edge thereof and the covering disk 25 , is a sealing ring 44 which is composed , for example , of rubber or soft plastic material and which is connected , especially clipped , to the covering disk 25 . the wedge segments 27 ( and the omega spring 35 ) define an eccentric which , in extension of the direction of eccentricity ( i . e . the line connecting the axes ), presses the toothed wheel 16 into the toothed ring 17 at an engagement site so defined . when drive is effected by means of the rotating drive shaft 7 , a torque is first of all transmitted onto the driver 21 and then , by means of the driver segment 29 , onto the eccentric which slides along the slide bearing bush 28 , shifting the direction of eccentricity and thus shifting the site of engagement of the toothed wheel 16 in the toothed ring 17 , this presenting itself as a wobbling rolling movement , i . e . as a relative rotation with a superimposed wobbling movement . as a result , the inclination of the backrest 4 is continuously adjustable between several use positions . depending on the mounting of the fitting 10 , the eccentric ( i . e . the wedge segments 27 ) is supported by the second fitting part 12 , while the eccentric , for its part , supports the first fitting part 11 , or the relationships are exactly reversed , i . e . the eccentric rests on the first fitting part 11 and supports the second fitting part 12 . each of the — in the present case thirty three — teeth 16 a of the toothed wheel 16 has radially inward on both sides a tooth root 16 b , radially outward a tooth tip 16 c and , between them on both sides , one tooth flank 16 d each . the tip circle circumscribing the tooth tips 16 c and the root circle inscribed by the tooth roots 16 b are concentrical , in the present case to the receptacle for the eccentric , such receptacle being coated with the slide bearing bush 28 , a center point m 16 and a radial orientation ( in cylinder coordinates ) of the toothed wheel 16 thus being defined . the course of two adjacent tooth roots 16 b results , for example , from a radius ( quarter arc ) of approximately 1 mm , adjoining the one tooth flank 16 d ( continuous and differentiable ), a straight piece of 1 to 2 mm which is adjacent tangentially to the root circle , and a mirror - symmetrical radius ( quarter arc ) of approximately 1 mm , which is adjoining the next tooth flank 16 d . the tooth roots 16 b merge in the point of contact to the root circle ( radius for example approximately 31 mm ). the course of a tooth tip 16 c results , for example , from a radius ( quarter arc ) of approximately 1 mm , adjoining the one tooth flank 16 d ( continuous and differentiable ), a tangential piece of 1 to 2 mm and a mirror - symmetrical radius ( quarter arc ) of approximately 1 mm , which is adjoining the other tooth flank 16 d . the tooth tips 16 c touch the tip circle ( radius , for example , approximately 34 mm ) at their radially outermost point . correspondingly , each of the — in the present case thirty - four — teeth 17 a of the toothed ring 17 has a tooth root 17 b , a tooth tip 17 c and two tooth flanks 17 d . the tip circle which is inscribed by the tooth tips 17 c and the root circle which circumscribes the tooth roots 17 b are concentrical , in the present case with respect to the collar 19 , thus defining a center point m 17 and a radial orientation ( in cylinder coordinates ) of the toothed ring 17 . the courses of the tooth roots 17 b and of the tooth tips 17 c preferably correspond to those of the tooth roots 16 b and of the tooth tips 16 c . the straight piece which bears against the root circle ( radius for example approximately 36 mm ) can be a little longer than that of the toothed wheel 16 . the radius at the tooth tip 17 c can be a little larger than that of the tooth tip 16 c , resulting in the piece adjoining the tip circle ( radius , for example , approximately 33 mm ) being a little shorter than with the toothed wheel 16 . the tooth roots of adjacent teeth 17 a merge in their point of contact with the root circle ( their radially outermost point ), thus defining the tooth base enclosed by them . the tooth tips 17 c touch the tip circle at their radially inmost point . the eccentricity e ( of the eccentric ) is the distance between the center point m 17 of the toothed ring 17 and the center point m 16 of the toothed wheel 16 . it amounts , for example to 1 to 2 mm . it results from the exact configuration of the teeth 16 a and 17 a , how the teeth 16 a , 17 a can come into contact , in particular along which contact lines and contact surfaces . in the pole toothing of the present embodiment , the tooth flanks 16 d and 17 d — subsequently at one pitch point w each — get to bear against one another , i . e . they serve for the rolling movement , while the tooth tips 16 c , 17 c , and the tooth roots 16 b , 17 b can be configured independently of this . when the fitting 10 is driven , that is to say during the rolling movement , the pitch point w is not exactly in the extension of the eccentricity e , but — relative to the center point m 16 of the toothed wheel 16 — it is at a first angle α of 10 ° to 50 °, in particular approximately 45 °, over the extension of the eccentricity e . the contact of these tooth flanks 16 d and 17 d at the pitch point w has the same effect as if the toothed wheel 16 and the toothed ring 17 rotated relative to one another around an instantaneous center of rotation p . the first angle a depends on the shape of the wedge segments 27 , in particular of the wedge angle , and of their position during the rolling movement . with respect to the extension of the eccentricity e , a further pitch point occurs on the side opposing pitch point w , so that the toothed wheel 16 is supported , i . e . stabilized at three points ( eccentric and the two pitch points ). the instantaneous center of rotation p is , in every case , in the extension of the eccentricity e . moreover , the instantaneous center of rotation p — with respect to the pitch point w — is located at a second angle β of 80 ° to 100 °, in particular approximately 90 °, with respect to the straight line connecting the pitch point w and the center point m 16 of the toothed wheel 16 . the toothed flanks 16 d and 17 d are configured as circular - arc pieces around the instantaneous center of rotation p , i . e . the center point of their curvature is the same point , namely the instantaneous center of rotation p , and the ( constant ) radius of curvature k 1 of the tooth flank 16 d and the ( constant ) radius of curvature ) k 2 of the tooth flank 17 d are identical as well ( for example approximately 33 mm ). the identical radius of curvature k 1 = k 2 for the tooth flanks 16 d and 17 d is an ideal radius of curvature for perfectly worked teeth 16 a and 17 a . in practice , there are tolerances in production . to compensate them , it is advantageous , if the actual radius of curvature k 2 of the tooth flank 17 d is slightly smaller and / or the actual radius of curvature k 1 of the tooth flank 16 d is slightly larger than the ideal radius of curvature , i . e . the radius of curvature k 1 of the tooth flank 16 d at the pitch point w and the radius of curvature k 2 of the tooth flank 17 d at the pitch point w are ( only ) at least approximately identical . since the tooth flanks 16 d , 17 d are only very short circular - arc pieces it can be sensible — depending on the production tolerances — that the actual radii of curvature k 1 , k 2 of the tooth flanks 16 d , 17 d are within a range of ± 10 %, preferably ± 4 %, particularly preferably ± 1 %, each time , for example , referred to their common mean value ( k 1 + k 2 )/ 2 . the named ranges are consequently considered to be still approximate . preferably , both centers of curvature are located on the straight line connecting pitch point w and the instantaneous center of rotation p . while specific embodiments of the invention have been described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles . | 1 |
turning now to the drawings , fig1 illustrates a partial cross - sectional view of a semiconductor substrate 10 . substrate 10 is preferably a silicon - based , single crystalline material doped either n - type or p - type . arranged on the upper surface of substrate 10 can be various isolation structures ( not shown ). isolation structures can be formed either by the shallow trench isolation (&# 34 ; sti &# 34 ;) process or the locos process . in either event , isolation structures serve to isolate an active or passive device in one portion of substrate 10 from an active or passive device within another portion of substrate 10 . an example of one active device formed between isolation structures is provided in reference to numeral 14 . device 14 is shown as a first transistor formed upon and within the upper surface of substrate 10 . first transistor 14 includes , according to one embodiment , a gate conductor 20 and a gate dielectric 22 . gate conductor 20 , in combination with adjacent isolation structures , serve to mask implant of a lightly doped drain 24 (&# 34 ; ldd &# 34 ;) into the regions therebetween . thereafter , a cvd oxide is deposited across the topography , including the ldd implant areas 24 . the cvd oxide is then removed using an anisotropic etch . resulting from the anisotropic etch , oxide spacers 26 remain on opposing side wall surfaces of conductor 20 . spacers 26 , as well as isolation structures 12 , serve to mask implant of source / drain impurities . the source / drain implant 28 , in conjunction with ldd implant 24 , comprises a junction , wherein the term &# 34 ; junction &# 34 ; conotates either a source region or a drain region . during the implant process , another implant 29 can be formed . implant 29 is a region which receives implant species of the same type as those in the bulk of substrate 10 . implant 29 is a high concentration implant area . for example , if substrate 10 comprises p - type species , then implant 29 comprises a higher concentration of p - type species ( often referred to as a p + implant ). implant 29 thusly formed is often referred to as a &# 34 ; well - tie &# 34 ; implant . it serves to receive a contact subsequently formed and for providing a low resistive path from the contact to the substrate . thus , substrate 10 shown in fig1 is possibly only a small portion of the entire wafer substrate , i . e ., a well portion of that wafer substrate . the use of wells in general and the formation of a well - tie implant within each well are concepts that are known to those skilled in the art . provision of wells and contacts thereto make available the present process to cmos technologies . junction areas serve to receive various silicides shown in reference to fig2 . the silicides help reduce contact resistivity of metal conductors forwarded to the junctions . silicides are shown in reference to as numeral 30 , and are formed anywhere where silicon is present . silicides 30 primarily exist on the silicon - based junctions 28 , the silicon based well - ties 29 , as well as the polysilicon gate conductor 20 . silicides 30 upon polysilicon are often referred to as &# 34 ; polycide &# 34 ;. regardless of where the silicides are formed , the process sequence used in producing silicide is generally the same . first the silicon - based material receives a refractory metal . second , the metal covered , silicon - based material is subjected to a high temperature anneal cycle . the anneal cycle allows movement of the silicon and refractory metal atoms so that a metal silicide occurs . the anneal cycle is often repeated to achieve a first phase silicide , followed by a second phase silicide . the second phase silicide is generally of lower resistivity than the first phase silicide . in the interim , however , non - reacted refractory metal is removed from areas typically in regions over oxide . referring to fig3 a processing step subsequent to fig2 is shown . in particular , fig3 illustrates an interlevel dielectric 32 deposited across the first topography onto which , and into which , first transistor 14 resides . interlevel dielectric 32 can be deposited in numerous ways . preferably , dielectric 32 is deposited as an oxide using cvd techniques . according to one embodiment , dielectric 32 is deposited using plasma enhanced cvd to a thickness sufficient to isolate transistor 14 from certain devices subsequently placed upon and within dielectric 32 . dielectric 32 is also deposited at a thickness sufficient to define the thickness of a subsequently placed gate conductor attributable to a second level transistor . in preparation for second level devices , dielectric 32 is preferably planarized after it is deposited . according to one embodiment , peak elevation regions 34 of dielectric 32 are removed by chemical mechanical polishing (&# 34 ; cmp &# 34 ;). cmp utilizes a slurry material and a polishing pad placed on the exposed surface , whereby the pad rotates and removes the upper surfaces commensurate with the lower surfaces . according to another embodiment , the upper surfaces 34 are removed using a sacrificial etch back . in this instance , a sacrificial material is placed on the upper surface such that the recesses or valleys are filled with that material . the material upper surface is then removed at an etch rate substantially the same as the dielectric underlayer . when all of the sacrificial material is removed , the remaining dielectric surface is approximately planar in that it takes on the same contours as the planar surface of the sacrificial material . referring to fig4 a processing step subsequent to fig3 is shown . fig4 depicts an opening 36 which extends entirely through interlevel dielectric 32 to the upper surface of silicide 30 . opening 36 is contained only to the silicide upon the first transistor gate conductor 20 . opening 36 is produced by placing a masking layer across dielectric 32 and then patterning the masking layer such that the region to be opened is exposed . the exposed region is then subjected to an etch which , according to one embodiment , is a dry ( anisotropic ) etchant . the etchant cycle continues for a time sufficient to remove all of interlevel dielectric 32 directly above silicide 30 . the etchant composition is chosen so that it is selective to removing dielectric 32 but to a lesser degree silicide 30 . various etchant species used for achieving that purpose are generally well known , all of which achieve a fairly straight side wall surface characteristic of an anisotropic etch . referring to fig5 opening 36 is filled with a polycrystalline (&# 34 ; polysilicon &# 34 ;) material 38 . polysilicon 38 fills opening 36 by blanket depositing a layer of polysilicon to a thickness which is greater than the depth of opening 36 . thereafter , the upper regions of the polysilicon layer are removed using , for example , cmp . removal continues for a time sufficient to retain polysilicon 38 only within the confines of opening 36 . the retained polysilicon 38 is henceforth referred to as the gate conductor 40 of a second , upper level transistor . after cmp , a blanket implant is performed to dope polysilicon 38 to render it conductive . fig6 illustrates a processing step subsequent to fig5 wherein a dielectric 42 is formed across the upper surfaces of interlevel dielectric 32 and gate conductor 40 , according to one embodiment . dielectric 42 can be cvd deposited . the deposited dielectric may be chosen to contain a nitrogen species . according to another embodiment , dielectric 42 is formed only in regions directly above gate conductor 40 . in the later instance , dielectric 42 is denoted as reference numeral 42a , wherein dielectric 42a can be grown from the silicon - based gate conductor 40 . regardless of the method used in producing dielectric 42 and / or 42a , the result is the same : to separate gate conductor 40 from a overlying substrate produced in accordance with the processing step shown in fig7 . fig7 illustrates a silicon - based substrate 44 ( or second substrate ) formed across only select regions of interlevel dielectric 32 . more specifically , substrate 44 is formed by depositing a layer of polysilicon , and then removing portions of that polysilicon except for areas directly above gate conductor 40 and gate dielectric 42a . the retained portions of polysilicon substrate 44 is centered directly above gate conductor 40 and gate dielectric 42 , but also extends laterally from the upper surfaces of the gate dielectric . the amount of lateral extension onto adjacent interlevel dielectric 32 can vary . substrate 44 is defined as having a thickness sufficient to receive source / drain junction implants which extend downward to the bottom surface of substrate 44 , or lower . if desired , and it usually is desired , a threshold adjust implant and possibly a punch through implant is incorporated into substrate 44 prior to source / drain formation . fig8 depicts a processing step whereby a masking material 46 is deposited across the entire upper topography . portions of that masking material are removed , and those portions are designated as reference numeral 46a . the retained portions 46b , however , exist only upon substrate 44 . retained masking material 46b exists only along a center region of substrate 44 . the extremities of substrate 44 are thereby exposed as shown in fig9 . fig9 illustrates a processing step subsequent to fig8 wherein source / drain implants are forwarded into substrate 44 in regions void of retained masking material 46b . implants 48 extend into substrate 44 and form source / drain junctions 50 . junctions 50 , in combination with gate conductor 40 and gate dielectric 42a , comprise a second transistor 52 . second transistor 52 comprises essentially the same features as first transistor 14 . however , those features are inverted relative to the order in which features of first transistor 14 are formed . further , features of second transistor 52 are confined entirely within or below substrate 44 . for sake of clarity , gate conductors 20 and 40 are not drawn to scale . the topological thickness and area of polysilicon which form those conductors can be adjusted depending upon the size of transistors 14 and 52 as well as the thickness of interlevel dielectric 32 . it is not imperative that the relative features be drawn to scale or that dimensions be specified , all of which would be readily apparent to those skilled in the art given the benefits described herein . what is necessary , however , is that the second level gate conductor 40 be adjoined to first level gate conductor 20 with substantially no intermediate interconnect other than silicide 30 . further , the electrical connection between the gate conductors is made in the shortest possible manner . rather than having to route the gate conductor of one transistor laterally across a topological surface to a gate conductor of another transistor , the gate conductors herein are stacked one upon each other using an inverted second transistor . connection to the stacked gate conductors is performed in a dimension either behind or in front of the cross - sectional plane shown in fig9 . substrate 44 of second transistor 52 receives various dopants to render the substrate ( or well ) semiconductive . preferably , substrate 44 comprises polysilicon , and polysilicon is exposed along a separate surface to receive all the various implants necessary to form junctions and channels . according to an alternative embodiment , substrate 44 can , if desired , be forwarded into the opening 36 shown in fig4 . substrate 44 therein can receive dopants using a masking layer similar to the step shown in fig9 . in this alternative arrangement , the second substrate 44 is confined within the opening directly upon gate conductor 20 . thus , instead of using a silicide 30 , the latter arrangement forgoes silicide and allows growth of a gate oxide instead . the gate oxide is therefore drawn between the shared gate conductor 20 and the substrate material deposited into opening 36 . in this configuration , only a single polysilicon gate conductor 20 need be fabricated . while the alternative configuration may be used , it is desired that a silicide be used , and two gate conductors 20 and 40 be arranged on opposing sides of the silicide 30 . moreover , it is desirable that second substrate 44 be dimensioned outside of opening 36 into which second gate conductor 40 exists . fig1 illustrates a processing step subsequent to fig9 whereby another interlevel dielectric 56 can be fashioned upon second transistor 52 and the lateral topography into which and upon which transistor 52 occurs . dielectric 56 can be planarized , similar to the technique used to planarize dielectric 32 . accordingly , dielectric 56 affords an opportunity to introduce openings 58 to source junctions and well ties 28 / 29 of the lower transistor as well as openings 59 to drain junctions 28 of the lower transistor . depending upon where contact is to be made , the vertical distance of openings 58 and 59 can vary . however , in each case , the length of the various openings depend upon the thickness of first and second interlevel dielectrics 32 and 56 , respectively . openings 58 and 59 are filled with conductive material as shown in fig1 . filling the openings form junction vias which are electrically conductive . the conductive vias serve as interconnect which extend along a vertical axis ( or along an axis perpendicular to the topological surfaces on which transistors 14 and 52 exist ). the interconnect serves to couple a junction of a lower level transistor to a junction of an upper level transistor , couple a junction of an upper or lower transistor to a power supply , and couple a junction of an upper or lower transistor to ground . the various conductors formed by filling openings 58 and 59 are shown as output and ground conductors . in the illustration provided , only an output and ground conductor 61 and 62 are brought forth . however , it is understood that the cross - section shown in fig1 is indicative of only a portion of a nor gate depicted in elevational view . fig1 thereby illustrates only one pair of transistors which make up a nor gate . likewise , fig1 illustrates connection of a ground conductor , whereas another cross - section of a nor gate may indicate the power ( vcc ) connection . it is understood that the source junction areas of an pmos transistor , such as transistor 52 , is connected to such a power conductor . fig1 illustrates a top plan view of a nor gate 64 formed according to the processing steps set forth above . nor gate 64 includes a pair of stacked transistors 14 and 52 modulated by a first gate conductor 20 and a second gate conductor 40 . the cross - sectional detail of transistors 14 and 52 as shown in fig1 are presented along the plane 13 -- 13 of fig1 . for example , fig1 depicts output conductor 61 and , more specifically , the junction via which extends output conductor 61 to both the lateral edge of upper transistor junction 50 and the upper surface of lower transistor junction 28 . fig1 also illustrates coupling of ground conductor 62 to junction 28 but not to junction 50 . the cross - hatching of the p - type source / drain (&# 34 ; p active &# 34 ;) and n - type source / drain (&# 34 ; n active &# 34 ;) makes clear the demarcation of output conductor 61 / ground conductor 62 connectivity . it is noted that the stacking of transistors shown at the left - hand side of fig1 is repeated at the right - hand side . the right - hand side shows a pair of stacked transistors linked to those stacked at the left - hand side . both the left - hand and right - hand sides show metal contacts of power and ground to respective well regions of pmos and nmos transistors . the pmos and nmos power and ground well - ties are shown in reference to numerals 68 and 70 . coupling the wells to appropriate power and ground conductors affords biasing the &# 34 ; body &# 34 ; of nmos transistors to a ground voltage while also biasing the body of pmos transistors to a vcc voltage . biasing the body causes a change in the workfunction difference between the gate material and the bulk silicon in the ensuing channel . in essence , biasing the body of an nmos device to ground voltage will force the threshold voltage more positive . conversely , biasing the body of a pmos device to ground to a power voltage will force threshold voltage more negative . more importantly , in both instances , biasing the body will force the threshold voltage to be more consistent from transistor to transistor given the relatively constant bias being applied to the respective transistor body . a consistent turn - on threshold that does not deteriorate at smaller geometries is at least one benefit provided by grounding the body or well of an nmos transistor and powering the body or well of a pmos transistor . fig1 depicts but one example of various features of a nor gate and a layout of those features with respect to one another . it is apparent from fig1 that two pairs of transistors are needed to form a nor gate . each pair comprises a transistor inverted directly upon a non - inverted transistor . routing a junction of one transistor within one of the pairs to another transistor within the same pair or to another pair occurs by using contacts to an overlying metal layer or by laterally extending the junction within the same elevational plane to another junction associated with another transistor pair . various permutations or variations may be made to the layout arrangement . all of this would be obvious to a skilled artisan given the benefit of the present description . accordingly , a cross - section through the stacked pair of transistors on the right - hand side of fig1 would be somewhat similar to the cross - section shown in fig1 with modifications apparent given the top - plan view of fig1 . turning now to fig1 , a circuit schematic of nor gate 64 is illustrated . the circuit schematic illustrates biasing nmos transistor bodies 72 to ground and biasing pmos transistor bodies 74 to power . fig1 also illustrates the two pair of stacked transistors shown in dashed line as numerals 14 and 52 . transistor 14 is illustrated as being an nmos transistor while transistor 52 is a pmos transistor , for example . accordingly , the transistor layout and the general interconnect arrangement of the circuit schematic follows to some degree the layout shown in fig1 in that transistor 14 and 52 represent the stacked transistors on the left - hand side of fig1 and transistors 76 and 78 represent stacked transistors on the right - hand side . input b in modulates transistors 76 and 78 , while input a in modulates transistors 14 and 52 . a nor gate 64 is shown having two pairs of stacked transistors . depending upon the number of levels needed , numerous other transistors can therefor be stacked almost endlessly into a third dimension to allow a multi - level device fabrication thereof . it will be appreciated to those skilled in the art having the benefit of this disclosure that the present process methodology is capable of producing numerous nor gates in three dimensions . preferably , a pmos device is stacked directly upon an nmos device , yet inverted from that nmos device . alternatively , a nmos can be stacked ( and inverted ) upon a pmos device . in either instance , stacking pmos and nmos devices affords ready linkage of their gates and interconnect of their junctions amongst one another and to the power and ground conductors associated with the ensuing wafer . thus , the first and second transistor shown in the above figures are of opposite type so that gate conductor 40 of second transistor 52 is doped opposite gate conductor 20 of first transistor 14 . the same can be true of a third and fourth transistor with common gates linking one another in the shortest possible fashion . the third and fourth transistors are of opposite type , similar to the first and second transistors , so that the corresponding gate conductors are doped opposite one another to ensure ohmic contact at silicide formed therebetween . this ohmic contact provides that both polysilicon gates will be at the same bias -- a desired outcome in circuit applications . various modifications and changes may be made to each and every processing step without departing from the spirit and scope of the invention provided the interconnect concepts set forth in the claims are retained . it is intended that the following claims be interpreted to embrace all such modifications and changes , and accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense . | 7 |
fig3 a is a top plan view of a pair of inventive roller - type brushes 23 a , 23 b . each of the brushes 23 a , 23 b comprises a wafer contacting surface 25 ( i . e ., the surface that contacts the wafer during polishing ) which further comprises a first portion 27 , having a planar contact surface 25 a , and a second portion 31 having a profiled contact surface 25 b positioned along at least one end 35 a , 35 b of each brush . when two of the inventive roller brushes 23 a , 23 b are used to simultaneously clean both the front and back surfaces of a wafer , the brushes are preferably positioned such that the ends 35 a , 35 b and the second portions 31 positioned thereon , are at opposite ends of the brushes 23 a , 23 b ( i . e ., laterally opposed ) as shown in fig3 a . preferably both the first and second portions 27 , and 31 have a plurality of nodules that contact the wafer during polishing . a first set of nodules 37 is located on the first portion 27 of the brush . the nodules 37 thus define the planar contact surface 25 a . these planar nodules 37 are preferably circular for ease of manufacture . rows of circular planar nodules 37 having a height h 1 of 0 . 21 inches , a diameter d 1 of 0 . 41 inches , and a spacing x 1 between adjacent nodules 37 of 0 . 2 inches have proven effective during testing on roller brushes 23 a , 23 b having a first outside diameter d 1 of 2 . 72 inches and a second outside diameter d 2 of 2 . 3 inches , as best understood with reference to the side sectional view of fig3 b , which is taken along line 3 b — 3 b of fig3 a . the test brushes were made of pva having a tensile strength of between 77 - 87 psi and an elongation at failure of between 230 %- 300 %. similarly a second set of nodules 39 is located on the second portion 31 of the brush . the nodules 39 thus define the profiled contact surface 25 b as best shown with reference to fig3 c which shows a side sectional view of both the brush of fig3 a taken along line 3 c — 3 c , and a side sectional view of a wafer “ w ”. these profiled nodules 39 are preferably elongated , having an elliptical or rectangular shape . a row of elliptical profiled nodules 39 having a height h 2 along the inside edges thereof of 0 . 735 inches , a height h 3 along the outside edges thereof of 0 . 7908 inches , a width equal to d 1 ( fig3 b ), a length l 1 of 0 . 75 inches , and a spacing between adjacent profiled nodules 39 of 0 . 58 inches has proven effective during testing on the roller brushes 23 a , 23 b described above . the profile ( e . g ., taper ) between the inside edge height h 2 and the outside edge height h 3 preferably corresponds to the edge profile of the wafer w to be cleaned , as shown in fig3 c . a recessed area 41 surrounds both the planar and the profiled nodules 37 and 39 so as to provide a channel through which solvents and slurries may travel . in this manner , slurry residue effectively cleaned from both the wafer &# 39 ; s planar surfaces and from the wafer &# 39 ; s edge surfaces by the planar and profiled brush portions 25 a and 25 b , respectively , may easily travel through the recessed area 41 until gravity and / or an auxiliary liquid flow removes the slurry residue from each brush , as further described below with reference to fig4 . fig4 is a side perspective view of a scrubbing device 43 that employs the inventive brushes of fig3 a - c , and is useful in describing the advantages provided by the present invention . as shown in fig4 the inventive scrubbing device 43 comprises a platform 45 for supporting a wafer w to be cleaned . the first and second brushes 23 a , 23 b , described above , are operatively coupled to the platform 45 so as to contact both the planar and profiled portions of a first side w 1 of the wafer w , and the planar and profiled portions of a second side w 2 of the wafer w , respectively . a conventional spinning mechanism 47 such as a motor , represented generally by reference number 47 , is operatively coupled to the first and second brushes 23 a , 23 b so as to selectively spin the first and second brushes 23 a , 23 b as described below . further , a rotating mechanism ( described below ) is operatively coupled to the platform 45 so as to rotate the wafer w positioned thereon . preferably , as shown in fig4 the platform 45 comprises a plurality of rotating wheels 49 a - c for both supporting and rotating the wafer w . specifically , each rotating wheel 49 a - c has a central notch or groove 51 , having a sidewall angle ( e . g ., of 45 °) such that only the very edge of the wafer w contacts the rotating wheels 49 a - c . the notches thus prevent damage to the front or back wafer surfaces that may otherwise occur . in operation , the first and second brushes 23 a , 23 b are initially in an open position ( not shown ), a sufficient distance from each other so as to allow a wafer to be inserted therebetween . thereafter , the wafer w to be cleaned is positioned between the first and second brushes 23 a , 23 b and the brushes assume a closed position ( fig4 ), sufficiently close to each other so as to both hold the wafer w in place therebetween and to exert a force on the wafer surfaces sufficient to achieve effective cleaning . mechanisms ( not shown ) for moving the brushes 23 a , 23 b between the open and closed positions are well known in the art and are therefore not further described herein . once the brushes 23 a , 23 b are in the closed position , the spinning mechanism 47 is engaged and the first and second brushes 23 a , 23 b begin to spin . preferably the brushes 23 a , 23 b spin in opposite directions , as indicated by arrows s 1 and s 2 in fig4 applying forces to the wafer w in a first direction ( e . g ., downward ) while the wafer w rotates either clockwise or counterclockwise . this drives the wafer into the rotating wheels 49 a - c , so that the wafer w remains captured thereby . the top and bottom surfaces of wafer w are cleaned of slurry residue when contacted by the nodules 37 , 39 of the first and second brushes 23 a , 23 b , respectively . more specifically , the first set of nodules 37 contact the flat surfaces of the wafer w , cleaning slurry residue therefrom , and the second set of nodules 39 contact the edge surfaces of the wafer w , cleaning slurry residue therefrom . while the pair of brushes 23 a , 23 b spin , the rotating wheels 49 a - c which engage the wafer &# 39 ; s edge rotate causing the wafer w to rotate . rotation of the wafer w ensures that the pair of brushes 23 a , 23 b contact each point along the surface of the wafer w . because the brush profile of the inventive scrubbing device 43 is preferably designed to follow the wafer &# 39 ; s profile , a uniform contact force is applied to both the flat surfaces and the profiled surfaces of the wafer w . in this manner , with use of only two brushes , uniform cleaning is achieved across the entire wafer surface . preferably , the scrubbing device 43 is employed within an automated semiconductor device processing system having a loading station for receiving wafers , and a wafer handler for transferring wafers from the loading station to the scrubbing device 43 . the foregoing description discloses only the preferred embodiments of the invention , modifications of the above disclosed apparatus and method which fall within the scope of the invention will be readily apparent to those of ordinary skill in the art . for instance , although inventive brushes are preferably pva roller type brushes , they may be other types of brushes such as pancakes , disks , etc ., and may comprise other materials such as nylon bristles , mohair , etc . the brushes may or may not employ nodules , and the nodules , if used , may assume any shape ( e . g ., square , octagonal , etc .). although the brushes of fig3 a - 4 have only a single profiled end , both ends and / or other locations of a roller - type brush may have profiled portions ( as shown in fig5 a ), or the alternative edge contacting portion described herein , and numerous locations along , or the entire outer perimeter of a pancake - type brush may have profiled portions ( as shown in fig5 b ), or the alternative edge contacting portion described herein . finally , it will be understood by those of ordinary skill in the art , that specific dimensions provided herein are merely exemplary of the presently preferred embodiment of the invention , and the invention is not to be limited thereby . accordingly , while the present invention has been disclosed in connection with the preferred embodiments thereof , it should be understood that other embodiments may fall within the spirit and scope of the invention , as defined by the following claims . | 6 |
referring to fig1 and 3 , the floor mat 10 is a large , planar , flat , body 12 which has a first surface 16 a and a second opposing parallel surface 16 b . the two surfaces 16 a and 16 b are parallel to one another . the periphery of the floor mat is bounded by an interlocking perimeter 26 . the surface 16 a has a texture or three dimensional design and the second surface 16 b has a texture or three dimensional design , the two textures or designs can be the same or different . for purposes of this invention , texture means a three dimensional texture or design embossed in or embossed out of the mat surface . one or both surfaces 16 a and 16 b can also be smooth . the body is made up of two layers 14 a and 14 b ( see fig6 ). the two layers are bound together either by heat welding and / or an adhesive . preferably , the two layers have the same chemical composition so that the two layers have the same coefficient of thermal expansion and the same elastomeric properties so that the two layers work together and respond similarly when subject to temperature changes and forces . the two layers have an outer surface 16 a and 16 b , respectively , and two inner surfaces 17 a and 17 b which preferably form an undulating boundary 20 between the two layers . preferably , the inner surfaces 17 a and 17 b are not parallel to the first and second surfaces . rather , the two inner surfaces 17 a and 17 b in the preferred embodiment meet to form undulating boundary 20 which has a topography of rolling hills and vales . the two outer surfaces 16 a and 16 b are parallel , or generally parallel . in the preferred embodiment , the inner surfaces 17 a and 17 b are generally not parallel to either of the outer surfaces . thus , the thickness 22 of the body is generally constant across the entire length and width of the body . in contrast , in the preferred embodiment , the thicknesses of the first layer and second layer vary as the boundary undulates . thus , the thickness of the first and second layers vary from point to point . the thickness 24 a of the first layer 14 a at a given point , together with the thickness 24 b of the second layer at the same point are equivalent to the thickness 22 of the body . thus , thickness 24 c of the first layer 14 a , at a second point , is less than the thickness 24 a at the first point and the thickness 24 d of the second layer 14 b at the second point is greater than the thickness 24 b of the second layer at the first point . the undulating boundary between the first layer and the second layer resists delamination of the two layers making the mats more robust as explained supra . however , the two layers 14 a and 14 b can be flat planar layers of the same or different thickness , each having a generally uniform thickness . as described above , the texture of the first surface 16 a can be different than the texture of the second surface 16 b . similarly , the color of the first layer and the first surface 16 a can be different than the color of the second layer 14 b . thus , the present mats give the purchaser the opportunity to have a selection of colors and / or a selection of textures . in addition , it permits the purchaser to form a checkerboard pattern or other pattern , assuming enough tiles are utilized , utilizing the different textures and / or colors of the mat tiles . preferably , the mats are made from resilient polymeric materials , such as natural or synthetic rubber , and most preferably from foam elastomeric material , such as polyethylene foam , polyurethane foam , eva - pe foam ( ethylene vinyl acetate - polyethylene foam elastomer ), and eva foam ( ethylene vinyl acetate foam ). preferably , the elastomeric mats are made from a combination of virgin polymer and recycle polymer , such as virgin eva polymer and a mix of virgin and recycle pe ( polyethylene ) polymer . the blend of eva and virgin and recycle pe are compounded together and heated to a temperature below the polymer foaming temperature and pressed into thin sheets through rollers of uniform thickness within uniform temperatures of a range of 5 ° c . ; preferably within a range of 1 ° c . the sheets are 5 to 10 millimeters in thickness . other thicknesses can be employed . the sheets are sandwiched together , normally about six sheets to each mat and placed in trays having a bottom surface with a die or mold for the texture and a top plate . the top plate may also have a die or mold for the texture for the other surface . the tray with the sandwich of layers of the raw composition and the top plate are pressed in a press and heated to a temperature to permit the elastomer to foam and expand . the press is required to keep the distance between the tray and the top plate constant to yield elastomeric foam mat of a predetermined thickness . preferably , the three like sheets have virtually identical compositions and blend together to form one layer of the mat . the two mat layers have slightly different compositions because their respective sheets are made from different raw compositions ( the differences can be slight ) at different times . the virgin pe and the recycle pe have different rates of thermal expansion and different rates of foaming . the raw compositions of the sheets are restricted in vertical movement and unrestricted in horizontal movement between the tray and the top plate in the press when heated . in the preferred embodiment , three layers of the raw composition will have one color and the other three layers of composition will have another color . thus , one side of the mat may be red and the other side may be black , etc . the die in the bottom of the tray places one texture on one surface of the mat , and if the top plate has a die , it places a texture on the other surface of the mat . preferably , the two textures are different although they can be the same . after the foaming reaction is completed by the heating in the press , the tray and the top plate are removed from the press and the unfinished mat is removed from the tray . the mat is allowed to cool and then it is passed to a cutting machine wherein the mat with the interlocking periphery is cut out of the unfinished mat . the mat is now complete . in those cases where the top plate does not have a die for the texture , the mat comes out of the press with a texture only on one surface and a smooth planar other surface . the mat can be sent to a roller mill having a cool roller and a heated roller with a die attached thereto . the heated roller with die only heats the surface not having a texture permitting the heated roller with die to texture the other surface of the mat . the textured surface is kept cool by the cool roller . the mat is passed between two rollers and the roller that touches the texture surface is cool , whereas the roller with the die to give texture to the other surface is hot . the cooling roller prevents destruction or damage to the textured surface created in the press . the above invention is not restricted to the specific embodiments disclosed herein ; modifications and other embodiments of the invention are within the scope of the invention . | 4 |
in brief overview and referring to fig1 a and 1b , an embodiment of the connection detection circuit 8 of the invention which detects when an active communications device , such as an rs232 transmitter , is connected to it and which sets the state of an inactive control line in response thereto is shown . in the embodiment shown , the detection connection circuit 8 is incorporated in an rs232 communications device having five receiver input terminals 10 , 12 , 14 , 16 , 18 . each of the input terminals 10 , 12 , 14 , 16 , 18 is capable of providing an input signal , received from an rs232 communications driver , to a respective receiver circuit 20 , 22 , 24 , 26 , 28 and a respective inactive detection circuit 30 , 32 , 34 , 36 , 38 . an output terminal 40 , 42 , 44 , 46 , 48 of each receiver circuit 20 , 22 , 24 , 26 , 28 is a respective output terminal 40 , 42 , 44 , 46 , 48 of the rs232 communications device . the output terminals 40 , 42 , 44 , 46 , 48 pass the corresponding input signals , received from the rs232 communications driver , as output signals of the rs232 communications device . an output terminal 50 , 52 , 54 , 56 , 58 of each inactive detection circuit 30 , 32 , 34 , 36 , 38 provides the input signal to a corresponding input terminal 60 , 62 , 64 , 66 , 68 of a accumulated delay circuit 70 . an output terminal 72 of the accumulated delay circuit 70 is the output terminal of the connection detection circuit 8 , upon which appears an inactive control signal . when an active rs232 communications driver is connected to the input terminals 10 , 12 , 14 , 16 , 18 of the connection detection circuit , the connection detection circuit 8 of the invention places a first predetermined voltage , as described below , onto its output terminal 72 . when no rs232 communications driver is detected , the connection detection circuit places a second predetermined voltage on its output line 72 . considering one representative receiver circuit 20 and inactive detection circuit 30 , of the connection detection device , the input terminal 10 is connected to ground through a resistor 74 in the receiver circuit 20 , which in one embodiment is 4 . 5 k ohms . the input terminal 10 is also electrically connected to a first input terminal 76 of the inactive detection circuit 30 , and the input of a schmitt trigger 78 , whose output terminal 79 is connected to the input terminal 81 of an inverter 80 . the output terminal 82 of the inverter 80 is connected to a second input terminal 84 of the inactive detection circuit 30 and the input terminal 86 of a second inverter 88 . the output terminal 89 of the second inverter 88 is the output terminal of the device 40 . the first input terminal 76 of the inactive detection block 30 is in electrical connection to one terminal 90 of a fet 94 . the gate 96 of the fet 94 is connected to ground and a third terminal 98 of fet 94 is connected to both the first terminal 100 and the gate 104 of a fet 108 . a third terminal 110 of fet 108 is electrically connected to supply voltage v cc . the common node 114 of fets 96 and 108 is connected to the input terminal 120 of inverter 124 . the output terminal 126 of inverter 124 is connected to one input terminal 128 of a nor gate 130 . the other input terminal 132 of nor gate 130 is the second input terminal 84 of the inactive detection circuit 30 . the output terminal 134 of nor gate 130 is the output terminal 50 of the inactive detection circuit 30 . the logic which generally is embodied in a nor gate operating under what is called positive logic is that an output of high or logic 1 is produced only when both inputs to the nor gate are held at low or logic 0 , and the nor gate produces an output of low or logic 0 if either or both of its inputs are held at high or logic 1 . one obtains the rules under negative logic by inverting all output values in the truth table of the nor gate . the output terminal 50 of the inactive detection circuit 30 is electrically connected to one input terminal 60 of the accumulated delay circuit 70 . this input terminal 60 is the input terminal to one stage 140 of the accumulated delay circuit 70 . there is at least one stage 140 , 142 , 144 , 146 , 148 in the accumulated delay circuit 70 for each receiver circuit 20 , 22 , 24 , 26 , 28 . each stage 140 , 142 , 144 , 146 148 includes at least one pmos fet 150 , 152 , 154 , 156 , 158 and at least one nmos fet 160 , 162 , 164 , 166 , 168 and a delay capacitor 170 , 172 , 174 , 176 , 178 . each input terminal 60 , 62 , 64 , 66 , 68 is electrically connected to the gate 180 , 182 , 184 , 186 , 188 respectively of the pmos fet 150 , 152 , 154 , 156 , 158 and the gate 190 , 192 , 194 , 196 198 respectively of the nmos fet 160 , 162 , 164 , 166 , 168 of its respective stage 140 , 142 , 144 , 146 , 148 . the first terminal 200 , 202 , 204 , 206 , 208 of each respective pmos fet 180 , 182 , 184 , 186 , 188 of each respective stage 140 , 142 , 144 , 146 , 148 is connected to supply voltage v cc . the first terminal 210 of nmos fet 160 is connected to ground . the second terminal 212 of pmos fet 150 and the second terminal 214 of nmos fet 160 are electrically connected to each other and one terminal of capacitor 170 . the second terminal of capacitor 170 is connected to ground . the first terminal of capacitor 170 is also electrically connected to the first input terminal 220 of the nmos fet 162 of the next stage 142 . the second terminal 222 of the nmos fet 162 of the second stage 142 is electrically connected to the second terminal 226 of the pmos fet 152 of the second stage 142 , the first terminal of capacitor 172 and the first terminal 230 of nmos fet 164 of the next stage 144 . again , the second terminal of capacitor 172 is connected to ground . this pattern in which the second terminals of the pmos and nmos fets of one stage are electrically connected to one terminal of the capacitor of that stage and also are electrically connected to the first terminal of nmos fet of the succeeding stage is repeated for each stage of the accumulated delay circuit 70 except the last stage 148 . the common connection of the second terminal 260 of pmos fet 158 , the second terminal 262 of nmos fet 168 , and the first terminal 264 of capacitor 178 of the last stage 148 is connected to the input terminal 270 of inverter 274 . the output terminal 278 of inverter 274 is connected to the input terminal 280 of inverter 284 and the output terminal 288 of inverter 284 is the output terminal 72 of the accumulated delay circuit 70 . in describing the operation of the device only one representative receiver 20 will be considered for simplicity . three possible input conditions are herein discussed . the first is the absence of a drive signal , or the presence a noise signal of small magnitude , such as a few millivolt signal . the second is the presence of a drive signal at high or logic 1 , which in one embodiment may be of the order of hundreds of millivolts or more above a reference voltage such as ground . the third is the presence of a drive signal at low or logic 0 , which in one embodiment may be of the order of hundreds of millivolts or more below a reference voltage such as ground . as will be recognized by those of ordinary skill in the art , these voltages relate simply to one embodiment , and other voltage ranges , which may or may not be symmetrically disposed about a reference voltage such as ground , can equally well be dealt with by a circuit which is another embodiment by the invention . in the first input condition , when there is no driver connected to input terminal 10 , or when a driver is connected to input terminal 10 but is inactive or is floating , the voltage on the input terminal 10 is brought to ground by resistor 74 . this is therefore a low or logic 0 input signal to the schmitt trigger 78 whose output is therefore high or logic 1 . this signal is inverted to low or logic 0 by inverter 80 and again to high or logic 1 by inverter 88 . the high or logic 1 output signal of inverter 88 is presented on the output terminal 40 . the inactive , noise or ground signal on the input terminal 10 which is forced to ground by resistor 74 is also applied to the first terminal 90 of fet 94 , which in con unction with the grounded gate terminal 96 causes fet 94 to be non - conductive . the second terminal 100 and gate 104 of fet 108 being electrically connected in conjunction with the first terminal 110 of fet 108 being electrically connected to supply voltage v cc , turns fet 108 on and brings node 114 high or logic 1 . this high signal applied to the input terminal 120 of inverter 124 results in a low or logic 0 output signal being applied to one input terminal 128 of nor gate 130 . the second input terminal 132 of the nor gate 130 is connected to the output terminal 82 of inverter 80 of the receiver circuit 20 and is also low or logic 0 as described above . the output terminal 134 of nor gate 130 is therefore high or logic 1 . this voltage level is the inactive signal which is placed on the output terminal 50 of the inactive detection circuit 30 . this high or logic 1 signal is applied to the gates 180 and 190 of fets 150 , 160 , respectively , of the first stage 140 of the accumulated delay circuit 70 . when the second input condition , namely an input signal of high or logic 1 , which in this embodiment comprises a signal of several hundred millivolts or more above ground , is applied to input terminal 10 , the voltage on the input terminal 10 is not brought to ground by resistor 74 so long as the driver can source or supply sufficient current to sustain the voltage input signal across resistor 74 . there is therefore a high or logic 1 input signal to the schmitt trigger 78 whose output is therefore low or logic 0 . this signal is inverted to high or logic 1 by inverter 80 , which appears at terminal 82 and is communicated to in put terminal 132 of the nor gate 130 . this high or logic 1 is converted again to low or logic 0 by inverter 88 . the low or logic 0 output signal of inverter 88 is presented on the output terminal 40 . however , since nor gate 130 has one input which is high or logic 1 , it is irrelevant what signal is applied to the other input , because the rules of operation of the nor gate require that its output be a low or logic 0 in any case . this low or logic 0 nor gate 130 output voltage level indicates an active signal at input terminal 10 , and is placed on the output terminal 50 of the inactive detection circuit 30 . when the third input condition , namely an input signal of low or logic 0 is applied to input terminal 10 , the voltage on the input terminal 10 is not brought to ground by resistor 74 so long as the driver can source or supply sufficient current to sustain the voltage input signal across resistor 74 . in this embodiment , there is therefore a low or logic 0 input signal of a value which is typically many hundred millivolts or more below reference ground which is applied via first input terminal 76 of the inactive detection circuit 30 to the first terminal 90 of fet 94 . this signal , in conjunction with the grounded gate terminal 96 causes fet 94 to be conductive . this draws node 114 to a low voltage . second terminal 100 and gate 104 of fet 108 are electrically connected to node 114 . fet 108 therefore is turned off . the low or logic 0 signal at node 114 is applied to the input terminal 120 of inverter 124 which results in a high or logic 1 output signal being applied to input terminal 128 of nor gate 130 . once again , because nor gate 130 has one input which is high or logic 1 its output be a low or logic 0 . this low or logic 0 nor gate 130 output voltage level indicates an active signal at input terminal 10 , and is placed on the output terminal 50 of the inactive detection circuit 30 . the presence of a high or logic 1 signal on the gate 180 of pmos fet 150 from the output terminal 50 of the inactive detection circuit 30 turns pmos fet 150 off . the presence of the high or logic 1 signal on the gate 190 of nmos fet 160 turns nmos pet 160 on , thereby applying a low or logic 0 signal to one terminal of capacitor 170 and to the first terminal 220 of nmos pet 162 of stage 142 . for the rest of the discussion it is assumed that all the input terminals 60 , 62 , 64 , 66 , 68 of the accumulated delay circuit 70 are high or logic 1 indicating that there are no active drivers connected to any of input terminals 10 , 12 , 14 , 16 , 18 and hence all input terminals 10 , 12 , 14 , 16 , 18 are at ground due to resistor 74 and its equivalents in each receiver 22 , 24 , 26 , 28 . because input terminal 62 is high , the gates 182 and 192 of the pmos pet 152 and nmos pet 162 , respectively , are high and pmos pet 152 is off and nmos pet 162 is on in the next stage 142 . because of the high or logic 1 value applied to each input terminal 60 , 62 , 64 , 66 , 68 of the accumulated delay circuit 70 , the pmos fets 154 , 156 , 158 will be off and the nmos fets 164 , 166 , 168 will be on for each subsequent stage 144 , 146 , 148 . because a low or logic 0 signal is applied to the first terminal 220 of nmos fet 162 of stage 142 , the low or logic 0 signal will be propagated to each first terminal 230 , 232 , 234 of each respective nmos fet 164 , 166 , 168 of each respective stage 144 , 146 , 148 and to the input terminal 270 of inverter 274 . inverter 274 inverts the signal thereby applying a high or logic 1 signal to the input terminal 280 of inverter 284 and causing the output terminal 72 of the device to be low or logic 0 . if conversely one input terminal , for example input terminal 16 , were connected to an active driver , then the output terminal 56 of the inactive detection circuit 36 which is connected to the input terminal 66 of the accumulated delay circuit 70 would be low or logic 0 . this signal applied to gates 186 and 196 of pmos fet 156 and nmos fet 166 , respectively , of stage 146 will cause nmos fet 166 to turn off and pmos fet 156 to turn on , thereby applying v cc to capacitor 176 and first terminal 234 of nmos fet 168 of the next stage 148 . capacitor 176 will therefore charge with a characteristic time constant , delaying the propagation of the high or logic 1 signal to the nmos fet 168 . the presence of a high or logic 1 signal on the gate 198 of the nmos fet 168 turns it on thereby applying the v cc or logic 1 which is on terminal 234 to capacitor 178 and the input terminal 270 of inverter 274 . as the capacitor 178 charges , the application of the v cc to input terminal 270 is also delayed . the high or logic 1 input applied to the inverter 274 is inverted to a low or logic 0 signal which in turn is applied to the input terminal 280 of inverter 284 . inverter 284 inverts this signal to high or logic 1 which is then the output signal appearing on device output terminal 72 , indicating that at least one active driver is connected to the receivers 20 , 22 , 24 , 26 , 28 of the device 8 . referring to fig2 another embodiment of the accumulated delay circuit 70 of the invention is shown which includes an additional pmos fets 300 , 304 , 308 , 312 associated with each stage 140 , 142 , 144 , 146 , but the last stage 148 , respectively . in this embodiment , the input terminals 60 , 62 , 64 , 66 , 68 of the accumulator delay circuit are connected not only to the gates of each stage 140 , 142 , 144 , 146 , 148 but also to the gates 320 , 324 , 328 , 332 of the pmos fets 300 , 304 , 308 , 312 . the first terminal 340 , 344 , 348 , 352 of each pmos pet 300 , 304 , 308 , 312 respectively , is electrically connected to the first terminal of each capacitor 170 , 172 , 174 , 176 , respectively . the second terminal 320 , 324 , 328 , 332 of each pmos fet 300 , 304 , 308 , 312 respectively , is connected to node 380 at the first terminal of capacitor 178 &# 39 ; shown in this embodiment as two capacitors in parallel . in this configuration , when any of the input terminals 60 , 62 , 64 , 66 are low or logic 0 , the corresponding pmos fet 300 , 304 , 308 , 312 turns on reducing the delay caused by the corresponding capacitor stages 170 , 172 , 174 , 176 , 178 &# 39 ; and allowing the connection of a driver to the input terminals 10 , 12 , 14 , 16 , 18 of the device 8 to be quickly detected . referring to fig3 a complete rs232 communication device is shown which is constructed in accordance with the invention . the device includes five receiver units 400 , 404 , 408 , 412 , 416 and three driver circuits 420 , 424 , 426 . each receiver unit 400 , 404 , 408 , 412 , 416 includes a respective one receiver circuit 20 , 22 , 24 , 26 , 28 and a respective one inactive detection circuit 30 , 32 , 34 , 36 , 38 ( fig1 a and b ). the input terminals 10 , 12 , 14 , 16 , 18 of the receiver units 400 , 404 , 408 , 412 , 416 are the input terminals of the receiver circuits 20 , 22 , 24 , 26 , 28 . similarly the output terminals 40 , 42 ′, 44 , 46 , 48 are the output terminals of the receiver circuits 20 , 22 , 24 , 26 , 28 . the inactive detection output terminals 50 , 52 , 54 , 56 , 58 are the output terminals of the inactive detection circuits 30 , 32 , 34 , 36 , 38 . these inactive detection output terminals 50 , 52 , 54 , 56 , 58 are connected to the input terminals 60 , 62 , 64 , 66 , 68 of the online device 440 which are also the input terminals to the accumulated delay circuit 70 contained within the online device 440 . the output terminal 72 of the accumulated delay circuit 70 is the output terminal of the online circuit 440 . this output terminal 72 is the input to an inverter 444 which inverts the output signal of the online circuit 440 . enable - 232 ( en232 ) 450 and not - enable - 232 ( en232 bar ) 454 , as described below , are also output terminals of the online circuit 440 as is the pump - shutdown line ( pumpsd ) 458 . the enable - 232 ( bn232 ) 450 and not - enable - 232 ( en232 bar ) 454 terminals provide input signals to a level shifter 480 whose output signal placed on output terminal 490 controls the state of the drivers 420 , 424 , 426 . three additional control lines not - shutdown ( shutdown bar ) 460 , not - online ( online bar ) 464 , and driver - shutdown ( drsd ) 468 , as described below also control the operation of the online circuit 440 . the components of the online device 440 shown in fig3 in addition to the accumulated delay circuit 70 are shown in fig4 . the output termninal 72 of the accumulated delay circuit 70 provides one input signal to a nor gate 500 . the other input signal to the nor gate 500 is provided by the control line not - shutdown ( shutdown bar ) 460 . when not - shutdown ( shutdown bar ) 460 is high it prevents the state of the output line 72 of the accumulated delay circuit 70 from propagating and having any effect . that is , the not - shutdown ( shutdown bar ) 460 terminal when set high causes the output of the accumulated delay circuit to be ignored or overridden . the output signal of the nor gate 500 applied to the output terminal 504 is inverted by inverter 510 and the output signal of the inverter is one input signal to a nand gate 514 . the other input terminal of the nand gate 514 is provided by control line not - online ( online bar ) 464 . the state of not - online ( online bar ) 464 therefore provides a second control signal which determines whether the inactive output signal provided by the accumulated delay circuit 70 is propagated on output line pump - shutdown ( pumpsd ) 458 . the output signal from nand gate 514 is one input signal to a second nor gate 520 . the second input signal to the nor gate 520 is provided by control line driver - shutdown ( drsd ) 468 . the output signal from nor gate 520 is provided on output terminal enable - 232 ( en232 ) 450 and is inverted by inverter 530 and placed on output terminal not - enable - 232 ( en232 bar ) 454 . thus the state of the driver - shutdown terminal ( drsd ) 468 determines , in part , the state of the enable - 232 ( en232 ) 450 and not - enable - 232 ( en232 bar ) 454 and thus provides a way to shut down the drivers 420 , 424 , 426 . variations , modifications , and other implementations of what is described herein will occur to those of ordinary skill in the art without departing from the spirit and the scope of the invention as claimed . accordingly , the invention is to be defined not by the preceding illustrative description but instead by the spirit and scope of the following claims . | 8 |
before describing the detailed operation of one embodiment , it may be best to address how the prior art utilizes precise and rigorous test scripts in a laboratory environment to anticipate the various conditions complex electronic device may face in actual use . fig3 a shows one example of the prior art where simple loop script 30 is used to test only one particular set of parameters . script 30 begins by process 301 which initiates a connection with the device under test ( dut ). the number of iterations for which the test is to be run is set in process 302 . within each iteration , or loop , process 303 sets the value of the specified protocol parameter to the value associated with the loop &# 39 ; s index . this single protocol parameter may be associated with the dut , or with the simulated base station emulator ( bse ). once the parameter is set , the results are measured at process 304 and then outputted or stored to be used in a later analysis , for example , by process 305 . the loop &# 39 ; s index is then incremented in process 306 , and the system determines whether the script has finished its specified iterations in process 307 . based on such a determination , the script either ceases or continues via process 302 with the next iteration , setting the value of the associated protocol parameter to the value associated with the incremented index . for example , fig3 b utilizing the simple loop script illustrated in fig3 a , depicts the values associated with the specified protocol parameter . the system first initiates contact as discussed in process 301 , and then steps through the number of iterations , m , from 1 to 5 . the system then determines what protocol parameter it is to be manipulated . in this example , fig3 a and 3b have set the parameter to the channel number . the value of the channel number is then initialized to the value of m , in this case 1 . after measuring the cell phone &# 39 ; s transmit power at channel 1 , the system then outputs or stores the results and increments the index to 2 . the loop then continues , incrementing the channel number to 2 and measuring the results . eventually , the index is incremented from 5 to 6 , and the system determines whether the loop end index is exceeded . since the loop index has been exceeded , the test is now finished . the test results based on the channel number will then be analyzed for problems encountered during laboratory testing . obviously , an algorithm for testing devices based on the simple loop script 30 is limited in that the designer / engineer can only test the functionality of a device in relation to a single protocol parameter . to test every possible parameter , the script must be run linearly , on the order of the total number of parameters and consuming valuable time and resources . additionally , such an algorithm is incapable of testing the interaction between multiple protocol parameters at various ranges . in recognition of this limitation , the prior art has expanded to include test scripts which utilize multiple loops to test the interaction between various protocol parameters . fig4 a exemplifies an algorithm based on multiple loop test script 40 . after initiating a connection with the device to be tested at process 401 , the outer loop index m is initialized in process 402 and set in process 403 to a specific parameter . the system then initializes the index of an inner loop n , via process 404 , and associates a second parameter with that index in process 405 . the result of the interaction and combination of the two parameters is then measured at process 406 . the result is then either outputted or stored in process 407 , and the inner loop &# 39 ; s end index is incremented in process 408 . the system then determines whether the index of the inner loop is exceeded via process 409 . if the index is not exceeded , the inner loop returns and continues its iteration in process 404 , incrementing the value of the associated protocol parameter to that of the incremented index . once the inner loop &# 39 ; s iterations are complete , the system determines that the inner loop &# 39 ; s index has been exceeded and exits the inner loop . the index of the outer loop is then incremented 4 in process 10 , and the system determines whether the outer end index has been exceeded in process 411 . if the outer end index has not been exceeded , the outer loop continues its next iteration , setting the value of the associated protocol parameter to that of the incremented index in process 403 . the system then reinitializes the index of the inner loop ; the outer loop &# 39 ; s parameter remains fixed as the inner loop &# 39 ; s parameter is increased with each iteration of the inner loop . the result from each iteration is again outputted or stored in process 407 . once the outer loop &# 39 ; s end index has been exceeded in process 411 , the test ends and the results are analyzed for issues arising with the different permutations . fig4 b , utilizing the multiple loop script illustrated in fig4 a , depicts indexing the outer loop m ( channel number in this example ) in a range from 1 to 5 . the system then determines and associates a specific protocol parameter with the outer index , selecting the channel number and setting its initial value to that of m . in the example , the system then determines the number of iterations the inner loop ( power level in this example ) is to traverse . in this instance , n is set to iterate four times . through each iteration of the inner loop , the script tests the functionality of the first channel with power levels 1 through 4 . after each iteration of the inner loop , i . e . channel number set to 1 and power level set to 1 , the system outputs the results , increments the index of the inner loop , and then repeats the measurement . the channel number remains at 1 , while the power level is incremented to 2 , 3 , and 4 , respectively . ( thus , each channel will be tested four times , each time using a different power level .) once the power level is incremented beyond 4 , the inner loop ceases its iterations . the system then increments the index of the outer loop , m , and the channel number is changed to 2 ( two ). upon re - entering the inner loop , the script then tests the combination of channel number 2 with each power level . the process continues until the outer index is incremented to 5 . the script then exits and the test ceases . while script 40 ( fig4 a ) is an improvement over simple loop script 30 ( fig3 a ), the use of such a multiple loop algorithm still presents a number of problems for designers . while the script may be written to include multiple inner loops , given the number of possible protocol parameters , testing every possible permutation is time consuming and infeasible . moreover , since the sequence of testing is well - defined , it does not correlate well with real - world conditions . for example , in an everyday setting , a user will normally not encounter a device that sequentially iterates through the various ranges of each parameter . instead , the device will transition between various parameter values based on various conditions which are not simulated . as such , the multiple loop algorithm continues to limit the ability of a designer to effectively simulate real - world conditions and address the issues a user will face under real - world conditions . and while field testing remains a valuable alternative available to designers / engineers , providing them with real - world transitions , field testing is expensive . additionally , it is often difficult or impossible to reproduce the exact situation in a protocol process that caused the failure . it then becomes exceedingly difficult to diagnose problems encountered in field testing in order to remedy the design problem . as such , the desire and need exists for a testing protocol that enables the designer of complex electronic equipment in a laboratory setting to randomly test different permutations of the protocol parameters that affect complex electronic equipment in an effort to simulate and address the real - world use of such devices . turning now to fig1 , there is shown one embodiment detailing system and method 10 utilizes pseudo - random loop algorithm 14 . such an algorithm can be embedded in system controller 13 ( or in mobile phone tester 12 ) which in turn , sends the parameters , permutations , and values for each parameter to be tested to mobile phone tester 12 . controller 13 receives the results of the test from mobile phone tester 12 for further processing and for presentation to a user of system 10 . mobile phone tester 12 itself contains base station emulator ( bse ) 120 and is in direct communication with dut 11 . controller 13 can be a pc or a specialized test set , if desired , and could contain memory as well as processing capability . a graphical user interface could be provided for presentation of the data to the user . as noted above , system 10 contains pseudo - random loop algorithm 14 that is responsible for randomly testing available permutations of protocol parameters . fig2 a details one embodiment 20 of such an algorithm . pseudo - random loop algorithm 20 comprises , for example , pseudo - random seed 205 , parameter list for looping 202 , range , or the allowed values of each parameter 203 , and the number of iterations desired 204 . any number of other parameters can be established as desired . if desired , a fully random algorithm could be used , but by using the seed to establish pseudo - randomness it is easier to achieve test repeatability . as shown in fig2 a , process 200 of algorithm 20 first initiates a connection with the dut . if this is to be a repeat test , process 201 directs the retrieval from memory of the seed , and the parameters of the prior test via process 221 . if this is a new test then the system , via process 202 , sets the protocol parameters which are associated both with the bse and dut . under such an algorithm , the number of parameters is neither limited by the amount of time it will take to iterate through each possible permutation nor by the number of iterations . the range for each protocol parameter is then determined in process 203 , and the system sets the number of iterations for the loop in process 204 . another embodiment of such a system may have the system prompt the designer / engineer for the protocol parameters to be tested , the range for each parameter , and the number of iterations via manual input 121 ( fig1 ). embodiments may utilize a combination of user input and system determination in setting each of these values . once the number of iterations has been determined , the algorithm then sets the seed for the pseudo - random generator in the loop . the seed could be determined by the code designer from a random number generator , or the user ( or system ) could use any number , for example , the time since midnight in milliseconds . the seed for pseudo - random generation is then retained for reference in process 206 , and the first iteration of the loop begins in process 207 . utilizing the pseudo - random seed and loop index , process 205 pseudo - randomly sets the value of each protocol parameter in process 208 . in the example being illustrated , the algorithm would set values for parameters associated with both the dut and , if desired , the bse , with no limitation on the number of parameters that may be included in the testing . once the specified parameters have been set , the results are then measured via process 209 and then either outputted or stored via process 210 . it is important to note that , though the algorithm is embodied within system controller 13 , the results from the test will first be recorded by mobile phone tester 12 . tester 12 may then either retain the results until all iterations of the loop are complete or may immediately send the results back to system controller 13 . this communication can be either by wireline or wireless . using a stack based bse allows protocol parameters such as channel number , channel type , or power level to be changed in any order because it handles all the protocol messages for making the transition between states in the bse and dut . using the seed and loop index number in the system controller to pseudo - randomly set protocol parameters allows for great variation in the order protocol parameters are sequenced . once the result has been preserved , the loop end index is incremented via process 211 , and the algorithm determines whether the loop has exceeded its end index , process 212 . if the end index has not been exceeded , the loop continues with its next iteration . once the loop &# 39 ; s end index is exceeded , the test ends and , depending on the specific embodiment , the results from the final test , which have been recorded by mobile phone tester 12 , may immediately be sent back to system controller 13 . alternatively , mobile phone tester 12 may return the results from all permutations to system controller 13 . fig2 b and 2c are examples of possible permutations that may result from the utilization of pseudo - random loop algorithm 20 . after initiating a connection with the dut , the system or the designer / engineer , or a combination thereof , selects the channel number and power level ( and any other parameters desired ) as the protocol parameters in the test . note that in this context the magnitude can be either the level ( such as power level , channel number , etc .) or could be a value ( such as pcs band ). the system or designer / engineer then instructs the system to iterate , for example , 20 times and the pseudo - random seed is generated and retained for future use . the loop index , m , is initialized to 1 and the pseudo - randomly generated seed is used to set the values of the channel number and power level . note that in fig2 b in step 1 , the system is testing channel 4 at a power level of 2 , while at step 2 , channel 2 is being tested at a power level of 1 . the system then measures the dut &# 39 ; s transmit power with such a permutation , and outputs or stores the result . the value m is then incremented . since the end index has not been exceeded , the system repeats the test with different values , generated by the pseudo - random seed , for each parameter . this process continues until the loop end index is exceeded , thereby ending the test . as noted above , the results from each iteration may have been stored locally in tester 12 or may have been immediately transmitted back to system controller 13 . in either case , all results are transmitted back to system controller 13 to be preserved for display and / or analysis . note also that the next time a test is run ( as shown in fig2 c ) a new seed is created and this relationship between the channel number and power level ( or other parameters being tested ) is different , as is the order of channel testing . thus , random testing patterns are achieved even with the same loop index parameters . note also that the sequence shown in fig2 b and 2c are examples for illustration purposes only since the actual testing would be random . also the parameters ( such as channel and power are likewise only used as examples ) unlike the permutations discussed with respect to fig3 b and 4b of the prior art . in a specific embodiment , system controller 13 ( fig1 ) may contain : memory containing the pseudo - random loop algorithm ; a record of each transition between the randomly - generated protocol parameters and the results from each different test ; and the controller could be used for evaluating all the results from a given test sequence ; and could also be used to store and analyze all the protocol messages that passed between the base station emulator ( bse ) and dut for proper operation or errors . having a stack - based bse in the mobile phone tester handles all of the messages required for transition from one protocol state to another , such as during a channel change . it also allows the mobile phone tester to respond to messages from the dut algorithmically in a way similar to real networks and thus eliminates the need for predetermined protocol states . as shown in fig2 a , if a particular test sequence is to be repeated , process 221 , either under system control or under control of the user , would set the seed and parameters to those of the test sequence to be repeated . because the seed and parameters of the sequence are the same as those for the original sequence the looping algorithms would result in the original sequence of protocol state changes and tests would be exactly repeated . this pattern could also be applied to the same dut or more devices as desired . in communication with system controller 13 , mobile phone tester 12 is responsible for initiating the connection with the electronic device being tested . for example , in fig1 , mobile phone tester 12 maintains a connection with a dut . a connection may be initiated between mobile phone tester 12 and dut 11 in a number of different ways . in one embodiment , the tester may be a base into which the cell phone is plugged . the tester then has a direct , hard - wired connection to the device and may manipulate the dut &# 39 ; s protocol parameters through electronic circuitry . in another embodiment , the tester may be wirelessly connected to the dut and this may emulate a base station or centralized server which communicates with the dut via wireless networks . advantages of utilizing a pseudo - random loop system and method over the prior art are numerous . a pseudo - random algorithm more closely mimics the real networks for which the electronic device under test was designed . under real network conditions , the protocol processes are exceedingly random . depending on environmental and device conditions , the bse &# 39 ; s and dut &# 39 ; s parameters may randomly alter the values of a number of different parameters in an effort to provide maximum functionality of the device . such randomly - generated variations , such as variations in weather conditions , battery power , location of user or other users , etc ., can affect an electronic device in ways unable to be simulated under tests using the prior art . by utilizing the seed to pseudo - randomly generate the sequence , the sequence of parameters the electronic device faces appears to be more random and more closely simulates real - world conditions . by utilizing a pseudo - random loop system and method , a far larger and more thorough sequence of protocol transitions and dut states may be tested than could ever be practical with script testing . the random generation of parameter values alleviates the need for identifying every possible permutation and , by extension , generating complex multiple loop scripts which must run each permutation in a linear fashion . by retaining the sequence of protocol transitions , a failure may then be analyzed according the sequence of transitions it underwent prior to the failure . thus , while the parameters were tested in random fashion , such randomness , for any one test , is prescribed and repeatable , either under control of controller 13 or by phone tester 12 because the values of the seed and parameters are maintained in memory . this further enables the designer to more easily duplicate the failure in a more real - world simulation . use of a pseudo - random loop system and method enables the designer to more easily test a complex electronic device &# 39 ; s response to the interaction of multiple parameters . under such an algorithm , the designer is not limited to testing only the parameters on a device or only the parameters associated with the base station . with such an algorithm , the designer is able to test the interaction between various parameters , regardless of which device the parameters are associated with , as well as analyze how the device reacts to the randomly - generated transitions between the parameters . it should be recognized that many different embodiments of the system and method described therein may be used to achieve the same results . for example , pseudo - random loop algorithm 20 may be placed on a chip which is inserted into a system control device or mobile phone tester . additionally , system control 13 and tester 12 may be combined in such a manner that the need for two separate devices is negated . a single device may then be used to maintain the results of the testing , manipulate the parameters of the bse , and initiate contact with and manipulate the parameters of the dut . additionally , the concepts discussed herein are not limited to the testing of mobile phones , but may be useful in many different areas , including , for example , cordless telephones , paging devices , vehicle navigation systems , wireless networks , as well as other complex electronic systems outside the communication industry , such as elevators , automobile , traffic light controllers , computers , chip sets , etc . | 6 |
as used herein , the term “ refinery stream ” generally refers to an apparatus or instrumentality of a chemical process ( e . g ., a process to refine crude hydrocarbons ), such as an oil refinery process , which is , or can be , susceptible to contamination with a polar molecule . refinery streams include , but are not limited to , processing streams in connection , or fluid communication with , heat transfer components such as a heat exchanger , a furnace , a crude preheater , a coker preheater , or any other heaters , a fcc slurry bottom , a debutanizer exchanger / tower , other feed / effluent exchangers and furnace air preheaters in refinery facilities , flare compressor components in refinery facilities and steam cracker / reformer tubes in petrochemical facilities . refinery streams can also be in connection , or in fluid communication with , other instrumentalities in which heat transfer can take place , such as a fractionation or distillation column , a scrubber , a reactor , a liquid - jacketed tank , a pipestill , a coker and a visbreaker . refinery streams can also be in connection , or in fluid communication with , tubes , piping , baffles and other process transport mechanisms that are internal to , at least partially constitute , and / or are in fluid communication with , any one of the above - mentioned components . it is understood that the term refinery stream includes , but is not limited to , process streams in connection with chemical processes besides petrochemical refining operations . as used herein , the terms “ hydrocarbon fluid ” or “ hydrocarbon liquid fluid ” refer to a fluid composition containing at least predominately compounds comprising hydrogen and carbon . such compounds include , for example , saturated alkanes , and / or unsaturated alkenes and alkynes . a hydrocarbon fluid can also include cycloalkanes , cycloalkenes and cycloalkynes . furthermore , a hydrocarbon fluid can include aromatic hydrocarbons or arenes , alkanes , alkenes and alkyne - based compounds . the hydrocarbon compounds can be unsubstituted or substituted with additional chemical groups . as used herein , the term “ polar molecule contaminant ” refers to any polar compound present in a refinery stream that has a surface affinity for high surface energy compounds , wherein the polar molecule contaminant adsorbs onto the surfaces of such high surface energy compounds . as used herein , the term “ nanoparticle compound ” refers to a compound with high surface energy and / or high surface area , as described in more detail below , wherein the surface of the compound has the capacity to adsorb polar molecules . reference will now be made in detail to the various aspects of the present invention . the method and corresponding steps of the invention will be described in conjunction with the figures and examples provided herein . in accordance with the present invention , a method for reducing polar molecule contaminants in a refinery stream is provided . this reduction in contaminants is achieved by adding an amount of a nanoparticle compound to a refinery stream effective to remove the polar molecule contaminants , wherein the polar molecule contaminants are adsorbed onto the nanoparticle compound , and separating the nanoparticle compound - polar molecule complex from the refinery stream . the nanoparticle compound can be added to the refinery stream in separate batches , or in a continuous refinery stream . in accordance with another embodiment of the invention , the refinery stream includes a hydrocarbon fluid . for example , the refinery stream can be in connection with a petrochemical refinery operation . in another embodiment of the invention , the nanoparticle compound is introduced to be freely dispersed within the hydrocarbon fluid . in accordance with another aspect of the present invention , a system is provided that is capable of removing polar contaminates from a refinery stream . the system includes at least one fluid , solution , solvent or mixtures thereof , containing a polar molecule contaminant ; a supply of a nanoparticle compound to be introduced to the refinery stream , wherein the polar molecule contaminant is capable of being adsorbed onto the nanoparticle compound to form a nanoparticle compound - polar molecule complex ; and a separator in fluid communication with the refinery stream for separating the nanoparticle compound - polar molecule complex from the refinery stream . in accordance with the invention , the addition of an amount of a nanoparticle compound to a refinery stream effective to adsorb a polar molecule contaminant to form a nanoparticle compound - polar molecule complex , and separation of the nanoparticle compound - polar molecule complex from the refinery stream is effective in reducing contamination of the refinery stream . while not limited thereto , the addition of a nanoparticle compound according to the methods of the invention is particularly suitable in reducing or preventing polar molecule contamination . in accordance with one embodiment of the invention , the polar molecule contaminants include organic and inorganic particulates . organic particulates ( such as precipitated asphaltenes and coke particles ) include , but are not limited to , insoluble matter precipitated out of solution upon changes in process conditions ( e . g . temperature , pressure , or concentration changes ) or a change in the composition of the refinery stream ( e . g . changes due to the occurrence of a chemical reaction ). inorganic particulates include , but are not limited to silicon dioxide , clay and iron oxide . in accordance with another embodiment of the invention , a polar molecule contaminant includes , but is not limited to , sulfur - containing compounds , nitrogen - containing compounds , porphyrin , asphaltene , naphthenic acid , mercury , carbon dioxide and particulates . in accordance with another embodiment of the present invention , the nanoparticle compound is added to a refinery stream , for example , a hydrocarbon fluid , which contains polar molecule contaminants , including organic and inorganic particulates as defined above . the refinery stream can contain any amount of particulates , such as , for example , 1 - 10 , 000 ppm . in accordance with one embodiment of the invention , the nanoparticle compound is a compound comprising a high surface energy . generally , surface energy quantifies the disruption of intermolecular bonds that occurs when a surface is created , wherein the surface of a compound is less energetically favorable than the remainder of the compound . in accordance with one embodiment of the invention , the surface energy of the nanoparticle compound is at least about 10 mj / m 2 , at least about 20 mj / m , at least about 30 mj / m 2 , at least about 40 mj / m 2 , at least about 50 mj / m 2 , at least about 60 mj / m 2 , at least about 70 mj / m 2 , at least about 80 mj / m 2 , at least about 90 mj / m 2 , or at least about 100 mj / m 2 . in accordance with one embodiment of the invention , the nanoparticle compound has a diameter of from about 0 . 01 to about 1000 nm , more preferably from about 1 to about 60 nm , and more preferably from about 1 to about 10 nm . in one embodiment , the nanoparticle compound has a diameter of from about 40 - 60 nm . in other embodiments , the nanoparticle compound has a diameter of about 3 nm . in yet another embodiment of the invention , the nanoparticle compound has a diameter of about 1 mm or less . in other embodiments of the invention , the nanoparticle compound has a diameter of about 0 . 5 mm or less . without being bound to any theory , it is believed that the capacity of a unit mass of nanoparticle compound to adsorb a polar molecule contaminant increases as the surface area of the unit mass of nanoparticle compound is increased . in accordance with one embodiment , the present invention includes a method of increasing the capacity of a nanoparticle compound to adsorb a polar molecule contaminant by decreasing the size of the nanoparticle compound , for example , as measured by the nanoparticle compound diameter . for example , the size of the nanoparticles comprising a unit mass of nanoparticle compound can be decreased , thereby increasing the adsorbent capacity of the unit mass of nanoparticle compound . in one embodiment , the methods of the invention include decreasing the size of the nanoparticle compound prior to introducing the nanoparticle compound into a refinery stream , for example , a hydrocarbon fluid , to increase the nanoparticle compound &# 39 ; s capacity to remove polar molecule contaminants from the refinery stream . the size of the nanoparticle compound can be decreased by any known means in the art . in one non - limiting example , the nanoparticle compound includes fe 2 o 3 , and decreasing the size of the nanoparticle includes chemically reducing the fe 2 o 3 at a temperature of from at least about 100 - 400 ° c ., from at least about 125 - 350 ° c ., from at least about 150 - 300 ° c ., or from at least amount 175 - 200 ° c . to fe 3 o 4 . in another non - limiting example , the nanoparticle compound includes fe 2 o 3 , and decreasing the size of the nanoparticle includes chemically reducing the fe 2 o 3 at a temperature of about 150 ° c . to fe 3 o 4 . in other embodiments of the invention , heating the nanoparticle compound prior to introducing the nanoparticle compound into a refinery stream , for example , hydrocarbon fluid , increases the nanoparticle compound &# 39 ; s capacity to remove polar molecule contaminants from the refinery stream . in one embodiment of the invention , the nanoparticle compound is heated at a temperature of from about 100 ° c . to about 1000 ° c ., or from about 100 ° c . to about 750 ° c ., or from about 100 ° c . to about 500 ° c ., or from about 100 ° c . to about 200 ° c . in other embodiments of the invention , the nanoparticle compound is heated at a temperature of at least about 250 ° c . in yet other embodiments of the invention , the nanoparticle compound is heated at a temperature of at least about 350 ° c . in other embodiments of the invention , the nanoparticle compound is heated prior to introducing the nanoparticle compound into a refinery stream , for example , hydrocarbon fluid , at a temperature up to the magnetic phase transition temperature of the nanoparticle , or a magnetic compound present in the nanoparticle . in other embodiments , the nanoparticle compound is heated prior to introducing the nanoparticle compound into a refinery stream , for example , hydrocarbon fluid , at a temperature above about 250 ° c . and below the magnetic phase transition temperature of the nanoparticle , or a magnetic compound present in the nanoparticle . in one non - limiting example , when the magnetic compound is magnetite , the nanoparticle can be heated at a temperature , for example , between about 250 ° c . and 585 ° c . in accordance with one embodiment of the invention , the nanoparticle compound has a surface area from at least about 0 . 5 - 1000 m / g , from at least about 1 - 750 m 2 / g , from at least about 5 to 500 m 2 / g , from at least about 7 - 400 m 2 / g , from at least about 15 - 200 m 2 / g as measured by nitrogen bet . in accordance with one embodiment of the invention , the nanoparticle compound has a surface area from at least about 10 - 300 m 2 / g as measured by nitrogen bet . in accordance with another embodiment of the invention , the nanoparticle compound can be introduced into a refinery stream , for example , a hydrocarbon fluid , at an acidic ph ( for example , a ph that is less than ph 7 . 0 ), a neutral ph ( for example , at about ph 7 . 0 ), or at a basic ph ( for example , a ph greater than ph 7 . 0 ). in one embodiment of the invention , the nanoparticle compound is introduced into the refinery stream at a ph greater than 1 . 0 . as encompassed by the present invention , the nanoparticle can be introduced into a refinery stream , adsorb a polar molecule contaminant onto its surface , and be separated from the refinery stream without changing the temperature of the refinery stream , for example , a hydrocarbon fluid . thus , in accordance with one embodiment , the methods of the invention includes maintaining a temperature of a refinery stream following introduction of the nanoparticle compound at a similar temperature as prior to the introduction of the nanoparticle compound . in other embodiments of the invention , the temperature of the refinery stream is increased or decreased before , after , or at the same time as the nanoparticle is introduced into the refinery stream . this is in contrast to prior art methods , for example , methods of removing contaminants using fixed bed assemblies , which require temperature changes in removing contaminants from a refinery stream . in one embodiment , the nanoparticle is introduced into a hydrocarbon stream at a temperature up to the magnetic phase transition temperature of the nanoparticle , or a magnetic compound present in the nanoparticle . in one non - limiting example , when the magnetic compound is magnetite , the nanoparticle can be introduced into a hydrocarbon stream at a temperature up to , for example , about 585 ° c . as encompassed by the present invention , the nanoparticle compound can be introduced into a refinery stream , for example a hydrocarbon fluid , adsorb a polar molecule compound onto its surface , and be separated from the refinery stream without changing the pressure of the refinery stream . thus , in accordance with one embodiment , the methods of the invention further include maintaining a pressure of the refinery stream following introduction of the nanoparticle compound at a similar pressure as before the introduction of the nanoparticle compound . in other embodiments of the invention , the pressure of the refinery stream is increased or decreased before , after , or at the same time as the nanoparticle compound is introduced into the refinery stream . this is in contrast to prior art methods , for example , methods of removing contaminants using fixed bed assemblies , which require pressure changes in the refinery stream to remove the contaminants . as contemplated by the present invention , the nanoparticle compound is introduced into a refinery stream , for example , a hydrocarbon fluid , in an amount effective to remove a polar molecule contaminant from the refinery stream . in one non - limiting embodiment , the nanoparticle compound is introduced into the refinery stream at a concentration of from about 0 . 01 weight % to about 99 weight %, from about 0 . 01 weight % to about 90 weight %, from about 0 . 01 weight % and 80 weight %, from about 0 . 01 weight % to about 70 weight %, from about 0 . 01 weight % to about 60 weight %, from about 0 . 01 weight % to about 50 weight %, from about 0 . 01 weight % to about 40 weight %, from about 0 . 01 weight % to about 30 weight %, from about 0 . 01 weight % to about 2 . 0 weight %, from about 0 . 01 weight % to about 10 weight %, from about 0 . 01 weight % to about 5 weight %, or from about 0 . 01 weight % to about 1 weight % of the refinery stream . in one non - limiting embodiment , the nanoparticle compound is introduced into the refinery stream at a concentration of from about 0 . 1 to about 15 weight % of the refinery stream . in one embodiment of the invention , the nanoparticle compound is introduced into the refinery stream , for example , a hydrocarbon fluid , at a concentration of 10 weight % of the refinery stream . in other embodiments , the nanoparticle compound is introduced into the refinery stream at a concentration of 1 weight % of the refinery stream . in accordance with another embodiment of the invention , the nanoparticle compound is introduced into a refinery stream , for example , a hydrocarbon fluid , in amount effective to reduce the concentration of polar molecule contaminants in the refinery stream . in one embodiment , the amount of nanoparticle compound introduced into the refinery stream is effective to reduce the concentration of polar molecule contaminants in the refinery stream from about 0 % to 100 %, or from about 0 to about 90 %, or from about 0 to about 80 %, or from about 0 to about 70 %, or from about 0 to about 60 %, or from about 0 to about 50 %, or from about 0 to about 40 %, or from about 0 to about 30 %, or from about 0 to about 20 %, or from about 0 to about 10 %, or from about 0 to about 5 %, or from about 0 to about 1 %. in accordance with one embodiment of the invention , the nanoparticle compound is a magnetic compound . because the compound is magnetic , and can be attracted or repelled by a magnetic field , the nanoparticle compound of the invention , and / or the nanoparticle compound - polar molecule complex , can be separated from a refinery stream , for example , a hydrocarbon fluid , by applying a magnetic field to the nanoparticle compound and / or the nanoparticle compound - polar molecule complex . in accordance with another embodiment of the invention , the nanoparticle compound can comprise any material that can be attracted to a magnetic field , for example , but not limited to , iron , nickel , cobalt , magnetite or mixtures thereof . in accordance with another embodiment of the invention , the nanoparticle compound can be separated from the refinery stream , for example , a hydrocarbon fluid , by applying a magnetic field to the nanoparticles . in one embodiment , the nanoparticle compound has a polar molecule contaminant adsorbed on its surface to form a nanoparticle compound - polar molecule complex . in other embodiment , the polar molecule contaminant is absorbed into the nanoparticle compound to form a nanoparticle compound - polar molecule complex . the magnetic field can attract or repel the nanoparticle compound - polar molecule complex to or away from the magnetic source so that the nanoparticle compound - polar molecule complex can be collected and removed from the refinery stream . the magnetic field can be produced by any means known in the art . according to one embodiment , separating the nanoparticle compound - polar molecule complex from a refinery stream , for example , a hydrocarbon fluid , includes applying a magnetic field to the nanoparticle compound - polar molecule complex to separate the complex from the hydrocarbon liquid fluid . in one embodiment , the nanoparticle compound or the nanoparticle compound - polar molecule complex can be separated from a refinery stream in the absence of a filter . in other embodiments , a filter is present . in other embodiments of the invention , a nanoparticle compound - polar molecule complex can be removed from a fluid by passing the fluid comprising the nanoparticle compound - polar molecule complex through an apparatus , such as , but not limited to , a packing or filter that is magnetized , for example , by an electric current or an electromagnetic field . by passing the fluid through the magnetic apparatus , the nanoparticle compound - polar molecule complex can be attracted to or repelled from the apparatus , thereby removing the nanoparticle compound - polar molecule complex from the fluid passed through the apparatus . when the nanoparticle compound - polar molecule complex is attracted to the apparatus , the magnetic field can be turned off periodically to dislodge the nanoparticle compound - polar molecule complex attached to the apparatus . in yet other embodiments , the apparatus is not magnetized , and the nanoparticle compound - polar molecule complex is separated from the fluid by a physical interaction with the apparatus , such that the fluid passes through or around the apparatus , while the nanoparticle compound - polar molecule complex is bound to the apparatus . furthermore , the addition of a nanoparticle compound to a refinery stream , as described in connection with the present invention , can be combined with other techniques for reducing and / or mitigating polar molecule contamination . such techniques include , but are not limited to , fixed bed adsorption , as generally known in the art ( see , e . g ., u . s . pat . nos . 5 , 730 , 860 and 7 , 148 , 389 , which are each hereby incorporated by reference in their entireties ). following the removal of a nanoparticle compound - polar molecule complex from a refinery stream , for example , a hydrocarbon fluid , the nanoparticle compound can be regenerated to removed the polar molecule contaminants adsorbed onto the surface of the nanoparticle compound , and increase the nanoparticle compound &# 39 ; s ability to adsorb additional polar molecule contaminants . in accordance with one embodiment , a nanoparticle compound of the present invention can be regenerated from a nanoparticle compound - polar molecule complex by heating the nanoparticle compound - polar molecule complex . in one embodiment , regenerating the nanoparticle compound includes heating the nanoparticle compound - polar molecule complex at a temperature of at least about 250 ° c . in other non - limiting embodiments , a nanoparticle compound of the present invention can be regenerated from a nanoparticle compound - polar molecule complex by heating the nanoparticle compound - polar molecule complex at a temperature above about 250 ° c . and below the magnetic phase transition temperature of the nanoparticle , or the magnetic compound present in the nanoparticle . in one non - limiting example , when the magnetic compound is magnetite , the nanoparticle can be heated at a temperature , for example , between about 250 ° c . and 585 ° c . in other embodiments of the invention , the nanoparticle compound can be regenerated from a nanoparticle compound - polar molecule complex by contacting the nanoparticle compound - polar molecule complex with water , or any other polar liquid or solution . in one embodiment , regenerating the nanoparticle compound includes immersing the nanoparticle compound - polar molecule complex in water . referring now to fig1 , there is shown an exemplary system and method according to one embodiment of the invention for removing a polar molecule contaminant from a fluid , for example , a hydrocarbon fluid . as shown in fig1 , magnetite nanoparticles ( 1 ) are introduced into a first tank ( 2 ) containing fluid ( 3 ) comprising polar molecule contaminants ( 4 ). the polar molecule contaminants are adsorbed onto the surface of the magnetite nanoparticles to form nanoparticle compound - polar molecule complexes ( 5 ). a magnetic force produced by a magnet ( 6 ) is then exerted on the nanoparticle compound - polar molecule complexes , thereby attracting the nanoparticle compound - polar molecule complexes towards the magnet , and the fluid removed from the first tank to a second tank ( 7 ), wherein the removed fluid is free from , or substantially free from , the nanoparticle compound - polar molecule complexes ( 5 ). the present invention is further described by means of the examples , presented below . the use of such examples is illustrative only and in no way limits the scope and meaning of the invention or of any exemplified term . likewise , the invention is not limited to any particular preferred embodiments described herein . indeed , many modifications and variations of the invention will be apparent to those skilled in the art upon reading this specification . the invention is therefore to be limited only by the terms of the appended claims along with the full scope of equivalents to which the claims are entitled . sum frequency generation ( sfg ) was used to examine the affinity of asphaltene or porphyrine for sapphire , a high energy surface . sample of deuterated toluene that contain either asphaltene or porphyrine , two polar molecule contaminants , were contacted with sapphire . the sfg spectra of the interface between the sapphire and the toluene - asphaltene or toluene - porphyrine was generated . deuterated toluene does not produce any spectral features in the 2800 - 3200 cm − 1 and the spectral structures shown in fig2 are produced by asphaltene or porphyrine at the liquid / sapphire interface , indicating the adsorption of these two polar molecules onto the sapphire . this is concluded based on the fact that randomly oriented molecules at the interface do not produce any sfg signals . when molecules such as asphaltene and porphyrine adsorb onto the solid their random orientational arrangement is lifted and able to produce sfg signals . therefore , the sfg resonance features in the spectra , shown in fig2 , are the signatures of adsorbed asphaltene and porphyrine onto the solid surface . this demonstrates that these polar molecules have strong affinity toward high surface energy materials , such a sapphire . a toluene solution containing 250 ppm of asphaltene ( extracted from arab light crude ) was cleaned using 10 wt % of 40 - 60 nm magnetite particles . fig3 shows a toluene solution containing 250 ppm asphaltene to which no magnetite nanoparticles have been added ( 1 ), and a toluene solution containing 250 ppm asphaltene to which the nanoparticles have been added ( 2 ). the magnetite nanoparticles with adsorbed asphaltene in ( 2 ) have been attracted to a magnet ( 3 ) which exerted an attractive magnetic force on the magnetite nanoparticles . fig3 shows a reduction in asphaltene concentration only . the initial amounts of solvent in ( 1 ) and ( 2 ) were not identical , and the lower level of solution in ( 2 ) is not due to liquid uptake by the nanoparticles . 770 ppm of asphaltene ( extracted from arab light crude ) was prepared in toluene ( fig4 , solution 0 ). 10 wt % of 40 - 60 nm magnetite nanoparticles were then added to the solution and kept in contact with the solution for approximately five minutes . the nanoparticles were removed using a magnet ( fig4 , solution 1 ). 10 wt % of 40 - 60 nm magnetite nanoparticles were added to solution 1 . after approximately five minutes the nanoparticles were removed using a magnet ( fig4 , solution 2 ). 10 wt % of 40 - 60 nm magnetite nanoparticles were then added to solution 2 . after approximately five minutes the nanoparticles were removed using a magnet ( fig4 , solution 3 ). the uv - vis transmission spectrum of each solution was collected and the absorption was calculated . using the known value of the concentration of “ solution 0 ” and the measured value of the total uv - vis absorbance of each solution , the asphaltene concentration of each solution was determined . fig4 depicts a graph showing the asphaltene concentration for each solution , demonstrating the removal of asphaltene using magnetite nanoparticles . the initial 770 ppm concentration of asphaltene was reduced by 87 . 5 % after the first treatment with magnetic nanoparticles , and was reduced by about 100 % after the second treatment with the magnetite nanoparticles . 800 ppm of porphyrin solution was prepared in toluene ( fig5 , solution 0 ). 10 wt % of 40 - 60 nm magnetite nanoparticles were added to the solution and kept in contact with the solution for approximately five minutes . the nanoparticles were removed using a magnet ( fig5 , solution 1 ), 10 wt % of 40 - 60 nm magnetite particles were then added to solution 1 . after approximately five minutes the nanoparticles were removed using a magnet ( fig5 , solution 2 ). 10 wt % of 40 - 60 nm magnetite particles were then added to solution 2 . after approximately five minutes the nanoparticles were removed using a magnet ( fig5 , solution 3 ). 10 wt % of 40 - 60 nm magnetite particles were then added to solution 1 . after approximately five minutes the nanoparticles were removed using a magnet ( fig5 , solution 4 ). the uv - vis transmission spectrum of each solution was collected . using the known value of the concentration of “ solution 0 ” and the measured value of the total uv - vis absorbance of each solution , the porphyrin concentration of each solution was determined . fig5 depicts a graph showing the porphyrin concentration for each solution , demonstrating the removal of porphyrin using magnetite nanoparticles . the initial 800 ppm concentration of porphyrin was reduced by 37 . 5 % after the first treatment with magnetite nanoparticles , and was reduced by about 50 % after the second treatment with the magnetite nanoparticles . the concentration of porphyrin in solutions 3 and 4 remained at about 50 % of solution 0 following treatment . a solution containing naphthenic acid with a tan of 2 . 2 was prepared in hexadecane ( fig6 , solution 0 ). 10 wt % of 40 - 60 nm magnetite nanoparticles were then added to the solution and kept in contact with the solution for approximately five minutes . the nanoparticles were removed using a magnet ( fig6 , solution 1 ). next 10 wt % of 40 - 60 nm magnetite particles were added to solution 1 . after approximately five minutes the nanoparticles were removed using a magnet ( fig6 , solution 2 ). 10 wt % of 40 - 60 nm magnetite particles were then added to solution 2 . after approximately five minutes the nanoparticles were removed using a magnet ( fig6 , solution 3 ). the ftir spectrum of each solution was collected . using the known value of the concentration of “ solution 0 ” and the measured value of the total absorbance of ir for the acid group of each solution , the naphthenic acid concentration of each solution was determined and tan was calculated . fig6 depicts a graph showing tan for each solution , demonstrating the removal of naphthenic acid using magnetite nanoparticles . the initial concentration of naphthenic acid was reduced by 22 . 7 % after the first treatment with magnetite nanoparticles , by about 27 . 2 % after the second treatment with the magnetite nanoparticles , and by about 36 . 3 % after the third treatment with magnetite nanoparticles . a solution containing 823 ppm of asphaltene ( extracted from heavy arab crude ) in toluene was prepared . 10 wt % of 40 - 60 nm magnetite nanoparticles were added to the solution . the nanoparticles were then separated from the solution with a magnet . using the uv - vis spectrum of the original solution and the once - cleaned solution it was determined that 631 ppm of asphaltene was removed by the nanoparticles . following removal from the solution , the nanoparticles were left to dry overnight in an ambient environment and then placed in an air oven at 350 ° c . for one hour . the heat treated nanoparticles were then added to a freshly prepared solution of 823 ppm of asphaltene in toluene . after one minute the nanoparticles were removed from the solution using a magnet , and the uv - vis of the processed solution was recorded . the uv - vis spectrum reveals that 772 ppm was removed from the solution . thus , the polar removal capability of magnetite nanoparticles can be restored using heat . additionally , the polar molecule contaminant removal capability of the magnetite nanoparticles increases with heat treatment . a solution containing 823 ppm of asphaltene ( extracted from heavy arab crude ) in toluene was prepared . 10 wt % of 40 - 60 nm magnetite nanoparticles were added to the solution . the nanoparticles were removed from the solution after approximately five minutes using a magnet . using the uv - vis spectrum of the original solution and the once - cleaned solution , it was determined that 749 ppm of asphaltenes were removed by the nanoparticles . the removed nanoparticles were immersed in water for approximately five minutes . the nanoparticles were then separated from water using a magnet and left to dry in an ambient environment for 12 days . the water - treated nanoparticles were then added to a freshly prepared solution of 823 ppm of asphaltene in toluene . after approximately five minutes the nanoparticles were separated from the solution and the uv - vis of the processed solution was recorded . the uv - vis spectrum reveals that 644 ppm was removed from the solution . thus , the polar removal capability of the magnetite nanoparticles can be restored by immersing used nanoparticles in water . two equal amounts of 1000 ppm asphaltene ( extracted from heavy arab crude ) in toluene solution were prepared . in one solution 10 wt % of 40 - 60 nm magnetite nanoparticles were added . 1 wt % of 3 nm magnetite nanoparticles were added to the second solution . the nanoparticles were removed from the solutions after approximately five minutes using a magnet . the uv - vis spectra of the cleaned solutions revealed that the concentration of asphaltene was reduced to 91 and 87 ppm , in the first and the second solution , respectively . fig7 shows the nanoparticle - cleaned solutions to which 10 wt % of 40 - 60 nm magnetite nanoparticles ( 1 ) and to which 1 wt % of 3 nm magnetite nanoparticles were added ( 2 ). alongside the two cleaned solutions is a 1000 ppm ( uncleaned ) reference solution ( 3 ). the present invention is not to be limited in scope by the specific embodiments described herein . indeed , various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures . such modifications are intended to fall within the scope of the appended claims . patents , patent applications , publications , product descriptions and protocols are cited throughout this application , the disclosures of which are incorporated herein by reference in their entireties for all purpose . | 2 |
these compounds are known per se . a certain number of methods by which they can be synthesised can be found in the literature . the cyclic derivatives of formula i can be prepared for example by the following process carried out in two stages : in the first stage , an anhydrous α - glycol is reacted with anhydrous phosphorus trichloride in solution in dichloromethane to form a cyclic glycol chlorophosphite in accordance with the following reaction scheme : ## equ3 ## since this reaction is highly exothermic , the reaction mixture has to be cooled . the solvent is eliminated by distillation after about 1 . 5 hours , the resulting product being distilled under reduced pressure . in a second stage , the chlorophosphite in solution in dioxan is hydrolysed by the addition of water in accordance with the following reaction : ## equ4 ## the evolution of hydrochloric acid is promoted by maintaining a temperature around ambient temperature and a reduced pressure . it is also possible to obtain the same compounds by transesterifying diethylphosphite in the presence of an α - glycol ( oswald , can . chem . vol . 37 , page 1498 ). unfortunately , the products obtained by these two methods contain not only the cyclic derivative , but also more viscous derivatives . one method of obtaining the cyclic product is to hydrolyse the cyclic chlorine - containing derivative with a stoichiometric quantity of water in the presence of a hydrochloric acid acceptor . it is known ( cf . journ . amer . chem . soc . 1972 , page 5491 ) that certain cyclic phosphonates corresponding to the above formulae in which y &# 39 ; and y &# 34 ; are hydrogen whilst z &# 39 ; and z &# 34 ; represent hydrogen on the one hand and a methyl on the other hand , or both represent hydrogen or a methyl , are readily soluble in water and give a neutral solution which gradually acidifies due presumably to hydrolysis into monohydroxyalkyl phosphite . in other words , when the cyclic compounds of formula i are in contact with water , there is an equilibrium between the cyclic form and the form resulting from opening of the ring by hydrolysis . in practice , an aqueous composition of one of the cyclic derivatives contains a mixture of both forms . this reaction is more complete in alkaline medium . we have found that the cyclic compounds of formula i , irrespective of whether they have been obtained by one or other of the methods described above , undergo ring - opening in aqueous medium to form at least partly linear compounds corresponding to formulae iia and iib . in addition , analysis has shown that the viscous products referred to above are oligomers of compounds corresponding to formulae iia and iib . these oligomers are also present in compositions based on cyclic compounds which have been stored . this explains why the fungicidal compositions according to the invention can contain active materials corresponding to the different formulae . thus , if the starting product is a cyclic compound of formula ( i ), this compound , on being dissolved in water or in a medium containing water , or even if it is merely in contact with water , is progressively partially hydrolysed to give linear compounds of formulae ( iia ) and ( iib ), the composition ultimately used being formed by a mixture more or less rich in one or other of the different structures , each of which has similar fungicidal properties . the compounds of general formulae iia and iib can thus be prepared by the preferably alkaline hydrolysis of corresponding cyclic derivatives . they can also be obtained by known methods for preparing monoesters of phosphorous acid for example ( journal of the chemical faculty of the russian chemical academy , 1972 , vol . 42 , page 1930 ) by dealkylating the corresponding diesters with metal halides in accordance with the following reaction : ## equ5 ## the same result can also be obtained by treating a dialkyl phosphite with a base ( soda or ammonia ). in this case ( cf . journ . org . chem . 1962 , page 2521 ), the aforementioned ammonium salt is obtained . we have also found that , during storage , the compounds according to the invention show a tendency towards condensation to form much more viscous oligomers . these compounds in turn readily give the active compounds of formulae iia and iib by dissolution in water or by contact with water , as explained above . the following examples illustrate the preparation and use of the compounds according to the invention . preparation of 2 - hydroxy - 4 - methyl - 1 , 3 , 2 - dioxaphospholane , o -( 2 - hydroxypropyl )- phosphonate and o -( 1 - methyl - 2 - hydroxy - ethyl )- phosphonate ( compound nos . 1 , 5 and 6 ). a . in a first method , 4 - methyl - 2 - oxo - 2h - 1 , 3 , 2 - dioxaphospholane is synthesised by hydrolysing 4 - methyl - 2 - chloro - 1 , 3 , 2 - dioxaphospholane in the presence of a hydrochloric acid acceptor , such as pyridine , in accordance with the following reaction : ## equ6 ## 28 . 1 g ( 0 . 2 mole ) of chlorophosphite are dissolved in 250 ml of anhydrous toluene and the resulting solution cooled while stirring to below 15 ° c . this is followed by the gradual introduction of 3 . 6 g ( 0 . 2 mole ) of water in solution in 15 . 8 g ( 0 . 2 mole ) of anhydrous pyridine . on completion of the addition , the temperature of the reactants is allowed to rise to 20 ° c . the pyridine hydrochloride is filtered and the toluene removed in vacuo . the residue , in the form of a fluid oil , is distilled in vacuo . this mobile liquid which has a geranium odor is soluble in all organic solvents . the nmr spectrum indicates that the product ( compound 1 ) is a mixture of 2 isomers of cyclic form . elemental analysis c % h % p % calculated 29 . 50 5 . 74 25 . 40found 29 . 33 6 . 13 25 . 48 the product is then dissolved in acetonitrile and one equivalent of water added to the resulting solution . removal of the solvent leaves a liquid product ( n d 20 = 1 . 4528 ) containing 97 % of a mixture of the following compounds : ## equ7 ## and ## equ8 ## centesimal analysis for c 3 h 9 o 4 p analysis c % h % p % calculated 25 . 71 6 . 43 22 . 14found 25 . 76 6 . 18 22 . 17 b . in another method , 1 mole of anhydrous 1 , 2 - propyleneglycol is reacted with 1 mole of anhydrous phosphorus trichloride in solution in dibromomethane . the chloro - phosphite of propylene glycol is quantitatively obtained in accordance with the following reaction : ## equ9 ## since the reaction is exothermic , the reaction mixture is cooled . after about 1 . 5 hours , the solvent is removed by distillation and the resulting product distilled under reduced pressure . this is followed by the addition of two equivalents of water to one equivalent of chloro - phosphite in solution in acetonitrile . c . the method described by oswald ( j . can . chem . vol . 37 , page 1498 ) is used with diethylphosphite and propylene glycol in accordance with the following scheme ; ## equ10 ## a mixture of 1 mole of each of the reactants is heated to 120 ° c - 130 ° c under a pressure of 120 mmhg until distillation of the glycol has stopped , which takes about 3 hours . the distilled product , obtained in a yield of 71 %, is a colourless viscous oil with an index n d 20 of 1 . 469 and a boiling point of 106 ° - 107 ° c / 10 . sup . - 3 mmhg . this oil is soluble in water , alcohol , acetone , and insoluble in aromatic solvents . analysis c % h % p % calculated 29 . 50 5 . 74 25 . 40found 30 . 69 6 . 24 22 . 46 the corresponding open derivatives are obtained in the same way as described above in ( a ). d . the method adopted is the method described by mandelbaum et al in c . a . 69 , 43338h ( 1968 ) for the production of dialkylphosphites , comprising reacting phosphorus trichloride with a mixture of propylene glycol and methanol at a temperature below - 15 ° c . removal in vacuo of the hydrocrloric acid and methylene chloride leaves compound 1 whose structure is confirmed by infra - red spectrum . compounds 5 and 6 can be obtained from compound 1 as described above in ( a ). the o -( 2 - hydroxypropyl )- phosphite obtained in example 1 is neutralised and dissolved in water by the addition of normal caustic soda . a virtreous , highly hygroscopic product is obtained by precipitation . centesimal analysis for c 3 h 8 nao 4 p analysis c % h % p % calculated 22 , 22 4 , 94 13 , 66found 21 , 83 5 , 11 13 , 77 practically a mixture of the predicted compound with the sodium o -( 1 - methyl 2 - hydroxyethyl ) phosphite isomer is obtained . ( compound no . 17 ).&# 34 ; the procedure is as described above , except that the soda is replaced by ammonia . a vitreous , highly hygroscopic product is obtained by precipitation . centesimal analysis for c 3 h 12 no 4 p analysis c % h % n % p % calculated 22 , 93 7 , 64 8 , 92 19 , 75found 22 , 88 7 , 93 8 , 82 19 , 52 practically a mixture of the predicted compound with the ammonium 0 -( 1 - methyl , 2 - hydroxyethyl ) phosphite isomer is obtained ( compound no . 18 )&# 34 ;. the procedure is as in example 2 , except that the soda is replaced by monoethanolamine . a vitreoous , highly hygroscopic product is obtained by precipitation . the procedure is as in example 2 except that the soda is replacd by calcium hydroxide and barium hydroxide , respectively . the corresponding salts are obtained . following the procedure of example 1 , method b ), 4 - chloromethyl - 2 - chloro - 1 , 3 , 2 - dioxaphospholane is hydrolyzed in solution in methylene chloride with two equivalents of water . the liquid obtained , of index n d 20 = 1 . 5008 , contains approximately 93 % of a mixture of the following two isomeric compounds : ## equ11 ## and ## equ12 ## analysis c % h % p % cl % calculated 20 . 63 4 . 58 17 . 77 20 . 34found 20 . 58 4 . 94 17 . 66 20 . 18 2 - chloro - 2 , 3 , 2 - dioxaphospholane is hydrolysed in the same way as described in example 1 , method b ), giving a liquid which is soluble in water and which contains the required product , as shown by the nmr - spectrum . preparation of diethylammonium salts of o -( 2 - hydroxy propyl ) phosphite ( compound no . 20 ) and o -( 1 - methyl 2 - hydroxy ethyl ) phosphite ( compound no . 21 ). the procedure is as described above in example 2 , except that the soda is replaced by diethylamine . a liquid ( n d 20 = 1 . 452 ) is obtained by precipitation with a quantitative yield . centesimal analysis for c 7 h 20 no 4 p analysis c % h % n % p % calculated 39 , 4 9 , 38 6 , 57 14 , 55found 39 , 49 9 , 11 6 , 56 14 , 70 preparation of salts of respectively dimethyl - diethyl -, and diisopropylammonium of o -( 2 - hydroxy - ethyl ) phosphite ( compounds no . 22 , 23 and 24 ) the procedure is as described in example 2 , except that the soda is respectively replaced by dimethyl ), diethyl -, and diisopropylamine . the final products are liquids which are obtained with a quantitative yield . ______________________________________compound molecular ref . index centesimal analysis anal - calcul . found n . sub . d . sup . 20 ysis______________________________________ c % 28 , 25 27 , 65 h % 8 , 18 8 , 1122 c . sub . 4 h . sub . 14 no . sub . 4 p 1 , 458 n % 8 , 18 7 , 78 p % 18 , 13 18 , 34 c % 36 , 18 36 , 41 h % 9 , 05 9 , 1523 c . sub . 6 h . sub . 18 no . sub . 4 p 1 , 458 n % 7 , 04 7 , 12 p % 15 , 58 15 , 63 c % 42 , 3 42 . 16 h % 9 , 7 10 , 0424 c . sub . 8 h . sub . 22 no . sub . 4 p 1 , 4625 n 6 , 17 6 , 20 p 13 , 66 13 , 77______________________________________ the products according to the invention are tested for their effect on the mycelian growth of the following fungi : the &# 34 ; agar plate dilution &# 34 ; method is used for each test . a mixture of gelose and an acetone solution or a wettable powder containing the material to be tested in a concentration of 0 . 25 g / l , is poured into a petri dish at a temperature of around 50 ° c . the wettable powder is prepared by mixing the following ingredients for 1 minute in a cutter mill : - active material to be tested 20 % deflocculant ( calcium lignosulphate ) 5 % wetting agent ( sodium alkylaryl sulphate ) 1 % filler ( aluminium silicate ) 74 % this wettable powder is then mixed with a quantity of water for a single application in the required dose . the gelose - containing mixture is allowed to solidify and discs of mycelian culture of the fungus placed on it . a petri dish similar to the other petri dish , except that the gelose medium does not contain active material , is used as control . after 4 days at 20 ° c , the surface area of the inhibition zone observed is evaluated and expressed as a percentage of the inoculated surface area . ______________________________________fungus % inhibition product no . 1 product no . 2______________________________________rhizoctonia 50 50fusarium oxysporum 60 60fusarium nivale 78 65fusarium roseum 60 70sclerotinia minor 83 100sclerotinia sclerotiorum -- 50pythium 100 100phomopsis 50 50septoria 95 70helminthosporium 83 70verticillium 100 100cercospora -- 90gloesporium 60 -- ______________________________________ the products according to the invention are tested for their action on pythium de baryanum in cucumbers . the following procedure is adopted for each test : a medium containing a culture of the fungus is mixed with a sterilised earth and pots filled with the resulting mixture . after 8 days , the earth is infested . it is then treated by spraying with a suspension of the active material to be tested in various concentrations . the active material is in the form of a wettable powder prepared as described in example 1 . the results of the test are assessed 15 days after sowing of the seeds by counting the number of destroyed or sick plants in relation to an untreated control and a non - contaminated control . under these conditions , products 1 and 2 afford complete protection in a dose of 0 . 5 g / l . one drop of a mixture of a suspension of spores containing approximately 80 , 000 units per cc , and of a suspension in the required dilution of a wettable powder of the same composition as that described in example 8 , in the case of an insoluble product , or of an acetone solution , is applied to freshly cut tomato leaves . under these conditions , products 1 and 2 afford complete protection in a dose of 0 . 5 g / l , whilst product 1 affords adequate protection in a dose of 0 . 125 g / l . pot - grown vine plants are treated by spraying the underneath of their leaves with an aqueous suspension of a wettable powder having the following composition by weight : - active material to be tested 20 % deflocculant ( calcium lignosulphate ) 5 % wetting agent ( sodium alkylaryl sulphonate ) 1 % filler ( aluminium silicate ) 74 % in the required dilution containing the active material to be tested in the appropriate dose . each test is repeated twice . after 48 hours , the plants are infected by spraying the underneath of their leaves with an aqueous suspension containing approximately 80 , 000 units per cc of spores of the selected fungus . the pots are then placed for 48 hours in an incubation cell at 20 ° c / 100 % relative humidity . under these conditions , compounds 1 , 2 , 3 and 5 to 16 afford complete protection in a dose of 0 . 5 g , compounds 5 to 23 also afford complete protection in a dose of only 0 . 25 g / l , whilst the cyclic compound , compound no . 1 , has a distinctly inadequate effect . in addition , none of the products tested showed the least sign of phytotoxicity . the base of several vine stocks ( gamay variety ) each accommodated in a pot containing vermiculite and a nutritive solution , are sprayed with 40 cc of a solution containing 0 . 1 g / l of the material to be tested . after 2 days , the vine is contaminated with an aqueous suspension containing 100 , 000 spores per cc of plasmopara viticola . the vine thus treated is left to incubate for 48 hours in a room at 20 ° c / 100 % relative humidity . the degree of infestation is observed after about 7 days in relation to an infested control sprayed with 40 cc of distilled water . under these conditions , compounds 1 and 5 to 23 absorbed by the roots provide the vine leaves with complete protection against mildew , which clearly demonstrates the systemic character of these compounds . several vine stocks ( gamay variety ), each accommodated in a pot containing a mixture of pure earth and sand , are treated at the stage of 7 leaves by spraying a wettable powder containing 1 g / l of the active material to be tested onto the underneath of the 4 lowest leaves . this is followed by incubation for 48 hours in a room at 20 ° c / 100 % relative humidity . the degree of infestation is noted after about 7 days on the fifth to seventh leaves , counting from the bottom upwards , in relation to a control which has been treated with distilled water . under these conditions , compounds nos . 1 and 5 to 23 provide the uppermost leaves of the vine with complete protection against mildew . the systemic effect observed in the preceding example is confirmed when the active material is applied to leaves . groups of vine stocks ( gamay ) are naturally infested at the beginning of the month of august , following abundant rainfall and frequent watering . these groups of vine stocks are then treated after 8 , 14 and 23 days , respectively , with 50 % &# 34 ; slurries &# 34 ; of wettable powders respectively containing as active material compound no . 1 , manganese ethylene - 1 , 2 - bis - dithiocarbamate , or manebe , and a mixture of these two compounds . the following table shows the results of observations made 2 , 8 , 20 , 35 and 45 days , respectively , after the final treatment . these results are expressed in percentage protection in relation to a contaminated , but untreated control . ______________________________________active material dose observation after g / l 2 8 20 35 45 days days days days days______________________________________compound no . 1 2 100 70 15 10 0manebe 1 . 2 95 93 88 77 70compound no . 1 2 + 100 100 100 95 90 1 . 2______________________________________ this table clearly illustrates , on the one hand , the excellent immediate action of compound no . 1 , on the other hand the remarkable persistence of the mixture , which is greater than that of manebe used on its own , and finally the absence of phytotoxicity of compound no . 1 on vine . several groups of 10 vine stocks ( gamay variety ) are subjected from spring to the beginning of august to regular , very fine spraying so as to produce heavy contamination with mildew . the groups of vine stocks are treated respectively with a known fungicide ( manganese dithiocarbamate , or manebe , and n -( trichloromethylthio )- phthalimide ) used in the standard dose , and with compound no . 5 . at the end of august , the percentage of leaves affected by mildew is counted for each group . ______________________________________active material dose in % of sick leaves g / hl______________________________________compound no 5 300 1 . 8manebe 280 4 . 3folpel 150 25control -- 90______________________________________ this table clearly illustrates the superiority of the compounds according to the invention over known anti - mildew fungicides . it should be noted that results similar to those produced by compound no . 5 are obtained with compound no . 1 of the parent patent . several groups of 10 vine stocks ( gamay variety ) are treated against mildew ( plasmopara vitricola ) from spring to the beginning of august ( 10 treatments ) with a 50 % wettable powder ( unless indicated otherwise ) containing known fungicides ( copper oxychloride , manebe , folpel , n -( trichloromethylthio )- 3a , 4 , 7 , 7a - tetrahydro - phthalimide or captane and n -( 1 , 1 , 2 , 2 - tetrachloroethylthio )- 3a , 4 , 7 , 7a - tetrahydrophthalimide or captafol ) in the standard dose , on the one hand alone and , on the other hand with a dose 2 to 3 times lower in admixture with 300 g / hl of compound no . 5 . protection is observed on the 31st of august and then on the 27th september . the following table shows the results expressed as a percentage of the surface area of the patches of mildew in relation to the total surface area of the leaves . ______________________________________known fungicide + compound % of the surface area of the leaves protected 31 / 8 27 / 9______________________________________copper oxychloride500 -- 90 90120 -- 80 60120 300 100 95manebe280 -- 95 95120 -- 70 70120 300 97 . 5 90captane175 -- 85 70 70 -- 70 40 70 300 96 . 5 70captafol160 -- 85 85 70 -- 70 70 70 300 100 95folpel150 -- 85 85 70 -- 70 60 70 300 97 . 5 85______________________________________ these results clearly demonstrate the remarkable ability of the compounds according to the invention to afford , in combination with low doses of known fungicides , distinctly better protection than that afforded by these fungicides used in the standard dose . it should also be noted that , when used under the same conditions as compound no . 5 , compound no . 1 gives similar results . finally , tests on tobacco and hops have shown that compounds nos . 1 and 5 are active in protecting these plants against mildew without any signs of phytotoxicity . these examples clearly demonstrate the remarkable fungicidal properties of the compounds according to the invention , namely the wide spectrum comprising ground fungi and mildews , and in their case , an immediate , systemic and inhibiting action and the absence of phytotoxicity on vine . accordingly , the compounds according to the invention can be used generally for protecting plants against fungus disease and , more particularly , the vine against mildew , both in preventive and in curative treatment . they can be used either on their own or in admixture with one another and , in particular , with cyclic compounds of formula i and open compounds corresponding to formulae iia and iib , and in association with known fungicides such as metallic dithiocarbamates ( manebe , zinebe , mancozebe ), basic salts or hydroxides of copper , ( tetrahydro )- phthalimides ( captane , captafol , folpel ), methyl n -( 1 - butyl - carbamoyl )- 2 - benzimidazole carbamate ( benomyl ), methyl n - 2 - benzimidazole carbamate , etc ., either in order to complete the spectrum of activity of the compounds according to the invention or to increase their presistence . by virtue of these properties , the compounds according to the invention can be used for protecting plants against fungus disease , more especially in agriculture , arboiculture , horticulture , market gardening and , more particularly , in viticuluture , and for the treatment of seeds . for practical application , the compounds according to the invention are rarely used on their own . more often they form part of formulations generally comprising a support and / or a surfactant in addition to the active material according to the invention . in the context of the invention , a support is an organic or mineral , natural or synthetic material with which the active material is asssociated to facilitate its application to the plant , to seeds or to the soil , or its transportation or handling . the support can be solid ( clays , natural or synthetic silicates , resins , waxes , solid fertilisers ....) or fluid ( water , alcohol , ketones , petroleum fractions , chlorinated hydrocarbons , liquefied gases ). the surfactant can be an ionic or non - ionic emulsifier , dispersant or wetting agent such as , for example , salts of polyacrylic acids , lignin - sulphonic acids , condensates of ethylene oxide with fatty alcohols , fatty acids or fatty amines . the compositions according to the invention can be prepared in the form of wettable powders , dusting powders , granulates , solutions , emulsifiable concentrates , emulsions , suspended concentrates and aerosols . the wettable powders are normally prepared in such a way that they contain from 20 to 85 % by weight of active material . in addition to a solid support , they normally contain from 0 to 5 % by weight of a wetting agent , from 3 to 10 % by weight of a dispersant and , when necessary , from 0 to 10 % by weight of one or more stabilisers and / or other additives , such as penetration agents , adhesives or anti - lumping agents , colourants , etc . for example , a wettable powder can have the following composition : - active material 50 % calcium lignosulphate ( deflocculant ) 5 % anionic wetting agent 1 % anti - lumping silica 5 % kaolin ( filler ) 39 % aqueous dispersions and emulsions , for example compositions obtained by diluting with water a wettable powder or an emulsifiable concentrate such as described above , are included within the general scope of the invention . these aqueous compositions are of considerable practical significance . due to the hydrolysis reactions of the compounds of formula i , the preparation of compositions of this kind spontaneously produces corresponding compounds iia and iib so that the compositions often contain a mixture of the two types of compounds . these emulsions can also be of the water - in - oil type or of the oil - in - water type and they can have a thick consistency resembling that of a mayonnaise . the compositions according to the invention can contain other ingredients , for example protective colloids , adhesives or thickeners , thixotropic agents , stabilisers or sequestrants , and other active materials known to have pesticidal properties , in particular acaricides or insecticides . | 2 |
fig1 is a floor care apparatus 2 of one embodiment of the present invention that comprises a chassis 6 that supports a steerable front wheel 10 and a plurality of rear wheels 14 . one of skill in the art will appreciate that the apparatus shown is traditionally used for floor scrubbing operations . the floor care apparatus of embodiments of the present invention , however , may also be used for finish removal and include a floor treating assembly 18 that houses at least one sanding pad 22 . although two pads 22 are shown , one of skill in the art will appreciate that any number of pads 22 , or brushes , or any other type or combination of floor treating device known in the art may be employed . a broom or squeegee 26 is located behind the floor treating assembly 18 and in front of the rear wheels 14 . in one embodiment of the present invention , two pads 22 with a surface adapted for removing finish treatment are employed . preferably , a 3m scotch brite ® surface preparation pad is integrated into the brush or wrapped around a brush core of existing manufacturer , which will be described in further detail below with respect to fig3 . the pad 22 may be wrapped around the core in a spiral fashion as disclosed in wo 2009 / 149 , 722 , which is incorporated by reference herein . in addition , core of one embodiment is interconnected to the floor cleaning apparatus by bearings as also disclosed in the &# 39 ; 722 application . as mentioned above , the floor care apparatus comprises two pads 22 for removal of finish . in other embodiments of the present invention , however , a front pad 22 f is adapted for removing layers of floor treatment while the rear pad 22 r is used for scrubbing the floor to remove debris . the scrubbing pad or brush 22 r may be cylindrical as shown or may be disk shaped and rotate along an axis perpendicular to the surface being cleaned . it should be understood that any cleaning device may be used in conjunction with the contemplated sanding pad 22 . one skilled in the art will further appreciate that any of the features disclosed in the references listed below may be used with the floor care apparatus without departing from the scope of the invention . for example , the floor care apparatus shown may be either walk - behind or ride - on . the chassis 6 includes a tank of water cleaning solution that is mixed with cleaning solution or premixed , such as soap water , and a recovery tank . as the floor care apparatus 2 traverses the floor , the front brush 22 f sands the floor to remove a layer or layers of finish of predetermined thickness . nozzles located behind the front brush 22 f spray water or cleaning solution on the sanded floor capture the dust and debris generated by the front brush 22 f . the second brush 22 r uses the cleaning solution to scrub the floor and a squeegee 26 , or any other fluid capturing device , and suctioning system to direct the dirty solution and debris into a recovery tank . additional nozzles positioned in front of the sanding brush 22 f may be used that spray chemical or other finish softening agents to the floor . still other embodiments of the present invention may be completely dry wherein a plurality of sanding brushes are used and debris is collected by a broom and vacuum system . referring now to fig2 , a smaller walk - behind floor care apparatus 2 is shown that is controlled via a rotatable handle 30 interconnected to a motor and solution housing 34 . a plurality of sanding pads 22 are located under the motor and are urged against the floor by the weight of the motor . this embodiment of the present invention is primarily used for wet finish removal operations wherein two pads 22 counter rotate which allows the apparatus to “ float ” and thus be more controllable . the weight of the gas or electrically powered motor , cleaning solution , and associated components will dictate the amount of force applied by the brushes , and , thus , the amount of finish removed . the apparatus also includes a squeegee 26 f ahead of the front brush 22 f and a squeegee rear 26 r of the rear brush 22 r that collect cleaning solution and debris from the floor . using two squeegees also allows the apparatus to be used in two directions . a series of wheels or other propelling mechanisms may be incorporated into the floor treating apparatus to provide a propulsion . referring now to fig3 , a pad employed by some embodiments of the present invention is shown that wrapped around a core 38 that is associated with an axle 42 . the axle 42 rotates around a longitudinal axis 46 that is positioned generally parallel to the surface being cleaned and perpendicular to the direction of floor care apparatus travel . the pad 22 may be firmly associated with the core 38 or may be selectively removable therefrom . further , the pad 22 may be formed in a single piece that is wrapped around the core 42 or may be of a clam shell configuration comprising two or more interconnected or closely associated pieces that extend the width of the core 38 . the pad 22 may alternatively be slip fit onto the core 38 . fig4 shows another embodiment of the pad that includes a flap cylinder 50 with a plurality of pads 22 operatively interconnected thereto . one edge 54 of the pad 22 is associated with the cylinder 50 and the outer edge 58 of the pad 22 is located outwardly from the core . although shown with a continuous external surface , one skilled in the art will appreciate that the pad may have a varied external pattern to facilitate removal of debris from the floor and expulsion of dust and debris from the pad material to prevent clogging . while various embodiments of the present invention have been described in detail , it is apparent that modifications and alterations of those embodiments will occur to those skilled in the art . however , it is to be expressly understood that such modifications and alterations are within the scope and spirit of the present invention , as set forth in the following claims . further , the invention ( s ) described herein is capable of other embodiments and of being practiced or of being carried out in various ways . in addition , it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . this application is related to u . s . pat . no . 5 , 555 , 596 , entitled “ floor cleaning apparatus ”; u . s . pat . no . 5 , 485 , 653 , entitled “ floor cleaning apparatus ”; u . s . pat . no . 5 , 628 , 086 , entitled “ floor cleaning apparatus with squeegee mounting system ”; and u . s . pat . no . 5 , 608 , 947 , entitled “ floor cleaning apparatus with pre - filter ”; the entire disclosures of which are incorporated by reference herein . this application is also related to u . s . patent application ser . no . 11 / 059 , 663 , filed feb . 15 , 2005 , now u . s . pat . no . 7 , 533 , 435 , which is a continuation - in - part of u . s . patent application ser . no . 10 / 737 , 027 , filed dec . 15 , 2003 , now abandoned , which is a continuation - in - part of u . s . patent application ser . no . 10 / 438 , 485 , filed may 14 , 2003 , now abandoned , the entire disclosures of which are incorporated by reference in their entirety herein . this application is also related to u . s . patent application publication nos . 2009 / 0094784 , 2006 / 0064844 , 2006 / 0124770 , and 2006 / 0156498 , and u . s . patent application no . 2011 / 0023248 , the entire disclosures of which are incorporated by reference herein . this application is also related to pending u . s . patent application ser . no . 12 / 912 , 554 , filed oct . 26 , 2010 , the entire disclosure of which is incorporated by reference herein . | 0 |
advantages and novel features of the invention will become more apparent from the following detailed description when taken in conjunction with the accompanying drawings . referring to the drawings in greater detail wherein like reference numerals refer to similar or identical parts throughout the various views , several embodiments of the present invention and methods of practicing the present invention will be considered . in one aspect , the invention provides a method for compensating for component characteristic drift in pixel circuit for driving light emitting devices . a two transistor one capacitor ( 2t1c ) active matrix display pixel circuit is described wherein the second transistor features dual gate and the capacitor is connected between the first gate and the drain of the second transistor . alternatively the second dual - gate transistor can be implemented as two single - gate transistors . a light emitting diode is driven with the drain current of the second transistor . the second gate of the second transistor is energized during the programming period of the pixel to pre - charge the pixel capacitance . during the holding phase of the pixel , the second gate of the second transistor is de - energized , allowing the capacitor in the feedback loop to favorably control the voltage on the first gate thus stabilizing the drain current of the second transistor in view of variations that the second transistor or light emitting device can manifest over time . one embodiment of the present invention is shown in fig4 representing a pixel circuit 100 in an active matrix display . the circuit includes a first sg or dg transistor ( m 1 ), a second dg transistor m 2 , a capacitor cp , and a light emitting device led . the light emitting device could be a light emitting diode , an organic light emitting diode , a quantum - dot light emitting device , or any other current stimulated light emitting device . m 1 receives signals v scan on its gate . the first source - drain terminal of m 1 receives v data . the second source - drain terminal of m 1 is connected to the first gate g 1 of m 2 ( 110 ). the second gate g 2 of m 2 ( 120 ) is connected to the v scan signal . the source s of m 2 is held at a common voltage , while the drain d is connected to the cathode of the led . the led anode is connected to the supply voltage vdd . the capacitor cp is connected between the first gate g 1 and drain d or m 2 . in the circuit of fig4 , m 1 acts as a switch . the gate of m 1 receives the v scan signal to control the on or off state of m 1 . a high v scan signal would turn m 1 on , and a low v scan signal would turn it off ( for the circuit in fig4 ). when m 1 is turned on , v data is passed from the first source - drain terminal of m 1 to the second source - drain terminal of m 1 , thus applying v data to g 1 of m 2 . the second gate g 2 of m 2 is driven by v scan signal or other appropriate switching voltage level switched simultaneously with the v scan signal . the v scan and v data signal waveforms are shown in fig5 . the v scan and v data signal waveforms are similar to what is commonly used in active matrix displays and is common knowledge for those of ordinary skill in the art . we explain it here for completeness . v scan periodically pulses , thus addressing a particular row of pixels by connecting the row pixels to a column bus for a short period of time . this is done through the switching action of m 1 . v data remains substantially stable during the time m 1 is switched on to allow settling and voltage programming of the first gate g 1 of m 2 . once v scan is removed , the pixel substantially maintains the programmed voltage within its capacitor cp , until the next frame is refreshed . fig6 shows key operating points for the circuit 100 in fig4 as v scan is sequenced . referring jointly to fig4 and fig6 the operation of the circuit is as follows . during the short v scan pulse , the gates g 1 and g 2 of m 2 are biased with v g1 = v data and v g2 = v scan , respectively . for this case , the dual - gate transistor m 2 operating point is in point a with v ds ( m 2 )= v 1 as shown in fig6 . the strong current contribution from the g 2 channel of m 2 pushes v 1 to be substantially low . during this time , the capacitor is programmed to ( v data − v 1 ) voltage . after the programming , v scan goes low . then , the circuit automatically establishes a new , smaller value of led current since the current from the channel of the second gate g 2 is excluded . without a capacitance cp placed in the feedback between drain d and the first gate g 1 of m 2 , the m 2 operating point would be at point c with v ds ( m 2 )= v 3 as shown in fig6 . instead , due to the feedback capacitance cp , the voltage transient at the drain of m 2 is transferred back to g 1 increasing the voltage at the first gate g 1 by the amount of δvg . because of this negative feedback loop the steady state operating point when v scan is turned off leads to a final operating point at point b with v ds ( m 2 )= v 2 and v g1 = v data + δvg as shown in fig6 . δvg can be expressed as : where c gd ( m 2 ), c gs ( m 2 ) and c gs ( m 1 ) are corresponding gate - drain , and gate - source overlapping capacitances of m 1 and m 2 , respectively , and m is a parameter approaching unity for sufficiently large cp . during the holding period with v scan low , the led current is determined by the voltage of g 1 as : with m 2 operating in saturation . the drain current of m 2 in saturation is given by i d ( m 2 )≈ β ×( v data − v th + δv g ) α , ( 3 ) where β is the gain coefficient , v th is the m 2 threshold voltage and α is the power low parameter . it is clear that the additional term δvg in ( 3 ) will compensate any v th drift if ∂ v th /∂( δv g )= 1 . using a linear approximation for the led curve in the range of v dd − v ds ≧ v p , the led current is expressed as : i oled ≈( v dd − v ds − v p )/ r d , for v dd − v ds ≧ v p ( 4 ) where v p is the led threshold voltage shown in fig6 . in this region and for the purpose of this analysis , the led dynamic resistance r d =∂ v oled /∂ i oled can be considered constant due to the inherently large series resistance of led . by combining equations ( 1 ), ( 2 ), ( 3 ) and ( 4 ), and with α ≈ 2 , v 1 ≈ const , r d ≈ const and v ds ≈ v 2 , it can be shown that : for in m · β · r d & gt ;& gt ; 1 , equation ( 5 ) reduces to ∂ v th /∂( δv g )≈ 1 , meaning that the led current becomes immune to the v th drift and deterioration . the above analytical conclusions can be more precisely demonstrated through circuit simulation . one example is shown in fig7 . the graph in fig7 shows relative led current degradation due to a 1 . 5v v th shift of m 2 for different programming voltages v data . while the relative degradation in the conventional pixel is more than 75 %, the present invention delivers degradation of less than 1 . 5 %. in addition , fig8 shows a comparison between the i - v characteristics of the pixel circuit of fig4 and the conventional pixel of prior art . an advantageous linear i - v characteristic of new pixel circuit is clearly observed in fig7 owning to a beneficial influence of the δvg term in equation ( 3 ), whereas a conventional pixel circuit exhibits substantial nonlinearity of its programming characteristics . the relative led current degradation plotted in fig7 is found as : fig9 shows additional benefits of the present invention in that it reduces the display degradation due to led &# 39 ; s non - uniformity and aging . if the led &# 39 ; s i - v curve changes due to aging or to pixel - to - pixel nonuniformity , the voltage difference ( v 2 − v 1 ) will change too , which in turn reflects in a favorable change in δv g that will correct the voltage at the first gate g 1 of m 2 thus compensating for the degradation in led . fig9 shows an example simulation that shows great improvement afforded by present invention compared to the conventional case . the driver current deviation plotted in fig9 is calculated as : the pixel circuit 100 shown in fig4 thus overcomes the drawbacks existing in the conventional active matrix pixel driving circuits while reducing the transistor drift , led drift , and improving non - linearity . at the same time the basic circuit of fig4 does not require any changes to the externally driven signals ( v data and v scan lines ) compared to the conventional state - of - the - art . furthermore , no extra space for circuitry is required compared to the conventional 2t1c pixel circuits ( fig1 and fig2 ). with its simple conventional voltage driving scheme and with no additional control lines , the proposed pixel maximizes an overall fill factor of display pixels . additional control of the circuit compensation behavior could be obtained by controlling the height of the pulse on the second - gate . in most instances , the height of the v scan pulse can be slightly adjusted without adversely affecting the switching properties of m 1 . however , g 2 of m 2 can be driven from a line that is separate from v scan and supplies the v g2 signal ( see fig1 ). in this case more flexibility is afforded as to the voltage levels and shape of v g2 . it is advantageous to implement m 2 as dg transistor . however , m 2 can be replaced by two sg transistors whose sources and drains are wired in parallel . such variation would still be within the scope of the present invention . additionally , p - type transistor circuit variations of circuit 100 ( fig1 and fig1 ) would also fall within the scope of the present invention . as can be seen from the above description , in one aspect the invention provides a method for compensating for component characteristic drift in pixel circuit for driving light emitting devices comprising steps of : providing a 2t1c active matrix display pixel circuit wherein the second transistor features dual gate and the capacitor is connected between the first gate and the drain of the second transistor . a light emitting diode is driven with the drain current of the second transistor . the second gate of the second transistor is energized during the programming period of the pixel to pre - charge pixel capacitance . during the holding phase of the pixel , the second gate of the second transistor is de - energized , allowing the capacitor in the feedback loop to favorably control the voltage on the first gate thus stabilizing the drain current of the second transistor in view of variations that the second transistor or light emitting device can manifest over time . an alternative implementation of the second dual - gate transistor could be accomplished by two single - gate transistors whose source and drain are wired together . while the invention has been described in terms of several embodiments , it will be apparent to those skilled in the art that various changes can be made to the described embodiments without departing from the invention as set forth in the following claims . | 6 |
referring to the drawings and in particular fig1 , 17 , 18 , 25 , 28 and 32 , the rigid intersection connection 1 , 1 &# 39 ;, 1 &# 34 ;, 1 &# 34 ;&# 39 ;, 1 &# 34 ;&# 34 ;, 1 &# 34 ;&# 39 ;&# 34 ; and 1 &# 34 ;&# 34 ;&# 34 ; of the present invention as shown in the structures of fig3 , 24 and 36 include a first elongated wood x structural member 2 having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a first elongated wood y structural member 7 intersecting the elongated wood x structural member 2 and having first , seat and second sides 8 , 9 and 10 ; a first elongated wood z structural member 11 intersecting the elongated wood x and y structural members 2 and 7 and having first , seat and second sides 12 , 13 , and 14 ; and a first rigid connector 15 constructed from a single sheet of sheet metal 16 configured for holding the intersecting elongated wood x , y , and z structural members 2 , 7 and 11 in a rigid embrace . the first rigid connector 15 includes : an xy support side member 17 dimensioned for registration with a portion of the elongated wood x structural member 2 ; an xz support side member 18 integrally connected to the xy support side member 17 along a substantial portion thereof and dimensioned for registration with a portion of the elongated wood x structural member ; a yx side member 19 integrally connected to the xy support side member 17 and dimensioned for registration with a portion of the first side 8 of the elongated wood y structural member 7 ; a zx side member 20 integrally connected to the xz support side member 18 and dimensioned for registration with a portion of the first side 12 of the elongated wood z structural member 11 ; a y seat member 21 integrally connected to the yx side member 19 and dimensioned for registration with a portion of the seat side 9 of the elongated wood y structural member 7 ; a y side member 22 integrally connected to the y seat member 21 and dimensioned for registration with a portion of the second side 10 of the elongated wood y structural member 7 ; a z seat member 23 integrally connected to the zx side member 20 and dimensioned for registration with a portion of the seat side 13 of the elongated wood z structural member 11 ; and a z side member 24 integrally connected to the z seat member 23 and dimensioned for registration with a portion of the second side 14 of the elongated wood z structural member 11 . the rigid connectors are connected to the elongated wood structural members as shown in the drawings by first fastener means 25 attaching the xy support side member 17 to the first side of the elongated wood x structural member ; second fastener means 26 attaching the yx side member 19 to the first side 8 of the elongated wood y structural member 7 ; third fastener means 27 attaching the y side member 22 to the second side 10 of the elongated wood y structural member 7 ; fourth fastener means 28 attaching the zx side member 20 to the first side 12 of the elongated wood z structural member 11 ; and fifth fastener means 29 attaching the z side member 24 to the second side 14 of the elongated wood z structural member 11 . this application describes three basic rigid connectors which may be constructed from the same sheet metal blank 16 . these rigid connectors are divided into three series 15 &# 39 ;, 15 , and 15 &# 34 ; which in turn have several modifications . the first series of rigid connectors 15 &# 39 ; are illustrated in fig1 - 21 and are constructed from the blank 16 illustrated in fig2 . the first series rigid connectors 15 &# 39 ; are used in the greenhouse structure 69 illustrated in fig3 - 14 , the bench structure 61 illustrated in fig2 , and the bunk bed furniture structure 68 illustrated in fig3 - 38 . the first series rigid connection 1 &# 39 ; is characterized by a structure in which the first elongated wood y and z structural members 7 and 11 are in general linear alignment and the xy and xz support side members 17 &# 39 ; and 18 &# 39 ; of the first rigid connector 15 &# 39 ; are in substantially the same plane . the parts of the first series rigid connector 15 &# 39 ; which are identical to the second series rigid connector 15 are designated by a single prime mark (&# 39 ;) and the description is not repeated . the third series of rigid connectors 15 &# 34 ; are illustrated in fig1 and are constructed from the blank 16 illustrated in fig2 . the third series rigid connectors 15 &# 34 ; are used in the greenhouse structure 69 illustrated in fig3 - 14 . the third series rigid connection 1 &# 34 ; is characterized by a structure in which the xy , and xz support side members 17 &# 34 ; and 18 &# 34 ; of the first rigid connector 15 &# 34 ; are disposed at an angle 70 and the yx side member 19 &# 34 ; and the xy support side member 17 &# 34 ; of the first rigid connector 15 &# 34 ; are disposed at an angle 71 . the parts of the third series rigid connector 15 &# 34 ; which are identical to the second series rigid connector 15 are designated by a double prime mark (&# 34 ;) and the description is not repeated . the second series of rigid connectors 15 are illustrated in fig1 , 15 and 16 and are constructed from the blank 16 illustrated in fig2 . the second series of rigid connectors have several modifications as follows : a first modified second series rigid connector 15 &# 34 ;&# 39 ; is illustrated in fig2 - 30 ( like parts are designated by the symbol (&# 34 ;&# 39 ;); a second modified second series rigid connector 15 &# 34 ;&# 34 ; is illustrated in fig2 - 27 ( like parts are designated by the symbol (&# 34 ;&# 34 ;); a third modified second series rigid connector 15 &# 34 ;&# 34 ;&# 39 ; is illustrated in fig3 - 34 ( like parts are designated by the symbol (&# 34 ;&# 34 ;&# 39 ;); and a fourth modified second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; is illustrated in fig3 - 41 ( like parts are designated by the symbol (&# 34 ;&# 34 ;&# 34 ;). the second series rigid connectors 15 are used in the greenhouse structure 69 illustrated in fig3 - 14 , the bench structure 61 illustrated in fig2 , the log holder structure 54 illustrated in fig2 , and the bunk bed furniture structure 68 illustrated in fig3 - 38 . the rigid intersection connections 1 , 1 &# 34 ;, 1 &# 34 ;&# 34 ;, 1 &# 34 ;&# 39 ;, 1 &# 34 ;&# 34 ;&# 39 ;, and 1 &# 34 ;&# 34 ;&# 34 ; illustrated in fig1 , 17 , 25 , 28 or 32 which includes third as well as second series rigid connectors include : a first elongated wood x structural member 2 having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a first elongated wood y structural member 7 intersecting the elongated wood x structural member 2 and having first , seat and second sides 8 , 9 , and 10 ; and a first elongated wood z structural member 11 intersecting the elongated wood x and y structural members 2 and 7 and having first , seat and second sides 12 , 13 , and 14 . first rigid connector 15 1 is constructed from a single sheet of sheet metal 16 configured for holding the intersecting elongated wood x , y , and z structural members 2 , 7 , and 11 in a rigid embrace and includes : an xy support side member 17 dimensioned for registration with a portion of the first side 3 of the elongated wood x structural member 2 ; an xz support side member 18 disposed at an angle 72 to the xy support side member 17 and integrally connected thereto along a substantial portion thereof and dimensioned for registration with the second side 4 of the elongated wood x structural member 2 ; a yx side member 19 integrally connected to the xy support side member 17 and dimensioned for registration with a portion of the first side 8 of the elongated wood y structural member 7 ; the xy support side member 17 and the yx side member 19 forming a first angle 30 ; a zx side member 20 integrally connected to the xz support side member 18 and dimensioned for registration with a portion of the first side 12 of the elongated wood z structural member 11 ; the xz support side member 18 and the zx side member 20 forming a second angle 31 ; a y seat member 21 integrally connected to the yx side member 19 and dimensioned for registration with a portion of the seat side 9 of the elongated wood y structural member 7 ; a y side member 22 integrally connected to the y seat member 21 and dimensioned for registration with a portion of the second side 10 of the elongated wood y structural member 7 ; a z seat member 23 integrally connected to the zx side member 20 and dimensioned for registration with a portion of the seat side 13 of the elongated wood z structural member 11 ; and a z side member 24 integrally connected to the z seat member 23 and dimensioned for registration with a portion of the second side 14 of the elongated wood z structural member 11 . the first rigid connector 15 1 is connected to the elongated wood structural members by first fastener means 25 attaching the xy support side member 17 to the first side 3 of the elongated wood x structural member 2 ; second fastener means 26 attaching the yx side member 19 to the first side 8 of the elongated wood y structural member 7 ; third fastener means 27 attaching the y side member 22 to the second side 10 of the elongated wood y structural member 7 ; fourth fastener means 28 attaching the zx side member 20 to the first side 12 of the elongated wood z structural member 11 ; fifth fastener means 29 attaching the z side member 24 to the second side 14 of the elongated wood z structural member 11 ; and sixth fastener means 32 attaching the xz support side member 18 to the second side 4 of the elongated wood x structural member 2 . the rigid intersection connections 1 , 1 &# 34 ;, and 1 &# 39 ; illustrated in fig1 , 17 , and 18 may be made even more rigid and hold greater loads by providing a y side opening means 33 formed in the y side member 22 permitting double shear fastening of the y side member 22 to the elongated wood x structural member 2 and z side opening means 34 formed in the z side member 24 permitting double shear fastening of the z side member to the elongated wood x structural member 2 . double shear attachment is by seventh fastener means 35 dimensioned for insertion through the y side opening means 33 , the elongated wood y structural member 7 and into the elongated wood x structural member 2 ; and eighth fastener means 36 dimensioned for insertion through the z side opening means 34 , the elongated wood z structural member 11 and into the elongated wood x structural member 2 . double shear fastening is fully explained in u . s . pat . no . 4 , 480 , 941 granted nov . 6 , 1984 entitled double shear angled fastener connector . a first modified second series rigid connector 15 &# 34 ;&# 39 ; is illustrated in fig2 - 30 . this form of the invention has been found to be suitable for connecting smaller dimension lumber to larger dimension posts . the rigid intersection connection 1 &# 34 ;&# 39 ; includes : a y side extension 37 integrally connected to the y side member 22 &# 34 ;&# 39 ; at an angle 41 and disposed in registration with a portion of the elongated wood x structural member 2 ; and a z side extension 38 integrally connected to the z side member 24 at an angle 42 and disposed in registration with a portion of the elongated wood x structural member 2 . connection is by ninth fastener means 39 piercing the y side extension 37 and inserted into the elongated wood x structural member 2 ; and tenth fastener means 40 piercing the z side extension 38 and inserted into the elongated wood x structural member 2 . a second modified , second series rigid connector 15 &# 34 ;&# 34 ; is illustrated in fig2 - 27 . this form of the invention is particularly suitable for lumber of the same thickness . the rigid intersection connection 1 &# 34 ;&# 34 ; includes : a y side extension interlock 43 integrally connected to the y side member 22 &# 34 ;&# 34 ; at an angle 47 and disposed in registration with a portion of the z side member 24 &# 34 ;&# 34 ;; and a z side extension interlock 44 integrally connected to the z side member 24 &# 34 ;&# 34 ; at an angle 48 and disposed in registration with a portion of the y side member 22 &# 34 ;&# 34 ;. connection is by eleventh fastener means 45 piercing the y side extension interlock 43 and the z side member 24 &# 34 ;&# 34 ; and inserted into the elongated wood z structural member 11 ; and twelfth fastener means 46 piercing the z side extension interlock 44 and the y side member 22 &# 34 ;&# 34 ; and inserted into the elongated wood y structural member 7 . a third modified second series rigid connector 15 &# 34 ;&# 39 ;&# 34 ; is illustrated in fig3 - 34 . this form of the invention is particularly suitable for large dimension lumber . the rigid intersection connection 1 &# 34 ;&# 39 ;&# 34 ; includes : a y side member extension x structural member interlock 49 integrally connected to the y side member 22 &# 34 ;&# 39 ;&# 34 ; at an angle 53 and disposed for registration with the z side member 24 &# 34 ;&# 39 ;&# 34 ;; a restricted opening 50 formed in the y side member extension x structural member interlock 49 ; a restricted slot opening 51 formed in the z side member 24 &# 34 ;&# 39 ;&# 34 ; in registration with the restricted opening 50 formed in the y side member extension x structural member interlock 49 ; and thirteenth fastener means 52 dimensioned for insertion through the restricted opening 50 formed in the y side member extension x structural member interlock and the restricted slot opening 51 formed in the z side member 24 &# 34 ;&# 39 ;&# 34 ;, and inserted into the elongated wood x structural member 2 . tab 89 connected to y seat member 21 &# 34 ;&# 39 ;&# 34 ; and formed with a fastener opening for receipt of fastener 124 for insertion therethrough into elongated x structural member 2 , and tab 90 connected to z seat member 23 &# 34 ;&# 39 ;&# 34 ; and formed with a fastener opening for receipt of fastener 124 for insertion therethrough into elongated x structural member 2 assist in increasing the rigidity of the rigid intersection connection 1 &# 34 ;&# 39 ;&# 34 ;. a fourth modified second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; is illustrated in fig3 - 41 . this form of the invention is particularly suitable for lumber of the same dimensional width and for structural rigidity . the rigid intersection connection 1 &# 34 ;&# 34 ;&# 34 ; includes : a y side extension overlap 57 integrally connected to the y side member 22 &# 34 ;&# 34 ;&# 34 ; at an angle 59 ; a z side extension overlap 58 integrally connected to the z side member 24 &# 34 ;&# 34 ;&# 34 ; at an angle 60 and disposed in overlapping registration with the y side extension overlap 57 ; and fifteenth fastener means 56 piercing the y and z side extension overlaps 57 , and 58 and inserted into the first elongated wood x structural member 2 . one of the simplest structures using a plurality of rigid intersection connections as described in the present invention is a log holder 54 which is illustrated in fig2 . this is only one example of a furniture structure , but it typifies one of the structures which takes advantage of the unique characteristics of the rigid connector of the present invention . any one of the second series rigid connectors could be used , but as an example , the second modified second series rigid connector 15 &# 34 ;&# 34 ; as previously described in fig2 - 27 is illustrated . the structure 54 as illustrated in fig2 includes : a plurality of rigid intersection connections 1 &# 34 ;&# 34 ; including : a first elongated wood x structural member 2 1 having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a second elongated wood x structural member 2 2 having first , second , third and fourth sides 3 , 4 , 5 , and 6 spaced from and disposed generally parallel to the first elongated wood x structural member 2 1 ; a third elongated wood x structural member 2 3 having first , second , third and fourth sides 3 , 4 , 5 , and 6 spaced from and disposed generally parallel to the second elongated wood x structural member 2 2 ; a fourth elongated wood x structural member 2 4 having first , second , third and fourth sides 3 , 4 , 5 , and 6 spaced from and disposed generally parallel to the first and third elongated wood x structural members 2 1 and 2 3 ; a second elongated wood y structural member 7 2 disposed parallel and spaced from the first elongated wood y structural member 7 1 ; a second elongated wood z structural member 11 2 disposed parallel and spaced from the first elongated wood z structural member 11 1 ; a first rigid connector 15 1 &# 34 ;&# 34 ; connected to the first elongated wood x structural member 2 1 , a second rigid connector 15 2 &# 34 ;&# 34 ; connected to the second elongated wood x structural member 2 2 , the first elongated wood z structural member 11 1 and the second elongated wood y structural member 7 2 ; a third rigid connector 15 3 &# 34 ;&# 34 ; connected to the third elongated wood x structural member 2 3 , the second elongated wood y structural member 7 2 and the second elongated wood z structural member 11 2 ; a fourth rigid connector 15 4 &# 34 ;&# 34 ; connected to the fourth elongated wood x structural member 2 4 , the second elongated wood z structural member 11 2 and the first elongated wood y structural member 7 1 ; and fastener means 55 attaching the first , second , third , and fourth rigid connectors 15 2 &# 34 ;&# 34 ;, 15 3 &# 34 ;&# 34 ;, 15 4 &# 34 ;&# 34 ; to the elongated wood structural members 2 1 2 2 , 2 3 , 2 4 , 7 1 , 7 2 , 11 1 , and 11 2 . the log holder 54 may be made of any dimension lumber , but a typical lumber size would be 2 &# 34 ;× 4 &# 34 ; or nominal 2 × 4 &# 39 ; s . referring again to the log holder structure illustrated in fig2 and the second modified , second series rigid connector 15 &# 34 ;&# 34 ; illustrated in fig2 - 27 each of the first , second , third and fourth rigid connectors 15 1 &# 34 ;&# 34 ;, 15 2 &# 34 ;&# 34 ;, 15 3 &# 34 ;&# 34 ;, and 15 4 &# 34 ;&# 34 ; include : a y side extension interlock 43 integrally connected to the y side member 22 &# 34 ;&# 34 ; at an angle 47 and disposed in registration with a portion of the z side member 24 &# 34 ;&# 34 ;; a z side extension interlock 44 integrally connected to the z side member 24 &# 34 ;&# 34 ; at an angle 48 and disposed in registration with a portion of the y side member 22 &# 34 ;&# 34 ;; eleventh fastener means 45 piercing each of the y side extension interlocks 43 and the z side members 24 &# 34 ;&# 34 ; and inserted into the elongated wood z structural members 11 ; and twelfth fastener means 46 piercing each of the z side extension interlocks 44 and the y side members 22 &# 34 ;&# 34 ; and inserted into the elongated wood y structural members 7 . another furniture structure which is uniquely adapted for construction with the rigid intersection connections of the present invention is a work bench . the work bench may have four or more legs such as the five leg work bench in fig2 . to minimize the number of drawings , a four leg work bench has not been specifically drawn ; rather it may be readily envisioned that simply placing a table top means on the top of the log holder of fig2 would readily result in the formation of a work bench or table . to construct an even sturdier work bench , horizontal wood structural members may be used as in the 5 post work bench of fig2 . the description which follows refers to a four leg work bench as illustrated in fig2 , but with the additional horizontal support members as illustrated in fig2 . a furniture structure such as a work bench previously described may include : a third elongated wood y structural member 7 3 disposed from the first elongated wood y structural member 7 1 and in parallel relation thereto ; a fourth elongated wood y structural member 7 4 disposed from the second elongated wood y structural member 7 2 and in parallel relation thereto ; a third elongated wood z structural member 11 3 disposed from the first elongated wood z structural member 11 1 and in parallel relation thereto ; a fourth elongated wood z structural member 11 4 disposed from the second elongated wood z structural member 11 2 and in parallel relation thereto ; a fifth rigid connector 15 5 &# 34 ;&# 34 ; disposed from the first rigid connector 15 1 &# 34 ;&# 34 ; and connected to the first elongated wood x structural member 2 1 , the third elongated wood y structural member 7 3 , and the third elongated wood z structural member 11 3 ; a sixth rigid connector 15 6 &# 34 ;&# 34 ; connected to the second elongated wood x structural member 2 2 , the third elongated wood z structural member 11 3 , and the fourth elongated wood y structural member 7 4 ; a seventh rigid connector 15 7 &# 34 ;&# 34 ; disposed from the third rigid connector 15 3 &# 34 ;&# 34 ; and connected to the third elongated wood x structural member 15 3 &# 34 ;&# 34 ;, the fourth elongated wood z structural member 11 4 and the fourth elongated wood y structural member 7 4 ; an eighth rigid connector 15 8 &# 34 ;&# 34 ; disposed from the fourth rigid connector 15 4 &# 34 ;&# 34 ; and connected to the fourth elongated wood x structural member 2 3 , the third elongated wood y structural member 7 3 and the fourth elongated wood z structural member 11 4 ; and the fastener means 55 also attach the fifth , sixth , seventh and eight rigid connectors 15 5 &# 34 ;&# 34 ;, 15 6 &# 34 ;&# 34 ;, 15 7 &# 34 ;&# 34 ;, and 15 8 &# 34 ;&# 34 ; to the elongated wood structural members 7 3 , 11 3 , 7 4 , 11 4 , 2 1 , 2 2 , 2 3 , and 2 4 . fig2 is an illustration of a 5 post work bench . the description which follows includes the description of the four post work bench set forth above . while the work bench may be constructed from any of the rigid connectors previously described , the description which follows is based on the second series rigid connectors illustrated in fig1 and 2 and the first series rigid connector illustrated in fig1 . the furniture structure 61 illustrated in fig2 includes : a fifth elongated wood x structural member 2 5 disposed between the first and fourth elongated wood x structural members 2 1 and 2 4 ; a first , first series rigid connector 15 2 , which includes : an xy support side member 17 &# 39 ; dimensioned for registration with a portion of the fifth elongated wood x structural member 2 5 ; an xz support side member 18 &# 39 ; integrally connected to the xy support side member 17 &# 39 ; along a substantial portion thereof and dimensioned for registration with a portion of the fifth elongated wood x structural member 2 5 ; a yx side member 19 &# 39 ; integrally connected to the xy support side member 17 &# 39 ; and dimensioned for registration with a portion of the first side 8 of the first elongated wood y structural member 7 1 ; a zx side member 20 &# 39 ; integrally connected to the xz support side member 18 &# 39 ; and dimensioned for registration with a portion of the first side 8 of the first elongated wood y structural member 7 1 ; a y seat member 21 &# 39 ; integrally connected to the yx side member 19 &# 39 ; and dimensioned for registration with a portion of the seat side 9 of the first elongated wood y structural member 7 1 ; a y side member 22 &# 39 ; integrally connected to the y seat member 21 &# 39 ; and dimensioned for registration with a portion of the second side 10 of the first elongated wood y structural member 7 1 ; a z seat member 23 &# 39 ; integrally connected to the zx side member 20 &# 39 ; and dimensioned for registration with a portion of the seat side 9 of the first elongated wood y structural member 7 1 ; a z side member 24 &# 39 ; integrally connected to the z seat member 23 &# 39 ; and dimensioned for registration with a portion of the second side 14 of the first elongated wood y structural member 7 1 ; and the xy and xz support side members 17 &# 39 ; and 18 &# 39 ; are in substantially the same plane ; a second , first series rigid connector 15 2 &# 39 ; spaced from the first , first series rigid connector 15 1 &# 39 ; including : an xy support side member 17 &# 39 ; dimensioned for registration with a portion of the fifth elongated wood x structural member 2 5 , an xz support side member 19 &# 39 ; integrally connected to the xy support side member 17 &# 39 ; along a substantial portion thereof and dimensioned for registration with a portion of the fifth elongated wood x structural member 2 5 ; a yx side member 19 &# 39 ; integrally connected to the xy support side member 17 &# 39 ; and dimensioned for registration with a portion of the first side 8 of the third elongated wood y structural member 7 3 ; a zx side member 20 &# 39 ; integrally connected to the xz support side member 18 &# 39 ; and dimensioned for registration with a portion of the first side 8 of the third elongated wood y structural member 7 3 ; a y seat member 21 &# 39 ; integrally connected to the yx side member 19 and dimensioned for registration with a portion of the seat side 9 of the third elongated wood y structural member 7 3 ; a y side member 22 &# 39 ; integrally connected to the y seat member 21 &# 39 ; and dimensioned for registration with a portion of the second side 10 of the third elongated wood y structural member 7 3 ; a z seat member 23 &# 39 ; integrally connected to the zx side member 20 &# 39 ; and dimensioned for registration with a portion of the seat side 9 of the third elongated wood y structural member 7 1 ; a z side member 24 &# 39 ; integrally connected to the z seat member 23 &# 39 ; and dimensioned for registration with a portion of the second side 14 of the third elongated wood y structural member 73 ; and the xy and xz support side members 17 &# 39 ; and 18 &# 39 ; are in substantially the same planes ; and the fastener means 55 also attach the first and second first series rigid connectors 15 1 &# 39 ; and 15 2 &# 39 ; to the elongated wood structural members 2 5 , 7 1 , and 7 3 . table surface 125 may be attached to third and fourth elongated wood y structural members 7 3 and 7 4 and third and fourth elongated wood z structural members 11 3 and 11 4 . use of eight rigid connectors in any furniture structure such as the table structure illustrated in fig2 or the bunk bed illustrated in fig3 - 38 which follow eliminates the need for any diagonal bracing . the use of a plurality of rigid intersection connections of the present invention forming structures based on rectangles instead of triangles , makes it possible to form many useful structures with very little change in the basic structure . for example , the construction of a 4 post table using the basic structure of the log holder 54 in fig2 also may result in the formation of a basic 4 poster bunk bed ( not shown but similar to the structure of fig3 ). the description that follows is therefore a continuation of the description of the four post bench but instead of using the second series rigid connectors previously described and illustrated in fig1 and 2 , the fourth modified , second series rigid connectors illustrated in fig3 and 41 is used . the furniture structure such as a four post bunk bed may include the structure previously described for a four post table and also include : the first through eighth rigid connectors 15 1 &# 34 ;&# 34 ;&# 34 ; through 15 8 &# 34 ;&# 34 ;&# 34 ; each of which include : a y side extension overlap 57 integrally connected to the y side member 2 2 &# 34 ;&# 34 ;&# 34 ; at an angle 59 ; a z side extension overlap 58 integrally connected to the z side member 2 4 &# 34 ;&# 34 ;&# 34 ; at an angle 60 ; fifteenth fastener means 56 piercing each of the y and z side extension overlaps 57 and 58 and inserted into each of the first , second , third , and fourth elongated wood x structural members 2 4 , 2 2 , 2 3 , and 2 4 . amazingly , the rigid intersection connection of the present invention is capable of constructing a log holder , a work bench and a bunk bed , but it is uniquely capable of constructing an entire building based on one rigid connector . the structure illustrated in fig2 - 14 may be a storage shed , tool house or greenhouse or other garden utilitarian structure . note that the structure is based on a series of rectangles rather than a series of triangles as in all other building structures . the use of rectangles rather than triangles permits windows , doors , vents or other openings to be placed anywhere in the structure ; even at corners because there is no interfering diagonal members . use of the intersecting connections of the present invention eliminates the need for plywood or other sheathing to create shear walls in building structures . thus glass or plastic panels may be fitted in each of the rectangles in the greenhouse illustrated in fig2 - 14 . the greenhouse described in this application may have a flat roof , a shed roof or a peaked roof . the description which follows relates to a flat roofed greenhouse which is not shown in order to reduce the number of drawings in this application . the rigid connectors used in the construction of the greenhouse structure may be any of those described . a full description of each rigid connector is not repeated as the description has been set forth above for each of the different series connectors . in determining the particular rigid connector , one may refer to the previous description , the claims and the drawings . referring specifically to fig3 the building structure includes : a first elongated wood x structural member 2 1 having first , second , third , and fourth sides 3 , 4 , 5 , and 6 and upper and lower ends 62 and 63 , a second elongated wood x structural member 2 2 disposed generally parallel to and spaced from the first elongated wood x structural member 2 1 and having first , second , third and fourth sides 3 , 4 , 5 , and 6 and upper and lower ends 62 and 63 ; a third elongated wood x structural member 2 . sup . 3 spaced from and disposed generally parallel to the second elongated wood x structural member 2 2 and having first , second , third and fourth sides 3 , 4 , 5 , and 6 and upper and lower ends 62 and 63 ; a fourth elongated wood x structural member 2 4 spaced from and disposed generally parallel to the first and third elongated wood x structural members 2 1 and 2 3 and having first , second , third and fourth sides 3 , 4 , 5 , and 6 and upper and lower ends 62 and 63 ; the first , second , third , and fourth elongated wood x structural members 2 1 , 2 2 , 2 3 , 2 4 provide corner studs in the building structure ; a first elongated wood y structural member 7 1 disposed between and intersecting the first and fourth elongated wood x structural members 2 1 and 2 4 and having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a first elongated z structural member 11 1 disposed between and intersecting the first and second elongated wood x structural members 2 1 and 2 2 and having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a second elongated wood y structural member 7 2 disposed parallel and spaced from the first elongated wood y structural member 7 1 and intersecting the second and third elongated x structural members 2 . sup . 2 and 2 3 and having first , second , third , and fourth sides 3 , 4 , 5 , and 6 ; a second elongated wood z structural member 11 2 disposed parallel and spaced from the first elongated wood z structural member 11 2 , and intersecting the second and third elongated wood x structural members 2 2 and 2 3 and having first , second , third and fourth sides 3 , 4 , 5 , and 6 ; the first and second elongated wood y structural members 7 1 and 7 2 and the first and second elongated wood z structural members 11 1 and 11 2 form a perimeter sill in the building ; a first , second series rigid connector 15 1 connected to and forming a rigid interconnection with the first elongated wood x structural member 2 1 , the first elongated wood y structural member 7 1 and the first elongated wood z structural member 11 1 ; a second , second series rigid connector means 15 2 connected to and forming a rigid interconnection with the second elongated wood x structural member 2 2 , the first elongated wood z structural member 11 1 and the second elongated wood y structural member 7 2 ; a third , second series rigid connector means 15 3 connected to and forming a rigid interconnection with the third elongated wood x structural member 2 3 , the second elongated wood y structural member 7 2 and the second elongated wood z structural member 11 2 ; a fourth , second series rigid connector means 15 4 connected to and forming a rigid interconnection with the fourth elongated wood x structural member 2 4 , the second elongated wood z structural member 11 2 and the first elongated wood y structural member 7 1 ; roof means such as a flat structure connected to the upper portions 62 of the elongated wood x structural members 2 1 , 2 2 , 2 3 , and 2 4 ; fastener means 25 - 29 , 32 , and 56 attaching the first , second , third , and fourth , second series rigid connectors 15 1 , 15 2 , 15 3 , and 15 4 , to the elongated wood structural members 2 1 , 2 2 , 2 3 , 2 4 , 11 1 , 7 2 , 11 2 , and 7 1 ; and the first elongated wood x structural member 2 1 , the first elongated wood y structural member 7 1 , the fourth elongated wood x structural member 2 4 and the roof means form a rectangular opening . the previously described building structure with a flat roof may also be formed with a shed or slanting roof by simply adding third series rigid connectors illustrated in fig1 and previously described . the additional structure for a shed roof building structures includes : the first , second , third , and fourth elongated wood x structural members have upper ends 62 ; a sixth elongated wood x structural member 2 6 disposed adjacent the upper ends 62 of the first and fourth elongated wood x structural members 2 1 and 2 4 ; a fifth elongated wood z structural member 11 5 having an upper end 64 and a lower end 65 intersecting the sixth elongated wood x structural member 2 6 and disposed in close association with the upper end 62 of the first elongated wood x structural member 2 2 ; a fifth elongated wood y structural member 7 5 having an upper end 66 and having a lower end 67 intersecting the sixth elongated wood x structural member 2 6 and disposed in close association with the upper end 62 of the fourth elongated wood x structural member 2 4 ; a first , third series rigid connector means 15 1 &# 34 ; connected to and forming a rigid interconnection with the sixth elongated wood x structural member 2 6 , the first elongated wood x structural member 2 1 and the fifth elongated wood z structural member 11 5 ; a second , third series rigid connector means 15 2 &# 34 ; connected to and forming a rigid interconnection with the sixth elongated wood x structural member 2 6 , the fourth elongated wood x structural member 2 4 , and the fifth elongated wood y structural member 7 5 ; and panel means connecting the upper ends 64 and 66 of the fifth elongated wood z structural member 11 5 and the fifth elongated wood y structural member 7 5 and the upper ends 62 of the second and third elongated wood x structural members 2 2 and 2 3 . the building structure with a peaked roof is illustrated in fig3 - 14 . this structure differs only with the previously shed roofed structure in that two additional third series rigid connectors illustrated in fig1 are required and two additional second series rigid connectors are added . any of the second series rigid connectors previously described may be used . the peaked roof building structure 69 illustrated in fig3 in addition to the description for the shed roof structure includes : a seventh elongated wood x structural member 2 7 disposed adjacent the upper ends 62 of the second and third elongated wood x structural members 2 2 and 2 3 ; an eighth elongated wood x structural member 2 8 disposed from and parallel to the sixth and seventh elongated wood structural x members 2 6 and 2 7 ; a sixth elongated wood y structural member 7 6 having upper and lower ends 66 and 67 and intersecting the seventh and eighth elongated wood x structural members 2 7 and 2 8 and the fifth elongated wood z structural member 11 5 , and the lower end 67 being disposed in close association with the upper end 62 of the second elongated wood x structural member 2 2 ; a sixth elongated wood z structural member 11 6 having upper and lower ends 64 and 65 and intersecting the seventh elongated wood x structural member 2 7 and the fifth elongated wood y structural member 7 5 , and disposed in close association with the upper end 62 of the third elongated wood x structural member 2 3 ; a third , third series rigid connector means 15 3 &# 34 ; connected to and forming a rigid interconnection with the seventh elongated wood x structural member 2 7 , the second elongated wood x structural member 2 2 and the sixth elongated wood y structural member 7 6 ; a fourth , third series rigid connector means 15 4 &# 34 ; connected to and forming a rigid interconnection with the seventh elongated wood x structural member 2 7 , the third elongated wood x structural member 2 3 , and the sixth elongated wood z structural member 11 6 ; a ninth , second series rigid connector means 15 9 connected to and forming a rigid interconnection with the eighth elongated wood x structural member 2 8 , the sixth elongated wood y structural member 7 6 and the fifth elongated wood z structural member 11 5 ; a tenth , second series rigid connector means 15 10 connected to and forming a rigid interconnection with the eighth elongated wood x structural member 2 8 , the fifth elongated wood y structural member 7 5 and the sixth elongated wood z structural member 11 6 ; and fastener means 55 attaching the third and fourth , third series rigid connectors 15 3 &# 34 ; and 15 4 &# 34 ; and the ninth and tenth second series rigid connectors 15 9 and 15 10 to the elongated wood structural members 2 7 , 2 8 , 7 6 , 11 6 , 11 5 , and 7 5 . surprisingly , the first , second , and third series connectors 15 &# 39 ;, 15 , and 15 &# 34 ; are all constructed from the same sheet metal blank 16 illustrated in fig2 . the second series rigid connector 15 illustrated in fig1 , 15 and 16 is constructed from sheet metal blank 16 illustrated in fig2 as follows : xy support side member 17 is bent up 90 ° along bend line 73 , y seat member 21 is bent up 90 ° along bend line 74 , y side member 22 is bent up 90 ° along bend line 75 , z seat member 23 is bent up 90 ° along bend line 76 and z side member 24 is bent up 90 ° along bend line 77 . first series rigid connector 15 &# 39 ; illustrated in fig1 - 21 is constructed from sheet metal blank 16 illustrated in fig2 in the exact same manner as second series rigid connector 15 explained above except that no bend is made along bend line 73 . third series rigid connector 15 &# 34 ; illustrated in fig1 is constructed from sheet metal blank 16 illustrated in fig2 in the exact same manner as second series rigid connector 15 except that variable bends may be made in either bend line 78 or 79 depending on the slope required as in the sloping roof for the greenhouse 69 illustrated in fig3 . first modified , second series rigid connector 15 &# 34 ;&# 39 ; illustrated in fig2 - 30 is constructed from sheet metal blank 80 illustrated in fig3 as follows : xy support side member 17 &# 34 ;&# 39 ; is bent up 90 ° along bend line 73 &# 34 ;&# 39 ;, y seat member 21 &# 34 ;&# 39 ; is bent up 90 ° along bend line 74 &# 34 ;&# 39 ;, y side member 22 &# 34 ;&# 39 ; is bent up 90 ° along bend line 75 &# 34 ;&# 39 ;, z seat member 23 &# 34 ;&# 39 ; is bent up 90 ° along bend line 76 &# 34 ;&# 39 ; and z side member 24 &# 34 ;&# 39 ; is bent up 90 ° along bend line 77 &# 34 ;&# 39 ;. y side extension 37 is then bent down 90 ° along bend line 81 , z side extension 38 is then bent down 90 ° along bend line 82 , and blank 80 is cut along cut line 83 and cut line 84 . second modified , second series rigid connector 15 &# 34 ;&# 34 ; illustrated in fig2 - 27 is constructed from the same sheet metal blank 80 illustrated in fig3 as first modified , second series rigid connector 15 &# 34 ;&# 39 ;, except that no cuts are made along line cut lines 83 and 84 , nor is any bend made along bend lines 81 and 82 . instead , y side extension interlock 43 is bent down 90 ° along bend line 85 and z side extension interlock 44 is bent down 90 ° along bend line 86 . third modified , second series rigid connector 15 &# 34 ;&# 34 ; illustrated in fig3 - 34 is constructed from sheet metal blank 87 illustrated in fig3 as follows : xy support side member 17 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 73 &# 34 ;&# 39 ;&# 34 ;, y seat member 21 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 74 &# 34 ;&# 39 ;&# 34 ;, y side member 22 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 75 &# 34 ;&# 39 ;&# 34 ;, z seat member 23 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 76 &# 34 ;&# 39 ;&# 34 ; and z side member 24 &# 34 ;&# 39 ;&# 34 ; is bent up 90 ° along bend line 77 &# 34 ;&# 39 ;&# 34 ;. in addition , y side member extension x structural member interlock 49 is bent down 90 ° along bend line 88 , and tabs 89 and 90 are bent down 90 ° along bend lines 91 and 92 . fasteners 124 attach tabs 89 and 90 to elongated wood structural member 2 . fourth modified , second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; illustrated in fig3 - 41 is constructed from sheet metal blank 93 illustrated in fig4 as follows : xy support side member 17 &# 34 ;&# 34 ;&# 34 ; is bent down 90 ° along bend line 73 &# 34 ;&# 34 ;&# 34 ;, y seat member 21 is bent down 90 ° along bend line 74 &# 34 ;&# 34 ;&# 34 ;, y side member 22 &# 34 ;&# 34 ;&# 34 ; is bent down 90 ° along bend line 75 &# 34 ;&# 34 ;&# 34 ;, z seat member 23 &# 34 ;&# 34 ;&# 34 ; is bent down 90 ° along bend line 76 &# 34 ;&# 34 ;&# 34 ; and z side member 24 &# 34 ;&# 34 ;&# 34 ; is bent down 90 ° along bend line 77 &# 34 ;&# 34 ;&# 34 ;. in addition , y side extension overlap 57 is bend up 45 ° along bend line 94 and z side extension overlap 58 is bent up 45 ° along bend line 95 . fourth modified , first series rigid connector 15 &# 39 ;&# 34 ;&# 34 ;&# 34 ; as illustrated in fig4 - 45 is constructed from sheet metal blank 93 illustrated in fig4 in the exact same manner as fourth modified , second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; explained above except that no bend is made along bend line 73 &# 34 ;&# 34 ;&# 34 ; nor is any bend made along bend lines 94 and 95 . the description of fourth modified , first series rigid connector 15 &# 39 ;&# 34 ;&# 34 ;&# 34 ; as illustrated in fig4 - 45 is identical to the description of fourth modified , second series rigid connector 15 &# 34 ;&# 34 ;&# 34 ; illustrated in fig3 - 41 except for the absence of bending along bend line 73 &# 34 ;&# 34 ;&# 34 ;, and bend lines 57 and 58 . numbering of rigid intersection connection 1 &# 39 ;&# 34 ;&# 34 ;&# 34 ; in fig4 - 45 is identical to the numbering of rigid intersection connection 1 &# 34 ;&# 34 ;&# 34 ; in fig3 - 41 except that the designation (&# 39 ;&# 34 ;&# 34 ;&# 34 ;) is set forth after the numbers in fig4 - 45 instead of the designation (&# 34 ;&# 34 ;&# 34 ;) set forth after the numbers in fig3 - 41 . rigid intersection connections 1 &# 34 ;&# 34 ;&# 34 ; and 1 &# 39 ;&# 34 ;&# 34 ;&# 34 ; are used in the construction of the furniture structure 68 sometimes referred to as the &# 34 ; bunk bed &# 34 ; in fig3 - 38 . referring to fig4 - 51 , a rigid angle 96 is illustrated which is ancillary to the structures of the present invention based on rectangles rather than triangles . the rigid angle 96 consists of a first side 97 , connected at right angles to a second side 98 and formed with a first member 99 integrally connected to first side 97 along bend line 101 and a second member 100 integrally connected to second side 98 along bend line 102 and constructed from a sheet metal blank 103 illustrated in fig4 . attachment in furniture products is preferably by screws or lag bolts 104 . construction of the building structure 69 such as a greenhouse illustrated in fig3 - 14 is generally as set forth above , but with the following additional description . a plurality of intermediate elongated wood x structural members 2 9 are attached at their bottom ends to elongated wood y structural members 7 1 and 7 2 at spaced intervals by a plurality of first series rigid connectors 15 &# 39 ; and at their top ends to sixth and seventh elongated x structural members 2 6 and 2 7 by third series rigid connectors 15 &# 34 ;. a door 105 may be hung in door frame members 106 and 107 in which their bottom ends are attached to first elongated wood z structural member 11 1 by first series rigid connectors 15 &# 39 ; and their top ends by rigid angles 96 . in addition to the roof structure previously described , a plurality of intermediate rafters or intermediate elongated wood z structural members 11 7 and intermediate elongated wood y structural members 7 7 may be spaced at intervals with their lower ends connected to sixth and seventh elongated wood x structural members 2 6 and 2 7 by third series rigid connectors 15 &# 34 ; and their top ends connected to eighth elongated wood x structural member 2 8 by second series rigid connectors 15 . a movable roof vent 109 may be located in the roof structure . preferably the movable roof vent is controlled for opening and closing by a temperature sensitive means so that a more even temperature may be maintained in the greenhouse . movable roof vent 109 may be framed by framing member 112 . preferably movable lower side vent 108 is also installed in the side or rear of the greenhouse 69 to admit cool fresh air when needed . an alternate form of construction is illustrated in fig8 , 13 and 14 . the rear elevation of the building structure illustrated in fig8 may be constructed with a window 114 set in window frames 113 and a movable vent 115 installed below window 114 . to strengthen the building structure , fire stops 116 may be installed as required and connected to the wood members by either first series rigid connectors 15 &# 39 ; or second series rigid connectors 15 as required . door 105 may be one piece or it may be a two piece &# 34 ; dutch door &# 34 ; divided into upper and lower portions 110 and 111 . a basic version of furniture structure 68 , also known as a bunk bed was previously described . fig3 illustrates a more commercial form having ladder means 119 including an intermediate elongated wood structural member 2 10 connected at its upper end to third elongated wood y structural member 7 3 by first series rigid connector 15 &# 39 ; and including a plurality of ladder steps 120 . railings 121 may be connected to the upper ends of elongated wood x structural members 2 1 , 2 2 , 2 3 , 2 4 , and 2 10 by rigid angles 96 , first series rigid connectors 15 &# 39 ;, and second series rigid connectors 15 as required . load ledgers 122 may be added to support the edges of the bed frame , book shelves , desks and other loads to be held by the furniture structure . first elongated wood y structural member 7 1 may be removably attached to fifth rigid connector 15 4 &# 34 ;&# 34 ;&# 34 ; and rigid angle 96 for ease in entering and exiting the furniture structure . research has indicated that college students assigned to small dormitory rooms or renting private rooms have very limited floor area in which to place their bed , desk and book storage unit . a combination bed and study unit illustrated 123 in fig3 and 38 using the rigid connectors previously described in this application was the structure which resulted from this study . the combination bed and study unit includes : a desk unit 117 connected to the first and second elongated wood x structural members 2 1 and 2 2 ; a storage unit 118 connected to the third and fourth elongated wood x structural members 2 3 and 2 4 ; ladder means 119 connected to the third and fourth elongated wood and structural members 2 10 ; and the fastener means 55 are threaded for installation and disassembly of the rigid connectors 15 , and 15 &# 39 ;, rigid angles 96 , and elongated wood structural members as set forth in fig3 - 38 of the drawings . for purposes of clarity and convenience , no connectors were drawn on fig3 and 38 . it is to be understood that the same connectors illustrated on fig3 are used in the construction of the bed and study units illustrated in fig3 and 38 . | 8 |
hereafter , an embodiment of the present invention will be described more specifically with reference to the drawings . fig1 is an equivalent circuit diagram of a tunable filter according to a first embodiment of the present invention . the tunable filter shown in fig1 includes a filter main body 11 , and a control circuit 12 that controls the filter main body 11 . the filter main body 11 is a ladder filter including a series resonance unit 3 having two resonance units 1 and 2 connected in series , and parallel resonance units 4 and 5 that are connected to between one end of the resonance units 1 and 2 , respectively and an input / output common terminal . each of the resonance units 1 , 2 , 4 , and 5 has a variable capacitor 7 and a thin - film piezoelectric resonator , i . e ., a film bulk acoustic resonator ( fbar ) 8 that are connected in parallel , and a variable capacitor 9 that is connected in series with them . an upper electrode of the film bulk acoustic resonator 8 within the series resonance unit 3 and an upper electrode of the film bulk acoustic resonator 8 within the parallel resonance unit 6 have mutually different thicknesses . based on this , a resonance frequency of the series resonance unit 3 and a resonance frequency of the parallel resonance unit 6 are slightly different from each other . configurations of the variable capacitors 7 and 9 , and the film bulk acoustic resonator 8 are described later . the control circuit 12 includes a first voltage controlled oscillator ( vco 1 ) 13 that oscillates in a first oscillation frequency , a second voltage controlled oscillator ( vco 2 ) 14 that oscillates in a second oscillation frequency , a temperature compensated crystal oscillator ( tcxo ) 15 that generates a reference frequency signal , a pll ( phase - locked loop ) circuit ( pll 1 ) 16 that controls the oscillation frequency of the first voltage controlled oscillator 13 , a voltage applying circuit 17 that controls capacitance of a part of the variable capacitors within the tunable filter , a pll circuit ( pll 2 ) 18 that controls the oscillation frequency of the second voltage controlled oscillator 14 , a voltage applying circuit 19 that controls capacitance of other part of the variable capacitors within the tunable filter , a base band circuit 20 , and a storage circuit 21 that stores reference frequencies of the first and the second voltage controlled oscillators 13 and 14 . the first voltage controlled oscillator 13 and the second voltage controlled oscillator 14 constitute a monitoring circuit . fig2 is a top plan diagram of the variable capacitors 7 and 9 that are used in the tunable filter shown in fig1 . fig3 is a cross - sectional diagram of the variable capacitors cut along a line a - a ′ in fig2 . as shown in these diagrams , each of the variable capacitors 7 and 9 have fixed electrode 32 formed on a silicon substrate 31 , a dielectric film 33 formed on the upper surface of the fixed electrode 32 , and a variable electrode 34 disposed opposed above the dielectric film 33 . bimorph type thin - film piezoelectric actuators 35 and 36 are formed at the left and right sides of the variable electrode 34 . each of the thin - film piezoelectric actuators 35 and 36 has a first electrode 38 formed above the silicon substrate 31 via an anchor 37 , a piezoelectric film 39 formed on the upper surface of the first electrode 38 , a second electrode 40 formed on the piezoelectric film 39 , and a support beam 41 formed on the upper surface of the second electrode 40 . when a voltage is applied to between the first electrode 38 and the second electrode 40 , bimorph operation occurs to displace the actuators 35 and 36 . maximum capacitance is obtained when the variable electrode 34 and the dielectric film 33 are brought into contact with each other . minimum capacitance is obtained when the variable electrode 34 is furthest from the dielectric film 33 . the dielectric film 33 formed on the upper surface of the fixed electrode 32 prevents occurrence of short - circuit between the fixed electrode 32 and the variable electrode 34 . fig4 is a diagram showing a relation between driving voltages applied to the thin - film piezoelectric actuators 35 and 36 and capacitances of the variable capacitors 7 and 9 . a distance between electrodes changes in proportion to an application voltage . capacitance changes in inverse proportion to a distance between electrodes . capacitance can change continuously in the order of about two digits . when electrodes have a large film thickness to have a low direct - current resistance , q becomes very large too . the first electrode 38 and the second electrode 40 of the thin - film piezoelectric actuators 35 and 36 , and the variable electrode 34 and the fixed electrode 32 of the variable capacitors 7 and 9 can have a thickness within a range of 10 nm to 1 μm , by taking a resistance into account , respectively . according to the present embodiment , these electrodes are assumed to have a thickness of 50 nm , respectively . the piezoelectric film 39 can have a thickness within a range of 10 nm to 1 μm , by taking displacement into account . according to the present embodiment , the piezoelectric film 39 is assumed to have a thickness of 500 nm . the dielectric film 33 is assumed to have a thickness of 50 nm , and equivalent area of the variable capacitors 7 and 9 is assumed to be 6400 μm . capacitances of the variable capacitors 7 and 9 are measured by changing control voltages vtune applied to the thin - film piezoelectric actuators 35 and 36 within a range of 0 to 3 volts . as a result , minimum capacitance is 0 . 34 pf and maximum capacitance is 2 . 86 pf , which shows a large change of 8 . 4 times . fig5 is a cross - sectional configuration diagram of the film bulk acoustic resonator 8 . the film bulk acoustic resonator 8 shown in fig5 includes a lower electrode 53 formed on a silicon substrate 51 via an anchor 52 , a piezoelectric unit 54 that covers the surrounding of the lower electrode 53 , and an upper electrode 55 formed on the upper surface of the piezoelectric unit 54 . an aluminum nitride film that grows in orientation to a direction of axis c is used for the piezoelectric unit 54 . aluminum is used for the upper electrode 55 and the lower electrode 53 , respectively . a resonator 56 including the lower electrode 53 , the piezoelectric unit 54 , and the upper electrode 55 is fixed to the substrate via the anchor 52 . when an alternate current is applied to between the upper electrode 55 and the lower electrode 53 , an alternate stress occurs due to a piezoelectric adverse effect , thereby exciting a resonance of an elastic wave in a thickness vertical mode . a film thickness of the piezoelectric unit 54 substantially corresponds to a half wave length of the resonance frequency . fig6 is a diagram showing impedance characteristic of the film bulk acoustic resonator 8 . fig7 is a diagram showing a phase characteristic of the film bulk acoustic resonator 8 . impedance becomes minimum at a resonance point fr , and impedance becomes maximum at an antiresonance point fa . the inductor can have very high q between fr and fa . when an oriented thin film of aluminum nitride or zinc oxide is used for the piezoelectric unit 54 , a distance between fr and fa can be taken by 5 to 6 percent cent . therefore , a filter having a relatively wide band can be configured . as is clear from a comparison between fig3 and fig5 , the variable capacitors 7 and 9 and the film bulk acoustic resonator 8 that are driven with the thin - film piezoelectric actuators 35 and 36 have very similar configurations . therefore , these units can be manufactured in a common manufacturing process . when they are hollow sealed , a larger advantage can be obtained . particularly , when plural elements are prepared on the same substrate , a variance between the elements can be reduced , which contributes to improve performance of the filter . according to the present embodiment , in order to obtain 2 ghz of resonance frequency , the piezoelectric unit 54 has a film thickness of 1100 nm , the lower electrode 53 has a film thickness of 100 nm , and the upper electrode 55 has a film thickness of 150 nm . the first voltage controlled oscillator 13 shown in fig1 has a tank circuit 61 and an amplifier 62 connected in parallel . the second voltage controlled oscillator 14 has a tank circuit 63 and an amplifier 64 that are connected in parallel . the tank circuit 61 has a film bulk acoustic resonance unit 65 and a variable capacitor 66 that are connected in parallel . the tank circuit 63 also has a film bulk acoustic resonance unit 67 and a variable capacitor 68 that are connected in series . the film bulk acoustic resonators 65 and 67 within the tank circuits 61 and 63 have configurations similar to those shown in fig5 . the variable capacitors 66 and 68 have configurations similar to those shown in fig3 . the voltage applying circuit 17 controls capacitance of the variable capacitor 66 within the first voltage controlled oscillator 13 , and controls capacitance of the variable capacitor 9 within the series resonance unit 3 and capacitance of the variable capacitor 9 within the parallel resonance unit 6 . the voltage applying circuit 19 controls capacitance of the variable capacitor 68 within the second voltage controlled oscillator 14 , and controls capacitance of the variable capacitor 7 within the series resonance unit 3 and capacitance of the variable capacitor 7 within the parallel resonance unit 6 . fig8 is a diagram for explaining the principle of the operation of the tunable filter shown in fig1 . the oscillation frequency of the first voltage controlled oscillator 13 is determined by a control voltage v 1 that is output from the voltage applying circuit 17 . the oscillation frequency of the second voltage controlled oscillator 14 is determined by a control voltage v 2 that is output from the voltage applying circuit 19 . the storage circuit 21 stores information concerning the oscillation frequencies of the first voltage controlled oscillator 13 and the second voltage controlled oscillator 14 so that band passage characteristics that are optimum for selecting a channel individual to the communication system are obtained at the time of manufacturing the tunable filter . the base band circuit 20 reads this information , and controls the pll circuits 16 and 18 , thereby accurately controlling the oscillation frequencies of the first voltage controlled oscillator 13 and the second voltage controlled oscillator 14 . the center frequency and the bandwidth in the passage characteristics of the ladder filter ( i . e ., filter main body ) 11 are determined by the control voltages v 1 and v 2 that are output from the voltage applying circuits 17 and 19 , respectively . more specifically , as shown in fig8 , the center frequency of the filter is determined by the control voltage v 2 that is output from the voltage applying circuit 19 , and the bandwidth of the filter is determined by the control voltage v 1 output from the voltage applying circuit 17 . fig9 is a diagram showing passage characteristics of the tunable filter shown in fig1 . as shown in fig9 , when the voltages applied by the voltage applying circuits 17 and 19 are changed within the range of 0 to 3 volts , the center frequency changes within a range of 2 . 95 mhz to 3 . 08 mhz , thereby obtaining a large range of a frequency change of 43 percent . at the same time , very precipitous shielding characteristic can be obtained . as explained above , according to the first embodiment , a feedback control , in which capacitances of the variable capacitors 7 and 9 within the filter main body 11 are controlled in accordance with the oscillation frequencies within the first and the second voltage controlled oscillators 13 and 14 as a monitoring circuit , is performed continuously during communication . with this arrangement , stable filter characteristics can be obtained without being affected by frequency drift due to rise in the temperature of the device . while the monitoring circuit including the first and the second voltage controlled oscillators 13 and 14 is used in fig1 , the configuration of the monitoring circuit is not particularly limited . by using this type of monitoring circuit , capacitances of variable capacitors during operation are accurately measured . further , a resonance frequency of a resonance circuit combined with an inductor element is accurately monitored . capacitances are calculated based on a result of monitoring the resonance frequency , and are fed back to the voltage applying circuits 17 and 19 that drive the variable capacitors . as a result , characteristics of the filtering circuit consisting of the variable capacitors 7 and 9 and the film bulk acoustic resonator 8 can be controlled accurately . a tunable filter according to a second embodiment is the same as that according to the first embodiment , except the circuit configuration of the filter main body 11 is different . therefore , the difference is mainly explained hereinafter . fig1 is a circuit diagram of the filter main body 11 according to the second embodiment . the filter main body 11 shown in fig1 includes two capacitors 71 and 72 that are connected in series , and a parallel resonance unit 75 having two resonance units 73 and 74 connected to between one end of the capacitors 71 and 72 , respectively and an input / output common terminal . each of the resonance units 73 and 74 has the film bulk acoustic resonator 8 and the variable capacitor 7 that are connected in parallel , and the variable capacitor 9 that is connected in series with them , like the resonator shown in fig1 . the number of resonators that constitute the parallel resonance unit 6 is not particularly limited to two . fig1 is a diagram showing passage characteristics of the tunable filter using the filter main body 11 shown in fig1 . fig1 shows a change in the passage characteristics when the application voltages output from the voltage applying circuits 17 and 19 shown in fig1 are changed . as is clear from a comparison between fig1 and fig1 , number of elements of the filter main body 11 shown in fig1 is smaller than that of the filter main body shown in fig1 . therefore , the area in which the elements are formed can be reduced , and the passage bandwidth becomes half of that in fig9 . further , when the capacitances of the variable capacitors 7 and 9 are changed , a total change in the impedance of the filter is small . on the other hand , attenuation characteristic becomes milder than that in fig9 . shielding characteristics in areas other than the passage band are different between at the low - frequency side and at the high - frequency side . as explained above , according to the second embodiment , the filter main body 11 can be made smaller . a tunable filter according to a third embodiment is the same as that according to the first embodiment , except the circuit configuration of the filter main body 11 is different . therefore , the difference is mainly explained . fig1 is a circuit diagram of the filter main body 11 according to the third embodiment . the filter main body 11 shown in fig1 has a lattice filter configured by four resonators 76 connected in a bridge . each resonance unit 76 has the film bulk acoustic resonator 8 and the variable capacitor 7 that are connected in parallel , and the variable capacitor 9 that is connected in series with them , like the resonator shown in fig1 . among the four resonators 76 shown in fig1 , the film bulk acoustic resonators 8 included in the two resonators on one diagonal line and the film bulk acoustic resonators 8 included in the two resonators on the other diagonal line have mutually different thicknesses in their upper electrodes 55 . therefore , resonance frequencies of the resonators on one diagonal line and resonance frequencies of the resonators on the other diagonal line are different from each other by a predetermined level . fig1 is a diagram showing passage characteristics of the tunable filter using the filter main body 11 shown in fig1 . this diagram shows passage characteristics when the voltage applying circuit controls capacitances of the variable capacitors 7 and 9 within a range of control voltage 0 to 3 volts . the center frequency changes within a range of 2 . 98 mhz to 3 . 12 mhz , thereby obtaining a large range of a frequency change of 5 . 2 percent . at the same time , very large out - of - band attenuation characteristics are obtained . as explained above , when a lattice filter is configured by plural resonators , a large variable - frequency range can be obtained , in a similar manner to that according to the first embodiment . according to a fourth embodiment , a circuit configuration of the control circuit 12 is different from that according to the first embodiment . fig1 is an equivalent circuit diagram of a tunable filter according to the fourth embodiment of the present invention . the tunable filter shown in fig1 has the control circuit 12 having a circuit configuration different from that shown in fig1 . the control circuit 12 shown in fig1 has a monitoring circuit 81 that constitutes a voltage controlled oscillator , the temperature compensated crystal oscillator 15 , the voltage applying circuits 17 and 19 , the base band circuit 20 , the storage circuit 21 , and an operating circuit 82 . the monitoring circuit 81 has the amplifier 62 and a resonance unit 83 that are connected in parallel . the resonance unit 83 has the film bulk acoustic resonator 8 and the variable capacitor 7 that are connected in parallel , and the variable capacitor 9 that is connected in series with them , like the resonator shown in fig1 . the voltage applying circuit 17 controls capacitance of the variable capacitor 9 within the monitoring circuit 81 , capacitance of the variable capacitor 9 within the series resonance unit 3 of the filter main body 11 , and capacitance of the variable capacitor 9 within the parallel resonance unit 6 . the voltage applying circuit 19 controls capacitance of the variable capacitor 7 within the monitoring circuit 81 , capacitance of the variable capacitor 7 within the series resonance unit 3 of the filter main body 11 , and capacitance of the variable capacitor 7 within the parallel resonance unit 6 . fig1 a and 15b are diagrams for explaining the principle of the operation of the tunable filter shown in fig1 . as shown in fig1 a , when the voltage applying circuit 17 controls the control voltage v 1 supplied to the monitoring circuit 81 , the oscillation frequency of the monitoring circuit 81 changes within a range of fr to fa . as shown in fig1 b , a center frequency is determined by the control voltage v 2 output from the voltage applying circuit 19 , and a passage bandwidth is determined by the control voltage v 1 output from the voltage applying circuit 17 . the storage circuit 21 stores in advance at a manufacturing time , the oscillation frequency of the monitoring circuit 81 corresponding to the band passage characteristics optimum for selecting a channel individual to a communication system . with this arrangement , the operating circuit 82 can accurately control the oscillation frequency of the monitoring circuit 81 corresponding to the passage characteristics desirable during communications . this feedback control of the oscillation frequency is carried out continuously during communications . as explained above , according to the fourth embodiment , stable filter characteristics can be obtained without being affected by frequency drift due to rise in the temperature of the device , in a similar manner to that according to the first embodiment . according to a fifth embodiment , a circuit configuration of the monitoring circuit is different from that according to the fourth embodiment . fig1 is an equivalent circuit diagram of a tunable filter according to the fifth embodiment of the present invention . the tunable filter shown in fig1 has a monitoring circuit 91 having a circuit configuration different from that of the monitoring circuit 81 shown in fig1 . the tunable filter shown in fig1 is input with an oscillation signal of a predetermined frequency from a voltage controlled oscillator 92 provided at the outside . the monitoring circuit 91 shown in fig1 includes resonators similar to those shown in fig1 . each resonator has the film bulk acoustic resonator 8 and the variable capacitor 7 that are connected in parallel , and the variable capacitor 9 that is connected in series with the film bulk acoustic resonator 8 and the variable capacitor 7 . the voltage applying circuit 17 controls capacitance of the variable capacitor 9 within the monitoring circuit 91 , capacitance of the variable capacitor 9 within the series resonance unit 3 of the filter main body 11 , and capacitance of the variable capacitor 9 within the parallel resonance unit 6 . the voltage applying circuit 19 controls capacitance of the variable capacitor 7 within the monitoring circuit 91 , capacitance of the variable capacitor 7 within the series resonance unit 3 of the filter main body 11 , and capacitance of the variable capacitor 7 within the parallel resonance unit 6 . fig1 a and 17b are diagrams for explaining the principle of the operation of the tunable filter shown in fig1 . as shown in the diagram , capacitances of the variable capacitors 7 and 9 within the monitoring circuit 91 are controlled based on the control voltage v 1 output from the voltage applying circuit 17 and the control voltage v 2 output from the voltage applying circuit 19 , respectively . as a result , oscillation frequencies change , and the passage bandwidth and the center frequency of the filter main body 11 are controlled . mainly , as shown in fig1 b , the center frequency of the filter main body 11 is controlled based on the control voltage v 1 , and the bandwidth of the filter main body 11 is controlled based on the control voltage v 2 . the voltage applying circuits intermittently control the control voltages v 1 and v 2 during communications . as explained above , according to the fifth embodiment , stable filter characteristics can be obtained without being affected by frequency drift due to rise in the temperature of the device , in a similar manner to that according to the first embodiment . according to a sixth embodiment , the variable capacitors 7 and 9 and the film bulk acoustic resonator 8 of the filter main body 11 are used as a part of the control circuit 12 . fig1 is an equivalent circuit diagram of a tunable filter according to the sixth embodiment of the present invention . the tunable filter shown in fig1 has the control circuit 12 of which circuit configuration is different from that shown in fig1 . the control circuit 12 shown in fig1 has the temperature compensated crystal oscillator 15 , a voltage applying circuit 101 , the base band circuit 20 , the storage circuit 21 , the operating circuit 82 , switching circuits 102 , 103 , and 104 , a detecting circuit 106 that detects the amplitude of a signal output from the filtering circuit 11 , and a temperature detector 107 that detects the ambient temperature . the filter main body 11 has a circuit similar to that shown in fig1 . at the time of adjusting filter characteristics , the outside voltage controlled oscillator 92 inputs an oscillation signal having a predetermined frequency to the filter main body 11 via the switching circuit 104 . the switching circuit 103 uses the variable capacitors 7 and 9 of any one of the resonators of the filter main body 11 , as a part of the monitoring circuit 81 , and is used to control capacitances of these variable capacitors 7 and 9 . the variable capacitors 7 and 9 that are not selected by the switching circuit 102 hold charges held when these variable capacitors are connected to the switching circuit 102 before . the switching circuit 103 is switched at the time of monitoring the variable capacitors 7 and 9 of any one of the resonators of the filter main body 11 . according to the present embodiment , the output from the voltage controlled oscillator is intermittently sweep input to the filter main body 11 via the switching circuit 104 when the power is turned on or during communications . the detecting circuit 106 detects the amplitude of the output signal from the filter main body 11 . the operating circuit 82 controls capacitances of the variable capacitors 7 and 9 based on a result of detecting the amplitude by the detecting circuit 106 and a result of detecting the temperature by the temperature detector 107 . more specifically , the operating circuit 82 controls capacitances of the variable capacitors 7 and 9 so that the amplitude of the output signal from the filter main body 11 becomes maximum . with this arrangement , stable filter characteristics can be obtained without being affected by frequency drift due to rise in the temperature of the device . as explained above , according to the sixth embodiment , the filter main body 11 can be used as a monitoring circuit by switching the switching circuits 102 to 104 . as a result , an exclusive monitoring circuit is not necessary , thereby simplifying a circuit configuration . according to a seventh embodiment , a circuit configuration of a monitoring circuit is different from those according to the preceding embodiments . fig1 is an equivalent circuit diagram of a tunable filter according to the seventh embodiment of the present invention . the tunable filter shown in fig1 includes the voltage applying circuits 17 and 19 , the base band circuit 20 , the storage circuit 21 , monitoring circuits 111 and 112 , and a temperature detecting circuit 113 . each of the monitoring circuits 111 and 112 has a variable capacitor 114 and a capacitance detecting circuit 115 that are connected in parallel . the capacitance detecting circuit 115 measures capacitances of the variable capacitors 7 and 9 that are connected in parallel , and transmits a result of the measuring to the operating circuit 82 . the voltage applying circuit 17 controls capacitance of the variable capacitor 114 within the monitoring circuit 111 , capacitance of the variable capacitor 9 within the series resonance unit 3 of the filter main body 11 , and capacitance of the variable capacitor 9 within the parallel resonance unit 6 . the voltage applying circuit 19 controls capacitance of the variable capacitor 114 within the monitoring circuit 112 , capacitance of the variable capacitor 7 within the series resonance unit 3 of the filter main body 11 , and capacitance of the variable capacitor 7 within the parallel resonance unit 6 . the operation of the principle of the tunable filter shown in fig1 is explained hereinafter . a resonance frequency fr ′ and an antiresonance frequency fa ′ of the resonator in the filter main body 11 can be calculated based on the following expressions ( 1 ) and ( 2 ), using the resonance frequency fr and the antiresonance frequency fa of the film bulk acoustic resonator 8 , the capacitance vc 1 of the variable capacitor 7 connected in parallel , and the capacitance vc 2 of the variable capacitor 9 connected in series . f r ′ = f r 1 + c 1 c 0 + v c1 + v c2 ( 1 ) f a ′ = f r 1 + c 1 c 0 + v c1 ( 2 ) capacitors c 0 and c 1 correspond to an equivalent capacitance and a parallel equivalent capacitance , respectively when the film bulk acoustic resonator 8 is expressed by a bvd model equivalent circuit . therefore , when the resonance frequency and the antiresonance frequency of each resonator in the filter main body 11 , and the capacitances of the variable capacitor 7 connected in parallel and the variable capacitor 9 connected in series within each resonator are controlled based on the measured capacitances of the variable capacitors 114 within the monitoring circuits 111 and 112 , band passage characteristics of the filtering circuit can be set to a value that is optimum for selecting a channel individual to a communication system . as explained above , according to the seventh embodiment , configurations of the monitoring circuits 111 and 112 can be simplified . using a simpler circuit than that according to the first embodiment , stable filter characteristics can be obtained without being affected by frequency drift due to rise in the temperature of the device . an eighth embodiment is a modified example of the seventh embodiment , and differences from the seventh embodiment will be mainly described hereinafter . fig2 is an equvalent circuit diagram of a tunable filter according to the eighth embodiment of the present invention . the tunable filter of fig2 has voltage applying circuits 116 and 117 , and monitor circuits 118 and 119 , in addition to the constituents of fig1 . each of the monitor circuits 118 and 119 has a variable capacitor 114 and a capacitance detecting circuit 115 connected in parallel , similarly to the monitor circuit 111 . the capacitance detecting circuit 115 measures the capacitance of the variable capacitor 114 connected in parallel , and transmits the measured result to the operating circuit 82 . the voltage applying circuit 17 controls capacitance of the variable capacitor 114 in the monitor circuit 111 and capacitance of the variable capacitor 9 in the series resonance unit 3 in the filter main body 11 . the voltage applying circuit 19 controls capacitance of the variable capacitor 114 in the monitor circuit 112 and capacitance of the variable capacitor 7 in the parallel resonance unit 6 in the filter main body 11 . the voltage applying circuit 116 controls capacitance of the variable capacitor 114 in the monitor circuit 118 and capacitance of the variable capacitor 9 in the series resonance unit 3 in the filter main body 11 . the voltage applying circuit 117 controls capacitance of the variable capacitor 114 in the monitor circuit 119 and capacitance of the variable capacitor 9 in the parallel resonance unit 6 in the filter main body 11 . according to the eighth embodiment , resonance frequency and antiresonance frequency of the series resonance unit 3 in the filter main body 11 , and capacitances of the variable capacitor 7 connected in parallel and the variable capacitor 9 connected in series in the series resonance unit 3 can be controlled based on the measured capacitances of the variable capacitors 114 in the monitor circuits 111 and 112 . resonance frequency and antiresonance frequency of the parallel resonance unit 6 , and capacitances of the variable capacitor 7 connected in parallel and the variable capacitor 9 connected in series in the parallel resonance unit 6 can be controlled based on the measured capacitances of the variable capacitors in the monitor circuits 118 and 119 . therefore , it is possible to control band - pass property of the filter circuit , especially , central pass frequency and band - pass over a range of broad frequency band , and to set the band - pass property to an optimum value for channel selection inherent to the communication system . as described above , according to the eighth embodiment , it is possible to simplify the configurations of the monitor circuits 111 and 112 , and to obtain stable filter property corresponding to the central frequency and the band - pass width at a range broader than that of the first embodiment . according to the fourth , the fifth , and the seventh embodiments , when the variable capacitors 114 within the monitoring circuits 111 and 112 and the variable capacitors 7 and 9 within the filter main body 11 apply the same voltage to the respective piezoelectric driving actuators , the same capacitance needs to be obtained . further , the variable capacitors 7 connected in parallel or the variable capacitors 9 connected in series in the resonators within the filter main body 11 need to exhibit the same characteristics and the same responses . the mems elements formed on the same substrate according to the semiconductor process usually obtain the same characteristics within a narrow area of at least the same wafer even when there is a large variance among lots or among wafers . therefore , the control systems according to the fourth , the fifth , and the seventh embodiments can be employed . in order to enable the resonators to have the same capacitance by receiving control voltages from the voltage applying circuits , one actuator can be shared as shown in fig2 in place of individually providing actuators to the variable capacitors . fig2 shows an example of a state that one actuator 121 is used to drive variable capacitor within plural resonators . with this arrangement , a variance of characteristics of individual variable capacitors can be reduced . actuators of all variable capacitors to which one voltage applying circuit supplies a control voltage can be set together into one . actuators of all variable capacitors within the resonators 3 connected in series can be set together into one . actuators of all variable capacitors within the resonators 6 connected in parallel can be set together into one . as explained above , according to the ninth embodiment , one actuator is used to control capacitances of plural variable capacitors . therefore , characteristics of the variable capacitors 7 and 9 can be arranged . in the above embodiments , a film bulk acoustic resonator is used for the inductor element . alternatively , a surface acoustic wave element ( i . e ., a saw device ) can be used . an inductor including a general waveguide and a coil can be also used . fig2 is a top plan diagram showing one example of a surface acoustic wave element . fig2 is a cross - sectional diagram of the surface acoustic wave element shown in fig2 cut along a line a - a . as shown in these diagrams , the surface acoustic wave element has a comb electrode 132 and an input / output electrode 133 formed on a piezoelectric monochristalline substrate 131 . a monitoring circuit of the above variable capacitors can have various forms . for example , a voltage controlled oscillator using a film bulk acoustic resonator and a variable capacitor can be used , or a filter module having a film bulk acoustic resonator and a variable capacitor connected in series or in parallel can be used . alternatively , a tunable filter itself can be used to carry out monitoring during the operation . a filter main body configured by a variable capacitor and an inductor element has various types such as a ladder type and a lattice type . many circuit systems can be also applied to the monitoring circuit . in the above embodiments , a resonator uses the variable capacitor 7 and the film bulk acoustic resonator 8 that are connected in parallel , and the variable capacitor 9 that is connected in series with them . however , the circuit configuration of the resonator is not limited to this . for example , fig2 shows an example of a resonator that is configured by a variable capacitor and a film bulk acoustic resonator that are connected in series , and a variable capacitor that is connected in parallel with them . the resonator shown in fig2 can be used in the filter main body 11 , shown in fig1 etc ., and in the monitoring circuit 83 shown in fig1 . the tunable filters explained in the above embodiments are used in various electric appliances . because the tunable filter according to the present invention is formed on the semiconductor substrate , the device can be made small . therefore , the tunable filter can be applied to various portable devices such as a portable telephone . fig2 is a block diagram showing one example of a schematic configuration of a portable telephone that incorporates the tunable filter according to the above embodiments . this portable telephone is a direct conversion type . the portable telephone shown in fig2 includes an antenna 141 , a directional coupler 142 that switches between a transmission and a reception , a transmitter 143 , a receiver 144 , and a base band processor 145 . the receiver 144 includes a tunable filter 146 explained above , a low noise amplifier ( lna ) 147 , a phase demodulator 148 that demodulates the phase of an output signal from the lna 147 , and an a / d converter 149 that a / d converts the phase - modulated signal . the transmitter 143 includes a d / a converter 151 that d / a converts a transmission signal generated by the base band processor , a low - pass filter 152 that extracts only a predetermined frequency component of a signal output from the d / a converter 151 , a phase modulator 153 that modulates the phase of an output from the low - pass filter 152 , and an amplitude modulator 154 that modulates the amplitude of a phase - modulated signal . the tunable filter can be connected to a latter stage of the lna . | 7 |
solid state switching combined with a step up high voltage pulse transformer provides a high voltage pulser for modulating the cathode of a traveling wave tube amplifier . the pulser is capable of providing the required high voltage to the cathode of a traveling wave tube and simultaneously modulating the cathode with a desired wave envelope . since the pulser is all solid state , turn on after long periods of storage is limited only by the battery activation time and the traveling wave tube warm up time . pulse rise time , fall time , width and amplitude can be varied within the limitations of the output transformer by merely adjusting trim resistors , providing a wide range of flexibility in the output waveshape with a minimum of inconvenience . referring now to the drawings wherein like numbers represent like parts in the several views , fig1 discloses a preferred embodiment of the invention . a high frequency input pulse trigger is directed to a pulse steering circuit 10 . the steering circuit output delivers alternate pulses respectively to channel a and channel b . both channel a and channel b operate in the same manner and are comprised of identical components . since both circuits are identical all channel circuitry is described with respect to channel a . output 12 of pulse steering circuit 10 is coupled to provide a pulse to pulse stretchers 20 and 30 of channel a . output 14 of pulse steering circuit 10 is coupled to provide alternate pulses to channel b . therefore each channel is effectively operating at one - half the trigger pulse repetition frequency input . there are three microcircuit pulse stretchers in each channel , providing 8 μs , 1 μs and 2 μs duration pulses respectively . pulse stretcher 20 provides an 8 μs output pulse to a preamplifier 22 and provides a separate output pulse as an input to the 2 μs pulse stretcher 40 . the output of preamplifier 22 is coupled to a base drive circuit 24 , with the output of base drive circuit 24 being coupled as the input to a main drive circuit 26 . similarly the output of 1 μs pulse stretcher 30 is coupled to the input of a preamplifier 32 , the output of preamplifier 32 being coupled to base drive circuit 34 and the output of base drive circuit 34 being coupled as an input to main drive circuit 36 . similarly pulse stretcher 40 has an output coupled to preamplifier 42 , which has an output coupled to base drive circuit 44 . the output of base drive circuit 44 is coupled as an input to main drive circuit 46 to provide the 2 μs circuit . the output of preamplifier 32 is further coupled to the input of base drive circuit 24 . this allows the extra drive from the 1 μs pulse circuit to provide extra drive for the main drive transistors of the 8 μs pulse circuit to speed up their turn - on time . the signal coupled from the 8 μs pulse stretcher 20 to the 2 μs pulse stretcher input 40 is an impulse or trigger to start the 2 μs pulse . its time relation to the other 8 μs pulse output of pulse stretcher 20 is determined by the input prf only . functionally , each is independent of the other . the output of main drive circuit 26 is coupled in parallel with the output of main drive circuit 36 to one side of the primary winding of pulse transformer 28 . the other side of the primary winding is coupled to the output of main drive circuit 46 , with b + being supplied to the system through the center tap of the primary winding . the secondary winding of transformer 28 is coupled on one side to ground and on the other side to the cathode of a diode 29 . the anode of diode 29 is coupled to the traveling wave tube 50 for pulsing the tube . channel b is similarly coupled to receive steering pulses from steering circuit 10 , operate in response to these pulses alternately with channel a to couple an output signal in parallel with the output of diode 29 to the traveling wave tube 50 . these pulses are coupled to twt through common junction 54 . filament power for the traveling wave tube is coupled to the tube from filament power supply 52 . a clamping circuit 60 includes a power supply 62 coupled across the primary winding of a transformer 64 . the secondary of transformer 64 is coupled through a diode 66 , a capacitor bank 68 and 69 and back to the transformer and to a common circuit ground . a resistor bank 70 is coupled in parallel with capacitors 68 and 69 for providing a voltage dividing network . the anode - capacitor junction 72 of the voltage divider network is forward coupled through a diode 74 to the traveling wave tube input junction 54 . a sensing amplifier 76 has an input coupled to the junction 78 between capacitor bank 68 and 69 and an output 80 coupled to control clamp power supply 62 . another output 82 of sensing amplifier 76 is coupled to clamp dumping circuit 84 and an output of the clamp dump 84 is coupled through the primary winding of a transformer 86 to b + ( battery ). the secondary of transformer 86 is coupled on one side to common ground and on the other side in reverse through a zener diode to junction point 72 between diode 66 and diode 74 . outputs 90 and 92 respectively from channel a and channel b are coupled through a resistor network 94 and 96 respectively to the pulse steering circuit . similarly the outputs 90 and 92 are respectively coupled through resistances 98 and 100 to the clamp dump circuit 84 . fig2 disclose the pulse time sequence of the embodiment of fig1 . the μs and 8 μs pulses within a given channel start simultaneously . the additional drive provided by the 1 μs output is required to charge the load capacitance 68 - 69 and the stray capacitance of the transformer &# 39 ; s secondary within the allotted time . the 8 μs output provides the load current . at the end of the 8 μs period , the 2 μs drive circuit is triggered . it provides the energy required to discharge the capacitance of the load and the stray capacitance of the transformer secondary within the allotted time . during the 8 μs &# 34 ; on &# 34 ; period perturbations can occur on the output pulse as a result of the dump action of the dumping circuit . this can be eliminated or inhibited during this &# 34 ; on &# 34 ; period by coupling a signal through resistors 98 or 100 to the clamp dump circuit . the traveling wave tube cathode is pulsed during the 8 μs period after which the clamp dump transformer secondary is pulsed . the main drive , base driver , and clamp dump circuits are constant current drivers . fig3 shows a typical circuit that can provide this function . a transistor 110 or parallel group of transistors , has its emitter connected in series with a resistor 112 to a common ground . using a resistor forward voltage drop of approximately 4 volts , for example , at the desired current , the base or bases of the transistors will then be driven from a 5 volt voltage source . zener diode 114 is coupled between the base of the transistors to the circuit common for controlling this voltage . the main drive circuit having operational components similar to the base drive circuit is shown coupled to an output transformer 28 . the clamp dump circuit is the same type of circuit as the base drive or main drive circuit . as shown in fig4 the pulse steering circuit comprises a pair of transistors 121 and 122 , one transistor for each output channel . each transistor is driven from opposing outputs of a bistable multivibrator 124 . the collectors of the two transistors are resistively coupled through respective resistors r1 to the common input trigger pulse . the emitters of the respective transistors are coupled to ground and the collectors are coupled to provide the respective pulse steering outputs alternately to channel a and channel b . the particular &# 34 ; on &# 34 ; transistor shunts the input signal applied thereto to ground thereby preventing its channel from driving the traveling wave tube . the state of the bistable multivibrator 124 is changed by the output of the &# 34 ; on &# 34 ; channel 8 μs pule stretcher which is coupled through resistors 94 and 96 to the pulse steering circuit as shown in fig1 . the sense amplifier is simply a common variety operational amplifier such as the nationl semi - conductor model lm101 . in the clamping circuit 60 the series resistance in parallel with the two series capacitors 68 and 69 form a divider network for the sense amplifier , providing a predetermined approximate voltage at the amplifier input . the capacitors also act as a sync for excessive energy ( ripples and spikes ) occurring on the output pulse . the capacitors are precharged to the required pulse output voltage by the clamp power supply . when an output pulse occurs the excess voltage is clamped by the diode connected to the load . the clamp dump is inhibited during the on pulse period . once the inhibit is removed the clamp dump will pulse breaking down the high voltge zener diode connected to the secondary of the clamp dump transformer . the capacitor voltage is restored to the required voltage when the zener diode breaks down . during operation the high voltage pulser delivers both a high voltage and pulse shaping output to the cathode of the traveling wave tube . a high frequency input pulse trigger , typically a 50 kilohertz pulse , is directed to the pulse steering circuit 10 . the steering circuit output delivers alternate pulses to the pulse stretchers of channels a and b . therefore each channel is effectively operating at one - half the trigger prf or , for example 25 kilohertz . the respective channel pulse stretcher outputs are amplified , amplitude regulated , and fed to the base of the constant current output transistors which in turn drive the primary of the output pulse transformer . energy of the 1 μs pulse is used to charge the traveling wave tube capacitance producing a fast pulse rise time , while the 8 μs pulse is the main pulse determining the traveling wave tube on - time . the 2 μs pulse , which occurs at the end of the 8 μs pulse , is used to discharge the traveling wave tube capacitance and to reset the core of the output pulse transformer . the secondary of the two channel pulse transformers are connected to the load through high voltage diodes applied in an &# 34 ; or &# 34 ; configuration . in parallel with the load , but isolated from the load by the high voltage diode 74 , capacitor bank 68 - 69 is pre - charged to the required traveling wave tube voltage . when the constant current output of the pulser reaches the required output voltage , all excess drive current is shunted into the capacitor producing a flat topped pulse . during the inner pulse period the excess energy is removed from the capacitors by the clamp dumping circuit so that each pulse will have the same voltage amplitude . although a particular embodiment and form of this invention has been illustrated , it is apparent that various modifications and embodiments of the invention may be made by those skilled in the art without departing from the scope and spirit of the foregoing disclosure . accordingly , the scope of the invention should be limited only by the claims appended hereto . | 7 |
according to an embodiment of the invention , the method for preparing the phosphorus - containing benzoxazine resin is shown in flow chart 1 , and then the detail about flow chart 1 will be described in the followings . 21 . 32 g ( 0 . 05 moles ) phosphorus - containing diamine monomer ( iv - a ) and 12 . 82 g ( 0 . 105 moles ) 2 - hydroxybenzaldehyde are dissolved in dmac / toluene . the solution is contained in a three - necked bottle and a dean - stark device is set to execute a draining reaction . the reaction proceeds at the reflux temperature for 12 hours . after the reaction finishes , toluene is removed from the solution and the reflux temperature drops to the room temperature . nabh 4 are added into the three - necked bottle in batches and then the solution is stirred at the room temperature for 24 hours . after the reaction finishes , the reacting liquid is mixed in the deionized water to separate a white powder . the pumping and filtering process is used for obtain the white powder ( ii - a ) 30 . 33 g , and the yield is 95 %. afterwards , 10 . 0 g ( 0 . 0156 moles ) monomer ( ii - a ) is dissolved in toluene , and then 1 . 4976 g ( 0 . 0499 moles ) paraformaldehyde is added into the three - necked bottle to react at the reflux temperature for 24 hours . after the reaction finishes , toluene is removed by a spin concentrator to obtain a light yellow powder ( i - a ) 10 . 27 g , and the yield is 99 %. please refer to fig1 . fig1 is a schematic diagram illustrating 1h nmr spectrum of the compound ( i - a ). 22 . 73 g ( 0 . 05 moles ) phosphorus - containing diamine monomer ( iv - a ) and 12 . 82 g ( 0 . 105 moles ) 2 - hydroxybenzaldehyde are dissolved in dmac / toluene . the solution is contained in a three - necked bottle and a dean - stark device is set to execute a draining reaction . the reaction proceeds at the reflux temperature for 12 hours . after the reaction finishes , toluene is removed from the solution and the reflux temperature drops to the room temperature . nabh 4 are added into the three - necked bottle in batches and then the solution is stirred at the room temperature for 24 hours . after the reaction finishes , the reacting liquid is mixed in the deionized water to separate a white powder . the pumping and filtering process is used for obtain the white powder ( ii - b ) 30 . 33 g , and the yield is 91 %. afterwards , 10 . 0 g ( 0 . 0149 moles ) monomer ( ii - b ) is dissolved in toluene , and then 1 . 437 g ( 0 . 0479 moles ) paraformaldehyde is added into the three - necked bottle to react at the reflux temperature for 24 hours . after the reaction finishes , toluene is removed by a spin concentrator to obtain a light yellow powder ( i - b ) 10 . 09 g , and the yield is 98 %. 24 . 123 g ( 0 . 05 moles ) phosphorus - containing diamine monomer ( iv - c ) and 12 . 82 g ( 0 . 105 moles ) are dissolved in dmac / toluene . the solution is contained in a three - necked bottle and a dean - stark device is set to execute a draining reaction . the reaction proceeds at the reflux temperature for 12 hours . after the reaction finishes , toluene is removed from the solution and the reflux temperature drops to the room temperature . nabh 4 are added into the three - necked bottle in batches and then the solution is stirred at the room temperature for 24 hours . after the reaction finishes , the reacting liquid is mixed in the deionized water to separate a white powder . the pumping and filtering process is used for obtain the white powder ( ii - c ) 32 . 66 g , and the yield is 94 %. afterwards , 10 . 0 g ( 0 . 0143 moles ) monomer ( ii - c ) is dissolved in toluene , and then 1 . 381 g ( 0 . 046 moles ) paraformaldehyde is added into the three - necked bottle to react at the reflux temperature for 24 hours . after the reaction finishes , toluene is removed by a spin concentrator to obtain a light yellow powder ( i - c ) 10 . 14 g , and the yield is 98 %. 24 . 426 g ( 0 . 05 moles ) phosphorus - containing diamine monomer ( iv - d ) and 12 . 82 g ( 0 . 105 moles ) are dissolved in dmac / toluene . the solution is contained in a three - necked bottle and a dean - stark device is set to execute a draining reaction . the reaction proceeds at the reflux temperature for 12 hours . after the reaction finishes , toluene is removed from the solution and the reflux temperature drops to the room temperature . nabh 4 are added into the three - necked bottle in batches and then the solution is stirred at the room temperature for 24 hours . after the reaction finishes , the reacting liquid is mixed in the deionized water to separate a white powder . the pumping and filtering process is used for obtain the white powder ( ii - d ) 32 . 2 g , and the yield is 92 %. afterwards , 10 . 0 g ( 0 . 0142 moles ) monomer ( ii - d ) is dissolved in toluene , and then 1 . 37 g ( 0 . 0454 moles ) paraformaldehyde is added into the three - necked bottle to react at the reflux temperature for 24 hours . after the reaction finishes , toluene is removed by a spin concentrator to obtain a light yellow powder ( i - d ) 10 . 291 g , and the yield is 99 %. please refer to fig2 . fig2 is a schematic diagram illustrating 1h nmr spectrum of the compound ( i - d ). according to another embodiment of the invention , the method for preparing the phosphorus - containing benzoxazine resin is shown in flow chart 2 , and then the detail about flow chart 2 will be described in the followings . 30 . 53 g ( 0 . 05 moles ) phosphorus - containing diamine monomer ( viii - a ) and 12 . 82 g ( 0 . 105 moles ) are dissolved in dmac / toluene . the solution is contained in a three - necked bottle and a dean - stark device is set to execute a draining reaction . the reaction proceeds at the reflux temperature for 12 hours . after the reaction finishes , toluene is removed from the solution and the reflux temperature drops to the room temperature . nabh 4 are added into the three - necked bottle in batches and then the solution is stirred at the room temperature for 24 hours . after the reaction finishes , the reacting liquid is mixed in the deionized water to separate a white powder . the pumping and filtering process is used for obtain the white powder ( vi - a ) 38 . 26 g , and the yield is 93 %. afterwards , 10 . 0 g ( 0 . 012 moles ) monomer ( vi - a ) is dissolved in toluene , and then 1 . 16 g ( 0 . 0388 moles ) paraformaldehyde is added into the three - necked bottle to react at the reflux temperature for 24 hours . after the reaction finishes , toluene is removed by a spin concentrator to obtain a light yellow powder ( v - a ) 10 . 084 g , and the yield is 98 %. although the present invention has been described in considerable detail with reference to certain preferred embodiments thereof , the disclosure is not for limiting the scope of the invention . persons having ordinary skill in the art may make various modifications and changes without departing from the scope and spirit of the invention . therefore , the scope of the appended claims should not be limited to the description of the preferred embodiments described above . | 2 |
next , one embodiment of the present invention will be explained with reference to the drawings below . since btbas used in the present invention is in a liquid state at room temperature , the btbas is introduced into a furnace using a btbas supply apparatus shown in fig2 and 3 . a btbas supply apparatus shown in fig2 is a combination of a thermostatic bath and gas flow rate control . a btbas supply apparatus shown in fig3 controls a flow rate by a combination of a liquid flow rate control and a vaporizer . referring to fig2 , in the btbas supply apparatus 4 , an interior of a thermostatic bath 41 containing a btbas liquid raw material 42 therein is heated to about 100 ° c . to increase a vapor pressure of btbas , thereby evaporating the btbas . then , the evaporated btbas is controlled in flow rate by a mass - flow controller 43 , and supplied , from a btbas supply port 44 , to a supply port 22 of a nozzle 21 of an vertical - type lpcvd ( low pressure cvd ) film forming apparatus shown in fig1 . in the btbas supply apparatus 4 , pipes from the btbas liquid raw material 42 to the btbas supply port 44 are covered with pipe heating members 45 . referring to fig3 , in the btbas supply apparatus 5 , push - out gas of he or n 2 introduced from a push - out gas introducing port 53 is introduced , through a pipe 54 , into a btbas tank 51 containing a btbas liquid raw material 52 therein , thereby pushing out the btbas liquid raw material 52 into a pipe 55 . then , the btbas liquid raw material 52 is controlled in flow rate by a liquid flow - rate control apparatus 56 and sent to a vaporizer 57 . in the vaporizer 57 , the btbas liquid raw material 52 is evaporated and supplied , from a btbas supply port 58 , to the supply port 22 of the nozzle 21 of the vertical - type lpcvd ( low pressure cvd ) film forming apparatus shown in fig1 . in the btbas supply apparatus 5 , pipes from the vaporizer 57 to the btbas supply port 58 are covered with pipe heating members 59 . next , the vertical - type lpcvd film forming apparatus which can preferably be used in the present embodiment will be explained with reference to fig1 . in the vertical - type lpcvd film forming apparatus 1 , a heater 13 is provided outside of a quartz reaction tube 11 so that an interior of the quartz reaction tube 11 can be heated uniformly . a quartz inner tube 12 is provided in the quartz reaction tube 11 . a quartz boat 14 is provided in the quartz inner tube 12 , and a plurality of semiconductor wafers are mounted on the quartz boat 14 and stacked in the vertical direction . the quartz boat 14 is mounted on a cap 15 . the quartz boat 14 is brought into and out from the quartz inner tube 12 by vertically moving the cap 15 . lower portions of the quartz reaction tube 11 and the quartz inner tube 12 are opened , but they are air - tightly closed by a bottom plate 24 of the cap 15 by moving the cap 15 upward . apparatus nozzles 18 and 21 are provided in lower portions of the quartz inner tube 12 such as to bring into communication with the quartz inner tube 12 . an upper portion of the quartz inner tube 12 is opened . a discharge port 17 is provided at a lower portion of space between the quartz inner tube 12 and the quartz reaction tube 11 so as to bring into communication with the space . the discharge port 17 is in communication with a vacuum pump ( not shown ) so as to evacuate the quartz reaction tube 11 . the raw gases supplied from the quartz nozzles 18 and 21 are injected from injection ports 20 and 23 into the quartz inner tube 12 . the gases then move in the quartz inner tube 12 from its lower portion to its upper portion , thereafter downwardly flows through the space between the quartz inner tube 12 and the quartz reaction tube 11 , and is discharged from the discharge port 17 . a method for forming a silicon nitride film using the vertical - type lpcvd film forming apparatus 1 will be explained next . first , the quartz boat 14 holding a large number of semiconductor wafers 16 is inserted into the quartz inner tube 12 the inside temperature of which is maintained at 600 ° c . or lower . next , the quartz reaction tube 11 is evacuated from the discharge port 17 to produce a vacuum therein using a vacuum pump ( not shown ). in order to stabilize a temperature over the entire surface of the wafer , it is preferable to evacuate for about one hour . next , nh 3 gas is charged from a charging port 19 of the quartz nozzle 18 to purge the inside of the quartz reaction tube 11 using nh 3 before btbas is charged . then , while nh 3 gas is continuously charged from a charging port 19 of the quartz nozzle 18 , btbas is charged from the charging port 22 of the quartz nozzle 21 , and an si 3 n 4 film is formed on the semiconductor wafer 16 . next , the supply of btbas is stopped while keep charging the nh 3 gas from the charging port 19 of the quartz nozzle 18 , thereby purging the quartz reaction tube 11 using nh 3 . if only btbas is charged , a film different from the si 3 n 4 film is formed and thus , it is preferable to purge the quartz reaction tube 11 using nh 3 before and after deposition . next , n 2 is allowed to flow into the quartz reaction tube 11 from the quartz nozzle 18 to purge the quartz reaction tube 11 using n 2 , thereby removing nh 3 in the quartz reaction tube 11 . then , the supply of n 2 is stopped and the quartz reaction tube 11 is evacuated to produce a vacuum therein . a set of the purge operation using n 2 and the subsequent evacuation operation in the quartz reaction tube 11 is carried out several times . thereafter , the interior of the quartz reaction tube 11 is brought back from the vacuum state into the atmospheric pressure state . then , the quartz boat 14 is moved down and taken out from the quartz reaction tube 11 . then , the quartz boat 14 and the semiconductor wafers 16 are cooled down to room temperature . the above - described silicon nitride film forming method is repeated , and when a thickness of the si 3 n 4 film formed in the quartz reaction tube 11 reached 3 , 000 å , nf 3 gas is introduced into the quartz reaction tube 11 from the quartz nozzle 18 , thereby carrying out in situ cleaning of the si 3 n 4 film . first , the quartz boat 14 holding no semiconductor wafer 16 is inserted into the quartz inner tube 12 the inside temperature of which is maintained at 600 ° c . next , the quartz reaction tube 11 is evacuated from the discharge port 17 to produce a vacuum therein using the vacuum pump ( not shown ). then , nf 3 gas is charged from the charging port 19 of the quartz nozzle 18 at a flow rate of 500 sccm , the quartz reaction tube 11 is evacuated to produce a vacuum therein from the discharge port 17 using the vacuum pump ( not shown ), a pressure in the quartz reaction tube 11 is maintained at 10 torr or higher , and the interior of the quartz reaction tube 11 is cleaned . then , the supply of nf 3 gas is stopped , the quartz reaction tube 11 is evacuated to provide a vacuum therein from the discharge port 17 using the vacuum pump ( not shown ), and residue nf 3 gas is discharged . next , n 2 is allowed to flow into the quartz reaction tube 11 from the quartz nozzle 18 to purge the quartz reaction tube 11 using n 2 to remove nf 3 in the quartz reaction tube 11 . then , the quartz reaction tube 11 is evacuated to produce a vacuum therein from the discharge port 17 using the vacuum pump ( not shown ). the evacuation operation and the purge operation using n 2 are carried out several times . thereafter , the interior of the quartz reaction tube 11 is brought back from the vacuum state into the atmospheric pressure state . then , the quartz boat 14 is moved down and taken out from the quartz reaction tube 11 . at the time of cleaning using nf 3 , when the si 3 n 4 film is etched , the quartz is also adversely etched at the same time . therefore , important is condition in which the si 3 n 4 film is largely etched , and the quartz ( sio 2 ) is etched as little as possible . fig6 shows a relation between a pressure and an etching selection ratio . in this figure , the horizontal axis shows a pressure in the quartz reaction tube 11 , and the vertical axis shows a ratio of an etching rate ( er ( sin )) of the si 3 n 4 film to an etching rate ( er ( sio 2 )) of the quartz . referring to fig6 , it can be found that as the pressure becomes higher , the etching selection ratio is increased , and the quartz ( sio 2 ) becomes less prone to be etched . for these reason , it is preferable to set the pressure to 10 torr or higher . further , by further increasing the pressure , the etching selection ratio becomes more excellent , and the etching rate is also enhanced and thus , the etching time can be shortened . for example , although the etching time is about 30 minutes when the pressure is set to 10 torr , when the pressure is set to 70 torr , almost the same etching can be carried out for about 15 minutes . by carrying out the nf 3 cleaning whenever the thickness of the formed si 3 n 4 film reaches 3000 å , it is possible to form particle - free si 3 n 4 films 100 times continuously in a maintenance - free manner . fig7 shows data . in fig7 , the horizontal axis shows the number of film forming operations , a blank exists every three times operation . the blank shows the nf 3 cleaning operation . the vertical axis shows the number of foreign particles of 0 . 18μ or greater particle size on the wafer . the cleaning operation using nf 3 gas was carried out in such a manner that nf 3 gas was charged into the quartz reaction tube 11 at a flow rate of 500 scam , the quartz reaction tube 11 was evacuated to produce a vacuum therein , the pressure in the quartz reaction tube 11 was maintained at 10 torr ( 1 , 300 pa ), a temperature therein was set to about 600 ° c ., and the cleaning operation was carried out for 30 minutes . in fig7 , “ top ” means a 115th wafer from the bottom , “ cnt ” means 66th wafer from the bottom , and “ bot ” means a 16th wafer from the bottom , when 125 wafers were processed . time required for carrying out the nf 3 cleaning operation once is 2 . 5 hours ( it takes 30 minutes to flow nf 3 gas , and the remaining time are required for bringing up the boat and evacuating to produce a vacuum and the like ), and there is a merit if compared with 16 hours required for conventional maintenance . as described above , according to the preferred embodiment of the present invention , when si 3 n 4 films are formed using btbas and nh 3 , it is possible to reduce the frequency of maintenance as small as possible and to suppress or prevent the generation of particles . the entire disclosure of japanese patent application no . 11 - 333129 filed on nov . 24 , 1999 including specification , claims , drawings and summary are incorporated herein by reference in its entirety . although various exemplary embodiments have been shown and described , the invention is not limited to the embodiments shown . therefore , the scope of the invention is intended to be limited solely by the scope of the claims that follow . | 8 |
the inflatable basketball structure resembles an ordinary basketball apparatus and includes an inflatable basketball backboard , an inflatable basketball rim , a basketball net , an inflatable supporting pole , and an inflatable safety enclosure . the members are made of one or more inflatable cells . several members can be made of a single cell . each individual inflatable cell has an airtight inflatable chamber having an inflation valve . the inflation valve permits air to be introduced and removed from the chamber . alternately , the airtight inflatable chamber can be outfitted with more than one valve , an inflation valve and a separate deflation valve where the inflation valve only inflates the chamber and the deflation valve only deflates the chamber . members may be formed of an outside jacket layer providing additional structural support as an exoskeleton for an inside inflatable member inflated against the outside jacket layer to prevent buckling of the outside jacket layer . the inflatable basketball backboard , inflatable basketball rim , basketball net , inflatable supporting pole , and inflatable safety enclosure are formed of an outside jacket layer providing additional structural support as an exoskeleton for an inside inflatable member inflated against the outside jacket layer to prevent buckling of the outside jacket layer . the basketball rim is made of a hoop of inflatable or padded material . a standard basketball net can be used on the inflatable basketball hoop by attaching the net to the hoop by means of detachable hook and loop tape . the hoop holds the net via the hook and loop tape where a hook side is disposed on either the net or hoop and the loop side is disposed on the other side . the net detaches if a user &# 39 ; s fingers are caught in the net . the rim is attached to the backboard . the junction between the hoop and the backboard is reinforced by elastic cord that restores the hoop to neutral position after a user dunks on the hoop . elastic cord connects the backboard to the hoop . the rim is flexible in relationship to the backboard and can flex when a user slam dunks . the backboard is in turn attached to the backboard pole . the backboard can be made of a single planar rectangular inflatable member . the backboard has an outside jacket layer restraining an inflated inside inflatable member . the outside jacket layer is a tough and more rigid fabric providing additional structural support as an exoskeleton . the inside inflatable backboard member is inflated against the outside jacket layer to prevent buckling of the outside jacket layer . the outside jacket layer restrains the inside inflatable member from expansion beyond the size of the outside jacket layer . alternatively , the backboard can also be made of a planar rectangular rigid core enveloped on the rear side by an inflatable member . the inflatable basketball pole is hollow and inflatable . optionally , the pole has an outside jacket layer restraining an inflated inside inflatable member . the outside jacket layer is a tough and more rigid fabric providing additional structural support as an exoskeleton . the inside inflatable member is inflated against the outside jacket layer to prevent buckling of the outside jacket layer . the outside jacket layer restrains the inside inflatable member from expansion beyond the size of the outside jacket layer . the inside inflatable member is an inflatable airtight member having an inflation valve . the member has a single inflation valve . the height adjustable pole can height adjust by either forming intermediate inflation chambers or a crumple zone . in the first inflation chambers embodiment , a number of intermediate independent chambers have individual air inflation valves and form preferably a pair of independent inflation chambers . in the inflation chamber embodiment , the base portion of the inflatable basketball pole supports a number of independent chambers . the independent chambers in turn support the upper portion of the inflatable basketball pole . a user may inflate or deflate one or more of the chambers to raise or lower the height of the basketball hoop , rim , and backboard . upon deflation of the independent chambers , the upper portion of the basketball pole decreases to a lower height , without affecting the air pressure of the base portion of the inflatable basketball pole or the upper portion of the inflatable basketball pole . a user then secures the upper , lower and intermediate portions by pairs of upper and lower straps of hook and loop tape . the upper and lower strap maintains the relative position of the members in the inflation chamber embodiment . the upper straps begin at a location above the upper intermediate inflation chamber and secures to a corresponding lower strap below the lowest intermediate inflation chamber . buttons or other hardware attachment means may connect the straps to each other . the preferred means for securing the opposing pair of straps is hook and loop tape . similarly , a user can increase the height of the basket by detaching the straps and inflating the intermediate chambers . in the second basketball pole embodiment , a crumble zone is a user height adjustable section of the basketball pole that allows a user to adjust the height of the basket . unlike the inflation chamber embodiment , the crumble zone embodiment has a single cell representing the basketball pole . the crumble zone is a location on the basketball pole that can be deflated and restricted in height by a plurality of straps , or other restriction means , so that the zone does not inflate to full height when restricted by a height restriction means . the crumble zone is defined by height restriction means such as upper straps that connect to lower straps . upper straps connecting to lower straps allow partial inflation of the crumble zone . when the air pressure is at full inflation air pressure , the crumble zone is also at full pressure . the crumble zone deflates upon deflation of the entire enclosure . instead of straps , the sleeve representing the outside shell of the basketball pole can be modified to include zippers between flaps to allow a user to zip up and contract a portion of the sleeve to limit the full inflation height of the crumble zone . a user determines the desired height of the basket rim and can adjust straps and set the straps to the proper height . the proper height is marked on the straps . once the straps are in place , the user inflates the device . the crumple zone straps limit the total height of the basket rim while maintaining rigid inflation . the crumple zone can be scored or prefolded to create a standard folding pattern that allows the zone a specific repetitively formed shape instead of a random crumpled shape . the net has hook and loop tape connecting the net to the rim . the loop side is attached to the net while the hook side is attached to the rim . if a user has a finger caught in the net , the net detaches to prevent injury to the user . the present embodiment further includes and an elastic cord attaching the back of the backboard to the spine of the basketball pole . the spine is the rearward portion facing away from the face of the backboard . the elastic cord restores the position of the backboard after a user dunks . the elastic cord can be threaded through loops or a continuous sleeve stitched into the spine of the basketball pole . a plurality of elastic cords may be used depending upon the restoring force desired . an elastic cord connects the upper and lower portion in a similar manner and reinforces the hook and loop tape . the basketball pole has an outside covering that can be enveloped around the pole . the crumple zone shares air pressure with the basketball pole and main wall members . an air pump can assist in maintaining air pressure by providing air to the enclosure and the basketball pole . the air pump is preferably attached to the base of the enclosure , constantly providing air input . the inflatable structure enclosure retains a basketball inside the enclosure by mesh netting . retaining the basketball enhances users safety and fun . the three main wall members forming the enclosure includes the left wall , the right wall and the rear wall . the standard wall consists of a top tubular member attached to a pair of side tubular members attached to a bottom tubular member . the four tubular members form a frame defining an aperture that is enclosed by netting stretched to span across the aperture . the inflatable basketball structure can be mounted on a trampoline with the left wall , right wall , and rear wall resting on the periphery of the rectangular trampoline . a rope or strap retains the enclosure to the trampoline frame and can attach the left wall , right wall and rear wall to the frame . the preferred embodiment has a rectangular enclosure with three main walls . alternate embodiments may use circular or semicircular wall configurations . a wall includes a structure of inflatable frame members with netting spanning between inflatable frame members . in an alternate freestanding embodiment , the basketball pole , basket and rim are separately inflated from the enclosure . the assembly of the basketball pole , basket and rim forms a freestanding unit resting on the basketball pole base having no air communication with the protective enclosure . the freestanding inflatable pole is attached to the protective enclosure by mounting straps or mounting cord and can be reconfigured to attach to other structures by mounting straps or a mounting cord . the freestanding embodiment maximizes user configuration options and allows the basketball pole member to be separated from the protective enclosure and attached to other non - inflated or inflated protective trampoline enclosures . non - inflated protective trampoline enclosures having solid steel frames and retaining mesh netting are widely used . some are described in u . s . pat . nos . 6 , 053 , 845 , and 6 , 261 , 207 to publicover . the freestanding inflatable pole can be attached to a wide variety of non - inflated structures by means of straps or cord . the inflatable basketball structure may comprise an inflatable safety enclosure having three walls defining a semicircular instead of rectangular enclosure , and here the trampoline provided is a circular trampoline . | 0 |
turning to the drawing , there may be seen a block diagram representing a preferred embodiment of the adaptive gain - ranging system of the present invention . signal source 10 is connected , through selector switch 12 and selectable gain amplifier 14 , to the input of analog - to - digital ( a / d ) converter 16 . in turn , the output of a / d converter 16 provides a signal to data system 18 and thence to output device 20 . the system further comprises control device 22 , interconnected between various other components as will hereinafter be described in detail , and a calibration signal system in general designated by reference numeral 24 , also connected to the input of a / d converter 16 through selector switch 12 and selectable gain amplifier 14 . power for the operation of the system is supplied , as appropriate , by one or more power supplies ( not shown ). in greater detail , signal source 10 may be any one of a number of well - known electrical transducers that provide a variable electrical current or voltage responsive to a physical parameter . in this regard , signal source 10 may be , for instance , a photodetector , a piezoelectric strain gauge , a capacitive proximity detector , or the like , together with any required power supply , preamplier , impedance matching device , and the like , as well known in the art . selector switch 12 is any one of a number of devices for making an electrical connection between either of two electrical inputs and the switch &# 39 ; s electrical output while simultaneously electrically disconnecting the other input . in the preferred embodiment , selector switch 12 is chosen so as to be activated by an appropriate electrical &# 34 ; mode set &# 34 ; signal from control device 22 . in this case , selector switch 12 may be an electromechanical or solid state relay . however , it will be appreciated that in some applications selector switch 12 might be a manually manipulated device , such as one or more switches or connectors . selector switch 12 is connected to receive input signals from signal source 10 and calibration signal system 24 and to connect them alternately to selectable gain amplifier 14 . selectable gain amplifier 14 is chosen to provide ( analog ) output signals responsive to ( analog ) input signals at any one of a preselected plurality of nominal gains , the gain being selected by an appropriate gain set signal . while typically the preselected gains of selectable gain amplifier 14 are chosen to differ from one another nominally by powers of two , it will be appreciated that any two or more values of the preselected gain may be employed , and further that one or more of the preselected gains may be fractional ( i . e ., selectable gain amplifier 14 may provide attenuation ). in the preferred embodiment , the gain is set in response to an electrical gain set signal from control device 22 . for such an embodiment , the gain of the selectable gain amplifier may be established by opening , closing , or stepping an electromechanical relay or its solid state equivalent . however , as is the case of the operation of selector switch 12 , it will be understood that in certain embodiments a manually manipulated device , such as a multi - tap switch , might be employed to select the value of the desired gain . selectable gain amplifier 14 is connected between selector switch 12 and a / d converter 16 so as to provide a signal proportional to the signal received from the selector switch 12 . a / d converter 16 is any one of a number of well - known devices for periodically providing digitally ( commonly binary ) encoded electrical signals responsive to the current or voltage of an input signal . the output of a / d converter 16 serves as an input ( directly or through telemetry ) to data system 18 , which preferably is a dedicated data system capable of storing , comparing , and otherwise manipulating digital information . thus , data system 18 is preferably an electronic computer programmed , as taught by the prior art , to accumulate and process the output of a / d converter 16 into a form useful to the user , depending on the nature of the system and signal source 10 . in its simplest form , data system 18 might thus be programmed only to correct the data by the last known values of the gain and offset , e . g ., by dividing by the gain and adding the offset . typically , data system 18 is connected to an output device 20 so that the raw data from a / d converter 16 , or the result of its manipulation or comparison with previously stored data , may be displayed or permanently recorded . to this end , output device 20 is typically a display system , printer , recorder , or the like . control device 22 is any one of a number of devices for providing a sequence of control signals on command . thus , control device 22 may be an electromechanical sequence controller , tape or card actuated switching gear , or the like . in the preferred embodiment , control device 22 is a signal conditioner providing a set of appropriate electrical signals responsive to signals from data system 18 . it will be understood , however , that control device 22 might also be a manually operated device , such as a set of switches . control device 22 is connected to a power supply ( not shown ) so as to provide control signals to selector switch 12 , selectable gain amplifier 14 , and calibration source system 24 . calibration source system 24 includes selectable bias source 26 , noise source 28 , and summing amplifier 30 . selectable bias source 26 is any one of a number of devices for providing any selected constant level reference signal from a set of pre - established dc signal levels . thus , selectable bias source 26 may be a voltage divider network and a precision power supply , a set of standard cells , or the like , that may be variously connected to provide a selected reference signal . in the preferred embodiment , the selection of the bias level is responsive to a bias set signal from control device 22 . to this end , as well known , solid state or electromechanical relays or the like may be used to interconnect components so as to provide the desired signal levels . however , it will also be understood that the selection of reference signals might also be done manually . in a preferred embodiment , the selected output signal from selectable bias source 26 is provided as one of the inputs to summing amplifier 30 . in a preferred embodiment , noise source 28 is connected as the other input of summing amplifier 30 . noise source 28 is any one of a number of well - known devices for producing an electrical noise of known statistical properties . thus , noise source 28 may be a diode noise generator , a noisy amplifier , or the like . preferably , but not necessarily , noise source 28 is chosen to produce a gaussian ( or nearly gaussian ) noise spectrum which , as well known , exhibits amplitude variations having a mean average of zero over time . in any event , as will become apparent hereinafter , the operation of the invention is simplified if the probability distribution of the noise is symmetric . summing amplifier 30 is preferably a conventional unity - gain amplifier capable of superposing a pair of signals . its output , corresponding to the sum of the signals it receives from selectable bias source 26 and noise source 28 , is connected as an input to selector switch 12 . concerning the overall system parameters of calibration signal system 24 , noise source 28 is selected so as to produce a noise signal having maximum amplitude variations about its mean average value . the noise signal has a maximum amplitude , when amplified at the lowest gain of selectable gain amplifier 14 , that is greater than at least one , and preferably several times , the least significant digit value of a / d converter 16 , while preferably remaining less than half the counting range i . e ., less than half the value between the minimum and maximum output values , of the converter at the highest gain of the selectable gain amplifier . the minimum and maximum reference signal levels of selectable bias source 26 are chosen such that , when amplified by selectable gain amplifier 14 at minimum and maximum gain respectively , they correspond to output signals of a / d converter 16 spaced from the minimum and maximum output values or counts by better than half the maximum noise amplitude produced by noise source 28 . it will be understood that for a truly gaussian signal , the maximum amplitude of the noise signal may be generated within any convenient range , say six standard deviations . however , the requirement remains that at the lowest gain of the gain - ranging amplifier the amplitude of the noise signal covers at least one -- and preferably several times -- the least significant digit as digitized by the a / d converter in a relatively small number of counting cycles , yet the noise signal does not the range of the converter at the highest gain a significant number of times in a relatively large number of counts ). the operation of the preferred embodiment will now be described . normally , selector switch 12 is positioned to connect signal source 10 to selectable gain amplifier 14 ( disconnecting calibration source system 24 ), and selectable gain amplifier 14 is set at a predetermined nominal gain . signals from signal source 10 , amplified accordingly , are supplied as input to a / d converter 16 . as a result , a train of digital signals spaced apart by the sampling time of the a / d converter is supplied to data system 18 . in the preferred embodiment , as in prior art devices , data system 18 , inter alia , compares the signals from a / d converter 16 with pre - established limit signals ( stored , for instance , in a look - up table ), and supplies control device 22 with an appropriate up or down signal respectively as the count falls below or exceeds the pre - established lower or upper limits . in response , control device 22 generates appropriate gain set signals and supplies them to selectable gain amplifier 14 , stepping the gain up or down . this process continues until the digitized signal from a / d converter 16 is within the pre - established limits . thereafter , data is collected , processed , and disposed of as required by the nature of the overall system . throughout the cycling of selectable gain amplifier 14 , it will be understood that the nominal value of the selected gain is somehow recorded , as on a counter , in data system 18 responsive to the up and down signals . data system 18 may thus present to output device 20 a digital output , updated as desired , corresponding to the signal from signal source 10 , as amplified by selectable gain amplifier 14 , together with an indication of the nominal gain setting of the amplifier . alternatively , as will be understood by those skilled in the art of computer - assisted instrumentation systems , data system 18 might apply ( as from a look - up table ) the last known values of the gain and offset corresponding to the gain setting , thereby supplying output device 20 a corrected sequence of data . in response to signals from data system 18 , control device 22 also provides a sequence of signals to selector switch 12 , selectable gain amplifier 14 , and calibration source system 24 , thereby interposing a calibration test . this sequence may be initiated by data system 18 in response to either a previously established program ( e . g ., an instruction to initiate a calibration sequence at fixed time intervals , after cycling selectable gain amplifier 14 a pre - set number of times , or the like ), a user command , or the like . at the same time that the calibration sequence is initiated , the gain - ranging function of data system 18 described supra is inhibited . in the calibration sequence , control device 22 preferably first resets selectable gain amplifier 14 to the lowest gain and selectable bias source 26 to the lowest bias . control device 22 then sets selector switch 12 to connect calibration source system 24 to the input of the selectable gain amplifier , disconnecting signal source 10 at the same time . as a consequence , the lowest level dc calibration signal , with superposed noise due to noise source 28 , is supplied to a / d converter 16 at the lowest nominal gain of selectable gain amplifier 14 . data system 18 now accumulates in memory a series of digital signals corresponding to this bias and gain . alternatively , this information may be recorded by output device 20 . unlike data accumulated from signal source 10 , these digital signals are not manipulated according to the function of the system , nor are they corrected by applying the last known gain and offset values corresponding to the gain set . when a statistically significant number of samples of digital signals is collected , control device 22 generates a bias set signal resetting the bias of selectable bias source 26 to the highest level calibration signal , and data system 18 accumulates another series of digital signals . in a like manner , control device 22 generates gain set and bias set signals to step selectable gain amplifier 14 through its preselected gains , supplying minimum and maximum calibration signals for each gain setting . data system 18 accumulates a set of signals for each calibration level at each gain setting . since the maximum amplitude of the noise generated by noise source 28 has been selected to be greater than the resolution of a / d converter 16 at the minimum gain of selectable gain amplifier 14 , each series of digital signals produced during the calibration sequence will evidence scatter . since the levels of the dc calibration signals have been selected , in view of the gains of selectable gain amplifier 14 , to correspond to digital signals displaced from the limits of a / d converter 16 by counts greater than half the maximum amplitude of the noise signal , virtually all of the sample counts of each digital signal series will be within the counting limits , i . e ., the maximum and minimum values of the converter . the time or mean average of each series of digital signals will be a value corresponding to the noise - free value of the corresponding calibration signal at the gain in question , since , preferably , the time average value of the noise signal is zero . the accuracy of this average depends upon the number of individual values of the digital signal averaged and upon the statistical behavoir of the noise , and may be deduced by an analysis of the particular system parameters and noise source . absent a detailed analysis , it is evident that the number of significant figures in this average easily exceeds that obtainable from observations of a noise - free calibration source . in particular , for a gaussian noise , it may be shown that the accuracy of the average increases inversely as the square root of the number of independent values or samples entering into the average . consequently , at moderate data rates and over reasonable time periods , values of gain and offset , one or two orders of magnitude more accurate than the a / d converter resolution , are readily obtainable . the average values of the series of digitized calibration signals correspond to zero - point and scale ( offset and gain ) values of the various gain settings . the gain and offset may be directly determined therefrom , as by data system 18 or manually . these new values may be recorded or used to update a correction look - up table in data system 18 . at the end of the calibration sequence , control device 22 resets selectable gain amplifier 14 to the initial predetermined nominal gain and resets selector switch 12 so as to reconnect signal source 10 to the selectable gain amplifier while simultaneously disconnecting calibration source system 24 . the data system is simultaneously returned to its normal data collection mode . it will be appreciated that details of both the apparatus and method described above may be altered without departing from the scope of the invention . thus , as previously indicated , controller 22 may be an electromechanical sequence controller or an extension of a general purpose computer . further , the various control functions may be , if desired , performed manually . then too , it will be understood that noise source 28 need not be a separate device , but might , for instance , be incorporated into selectable bias source 26 . thus , selectable bias source 26 might incorporate a stage of amplification with a noisy amplifier . it will be appreciated that , in cases where noise source 28 is incorporated into selectable bias source 26 , summing amplifier 30 may be dispensed with , the selectable bias source being directly connected to selector switch 12 . it will also be appreciated that the averaging of the calibration signals may be performed by data system 18 , and that weighted averaging might be employed , for instance , for noise sources having nonsymmetrically distributed noise spectra . it will also be understood that the results of each calibration run might be automatically incorporated into subsequent data processing by data system 18 , and that further , the individual digital signals corresponding to each train of a calibration run might simply be passed through data system 18 to output device 20 for subsequent analysis . since these and other changes may be made in the above apparatus and method without departing from the scope of the invention herein involved , it is intended that all matter contained in the above description or shown in the accompanying drawing shall be interpreted in an illustrative and not a limiting sense . | 7 |
fig2 shows one embodiment of an arrangement of a disc storage unit suitable for implementing a data read / write system in accordance with the present invention . in this embodiment , servo information of the above - described intersector built - in system is employed . fig3 illustrates in detail the servo information . each of fig4 a and 4b show procedures of addressing of the disc surface serial system in a similar manner as fig1 a and 1b . on one surface of disc 1 , which is shown at an upper part on the left side of fig2 there are shown a track t and a plurality of fan - shaped regions for servo information si which are arranged radially so as to partially interrupt the tracks in the circumferential direction . in fig2 the number of the fan - shaped regions is eight . in practice , however , this number is the same as the number of the sectors in the track , and usually several tens of fan - shaped regions are provided . a head 2 is supported via a thin plate spring by an arm 3 which rocks in a direction indicated by an arrow m in this embodiment . the position of the arm 3 in the radial direction is controlled by an actuator 4 of a type using a voice coil motor consisting of a stator 4a and a rotor 4b . a driver 5 is provided for driving the actuator 4 . a plurality of heads 2 in the disc storage unit are connected to read / write circuit 6 . of the heads , the one which is designated by a head selection instruction hs from a processor 20 is put in a mode of reading or writing data in response to the contents of a read / write instruction rw also from processor 20 , as is the case of a conventional disc unit storage unit . a read out signal rs outputted from a read out output r of the read / write circuit 6 is sent via a demodulation circuit 7 and a data separating circuit 8 to an encoder - decoder circuit 9 . on the other band , a write signal ws is supplied by the encoder - decoder circuit 9 to a write input w of the read / write circuit 6 . the read out signal rs is also supplied to a servo information reading circuit 10 so that the read - out portion of the servo information si contained therein can be read out . microprocessor 20 is incorporated in the disc storage unit for overall control of the components therein , and microprocessor 20 is connected to the servo information reading circuit 10 via an internal bus 40 which functions as both an address but and a data bus simultaneously . the microprocessor 20 is connected by address but 41 to a rom 21 for storing recorded programs therein and rom 21 also is connected to the internal bus 40 . a data controlling circuit 30 connected to the microprocessor 20 via the internal bus 40 is itself a simple processor . ram 31 is connected to the data control circuit 30 via the address bus 41 . as is the case of a conventional disc storage unit , the data controlling circuit 30 receives serially the read - out signal decoded by the encoder - decoder circuit 9 and converts it into parallel data which are stored first in the ram 31 , followed by supplying the parallel data to a data bus 42 and conversely reading the data on the data bus 42 in a parallel mode and converting it into a serial write signal , and then supplying it to to the read / write circuit 6 via the encoder - decoder circuit 9 in an encoded mode . the internal bus 40 and the data bus 42 are connected to or associated with an external bus 60 for a computer ( not shown ) via an interface circuit 50 of scsi system , for example . the data controlling circuit 30 is separately connected to the rom 21 for the microprocessor 20 so that the programs and basic data information contained therein can be utilized . as is shown in fig2 the microprocessor 20 supplies a driving instruction to the driver 5 for the actuator 4 via the internal bus 40 and also sends the above - described two instructions ( hs and rw ) for the read / write circuit 6 . fig3 is a partial development view showing a part of a disc surface to explain an example of the mode of writing intersector built - in servo information si between the sectors s in a track t . in this embodiment , the servo information si is a so - called vast servo type which consists of four servo information regions sa , sb , sc and sd arranged in the circumferential direction of the disc 1 . as is described in detail in u . s . pat . no . 4 , 669 , 004 , the contents of the four servo information regions are written into the respective surfaces of the disc 1 at different positions thereof in radially opposite directions with respect to the center line of a track t in a simple repetitive manner such that each of them has a content consisting of several repetitive patterns and that a deviation of the head from the center line of the track , or off - track , can be detected based on the magnitude of the vast signal which is obtained by reading out the contents of each servo information portion . on the left hand side of the servo information regions , there is provided a marker b for detecting the servo information si , which indicates that the servo information regions follow it . usually , the marker b is made as a region which is blank , that , is no data has content . on the right hand side of the servo information portion , there is written a track number tn in the form of a unique code so that it can be read out during a so - called seeking operation in which the head is displaced or seeds . the servo information reading circuit 10 shown in fig2 is contemplated to read out the contents of the servo information si which consists of the marker b , the servo information regions sa to sd and the track number tn . the circuit 10 detects the marker b to initiate the reading out and detects the respective magnitudes of the four vast signals derived from the servo information regions sa to sd , and if desired , also reads out the track number tn and then supplies the information to processor 20 via internal bus 40 . next , the overall construction of the sectors s on the track t in accordance with the present invention will be described by referring mainly to one of them . as is the case in a conventional disc storage unit , a sector s consists of an identification portion id and a data portion dt , and synchronization data sy are provided at the respective beginning portions thereof . the identification portion id contains the physical addresses , i . e ., the head number hn , the track number tn and selector number sn , of the sector and the data portion dt contains data d of using 256 to 1024 bytes together with error codes . of course , the head number hn denotes the number of the disc and the track number tn corresponds to the cylinder number as conventionally used . fig4 a and 4b show how to convert the logical addresses into the physical addresses in the same manner as previously explained in fig1 with respect to the case where two disc surfaces are used . in this case , it is assumed that the servo information si is written in eight component portions on each disc surface for the ease of illustration . fig4 a shows the disc surface for which the head number hn is 0 and the logical addresses 0 to 7 designated by a computer ( not shown ) are sequentially converted into the eight sectors s in the radially outermost track with the track number tn = 0 as shown in fig4 a , and the accompanying logical addresses 8 to 15 are sequentially converted into the eight sectors in the track with the track number tn = 1 . in the same manner as above , continuous logical addresses are sequentially converted into the sectors arranged in the inner tracks in the radial direction . assuming that the total number of sectors of one disc surface is x as is the case previously explained , the logical address x - 1 is converted into the last sector in the radially innermost track . the subsequent logical addresses are all converted into the sectors in the disc surface with the head number hn = 1 shown in fig4 b . in this embodiment , the first logical address x on this surface is converted into the top sector in the radially innermost track of this disc surface as shown in fig4 b . as shown in fig4 b , of the logical addresses x - 1 et seq ., every eight logical addresses are converted into sectors in the tracks sequentially from the sector which is present by one track outer in the radial direction than the radially innermost track toward the sector which is the radially outermost track in the disc surface with the head number 1 . the last logical address 2x - 1 is converted into the last sector in the radially outermost track . it follows from this that when the disc surface is switched in response to the movement of the logical address from x - 1 to x , it is only necessary that the read / write action be switched from the head no . 0 to the head no . 1 , without moving the head actually . next , explanation of the overall operation of the system in accordance with the present invention will follow the description of the above - described construction of the disc storage unit for practicing the present invention . the data read / write instruction rw derived from a computer ( not shown ) is supplied to the microprocessor 20 via the external bus 60 , the interface circuit 50 and the internal bus 40 . the read / write instruction always includes designation of a read instruction or a write instruction in addition to the top logical address of the data , and therefore , the processor 20 first converts the logical addresses into the physical addresses by the address converting means p stored in the rom . now , assuming that the number of tracks on one of the disc surfaces is nt , and that the number of sectors in one track is ns , as will be readily understood , the designated logical addresses can easily be converted into physical addresses by defining as the head number hn an integer part of a value obtained by dividing the value of the designated logical address by nt · ns , further defining as the track number tn an integer part of a value obtained by dividing the remainder of the division of the designated logical address by nt · ns by ns and also defining the surplus of the second division as the sector number ts . the processor 20 issues the head number hn contained in the converted physical address as a head selection instruction hs and supplies it to the read / write circuit 6 , and performs a so - called seek operation in which the processor 20 reads out the track number portion tn in the servo information si via the servo information reading circuit 10 , as is the case of a conventional disc storage unit , and moves the head 2 in the vicinity of the track with the track number tn in the converted physical address while issuing an instruction for operation and supplying it to the drive circuit 5 of the actuator 4 . immediately after completion of the seek operation a read / write instruction rw is supplied to the read / write circuit 6 in response to the instruction given by a computer ( not shown ) so as to begin a data read / write action . in this case , the processor 20 receives the magnitude of the vast signal obtained by reading the four servo information regions sa to sd in the servo information si from the servo information reading circuit 10 , as is the case of a conventional disc storage unit , and a calculates on off - track amount , and then while controlling the position of the head 2 via the actuator 4 in a closed loop control mode so that the off - track amount falls within a predetermined allowance , starts read / write operation in association with the internal bus 40 on the condition that the off - track amount becomes within the predetermined allowance . the reading or writing of data is usually performed such that the content of the data for one track is read or written continuously in one operation . however , in the present invention , the reading or writing data from or into a sector in a track is performed in a closed loop control mode with reference to preceding servo information on the same disc surface , resulting in that accurate reading out or writing can always be carried out even when the pitch between adjacent tracks is narrow and the mechanical precision of the head mechanism is not high . of course , the reading or writing of data is carried out within the logical addresses designated by a computer ( not shown ) or until the last designated logical address is reached . when switching tracks from which data information is to be read from or written into while continuing the above - described operation , the processor 20 operates the actuator 4 to change the position of the head 2 by one intertrack pitch radially inwardly or outwardly and starts reading or writing data from or into a new track after confirming that the off - track amount has become within the predetermined allowance with reference to the servo information . as stated above , the time required for movement of the head by one intertrack pitch according to the present invention is shorter than the time required conventionally for correction of the position of the head after switching heads in the case where the intertrack pitch is narrow , and therefore , reading out or writing data information from or into new tracks can be carried out faster than before . communication of data to be read or written with the computer in the present invention is the same as the conventional technique , and more specifically , the data read out by the data controlling circuit 30 is first stored in ram 31 and then supplied to the computer via the data bus 42 , the interface circuit 50 and the external bus 60 , and on the other hand the data to be written is first stored in ram 31 and supplied in the reverse direction to the data controlling circuit 30 and the like to obtain the write signal ws for disc 1 . while the description of the embodiments of the present invention has been completed , it is to be understood that the present invention is not limited to the above - described embodiments and that various modifications can be effected within the true spirit of the present invention . for instance , although description of the above embodiments has been made as to the case where two disc surfaces are used for convenience , it is rather common to use four or more disc surfaces in practice . the servo information is not limited to the vast servo system type used in the above - described embodiments and any known type of servo information can be used in the present invention as the case may be . the number of the regions where servo information is to be written should be selected appropriately from disc to disc in response to the accuracy of reading or writing operations or the degree of the mechanical precision of the head mechanism . for instance , there can be used only one region but with as high as possible a storage capacity or that of intersector built - in mode as used in the embodiments described above in order to increase the tracking accuracy upon reading or writing data . the construction of the disc storage unit used in the above - described embodiments is merely an example and those having a construction such as a type or model considerably different from that used in the embodiments can also be used in the present invention in an appropriate manner . the practical manner of conversion of the logical addresses into the physical addresses is to be adapted to the construction of the disc storage unit , and various variations may be made in practice . the invention has been described in detail with respect to embodiments , and it will now be apparent from the foregoing to those skilled in the art that changes and modifications may be made without departing from the invention in its broader aspects , and it is the intention , therefore , in the appended claims to cover all such changes and modifications as fall within the true spirit of the invention . | 6 |
a detailed description of the embodiments of this invention is next related while referring to the accompanying drawings . fig1 a and fig1 b are respectively drawings showing cross sectional views of the chemical tank and the wash tank comprising the wet processing device of the first embodiment of the invention . this embodiment , as shown in fig1 a and fig1 b is comprised of a chemical tank 1 consisting of an inner tank 1 a and an outer tank 1 b , a wash tank 15 , and a wafer conveyor 8 . as shown in fig1 a , the inner tank 1 a of the chemical tank 1 , besides having a wafer stand 3 for mounting the wafer 2 conveyed to the bottom , also has a cylinder 7 in the vicinity of the upper edge for overflow of the chemical 5 . the cylinder 7 uses a material having excellent chemical resistance , is affixed with a non - contact fluid level sensor 6 at the top connected by a wire 10 , and is open at the bottom . the non - contact fluid level sensor 6 detects the level of air bubbles 4 emitted in the inner tank 1 a , and supplies different types of control signals by way of the wire 10 . the cylinder 7 is connected with an air bleed pipe 11 to bleed off ( remove ) the air bubbles 4 accumulated in the sealed space formed in the lower part of the sensor 6 , and the passage in the pipe 11 is installed with an air solenoid operated valve ( asv ) 12 . the wafer conveyor 8 conveys the wafer 2 held in the conveyor chuck 9 along the shaft 8 a to the wafer stand 3 installed in the inner tank 1 a of the chemical tank 1 . however the wafer pull - up speed when extracting the wafer from the tank , is a high pull - up speed or a low pull - up speed based on the output from the sensor 6 . a circulating pump 13 and a filter 14 are installed in the chemical line between the inner tank 1 a and the outer tank 1 b , the same as in the example of the prior art . next , as shown in fig1 b , the wafer 2 extracted by the wafer conveyor 8 from the inner tank 1 a of the chemical tank 1 is conveyed to the wash tank 15 and mounted on the wafer stand 16 installed in the bottom . the wash tank 15 connects to the water supply line 17 and carries out washing of the wafer 2 . in the example of the prior art , one water - supply air operated valve is connected to the water supply line 17 , and a fixed quantity ( fixed speed ) of distilled water was supplied to the wash tank 15 . here however , a first water - supply air operated valve 18 for high - speed water supply , and a second water - supply air operated valve 19 for low - speed water supply are installed . the selection of these first and second water - supply air operated valves 18 , 19 is performed by control signals from the above mentioned non - contact fluid level sensor 6 . when many air bubbles 4 are detected , high speed is selected or in other words , the first water - supply air operated valve 18 is opened to supply a large quantity of distilled water . conversely , when few air bubbles 4 are detected , the low speed is selected or in other words , the second water - supply air operated valve 19 is opened to supply a small quantity of distilled water . an enlarged view of the sensor and cylinder of fig1 is shown in fig2 . the non - contact fluid level sensor 6 is inserted in the top section of the cylinder 7 as shown in fig2 . a sealing material 20 is installed between the non - contact fluid level sensor 6 and the cylinder 7 to prevent drooping and to maintain the air sealing . an air bleed pipe 11 is installed between the over flow level constituted by the bottom of the non - contact fluid level sensor 6 and the reference fluid level 22 , on the side of the cylinder 7 , and the above described asv ( air solenoid operated valve ) asv 12 is installed in this pipe 11 . an opening 21 is formed in the bottom of the cylinder 7 , and along with the open surface of the opening 21 and the overflow surface forming a right angle versus the cylinder 7 axis , the cylinder 7 itself is installed in an inner tank position not exerting an effect in the event of an overflow of chemical 5 to the outer tank 1 b or in other words installed near the inner side of the wall of the inner tank 1 a . consequently , when installed in the inner tank 1 a of the cylinder 7 , and the valve 12 installed in the pipe 11 is opened , or in other words when the air is bled off , the reference fluid level 22 can match the overflow . a fluid setting level 23 can also be set to the desired level between the reference fluid level 22 and the opening 21 . therefore , after installing the cylinder 7 and bleeding off the air , the fluid level within the cylinder drops from reference fluid level 22 to the desired fluid setting level 23 due to the penetration of some air bubbles through the opening 21 . when the fluid level inside the cylinder falls to the fluid setting level 23 due to the air bubbles , the sensor 6 detects the presence of many air bubbles , and implements control by way of the wire 10 . [ 0029 ] fig3 shows an enlarged view of the chemical tank and cylinder of fig1 . the non - contact fluid level sensor 6 in the cylinder 7 installed in the inner tank 1 a of the chemical tank 1 , as shown in fig3 has already determined the level formed by the opening 21 of cylinder 7 and the reference fluid level 22 so that no fluid level detection is required . just detecting the optional level that the fluid setting level 23 is set to is sufficient . the optionally set fluid setting level 23 in the cylinder 7 can be just one level for checking the air bubble quantity and switching to high speed / low speed or can be two levels for switching to high speed / low speed . in either case , just providing a function for detecting the fluid level with the sensor 6 is sufficient . the non - contact fluid level sensor 6 determines that the amount of air bubbles is large when the fluid level reaches fluid setting level 23 and commands the shaft drive of wafer conveyor 8 to perform high - speed wafer pull - up . on the other hand , if the optional level that the fluid setting level 23 is set to is not detected , then the sensor 6 commands the shaft drive of wafer conveyor 8 to perform low - speed wafer pull - up . the non - contact fluid level sensor 6 controls the water quantity of the wash tank 15 in the same way , by detecting the air bubbles . in other words , when determined that a large amount of air bubbles are present , a thick deposit of chemical remains on the wafer surface in order to set a high speed pull - up of the wafer as described above . the remaining chemical must be washed ( rinsed ) requiring a large distilled water flow rate so the water supply line must be switched to a flow rate to handle a large water quantity . conversely , when few air bubbles are found , a low pull - up speed is set and the flow rate is small . in detecting the air bubbles 4 of the chemical tank 1 in this embodiment in this way , the amount of air bubbles 4 are detected as the height of the fluid setting level 23 in the sealed space 24 inside the cylinder 7 . in other words , when the fluid level formed in the sealed space 24 has dropped to the optional level set for the fluid setting level 23 , many air bubbles are determined to be present , and a command for high speed pull - up of the wafer 2 from the chemical tank 1 is sent . also , when determined that many air bubbles 4 are present , a large flow rate is specified for the water supply line at the wash tank 15 . the embodiments of the invention are hereafter described in more detail while referring to fig1 through fig3 . under the conditions of chemical processing that generates many air bubbles and a minute amount of air - borne particles around the chemical tank 1 and the wash tank 15 , air - borne particles are easily prone to adhere to the surface of the wafer 2 being conveyed to the wash tank 15 after chemical processing . furthermore , even more bubbles are generated due to reaction with sulfuric acid and hydrogen peroxide when processing a wafer 2 with a resist coating , in sulfuric acid and hydrogen peroxide so that the adherence of particles to the surface of the wafer being conveyed is even further accelerated . here , an example of sulfuric acid — hydrogen peroxide processing followed by washing is described for the case where air bubbles are easily prone to occur due to effects of the circulating line and chemicals , under conditions of a minute amount of air - borne particles present while conveying a mix of both resist and non - resist coated wafers . the fluid setting level 23 was made to match the level of opening 21 . first of all , prior to mounting the wafer 2 in the wafer conveyor 8 in the chemical tank 1 , the asv 12 is opened and the air inside the cylinder 7 is bled off . when the air inside this cylinder 7 is bled off ( removed ), the space inside the cylinder is open to the outer air so that the reference fluid level 22 inside the cylinder 7 is at the same height as the overflow level . this non - contact fluid level sensor 6 detects the fluid level 22 inside the cylinder 7 , and closes the asv 12 after confirming that the overflow level of inner tank 1 a of chemical tank matches the reference fluid level 22 within the cylinder 7 , and stops the cylinder 7 air bleeding . closing this asv 12 forms a sealed space 24 between the fluid level 22 of cylinder 7 and the bottom edge of the non - contact fluid level sensor 6 . then , when the non - contact fluid level sensor 6 detects the fluid level 22 inside the cylinder 7 , the wafer 2 is conveyed to the inner tank 4 of chemical tank 1 , and chemical processing starts . further , circulation filtering is performed in the chemical tank 1 , and overflow of chemical 5 occurs from the inner tank 1 a to the outer tank 1 b , and the air bubbles 4 in the chemical 5 also overflow . during the overflow , a portion of the air bubble 4 in the chemical 5 pass through the opening 21 formed in the bottom of the cylinder 7 and are trapped in the sealed space 21 . when the wafer 2 is resist wafer , air bubbles are generated by the reaction with the sulfuric acid and hydrogen peroxide so that a portion of these air bubbles are also trapped in the same way in the cylinder 7 . when the air bubbles 4 are trapped inside the cylinder 7 , the chemical inside the cylinder 7 is ejected from the opening 21 of cylinder 7 , and the sealed space 24 expands . in other words , the fluid level inside the cylinder 7 drops from the fluid level 22 , and the non - contact fluid level sensor 6 does not detect the fluid level 22 . the fluid level inside the cylinder 7 declines even further , and when the non - contact fluid level sensor 6 detects the fluid setting level 23 set at the level at the opening 21 during chemical processing , the wet processing is determined to have many air bubbles 4 . a first control signal to set the pull - up speed of the wafer 2 after chemical processing to high speed is therefore sent to the shaft drive of the wafer conveyor 8 by way of the wire 10 . a second control signal sent simultaneously from the sensor 6 , opens the first water - supply air operated valve 18 during rinsing in the wash tank 15 , and closes the second water - supply air operated valve 19 to set a large distilled water flow rate . in other words , during wafer processing with a large quantity of air bubbles , the pull - up of the wafer 2 from the chemical tank 1 is set to a high speed so that a large amount of chemical flows into the wash tank 15 . consequently , the water supply to the wash tank 15 is increased to perform high efficiency rinsing within a short time within the wash tank 15 . during high speed pull - up , the wafer 2 is conveyed with a thick coating of chemical on the surface . the air - borne particles at this time attach to the wafer 2 while floating in the fluid film containing the air bubbles . the particles are therefore not directly adhering to the silicon surface so that when washing is performed while in this state , the fluid film on the wafer 2 and the particles are both washed away . as a final result , few particles directly adhere to the wafer 2 but a large quantity of water must be supplied to the wash tank 15 . the fluid level inside cylinder 7 on the other hand , does not fall much , and when the chemical processing is finished , or in other words , when the non - contact fluid level sensor 6 has detected that the fluid setting level 23 is between the reference fluid level 22 and the level of the opening 21 , the sensor 6 determines that few air bubbles 4 are present in the wafer processing and sets a low pull - up speed for the wafer 2 by issuing a first control signal after the chemical processing . simultaneous with that setting , a second control signal is issued from the sensor 6 to close the first water - supply air operated valve 18 and open the second water - supply air operated valve 19 during rinsing in the wash tank 15 . a low pull - up speed from the chemical tank 1 is set when few air bubbles 4 are present during wafer processing . due to the effect of tensile force during pull - up , the chemical 5 is pulled into the chemical tank 1 from the surface of the wafer 2 . as a result , the amount of chemical remaining on the wafer 2 is small , so that the amount of chemical flowing into the wash tank 15 is also small and rinsing just as effective as the rinsing during high speed pull - up can be performed with a small amount of water . in this embodiment , by in this way determining with the non - contact fluid level sensor 6 if there is a large or a small amount of air bubbles 4 during wafer processing , a high speed or a low speed can be automatically set as the pull - up speed from the chemical tank 1 , the flow rate or in other words a large or a small flow rate can also be automatically set during rinsing in the next wash tank 15 , and the amount of distilled water used in the wash tank can be reduced . a cross sectional view of the wet processing device for describing the second embodiment of the invention is shown in fig4 . the chemical processing section of this embodiment , as shown in fig4 is formed with a chemical tank 1 and a wafer conveyor and wash tank ( omitted here since is identical to fig1 b ), utilizes the non - contact fluid level sensor 6 to detect the quantity of air bubbles 4 , and also controls the concentration of hydrogen peroxide and wafer pickup speed as well as the amount of distilled water . members assigned with the same reference numerals are identical to the members in fig1 a so an explanation is omitted here . in this embodiment , the circulation filtering line having a circulating pump 13 and a filter 14 for the inner tank 1 a of chemical tank 1 , also consists of a distilled water fill pump 25 , a hydrogen peroxide pump 26 , and a sulfuric acid pump 27 , and controls the concentration of chemicals being supplied . the non - contact fluid level sensor 6 installed in the cylinder 7 determines the air bubble 4 condition ( amount of air bubbles 4 are detected by sensor 6 ), supplies a third control signal and when many air bubbles 4 are present , and along with stopping the filling of hydrogen peroxide from the hydrogen peroxide pump 26 , also drives the distilled water fill pump 25 and the hydrogen peroxide pump 26 to lower the concentration of hydrogen peroxide and decrease the air bubbles 4 in the inner tank 1 a inside the chemical tank 1 . this embodiment differs from the first embodiment in the point that the concentration of the chemical 5 is adjusted according to the amount of air bubbles 4 in the inner tank 1 a of chemical tank 1 . further , the pull - up of the wafer 2 and the washing after pull - up of the wafer 2 are processed in the same way as previously described in the wash tank 15 in fig1 b . further , the supply of chemical for refilling was explained above as being controlled with the hydrogen peroxide pump 26 however , all the pumps 25 through 27 may also be controlled so that the relative amount of hydrogen peroxide is reduced . by controlling the chemicals in this way , the adherence of particles to the wafer due to the effect of the air bubbles can be limited , and consequently uniform wafer quality achieved , and product reliability improved to an even higher level . the wet processing device of this invention as described above , detects the status of the air bubbles within the chemical tank so that a high pull - up speed or a low pull - up speed to pull up wafer from inside the chemical tank can be automatically set to render the effect that the amount of distilled water consumed inside the chemical tank is minimized and that a reduction in particles can be achieved . this invention renders the further effect that the amount of water supplied to the wash tank is controlled according to the air bubble status within the chemical tank , and the amount of distilled water consumed inside the wash tank can be reduced , to achieve lower costs . this invention renders the still further effect that by achieving control of the air bubble quantity and water supply quantity , various types of wafers can be handled , uniform wafer quality can be attained , and product reliability improved to an even higher level . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limiting sense . various modifications of the disclosed embodiments will become apparent to persons skilled in the art upon reference to the description of the invention . it is therefore contemplated that the appended claims will cover any modifications or embodiments as fall within the true scope of the invention . | 8 |
preferred embodiments of the present invention will hereinafter be described with reference to the accompanying drawings . a first embodiment of the present invention will be described with reference to fig1 a and 1b . the first embodiment is directed to a positioning apparatus constituting a positioning body portion of an exposure apparatus , an electron - beam drawing apparatus , a precise measuring instrument , or the like . on a base 1 serving as a stationary base , there are arranged a positioning mount 3 for positioning a stage apparatus 2 for supporting a substrate , such as a wafer , which is a workpiece or a measurement object , and a pair of guides 4 serving as a rolling guide interposed between the stage apparatus 2 and the positioning mount 3 in a detachably attachable manner . each guide 4 includes a plurality of rollers 41 serving as a rolling member , a plate - like retainer 42 with holes for holding the rollers 41 , a lower - side guide plate 43 in contact with ( abutting ) lower sides of the rollers 41 , and an upper - side guide plate 44 in contact with ( abutting ) upper sides of the rollers 41 . the upper - side guide plate 44 fits into a guide groove 2 a formed on a lower surface of the stage apparatus 2 in a detachably attachable manner , and the lower - side guide plate 43 fits into a guide groove 3 a formed on an upper surface of the positioning mount 3 in a detachably attachable manner . on the positioning mount 3 , are provided , in a stand - up fashion , reference members 31 to 33 for positioning the stage apparatus 2 in the x and y directions , respectively . a bottom surface of the stage apparatus 2 constitutes a reference surface that can be freely brought into contact ( abutment ) with a supporting surface ( an upper surface ) of the positioning mount 3 . the stage apparatus 2 is provided with hydrostatic bearings 5 serving as a hydrostatic bearing unit that faces the upper surface of the positioning mount 3 . in the event that the stage apparatus 2 is positioned while being in contact ( abutment ) with the reference members 31 to 33 ( as discussed later ) after each guide 4 is extracted while the stage apparatus 2 is lifted from the base 1 , the stage apparatus 2 is floated from the positioning mount 3 by the hydrostatic bearings 5 . as illustrated in fig2 , a detachably - attachable auxiliary base 6 is in contact ( abutment ) with an end surface of the base 1 , an auxiliary mount 7 is installed on the auxiliary base 6 , and an upper surface of the auxiliary mount 7 constitutes a movement surface that is an extension portion from the supporting surface of the positioning mount 3 . the lower - side guide plate 43 extends from the guide groove 3 a ( fig1 b ) of the positioning mount 3 into a guide groove 7 a ( fig1 a ) formed on the auxiliary mount 7 , and is capable of lightly moving the stage apparatus 2 installed on the auxiliary mount 7 up to the positioning mount 3 on the base 1 by means of rolling motions of the rollers 41 . in this event , the guide 4 moves by an around l / 2 while the stage apparatus 2 moves by a movement amount l . accordingly , the minimum necessary length of the guide 4 is equal to or more than a value of the length of the stage apparatus 2 plus the movement amount l / 2 . further , the height and inclination of the auxiliary mount 7 are so adjusted as to be approximately equal to those of the positioning mount 3 . the upper - side guide plate 44 moves together with the stage apparatus 2 , and the lower - side guide plate 43 extends over an almost overall length of the positioning mount 3 and the auxiliary mount 7 so as to cover a connection portion therebetween . since the lower - side guide plate 43 covers the connection portion between the positioning mount 3 and the auxiliary mount 7 , the roller 41 can pass the connection portion without any engagement , even if there is a step or an inclination at the connection portion . under a condition in which the stage apparatus 2 is moved to a place near the reference members 32 and 33 of the positioning mount 3 , as illustrated in fig3 , the stage apparatus 2 is lifted by a screw 11 serving as a lifting unit penetrating a screw block 10 of the stage apparatus 2 , and the stage apparatus 2 is settled on the positioning mount 3 by retracting the screw 11 again after both the guides 4 are extracted and the auxiliary mount 7 and the auxiliary base 6 are detached . here , the upper - side and lower - side guide plates 43 and 44 can be extracted together with the guides 4 . then , upon supply of compressed air to the hydrostatic bearings 5 through a pipe ( not shown ), the compressed air is injected toward the positioning mount 3 , and the stage apparatus 2 is caused to float from the positioning mount 3 and supported by the hydrostatic pressure in a non - contact fashion . under this condition , the stage apparatus 2 is moved in the x and y directions , and brought into contact ( abutment ) with the individual reference members 31 to 33 . thus , the positioning of the stage apparatus 2 is performed as illustrated in fig5 a and 5b . because the stage apparatus 2 is caused to float by the hydrostatic bearing 5 , no stick - slip motion occurs , and the stage apparatus 2 can be brought into contact ( abutment ) with the reference members 31 to 33 and positioned very lightly , accurately and quickly by using only a small force . in place of the screw 11 for lifting the positioning mount 3 from the stage apparatus 2 , a cylinder mechanism serving as a lifting unit can be used , as illustrated in fig4 . this cylinder mechanism includes a cylinder 20 buried in the base 1 and a piston 21 that is to be brought into contact ( abutment ) with the lower surface of the stage apparatus 2 to lift the stage apparatus 2 . fig5 a , 5 b and 6 are , respectively , a plan view , an elevation and a cross - sectional view showing a positioning - completed state in which the stage apparatus 2 is positioned with respect to the x and y directions , and brought into contact ( abutment ) with the reference members 31 to 33 . in general , a high precision measuring instrument , a semiconductor exposure apparatus , and the like , are disposed in a thermostatic chamber or a vacuum chamber . in the event that the auxiliary mount 7 is so constructed as to extend outside such a chamber , it is possible to use a conveying apparatus , such as a crane , during an operation for installing the stage apparatus 2 on the auxiliary mount 7 . the assemblage operating efficiency of a semiconductor exposure apparatus , an electron - beam drawing apparatus , and the like , can be improved , and the maintenance cost thereof can also be reduced by the use of the positioning apparatus discussed above . a second embodiment of the present invention will be described with reference to fig7 a and 7b . in the second embodiment , three spacers 34 serving as a supporting member are interposed between the above - discussed positioning mount 3 and base 1 . the three spacers 34 are arranged approximately equiangularly about a center of gravity of the stage apparatus 2 and the positioning mount 3 to support the positioning mount 3 at three points . further , each hydrostatic bearing 5 is arranged at a location of each spacer 34 in a superimposing manner . since the positioning mount 3 is thus supported at three points , the stage apparatus 2 is likewise supported substantially at three points , so that deformation of the stage apparatus 2 due to excessive constraints can be prevented . furthermore , since the hydrostatic bearing 5 is disposed at the above - mentioned support point , deformation of the positioning mount 3 due to the injection of the compressed air can be reduced to the minimum degree . the second embodiment is the same as the first embodiment concerning the guide , auxiliary mount , and so forth , and a description thereof is , therefore , omitted . a modification of the second embodiment of the present invention will be described with reference to fig8 a and 8b . in the modification , spacers 34 and butting members 35 are interposed between the above - discussed base 1 and positioning mount 3 . the height of the butting member 35 is set to be smaller than that of the spacer 34 for supporting the positioning mount 3 by a small amount . when the stage apparatus 2 is moved from the auxiliary mount 7 to the positioning mount 3 , deformation of the positioning mount 3 is likely to occur with the movement of the stage apparatus 2 . at this time , when the positioning mount 3 deforms by the amount of a difference between the spacer 34 and the butting member 35 , the bottom surface of the positioning mount 3 is brought into butting contact with the butting member 35 , and supported thereby . accordingly , the amount of deformation of the positioning mount 3 can be advantageously reduced to an amount below a predetermined amount . in the embodiments discussed above , the roller 41 can be a ball serving as a rolling member . in this case , the stage apparatus 2 can be two - dimensionally moved on a plane within an allowable range permitted by the retainer 42 , the guide grooves 2 a and 3 a , and so forth . further , the auxiliary base 6 for supporting the auxiliary mount 7 can be comprised of a self - supporting structure . the screw 11 for lifting the stage apparatus 2 can be assembled in the base 1 . the cylinder 20 can be disposed in the stage apparatus 2 . moreover , the hydrostatic bearing 5 can be constructed on the side of the supporting surface of the positioning mount 3 . as discussed in the foregoing , in the positioning apparatus , the stage apparatus is conveyed onto the movement surface of the auxiliary mount , and moved to the supporting surface of the positioning mount of a body apparatus , such as an exposure apparatus , using the rolling guide , and the stage apparatus is then lifted using the lifting unit to extract the rolling guide . after that , the stage apparatus is lowered onto the supporting surface . when the stage apparatus is positioned while being in contact ( abutment ) with the reference member , the stage apparatus is caused to float from the supporting surface by the hydrostatic bearing unit . when the stage apparatus is conveyed from the movement surface to the supporting surface , even a very heavy stage apparatus can be lightly moved because the weight of the stage apparatus is supported by the rolling guide . when the stage apparatus is positioned on the supporting surface using the reference member , the rolling guide is extracted and the stage apparatus is then supported by the hydrostatic bearing unit in a non - contact manner . accordingly , highly - precise positioning can be efficiently performed . it is thus possible to quickly and precisely position the stage apparatus for supporting a workpiece or a measurement object , and to drastically improve the assemblage efficiency of an exposure apparatus , and the like . except as otherwise discussed herein , the various components shown in outline or in block form in the figures are individually well known and their internal construction and operation are not critical either to the making or using or to a description of the best mode of the invention . while the present invention has been described with respect to what are at present considered to be the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . the present invention is intended to cover various modifications and equivalent arrangements included within the spirit and the scope of the appended claims . | 6 |
an illustrative programmable logic device 10 which can be constructed in accordance with this invention is shown in fig1 . the most detail is shown in the upper left - hand corner of fig1 . some of this detail is omitted in other portions of fig1 to avoid unduly burdening the drawing . device 10 includes a plurality of regions 20 of programmable logic disposed on the device in a two - dimensional array of intersecting rows and columns of regions . each region 20 includes a plurality of subregions 30 of programmable logic which can be constructed as described above in the background section of this specification . for example , each region 20 may include ten subregions 30 . a plurality of horizontal interconnection conductors 40 is associated with each row of regions 20 . a plurality of vertical interconnection conductors 50 is associated with each column of regions 20 . a plurality of local interconnection conductors 60 is associated with each region 20 . programmable connections 42 are provided for programmably selectively connecting the horizontal conductors 40 adjacent to each region to the local conductors 60 adjacent to that region . programmable connections 62 are provided for programmably selectively connecting the local conductors 60 adjacent to each region to input conductors 70 of that region . programmable connections 82 and 84 are provided for programmably selectively connecting output conductors 80 of each region to the horizontal and vertical conductors 40 and 50 adjacent to that region . and programmable connections 52 are provided for programmably selectively connecting intersecting horizontal and vertical conductors 40 and 50 . the structure shown in fig1 is only one example of many possible programmable logic device architectures with which this invention can be used . for example , the programmable connectivity shown in fig1 is only illustrative , and different or additional connectivity can be employed if desired . to briefly consider just some of these possibilities , more direct feedback can be provided from subregion outputs 80 to the local conductors 60 associated with the region that produces those subregion outputs . as another possibility , rather than providing separate programmable connections 52 , the functionality provided by those connections can be combined into connections 82 and 84 and the associated circuitry . an illustrative embodiment of the improved driver circuitry of this invention is shown in fig2 . the circuitry shown in fig2 is associated , at least for the most part , with one representative region 20 in fig1 . ( of course , each region 20 will typically have similar circuitry associated with it .) the output signal 80 of each subregion 30 in the associated region is applied to one input of a respective , conventional , programmable logic connector (&# 34 ; plc &# 34 ;) 110 . other inputs to each plc 110 are signals from several ( i . e ., &# 34 ; m &# 34 ;) horizontal and / or vertical conductors 40 and 50 . in the simplest embodiment , each plc 110 is programmable ( by function control elements (&# 34 ; fces &# 34 ;) that are not shown separately in fig2 ) to select one of its input signals for application to its output terminal . ( in more complex embodiments , each plc may be programmable to perform various logical operations on one or more of its inputs in order to produce an output .) the output signal of each plc 110 is applied to an associated , conventional buffer 120 . each buffer amplifies and otherwise conditions the applied signal for use in driving one or more conductors 40 and / or 50 . the output signal of each buffer 120 is applied to an associated nmos pass gate transistor 130 and also to the input terminal of an associated , conventional plc 140 . in the illustrative embodiment shown in fig2 all of the pass gates 130 associated with each region 20 are controlled in parallel by the signal on lead 170 . this signal may be dynamically controlled by the output signal of a subregion 30 in the associated region or a subregion 30 in another region adjacent to the associated region . alternatively , the signal on lead 170 may be programmed or fixed at logic 0 or logic 1 by appropriately programming fces 152 and 162 . for example , if fce 162 is programmed logic 0 , the output signal of nand gate 160 is always logic 1 . if fces 152 , 162 are both programmed logic 1 , the output signal of nand gate 160 is always logic 0 . if fce 152 is programmed logic 0 and fce 162 is programmed logic 1 , the signal on lead 170 is the inverted output of the subregion 30 shown in fig2 . thus the signal on lead 170 can be either the dynamic inverted output of the depicted subregion 30 or static logic 0 or logic 1 . the output signal of each pass gate 130 is applied to a respective one of vertical conductors 50a . each of these pass gate 130 output signals is effectively tri - statable by disabling the associated pass gate ( signal on lead 170 is logic 0 ). the vertical conductors 50 adjacent to each column of regions 20 are divided into two groups of m conductors 50a and n conductors 50b . for example , if there are ten subregions 30 in each region 20 , there may be ten conductors in each group of conductors 50a ( i . e ., m = 10 ). substantially more conductors may be included in each group of conductors 50b . for example , n may be a number like 70 . each conductor 50a receives the output of one pass gate 130 associated with each row of regions 20 . thus each conductor 50a has several pass gates 130 connected to it ( i . e ., one in each row of regions 20 ). however , only one group of pass gates 130 along conductors 50a will be enabled ( by the associated signal 170 ) at any one time . the other pass gates 130 along those conductors 50a that are not enabled ( i . e ., in other rows ) are effectively tri - stated as described above . accordingly , conductors 50a are operable as tri - state - type lines . considering now the other connectivity of the output signals of buffers 120 , each of plcs 140 is programmable by fces ( not shown separately ) to apply the associated buffer 120 output signal to one or more of n vertical conductors 50b and / or n &# 39 ; horizontal conductors 40 . ( if desired , plcs 140 may be additionally programmable to perform logic on the signal being passed .) from the foregoing it will be seen that each buffer 120 is effectively shared between two uses : ( 1 ) tri - state - type driving of conductors 50a , and ( 2 ) static connection driving of conductors 50b and / or 40 . nmos pass gates 130 , which are used in the tri - state - type operation , can be much smaller than dedicated tri - state drivers . in addition , the enable signal 170 for pass gates 130 comes from a local source such as a nearby subregion 30 , thereby avoiding extensive routing and consequent delay of the enable signal . fig3 illustrates the type of dynamic switching that can be easily implemented in a programmable logic device 10 constructed as shown in fig1 and 2 . the several regions 20 on the left in fig3 are all in one column on device 10 . the region 20 to the right is typically in another column . the desired task is to transfer the contents of the ten registers in the subregions 30 that make up any one of the regions 20 on the left to the ten registers in the subregions that make up the region on the right . this can be done by enabling the pass gates 130 associated with the desired source registers , while disabling the pass gates 130 associated with all of the other possible source registers . in this way conductors 50a are effectively used as a multiplexer for transferring the desired source data to the destination registers on the right . use of conductors 50a can be changed dynamically , so that at another time other registers on the left can be used as the source of the data transferred to the registers on the right . for example , the subregion 30 that controls a group of pass gates 130 can be programmed to act as an address decoder ( the address data being applied to the subregion via its inputs 70 ). when the subregion 30 receives the address it is programmed to recognize , it outputs a signal that enables the associated pass gates 130 , thereby allowing the signal sources ( e . g ., subregion outputs 80 ) connected to the inputs of the associated buffers 120 to make use of conductors 50a . all of the other subregions 30 that control pass gates 130 connected to those conductors 50a are programmed to recognize different addresses . thus at any one time only the pass gates 130 associated with one region 20 in a column are enabled . all of the other pass gates 130 in that column are effectively tri - stated . fig4 shows another illustrative embodiment in which control of the pass gates 130 associated with each region 20 is at least partly subdividable . half of the pass gates 130 associated with each region 20 are controlled by the signal on lead 170 &# 39 ;, and the other half of those pass gates 130 are controlled by the signal on lead 170 &# 34 ;. both of leads 170 &# 39 ; and 170 &# 34 ; can carry the ( inverted ) output signal of depicted subregion 30 . ( this assumes fce 156 programmed logic 1 and fces 166 &# 39 ; and 166 &# 34 ; programmed logic 0 .) alternatively , both of leads 170 &# 39 ; and 170 &# 34 ; can be forced to logic 1 by programming all of fces 156 , 166 &# 39 ;, and 166 &# 34 ; logic 0 . as still another possibility , either or both of fces 166 &# 39 ; and 166 &# 34 ; can be programmed logic 1 to force the associated lead or leads 170 &# 39 ;/ 170 &# 34 ; to logic 0 . if only one of fces 166 &# 39 ; and 166 &# 34 ; is programmed logic 1 , then the lead associated with the other of these fces can be dynamically controlled by the output signal of subregion 30 ( assumes fce 156 programmed logic 1 ) or can be forced to logic 1 ( by programming fce 156 logic 0 ). in respects other than those specifically mentioned above , the embodiment shown in fig4 may be similar to the embodiment shown in fig2 . the embodiment shown in fig4 allows somewhat greater flexibility in the use of tri - state - type conductors 50a . for example , if only some of conductors 50a need to be driven from the subregions 30 in an adjacent region , the pass gates 130 associated with the other subregions in that region can be gated off ( associated fce 166 &# 39 ; or 166 &# 34 ; programmed logic 1 ). those other subregions can then be used for other purposes ( e . g ., driving conductors 50b and / or 40 ). fig5 illustrates a programmable logic device 10 ( which includes driver circuitry in accordance with this invention ) in a data processing system 200 . in addition to device 10 , data processing system 200 may include one or more of the following components : a processor 204 ; memory 206 ; i / o circuitry 208 ; and peripheral devices 210 . these components are coupled together by a system bus 220 and are populated on a printed circuit board 230 which is contained in an end - user system 240 . system 200 can be used in a wide variety of applications , such as computer networking , data networking , instrumentation , video processing , digital signal processing , or any other application where the advantage of using reprogrammable logic is desirable . programmable logic device 10 can be used to perform a variety of different logic functions . for example , programmable logic device 10 can be configured as a processor or controller that works in cooperation with processor 204 . programmable logic device 10 may also be used as an arbiter for arbitrating access to a shared resource in system 200 . in yet another example , programmable logic device 10 can be configured as an interface between processor 204 and one of the other components in system 200 . it should be noted that system 200 is only exemplary , and that the true scope and spirit of the invention should be indicated by the following claims . the plcs mentioned throughout this specification ( which includes the appended claims ) can be implemented in any of a wide variety of ways . for example , each plc can be a relatively simple programmable connector such as a switch or a plurality of switches for connecting any one of several inputs to an output . alternatively , each plc can be a somewhat more complex element which is capable of performing logic ( e . g ., by logically combining several of its inputs ) as well as making a connection . in the latter case , for example , each plc can be product term logic , implementing functions such as and , nand , or , or nor . examples of components suitable for implementing plcs are eproms , eeproms , pass transistors , transmission gates , antifuses , laser fuses , metal optional links , etc . as has been mentioned , the components of plcs can be controlled by various , programmable , function control elements (&# 34 ; fces &# 34 ;), which are not always shown separately in the accompanying drawings . ( with certain plc implementations ( e . g ., fuses and metal optional links ) separate fce devices are not required , so that in those cases any depiction of fce devices in the accompanying drawings merely indicates that the plcs are programmable .) fces can also be implemented in any of several different ways . for example , fces can be srams , drams , first - in first - out (&# 34 ; fifo &# 34 ;) memories , eproms , eeproms , function control registers ( e . g ., as in wahlstrom u . s . pat . no . 3 , 473 , 160 ), ferro - electric memories , fuses , antifuses , or the like . from the various examples mentioned above it will be seen that this invention is applicable both to one - time - only programmable and reprogrammable devices . it will be understood that the foregoing is only illustrative of the principles of the invention , and that various modifications can be made by those skilled in the art without departing from the scope and spirit of the invention . for example , the principle illustrated by fig4 can be extended to even more subdivisions of tri - state - type conductors 50a . as another example of modifications within the scope of the invention , more than one pass gate 130 can be connected to the output of each buffer 120 . the outputs of such multiple pass gates can go to different conductors 50 , or some can go to horizontal conductors 40 instead of only to vertical conductors 50 . if provided , the multiple pass gates 130 associated with each buffer 120 can be partly or wholly independently controlled ( e . g ., in the manner that the pass gates in the two groups shown in fig4 can be independently controlled if desired ). the number of subregions 30 in each region 20 can be varied , as can the numbers of rows and columns of regions . the number of inputs and outputs of each subregion 30 can also be changed if desired . different types of logic can be used in the subregions or regions . for example , instead of look - up tables , sum - of - products logic could be employed . it will also be understood that terms like &# 34 ; row &# 34 ; and &# 34 ; column &# 34 ;, &# 34 ; horizontal &# 34 ; and &# 34 ; vertical &# 34 ;, &# 34 ; top &# 34 ; and &# 34 ; bottom &# 34 ;, &# 34 ; left &# 34 ; and &# 34 ; right &# 34 ;, and other similar directional or orientational characterizations are entirely arbitrary and are employed only as relative terms for convenience herein . these terms are not intended to have any absolute or fixed meaning or to limit the scope of the claims to any particular device orientations or directions . | 7 |
the present invention includes a therapy of administering a therapeutically effect amount of ex vivo cultured blood cells to patients afflicted with blood deficiencies , such as anemia , aplastic anemia and thrombocytopenic purpura . the term “ therapeutically effective amount ” is intended to include a sufficient quantity of the present activated blood cells to effect a statistically significant increase in blood cell counts when administered to a patient with blood deficiencies , i . e ., a significantly low concentration of a natural blood component , such as red blood cells , white blood cells , platelets and other factors produced by the bone marrow and cells generated from the bone marrow . the cultured blood cells may be either from the patient or from an immunologically acceptable donor . one protocol for activating blood cells via ex vivo culture includes obtaining a blood sample ( e . g ., 10 - 100 ml ) from the patient , or an immunologically acceptable donor , separating blood cells from the blood sample , and culturing the separated blood cells . an “ immunologically acceptable donor ” is a person having tissues , to include blood cells , that do not have medically unacceptable levels of recipient reactions ( e . g ., hemolytic anemia , heart failure , renal failure ). the blood cells may be separated from blood sera by protocols such as by centrifugation . the separated blood cells are then cultured under sterile conditions in a medium with one or more of a cytokine ( to include cell stimulating factors ) and an ionophore . the separated blood cells may be cultured in the media as specified above , for example , for periods between of greater than about 1 hour , in other embodiments between about 10 and 200 hours , between about 20 and 80 hours , or between about 30 and 60 hours and at a temperature , for example , between about 30 and 42 degrees c ., in other embodiments between about 32 and 40 degrees c ., or between about 37 and 38 degrees c . or any range subsumed therein . a person of ordinary skill in the art will recognize that other ranges of periods and temperatures within these explicit ranges are contemplated , and are within the present disclosure . blood deficiencies can be treated by the approaches described herein . in general , the blood deficiencies involve a reduced concentration of blood components that originate from the bone marrow or from products , such as specific cell types , from the bone marrow . blood deficiencies include , for example , anemia , aplastic anemia and thrombocytopenic purpura . anemia can be considered broadly as a deficiency of a blood component or , in some contexts , as a deficiency of red blood cells . aplastic anemia is a deficiency of peripheral blood elements . thrombocytopenic purpura , such as idiopathic thrombocytopenic purpura , involves a deficiency in platelet number . as a specific example , the discussion below describes aplastic anemia in some detail , although the treatment methods can be applicable more broadly . after being cultured , the activated blood cells may be washed ( e . g ., twice with sterile saline solution ). therapeutically effective amounts of the activated blood cells are then administered to patients . one acceptable method of administering the activated blood cells is intravenously . while the activated cells may be administered in a single dose , portions of the activated blood cells may also be administered over a period of time . for example , doses of the present activated blood cells may be administered to patients once per week for a period of four weeks . however doses of the present activated blood cells may be administered to patients at intervals of , for example , one - half week , ten days , 14 days , 21 days , other intermediate periods , or other effective periods . moreover , the intervals may vary during the course of the treatment . for example , initially blood cell doses may be administered at daily , twice a week , weekly , and / or bi - weekly intervals . the dosages can be , for example , between about 1 × 10 5 to about 2 × 10 8 cells per treatment , which may depend on the patient &# 39 ; s age and condition . the total time required for treatment ( e . g ., administering the present activated blood cells ) may depend on the amount of activated blood cells available and patient response . patient response can be measured , for example , in terms of return to normal blood cell counts and / or marrow histology as well as an overall improvement in health . obviously , blood samples can be drawn from patients repeatedly during or after the initial treatment period so that additional activated blood cells can be obtained for further treatments . furthermore , activated blood cells from an immunologically acceptable donor can be administered initially or administered for the entire duration of the treatment . alternatively , blood cells from the patient , activated by the present protocol , may be administered after blood cells from an immunologically acceptable donor are initially administered . the most current definition of severe aplastic anemia is marked pancytopenia with at least two of the following : 1 ) granulocytes less than 500 / microliter , 2 ) platelets less than 20 , 000 / microliter , 3 ) anemia with corrected reticulocyte count less than 1 %, plus markedly hypoplastic marrow depleted of hematopoietic cells . moderate aplastic anemia generally involves a hypocellular bone marrow and cytopenia in at least two cell lines not in the severe range . onset is insidious and the initial complaint may be progressive fatigue and weakness due to the anemia , followed in some cases by hemorrhage . the hemorrhage is usually from the skin and mucosal linings , due to thrombocytopenia . infection is rare despite the severe neutropenia . physical examination reveals pallor and possibly bruising or petechiae . aplastic anemia patients exhibit no lymphadenopathy or splenomegaly . fever may or may not be present . peripheral blood assays show pancytopenia . the presence of immature red and white blood cells strongly argues against aplastic anemia . red blood cells may be mildly macrocytic due to increased erythropoietic stress and they usually are normocytic and normochromic . the corrected reticulocyte count is very low or zero , indicating a lack of erythropoiesis . bleeding time may be prolonged even with normal coagulation parameters . patients have an increased serum iron and a normal transferrin , resulting in an elevated transferrin saturation . plasma iron clearance is decreased due to a reduction in erythropoiesis . bone marrow aspirate may be dry . but a biopsy can show severe hypocellular or aplastic marrow with fatty replacement . because there have been cases in which the initial marrow biopsy exhibited hypercellularity , more than one biopsy may be necessary for accurate diagnosis . a severe depression can be noted in all hematopoietic progenitor cells , including myeloid , erythroid , pluripotent cell lines , and megakaryocytes . diagnosis generally is based on finding the classic triad of anemia , neutropenia , and thrombocytopenia in both blood and bone marrow specimens . x - rays may be needed to rule out bone lesions or neoplastic infiltrates . magnetic resonance imaging has been useful in clearly defining hypoplastic marrow . since the diagnosis is one of exclusion , all other causes of pancytopenia and other lab findings are usually ruled out before aplastic anemia can be diagnosed . the basic defect in aplastic anemia is failure of production of all cell lines . possible mechanisms of the pathogenesis of aplastic anemia include 1 ) defective or absent hematopoietic stem cells , 2 ) abnormal bone marrow microenvironment , 3 ) abnormal regulatory cells , and 4 ) suppression of hematopoiesis by immunologic cells . while the pathophysiology of the disease is not yet completely clear , ( young et al ., the pathophysiology of acquired aplastic anemia , n . engl . j . med . 1997 ; 336 ( 19 ): 1365 - 1372 and young et al ., the treatment of severe acquired aplastic anemia , blood . 1995 ; 85 ( 12 ): 3367 - 3377 ) there is evidence to support the theory that aplastic anemia is an immune - mediated disease . bone marrow transplantation and immunosuppressive therapy using combined antilymphocyte globulin and cyclosporine have been used for treatment ( rosenfeld et al ., intensive immunosuppression with antithymocyte globulin and cyclosporine as treatment for severe aplastic anemia , blood 1995 ; 85 ( 11 ): 3058 - 3065 and halperin et al ., severe acquired aplastic anemia in children : 11 - year experience with bone marrow transplantation and immunosuppressive therapy , am . j . pediatr . hematol . oncol . 1989 ; 11 ( 3 ): 304 - 309 ). however , the therapy of immune suppression often has undesirable and severe side effects . moreover , hematopoietic growth factors such as granulocyte colony - stimulating factor ( kojima et al ., treatment of aplastic anemia in children with recombinant human granulocyte - colony stimulating factor , blood 1991 ; 77 ( 5 ): 937 - 941 and sonoda et al ., multilineage response in aplastic anemia patients following long - term administration of filgrastim ( recombinant human granulocyte colony stimulating factor ), stem cells 1993 ; 11 : 543 - 554 ), granulocyte macrophage colony - stimulating factor ( champlin et al ., treatment of refactory aplastic anemia with recombinant human granulocyte - macrophage - colony - stimulating factor , blood 1989 ; 73 ( 3 ): 694 - 699 and guinan et al ., a phase i / ii trial of recombinant granulocyte - macrophage colony - stimulating factor for children with aplastic anemia , blood 1990 ; 76 ( 6 ): 1077 - 1082 ), and interleukin - 3 ( ganser et al ., effect of recombinant human interleukin - 3 in patients with normal hematopoiesis and in patients with bone marrow failure , blood 1990 ; 76 ( 4 ): 666 - 676 and nimer et al ., a phase i / ii study of interluekin - 3 in patients with aplastic anemia and myelodysplasia , exp . hematol . 1994 ; 22 : 875 - 880 ) have provided only limited and transient effects . many patients respond to immunosuppressive therapy and there are abnormal levels of various immune molecules in aplastic patients . for instance , interleukin - 1 , produced by macrophages , natural killer cells , b lymphocytes , and endothelial cells , plays a central role in both immune responses and regulation of hematopoiesis by inducing the release of erythroid and multipotent colony - stimulating factors from marrow stromal cells , regulating early progenitor cells and stimulating stem cell recovery following induced myelosuppression . immune dysregulation in aplastic anemia consists of decreased natural killer cell activity , increased numbers of activated t suppressor cells and abnormal production of interleukin - 2 and gamma - interferon . natural killer cells are large granular lymphocytes which lyse tumor cells or virus - infected target cells upon direct contact . natural killer cells also produce gamma - interferon , interleukin - 2 , and induces colony - stimulating activity . these cells may inhibit myeloid and erythroid colony formation under certain conditions . for instance , when exogenous growth factors are absent from a culture , natural killer cells normally produce cytokines and support hematopoiesis . however , optimal conditions induce natural killer cells to inhibit hematopoiesis . natural killer cell activity in aplastic anemia patients returns to normal after hematopoietic recovery . gamma - interferon is produced by activated lymphocytes and suppresses hematopoiesis . although aplastic patients show an overproduction of gamma - interferon , levels of gamma - interferon decrease in response to immunosuppression . interferons are potent inhibitors of hematopoietic colony formation — both through direct action on progenitor cells and indirect effects via accessory immune system cells . tumor necrosis factor - alpha is another cytokine which is in excess in aplastic anemia . it functions to inhibit colony growth of the normal hematologic progenitors . high tumor necrosis factor - alpha values correlate with decreased platelet , hemoglobin , and leukocyte counts . tumor necrosis factor - alpha and gamma - interferon may act synergistically to suppressor hematopoiesis . aplastic anemia patients produce gamma - interferon and tumor necrosis factor - alpha in excess , show an inverted helper : suppressor t cell ratio , and have predominantly t suppressor cells in the bone marrow . these cells may mediate suppression of hematopoiesis via cytokine production . the bone marrow also has a higher proportion of cytotoxic t cells than peripheral blood . the clinical relevance of immune dysfunction is suggested by a decrease in activated lymphocytes following successful immunosuppressive therapy . mechanisms for acquired aplastic anemia in general , and mechanisms for benzene - induced aplastic anemia in particular , are not well understood . nonetheless , both types of aplastic anemia share considerable similarities with respect to pathophysiology and clinical manifestations . there are presently two hypotheses to explain the mechanism of aplastic anemia , direct damage and immune - mediated . both hypotheses are supported by data from experimental and clinical studies . direct damage to bone marrow cells is thought to be responsible for temporary and reversible bone marrow failure following cytotoxic chemotherapy and radiotherapy . immune - mediated bone marrow failure is more difficult to cure . in the case of benzene - induced aplastic anemia , the disease seems to be associated with both mechanisms . evidence of direct damage to bone marrow cells is supported by the studies indicating that benzene is involved in inhibiting a number of biochemical processes of bone marrow cells . specifically , benzene has been shown to damage stromal macrophages in bone marrow , thereby leading to deficient interleukin - 1 production ( niculescu et al ., inhibition of the conversion of pre - interleukins - 1 [ alpha ] and 1 [ beta ] to mature cytokines by p - benzoquinone , a metabolite of benzene , chemico - biological interactions ; 1995 ; 98 : 211 - 222 and kalf et al ., p - benzoquinone , a reactive metabolite of benzene , prevents the processing of pre - interleukins - 1 [ alpha ] and - 1 [ beta ] to active cytokines by inhibition of the processing enzymes , calpain , and interluekin - 1 [ beta ] converting enzyme , environmental health perspectives ; 1996 ; 104 ( suppl . 6 ): 1251 - 1256 ). interleukin - 1 is considered important for growth and differentiation of stem cells ( bagby , g . c ., production of multi lineage growth factors by hematopoietic stromal cells : an intercellular regulatory network involving mononuclear phagocytes and interleukin - 1 , blood cells 1987 ; 13 : 147 - 159 and fibbe et al ., human fibroblasts produce granulocyte - csf , macrophage - csf and granulocyte - macrophage - csf following stimulation by interleukin - 1 and poly ( rl ). poly ( rc ), blood 1988 ; 72 ( 3 ): 860 - 866 ). however , there has been no report of prolonged response to treatments of hematopoietic growth factors , including interleukin - 1 . suitable media used in ex vivo activation provide essential nutrients for blood cells . these media generally comprise , for example , inorganic salts , amino acids , vitamins , and other compounds all in forms which can be directly utilized by blood cells . by way of illustration and not limitation , one suitable medium is rpmi 1640 . however , other media , such as serum - free media aim - v , will support blood cells in culture may be suitable as well . the medium may be supplemented with a mammalian serum , e . g ., fetal bovine serum at levels between about 0 . 1 and 50 %, between about 1 and 40 %, or between about 5 % and 15 %, of the medium , by weight . one suitable formulation of rpmi , designated as a modified rpmi 1640 and available under catalog number 30 - 2001 from american type culture collection , has the following ingredients : 1 . cytokines . one or more cytokines may be used to activate blood cells when cultured in the presence thereof . cytokines are small proteins ( usually in the range of 5 - 20 kd ) that are released by cells and have specific effects on cell - cell interaction , communication , and behavior of other cells . usually included as cytokines , are interleukins , lymphokines and signaling molecules such as tumor necrosis factor ( tnf ) and interferons . while natural cytokines can be used , recombinant produced cytokines produced , for example , by established nucleic acid expression systems are also contemplated . as such , modified and mutated forms of natural cytokines that maintain function can also be used . exemplary cytokines , which may be suitable for some embodiments of the present invention , include : a . interleukins . a variety of naturally occurring polypeptides that affect functions of specific cell types and are found in small quantities . they are secreted regulatory proteins produced by lymphocytes , monocytes and various other cells and are released by cells in response to antigenic and non - antigenic stimuli . the interleukins , of which there are 16 identified to date , modulate inflammation and immunity by regulating growth , mobility and differentiation of lymphoid and other cells . interleukins may be present in concentrations between about 10 and 50 , 000 iu / ml , about 100 - 5 , 000 iu / ml , or about 100 - 1 , 000 iu / ml . alternatively an effective concentration of interleukins may be present . an effective concentration of interleukins is any concentration at which blood cells are actived by the present protocol . i . interleukin - 1 ( il - 1 ). il - 1 is a soluble protein ( 17 kd : 152 amino acids ) secreted by monocytes , macrophages or accessory cells involved in the activation of both t lymphocytes and b lymphocytes and potentiates their response to antigens or mitogens . biological effects of il - 1 include the ability to replace macrophage requirements for t - cell activation , as well as affecting a wide range of other cell types . at least two il - 1 genes are known and alpha and beta forms of il - 1 are recognized . il - 1 is released early in an immune system response by monocytes and macrophages . it stimulates t - cell proliferation and protein synthesis . another effect of il - 1 is to cause fever . ii . interleukin - 2 ( il - 2 ). il - 2 is a hormone - like substance released by stimulated t lymphocytes . il - 2 causes activation and differentiation of other t lymphocytes independently of antigen . il - 2 stimulates the growth of certain disease - fighting blood cells in the immune system and is secreted by th1 cd4 cells to stimulate cd8 cytotoxic t lymphocytes . il - 2 also increases the proliferation and maturation of cd4 cells themselves . iii . interleukin - 3 ( il - 3 ). il - 3 is a product of mitogen activated t - cells . il - 3 is a colony stimulating factor for bone marrow stem cells and mast cells . il - 3 is considered one of the hematopoietic colony stimulating factors . iv . interleukin - 4 ( il - 4 ). il - 4 is a soluble cytokine factor produced by activated t lymphocytes that promotes antibody production by causing proliferation and differentiation of b - cells . il - 4 induces the expression of class ii major histocompatibility complex and fc receptors on b - cells . il - 4 also acts on t lymphocytes , mast cell lines , and several other hematopoietic lineage cells including granulocyte , megakaryocyte , and erythroid precursors , as well as macrophages . v . interleukin - 5 ( il - 5 ). il - 5 is a factor promoting eosinophil differentiation and activation in hematopoiesis . it also triggers activated b - cells for a terminal differentiation into ig - secreting cells . vi . interleukin - 6 ( il - 6 ). il - 6 stimulates the growth and differentiation of human b - cells and is also a growth factor for hybridomas and plasmacytomas . it is produced by many different cells including t - cells , monocytes , and fibroblasts . il - 6 is a single chain 25 kd cytokine originally described as a pre b - cell growth factor , now known to have effects on a number of other cells including t - cells which are also stimulated to proliferate . vii . interleukin - 7 ( il - 7 ). il - 7 is a hematopoietic growth factor that promotes growth of b - cell precursors and is also co - mitogenic with interleukin - 2 for mature t - cell activation . il - 7 is produced by bone marrow stromal cells . viii . interleukin - 8 ( il - 8 ). il - 8 is a cytokine that activates neutrophils and attracts neutrophils and t lymphocytes . il - 8 is released by several cell types including monocytes , macrophages , t lymphocytes , fibroblasts , endothelial cells , and keratinocytes by an inflammatory stimulus . il - 8 is a member of the beta - thromboglobulin superfamily and structurally related to platelet factor 4 . ix . interleukin - 9 ( il - 9 ). il - 9 is a cytokine produced by t - cells , particularly when mitogen stimulated . il - 9 stimulates the proliferation of erythroid precursor cells ( bfue ) and is thought to be a regulator of hematopoiesis . il - 9 may act synergistically with erythropoietin . the il - 9 receptor belongs to the hemopoietic receptor super family . il - 9 has been shown to enhance the growth of human mast cells and megakaryoblastic leukaemic cells as well as murine helper t - cell clones . i1 - 9 is a glycoprotein that is derived from t - cells and maps to human chromosome 5 . x . interleukin - 10 ( il - 10 ). il - 10 is a factor produced by th2 helper t - cells , some b - cells and lps activated monocytes . it is a coregulator of mast cell growth . xi . interleukin - 11 ( il - 11 ). il - 11 is a pleiotropic cytokine , originally isolated from primate bone marrow stromal cell line , that has the ability to modulate antigen - specific antibody responses , potentiate megakaryocytes , and regulate bone marrow adipogenesis . il - 11 stimulates t - cell dependent b - cell maturation , megakaryopoiesis , and various stages of myeloid differentiation . xii . interleukin - 12 ( il - 12 ). il - 12 is a 75 kd heterodimeric cytokine composed of disulfide - bonded 40 kd and 35 kd subunits that was originally identified by its ability to induce cytotoxic effector cells in synergy with less than optimal concentrations of interleukin - 2 . il - 12 is released by macrophages in response to infection and promotes the activation of cell - mediated immunity . specifically , il - 12 triggers the maturation of th1 cd4 cells , specific cytotoxic t lymphocyte responses , and an increase in the activity of nk cells . consequently , il - 12 is the initiator of cell - mediated immunity . it enhances the lytic activity of nk cells , induces interferon production , stimulates the proliferation of activated t - cells and nk cells . is secreted by human b lymphoblastoid cells ( nc 37 ). xiii . interleukin - 13 ( il - 13 ). il - 13 is a t lymphocyte - derived cytokine that produces proliferation , immunoglobulin isotype switching , and immunoglobulin production by immature b - lymphocytes . il - 13 is produced by activated t - cells , inhibits il - 6 production by monocytes , and also inhibits the production of other pro - inflammatory cytokines such as tnf , il - 1 , and il - 8 . il - 13 stimulates b - cells . the gene for il - 13 is located on human chromosome 5q in a gene cluster that also has the il - 4 gene . xiv . interleukin - 14 ( il - 14 ). il - 14 is a cytokine that induces b - cell proliferation , inhibits immunoglobulin secretion , and selectively expands certain b - cell subpopulations . xv . interleukin - 15 ( il - 15 ). il - 15 is a cytokine that stimulates the proliferation of t lymphocytes and shares biological activities with il - 2 . i1 - 15 also can induce b lymphocyte proliferation and differentiation . xvi . interleukin - 16 ( il - 16 ). il - 16 is a cytokine produced by activated t lymphocytes that stimulates the migration of cd4 - positive lymphocytes and monocytes . b . lymphokines . a lymphokine is a substance produced by a leucocyte that acts upon another cell . examples are interleukins , interferon alpha , lymphotoxin ( tumor necrosis factor alpha ), granulocyte monocyte colony stimulating factor ( gm - csf ). i . interferons ( ifn ) are a family of glycoproteins human cells which normally have a role in fighting viral infections by preventing virus multiplication in cells . interferons may be present in the same concentrations as interluekins . alternatively , effective concentrations of interferons may be present . effective concentrations of interferons are contemplated to include any concentration at which blood cells are activated by the present protocol . ifn alpha is secreted by leucocytes and ifn gamma is secreted by fibroblasts after viral infection . 1 . interferon gamma is an interferon elaborated by t lymphocytes in response to either specific antigen or mitogenic stimulation . 2 . interferon alpha includes a number of different subtypes that are elaborated by leukocytes in response to viral infection or stimulation with double - stranded rna . ifn - alpha - 2a and - 2b are protein products made by recombinant dna techniques and are used as antineoplastic agents . interferon - alpha is one of the type i interferons ( interferon type i ) produced by peripheral blood leukocytes or lymphoblastoid cells when exposed to live or inactivated virus , double - stranded rna , or bacterial products . it is the major interferon produced by virus - induced leukocyte cultures and , in addition to its pronounced antiviral activity , causes activation of natural killer cells . 3 . interferon alfa - 2a is a type i interferon consisting of 165 amino acid residues with lysine in position 23 . this protein is produced by recombinant dna technology and resembles interferon secreted by leukocytes . it is used extensively as an antiviral or antineoplastic agent . 4 . interferon alfa - 2b is type i interferon consisting of 165 amino acid residues with arginine in position 23 . this protein is produced by recombinant dna technology and resembles interferon secreted by leukocytes . it is used extensively as an antiviral or antineoplastic agent . 5 . interferon beta is an interferon elaborated by fibroblasts in response to the same stimuli as interferon alpha . interferon - beta is one of the type i interferons produced by fibroblasts in response to stimulation by live or inactivated virus or by double - stranded rna . it is a cytokine with antiviral , antiproliferative , and immunomodulating activity . 6 . interferon - b2 ( interleukin - 6 ) is a cytokine that stimulates the growth and differentiation of human b - cells and is also a growth factor for hybridomas and plasmacytomas . it is produced by many different cells including t - cells , monocytes , and fibroblasts . inf - b2 is a single chain 25 kd cytokine originally described as a pre b - cell growth factor , now known to have effects on a number of other cells including t - cells , which are also stimulated to proliferate . inf - b2 is an inducer of acute phase proteins and a colony stimulating factor acting on mouse bone marrow . 7 . interferon gamma is elaborated by t lymphocytes in response to either specific antigen or mitogenic stimulation . ii . tumor necrosis factor ( tnf ) is a tumor - inhibiting factor present in the blood of animals exposed to bacterial lipopolysaccharide . tnf preferentially kills tumor cells in vivo and in vitro , causes necrosis of certain transplanted tumors in mice , and inhibits experimental metastases . human tnf alpha is a protein of 157 amino acids and has a wide range of pro - inflammatory actions . tnf may be present in the same concentrations as interleukins . alternatively , tnf may be present in an effective concentration . an effective concentration of tnf is an concentration at which blood cells are activated by the present protocol . c . cell stimulating factors . activating blood cells in the presence of one or more cell stimulation factors may be efficacious in alleviating aplastic anemia in the context of the present invention . cell stimulating factors are contemplated to include such substances as granulocyte colony - stimulating factor granulocyte macrophage - colony stimulating factor and macrophage - colony stimulating factor . cell stimulating factors may be present in concentrations between about 10 and 50 , 000 iu / ml , between about 10 and 10 , 000 iu / ml , or between about 10 and 1000 iu / ml . alternatively , an effective concentration of cell stimulating factors may be present . an effective concentration of cell stimulating factors is any concentration at which blood cells are activated by the present protocol . 1 . granulocate colony - stimulating factor ( g - csf ): g - csf are glycoproteins synthesized by a variety of cells and are involved in growth and differentiation of hematopoietic stem cells . in addition , these factors stimulate the end - cell functional activity of stem cells . 2 . granulocyte - macrophage colony - stimulating factor ( gm - csf ): gm - csf is an acidic glycoprotein of 23 kd with internal disulfide bonds . gm - csf is produced in response to a number of inflammatory mediators by mesenchymal cells present in the hemopoietic environment and at peripheral sites of inflammation . gm - csf stimulates the production of neutrophilic granulocytes , macrophages , and mixed granulocyte - macrophage colonies from bone marrow cells and can stimulate the formation of eosinophil colonies from fetal liver progenitor cells . 3 . macrolphage - colony stimulating factor ( m - csf ): m - csf is a cytokine synthesized by mesenchymal cells that stimulates pluripotent stem cells of bone marrow into differentiating towards the production of monocytes ( mononuclear phagocytes ). the compound stimulates the survival , proliferation , and differentiation of hematopoietic cells of the monocyte - macrophage series . it is a disulfide - bonded glycoprotein dimer with a mw of 70 kd and binds to a single class of high affinity receptor which is identical to the product of the c - fins proto - oncogene . 2 . ionophores . ionophores are calcium or other cation specific reagents ( such as polypeptrates ) which can traverse a lipid bilayer and a lipid soluble . there are two classes of ionophores : carriers and channel formers . carriers , like valinomycin , form cage - like structures around specific ions , diffusing freely through the hydrophobic regions of the bilayer . channel formers , like gramicidin , form continuous aqueous pores through the bilayer , allowing ions to defuse therethrough . in addition to the foregoing , suitable ionophores for the present protocol may include a23187 ( calcimycin ), ionomycin , geldanamycin , monensin ( na - salt ), nystatin , polymyxin - b sulfate , and rapamycin . it is believed that carriers , such as a23187 , accumulate calcium cations in response to ph gradients . a23187 possesses a dissociating carboxylic acid group and catalyzes an electrically neutral exchange of protons for other cations across the membrane ( hyono et al ., bba 389 , 34 - 46 ( 1985 ): kolber and haynes , biophysics journal , 36 , 369 - 391 ( 1981 ); hunt and jones , biosci . rep ., 2 , 921 - 928 ( 1982 )). two molecules of a23187 are present as carboxylate anions , and are thus available to carry to protons , or equivalents , back across the membrane after releasing the transported divalent cation . if present , ionophores may be present in concentrations between about 1 and 10 , 000 ng / ml , between about 1 and 1000 ng / ml , or between about 10 and 500 ng / ml . alternately , ionophores may be present in an effective concentration . an effective concentration of ionophores is any concentration at which blood cells are activated , but not overactivated , by the present protocol . excessive concentrations of activating agents may not be effective in the treatment approaches described herein . the delivery of activated cells can provide a statistically significant improvement in clinical parameters of a patient . for example , the administration of cell activated as described herein can result in a statistically significant increase in white blood cell counts , red blood cell counts hemoglobin levels and platelet counts . in general , continuation of the treatment procedure as described herein can result in a return to normal blood levels . in some embodiments , after four treatments , the patient can have an increase in each of white blood cell counts , red blood cell counts and hemoglobin of at least about 20 %, in other embodiments at least about 35 % and in other embodiments at least about 50 %. similarly , in some embodiments , platelet counts can increase by at least about 25 %, in other embodiments at least about 50 %, and in further embodiments at least about 100 %. a person of ordinary skill in the art will recognize that additional ranges of blood parameter improvement within the explicit ranges presented are contemplated and are within the present disclosure . the activation compounds , such as one or more cytokines and / or one or more ionophore , can be mixed with an appropriate cell culture medium or a portion thereof for distribution . in alternative embodiments , one or more activation compounds can be packaged along with a cell culture medium or portions thereof for shipping . similarly , a desired combination of activation compounds , such as one or more cytokines and one or more ionophores , can be packaged together for shipping , either mixed or in separate compartments . in any of these embodiments , the medium and / or activation compounds can be combined with any remaining medium components and / or activation compounds to form the desired medium for culturing cells under conditions to activate the cells . also , in any of these embodiments , the compositions that are packaged together can include , for example , instructions for completing the cell culture medium with activation properties and / or instructions for performing the cell culturing . the cell culturing can be performed at the facility that is treating the patient or the cell culturing to activate the cells can be performed at a remote location . in either case , the activated cells can be administered after a short period of time after harvesting from the cell culture to ensure that the cells remain viable . alternatively , the cells can be stored under conditions that maintain the cells in a viable condition . for example , the cells can be stored at liquid nitrogen temperatures with a cryoprotectant . the cells can be prepared , for example using known procedures , at appropriate times for administration to the patient . for example , the cells can be suspended in a buffered saline solution for administration to the patient . other known carriers , for example , can be used for delivery of the cells . eight patients with verified histories of from one to six years of occupational exposure to benzene were subjected to the present regimen after their consents were obtained . the makeup of the patients was one male and seven females and the ages of the patients ranged from 24 to 41 . all patients experienced symptoms of weakness , dizziness , fainting , and accelerated heart rates . among these patients , four were hospitalized due to acute symptoms with bleeding . the hospitalized patients required blood or platelet transfusions . the other four patients experienced chronic symptoms and were treated with standard therapies for four , six and 15 months , respectively . bone marrow biopsies and aspiration samples were obtained from all patients to confirm hematopoiesis . toxic levels of benzene were present in the blood and bone marrow of all patients . peripheral blood mononuclear cells ( pbmcs ) were separated from patient blood samples ( 40 - 50 ml ) by ficoll - hypaque centrifugation . the separated pbmcs were then placed in an appropriate volume ( based on cell concentration ) of rpmi 1640 with 10 % fetal bovine serum under sterile conditions and cultured at 2 × 10 6 cells / ml for 48 hours in the presence of interleukin - 2 ( il - 2 ) at 500 iu / ml ( chiron , emeryville , calif . ), granulocyte macrophage - colony - stimulating factor ( gm - csf ) at 200 iu / ml ( immunex , seattle , wash . ), and calcium ionophore a23187 at 100 ng / ml ( sigma , st . louis , mo .). at the end of the culture period , adherent cells were scraped off the plastic surfaces of the culture vessels and harvested together with non - adherent cells . to harvest the cells , the cells were spun down to form a cell pellet . different numbers of cells were obtained for different patients . the harvested cells were washed twice in saline solution and administered to the patients . after washing , the cells were resuspended in 5 to 10 mls of saline , with the volume determined by the number of cells . these suspensions were further diluted with 50 ml of saline before administering the cells to the patients . activated allogeneic pbmcs were used for a single patient ( hc ) in the first three treatments because the patient had experienced low blood counts , severe bleeding and infection . for the other patients , activated pbmcs were intravenously administered with 50 ml saline to the patients . the treatment was repeated every week for at least four weeks . the number of cells administered to a particular patient depended on the number of cells obtained from the patient . hematological parameters , white blood cell counts , red blood cell counts , hemoglobin levels , and platelet counts , were monitored before and after the treatment for each patient and are shown in table 1 . data from these patients indicated that the therapy was effective in enhancing the peripheral blood cell counts . six patients experienced improvement of more than one subset listed and two patients had better platelet counts . the blood cell counts began to improve in most patients after two treatments and continued to improve throughout the time the present activated cells were administered . seven of the eight patients improved to the extent that some of their hemological parameters reach normal levels or levels approaching normal after completion of four treatments . although blood cell counts of the patients improved from the therapy in general , improvements were not uniformly achieved . some patients experienced limited improvement in red blood cell counts , but dramatic improvement in platelet counts . it was noted that all patients &# 39 ; platelet counts were significantly increased . patient hc experienced more severe acute symptoms than the other patients . additionally , patient hc had a bleeding problem as well . because of the low yields of peripheral blood cells from patient hc , allogeneic pbmcs were used to stimulate patient hc &# 39 ; s hematopoiesis . after three treatments using allogeneic cells , patient hc &# 39 ; s blood counts began to improve . after the three treatments of allogeneic cells , autologous pbmcs were then used to continue the therapy . although patient hc &# 39 ; s hemotological parameters were not corrected to normal levels after six treatments , patient hc continued to improve . discomfort due administering the present immunotherapy was mild to moderate . five patients experienced no appreciable discomfort . three patients experienced chilling , fevers between 37 and 39 degrees c ., headaches , nausea , vomiting , and loss of appetite after cell infusion . however , these symptoms were transient , typically lasting one to two days . aspirin was administered when patients experienced discomfort . bone marrow biopsies and aspiration samples were obtained from all patients before the therapy began and two weeks after the final treatment . as shown in fig1 , the histology of the bone marrow samples from three patients with the most severe samples indicated severe damage before the therapy was begun . after the therapy was administered , remarkable improvements in bone marrow histology were found . with respect to patient hc , however , the improvement observed in patient hc &# 39 ; s bone marrow was not coupled with improved peripheral blood counts . before beginning treatment , four of the eight patients experienced severe symptoms , coupled with bleeding . these four patients required periodic transfusions of whole blood or platelets before and during the therapy . after four treatments , however , none of the patients experienced bleeding and whole blood and platelet transfusions were not continued . the beneficial effects of the present cell - based therapy do not appear to be transient . all patients continued to have improved or stable hematological parameters after the therapy was discontinued . some female patients experienced unstable blood counts during menstrual periods , but no patients experienced a relapse . patient lc , who responded to the therapy , has experienced stable symptoms for more than two months since the final treatment ( fig2 ). the results of this study suggest that administering activated pbmcs to patients with aplastic anemia is highly effective . some patients had close to normal bone marrow histologically , but had peripheral hematological parameters which were not as close to normal . to this end , it seemed that a time gap occurred between histological recovery of bone marrow and recovery of peripheral blood cell counts . patients experiencing this gap were closely monitored and the patients &# 39 ; hematological parameters showed continued improvement . these patients sometimes took a few weeks or months to attain normal peripheral blood cell counts . in analyzing the data generated by the study , it was noted that , among different compartments of the blood , increase in platelets was most evident , significant and rapid in patients benefiting from therapy . the initial increase in platelet counts was possibly due to the fact that platelets have a faster generation and differentiation interval . other cell types of blood such as neutrophils , granulocytes and reticulocytes were also improved in agreement with the four parameters listed ( data not shown ). platelet counts are likely more susceptible to benzene toxicity than other blood cells , but are the most responsive to the present therapy due to their faster generation interval . acquired aplastic anemia is a difficult disease to cure . however , the present immunosuppression therapy was very effective in treating this disease , for which bone marrow transplants are the only known cure heretofore . however , in spite of the success of bone marrow transplants , this therapy has serious complications , e . g ., tumors , ( socie et al ., malignant tumors occurring after treatment of aplastic anemia , n . eng . j . med . 1993 ; 329 ( 16 ): 1152 - 1157 ) and graft - versus - host disease ( ferrara et al ., graft - versus - host disease , n . engl . j . med . 1991 ( 324 ); 324 : 667 - 674 ). moreover , many patients cannot obtain bone marrow transplants due to the expense of the procedure and / or the lack of compatible donors . to this end , a simple and effective therapy with fewer side effects is needed to treat aplastic anemia . the results of this study indicate that aplastic anemia can be effectively treated with minimal side effects . the present cell - based immunotherapy is believed to be applicable to other types of anemia and bone marrow disorders as well . these disorders include those experienced by hiv ( human immunodeficiency virus )- infected patients after cocktail chemotherapy and cancer patients with bone marrow failure after chemotherapy and radiotherapy , inherited aplastic anemia , and idiopathic thrombocytopenic purpura . while not wishing to be bound by a specific theoretical basis for the operation of this invention , it is presently believed that several phenomena may be responsible for the favorable responses of patients to the present immunotherapy . a first theory is that the activated cells secrete multiple ( perhaps partially unknown ) effective factors simultaneously . these multiple factors , when working in concert , may have a synergistic combined effect . a second factor hypothesized for the effectiveness of the present therapy is that some presently unknown key factors for hematopoiesis are produced by activated immune cells . these unknown factors may be responsible , at least in part , for the effectiveness of the present therapy . a third factor which might be involved is that immune cells are capable of traveling to bone marrow and of delivering cytokines to hematopoietic stem cells and to other precursor cells at close range . moreover , the present activated immune cells may be able to remain in close proximity to the marrow for periods sufficient to effect microenvironment improvement in the bone marrow . a fourth factor which might be responsible for the effectiveness of the present therapy is that cell contact between immune cells and hematopoietic cells may be essential for hematopoietic cell growth and differentiation . a fifth factor might be that activated immune cells , even in small amounts , may contribute to prevent the immune system from adversely influencing hematopoiesis . quantities of pcmbs from 10 - 100 ml of blood are relatively small . however , these small quantities exerted large effects on bone marrow histology and hematopoiesis . the results of administering blood cells activated by the present protocol are unexpected in view of results from previous studies . with the exception of one study , young et al . ( note 2 ) found administered growth factors ( granulocyte - colony stimulating factor and granulocyte macrophage - colony stimulating factor ) to affect neutrophil numbers only . the one study showed marked increases of neutrophil and platelet counts when granulocyte - colony stimulating factor was administered . interleukin - 3 , administered alone or in combination with granulocyte macrophage stimulating factor had even less effect on myelopoiesis than the growth factors administered alone . similarly ( liu et al ., cellular interactions in hemopoiesis , blood cells 1987 ; 13 : 101 - 110 and ettinghausen et al ., hematologic effects if immunotherapy with lymphokine - activated killer cells and recombinant interleukin - 2 in cancer patients , blood 1987 ; 69 ( 6 ): 1654 - 1660 ), found that administering activated peripheral blood mononuclear cells and interleukin - 2 to patients “ emphasized ” anemia and oesinophilia in patients receiving this therapy . the present invention is also contemplated to include items of manufacture , which include separately packaged containers of one or more cytokine ( s ) and ionophore ( s ) as more fully described above . the container contents may be used to culture , and thereby activate , blood cells for use in the present therapeutic protocol . instructions , such as on a label , may be present in the item of manufacture . a medium suitable for culturing blood cells may further be included . this example described the treatment of a 1 year five month old female patient with idiopathic thrombocytopenic purpura . the patient was diagnosed with the disease at about 9 months . the patient was first treated with conventional therapy of corticosteroids and intravenous infusions of immunoglobulin . although the patient responded to the conventional treatment , the patient became completely dependent on the corticosteroid therapy . the maintain sufficient platelet levels , the patient had to receive increasingly higher doses of corticosteroids . then , the patient was treated with an activated cell based therapy as described herein . the treatment was the same as described in example 1 except that only 20 mls of blood was drawn from the patient each time , rather than 40 - 50 mls . the patient was treated once a week for 9 weeks . ex vivo activated cells were administered on day 1 , day 8 , day 15 , day 22 , day 29 , day 35 , day 42 , day 49 and day 56 . at the same time that immunotherapy with activated cells was initiated , corticosteroids and any other aspect of conventional therapy were completely withdrawn . the patient &# 39 ; s platelet levels gradually improved during the treatment with activated cells as shown in fig2 . the patient had a lung infection at day 49 that correlated with a significant decrease in platelet number . after the patient recovered from the infection , the patient &# 39 ; s platelet numbers went back to normal levels . all publications , patents , patent applications , and other documents cited herein are hereby incorporated by reference in their entirety . in the case of conflict , the present specification shall prevail . because numerous modifications of this invention may be made without departing from the spirit thereof , the scope of the invention is not to be limited to the embodiments illustrated and described . rather , the scope of the invention is to be determined by the appended claims and their equivalents . | 2 |
fig1 depicts a conceptual diagram with an exemplary embodiment of the present invention . the arrangement of fig1 includes a computer system 100 that comprises at least an application server 107 and database server 108 . not shown in fig1 are optional local client pcs or terminals which may connect with the application server to execute one or more applications . it is noted that the arrangement in fig1 also does not show a variety of other computers and terminals that may be connected to the database server 108 . the arrangement of fig1 is exemplary only , and is not intended to limit the nearly infinite variety of computer networks that may be configured to implement the same functionality . each of the database server and application server may be distributed among plural computers . moreover , the application and database server may be implemented on the same or different computers . in operation , an exemplary application represented by block 110 executes on the application server 107 . when the application requires a particular parameter , the application first checks cache memory 103 if the parameter is found in cache memory 103 , and if the cache is deemed current enough to be useful , the application 110 simply utilizes the parameter from cache . whether or not a parameter in cache is deemed current enough may vary by parameter . specifically , the system designed and typically knows in advance approximately how often the cache memory should be updated with a new value . the value that is to replace the cache value comes from another source , for example , database 102 . thus , if the desired parameter is either not found in cache memory 103 , or the application determines that , although the parameter is found in cache memory 103 , it has timed out , the next step described below is executed . if either the parameter has timed out in cache , or if it is not present at all in cache , then an additional source such as database 102 ( or other file ) is checked for a current version of the necessary parameter . database 102 is preferably , but not necessarily , a database and is also preferably implemented on a separate database server as shown in fig1 . by implementing database 102 on a separate server 108 , new data can be populated into the database without taking down the system , and this data will find its way into the cache as a result of the methodology described herein . moreover , if the database is not operable , the system can simply move to the next step shown in fig1 , just the same as if it did not find the data in database 102 . if the required parameter is located in database 102 , it is written to cache memory 103 and also utilized by application 1 10 . however , if the parameter is not found in database 102 , the flat file 104 is then checked , and the data presumably located . in all events , however , the value of the parameter is retrieved at block 105 and placed into cache memory 103 for subsequent use . fig2 depicts and additional embodiment of the present invention in which the application server includes plural terminals 205 - 207 , and two database servers 209 and 108 . in such a case , a parameter in cache memory may also specify , in the cache , which of the database servers the 209 or 108 to use for the updated parameter . in this manner , if the needed parameter is not in the cache at all , the next step would be to check the database servers 108 and / or 109 . these two servers may represent one live and one backup , or , they may represent multiple servers for storing a large amount of data , such that the database is implemented between the two of them . alternatively , if the parameter is in cache 103 but has time out , the cache version could include a pointer to the specific database server to check , thereby eliminating the need to check plural servers . preferably , the system designer will ascertain in advance which of numerous software parameters change often enough to use the database or other file 102 , and which do not change so frequently . thus , for parameters like passwords , for example , which users tend to maintain long term , the flat file or hard coding can be used . for parameters such as a customer balance in an account , the database server 108 and database 102 can be used as the source of these . thus , all parameters will gradually be moved into cache as the software application ( s ) that need them are run on the application server 107 , and the cache will by kept up to date using the timeout features described above . in one embodiment , all parameters that may be used by the software application and which vary are divided into groups in advance of use . parameters expected to be updated more frequently than the predetermined threshold are placed into the database 102 , whereas , parameters expected to be updated less frequently than the predetermined threshold are placed into the flat file . in this manner , once the application ( s ) are up and running , the parameters gradually migrate into cache , and the ones that need to be updated more frequently than the the threshold can be changed while the software applications using them are “ live ”. notably , parameters in the flat file 104 can also be put into the database file 102 . such a situation will arise when a parameter was previously selected for the flat file , but the developer wishes to override the value . rather than have to take the application out of service to update the flat file , the parameter can just be put into the database 102 . due to the order in which the sources for the parameter are checked , as described above , the system will continue to operate , but the database file will trump the flat file because it is checked first . the above technique can also be used to allow a parameter in the flat file , and which can thus be accessed very quickly by the software application , to be altered without having to take down a software application using those parameters . specifically , consider the case where the desired parameter is one that does not vary all that often , so it is placed in flat file 104 . if a time comes that such a parameter must be changed , the system can then change it by placing the parameter in database 102 , even though it is not normally kept there . due to the order in which the software application checks for sources of the parameter ( described above ), the software application will continue operating , however , it will do so using the new value of the parameter in database 102 . then , if it is desired to permit even faster access by placing the parameter in flat file 104 , at least two methodologies can be utilized . first , the flat filed can be updated with the new value at a time when the application is not used , or at least less critical ( e . g . ; overnight ). alternatively , the software itself can be programmed , and the parameter in database 102 tagged , so that the software itself is instructed to place the new parameter into the flat file after it is first read into cache from the database 102 . the system may also keep track of the number of times a parameter is replaced with information from the database . in this manner , if a parameter was designated by the developer for the flat file , but the system detects that it is changing too often , it can alert the developer to reallocate such parameter to the database file 102 . while the above describes the preferred embodiment of the present invention , various other modifications can be implemented without departing the spirit and scope of the invention . | 6 |
the fuel tank emission system 10 shown in the drawing , includes a fuel tank 12 ; a file pipe 14 through which fuel enters the tank 12 ; an evaporative leak check module ( elcm ) 20 ; filter 22 ; a normally - closed diurnal control valve ( dcv ) 24 ; carbon canister 26 , connected by a passage 28 to tank 12 ; fuel tank vapor pressure sensor ( ftvps ) 30 ; an atmosphere reference port 32 ; and a purge valve 34 , connected by a passage 36 to an engine 37 . the ftvps 30 is used to check the fuel system vapor space for the presence of a leak equivalent to about a 0 . 020 inch ( 0 . 508 millimeters ) diameter hole . fuel vapor generated in tank 12 is at least partially vented through a first vapor flow path , which includes passage 28 and canister 26 . activated carbon , similar to charcoal , contained in canister 26 collects and stores the hydrocarbons . when the engine is running , air is drawn through canister 26 , and the hydrocarbons are drawn into the engine 37 . the tank vapor pressure sensor 30 is essentially a membrane exposed on one side of its thickness to fuel tank and canister pressure , and on the opposite side to atmospheric pressure through port 32 . the elcm 20 includes a valve 40 , pressure sensor 42 , and pump 44 , preferably a vane pump . pump 44 communicates though a port 46 with the fuel tank 12 through a second vapor flow path , which includes passages 48 , 49 and a filter 22 . passages 48 , 50 connect filter 22 to valve 40 . the air line 56 may include the evaporative leak check module ( elcm ) 20 . the elcm filter 22 filters the air flow to the elcm 20 . the evaporative leak check module 20 includes the elcm diverter valve 40 , vacuum pump 44 and elcm pressure sensor 42 . a reference orifice 70 may also be included within the evaporative leak check module 20 . the diverter valve 40 includes a first path 62 and a second path 64 , which pass through valve 40 . in a first position as illustrated in the figure , air is directed through path 62 of the diverter valve 40 directly from its input to the dcv 24 . in the second position , the diverter valve 40 is controlled upward so that the vacuum pump 44 is in use , thereby creating vacuum in the passage 55 , 56 , 64 up to the diurnal control valve 24 . in either case , the pressure sensor 42 generates a pressure signal corresponding to the pressure within the elcm 20 . the pump &# 39 ; s port 52 communicates with valve 40 through passage 64 and with pressure sensor 42 , passage 56 and the dcv 24 through passage 55 . pressure sensor 42 preferably indicates absolute pressure in the system . the valve 40 of the elcm 20 is a two - position valve , actuated by a solenoid 58 and compression spring 60 . valve 40 moves alternately to and from the position shown in the figure wherein passages 50 , 56 are interconnected through valve passage 62 . in the position shown in the figure , the vacuum pump 44 is isolated from the system . in the alternate position , passage 50 is isolated and vacuum pump 44 can apply a pressure differential to create vacuum in passages 55 , 56 and 64 . through the use of diverter valve 40 , pump 44 has ability to draw a reference vacuum on orifice 70 corresponding in magnitude to the vacuum in a fuel system having a leak through an orifice of about 0 . 20 inch diameter . if pump 44 can produce a larger vacuum on the complete fuel system 10 than the reference vacuum , the system 10 is assumed to be sealed . if the pump cannot produce vacuum as great as the reference vacuum , the system is assumed to be unsealed or leaking . a pressure relief valve 66 , located in a passage 68 , is connected to the dcv 24 and passage 56 . the reference orifice 70 is located between pressure sensor 42 and passage 56 . a low - cost snorkel hose 72 has an open end connected to the atmospheric reference port 32 of the ftvps 30 . hose 72 is connected through a tee fitting 74 in passage 56 between the dcv 24 and pump 44 . an engine control module ( ecm ) 80 communicates through electronic data lines to a fuel level sensor 82 in the fuel tank 12 , the solenoid 83 of purge valve 34 , the ftvps 30 , the solenoid 58 and pressure sensor 42 of the elcm 20 , and the solenoid 85 of the dcv 24 . unlike typical evaporative emissions systems that are vented to atmosphere during normal operation , the evaporative emissions system 10 is closed to atmosphere by the dcv 24 . the ftvps 30 is located on the sealed side of the dcv 24 , but it is undesirable to open the dcv 24 when the gasoline engine 37 is not operating . opening the dcv 24 without the engine running would allow the escape of hydrocarbon vapors . in the sealed system 10 , pressure in the fuel system will vary from negative to positive during normal operation and while the vehicle is parked with the engine off . no operating condition exists in which pressure in the system is predictably zero . because of this , the fuel tank vapor pressure sensor 30 could be stuck - in - range at a pressure reading , in which case it would be impossible to diagnose the condition . a reliable way is needed to confirm that the fuel tank vapor pressure sensor 30 is operating correctly and reading the actual pressure in the fuel tank 12 . to reliably ensure that fuel tank vapor pressure sensor 30 is operating correctly , while the engine is not running , pump 44 in the elcm 20 is used to produce vacuum , which is communicated to the atmospheric reference port 32 of the fuel tank vapor pressure sensor 30 through hose 72 . the fuel tank vapor pressure sensor 30 is intended to read the pressure differential between the sealed system 10 and atmosphere . in the illustrated example , the vapor pressure sensor 30 is attached directly to the carbon canister 26 . the snorkel hose 72 connects the atmospheric reference port 32 on the fuel tank vapor pressure sensor to passage 56 between the dcv 24 and the elcm 20 with the use of tee fitting 74 . pump 44 in the elcm 20 creates a vacuum which is applied to the atmospheric reference port 32 on fuel tank vapor pressure sensor 30 through hose 72 . pump 44 can produce up to 4 kpa of pressure differential between the sealed system 10 and atmosphere , which is great enough to cause a change in output of fuel tank vapor pressure sensor 30 . the change in output of fuel tank vapor pressure sensor 30 can be used to confirm that the sensor is operating properly . the pressure sensor 42 in the elcm 20 produces a signal representing absolute pressure , which is used in a rationality test to confirm that the output of fuel tank vapor pressure sensor 30 changed the correct amount when vacuum is produced in the system by pump 44 . under normal running conditions , the air reference port hose 72 does not affect the output of fuel tank vapor pressure sensor 30 because the air reference port 32 is open to atmosphere . the air reference port 32 is protected from water splash . the system provides a reliable check on the operation of the fuel tank pressure sensor 30 without opening the dcv 24 . while certain embodiments of the present invention have been described in detail , those familiar with the art to which this invention relates will recognize various alternative designs and embodiments for practicing the invention as defined by the following claims . | 5 |
this present invention provides a wearer of nasal cannula apparatus the ability to reposition the fluid supply tubes to be oriented in a more comfortable position by adding lightweight flexible polymeric joints and / or malleable non - ferromagnetic metals to the nasal cannula apparatus as is described in the various aspects and embodiments of the inventions provided below . referring to fig1 , a first exemplary embodiment of the invention is shown in which a wearer 5 has comfortably positioned a nasal cannula apparatus away from the ears 60 . the nasal cannula apparatus includes a first fluid supply tube 20 which is joined to an inlet side of a first adjustment member 30 a . a first fluid supply tube segment 35 is joined to the outlet side of the first adjustment member 30 a at one end and is joined to an inlet side of a second adjustment member 30 b at the opposite end . a second fluid supply tube segment 50 is joined to the outlet side of the second adjustment member 30 be at one end and to a first inlet side of a nasal insufflating member 55 at its opposite end . likewise , a second fluid supply tube 15 is joined to an inlet side of a third adjustment member 30 c . a third fluid supply tube segment 40 is joined to the outlet side of the third adjustment member 30 c at one end and to an inlet side of a fourth adjustment member 30 d at the opposite end . a fourth fluid supply tube segment 45 is joined to the outlet side of the fourth adjustment member 30 d at one end and to a second inlet side of the nasal insufflating member 55 at its opposite end . in this embodiment of the invention , the first and second fluid supply tubes 20 , 15 are shown routed over the top the wearer &# 39 ; s head 5 and held in position by a retaining clip 25 depicted in fig1 a , 1 b . the diameters of the first and second fluid supply tubes 20 , 15 and the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 are generally equal and constructed of like polymeric materials to ensure a balanced fluid flow is delivered to the nasal insufflating member 55 . a larger diameter common fluid supply tube 10 delivers the fluid from a reservoir to the first and second fluid supply tubes 20 , 15 by way of a y - fitting 70 depicted in fig1 b . the first , second , third and fourth adjustment members 30 a , 30 b , 30 c , 30 d are coaxially joined to the first and second fluid supply tubes 20 , 15 and the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 so as to not interfere with the fluid supply being delivered to the wearer 5 . while four adjustment members 30 a , 30 b , 30 c , 30 d are shown in this figure , one skilled in the art will appreciate that fewer adjustment members could be used to allow the wearer to reposition the fluid supply tubes to achieve a more comfortable position . the polymeric construction materials of the first and second fluid supply tubes 20 , 15 , the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 and common fluid supply tube 10 are preferably of a thermo plastic such as polyvinyl chloride ( pvc ) having a sufficient plasticizer to allow flexibility and suppleness . pvc or other common thermo plastic polymers used in the current art are acceptable for use in the various components incorporated into the invention . additional construction materials may be incorporated or replace the polymeric construction of the first , second , third and fourth adjustment members 30 a , 30 b , 30 c , 30 d as described below . referring to fig2 a , a first embodiment of the invention is depicted . in this embodiment of the invention , a flow through adjustable bellows joint ( adjustment member ) 30 a is disposed into the nasal cannula invention at two or more of the adjustment member positions 30 a , 30 b , 30 c , 30 d depicted in fig1 . the bellows joint ( s ) 30 a are constructed with inlet 75 and outlet nozzles 80 for attachment to the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . the designation of inlet and outlet are used for convenience only . the adjustment members are intended to be simple flow - through devices which lack flow directivity restrictions . the adjustment members , as is depicted in fig2 b , are constructed of polymeric materials which are compatible with the polymeric construction materials of the first and second fluid supply - tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . to achieve the necessary flexibility , positioning memory and structural integrity , a more rigid construction of polymer is used . for example , pvc having a reduced amount of plasticizer as is common used in the non - analogous art of drinking straws with flexible elbow joints . in one embodiment of the invention , depicted in fig2 c , the adjustment members 30 a are dimensioned to fit into the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . in this embodiment of the invention , the outer diameters of the inlet and outlet nozzles 75 , 80 are slightly larger than the inner diameters of the fluid supply tubing 35 , 20 . the resilient properties of the dimensionally expanded fluid supply tubing 35 , 20 forms sealed joints over the inlet and outlet nozzles 75 , 80 . this tubing coupling arrangement is commonly employed in the non - analogous art of aquarium aeration tubing . alternately , the inlet and outlet nozzles may be attached to the various fluid supply tubing using an adhesive . the various inner and outer diameters of the first and second fluid supply tubes 20 , 15 , the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 and / or the inlet and outlet nozzles 75 , 80 may be adjusted accordingly to optimize the fluid flow delivered to the nasal insufflating member 55 depicted in fig1 . in another related embodiment of the invention , depicted in fig2 d , the adjustment members 30 a are dimensioned to fit over the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . in this embodiment of the invention , the inner diameters of the inlet and outlet nozzles 75 , 80 are slightly smaller in diameter than the fluid supply tubing 35 , 20 . the resilient properties of the dimensionally compressed fluid supply tubing 35 , 20 forms sealed joints within the inlet and outlet nozzles 75 , 80 . alternately , the inlet and outlet nozzles 75 , 80 may be attached to the various fluid supply tubing using an adhesive . as before , the various diameters of the first and second fluid supply tubes 20 , 15 , the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 and / or the inlet and outlet nozzles 75 , 80 may be varied accordingly to optimize the fluid flow delivered to the nasal insufflating member 55 depicted in fig1 . both embodiments of the invention depicted in fig2 c and 2 d may be used to retrofit an existing nasal cannula available in the current art or provided as a complete nasal cannula assembly . inclusion of the bellows joints as adjustment members 30 a , 30 b , 30 c , 30 d allows a wearer 5 of the nasal cannula to adjust various portions of the fluid supply tubing to achieve a more comfortable wearing position . wearing adjustment is made simply by repositioning of the applicable section ( s ) of the supply tubing and flexing of the bellows joints ( adjustment members 30 a , 30 b , 30 c , 30 d ) depicted in fig1 . referring to fig3 a , another embodiment of the invention is depicted . in this embodiment of the invention , a flow through adjustable joint 30 a is disposed into the nasal cannula invention at two or more of the adjustment member positions 30 a , 30 b , 30 c , 30 d depicted in fig1 . the flow through adjustment member 30 a is uniform in diameter for direct attachment to the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . the adjustment member 30 a , as is depicted in fig3 b , is constructed of one or more non - ferromagnetic metals that are compatible with the polymeric construction materials of the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . for example , non - ferromagnetic metal tubing constructed from aluminum , copper or austenitic stainless steel may be used for the adjustment members 30 a . non - ferromagnetic metals are important for wearers who may undergo magnetic resonance imaging ( mri ) procedures . if mri procedures are not of concern , iron alloys may be employed as well . to achieve the necessary flexibility , positioning memory and structural integrity , the wall thicknesses of the metal tubing comprising the adjustment member 30 a is optimized to allow the tubing to bend without reaching the ductility limit ( s ) of the metal . in one embodiment of the invention , depicted in fig3 c , the adjustment member 30 a is dimensioned to fit into the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . in this embodiment of the invention , the outer diameter of the metal adjustment member 30 a is dimensioned slightly larger than the inner diameters of the fluid supply tubing 35 , 20 . the resilient properties of the dimensionally expanded fluid supply tubing 35 , 20 forms sealed joints over the adjustment member 30 a . alternately , the adjustment member 30 a may be attached to the various fluid supply tubing using an adhesive . the various inner and outer diameters of the first and second fluid supply tubes 20 , 15 , the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 and / or the inlet and outlet nozzles 75 , 80 may be varied accordingly to optimize the fluid flow delivered to the nasal insufflating member 55 depicted in fig1 . in another related embodiment of the invention , depicted in fig3 d , the adjustment member 30 a is dimensioned to fit over the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . in this embodiment of the invention , the inner diameter of the adjustment member 30 a is slightly smaller in diameter than the fluid supply tubing 35 , 20 . the resilient properties of the dimensionally compressed fluid supply tubing 35 , 20 forms sealed joints within the adjustment member 30 a . alternately , the adjustment member 30 a may be attached to the various fluid supply tubing using an adhesive . as previously described , the various diameters of the first and second fluid supply tubes 20 , 15 , the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 and / or the inlet and outlet nozzles 75 , 80 may be varied accordingly to optimize the fluid flow delivered to the nasal insufflating member 55 depicted in fig1 . both embodiments of the invention depicted in fig3 c and 3 d may be used to retrofit an existing nasal cannula available in the current art or provided as a complete nasal cannula assembly . inclusion of the metal adjustment members 30 a , 30 b , 30 c , 30 d allows a wearer 5 of the nasal cannula to adjust various portions of the fluid supply tubing to achieve a more comfortable wearing position . wearing adjustment is made simply by bending of the applicable section ( s ) of the of the adjustment members 30 a , 30 b , 30 c , 30 d depicted in fig1 . referring to fig4 a , another embodiment of the invention is depicted . in this embodiment of the invention a flow through flexible polymeric joint ( adjustment member ) 30 a is disposed into the nasal cannula invention at two or more of the adjustment member positions 30 a , 30 b , 30 c , 30 d depicted in fig1 . the polymeric joint 30 a as depicted in fig4 b , is constructed primarily of polymeric materials which is compatible with the polymeric construction materials of the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . in addition , a thin non - ferromagnetic metal ribbon or wire 65 , 65 ′ is incorporated along a long axis of the polymeric joint ( adjustment member ) 30 a . the addition of the thin non - ferromagnetic metal ribbon or wire 65 , 65 ′ provides the necessary positioning memory not generally available in the inexpensive thermoplastic polymers normally found in nasal cannula constructions . the metal ribbon or wire 65 , 65 ′ may extruded with the thermoplastic tubing at the time of tubing manufacture or added thereafter by heating the ribbon or wire 65 , 65 ′ beyond the melting point of the thermoplastic and embedding the metal into polymeric tubing . in both of the aforementioned manufacturing methods , the metal ribbon or wire 65 , 65 ′ should be embedded entirely in the polymeric construction of the tubing rather than extending into the fluid flow channel . this reduces the chances of oxidation and possible reaction if high concentrations of oxygen are to be used as the fluid provided to the wearer . in one embodiment of the invention , depicted in fig4 c , the adjustment member 30 a is dimensioned to fit into the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . in this embodiment of the invention , the outer diameter of the adjustment member 30 a is dimensioned slightly larger than the inner diameters of the fluid supply tubing 35 , 20 . the resilient properties of the dimensionally expanded fluid supply tubing 35 , 20 forms sealed joints over the adjustment member 30 a . alternately , the adjustment member 30 a may be attached to the various fluid supply tubing using an adhesive . the various inner and outer diameters of the first and second fluid supply tubes 20 , 15 , the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 and / or the inlet and outlet nozzles 75 , 80 may be varied accordingly to optimize the fluid flow delivered to the nasal insufflating member 55 depicted in fig1 . in another related embodiment of the invention , depicted in fig4 d , the adjustment member 30 a is dimensioned to fit over the first and second fluid supply tubes 20 , 15 , and / or the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 . in this embodiment of the invention , the inner diameter of the adjustment member 30 a is slightly smaller in diameter than the fluid supply tubing 35 , 20 . the resilient properties of the dimensionally compressed fluid supply tubing 35 , 20 forms sealed joints within the adjustment member 30 a . alternately , the adjustment member 30 a may be attached to the various fluid supply tubing using an adhesive . as previously described , the various diameters of the first and second fluid supply tubes 20 , 15 , the first , second , third , and fourth supply tube segments 35 , 40 , 45 , 50 and / or the inlet and outlet nozzles 75 , 80 may be varied accordingly to optimize the fluid flow delivered to the nasal insufflating member 55 depicted in fig1 . both embodiments of the invention depicted in fig4 c and 4 d may be used to retrofit an existing nasal cannula available in the current art or provided as a complete nasal cannula assembly . inclusion of the adjustment members 30 a , 30 b , 30 c , 30 d allows a wearer 5 of the nasal cannula to adjust various portions of the fluid supply tubing to achieve a more comfortable wearing position . wearing adjustment is made simply by bending of the applicable section ( s ) of the of the adjustment members 30 a , 30 b , 30 c , 30 d depicted in fig1 . referring to fig4 e , another embodiment of the invention is depicted where the adjustment member 30 a is dimensioned to slidably fit over the first and second fluid supply tubes 20 , 15 , becoming a slidable sleeve which may be repositioned anywhere along the contiguous outer surfaces of the first and second fluid supply tubes 20 , 15 . as such , the adjustment member 30 a in this embodiment of the invention does not become part of the fluid flow channel and is therefore ideal as a simple retrofit of existing nasal cannula apparatus . usage of this embodiment of the invention by the wearer 5 of the nasal cannula apparatus is nearly identical to that described above with the added advantage of the wearer being able to slide one or more of the adjustment members 30 a , 30 b , 30 c , 30 d to the most comfortable positions along the long axis of the first and second fluid supply tubes 20 , 15 . referring to fig5 a , a final embodiment of the invention is shown where a non - ferromagnetic metal ribbon or wire 65 is embedded directly in the first and second fluid supply tubes 20 , 15 . this embodiment of the invention is simply an extension of the embodiments of the invention described above for fig4 a , 4 b , 4 c , 4 d and 4 e where a metal ribbon or wire 65 ′ is incorporated directly into the polymeric construction of the first or second fluid supply tubes 20 , 15 as shown in fig5 b . this embodiment of the invention provides an additional advantage in that there are no rough surfaces or tubing diameter changes involved in the construction of the nasal cannula apparatus . the wearer 5 of the nasal cannula apparatus which incorporates this embodiment of the invention may simply bend the portion or portions of the first and second fluid supply tubes 20 , 15 to the most desirable position without encountering rough edges which could irritate the skin or tubing diameter changes which snag on clothing . all other aspects of this embodiment of the invention are nearly identical to those described above fig4 a , 4 b , 4 c , 4 d and 4 e . the foregoing described embodiments of the invention are provided as illustrations and descriptions . they are not intended to limit the invention to precise form described . in particular , it is contemplated that functional implementation of the invention described herein may be constructed in various shapes and of different materials . no specific limitation is intended to a particular shape or construction material . other variations and embodiments are possible in light of above teachings , and it is not intended that this detailed description limit the scope of invention , but rather by the claims following herein . | 0 |
[ 0032 ] fig1 shows of a network b 1 two data channels b 2 , an output unit b 3 , and two terminals , a computer terminal b 4 and a telephone terminal b 5 . the terminal b 4 has an output unit b 3 . this output unit b 3 is connected via a data channel b 2 with a network b 1 . the telephone terminal b 5 is as well connected with the network b 1 via a data channel b 2 . the figure describes the scenario for this realization . both terminals b 4 , b 5 , in the role of a receiver , are connected with the network b 1 via data channels b 2 . the terminals receive packets over the data channels and these packets contain streamed data , which has to be reconstructed . to be able to reconstruct the data stream , there might be a special hardware , called output unit b 3 , that alternatively might be integrated in the terminal . the terminal and the output unit are assumed to be controlled by a computer program . although the realization of the reconstruction method could also be implemented in software only . [ 0034 ] fig2 shows a control entity a 1 , a buffer queue a 2 , an input channel a 3 , an output stream a 4 , an input packet sequence a 5 , an output data stream a 6 and an illustration of two time intervals a 7 between two consecutive packets also - known as packet inter - arrival times . the control entity a 1 controls the buffer queue a 2 , i . e . when the queue has to be emptied and filled . the buffer queue a 2 is connected with the input channel a 3 transporting the input packet sequence a 5 . the input packet sequence a 5 consists of a sequence of packets a 5 , where each packet having a packet sequence number 15 , 16 , . . . , 20 . this input packet sequence as needs not coinciding with the packet number sequence as illustrated in the drawing . the figure does not show the packet representation , i . e . header , payload , etc . it is assumed that the payload is already extracted and labeled by the sequence number . the figure shows especially the time intervals a 7 between the consecutive packets 19 and 20 as well as the time intervals a 7 between the consecutive packets 15 and 16 . the buffer queue a 2 is also connected with the output stream a 4 transporting the ordered continuous output data stream a 6 . the output stream is ordered by packet numbers and the time interval between two consecutive packets disappears , by using the previously buffered reservoir . in the illustrated configuration the output stream data carries data from packets 1 , 2 , 3 , 4 , 5 , the buffer queue a 2 stores packets 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , and the input channel data as consists of the packets 15 , 14 , 16 , 17 , 19 , 18 , 20 . the figure illustrates the functionality of reconstructing a data stream . a jittered input data stream running into a buffer , converted into a continuous output data stream . the arriving packets , each having its number , are translated into an ordered continuous data stream where the data is ordered by the packet numbers and the time interval between the content of two consecutive packets disappears . in the example it is assumed that the packet stream has a jitter and the packets need not arrive in the origin sequence . the network might have additional characteristics , e . g . an asserted delay bound that should be taken into account when implementing the described functionality . in further , it is assumed that there is no packet loss . in case of packet loss additional strategies have to be considered beside buffering , e . g ., reconstruction of packet information on the application layer or depending if network resources and time are available an additional request for retransmission . [ 0038 ] fig3 shows a use case diagram according to the uml notation , from the ‘ unified modeling language user guide ’, g . booch , j . rumbaugh , i . jacobson , addison - wesley , reading mass ., 1999 , pages 233 - 236 , containing the actors “ network ” and “ application ”, as well as a use case “ converter ” and a use case “ control ”. the “ network ” is associated with the “ converter ” by “ data channel ” and the “ application ” is associated with the “ converter ” by “ data stream ”. the “ converter ” is extended by the “ control ”. the diagram shows the problem context , namely the data channel “ data channel ” supporting the jittered packet data stream shown in fig2 and a application “ application ” requesting the reconstructed continuous streamed data . this reconstruction is performed by a controlled converter “ converter ” extended by “ control ”. the control mechanism is explicitly stated . it might be hidden by other use cases as side effects , e . g . a scheduler integrated in an operating system . [ 0041 ] fig4 shows a class diagram according to the uml notation , from the ‘ unified modeling language user guide ’, g . booch , j . rumbaugh , i . jacobson , addison - wesley , reading mass ., 1999 , pages 105 - 108 , containing the data types “ channel ”, “ stream ”, and “ priorityqueue ”; the processes “ receive ” and “ stream ”; and a class “ estimation ”. “ channel ” provides the two methods “ end ” and “ fetch ”. “ stream ” provides the two methods “ append ” and “ read ”. “ priorityqueue ” provides four methods “ add ”, “ get ”, “ isempty ”, and “ size ”. “ estimation ” provides the two methods “ measure ” and “ predict ”. the diagram shows an architecture for streamed data reconstruction . this architecture has a framework character . it is designed for illustration purposes . it allows to substitute the estimation and to simplify the description by abstraction . an architecture of a realization is influenced by the complete product design . the architecture consists of three abstract data types , a channel , a stream and a priority queue , as well as two processes , “ receive ” and “ stream ”. the priority queue is chosen to illustrate the abstract buffering mechanism . it is not necessary to use abstract data types . for instance , a often used technique instead of a priority queue is a straight forward array implementation of a buffer queue . the processes need not to be explicitly designed . instead one might realize the method by threads or operating system services . the data type “ channel ” is aggregated by the process “ receive ”. the data type “ stream ” is aggregated by the process “ stream ”. the data type “ priorityqueue ” and the class “ estimation ” are both associated to both processes “ receive ” and “ stream ”. the method “ end ” of the data type “ channel ” returns the boolean true when the last packet of the packet sequence has arrived , the boolean false otherwise . the method “ fetch ” returns the next received packet . the method “ append ” of the data type “ stream ” appends the argument to the end of this stream . the method “ read ” reads the head of this stream ( destructive ). the method “ add ” of the data type “ priorityqueue ” enters the argument into this priority queue . the method “ get ” returns the least element of this priority queue . the method “ isempty ” returns the boolean true if this priority queue contains no element , the boolean false otherwise . the method “ size ” returns the number of elements contained in this priority queue . the method “ measure ” of the class “ estimation ” collects network performance information and updates network characteristics accordingly . the method “ predict ” returns values for controlling the behavior of the two processes . the two processes are controlled by the class “ estimation ” that measures network behavior and derives network performance predictions . the two processes “ receive ” and “ stream ” use this prediction in order to adapt their behavior , e . g . the use of the buffer queue or the stream speed etc . [ 0052 ] fig5 shows a program implementing the architecture for streamed data reconstruction of fig4 . the abstract notation for the program consists of a declaration part for variables and types , labeled by ‘ declaration ’ and an implementation part labeled by ‘ implementation ’. a data type “ channel ”, framed by ‘ data type channel ’ and ‘ end data type channel ’, a data type “ stream ”, framed by ‘ data type stream ’ and ‘ end data type stream ’, a data type “ priorityqueue ”, framed by ‘ data type priorityqueue ’ and ‘ end data type priorityqueue ’. a process “ receive ”, framed by ‘ process receive ’ and ‘ end process receive ’, and a process “ stream ” framed by ‘ process stream ’ and ‘ end process stream ’, a class “ estimation ”, framed by ‘ class estimation ’ and ‘ end class estimation ’. a method “ end ”, returning the boolean true if the input packet sequence ends , and a method “ append ”, adding a data element at the end of this stream , and a method “ get ”, returning and removing the packet with the least element , i . e . the - packet with the least number , from this priority queue , a method “ isempty ”, returning the boolean true if the priority queue contains no packet , a method “ size ”, returning an integer , the number of packets contained in this priority queue . the process “ receive ” consists of a loop , framed by ‘ while ’ and ‘ end while ’, with the terminating condition ‘ not input . end ( )’, and a body consisting of the statement sequence ‘ packet = input . fetch ( )’; ‘ estimation . measure ( packet )’; ‘ buffer . add ( packet )’. hence , the process iterative reads a packet from the input channel , update the performance statistic of the network and buffers the packet , until the last packet is arrived . the process “ stream ” consists of a main loop , framed by ‘ while ’ and ‘ end while ’, with the terminating condition ‘ not ( input . end ( ) and buffer . isempty ( ))’ and a body consisting of the statement ‘ estimation . predict ( buffersize , delaytime )’ followed by a sequence of further while loops . the first while loop , framed by ‘ while ’ and ‘ wait end while ’ has the terminating condition ‘ buffer . size ( )& lt ; buffersize ’ waits until the buffer is filled according to the predicted value buffer . size . the second while loop , framed by ‘ while ’ and ‘ end while ’, with the terminating condition ‘ not buffer . isempty ( )’ and a body consisting of the statement sequence ‘ output . append ( buffer . get ( ))’; ‘ delay ( delaytime )’, empties the buffer and serves the stream continuously with a homogenous by the estimation predicted delay . the latter two loops are iterated until the complete stream is reconstructed . the kernel of the described program and the control of the processes and the buffer is the class “ estimation ”. this class contains the variable “ meandelay ”. in general this class contains variables for measured network characteristics . furthermore , the class “ estimation ” consists of a set of variables for the statistical observations and two methods , a method “ measure ” that updates the network characteristics by observed events , here a packet arrival , and buffersize and delaytime , based on gathered network characteristics . it should be noted that the methods of the two processes are only a specific option model . beside the stated mode there might be a streaming handshake , forcing faster streams , or an application that might allow a homogenous delay or a smooth increasing delay . [ 0088 ] fig6 shows a program implementing a class estimation introduced in fig5 . the class “ estimation ” is framed by ‘ class estimation ’ and ‘ end class estimation ’ and contains five variables , three reals “ t ”, “ sr ”, and “ tr ”, as well as two integers “ r ” and “ n ”, and two methods . a method “ measure ” that updates the mean delay t by an observed packet delay t , as well as the decrement of the number of remaining packets r and a method “ predict ”, that returns parameters for the conversion , buffer size b and delay time ( the reciprocal of the sample rate ), based on gathered network characteristics . [ 0092 ] fig7 shows three diagrams , labeled by o 1 , o 2 , and o 3 . the x - axis of each diagram is the time and the y - axis are packets . diagram o 1 shows encoding and packetisation , diagram o 2 shows transportation through a network , and diagram o 3 shows the stream resuming at the receiver . the figure depicts an encoding - transmission - decoding scenario . there are three observation points o 1 at the sender , o 2 at the network , and o 3 at the receiver . diagram o 1 consists of a packet p ( 1 , 1 ) and two occurrences of packet p ( 2 , 1 ) . diagram o 2 consists of a waiting packet w ( 2 , 1 ) and two total service time intervals n stag t s for each packet . diagram 03 consists of a de - jittering delay t jit and a decoding delay t dec . the diagrams are connected via three dashed arrows showing a path of packet p ( 2 , 1 ). the horizontal double arrows a 2 shows a time interval until packet p ( 2 , 1 ) arrives . the horizontal arrow w 2 , 1 shows a waiting time interval of packet p ( 2 , 1 ). a horizontal arrow n stag t s shows a service time interval of p ( 2 , 1 ) , and a horizontal arrow d 2 , 1 shows a delay of packet p ( 2 , 1 ) . assumptions for the shown scenario are identical encoding ( e . g . voice activity detection or not ) and packetisation of the arriving calls , with no time stamps and available packet sequence numbers . negative - exponentially distributed connection inter - arrival time a 2 is assumed at the encoder . shown in diagram o 2 a packet - based network delays discontinuously packets with a deterministic service time n stag t s . no priorities , no retransmission , no overtaking , no change in routing , only real - time traffic , and no disturbing data traffic is assumed . the packet p ( 2 , 1 ) is traced through the described scenario . at the sender this packet is created after the time a 2 starting from the creation event of the preceding packet p ( 2 , 1 ) . when the first packet is processed the packet p ( 2 , 1 ) enters the network . there it waits for the time w 2 , 1 . when the waiting time is passed the network transports the packet within time n stag t s to the receiver . at the receiver it is buffered for a time t jit and decoded within a time t dec . the following section contains an example application for a stream transmission scenario where a size of a file to stream is known and a network that delays equally sized packets equally . then considering the following intermediate scenario enabling one to determine the optimal buffer size for continuos streaming , i . e ., the following three events coincide : buffer is empty , the file is completely transmitted , and the buffer is completely streamed . because of the deterministic delay assumption there is no need for prediction . but the example shows the dependence of the scenario parameters and illustrates the adaptive buffer functionality . in an intermediate scenario there is a rest of the stream to transmit at the sender , called rest , of size r , a buffered stream , called buffer , of size b and a played stream at the sender . the above three events coincide when the transmission time for the rest and the time for streaming the rest and buffer is equal . the transmission rate tr is 1 / t , the stream rate is a constant , say sr . then the transmission time for the rest is r / tr and the time for streaming the rest and buffer is ( r + h )/ sr . derived from the equation r / tr =( r + b )/ sr one concludes the optimal buffer size b = sr / tr * r − r . for most packet networks the assumption that each packet is delayed equally is wrong . but one could approximate the real delay with the mean delay of the already transmitted packets instead . the mean delay t ( n ) for n transmitted packets each having its own delay t i is the sum delay t 1 + t 2 +. . . + t n divided by n . for calculation t ( n + 1 ) consider t ( n + 1 )=( t 1 + t 2 +. . . + t n + t n + 1 )/( n + 1 )=(( t 1 + t 2 +. . . + t n )+ t n + 1 )/( n + 1 ), but ( t 1 + t 2 +. . . + t n )= n * t ( n ). hence t ( n + 1 )=( n * t ( n )+ t n + 1 )/( n + 1 ). the above discussion is illustrated as an implementation of class ‘ estimation ’ shown in fig6 . the statistical model can be enhanced by observable properties of the network like packet routing , traffic , or network topology , and of the stream content itself , like length pauses and talk spurts in the case of voice data streams , as well as past transmissions or even past connections . the following section describes a more complex application for the special case of reducing delay jitter for a packetized voice network , with minimal delay , i . e ., small queues in the context and with the assumptions of fig6 . a set of recursive measurement and prediction equations , based on multiple probabilistic models is developed illustrating the claimed method . the main assumptions are a constant inter - arrival time for the packets at the network during active voice , but no constant inter - departure time when arriving at the receiver . for this application additionally a probability function which describes the network packet delay behaviour is missing . the delay of the first arriving packet ( reference packet ) d ref is unknown , as well as the sender clock is unknown and the time stamps are unavailable . the application has the property to be able re - configuring the queue while silence phases . hence this application is an example for a tight coupling of the application layer consuming the transmitted stream . for the detailed description the following notations are used for the encoding and packetisation delay factors for the end - to - end delay we say the delay introduced by encoder , packetizer and decoder : t enc , p , dec = n f t f + t la + t enc + t dec , for the delay in the packet - based network : d = n stag t s + w n , and for the dejittering delay : t jit . the mean number of created packets per call is { overscore ( x )} calculated out of the mean call holding time the following section contains notations used for the described packet delay calculations . amount of packets from calls arriving after the observed connection i until network arrival instant of packet number r . x k m + i , r min ( p r ) . number of additional packet arrivals of previous connections between l th connection arrival instant and network arrival instant of packet r from connection i : x k m + i , r min . probability of j poisson arrivals during packet producing time interval of a single connection : p j , r = ( λ ( r - 1 ) n f t f ) j j ! - λ ( r - 1 ) n f t f . the following section contains an itemization of the used notations for mean delay calculations mean delay of an arbitrary packet : { overscore ( d )}( n stag , t s , { overscore ( x )}, λ , n f t f ) mean absolute relative delay of an arbitrary packet : { overscore ( δd )}( n stag , t s , { overscore ( x )}, λ , n f t f ) mean delay of the r th packet { overscore ( d r )}( n stag , t s , { overscore ( x )}, λ , n f t f ) average number of cumulative network packet arrivals at network arrival instant of packet number r . { overscore ( q r )}({ overscore ( x )}, n ip , { overscore ( x r min )}, { overscore ( x r min ( p r ) )}) and of an arbitrary packet : { overscore ( q )}({ overscore ( x )}, n ip , { overscore ( x min )}, { overscore ( x min ( p ) )}). average relative number of cumulative network packet arrivals at network arrival instant of packet number r . { overscore ( δq r )}({ overscore ( x min ( p r ) )}) and of an arbitrary packet : { overscore ( δq )}({ overscore ( x )}, { overscore ( x min ( p ) )}). average minimum amount of additional packets from previous connections at network arrival time instant of packet number r . { overscore ( x r min )}({ overscore ( x )}, λ , n f t f ) and of an arbitrary packet : { overscore ( x min )}({ overscore ( x )}, λ , n f t f ). average minimum amount of additional packets from calls arriving after the observed connection until network arrival instant of packet number r . { overscore ( x r min ( p r ) )}({ overscore ( x )}, λ , n f t f ) and an arbitrary network packet arrival instant : { overscore ( x min ( p ) )}({ overscore ( x )}, λ , n f t f ). mean total inter - arrival time of an arbitrary packet : { overscore ( i )}( λ , { overscore ( x )}, n f t f ) the i th call : { overscore ( i i − l )}( λ , { overscore ( x )}, n f t f ), and the r th packet : { overscore ( i r )}( λ , n f t f ). mean value of n ip erlang -( i − l ) distributed time intervals : { overscore ( y )}( λ ) mean values of the relative absolute total inter - arrival time of an arbitrary packet : { overscore ( δi )}( λ , { overscore ( x )}, n f t f ) the l th call : { overscore ( δi i − l )}( λ , { overscore ( x )}, n f t f ), and the r th packet : { overscore ( δi r )}( λ , n f t f ). the following list contains the set of values for initialisation and adaptation . number of packets per active voice period x k m + i hypo - exponential process f d ( t ; t 1 , t 2 ) with mean values t 1 and t 2 . hyper - exponential process f d ( t , p , t 1 , t 2 ) with the mean values t 1 , 2 and probability p . we have two qualities of service bounds , the packet loss restriction pr └ d & gt ; d min + t jit ┘& lt ; p loss , and the delay restriction d max + t jit & lt ; d e2e . the problem of serving continuous streamed voice data is solved by gathering the decoder packet arrival instants t d ref and t d r ; then approximating the delay of the first arriving packet d ref with a pre - calculated mean delay value and calculating the delay of the r th packet out of d r = t d r − t d ref +{ overscore ( d )}−( r − ref )· n f t f , and creating a substitute delay probability function to calculate the maximum tolerated packet delay and consequently the dejittering delay . packets missing the quality of service restrictions for packet loss d r ≦ t d r − t d ref +{ overscore ( d )}−( r − ref )· n f t f , or equivalently t d r ≦ t d ref + t jit +( r − ref )· n f t f and the end - to - end delay d r + t jit & lt ; d e2e are discarded . the following section contains the variables needed for packet delay calculations . the delay of the r th packet produced from the l th connection during busy period m is denoted as d k m + i , r . w k m + i , r denotes the waiting time of packet number k m + i , r . i i − l , r describes the total inter - arrival period from the begin of route busy period m until network arrival instant of the r th packet of the l th connection . the total number of network packet arrivals from the beginning of the busy period m until service beginning of the observed packet is named q k m + i , r i − 1 + r − 1 ++ x k m + i , r min ( p r ) + x k m + i , r min . y 1 − 1 is the erlang distributed time interval of i − 1 negative - exponentially distributed successive call inter - arrival time intervals . δi i − l , r denotes the relative total inter - arrival time of the r th packet produced from the l th call . the negative - exponentially distributed encoder inter - arrival time of the l th connection is named a k m + l . the following section contains a description sample jitter delay algorithm for voice data streams . this prediction is based on gathered the decoder packet arrival instants t d ref and t d r ; via an approximated delay of the first arriving packet d ref with a pre - calculated mean delay value and calculate the delay of the r th packet out of d r = t d r − t d ref +{ overscore ( d )}−( r − ref )· n f t f ; and a substitute delay probability function to calculate the maximum tolerated packet delay and consequently the dejittering delay . there are two quality of service bounds considered , namely , the packet loss restriction pr └ d & gt ; d min + t jit ┘& lt ; p loss and the delay restriction d max + t jit & lt ; d e2e . the “ measure ” method for this example initializes the statistic observations by gathering the following values during call set - up the highest tolerated probability for packet loss due to jitter problems p loss the mean number of created packets per call { overscore ( x )} calculated out of the mean call holding time the initial mean delay of an arbitrary packet { overscore ( d ( 0 ) )}:={ overscore ( d )}( n stag , t s , { overscore ( x )}, λ , n f t f ) the initial mean absolute relative delay of an arbitrary packet { overscore ( δd ( 0 ) )}:={ overscore ( δd )}( n stag , t s , { overscore ( x )}, λ , n f t f ) while the call is active the “ measure ” method gathers the packet arrival instants t d r . then the delay of the r th packet by d r = t d r − t d ref +{ overscore ( d ( 0 ) )}−( r − ref )· n f t f is calculated . the quality of service restriction for streamed voice data are for packet loss requirement t d r ≦ t d ref + t jit ( 0 ) +( r − ref ) n f t f and for delay requirement d r + t jit ( 0 ) & lt ; d e2e . for the shown statistical description it is necessary to count the number packets per active voice period x k m + i , packet losses x loss , and overlong delays x e2e . the route length n stag and the service time n stag t s as well as the mean delay ( q ) _ : = ( q - 1 ) _ + 1 x k m + i ∑ r = 2 x k m + i t d r - t d r - 1 - n f t f , δ ( q ) _ : = δ ( q - 1 ) _ + 1 x k m + i ∑ r = 2 x k m + i t k m + i , r - t k m + i , ref - ( r - ref ) n f t f , in “ prediction ” method one calculate d max ( q ) choosing the hypo - exponential probability f d ( t ; t 1 ( q ) , t 2 ( q ) ) function when 0 ≦ c ( q ) ≦ 1 , where t 1 ( q ) ={ overscore ( d ( q ) )}·( 1 − c ( q ) ) and t 2 ( q ) ={ overscore ( d ( q ) )}· c ( q ) . and calculate d max ( q ) from probability function with respect to packet loss probability out of d max ( q ) = f d − 1 ( 1 − p loss ; t 1 ( q ) , t 2 ( q ) ) if c ( q ) & gt ; 1 choose the hyper - exponential probability function f d ( t ; p ( q ) , t 1 ( q ) , t 2 ( q ) ), where t 1 , 2 ( q ) = ( q ) _ · ( 1 ± ( c ( q ) ) 2 - 1 ( c ( q ) ) 2 + 1 ) - 1 and p ( q ) ={ overscore ( d ( q ) )}/ 2 · t 1 ( q ) . calculate the maximum relative delay d max ( q ) out of the hyper - exponential probability density function with e . g . the decomposition method . the result is used to adapt the stream output respectively by the maximum relative delay : δd max ( q ) := d max ( q ) − d min = d max ( q ) − n stag t s and determine t jit ( q ) according to δd max ( q ) =: t jit ( q ) ≦ d e2e − d max ( q ) during a silence period . the delay of the r th packet of the l th connection during busy period m is the sum of its service time and its waiting time in the network : d k m + i , r = n stag t s + w k m + i , r . the waiting time summarises the complete busy period until packet number k m + i , starts being serviced and reduces it with the time interval i i − l , r : w k m + i , r = n stag t s · q k m + i , r − i i − l , r : i i − l , r starts at the beginning of the busy period until the r th packet network arrival instant : i i - 1 , r = y i − l +( r − 1 ) n f t f , where y i − l denotes an erlang distributed time interval . the total number of network packet arrivals from the begin of the busy period m until service begin of the observed packet is q k m + i , r . the total inter - arrival time of the r th packet of the l th call is i i − l , r = y i − l +( r − 1 ) n f t f the relative total arrival time of the r th packet of the l th call is δi i − l , r =( r − 1 ) n f t f the number of l = 1 , . . . , j and j = 1 , . . . competing packet arrivals between l th connection arrival instant and network arrival instant of packet r from connection l is x k m + i + l , r min ( p j , r ) = min { x _ ; r - ⌊ y l - 1 n f t f ⌋ } . the number of additional packet arrivals of previous connections between l th connection arrival instant and network arrival instant of packet r from connection j ( j = 2 , . . . , i ) is x k m + j - 1 , r min ( p j , r ) = min { x _ - 1 ; ⌊ y i - j + 1 n f t f ⌋ + r - 1 } . the amount of additional packets from calls arriving after the observed connection i until network arrival instant of packet number r is x k m + i , r min ( p r ) = ∑ j = 1 ∞ p j , r ∑ l = 1 j x k m + i + l , r min ( p j , r ) . number of additional packet arrivals of previous connections between l th connection arrival instant and network arrival instant of packet r from connection i is x k m + i , r min = ∑ j = 2 j x k m + j - 1 , r min . the erlang distributed time interval y i − l ( λ )= σ k = l i − l a k ( λ ) is calculated by composition technique out of i − 1 negative - exponentially distributed successive inter - arrival time intervals by generating u 1 , u 2 , . . . , u i − 1 ( mutually ) independent and uniformly distributed between 0 and 1 , y i - 1 ( λ ) = - 1 λ ln ( u 1 · u 2 … u i - 1 ) . p j , r is the probability of j poisson arrivals during packet producing time interval ( r − 1 ) n f t f of connection l , hence p j , r = ( λ ( r - 1 ) n f t f ) j j ! - λ ( r - 1 ) n f t f . { overscore ( d )}= n stag t s +{ overscore ( w )}= n stag t s + n stag t s ·({ overscore ( x )}− 1 +{ overscore ( q )})−{ overscore ( i )}. the mean delay of the r th packet is { overscore ( d r )}= n stag t s +{ overscore ( w r )}= n stag t s + n stag t s { overscore ( q r )}−{ overscore ( i r )}. the mean absolute relative delay of an arbitrary packet { overscore ( δd )}={ overscore ( δw )}=| n stag t s ·{ overscore ( x )}·{ overscore ( δq )}−{ overscore ( δi )}|. the mean delay of an arbitrary packet is the average over all n ip packet delays observed during m = 1 , . . . , m busy periods : d _ = 1 x _ · n ip ∑ r = 1 x _ ∑ m = 1 m ∑ i = 1 n m d k m + i , r = 1 x _ ∑ r = 1 x _ d _ r = n stag t s + 1 x _ ∑ r = 1 x _ w _ r = n stag t s + n stag t s · 1 x _ ∑ r = 1 x _ q _ r - 1 x _ ∑ r = 1 x _ i _ r = n stag t s + w _ = n stag t s + n stag t s · ( x _ - 1 + q _ ) - i _ . the mean delay of the r th packet is the average over all n ip = ∑ m = 1 m ( n m ) r th d _ r = 1 n ip ∑ m = 1 m ∑ i = 1 n m d k m + i , r = n stag t s + 1 n ip ∑ m = 1 m ∑ i = 1 n m w k m + i , r = n stag t s + 1 n ip ∑ m = 1 m ∑ i = 1 n m n stag t s · q k m + i , r - 1 n ip ∑ m = 1 m ∑ i = 1 n m = n stag t s + w _ r = n stag t s + n stag t s · q _ r - i _ r the mean absolute relative delay of an arbitrary packet is the average over all { overscore ( x )}· n ip relative absolute packet delays observed during m = 1 , . . . , m busy periods is given by δ d _ = 1 x _ · n ip ∑ r = 1 x _ ∑ m = 1 m ∑ i = 1 n m d k m + i , r - d k m + i , 1 = = 1 x _ ∑ r = 1 x _ δ d r _ = 1 x _ ∑ r = 1 x _ δ w r _ = n stag t s · 1 x _ ∑ r = 1 x _ δ q r _ - 1 x _ ∑ r = 1 x _ δ i r _ = δ w _ = n stag t s · x _ · δ q _ - δ i _ average number of cumulative network packet arrivals at network arrival instant of packet number r is { overscore ( q r )}= r − 1 + 1 / 2 ( n ip − 1 )+{ overscore ( x r min ( p r ) )} and for arbitrary network packet arrival instants { overscore ( q )}= 1 / 2 ({ overscore ( x )}− 1 )+ 1 / 2 ( n ip − 1 )+{ overscore ( x min )}+{ overscore ( x min ( p ) )}. average relative number of cumulative network packet arrivals at network arrival instant of packet number r is { overscore ( δq r )}= r − 1 +{ overscore ( x r min ( p r ) )} and at arbitrary packet arrival instants δ q _ = x _ x _ - 1 q _ - q _ 1 = x _ 2 - x _ x _ - 1 x min ( p ) _ . average minimum amount of additional packets from previous connections at network arrival instant of packet number r x r min _ = 1 / n ip ∑ m = 1 m ∑ i = 1 n m x k m + i , r min x min _ = 1 / x _ ∑ r = 1 x _ x r min _ . average amount of additional packets from calls arriving after the observed connection i until network arrival instant of packet number r is x r min ( p r ) _ = 1 / n ip ∑ m = 1 m ∑ i = 1 n m x k m + i , r min ( p r ) x min ( p ) _ = 1 / x _ ∑ r = 1 x _ x r min ( p r ) _ . i _ ( λ , x _ , n f t f ) = 1 n ip ∑ m = 1 m ∑ i = 1 n m i i - 1 _ = 1 x _ ∑ r = 1 x _ i r _ = y _ ( λ ) + ( x _ - 1 ) 2 · n f t f i i - 1 _ ( λ , x _ , n f ′ t f ) = 1 x _ ∑ r = 1 x _ i i - 1 , r = y i - 1 ( λ ) + n f t f ( x _ - 1 ) 2 i r _ ( λ , n f t f ) = 1 n ip ∑ m = 1 m ∑ i = 1 n m i i - 1 , r = y _ ( λ ) + n f t f ( r - 1 ) 2 mean value of the relative absolute total inter - arrival time of an arbitrary packet : δ i _ ( λ , x _ , n f t f ) = 1 n ip ∑ m = 1 m ∑ i = 1 n m δ i i - 1 _ = 1 x _ - 1 ∑ r = 2 x _ δ i r _ = n f t f x _ 2 and the i th call : δ i i - 1 _ ( λ , x _ , n f t f ) = 1 x _ - 1 ∑ r = 2 x _ δ i i - 1 , r = n f t f x _ 2 = δ i _ and the i th packet : δ i r _ ( λ , n f t f ) = 1 n ip ∑ m = 1 m ∑ i = 1 n m δ i i - 1 , r = n f t f ( r - 1 ) . the mean value of n ip erlang -( i − l ) distributed time intervals is given by y _ ( λ ) = 1 n ip ∑ m = 1 m ∑ i = 1 n m y i - 1 . the hypo - exponential process is here used to construct a substitute probability distribution function and consists of a discrete time process d with random variable t l and mean t l ={ overscore ( d )}·( 1 − c ) linked with a negative exponential process m with random variable t 2 and mean t 2 ={ overscore ( d )}· c ftt o for o & lt ; t & lt ; tl fd ( t ; tl 2 )= if e -( t ) l t 2 for t & gt ; t , the probability distribution function of the hyper - exponential process is used to construct a substitute probability distribution function and is given by f d ( t , p , t 1 , t 2 )= 1 − p · e −( t / t 1 ) −( 1 − p )· e −( t / t 2 ) t 1 , 2 = d _ · ( 1 ± c 2 - 1 c 2 + 1 ) - 1 and probability p = d _ 2 · t 1 . | 7 |
referring to the drawings and more particularly to fig1 , a drain catheter in accordance with the present disclosure is generally shown at 10 . the drain catheter 10 is used for the drainage of bodily fluids from body cavities . for instance , the drain catheter 10 may be used for the drainage of fluid from cavities within the mediastinum , for instance after cardiac surgery . hence , the drain catheter 10 has a proximal end located outside the body , and a distal end within the body , with the longitudinal body of the drain catheter 10 within a body vessel . the drain catheter 10 has a main proximal drain tube 11 , a tube interface 12 and two or more distal drain tubes 13 . for clarity purposes , the main proximal drain tube 11 is relatively short in fig1 ( e . g ., fragmented ), but may have a substantial length relative to its outer diameter , to extend out of the body . moreover , the length of the main proximal drain tube 11 may be substantially greater than the length of each distal drain tube 13 . the tube interface 12 may be in or out of the body while the distal drain tubes 13 are mostly , if not fully , within the body . the end of the main proximal drain tube 11 located outside the body at end p is configured to be connected to any suitable suction source , fluid collection system , drainage device or accessory , while the free ends of the distal drain tubes 13 at end d of the drain catheter 10 are distributed at various locations of a body cavity to drain . various types of connectors may be located at the proximal end p of the main proximal drain tube 11 . any appropriate medical grade material may be used for the main proximal drain tube 11 . for instance , a silicone such as silastic ® of rx type may be used , with the hardness being selected as a function of the contemplated use , to sustain suction pressures in the range of 20 cm h 2 o without collapsing . the tube interface 12 is inserted into a distal - most end of the main proximal drain tube 11 . the tube interface 12 is the interface between the main proximal drain tube 11 and the plurality of distal drain tubes 13 . the tube interface 12 is connected to the main proximal drain tube 11 . the tube interface 12 may be sealingly connected to the main proximal drain tube 11 , so as to minimize pressure lost at the junction between the tube interface 12 and the main proximal drain tube 11 . the tube interface 12 is described in further details hereinafter . still referring to fig1 , there is illustrated three of the distal drain tubes 13 . the drain catheter 10 has two or more of the distal drain tubes 13 . the amount of distal drain tubes 13 is limited by the minimal dimensions of the distal drain tubes 13 : i . e ., depending on the application , a minimal diameter is required for the distal drain tubes 13 to operate efficiently . according to an embodiment , each of the distal drain tubes 13 is a multi - lumen catheter tube having longitudinal channels 13 a extending the full length of the distal drain tube 13 to maximize the amount of fluid captured by the drain tubes 13 , with a central cross - shaped core 13 b extending along the distal drain tubes 13 to provide structural integrity to the distal drain tubes 13 , and to support the elongated peripheral wall portions 13 c forming the outer periphery of the distal drain tubes 13 . the assembly of the central cross - shaped core 13 b and the elongated peripheral wall portions 13 c defines conduits within the drain tube 13 . for instance , the distal drain tubes 13 may be similar to the flexible drain portion described in u . s . pat . no . 4 , 398 , 910 , granted to blake et al . on aug . 16 , 1983 . other distal drain tube configurations are considered as well , with more or fewer of the longitudinal channels 13 a . for instance , perforated tubes and like other tubes may be used . to minimize any pain sustained by the patient , the distal drain tubes 13 are made of a flexible and resilient material , such as silicone . referring to fig1 , the tube interface 12 is shown having a cylindrical body 20 shaped to fill the interstitial space between the inner diameter of the proximal drain tube 11 and the outer diameters of the distal drain tubes 13 , in a generally airtight arrangement . referring to fig2 , the cylindrical body 20 may consist of a plurality of cylindrical body portions 20 a , 20 b and 20 c . the number of body portions is generally equivalent to the number of distal drain tubes 13 . for instance , if the drain catheter 10 has two distal drain tubes 13 , the tube interface 12 has two cylindrical body portions concurrently forming the cylindrical body 20 . an outer diameter 21 of the cylindrical body 20 is sized so as to be received in the distal - most end of the main proximal drain tube 11 . any appropriate type of interconnection between the tube interface 12 and the main proximal drain tube 11 is considered , such as a deformation fit , with or without the use of adhesives , etc . referring to fig1 and 2 , the cylindrical body 20 has canals 22 that will each receive a distal drain tube 13 . accordingly , the cylindrical body 20 has the same number of canals 22 as of distal drain tubes 13 . in another embodiment , the canals 22 converge to a single canal at a proximal end of the tube interface 12 . an inner diameter 23 ( i . e ., lumen ) of each of the canals 22 is sized to accommodate a proximal - most end of the distal drain tubes 13 , with the distal drain tubes 13 extend freely beyond the tube interface 12 . the assembly of the distal drain tubes 13 to the tube interface 12 , and of the tube interface 12 to the main proximal drain tube 11 is strong enough that these components remain connected to each other when the drain catheter 10 is pulled out of the body , despite frictional forces of the drain catheter with surrounding bodily tissue . the cylindrical body 20 is made of a medical grade material . according to an embodiment , the cylindrical body 20 is made from silicone , with a non - negligible level of resiliency . one type of silicone that may be used is silastic ® of rx type . in an embodiment , it is considered to use the same material for the distal drain tube 13 , although differing materials may be used as well . according to an embodiment , the cylindrical body 20 has a greater rigidity than the distal drain tubes 13 . with reference to fig2 , the cylindrical body portions 20 a , 20 b and 20 c are assembled onto the proximal - most ends of the distal drain tubes 13 . this ensures that the peripheral material of the canals 22 properly covers the ends of the distal drain tubes 13 and therefore produces a generally fluid - tight joint . in assembling the distal drain tubes 13 to the tube interface 12 , the length of the distal drain tubes 13 is adjusted by the user . the assembly of the cylindrical body portions 20 a , 20 b and 20 c capturing the ends of the distal drain tubes 13 may then be inserted in the main proximal drain tube 11 , using any appropriate type of manufacturing . for instance , the main proximal drain tube 11 may be resiliently deformed to insert the assembly therein . referring to fig3 , an alternative embodiment of the tube interface 12 is shown , with the cylindrical body 20 having slits 25 in communication with each of the canals 22 . in an embodiment , the slits 25 extend the full length of the canals 22 . in the natural state of the cylindrical body 20 , the slits 25 are closed by the resilience of the material of the cylindrical body 20 . the slits 25 may however be manually opened for the insertion therein of the distal drain tubes 13 . once the distal drain tubes 13 are inserted in the tube interface 12 ( with an appropriate length of the tubes 13 extending beyond the interface 12 ), the assembly may be inserted in the distal - most end of the main proximal drain tube 11 . it is observed that total frictional forces per volume of fluid are relatively lower for fluids circulating in the main proximal drain tube 11 with its single lumen , over the frictional forces for fluids in the plurality of distal drain tubes 13 . hence , the drain catheter 10 benefits from the lower frictional forces of the main proximal drain tube 11 for a substantial portion of the overall length of the drain catheter 10 . therefore , instead of having a plurality of tubes extending from an exterior of the body to the drained cavity , the use of a single proximal drain tube of greater lumenal dimensions connected to a plurality of distal drain tubes of smaller lumenal dimensions enhances the drainage of fluid . moreover , by using distal drain tubes 13 having longitudinal grooves 13 a extending proximally to the tube interface 12 and to the main proximal tube 11 , as in fig1 , the distal drain tubes 13 expose substantial drainage area to drain fluids from the bodily cavities . this may reduce the risk of clogging the various tubes . it is observed that the drain catheter 10 has a circular cross - sectional area . however , the drain catheter 10 may have any appropriate cross - sectional shapes ( oval , etc ), depending on the use of the drain catheter 10 . referring to fig4 and 5a - 5e , the drain catheter is shown at 10 ′ in accordance with another embodiment of the present disclosure . the drain catheter 10 ′ is similar to the drain catheter 10 shown in fig1 - 3 , whereby like elements will bear like reference numerals . one difference between the drain catheters 10 and 10 ′ is the interface portion 12 ′ of the catheter 10 ′ between the main proximal tube 11 and the distal drain tubes 13 . more specifically , referring concurrently to fig4 and 5e , it is observed that the drain catheter 10 ′ has the main proximal tube 11 with a circular cross - section ( although other section shapes are considered ). the circular cross - section is well suited for the connected of the main proximal tube 11 to a suction source . the distal drain tubes 13 have the longitudinal channels 13 a , the central cross - shaped cores 13 b , and the resulting conduits extending along the drain tubes 13 . the drain catheter 10 ′ is a single integral molded piece that may have an edgeless outer surface , with the interface portion 12 ′ being the transition between the circular shape of the main proximal tube to the specific shape of the distal drain tubes 13 as shown in fig5 e . hence , as shown in fig5 a , the interface portion 12 ′ has three lobes 40 . the number of lobes is in accordance with the number of distal drain tubes 13 . as shown in fig5 b , the interface portion 12 ′ transitions from the three - lobe configuration of fig5 a , to a configuration of three conduits 41 of circular inner diameter . as shown in fig5 c , the three interconnected conduits 41 of fig5 b detach to form three individual tubes 42 , having a diameter generally corresponding to that of the distal drain tubes 13 . then , sequentially to fig5 d , the tubes 42 of fig5 c feature the central cross - shaped core 13 b , but without the longitudinal channels 13 a , to then reach the configuration of fig5 e . in fig5 a to 5e , dimensions are provided as an example . these dimensions can be increased or reduced , proportionally to the outer diameter of the main proximal drain tube 11 of drain tubes 13 . referring to fig6 , various embodiments are provided with dimensions . these dimensions are provided as an example , and the drain catheters 10 / 10 ′ should not be restricted to these dimensions , as other dimensions are also considered . in accordance with a first embodiment , the drain tube 11 has an inner diameter 2 r of about 20 mm , with a thickness d of about 2 mm , for an outer diameter of about 24 mm . the nominal length of the drain tube 11 is up to 1 m . still in the first embodiment , the outer diameter of the tube interface 12 / 12 ′ is of about 20 mm ( i . e ., 2 r ), while the canals 22 have a radius r of about 4 mm . the distance b between the canals 22 is about 2 . 4 mm . the length of the tube interface 12 / 12 ′ is about 40 mm . still in the first embodiment , the outer diameter of the distal tubes 13 is of about 8 mm ( i . e ., 2 r ). the length of the distal tubes 13 is about 700 mm . the inner diameter of the drain tube 11 may range between 10 . 0 mm and 25 . 4 mm . the other dimensions of the drain catheter 10 / 10 ′ are generally proportional to that of the inner diameter of the drain tube 11 . in accordance with a second embodiment , the drain tube 11 has an inner diameter 2 r of about 10 mm , with a thickness d of about 2 mm , for an outer diameter of about 14 mm . the nominal length of the drain tube 11 is up to 1 m . still in the second embodiment , the outer diameter of the tube interface 12 / 12 ′ is of about 10 mm ( i . e ., 2 r ), while the canals 22 have a radius r of about 1 . 66 mm . the distance b between the canals 22 is about 2 . 44 mm . the length of the tube interface 12 / 12 ′ is about 40 mm . still in the second embodiment , the outer diameter of the distal tubes 13 is of about 3 . 3 mm ( i . e ., 2 r ). the length of the distal tubes 13 is about 700 mm . in an embodiment , the outer diameter of the proximal drain tube 11 is greater than a sum of an outer diameter of two of the distal drain tubes 13 . it is observed that the tube interface 12 / 12 ′ is arranged such that there is no increase in diameter from the distal tubes 13 to the main drain tube 11 , the largest outer diameter being that of the main drain tube 11 . whether the main drain tube 11 actually enters the body or not , the arrangement of the figures allows to use a single suction port and a single tube ( 11 ), for two or more distal drains 13 located at different regions of a body cavity . this may result in increased coverage resulting in enhanced drainage . | 0 |
[ 0035 ] fig1 shows a preferred use of an embodiment of a structure 10 of the present invention . the structure 10 in this embodiment is a stent 12 deployed in both the left inferior pulmonary vein ( lipv ) and the left superior pulmonary vein ( lspv ). the stent 12 includes a flared end 14 that is constructed and arranged to extend past the ostium of the the pulmonary vein and into the left atrium ( la ). the stent 12 is preferably constructed and arranged to maintain an outward force on the endothelium of the pulmonary vein and the left atrium , thus keeping the stent 12 in place and operating to prevent electrical communication between the pulmonary vein and the left atrium . the outward force is obtained through the use of an expandable stent , such as a self - expanding or mechanically expanding stent . the outward force necessary is dependent on the principal being practiced to prevent the electrical communication between the pulmonary vein and the left atrium . for example , one method of the present invention for preventing the aforesaid electrical flow is to stretch the endothelium , thereby inducing electrically - resistive fibrosis to occur . in this embodiment , the outward force exerted on the pulmonary vein by the stent 12 holds the pulmonary vein in a stretched condition sufficient to induce fibrosis . another method of the present invention for preventing the aforesaid electrical flow is to cut the current - carrying fibers in the endothelium and then stretching the pulmonary vein sufficiently to prevent the newly created fiber termini from reestablishing contact with each other . it is envisioned that the outward force necessary to keep the incision open would be less than that necessary to maintain the pulmonary vein in a stretched state . if the stent 12 is to include a flared end 14 , the desired shape can be established prior to compressing the stent into a delivery device ( not shown in fig1 but discussed below ). using a flexible bio - compatible material allows the stent to be compressed and released without significantly changing the configuration of the stent 12 . acceptable examples of bio - compatible materials include , but are not limited to , stainless steel , shape memory alloy , shape memory polymers , and stress - induced martensite alloys . elasticity and flexibility can be enhanced using various stent construction variations such as braiding density or fenestrated stent designs . some of the currently marketed self - expanding stents 101 include , but are not be limited to , the schneider wallstent , the scimed radiusô . the medtronic cardiocoil , the johnson & amp ; johnson s . m . a . r . tô stent , and guidant &# 39 ; s dynalinkô . it is understood that the structure 10 of the present invention is not limited to stents 12 . referring now to fig2 there is a shown a preferred use of an embodiment of a structure 10 whereby the structure 10 is a ring 16 deployed in both the left inferior pulmonary vein ( lipv ) and the left superior pulmonary vein ( lspv ). the ring 16 may also include a flared end 18 that is constructed and arranged to extend past the ostium of the the pulmonary vein and into the left atrium ( la ). construction and material considerations for the ring 16 are essentially the same as those considerations for the stent 12 mentioned above . a ring 16 may be preferable to a stent 12 in applications whereby it is desired to maximize the contact area between the endothelium of the pulmonary vein and the structure 10 . the electrical inhibiting effects of placing the structure 10 in the pulmonary vein may be enhanced chemically through the use of various coatings and / or coverings . coatings are herein distinguished from coverings as being non - fibrous chemically bonded materials bonded to the surfaces of the individual elements of the structure 10 . coatings are typically applied via electroplating , dipping or spraying . coverings are typically fabric - like fibrous materials that span any individual interstices of the structure 10 . coverings may be woven , electro - spun , pressed or sprayed . coverings typically cover only the exterior surfaces of the structure 10 whereas coatings may completely encompass all surfaces of the structure 10 , being applied as sparsely or generously as needed to accomplish the desired result . coatings and coverings will be collectively referred to herein as layers . layers envisioned for use with the structures 10 and methods of the present invention include , but are not limited to : conductive layers useable to short - out the natural conductive pathways ; non - conductive layers useable to block the natural conductive pathways ; a layer that includes a hydrophilic thrombus inhibiting polymeric agent such as heparin or heparin - benzalkonium chloride ; a layer of an anti - proliferative agent including but not limited to paclitaxel , rapamycin , discodermolide , or ecteinascidin 743 to help combat in - stent restenosis ; a layer made radioactive using a low level beta , and or , gamma isotope such as but not limited to , 32 - phosphoris or 192 - iridium yttrium 90 , palladium 103 , or strontium 90 , to name a few ; referring now to fig3 there is shown a preferred deployment device 30 of the present invention for use in deploying a self - expanding structure 10 . the deployment device 30 is a catheter assembly including a plurality of concentric elongate tubes of varying diameters . these elongate tubes include , from an exterior of the device 30 to an interior , a retractable sheath 32 , a stop 34 , an exterior balloon catheter 36 , and an interior balloon catheter 38 . the retractable sheath 32 is sliding disposed around the stop 34 . the stop 34 has an outer diameter that is slightly smaller than an interior diameter of the retractable sheath 32 , thereby allowing the two components to slide relative to each other . the stop 34 is shorter than the overall length of the device 30 , allowing room distal of the stop 34 for a self - expanding structure 10 . the retractable sheath 32 functions to prevent the self - expanding structure 10 from expanding until the sheath 32 is retracted . the stop 34 functions to act against the self - expanding structure 10 to prevent the structure 10 from retracting with the sheath 32 . the stop 34 includes a lumen 42 that contains the exterior and interior balloon catheters 36 and 38 . the interior balloon catheter 38 fits within a lumen of the exterior balloon catheter 36 . the interior balloon catheter 38 is longer than the exterior balloon catheter 36 and extends distally farther than any of the other aforementioned elongate tubes 32 , 34 , and 36 . around a distal end of the interior balloon catheter 38 there is disposed an atraumatic tip 44 . the additional length of the interior balloon catheter 38 provides adequate support for the soft atraumatic tip 44 . proximal of the atraumatic tip 44 , a distal end of a tapered balloon 46 is attached to the exterior surface of the interior balloon catheter 38 . a proximal end of the tapered balloon 46 is attached to the distal end of the exterior balloon catheter 36 . a significant difference in the interior diameter of the exterior balloon catheter 36 and the outer diameter of the interior balloon catheter 38 creates a gap 48 therebetween . the gap 48 is in fluid communication with the interior of the tapered balloon 46 and is thus used to send a bio - compatible fluid , such as saline , to and from the tapered balloon 46 for purposes of inflating and deflating the balloon 46 , respectively . also , the interior balloon catheter 38 optionally includes a lumen through which a guidewire 50 is slidingly disposed . in operation , the guidewire 50 may be used in conjunction with a steerable catheter ( not shown ) to place a distal end of the guide wire past the desired target location where the structure 10 is to be placed , such as in the pulmonary vein . once in place , the steerable catheter is retracted off of the guidewire 50 , leaving the guidewire 50 in place . the guidewire 50 is then used to locate the delivery device 30 at the desired location . the distal end 52 of the interior balloon catheter 38 is threaded over a proximal end of the guidewire 50 , and the device 30 is slowly advanced down the guidewire 50 while maintaining a stationary relationship between the guidewire 50 and the patient . while the device 30 is being advanced , the atraumatic tip 44 serves to guide the device 30 into the centers of the various body lumens en route to the desired destination as well as preventing the device 30 from causing any soft tissue damage . notably , the atraumatic tip 44 has a narrow distal end 54 and a wider proximal end 56 . preferably , the wider proximal end 56 has a greater diameter than the diameter of the sheath 32 , to prevent the relatively squared distal end of the sheath 32 from causing any damage . once the atraumatic tip 44 has reached the desired location where the structure 10 is to be deployed , the tip 44 , as well as the interior and exterior balloon catheters 38 and 36 are advanced farther until the balloon 46 extends past the distal end of the retractable sheath 32 and past the distal end of the structure 10 . next , the balloon 46 is inflated by pumping fluid from the proximal end of the device 30 , through the gap 48 , and into the balloon 46 . inflating the balloon 46 not only centers the device 30 in the pulmonary vein , but it also pre - stretches the pulmonary vein , thereby allowing the self - expanding structure 10 to expand to a greater size than if the structure 10 were expanding against the resistive force of the pulmonary vein . most self - expanding structures are more capable of resisting collapse than they are capable of expanding against counteracting forces . once the balloon 46 is inflated , the sheath 32 is retracted until the self - expanding structure 10 is completely exposed . the self - expanding structure 10 immediately deploys , expanding to at least the size of the interior of the pulmonary vein . fig4 shows a device 30 that has been used to deploy a self - expanding structure 10 . a preferred shape of the tapered balloon 46 is shown . the sheath 32 has been retracted past the stop 34 , allowing the structure 10 to expand . the structure 10 has a flared end 14 that hugs the interior wall of the left atrium la , thereby allowing the structure 10 to completely cover the ostium of the pulmonary vein pvo . [ 0053 ] fig5 shows a device 60 of the present invention that is useable with a structure 10 that is balloon - expandable . the structure 10 may be a balloon expandable stent . some of the currently marketed balloon expandable stents 109 include , but are not be limited to , the johnson & amp ; johnson bx velocityâ and entire palmaz - schatzô line of stents ; guidant &# 39 ; s multilinkô and subsequent generations , medtronic &# 39 ; s ave micro stent and subsequent generations , and boston scientific &# 39 ; s nir and express stents to name just a few . the device 60 also includes a plurality of concentric elongate tubes of varying diameters . like the device 30 , these elongate tubes include , from an exterior of the device 30 to an interior , a retractable sheath 32 , a stop 34 , an exterior balloon catheter 36 , and an interior balloon catheter 38 . also included is a deployment tube 62 disposed concentrically between the stop 34 and the exterior balloon catheter 36 . a deployment balloon 64 is attached at a proximal end to the stop 34 and at distal end to the deployment tube 62 . the retractable sheath 32 is sliding disposed around the stop 34 . the stop 34 has an outer diameter that is slightly smaller than an interior diameter of the retractable sheath 32 , thereby allowing the two components to slide relative to each other . the stop 34 is shorter than the overall length of the device 30 , allowing room distal of the stop 34 for the structure 10 and the deployment balloon 64 . the retractable sheath 32 functions to protect the expandable structure 10 and the soft tissue of the patient during insertion of the device 60 . the stop 34 functions to act against the expandable structure 10 to prevent the structure 10 from retracting with the sheath 32 . the stop 34 is also sealed to the proximal end of the deployment balloon 64 . the stop 34 includes a lumen 42 that contains the exterior and interior balloon catheters 36 and 38 , as well as the deployment tube 62 . the deployment tube 62 is small enough to leave a fluid gap 66 between the stop 34 and the deployment tube 62 . the deployment tube 62 is longer than the stop 34 and has sealed to it the distal end of the deployment balloon 64 . the fluid gap 66 is in fluid communication with the interior of the balloon 64 and is used to inflate and deflate the balloon 64 . the deployment tube 62 includes a lumen that houses the exterior balloon catheter 36 and the interior balloon catheter 38 . the interior balloon catheter 38 fits within a lumen of the exterior balloon catheter 36 . the interior balloon catheter 38 is longer than the exterior balloon catheter 36 and extends distally farther than any of the other aforementioned elongate tubes 32 , 34 , 36 , and 62 . around a distal end of the interior balloon catheter 38 there is disposed an atraumatic tip 44 . the additional length of the interior balloon catheter 38 provides adequate support for the soft atraumatic tip 44 . proximal of the atraumatic tip 44 , a distal end of a tapered balloon 46 is attached to the exterior surface of the interior balloon catheter 38 . a proximal end of the tapered balloon 46 is attached to the distal end of the exterior balloon catheter 36 . a significant difference in the interior diameter of the exterior balloon catheter 36 and the outer diameter of the interior balloon catheter 38 creates a gap 48 therebetween . the gap 48 is in fluid communication with the interior of the tapered balloon 46 and is thus used to send a bio - compatible fluid , such as saline , to and from the tapered balloon 46 for purposes of inflating and deflating the balloon 46 , respectively . also , the interior balloon catheter 38 optionally includes a lumen through which a guidewire 50 is slidingly disposed . in operation , the guidewire 50 may be used in conjunction with a steerable catheter ( not shown ) to place a distal end of the guide wire past the desired target location where the structure 10 is to be placed , such as in the pulmonary vein . once in place , the steerable catheter is retracted off of the guidewire 50 , leaving the guidewire 50 in place . the guidewire 50 is then used to locate the delivery device 30 at the desired location . the distal end 52 of the interior balloon catheter 38 is threaded over a proximal end of the guidewire 50 , and the device 30 is slowly advanced down the guidewire 50 while maintaining a stationary relationship between the guidewire 50 and the patient . while the device 30 is being advanced , the atraumatic tip 44 serves to guide the device 30 into the centers of the various body lumens en route to the desired destination as well as preventing the device 30 from causing any soft tissue damage . notably , the atraumatic tip 44 has a narrow distal end 54 and a wider proximal end 56 . preferably , the wider proximal end 56 has a greater diameter than the diameter of the sheath 32 , to prevent the relatively squared distal end of the sheath 32 from causing any damage . once the atraumatic tip 44 has reached the desired location where the structure 10 is to be deployed , the tip 44 , as well as the interior and exterior balloon catheters 38 and 36 are advanced farther until the tapered balloon 46 extends past the distal end of the retractable sheath 32 and past the distal end of the structure 10 . next , the balloon 46 is inflated by pumping fluid from the proximal end of the device 30 , through the gap 48 , and into the balloon 46 . inflating the balloon 46 not only centers the device 60 in the pulmonary vein , but it also helps anchor the device 60 at the desired location so the device 60 doesn &# 39 ; t move axially while the structure 10 is being deployed . once the balloon 46 is inflated , the sheath 32 is retracted until the expandable structure 10 is completely exposed . the structure 10 , once exposed , is next deployed by pumping fluid into the gap 66 to the interior of the deployment balloon 64 . the deployment balloon 64 inflates and acts against an interior surface of the structure 10 , causing the structure 10 to expand . fig6 shows a device 60 that has been used to deploy an expandable structure 10 . a preferred shape of the tapered balloon 46 is shown . the sheath 32 has been retracted past the stop 34 , and the deployment balloon 64 is fully inflated , expanding the structure 10 . the structure 10 has a flared end 14 that hugs the interior wall of the left atrium la , thereby allowing the structure 10 to completely cover the ostium of the pulmonary vein pvo . also shown in fig6 is an incision 70 in the endothelium of the pulmonary vein that was made to inhibit the flow of electrical current between the pulmonary vein and the left atrium . the incision is being held open by the outward force of the structure 10 , thereby preventing the cut conductive fibrils from reestablishing electrical communication . the incision may be made in a variety of ways . in a preferred embodiment , a cutting balloon ( not shown ) is used to make the incision 70 . after the steerable catheter is used to place the guidewire 50 in the desired location , the guidewire 50 is used to deliver a cutting balloon to the target site . the cutting balloon is inflated to make the incision 70 and is then deflated and removed . with the guidewire 50 still in place , a structure 10 , expandable or self - expanding , is placed within the circumferential incision using the aforementioned methods . alternatively , the cutting balloon may be incorporated into either device 30 or 60 . for example , the cutting balloon could replace the tapered balloon 46 on either device . the cutting balloon could thus be located at the desired point of incision , inflated to make the cut , deflated , and then extended distally to allow the structure 10 to be advanced under the incision 70 . the structure 10 is then deployed as described above . although exemplary embodiments of the present invention have been described in some detail herein , the present examples and embodiments are to be considered as illustrative and not restrictive . the invention is not to be limited to the details given , but may be modified freely within the scope of the appended claims , including equivalent constructions . | 0 |
detailed descriptions of one or more embodiments of the invention follow , examples of which may be graphically illustrated in the drawings . each example and embodiment is provided by way of explanation of the invention , and is not meant as a limitation of the invention . for example , features described as part of one embodiment may be utilized with another embodiment to yield still a further embodiment . it is intended that the present invention include these and other modifications and variations . aspects of the present invention are described below in the context of packaging within a widget the logic and resources needed to style the widget , in real - time , where it is accessed , and facilitating the inclusion of the widget in another web page . fig1 is a simplified block diagram illustrating how the invention may be employed . similar to other web - based widgets , a widget as defined herein may be embedded in a web page ( as discussed herein ) where it may be accessed by user 105 through a web browser ; the widget may receive , over a network 100 ( e . g ., the internet ), and from server 110 , the information it is to display ( e . g ., stock quotes , weather information , etc .). fig2 illustrates a conventional process by which widgets are customized . there are a number of different ways a user may come across a widget he would like to use , including perusing a site that offers many and various widgets , or seeing a particular widget on another page , etc . once a user has found a widget he likes , he will generally want to customize it in some manner ( e . g ., if the widget reports stock quotes , the user may want to define which companies &# 39 ; information to display , etc .). heretofore , the customization process has generally required the user to visit a web page , not unlike customization page 200 . usually , customization page 200 includes various widget options 205 that may be defined by the user . such options may include variables like height and width , and various other things such as whether to include certain widget elements in the widget ( e . g ., a stock widget may provide an element for displaying a graph of a certain stock &# 39 ; s performance over the past year ), etc . customization page 200 may also include widget preview 210 so that the user may see what the widget will look like with his given settings ( i . e ., the options as the user defines them ). generally , after a user has defined the options the way he wants , he will be presented with yet another page that includes the code he will use to embed the now - customized widget into the web page / site of his choice . in some cases , the user may actually be required to modify the embed code himself ; the widget may have no gui front - end for its customization and so the user may have to edit the embed code and use a kind of trial - and - error approach to get the widget to look / behave the way he wants . if the user does not have much experience modifying such code , he may find himself unable to customize the widget . in contrast , the invention — an inline - customizable widget — allows the user to define the widget options from within the widget itself , and without having to edit code . revisiting the previous examples , the user may come upon an inline - customizable widget he likes in a number of different ways , but instead of being made to search for the widget and then customize it through various pages not necessarily related to the widget &# 39 ; s instantiation ( if customization is available at all ), the user may customize the widget directly from where it was found , and then “ export ” the customized widget to a web page of his choice . for example , if a user comes across a web page with a widget that he likes , an inline - customizable widget may provide a “ button ” ( e . g ., a hypertext link , etc .) through which the user can alert the widget that he would like to begin customizing it ( i . e ., that he will customize the widget he is currently viewing ). fig3 is a flowchart illustrating interaction with widgets according to the present invention , and fig4 a - 4c illustrate an exemplary embodiment of the present invention ; both figures will be referenced together for the remainder of the discussion below . as illustrated at block 300 , a user comes across inline - customizable widget 405 embedded within web page 400 ( see fig4 a ). as discussed above , the user may come across widget 405 while browsing the web , browsing a particular site dedicated to making widgets available for download , or the like . widget 405 may comprise any of a number of widget elements 410 , 415 , and 420 , which display information , control some aspect of the widget , etc . widget 405 may have some text or an image or some other way to signal to a user that the widget is customizable ; the user may then take some action ( e . g ., click on the text , etc .) and begin the customization process , as illustrated at blocks 305 and 310 . unlike other widget customization schemes , the user is not transferred to another page for customization , or given the embed code and told to edit it to his liking ; instead , widget 405 becomes the customization “ page ,” as illustrated in fig4 b . the logic and code needed for the widget &# 39 ; s customization is built into the widget itself . this scheme not only allows for a user &# 39 ; s immediate gratification ( e . g . by not requiring the user to go to some other site to begin the customization process and / or modify any code ), but also reduces the number of interfaces the widget producer has to create and maintain because the customization process is built into the widget itself . for example , and as previously explained , widgets generally require the user to use a separate web page for their customization , and these web pages must be maintained by someone ( e . g ., the widget producer , etc . ); an inline - customizable widget eliminates the additional web page element , and so the widget producer can concentrate on only the widget itself . moreover , the user &# 39 ; s entire experience is simplified , which may facilitate increased adoption and use of the widget . fig4 b is a snapshot of a possible customization process , as built into widget 405 . for exemplification purposes only , customization options 425 are similar to those found in fig2 . it will be appreciated by those of skill in the art that customization options 425 may vary to differing degrees from those shown and will depend largely on the widget &# 39 ; s purpose and function . for example , a widget for displaying the most recent news items from a particular source would have different customization options ( e . g ., how many news items to display , etc .) than would a widget used to display the weather in particular cities ( e . g ., which cities , etc .). customization options 425 may be displayed inside the original boundaries of widget 405 ( i . e ., the footprint widget 425 had when the user originally started interacting with it ); however , if there are more options than can be displayed at once , and within the confines of the widget , the widget can be made to accommodate this in a number of ways . for example , the widget may be programmed to resize itself so that all options can fit , or the options may be “ flipped ” through ( i . e ., after the initial options are set , the user can choose to see more options , etc . ), or the options may be scrolled through within the widget , etc . it will be understood by those of skill in the art that the automatic resizing of the widget may be limited by the markup surrounding it and controlling its presentation . it may be the case that widget 405 contains various “ buttons ” for signaling to the widget that the user would like to preview the widget with the just - defined options , that he is done with the customization phase , etc . for example , widget 405 contains “ buttons ” 430 and 435 for previewing the widget and alerting the widget that the user is done customizing it . depending on the widget producer &# 39 ; s preference , it may be the case that the widget is automatically previewed after each option is changed , instead of requiring the user to explicitly tell the widget to remove the customization options and show the ‘ new ’ widget . once the user is satisfied that the widget looks and acts the way he wants , he may signal to the widget that he is done and for the widget to reveal the code needed for the widget &# 39 ; s use , as illustrated at block 315 and by “ button ” 435 . in one embodiment , widget 405 may then display the required code 440 within the widget itself , as shown in fig4 c . similar to the widget code provided by the usual widget customization pages , code 440 may be plain ascii text to be copied and pasted into the source code of the user &# 39 ; s web page . widget 405 may include a “ button ” 445 that , when pressed , copies code 440 to the clipboard of the user &# 39 ; s operating system . in either case , the widget may revert back to the original state in which the user found it ( e . g ., by clicking on another “ button ” used for this purpose ; or , where the code is automatically copied to the clipboard , automatically reverting to the original state after the code has been placed on the clipboard , etc .). in another embodiment , widget 405 may be able to “ talk ” directly with various online entities ( e . g ., my yahoo !™, myspace ™, facebook ™, etc .) through , for example , an application programming interface ( api ). in such an implementation , the user may simply choose ( through various “ buttons ,” drop - downs , etc .) to which site ( s ) he would like the widget installed . the widget may include further customization options depending on the site / service to which it will be added ( as chosen by the user ). for example , after completing the customization of a widget , the user may wish to add the widget to his my yahoo !™ “ homepage ,” which may allow the user to specify , for example , on which side of the page the widget should be installed , etc . these site - specific options may appear only after the user has decided on a specific site / service on which he would like the widget to persist . the sequence and numbering of blocks depicted in fig3 is not intended to imply an order of operations to the exclusion of other possibilities . those of skill in the art will appreciate that the foregoing systems and methods are susceptible of various modifications and alterations . for example , the widget may not allow the user to embed the widget in a web page of his choosing , but instead may require the user to choose one of various site / services in which it may be embedded ; in such a case , block 315 would not be needed . several features and aspects of the present invention have been illustrated and described in detail with reference to particular embodiments by way of example only , and not by way of limitation . those of skill in the art will appreciate that alternative implementations and various modifications to the disclosed embodiments are within the scope and contemplation of the present disclosure . therefore , it is intended that the invention be considered as limited only by the scope of the appended claims . | 6 |
fig1 , 2 and 12 show a decorative ornament 10 according to one embodiment of the present invention . the decorative ornament 10 generally include at least one anchor portion 20 , at least one support portion 30 and a least one decorative portion 40 . more specifically , the embodiment illustrated in fig1 and 2 indicates three anchor portions 20 having hook 22 and chain 24 assemblies , the anchor portion 20 being positioned approximately equilaterally from one another ( although other orientations are contemplated herein ), in operable connection with a light fixture ( not shown in fig1 and 2 ; shown in fig1 ) and a support portion 30 . the decorative portion 40 , as shown in fig1 , 2 and 12 , includes a plurality of beaded string assemblies 42 affixed hangingly from a support portion 30 . an anchor portion 20 may include any number of materials , designs , shapes and lengths that would serve to secure a decorative ornament 10 to a light fixture ( not shown in fig1 and 2 ; shown in fig1 ) or a surface at or near a light fixture of a home or office exterior or interior ( not shown ), including but not limited to hooks , clips and other fasteners . accordingly , an anchor portion 20 may include a variety of shapes and sizes , including but not limited to l - shaped , u - shaped , arcuate , paper clip - type configurations and other similar shapes that one of ordinary skill in the art would contemplate for use in accordance with the present invention . an anchor portion 20 may include a variety of materials , including but not limited to , plastic , metal , wood , glass , nylon , elastic and any combination thereof . an anchor portion 20 further may include any predetermined length selected to achieve a desired aesthetic and physical result . most preferably , the anchor portion 20 is comprised of material that is heat - and / or flame - resistant or , at a minimum , heat - tolerant . a support portion 30 may include any number of materials and designs that would serve to support a decorative portion 40 of a decorative ornament 10 , while also providing an operable connection with at least one anchor portion 20 . a support portion 30 may include any number of materials and shapes . the types of materials contemplated for use in a support portion 30 would include , but are not limited to , different types of metals ( for example , various gauges of wire , rings , etc ), plastics , wood , glass , nylon and elastic , as well as any number of combinations thereof . the types of shapes contemplated for use in a support portion 30 would include , but are not limited to , rings , circles , squares , rectangles , ellipses , whether such shape ( and / or material ) is contiguous or non - contiguous and / or such shape is occupying one dimensional plane or multi - dimensional planes , in orientation . preferably , a support portion 30 is constructed of materials ( for example , rigid plastic ), shapes , or a combination thereof , such that a predetermined weight of a decorative portion 40 is provided adequate support to achieve a desired aesthetic effect of an installed decorative ornament 10 . most preferably , a support portion 30 is comprised of material that is heat - and / or flame - resistant or , at a minimum , heat - tolerant . a decorative portion 40 may include any number of materials and designs that would serve to provide a desired aesthetic effect of a decorative ornament 10 . such designs of the decorative portion 40 may further include numerous patterns and orientations , whether predetermined or customized , as desired by the consumer . the decorative portion 40 may include beading , chains , ribbons , strings , wires and any combination thereof ( each of various possible shapes , sizes and materials ), of any desired predetermined length contemplated by one of ordinary skill in the art , selected to achieve a desired aesthetic or physical result . materials contemplated for use in the decorative portion 40 may include , but are not limited to , glass , wood , metals , fabric , nylon , plastic , paper and other materials that are known by ordinary persons of skill in the art . most preferably , a decorative portion 40 is comprised of material that is heat - and / or flame - resistant or , at a minimum , heat - tolerant . fig3 and 4 illustrate a decorative ornament 10 according to another embodiment of the present invention , including three anchor portions 20 , removably connected with a light fixture 50 , and also operably connected with a substantially combined support portion 30 and decorative portion 40 . more specifically , the decorative ornament 10 includes three anchor portions 20 having three separate hook 22 and beaded string 26 assemblies , operably connected with the substantially combined support portion 30 and decorative portion 40 . additionally , the combined support portion 30 and decorative portion 40 include a substantially planar support portion 30 which is operably connected with a helical or spring - like decorative portion 40 , the decorative portion 40 including a foundation of memory wire 48 threaded through decorative beads 45 ( as well as optionally affixed additional decorative beaded strings 42 , as shown ) and formed into a desired overall shape . fig5 and 6 illustrate a decorative ornament 10 according to another embodiment of the present invention , including three anchor portions 20 , removably connected with a light fixture 50 , and also operably connected with a substantially combined support portion 30 and decorative portion 40 . more specifically , the decorative ornament includes three anchor portions 20 having three separate hook 22 and chain 24 assemblies , operably connected with the substantially combined support portion 30 and decorative portion 40 , in the form of a substantially bowl shape , all of which produces a desired decorative and lighting effect . fig7 and 8 illustrate a decorative ornament 10 according to another embodiment of the present invention , including three anchor portions 20 , a support portion 30 and decorative portion 40 . more specifically , the decorative ornament 10 includes three anchor portions 20 having three separate hook 22 and beaded string 26 assemblies , operably connected with a support portion 30 including a rigid material ring , which is operably connected with a decorative portion 40 including numerous beaded string assemblies that are gathered at a predetermined region along the length of the strings assemblies , to produce a desired aesthetic effect . fig9 and 10 illustrate two different embodiments of anchor portions 20 contemplated for use with the present invention . namely , fig9 illustrates one embodiment of a hook 22 and beaded string 26 assembly contemplated for use as an anchor portion 20 as described herein . fig1 illustrates one embodiment of a hook 22 and chain 24 assembly as contemplated for use as an anchor portion 20 as described herein . fig1 illustrates a decorative ornament 10 according to another embodiment of the present invention , including three anchor portions 20 , a support portion 30 and decorative portion 40 . more specifically , the decorative ornament 10 includes three anchor portions 20 having three separate hook 22 and beaded string 26 assemblies , and a substantially combined support portion 30 and decorative portion 40 . the combined support portion 30 and decorative portion 40 include a support portion 30 which is operably connected with the anchor portions 20 by a first support ring 32 placed in a substantially perpendicular orientation relative to a light fixture 50 and a second support ring 34 placed in a substantially parallel orientation relative to a light fixture 50 , and decorative portions 40 operably connected with the above - described support portions 32 , 34 . fig1 , 15 and 16 illustrate decorative ornaments 10 according to another embodiment of the present invention , including ( each ) three anchor portions 20 , a support portion 30 and decorative portion 40 . more specifically , the decorative ornaments 10 includes three anchor portions 20 having three separate hook 22 and chain 24 assemblies , operably connected concurrently with a surface of a light fixture 50 and a support portion 30 including a rigid material ring , which is operably connected with a decorative portion 40 including numerous beaded string assemblies 42 that are gathered at a predetermined regions along the lengths of the beaded strings assemblies 42 ( respectively ), to produce desired aesthetic effects . fig1 illustrates a decorative ornament 10 according to another embodiment of the present invention , including three anchor portions 20 , a support portion 30 and decorative portion 40 . more specifically , the decorative ornaments 10 includes three anchor portions 20 having three separate hooks 22 , operably connected with a support portion 30 including a rigid material ring , which is operably connected with a decorative portion 40 which is operably connected with the support portion 30 by first attachment rings 44 at numerous predetermined locations along the support portion 30 and , further , by second attachment rings 46 connected with the first attachment rings 44 and supporting gathered beaded string assemblies 42 , to produce a desired aesthetic effect . fig1 illustrates a decorative ornament 10 according to another embodiment of the present invention , including three anchor portions 20 , a support portion 30 and a decorative portion 40 . more specifically , the decorative ornaments 10 includes three anchor portions 20 having three separate hooks 22 , operably connected with a support portion 30 including a rigid material ring , which is operably connected with a decorative portion 40 . the decorative portion 40 is operably connected with the support portion 30 at numerous predetermined locations along the support portion 30 as shown and , further , the decorative portion 40 is connected by rings 48 supporting beaded string assemblies 42 that are interconnected at predetermined regions along the lengths of the beaded string assemblies 42 , to produce a desired aesthetic effect . fig1 illustrates a decorative ornament 10 according to another embodiment of the present invention , including two anchor portions 20 removably connected with a light fixture 50 , and also operably connected with a substantially combined support portion 30 and decorative portion 40 . more specifically , the decorative ornament includes two anchor portions 20 having hook 22 and chain 24 assemblies , operably connected with the substantially combined support portion 30 and decorative portion 40 , in the form of a substantially cylindrical - shaped plastic piece and having a plurality of plastic strips 43 hangingly affixed thereon , all of which produces a desired decorative and lighting effect . fig1 a illustrates a decorative ornament 10 according to another embodiment of the present invention , including a substantially combined anchor portion 20 and support portion 30 , removably connected with a light fixture 50 , and also operably connected with a decorative portion 40 . as illustrated in fig1 b , the decorative ornament 10 includes a substantially combined anchor portion 20 and support portion 30 is removably affixed at or about a light fixture 50 at its rim 52 , which is also operably connected with a decorative portion 40 . the decorative portion 40 includes the form of a substantially cylindrical - shaped plastic piece and further includes a plurality of plastic strips 43 hangingly affixed thereon , all of which produces a desired decorative and lighting effect . fig2 illustrates a decorative ornament 10 according to another embodiment of the present invention , including three anchor portions 20 removably connected with a light fixture 50 , and also operably connected with a substantially combined support portion 30 and decorative portion 40 . more specifically , the decorative ornaments 10 includes three anchor portions 20 ( only one is shown ) having three separate hook 22 and chain 24 assemblies , operably connected with a substantially combined support portion 30 including a rigid material ring , which is operably connected with a decorative portion 40 . the decorative portion 40 includes a substantially cylindrical , substantially translucent fabric material ( for example , nylon ) operably connected with a weighted ring 47 of predetermined shape and material ( as earlier described herein ) sufficient to hold the decorative portion 40 at a predetermined position and length , sufficient to produce a desired aesthetic effect . although the invention has been described in terms of particular embodiments and applications , one of ordinary skill in the art , in light of this teaching , can generate additional embodiments and modifications without departing from the spirit of or exceeding the scope of the claimed invention . accordingly , it is to be understood that the drawings and descriptions herein are proffered by way of example to facilitate comprehension of the invention and should not be construed to limit the scope thereof . | 5 |
hereinafter , embodiments of the present invention will be described using appended drawings . fig1 illustrates an example of an optical system configuration of an optical pickup 11 in an optical information recording / reproduction device 10 of the present invention . first , a recording process of a hologram will be described . a light beam emitted from a light source 101 , such as a laser , is transmitted through a beam shaping element 104 to be shaped into a perfect circle shape . the light transmitted through a shutter 111 arranged in a focal distance of a relay lens 110 , through a mirror 109 , is prevented from becoming return light to the light source 101 , by an optical isolator 112 . then , the light is incident on a polarization beam splitter ( pbs ) prism 115 , after a polarization direction is controlled such that light quantity ratios of p polarized light and s polarized light become desired ratios by an optical element 113 configured from a ½ wavelength plate and the like . the light beam transmitted through the pbs prism 115 works as signal light 116 , and is transmitted through a phase mask 118 , a relay lens 119 , and a pbs prism 120 , and is incident on a spatial light modulator 121 , after a beam diameter is enlarged by a beam expander 117 . the signal light to which information is added by the spatial light modulator 121 is reflected at the pbs prism 120 , and is propagated in a relay lens 122 and a polytopic filter 123 . after that , the signal light is concentrated on an optical information recording medium 1 by an objective lens 124 . meanwhile , the light beam reflected at the pbs prism 115 works as reference light 125 , and is incident on a galvanometer mirror 130 , after passing through a wedge prism 127 that is an angle adjustment element in a pitch direction , and an aperture 128 for controlling a light flux diameter of the reference light to prevent excess exposure of the optical information recording medium 1 . the galvanometer mirror 130 can adjust an angle by an actuator , and thus can set the incident angle of the reference light incident on the optical information recording medium 1 after passing through a scanner lens 131 to a desired angle . to set the incident angle of the reference light , an element that converts a wavefront of the reference light may be used in place of the galvanometer mirror . by causing the signal light and the reference light to be incident to be overlapped with each other in the optical information recording medium 1 , an interference fringe pattern is formed in the recording medium , and the pattern is written in the optical information recording medium , so that the information is recorded . further , the incident angle of the reference light to be incident on the optical information recording medium 1 can be changed by the galvanometer mirror 130 . therefore , recording by angle multiplexing can be performed . next , a reproduction process of a hologram will be described . a light beam obtained by causing the reference light 125 to be incident on the optical information recording medium 1 , and to be transmitted through the optical information recording medium 1 passes through an optical element 132 configured from a ¼ wavelength plate , is reflected at a galvanometer mirror 130 that can adjust an angle by an actuator , and then passes through the optical element 132 again , so that a polarization state of the reference light is converted , and reproduction reference light is generated . reproduced light reproduced by the reproduction reference light is propagated in the objective lens 124 , the relay lens 122 , and the polytopic filter 123 . following that , the reproduced light is transmitted through the pbs prism 120 and is incident on a photodetector 133 , so that the recorded signal can be reproduced . as the photodetector 133 , an imaging element such as a cmos image sensor or a ccd image sensor can be used , for example . however , any element can be used as long as the element can reproduce the page data . fig2 is a diagram illustrating another configuration of an optical pickup 11 . a light beam emitted from a light source 201 is transmitted through a collimating lens 202 , and is incident on a shutter 203 . when the shutter 203 is open , the light beam passes through the shutter 203 , and is then incident on a polarization beam splitter 205 , after a polarization direction is controlled such that light quantity ratios of p polarized light and s polarized light become desired ratios by an optical element 204 configured from a ½ wavelength plate and the like . the light beam transmitted through the polarization beam splitter 205 is incident on a spatial light modulator 208 through a polarization beam splitter 207 . signal light 206 to which information is added by the spatial light modulator 208 is reflected at the polarization beam splitter 207 , and is propagated in an angle filter 209 having a characteristic of allowing only a light beam with a predetermined incident angle to pass through . after that , the signal light beam is concentrated on an optical information recording medium 1 by an objective lens 210 . meanwhile , the light beam reflected at the polarization beam splitter 205 works as reference light 212 , is set to be in a predetermined polarization direction by a polarization direction conversion element 219 according to at the time of recording or at the time of reproduction , and is then incident on a lens 215 through a mirror 213 and a mirror 214 . the lens 215 serves a function to concentrate the reference light 212 to a back focus surface of the objective lens 210 , and the reference light once concentrated on the back focus surface of the objective lens 210 becomes parallel light again by the objective lens 210 , and is incident on the optical information recording medium 1 . here , the objective lens 210 or an optical block 221 can be driven in a direction illustrated by the reference sign 220 , and the position of the objective lens 210 or the optical block 221 is shifted along a driving direction 220 , so that a relative positional relationship between the objective lens 210 and a concentrated point on the back focus surface of the objective lens 210 is changed . therefore , the incident angle of the reference light incident on the optical information recording medium 1 can be set to a desired angle . note that the incident angle of the reference light may be set to the desired angle by driving the mirror 214 by an actuator , instead of driving the objective lens 210 or the optical block 221 . by causing the signal light and the reference light to be incident to be overlapped with each other in the optical information recording medium 1 , an interference fringe pattern is formed in the optical information recording medium , and this pattern is written in the recording medium , so that information is recorded . further , by shifting the position of the objective lens 210 or the optical block 221 along the driving direction 220 , the incident angle of the reference light to be incident on the optical information recording medium 1 can be changed . therefore , recording by angle multiplexing can be performed . when the recorded information is reproduced , the reference light is incident on the optical information recording medium 1 , and the light beam transmitted through the optical information recording medium 1 is reflected at a galvanometer mirror 216 , so that reproduction reference light is generated , as described above . reproduced light reproduced by the reproduction reference light is propagated in the objective lens 210 and the angle filter 209 . after that , the reproduced light is transmitted through the polarization beam splitter 207 and is incident on a photodetector 218 , and a recorded signal can be reproduced . by configuring the optical system illustrated in fig2 to cause the signal light and the reference light to be incident on the same objective lens , the optical system of fig2 can have an advantage of a substantially decrease in size , compared with the optical system configuration illustrated in fig1 . the present invention can also be applied to the optical system like fig2 . fig3 illustrates a method of detecting angle deviation in the optical pickup 11 of fig1 . for example , when a laser is used as the light source 101 , beam pointing cannot sometimes become constant on a constant basis , due to vibration , temperature , backlash of components , and the like . when the beam pointing is deviated , the incident angle of light to a target component becomes larger as a distance from the laser to the target component becomes larger , and an aberration occurs . such an aberration may become a cause of deterioration of quality of a hologram reproduced image . therefore , in the present embodiment , detection of beam pointing deviation is performed in the photodetector 133 used at the time of reproduction of a hologram . as the photodetector 133 , a camera may be used , for example . as illustrated in fig1 ( a ) , it can be considered that the optical information recording medium can be most efficiently used for recording when an area ( diameter ) of the reference light that covers the signal light on the optical information recording medium is minimized therefore , this state is defined as an ideal state . the ideal state has a profound effect in terms of prevention of unnecessary exposure of the optical information recording medium and high - density recording . however , in this case , if only a little position deviation or angle deviation of the optical component occurs , the signal light and the reference light stop interfering with each other , and reproduction quality is deteriorated . therefore , the area of the reference light is desirably as small as possible although the area is not the minimum area . further , as illustrated in fig1 ( b ) , it is important to perform adjustment to cause the signal light to come to the center of the reference light in the vertical and horizontal directions in a focal position of the signal light , when the optical information recording medium is viewed from directly above , and to complete an optical system in which the reference light and the signal light interfere with each other on an upper surface and a lower surface of a recording layer of the optical information recording medium on a constant basis , at a lowest reference light angle used for recording in design ( a smallest angle in design , which indicates an angle made by the reference light and a normal line of a boundary surface of the optical information recording medium , as illustrated in the lower drawing of fig1 ( a ) ). after constant interference between the reference light and the signal light on the recording layer of the optical information recording medium is confirmed , the position of the photodetector 133 is adjusted so that the center of the beam of the signal light comes to the center of the photodetector 133 . in this case , if an aperture as small as possible to the extent that the light can be temporarily detected after the relay lens 119 is inserted , and the light is focused to make the beam center of the signal light more recognizable , the adjustment can be easily performed . further , as another method , a lens or the like may be inserted in front of the photodetector 133 to concentrate the signal light . further , the position of the photodetector 133 may be adjusted to cause the beam center of the signal light to come to the center of the photodetector 133 when an area where the signal light and the reference light interfere is minimized . note that , here , the upper surface and the lower surface of the recording layer of the optical information recording medium indicate the portions illustrated in fig1 ( a ) . note that it is necessary to cause the p polarized light transmitted through the pbs prism 115 to become the s polarized light in front of the pbs prism 120 in order to cause the p polarized light to be incident on the photodetector 133 . therefore , the ½ wavelength plate is inserted into an optical path from the pbs prism 115 to the pbs prism 120 , to cause the p polarized light to the s polarized light . as another method , when a film of the pbs prism 115 is designed to transmit the p polarized light by 100 % and reflect the s polarized light by 100 %, if a film of the pbs prism 120 is designed to transit the p polarized light by 95 % and reflect the p polarized light by 5 %, and reflect the s polarized light by 100 %, the light can be incident on the photodetector 133 , and can be detected . the above methods are examples . the light is caused to be incident on the photodetector 133 , and the beam pointing is detected , as described above . when the beam pointing deviation occurs , the position of the beam incident on a camera is changed . therefore , the angle of the mirror 114 is adjusted so that the beam comes to the center of the photodetector 133 , and the angle of the light is adjusted so that a maximum value of beam intensity comes to the center of the photodetector 133 . although described below , the optical element arranged between the light source 101 and the relay lens 110 in fig3 performs angle adjustment to cause the aberration to be minimized therefore , it is desirable to adjust the beam pointing , using the mirror 114 arranged in a subsequent stage of these elements . note that this adjustment method is an example in the optical system of fig3 , and the method is not limited to the example . further , in the present invention , the angle of the light is adjusted using the same photodetector as the photodetector used at the time of reproduction . therefore , downsizing of the device can be achieved . note that the present invention may use a photodetector different from the photodetector used at the time of reproduction . fig4 is a graph illustrating sensitivity of the angle deviation with respect to the aberration , of principal optical components through which the reference light is transmitted in the optical pickup 11 of fig1 . the sensitivity to the aberration in the optical information recording medium becomes larger as the distance from the optical component to the optical information recording medium is longer . meanwhile , to secure an snr and obtain a high - quality reproduced image , it is necessary to suppress the aberration except a defocus aberration . when a specification value of the aberration is allocated to four optical components illustrated in fig4 , an angle deviation allowable value of the optical components becomes several mdeg , and highly accurate adjustment is required . fig5 is a graph illustrating sensitivity of the position deviation with respect to the aberration , of principal components through which the reference light is transmitted in the optical pickup 11 of fig1 . the optical components 1 to 4 respectively correspond to the components illustrated in fig4 . similarly to the angle deviation , as a result of allocation of the aberration specification value to these four optical components , the position deviation allowable value becomes several mm . as is clear from the calculation results of fig4 and 5 , to decrease the aberration and obtain a high - quality reproduced image , highly accurate angle adjustment of the optical components is required . fig6 ( a ) and 6 ( b ) are diagrams illustrating the first embodiment for performing optical axis adjustment of the optical pickup 11 of fig1 . as illustrated in fig6 ( a ) , a position adjustment mechanism is provided in the relay lens 110 . the relay lens 110 in the present embodiment is a lens farthest from the optical information recording medium 1 , and having the largest sensitivity of the aberration . the same two lenses are configured to put the focal point therebetween , as illustrated in fig6 ( b ) . by adjusting one - side lens position , the angle of the emitted light can be changed . the angle adjustment of the emitted light is performed such that transmitted light of the relay lens 110 is incident on a measuring device that can measures the aberration of the wavefront sensor or the like , and is adjusted in the position adjustment mechanism to cause the value of the aberration becomes small . as such adjustment by measuring the aberration of the light emitted from the optical component in the middle of the optical pickup 11 , pre - shipment adjustment of a device can be considered . the position adjustment mechanism is driven by an element such as an actuator . further , as illustrated in fig6 ( c ) , the wavefront sensor 152 is arranged in front of the optical information recording medium , and the aberration there is detected at all times , and the actuator is driven in real time , so that not only the aberration at the time of initial assembly of the optical pickup 11 , but also temporal change of the aberration is detected , whereby the aberration can be prevented and the high - quality hologram can be reproduced and recorded . when the temporal change of the aberration is detected , it is necessary to arrange a wavefront sensor in the device . while fig6 ( c ) illustrates an example of an optical system that causes a part of the emitted light of the scanner lens 131 to be reflected at the mirror , and to be incident on the wavefront sensor 152 has been described , the arrangement method and the arranged location of the wavefront sensor are not necessarily the same . further , in reality , the mirror 153 , which is arranged to cause the emitted light to be incident on the wavefront sensor , needs to be arranged in a location where the mirror 153 does not reject the light . therefore , for example , it is necessary to employ a configuration in which the mirror reflects a part of the light only when the aberration is measured . as described above , in the present embodiment , the optical axis adjustment is performed using the optical element having large aberration sensitivity , so that the aberration can be decreased , and the high - quality hologram image can be reproduced and recorded . fig7 is a diagram illustrating a second embodiment for performing optical axis adjustment of the optical pickup 11 of fig1 . an angle adjustment mechanism is provided in the beam shaping element 104 arranged in front of the relay lens 110 having the largest sensitivity of the aberration , so that the angle of the emitted light is adjusted . the angle adjustment mechanism of the beam shaping element 104 may also be driven by an actuator or the like , similarly to the embodiment of fig6 ( a ) to 6 ( c ) . accordingly , the aberration can be decreased , and the high - quality hologram image can be reproduced and recorded . fig8 is a diagram illustrating a third embodiment for performing optical axis adjustment of the optical pickup 11 of fig1 . an optical element 151 that changes the angle of the emitted light , like a wedge prism , is newly inserted in front of the relay lens 110 having the largest sensitivity of the aberration , and an angle adjustment mechanism is provided , so that the angle of the emitted light is adjusted . similarly , this angle adjustment mechanism may also be driven by an actuator or the like . accordingly , the aberration is decreased , and the high - quality hologram image can be reproduced and recorded . fig9 is a diagram illustrating a fourth embodiment for performing optical axis adjustment of the optical pickup 11 of fig1 . as described above , when the sensitivity of the aberration of the relay lens 110 that is farthest from the optical information recording medium 1 is largest , an angle adjustment mechanism is provided in the mirror 109 arranged in front of the relay lens 110 , so that the incident angle to the relay lens 110 is adjusted . similarly , this angle adjustment mechanism may be driven by an actuator or the like . accordingly , the aberration can be decreased , and the high - quality hologram image can be reproduced and recorded . further , according to the second to fourth embodiments , by performing the optical axis adjustment , using the optical element such as the beam shaping element , the wedge prism , or the mirror having smaller aberration sensitivity and arranged at a side closer to the light source 101 than the optical element such as the relay lens 110 having larger aberration sensitivity , fine adjustment can be performed , compared with a case where the optical element having large aberration sensitivity itself is driven . all of the angle adjustment methods in the embodiments illustrated in fig6 ( a ) to 6 ( c ) , to fig9 cause the light transmitted through the optical component such as the relay lens 110 having large aberration sensitivity to be incident on the measuring device that can measure the wavefront aberration , such as the wavefront sensor , and adjusts the angle to cause the value of the aberration to become small . the optical component to which the angle adjustment mechanism is mounted is not limited to the present embodiment , and another component may be employed as long as the component can highly accurately control the incident angle with respect to the component having large aberration sensitivity . the present embodiments are examples . further , all of the adjustment methods of fig6 ( a ) to 6 ( c ) , to fig9 are favorably provided with an aperture so that a correct arrival position of the light beam after the optical element 113 can be recognized . highly accurate angle adjustment is performed within a range where the beam center passes through the aperture , and the aberration is minimized . while , typically , the laser light is emitted with light intensity distribution of gaussian distribution , an optical component for converting the light intensity distribution to a top - hat shape may be introduced to the optical pickup 11 of the present invention . this optical component is a beam homogenizer or an apodizer , for example . when the light intensity distribution of the laser light is uniform , the high - quality hologram can be recorded when the information is added to the signal light in the spatial light modulator 121 . the element for converting the light intensity distribution into the top - hat shape is supposed to be manufactured with an aspherical - shaped lens . typically , such an optical component having an aspherical shape is supposed to have large aberration sensitivity . therefore , by providing the angle adjustment mechanism in this component itself , or in another component arranged in a preceding stage of the component , the high - quality hologram can be reproduced and recorded . fig1 ( a ) and 12 ( b ) illustrate an example of an adjustment flow . fig1 ( a ) is a diagram for describing pre - shipment adjustment . the optical components are installed one by one in order from the light source for performing assembly of the optical pickup 11 ( 1201 ). from a perspective of the aberration , a decrease in the aberration of the reference light is mainly important . therefore , the wavefront aberration of the reference light is measured ( 1202 and 1203 ) by the measuring device such as a wavefront sensor , and whether the aberration falls within the specification value is confirmed ( 1204 ). if the aberration does not fall within the specification value , the angle of the optical component described in fig6 ( a ) to 6 ( c ) , to fig9 is adjusted , and the angle of the optical axis is adjusted and the aberration is decreased ( 1205 ). if the aberration falls within the specification value , the adjustment of the aberration is completed ( 1206 ). next , the position adjustment of the photodetector for beam pointing adjustment is started ( 1207 ). to be specific , the reference light and the signal light interfering with each other on all of an upper surface , an intermediate surface , and a lower surface of the recording layer of the optical information recording medium when the reference light is set to the lowers angle used in recording is confirmed ( 1208 ). when the interference does not occur , the relative position of the signal light and the reference light is adjusted to cause the interference ( 1209 ). when the adjustment has been made , the beam center of the signal light being incident on the center of the photodetector is confirmed ( 1210 ). when the signal light is incident on a position deviated from the center , an installed position of the photodetector is adjusted to cause the beam center to accord with the center of the photodetector ( 1211 ). the pre - shipment adjustment is terminated ( 1212 ). next , adjustment during recording and reproduction processing illustrated in fig1 ( b ) will be described . when a wavefront aberration or deviation of the beam pointing occurs during recording or reproduction , it becomes difficult to obtain a reproduced image with a high snr . therefore , the present adjustment is favorably real time correction . first , the wavefront aberration of the reference light is measured ( 1251 and 1252 ). whether the measured aberration falls within the specification value adjusted before shipment ( 1253 ), and if the measured aberration does not fall within the specification value , the angle of the optical axis is adjusted by the angle adjustment mechanism described in fig6 ( a ) to 6 ( c ) , to fig9 ( 1254 ), and the aberration is measured again . when the aberration falls within the specification value , the adjustment of the aberration is terminated ( 1255 ). next , the beam pointing deviation is detected ( 1256 ). whether the beam center of the signal light is incident on the center of the photodetector , which has been fixed in the pre - shipment adjustment is determined ( 1257 ), and if the beam center is not incident on the center of the photodetector , the angle of the optical component is adjusted , and the angle of the optical axis is caused to be incident on the center ( 1258 ). the above process is repeated every time page recording or page reproduction is terminated during recording or reproduction , so that the optical pickup 11 that can suppress the optical axis deviation and decrease the aberration , and can obtain the high - quality reproduced image can be provided . further , the timing of the adjustment is not limited to the above described timing , and is changed according to an environment where the present recording / reproduction device is used , such as at the time of maintenance of the optical pickup , or at the timing of replacement of the light source . fig1 is a block diagram illustrating a recording / reproduction device of an optical information recording medium that records / reproduces digital information , using holography . the optical information recording / reproduction device 10 is connected with an external control device 91 through an input / output control circuit 90 . when recording is performed , the optical information recording / reproduction device 10 receives an information signal to be recorded from the external control device 91 with the input / output control circuit 90 . when reproduction is performed , the optical information recording / reproduction device 10 transmits a reproduced information signal to the external control device 91 with the input / output control circuit 90 . the optical information recording / reproduction device 10 includes the optical pickup 11 , a reproduction reference light optical system 12 , a cure optical system 13 , a disk rotation angle detection optical system 14 , and a rotation motor 50 . the optical information recording medium 1 is configured to be rotatable with the rotation motor 50 . the optical pickup 11 serves a function to emit the reference light and the signal light to the optical information recording medium 1 and to record digital information in the recording medium , using holography . at this time , the information signal to be recorded is sent to a spatial light modulator in the optical pickup 11 through a signal generation circuit 86 , by a controller 89 , and the signal light is modulated by the spatial light modulator . when the information recorded in the optical information recording medium 1 is reproduced , an optical wave that causes the reference light emitted from the optical pickup 11 to be incident on the optical information recording medium 1 in an opposite direction to the direction of at the time of recording is generated in the reproduction reference light optical system 12 . the reproduced light reproduced with the reproduction reference light is detected by the photodetector described below in the optical pickup 11 , and a signal is reproduced by a signal processing circuit 85 . the position / angle adjustment mechanisms of the present embodiment are associated with the optical component in the optical pickup 11 . the aberration of the reference light is detected by an aberration detection correction circuit 21 from the optical pickup . further , a signal for correcting the position and the angle of the optical component to minimize the value of the aberration is transmitted to a position / angle adjustment mechanism actuator 20 , and the position / angle adjustment mechanisms of the optical component is driven . an irradiation time of the reference light and the signal light irradiated with the optical information recording medium 1 can be adjusted by controlling an open / close time of the shutter in the optical pickup 11 with the controller 89 through a shutter control circuit 87 . the cure optical system 13 serves a function to generate the light beam to be used in pre - cure and post - cure of the optical information recording medium 1 . the pre - cure is a pre - process of irradiating a desired position with a predetermined light beam in advance before irradiating the desired position with the reference light and the signal light , when information is recorded in the desired position in the optical information recording medium 1 . the post - cure is a post - process of irradiating the desired position with a predetermined light beam to disable additional writing to the desired position , after the information is recorded in the desired position in the optical information recording medium 1 . the disk rotation angle detection optical system 14 is used to detect a rotation angle of the optical information recording medium 1 . when the optical information recording medium 1 is adjusted to a predetermined rotation angle , a signal according to the rotation angle is detected by the disk rotation angle detection optical system 14 , and the rotation angle of the optical information recording medium 1 can be controlled by the controller 89 , using the detected signal , through a disk rotation motor control circuit 88 . a predetermined light source drive current is supplied from a light source drive circuit 82 to the optical pickup 11 , the cure optical system 13 , and the light source in the disk rotation angle detection optical system 14 , and each light source can emit the light beam with a predetermined light quantity ratio . then , the optical pickup 11 and the disk cure optical system 13 are provided with a mechanism that can slide its position in a radius direction of the optical information recording medium 1 , and position control is performed through an access control circuit 81 . by the way , the recording technologies using a principle of the angle multiplexing of holography tend to have an extreme small allowable error to the deviation of the reference light angle . therefore , it is necessary to provide a mechanism to detect a deviation amount of the reference light angle in the optical pickup 11 and generate a servo control signal in a servo signal generation circuit 83 , and to provide a servo mechanism to correct the deviation amount through a servo control circuit 84 in the optical information recording / reproduction device 10 . further , some of or all of the optical system configurations of the optical pickup 11 , the cure optical system 13 , and the disk rotation angle detection optical system 14 may be integrated and simplified . fig1 ( a ) to 11 ( c ) illustrate operation flows of recording and reproduction in the optical information recording / reproduction device 10 . here , flows related to recording and reproduction using holography will be especially described . fig1 ( a ) illustrates an operation flow from after the optical information recording medium 1 is inserted into the optical information recording / reproduction device 10 , to when preparation of recording or reproduction is completed , fig1 ( b ) illustrates an operation flow from the preparation completion state to when information is recorded in the optical information recording medium 1 , and fig1 ( c ) illustrates an operation flow from the preparation completion state to when the information recorded in the optical information recording medium 1 is reproduced . when the medium is inserted , as illustrated in fig1 ( a ) ( 1101 ), the optical information recording / reproduction device 10 determines whether the inserted medium is an optical information recording medium that records or reproduces digital information , using holography ( 1102 ). as a result of the determination of the optical information recording medium , when the inserted medium is determined to be the optical information recording medium that records or reproduces digital information , using holography , the optical information recording / reproduction device 10 reads control data provided in the optical information recording medium ( 1103 ), and acquires , for example , information related to the optical information recording medium and information related to various setting conditions at the time of recording and reproduction . after the read of the control data , the optical information recording / reproduction device 10 performs various types of adjustment according to the control data and learning processing related to the pickup 11 ( 1104 ), and completes preparation of recording or reproduction ( 1105 ). the operation flow from the preparation completion state to when information is recorded is to first receive data to be recorded ( 1111 ), and send information according to the data to the spatial light modulator in the optical pickup 11 , as illustrated in fig1 ( b ) . following that , various types of learning processing for recording such as power optimization of the light source 301 , and optimization of an exposure time by the shutter 303 are performed as needed , in advance ( 1112 ) so that the high - quality information can be recorded in the optical information recording medium . following that , in a seek operation ( 1113 ), the access control circuit 81 is controlled , and the optical pickup 11 and the cure optical system 13 are positioned to predetermined positions of the optical information recording medium 1 . when the optical information recording medium 1 has address information , the address information is reproduced , and whether the optical pickup 11 and the cure optical system 13 are positioned to target positions is confirmed . if the optical pickup 11 and the cure optical system 13 are not positioned to the target positions , deviation amounts from the predetermined positions are calculated , and the positioning operation is repeated again . following that , a predetermined region is procured using the light beam emitted from the cure optical system 13 ( 1114 ), and data is recorded using the reference light and the signal light emitted from the pickup 11 ( 1115 ). after the data is recorded , the post - cure is performed using the light beam emitted from the cure optical system 13 ( 1116 ). the data may be verified as needed . the operation flow from the preparation completion state to when recorded information is reproduced is to control the access control circuit 81 in the seek operation ( 1121 ), and to position the optical pickup 11 and the reproduction reference light optical system 12 to predetermined positions of the optical information recording medium 1 , as illustrated in fig1 ( c ) . when the optical information recording medium 1 has address information , the address information is reproduced , and whether the optical pickup 11 and the reproduction reference light optical system 12 are positioned to target positions is confirmed . if the optical pickup 11 and the reproduction reference light optical system 12 are not arranged to the target positions , deviation amount from the predetermined positions are calculated , and the positioning operation is repeated again . following that , the reference light is emitted from the optical pickup 11 , the information recorded in the optical information recording medium 1 is read ( 1122 ), and reproduced data is transmitted ( 1123 ). according to the embodiments , the position deviation and the angle deviation of the optical component arranged in the optical information recording / reproduction device can be adjusted , and as a result , the high - quality hologram can be recorded and reproduced . further , when attachment / detachment of the laser light source becomes necessary at the end of life or at the time of failure , adjustment of the optical axis of the optical system is required . by providing the position / angle adjustment mechanism to the principal optical components , a work time can be reduced . further , the optical axis of the optical system is adjusted during waiting for stabilization of oscillation of the laser light source , so that the time to start recording can be reduced , and efficiency of workability can be improved . the present invention is not limited to the above - described embodiments , and includes various modifications . for example , the above embodiments have been described in detail to explain the present invention in a simplified manner , and the present invention is not necessarily limited to one provided with all described configurations . further , a part of the configuration of a certain embodiment can be replaced with the configuration of another embodiment . further , the configuration of another embodiment can be added to the configuration of a certain embodiment . further , another configuration can be added to / deleted from / replaced with a part of the configuration of each embodiment . further , the above - described configurations , functions , processing units , processing means , and the like may be realized by hardware , by designing a part or the whole of the configurations , functions , processing units , and processing means with an integrated circuit , for example . further , the above - described configurations , functions , and the like may be realized by software , by a processor interpreting and executing a program that realizes the respective functions . information such as programs , tables , and files that realize the respective functions can be placed in a recording device such as a memory , a hard disk , or a solid state drive ( ssd ), or a recording medium such as an ic card , an sd card or a dvd . further , control lines and information lines that are necessary for description have been described , and not all of control lines and information lines necessary for a product are necessarily described . in practice , it may be considered that almost all of the configurations are mutually connected . 1 . . . optical information recording medium , 10 . . . optical information recording / reproduction device , 11 . . . optical pickup , 12 . . . reproduction reference light optical system , 13 . . . cure optical system , 14 . . . disk rotation angle detection optical system , 20 . . . position / angle adjustment mechanism actuator , 21 . . . aberration detection correction circuit , 50 . . . rotation motor , 81 . . . access control circuit , 82 . . . light source drive circuit , 83 . . . servo signal generation circuit , 84 . . . servo control circuit , 85 . . . signal processing circuit , 86 . . . signal generation circuit , 87 . . . shutter control circuit , 88 . . . disk rotation motor control circuit , 89 . . . controller , 90 . . . input / output control circuit , 91 . . . external control device , 101 . . . light source , 104 . . . beam shaping element , 109 . . . mirror , 110 . . . relay lens , 111 . . . shutter , 112 . . . optical isolator , 113 . . . ½ wavelength plate , 114 . . . mirror , 115 . . . pbs prism , 116 . . . signal light , 117 . . . beam expander , 118 . . . phase mask , 119 . . . relay lens , 120 . . . pbs prism , 121 . . . spatial light modulator , 122 . . . relay lens , 123 . . . polytopic filter , 124 . . . objective lens , 125 . . . reference light , 126 . . . mirror , 127 . . . angle adjustment element in pitch direction , 128 . . . aperture , 129 . . . mirror , 130 . . . galvanometer mirror , 131 . . . scanner lens , 132 . . . ¼ wavelength plate , 133 . . . galvanometer mirror , 201 . . . light source , 202 . . . collimating lens , 203 . . . shutter , 204 . . . ½ wavelength plate , 205 . . . polarization beam splitter , 206 . . . signal light , 207 . . . polarization beam splitter , 208 . . . spatial light modulator , 209 . . . angle filter , 210 . . . objective lens , 211 . . . objective lens actuator , 212 . . . reference light , 213 . . . mirror , 214 . . . mirror , 215 . . . lens , 216 . . . mirror , 217 . . . actuator , 218 . . . photodetector , 219 . . . polarization direction conversion element , 220 . . . driving direction , 221 . . . optical block , 230 . . . actuator , 150 . . . ½ wavelength plate , 151 . . . angle change element , 152 . . . wavefront sensor , 153 . . . mirror | 6 |
with reference first to fig1 , a system is illustrated therein for local wireless transmission and reception of digital audio and program information . a delivery system 10 , such as coaxial cable , satellite , the internet , microwave , and etc ., outputs a serial digital audio / program information stream 22 that contains digital audio , program information , and national subscriber information . the transmitter 100 , more fully described with respect of fig2 - 2 a , receives the said serial digital data stream 22 and demultiplexes , decrypts , and decodes the digital audio and program information signal . the digital audio signal and program information are converted to a digital rf carrier frequencies and broadcasted to a plurality of second devices , preferably at least one receiver / tuner unit 200 , more fully described with respect of fig3 - 4 , that outputs the selected audio electronically and displays the corresponding program information of the audio track currently listened to by the subscriber . fig2 is a block diagram of the preferred digital music transmitter ( dmt ) 100 . referring to fig1 - 2 , the serial digital data stream 22 is passed via an established system of digital data distribution 10 , for example , multisystem operators coaxial cable or direct broadcast satellite , and is received by the transmitter input terminal 105 . the transmitter input terminal 105 preferably includes phase - lock loop ( pll ) circuitry . the signal is amplified by an amplifier 110 and filtered by a saw filter 115 before being demodulated by a demodulator 120 . the demodulator 120 converts the selected digital frequency to demodulation intermediate frequency ( if ). the output of the demodulator 120 is quadrature partial response ( qpr ) demodulated to produce a 5 . 6 mbps data stream containing 150 stereo pair of digital audio data to an applications specific integrated circuit ( asic ) 130 . the demodulator 120 provides data to a data clock recovery pll 125 . the data clock recovery pll 125 contains a 33 . 8688 mhz crystal 122 ( about 33 . 9 mhz ) for timing purposes . the asic 130 provides demultiplexing , decrypting , and decoding operations upon the 5 . 6 mbps data stream input by the demodulator 120 to the microprocessor 140 . the asic 130 separates the 5 . 6 mbps data stream to a select one of 150 stereo pairs of digital audio signals . the selected stereo pair is decrypted and separated to provide digital audio signal and a program information signal . the digital audio signal is then decoded according to a variety of known techniques . the asic 130 inputs the digital audio signals , provided at a sampling rate of 44 . 1 kilohertz ( khz ), to a digital rf converter 150 . the audio signals are provided to a f . m . stereo encoder and loudness processor 152 , and then to f . m . band exciter 154 . the output of the exciter 154 is amplified by a high power amplifier 156 and broadcast over the airwaves by an antenna 160 as digital f . m . in the f . m . broadcast for reception by a digital f . m . receiver 201 , such as disclosed in fig3 a receiver 170 for a second controllable device , such as a digital receiver / tuner ( drt ) 200 , coupled to the microprocessor 140 receives instruction or control signals transmitted by the drt 200 to initiate the remote control of selected functions of the transmitter 100 . a clock signal generated internal to the asic 130 is utilized as a carrier signal to switch the output of the drt 200 on or off at a frequency of 44 . 1 khz . the 44 . 1 khz clock from an asic clock generator 130 a may be utilized to generate a carrier signal for rf signals sent by the drt transmitter 160 . the asic clock signal provided by the asic clock 130 a is derived from the about 33 . 9 mhz signal provided to the asic 130 by the data clock pll 125 . the drt 200 operates to control selected function of the transmitter as well as the program information transmitted by the drt transmitter 160 associated with the dmt 100 . the asic clock signal provided by the asic clock 130 is derived from the about 33 . 9 mhz signal provided to the asic 150 by the data clock pll 125 . specifically , the asic clock signal is derived by dividing the 33 . 9 mhz signal by three ( 3 ) to provide a second clock signal having a frequency of 11 . 3 mhz , and by then dividing the 11 . 3 mhz signal to the preferred fixed first frequency for the 44 . 1 khz asic clock signal . the 11 . 3 mhz clock signal is utilized as a clock signal selected operations conducted by the asic 130 . the asic 130 contains a synchronizing circuit 132 which is utilized to provide clock synchronized program information signals to the drt 200 . the synchronizing circuit 132 operated to provide two separate timing alignment functions . first , the synchronizing circuit 132 aligns the program information signal provided by the microprocessor to the 11 . 3 mhz clock signal . second , the synchronizing circuit 132 aligns the 44 . 1 khz asic clock signal to the 11 . 3 mhz clock signal . referring to fig2 - 2 a , the synchronizing circuit 132 includes a first synchronizing element 133 , an , edge detector 134 , and second synchronized element 135 , and gate 136 . the microprocessor 140 provides program information signals in the form of a serial data signal formatted in the appropriate display information protocol to the first synchronizing element 133 . the microprocessor 140 outputs the program information signals to the first synchronizing element 133 at a predefined data rate , preferably 4900 baud . in addition , the 11 . 3 mhz dock signal is provided as another input to the first synchronized element 133 . the first synchronizing element 133 aligns the rising edge of the program information signals to the 11 . 3 mhz clock signal to provide an output signal synchronized with the 11 . 3 mhz clock the second synchronizing element 135 accepts the synchronized output signal of the first synchronizing element 133 and produces a gate signal when the output signal of the edge detector 134 enables the second synchronizing element 135 . the gate signal produced by the second synchronizing element 135 and the asic clock signal of 44 . 1 khz are provided as inputs to an and gate 136 . accordingly , the integral number of cycles of the asic dock signal output by the and gate 136 is effectively determined by the pulse width or pulse duration of the gate signal output by the second synchronizing element 135 . the output of the asic 130 is a carrier - modulated program information signal , produced by an on / off keying technique , and is provided from the synchronizing circuit 130 on line 137 to the drt transmitter 160 . the carrier - modulated program information signal , when formatted with appropriate start bits , stop bits , and other formatting information described below , comprises a display information signal that is ultimately display as alphanumeric characters on the display of the drt 200 . the drt transmitter 160 is responsive to the carrier - modulated program information signal provided on line 137 . the microprocessor 140 initiates a transmission of a program information signal by the dmt 100 . in response to the initiation of a transmission , the asic 130 outputs the synchronized program information signal at the rate defined by the first frequency ( 44 . 1 khz ) to the drt transmitter 160 . the drt receiver 170 includes a demodulator 172 and rf diode 174 . the rf diode 174 is located between an input of the demodulator 172 and the ground . when the rf diode 174 detects a command signal from the drt 200 . the rf diode 174 outputs a detected signal to the demodulator 112 . the demodulator 172 demodulates and filters the detected rf signal and provides an output voltage signal to the receiver input terminal of the microprocessor 140 on line 173 . the demodulator 172 provided the specific functions preamplification , bandpass filtering , and detection of the detected rf signal provided by the rf diode 174 fig4 is a block diagram of the preferred digital receiver / tuner ( drt ) unit 200 . the preferred drt units , not limited to the embodiments in fig3 , include a display for the control of the digital music transmitter ( dmt ) 100 . the top surface of the drt 200 includes an alphanumeric character display and a matrix of contact switches forming a keypad . each contact switch of the keypad is covered by a push button or key that includes a label which defines the function or instruction initiated when the user presses the push button . in addition , selected areas of the tip surface of the drt unit include labels or other indicia that further designate the function or instruction associated with the key or push button . the user can control the functions of the dmt 100 in a manner similar to the use of currently popular wireless transmitter / receiver units that control the functions of consumer products , such as cordless telephones or local audio signal transmitter . specifically , the dmt 100 remains in a dormant mode with a transmitted passive signal that responds to a selected command function from the drt unit 200 . the user can initiate or terminate transmission of the digital audio and program information from the dmt 100 by pressing a selected key . each of the buttons or key of the keypad is labeled to indicate the function associated with the key . for example , by pressing any key or a set of keys labeled with arabic numerals 0 - 9 , a user can select one of the available digital audio and program information channels transmitted by the dmt 100 for the listening pleasure of the subscriber . the keys labeled tune ( up arrow ) and tune ( down arrow ) may be used by the listener to increment or decrement the digital audio and program information channels transmitted by the dmt 100 . in a similar fashion , a volume up ( vol up arrow ) and a volume down ( vol down arrow ) keys can be utilized to control the volume level provided by the dmt 100 . an on / off key with a power indicator light may be utilized by the listener to either power on or off the drt 200 and dmt 100 signal transmission . also , a mute key is useful for eliminating the audible portion of the program provided by the dmt 100 . those persons skilled in the art will appreciate that such control functions are similar to the control function provided by other wireless remote controls for consumer products . other control function related to the control of the dmt 100 by the drt unit 200 include control functions associated with the keys enter / next , preset and mode . by pressing the enter / next key , the user initiates a command function that may be associated with the various functions of the drt unit 200 . the preset key permits the user to store a favorite digital audio channel for future operations by the drt unit 200 . the mode function changes the message field on the lcd viewscreen according to selected function by the user , for example viewing or storing program information for a current music selection , participating in music surveys , or purchase of music via electronic account . the listener can also review the program information associated with a current program by inputting an information request for transmission to the dmt 100 . by pressing the view key , the user initiates the transmission of an information request by the drt unit 200 to the dmt 100 . the dmt processes the information request and initiates a search for program information associated with the current program . if the program information is not found by the dmt within a predetermined timer period , typically about five seconds , the dmt 100 will respond to the transmitted information request by transmitting an error message to the drt unit 200 . if the search by the dmt 100 is successful , the dmt 100 will respond to the transmitted information request by transmitting the program information to the drt unit 200 . with respect to digital audio signals , a typical program message includes information concerning the composer , the track title , the artist , the album associated with the track title , and custom information concerning the current performance . referring to fig4 , the preferred drt unit 200 includes a processor 240 , preferably a microcomputer or microcontroller , having on - board mask programmed memory , such as a read only memory ( rom ) 240 a . the memory 205 a comprises plurality of memory locations for storing parameters associated with different control signal protocols ( in particular , for storing a plurality or parameters associated with different control protocols for different controllable devices ). the preferred drt unit 200 further includes a rf receiver 201 , demodulator 218 , an applications specific integrated circuit asic 230 , digital / audio converter 270 , transmitter 260 , a data clock recovery pll 225 , front panel interface 250 , stereo output amplifier 280 . the output of the demodulator 218 is quadrature partial response ( qpr ) demodulated to produce a 5 . 6 mbps data stream containing 150 stereo pair of digital audio data to the asic 230 . the demodulator provides data to a data clock recovery pll 225 . the data clock recovery pll 225 contains a 33 . 8688 mhz crystal 122 ( about 33 . 9 mhz ) for timing purposes . in the preferred embodiment , the dmt 100 control signal protocols are stored in the rom 240 a . the control protocol includes the properly formatted codes associated with control functions for the dmt 100 . the asic 230 provides demultiplexing , decrypting , and decoding operations upon the 5 . 6 mbps data stream input by the demodulator 218 to the microprocessor 170 . the asic 230 separates the 5 . 6 mbps data stream to a select one of 150 stereo pairs of digital audio signals . the selected stereo pair is decrypted and separated to provide a program information signal and a digital audio signal . the digital audio signal is then decoded according to a variety of known techniques . the asic 230 inputs the digital audio and program information signals , provided at a sampling rate of 44 . 1 khz , to a digital / audio converter 270 , transmitter control 260 , and microprocessor memory 240 a . the demultiplexed control and channel data separated out from the data steam by the asic 230 are provided to a microprocessor 240 which controls the overall operation of the drt unit 200 . a clock signal generated internal to the asic 230 is utilized as a carrier signal to switch the output of the drt 200 on or off at a frequency of 44 . 1 khz . the 44 . 1 khz clock from an asic clock generator 230 a may be utilized to generate a carrier signal for rf signals sent by the drt transmitter 160 . the asic clock signal provided by the asic clock 230 a is derived from the about 33 . 9 mhz signal provided to the asic 230 by the data clock pll 225 . the drt 200 operates to control selected functions of the dmt 100 as well as the program information transmitted by the drt transmitter 260 associated with the dmt 100 . referring to fig2 a , the asic clock signal provided by the asic clock 230 a is similar in function and purpose to that of the aforementioned asic clock 130 a . as result , the 11 . 3 mhz clock signal is utilized as a clock signal selected operations conducted by the asic 230 . referring again to fig4 ., for a first operation mode , digital audio and program information carrier signals are received by the receiver antenna 201 from the dmt transmitter 160 . the received signal is provided to a double tuned tracking filter ( dttf ) with pll circuitry , from there to an amplifier 203 , on to a single tuned tracking filter ( sttf ) 205 , a mixer 207 , and saw filter 209 , and into a demodulator 218 , according to known techniques . the channel selection process is under control of a tuning synthesizer 220 , integrating amplifier 217 , sttf 215 , and amplifier 212 , interconnected as shown and impressing an appropriate signal on a line 211 to the dttf 201 , sttf 205 , and oscillator 210 to effect channel selection , according to known techniques . the program information signal from the asic 230 is sent to the microprocessor 240 where it may be displayed on the front panel interface 250 . the asic 230 also sends the program information signal to the transmitter interface 255 and transmitter control 260 for transmission to the dmt 100 . channel selection is provided by the infrared receiver and / or front panel interface 250 , which information is passed on by the microprocessor 240 to the tuning synthesizer 220 . the asic 230 inputs the digital audio and program information signals , provided at a sampling rate of 44 . 1 khz to a digital / audio converter 270 . the output of the d / a 270 device is provided as a data stream over a bus to a logic circuit 274 with separates the dates stream into control bits and channel indication ( tag bits ) and encrypted digital audio bits ( demultiplexing functions ) and decrypts the digitized audio data into a suitable form for a dolby decoder 278 . the audio data is decrypted into three serial streams per audio channel consisting of basic delta modulation parameters for “ left ” and “ right ” channels . the output of the dolby decoder 278 is provided as “ left and “ right ” audio channels to a stereo amplifier 280 , and to stereo outputs for use with standard audio components . from the foregoing description of the preferred embodiment , it will be appreciated that the present invention overcomes the disadvantages of the prior art and achieves the objects and advantages of the invention recited above . accordingly , the invention improves existing methods of providing digital music by making the service more convenient and accessible to subscribers through wireless transmission of music to remotely located devices . greater recognition among subscribers is gained by similarities of the preferred embodiments to more popular consumer electronic music devices . and , digital music is made more versatile with improved methods of subscriber interaction with the service . the above description of the invention is intended to be illustrative and not limiting . various changes or modifications in the embodiments described may occur to those skilled in the art and these can be made without departing from the spirit or the scope of the invention . | 6 |
with reference to fig1 , it is first shown an elongated single - compartment bag 11 made of two wall sheets having an opening 13 in one of the wall sheets , and a connector 15 that is shown unattached for illustration purposes . in order to place the connector member 15 in the bag , an ancillary member 17 which in this embodiment is of annular shape is positioned at the rim of the opening 13 , which annular member is capable of centrally receiving the connector body 15 within its throat or opening 13 , thus forming a sealing fit . as shown in fig2 , the member 15 comprises a central body 19 having annular ribs 21 , which allow for a firm hold within the opening 13 of the annular member 17 , and two wing - like lateral extensions 23 within which tubes or conduits 25 extend to respectively inject water and remove the solution therethrough . these conduits 25 extend from corresponding apertures 27 in the wing ends 23 , that are configured to allow the attachment and connection to a dialysis machine ( not shown ), having some lengths that form channels 29 that are open on one end on the outer or rear side 31 of the member , then leading into the inner side 33 of the connector , wherein the solution outlet tube has an extremity for the attachment of a suction tube 35 , the terminal edge of which ends in a filter 37 such that , in use , the latter is lodged at the bottom of the bag 11 , at the opposite end of the opening 13 . similarly the inlet tube to inject the water can have a filter element directly at its end in the central body 19 . the filter element can be made by various manufacturing techniques . in one embodiment the orifice of the inlet tube is covered by a non - woven welded sheet which is welded or glued to the central body . the inlet orifice may also have a small extremity pointing into the container and having an enlarged cross - section compared with the outlet tube . for brevity purposes , any further details on the conventional aspects of the disclosure so far are omitted , since they are known from the aforementioned patents . the permanent bond between the annular member and the sheet material the bag 11 is made of , as well as the snap fitting thereto of the central member or the actual nozzle 15 , may have the same characteristics as shown in the above publication ar no 35 , 471 . in accordance with one aspect of the invention , the connector member 15 is molded with a cap 39 attached thereto by two linking flexible strips 41 . such cap 39 has the same transversally elongated configuration as the aforementioned rear side 31 of the wings 23 in the connector 15 , together with internal protuberances 43 replicating the open portions 29 of the tubes . thus , it is easy to understand that , when the cap 39 is folded over the outer side 31 of the connector 15 , thus folding the strips 41 which attach it to the ends of wings 23 , protuberances 43 snap fit within the open channels 29 far enough to seal them , the sealing being guaranteed by ultrasound or laser welding . in the illustrated example , wings 23 have an 87 . 3 mm span to accommodate a 78 . 0 mm length between the central points of the mounting apertures and connection 27 . the open channels 29 have a 4 . 1 mm width , whereas the cap 39 has a 1 . 0 mm thickness , just like protuberances 43 on the inner side of the cap 39 . strips 41 attaching the cap onto the body 15 of the connector are 3 . 0 mm long , 2 . 0 mm wide and 0 . 8 mm thick . fig4 shows the apertures 27 that the channels 29 of the connector 15 lead into , and fig5 shows a reinforcing structure 45 that serves to stiffen the said member . once the central piece 15 of the connector with the cap 39 already welded onto it , as disclosed above , and the bag 11 with the annular member 17 have been made , the powdered product is filled into the bag 11 . the member 15 of the actual connector is then placed on the annular member 17 , by first introducing the suction tube 35 , which serves as an extension of the solution outlet , such that the filter 37 reaches the bottom of the bag 11 . both apertures 27 are sealed as shown in fig6 and 7 by means of a polyester - coated sheet 47 as shown in fig8 , which is bonded by a peel - off hot melt , and then the filled and sealed device containing the substance to be dissolved is ready to be shipped to a point of use , i . e . a hospital , clinic or dialysis center . it is seen that the annular member 17 serves two purposes : as an inlet port for the solid matter to be dissolved and as a sealing mounting and retention member on the central member of connector 15 having the characteristics of a finished plug . when it is time for use , the device is promptly attached to a dialysis machine , after the peel - off sheet 47 has been lifted from apertures 27 , and plugged into the mounting console of the machine , after which the latter will pump pure or distilled water via one of the tubes 25 in order to dissolve the solid matter . after being contacted by water , such solid matter forms a solution with the solid contents that is capable of passing through sieve 37 such that it can be sucked by tube 35 and carried through the outlet tube 21 into the machine for the purifying treatment of the blood taken from the patient to be detoxified and returned by extracorporeal circulation in the case of hemodialysis . when the product in the device bag has been depleted , the connecting apertures 27 are unplugged and the device is disposed of or replaced to perform another treatment with a new device . it will be apparent that various modifications and additions could be introduced into the embodiment disclosed herein , as long as they are consistent with the spirit and scope of the present invention . for instance , while the invention has been described regarding a replaceable device suitable for a hemodialysis machine , it should be apparent that the solution provided could eventually be used in other medical application with analogous problems to solve such as a peritoneal dialysis machine . it should also be apparent that while the described embodiment uses a bag , the concept of the invention is applicable to containers in general , independent of the flexibility of the walls of the container . | 0 |
the present invention relates to a process for the production of low - viscosity , storable amphoteric surfactants in which a ) 1 - hydroxyethyl - 2 - alkyl - 2 - imidazolines corresponding to formula ( i ): ## str4 ## in which r 1 is an alkyl radical containing 5 to 21 carbon atoms , are quaternized or carboxymethylated with halogenated carboxylic acid salts and , at the same time , hydrolyzed with aqueous bases at a ph value in the range from 7 . 5 to 9 and b ) the end reaction products are adjusted to a ph value of 5 to 7 . it has surprisingly been found that the careful control of the ph value both during the production of the imidazolinium betaines and during their storage results in the formation of products which are of low viscosity , even in highly concentrated form , and which show a constant low viscosity , even after storage for several weeks . 1 - hydroxyethyl - 2 - alkyl - 2 - imidazolines are known substances which are obtained , for example , by condensation of fatty acids with aminoethyl ethanolamine . typical examples of imidazolines which may be used as starting materials in the process according to the invention are the condensation products of aminoethyl ethanolamine with caproic acid , caprylic acid , capric acid , lauric acid , myristic acid , palmitic acid , stearic acid , isostearic acid , arachic acid and behenic acid and the technical mixtures thereof obtained , for example , in the pressure hydrolysis of native fats and oils . imidazolines corresponding to formula ( i ), in which r 1 is a c 11 - 17 alkyl radical , based on technical cocofatty or tallow fatty acids are preferably used . halogenated carboxylic acid salts in the context of the invention are the sodium and / or potassium salts of haloacetic acid , halopropionic acid and / or halobutyric acid . sodium chloroacetate is preferably used . the imidazolines and the halogenated carboxylic acid salts may normally be used in molar ratios of 1 : 1 . 5 to 1 : 3 and preferably 1 : 1 . 8 to 1 : 2 . 5 . it has proved to be optimal to carry out the quaternization or carboxymethylation and the hydrolysis simultaneously at temperatures in the range from 70 ° to 85 ° c . and preferably at temperatures in the range from 78 ° to 83 ° c . suitable aqueous bases are sodium hydroxide and / or potassium hydroxide , 5 to 55 % by weight solutions and , more particularly , 30 to 50 % by weight solutions of sodium hydroxide preferably being used . the quantity of base is determined by the content of halogenated carboxylic acid salt . the base and the salt are preferably used in a molar ratio of 0 . 9 : 1 to 1 : 1 . 2 and preferably in a molar ratio of 1 : 1 to 1 : 1 . 1 . the function of the base is to form an inorganic salt , for example sodium chloride , with the halogen component of the carboxylic acid salt . if , nevertheless , it should be of advantage in practice to exceed the equimolar ratio , this may be done when a relatively high concentration of base is necessary to maintain the ph range regarded as critical . in addition , it has proved to be of advantage to add small quantities of citric acid , for example , to the solutions in order to buffer the mixtures . in order to illustrate the findings on which the present invention is based , the process is described by way of example at this juncture : a solution of aqueous sodium chloroacetate and citric acid is initially introduced . beginning at 40 ° c ., the imidazoline is added over a period of 30 minutes , the temperature rising to around 50 ° c . and the ph measured in the mixture to a value of 11 . 65 . the temperature is then rapidly increased to 70 ° c ., the ph value falling . the ph value is then kept constant at 8 . 5 -- as required by the process according to the invention -- by addition of aqueous sodium hydroxide . the hplc analysis of a sample taken at this time shows that monocarboxylate and predominantly dicarboxylate are present alongside one another . after a reaction time of about 7 h and a consumption of 90 % by weight of total quantity of sodium hydroxide required to form the inorganic salt , the chromatogram shows only small amounts of unreacted imidazoline . the remaining quantity of base is added in one portion . analysis of the reaction product , which is adjusted to ph 8 . 5 by addition of acid , shows a ratio of dicarboxylate to monocarboxylate of greater than 6 . the viscosity is below 100 mpa · s . for storage , the ph value is lowered to 6 . if the reaction is carried out at ph values above 9 , it is possible by hplc to show that most of the imidazoline is hydrolyzed before quaternization can take place . the parallel carboxymethylation gives a highly viscous product which mainly contains compounds corresponding to formula ( iia ). if the reaction is carried out at ph values below 7 . 5 , the establishment of an equilibrium between &# 34 ; betainized &# 34 ; and free imidazoline is observed . when sodium hydroxide is added , both species are rapidly hydrolyzed , resulting again in a high percentage of the compound corresponding to formula ( iia ) ( ratio of dicarboxylate to monocarboxylate & lt ; 3 ). if , by contrast , the reaction is carried out under the conditions of the process according to the invention ( ph range 7 . 5 to 9 ), an equilibrium between betainized and free imidazoline is again established , although almost exclusively the betainized imidazoline is ring - opened under the reaction conditions . in accordance with the equilibrium position , betaine is reformed from the free imidazoline and , in turn , can be rehydrolyzed . in overall terms , therefore , the low - viscosity compound corresponding to formula ( iib ) is predominantly formed . the amphoteric surfactant concentrates of the prior art obtained on the basis of imidazoline almost all show a steady increase in viscosity in storage of which the rate is determined by the storage conditions , but especially by the ratio between the monocarboxylates and dicarboxylates ( iia ) and ( iib ). in the case of products corresponding to the prior art , the ratio of dicarboxylate to monocarboxylate typically falls from 3 . 2 to 1 . 4 after storage for 4 weeks at 60 ° c . this results in an increase in viscosity to more than four times the starting value . according to the invention , the sensitivity of ( iib ) to hydrolysis can be counteracted by adjusting the product to a ph of 5 to 7 for storage . hplc investigations have shown that the ratio of dicarboxylate to monocarboxylate and the content of free fatty acid remain constant under these conditions , even in the event of prolonged storage . the amphoteric surfactants obtainable by the process according to the invention have low viscosities and remain stable in storage , even over prolonged periods . they are suitable for the production of surface - active formulations , more particularly dishwashing detergents and cleaning products and also hair - care and personal - hygiene products , in which they may be present in quantities of 0 . 1 to 25 % by weight and preferably in quantities of 0 . 5 to 10 % by weight , based on the particular product . the following examples are intended to illustrate the invention without limiting it in any way . in a 400 ml four - necked stirred reactor equipped with a reflux condenser , thermometer , ph electrode and dropping funnel , 77 . 7 g ( 666 mmoles ) of sodium chloroacetate were dissolved in 170 . 2 g of water . after the addition of 0 . 6 g of citric acid monohydrate , 100 g ( 371 mmoles ) of 1 - hydroxyethyl - 2 - undecyl - 2 - imidazoline were uniformly added over a period of 25 minutes at 40 ° c ., the temperature rising to 50 ° c . and the ph value ( measured in the reaction mixture ) to 11 . 7 . the reaction mixture was then rapidly heated to 70 ° c ., a reduction in the ph value being observed . the ph value was kept constant at 8 . 5 by addition of 38 . 9 g ( 486 mmoles ) of sodium hydroxide in the form of a 50 % by weight aqueous solution and the mixture was stirred for 240 minutes . the ph value was then increased to 9 . 0 and was kept constant for another 180 minutes by addition of sodium hydroxide . the total consumption of naoh up to this time was 47 . 5 g ( 593 . 7 mmoles ). after another 120 minutes ( the ph value had meanwhile fallen to 8 . 3 ), another 5 g ( 62 . 5 mmoles ) of sodium hydroxide were added and the mixture was stirred for 60 minutes . on completion of the reaction , the resulting clear liquid was adjusted to a ph value of 8 . 5 by addition of concentrated hydrochloric acid and water . 73 . 9 g ( 633 mmoles ) of sodium chloroacetate dissolved in 152 . 8 g of water , 0 . 58 g of monohydrated citric acid and 100 g ( 352 mmoles ) of an imidazoline , which had been obtained from a hydrogenated c 12 / 18 cocofatty acid and aminoethyl ethanolamine in accordance with de - a 36 41 871 , were reacted as in example 1 . to control the ph value , a total of 152 . 8 g ( 633 . 8 moles ) of sodium hydroxide in the form of a 50 % by weight aqueous solution was consumed . the end product ( a clear liquid ) was adjusted to a ph value of 6 . 5 with concentrated hydrochloric acid . 1 , 500 g of a product obtained as described in example 1 were divided into 6 portions and adjusted to ph values in the range from 3 to 12 with hydrochloric acid and sodium hydroxide . equal portions of these products were stored for 2 weeks at temperatures of 5 ° to 60 ° c . the di / monocarboxylate ratio , the fatty acid content and the viscosity were then analyzed . the results are set out in table 1 . 237 . 8 g ( 2 . 04 moles ) of sodium chloroacetate dissolved in 450 g of water were reacted with 268 g ( 1 mole ) of 1 - hydroxyethyl - 2 - undecyl - 2 - imidazoline after addition of 8 . 4 g of citric acid , as described in examples 1 and 9 of de - b 40 38 983 . after the imidazoline had been added , the mixture was stirred for 30 minutes at 80 ° c . 155 . 7 g ( 1 . 95 moles ) of sodium hydroxide in the form of a 50 % by weight aqueous solution were then uniformly added over a period of 120 minutes . after another 180 mins . reaction time , a ph value of 8 . 25 was established by addition of 50 % by weight citric acid and the product was cooled a solids content of 50 0 s by weight was established by addition of water . the results of tests to determine stability in storage are set out in table 2 . table 1______________________________________storage behavior of example 3 according to the invention t fatty acid viscos . ph value ° c . dmr % by weight mpa · s______________________________________3 . 05 5 7 . 2 0 . 24 5100 25 6 . 7 0 . 35 4500 60 4 . 5 2 . 70 163005 . 07 5 8 . 3 0 . 29 280 25 8 . 2 0 . 24 270 60 6 . 6 0 . 40 12107 . 04 5 8 . 3 0 . 22 280 25 8 . 2 0 . 25 250 60 5 . 3 0 . 35 21508 . 59 5 8 . 2 0 . 24 155 25 8 . 1 0 . 27 120 60 3 . 3 1 . 00 1250010 . 46 5 8 . 4 0 . 32 130 25 8 . 4 0 . 34 120 60 4 . 2 2 . 50 2100012 . 0 5 4 . 1 2 . 60 35000 25 3 . 8 3 . 50 n . m . 60 0 . 7 8 . 4 n . m . ______________________________________ legend : t = temperature dmr = di / monocarboxylate ratio viscos . = viscosity cone / plate system at 25 ° c ., carrimed viscosimeter n . m . = not measurable table 2______________________________________storage behavior of comparison example t st . fatty acid viscos . ph value ° c . w dmr % by weight mpa · s______________________________________8 . 25 -- -- 3 . 2 1 . 1 3808 . 10 60 1 2 . 6 2 . 1 160007 . 90 60 4 1 . 4 4 . 3 40000______________________________________ legend : st . = storage time w = weeks | 2 |
in a modern hard disk drive , and with reference to fig1 and 3 , the hsa 40 is pivotally secured to the base of the drive via a pivot - bearing cartridge 42 so that the read / write transducer ( s ) of sliders 44 at the distal end of the suspension assembly ( ies ) may be moved over the recording surface ( s ) of the disk ( s ) 46 . the pivot - bearing cartridge 42 enables the hsa 40 to pivot , and includes a bearing cartridge and a pivot shaft that defines an axis 48 about which the actuator rotates when power is applied to the vcm . the “ rotary ” or “ swing - type ” actuator assembly rotates on the pivot bearing cartridge 42 between limited positions , and the coil assembly 52 that extends from one side of the body portion 50 of the actuator body of the hsa 40 is disposed between and interacts with a first permanent magnet 54 mounted to a bottom vcm plate 56 and a second permanent magnet 58 mounted to a top vcm plate 60 to form the vcm formed by the bottom vcm plate 56 , the first permanent magnet 54 , the coil assembly 52 , the second permanent magnet 58 and the top vcm plate 60 . in operation , when a driving voltage is applied to the vcm , torque is developed that causes the hsa 40 to pivot about the actuator pivot axis 48 and causes the read / write transducer ( s ) of the sliders 44 to sweep radially over the disk ( s ) 46 . most modern drives use a feedback mechanism so that small changes in applied voltage are operative to position the read / write transducer ( s ) of the sliders 44 precisely over the disk ( s ) 46 . the increasing number of disks in the disk pack , in particular , has engendered a corresponding increase in the number of actuator arms ( four such actuator arms being shown in fig1 - 3 ) on the hsa 40 . indeed , fig4 shows a side view of an hsa having six actuator arms that support fully ten sliders comprising read / write actuators configured to read and write data to and from 5 magnetic disks sandwiched therebetween . fig5 is a detail side view of a pair of the hgas and suspension or lift tabs shown in fig4 . fig5 shows two hgas 102 . each hga 102 may comprise a load beam 402 ( best seen in fig4 ), a gimbal 106 and a slider 108 attached to the gimbal 106 . the free distal end of the hga may comprise a suspension tab 502 . the suspension tab 502 may be configured , among other functions , to enable the heads to be loaded ( parked ) onto and unloaded from a ramp 202 ( best shown in fig1 and 2 ) disposed at the outer diameter ( od ) of the disks 46 . the slider 108 comprises a read head for reading and writing data from and to a magnetic disk ( e . g . disk 46 ). the read head includes a slider substrate having an abs ( the label 108 points to this surface ). the slider substrate may comprise aitic , although another ceramic or silicon materials may also be used . the slider substrate of the read head 210 also includes a trailing face that includes a read / write transducer ( too small to be practically shown in the figures ). in certain embodiments , the read / write transducer may comprise an inductive magnetic write transducer merged with a magneto - resistive read transducer . one purpose of the load beam 402 is to provide limited vertical compliance for the read head of the slider 108 to follow the vertical undulations of the surface of a disk ( e . g . disk 46 of fig1 ) as it rotates , and to preload the air bearing surface of the read head against the disk surface by the aforementioned “ gram load .” fig6 shows the gram load spring biasing forces 602 that are imposed upon a slider abs during conventional gram load measurement . as shown , a conventional method of gram load measurement uses the abs as a reference datum for the measurement of the spring force 602 . that is , the load beam , which may be under compression or tension , is made to move ( e . g ., released from a previously constrained initial configuration and position ) such that the abs of the slider 108 is made to contact the opposing surface of a load cell 604 . the resulting force imposed upon the load cell 604 by the abs of the slider 108 is measured and is related to the gram load . such a system presents two major issues ; namely , abs surface damage and contamination . indeed , the abs - to - load cell contact may damage the delicate structures of the abs and / or the facing surface of the load cell 604 may transfer contaminants onto the abs of the slider 108 , potentially negatively affecting operation of the slider 108 above the disks 46 . one embodiment comprises a gram load measurement assembly that does not rely upon the abss of the sliders - to - load cell contact to accurately measure the gram load . fig7 is a diagram of such a gram load measurement assembly 700 , configured for the measurement of hsa gram load without physical contact between the load cell and the sliders of the hsas . as shown , the gram load measurement assembly 700 may comprise , according to one embodiment , a base assembly 702 that supports a top tooling assembly 704 . characteristics and functionality of each is described hereunder and shown in the figures . fig8 is a diagram of a top tooling assembly 704 of the gram load measurement assembly 700 of fig7 , according to one embodiment . fig9 is a diagram of the base assembly 702 of the gram load measurement assembly 700 of fig7 , according to one embodiment . fig8 and 9 are shown at different scales , for clarity of illustration . according to one embodiment , the top tooling assembly 704 may comprise structure configured to clamp and hold captive an actuator assembly and to position the load beams of the hgas thereof in a manner suitable to enable the measurement of the respective gram loads thereof . the base assembly 702 of fig9 may be configured , according to one embodiment , to house a user interface and controls configured to enable a human or machine operator to operate the gram load measurement assembly 700 . the base assembly 702 may also house a load cell assembly that is acted upon by structure of the top tooling assembly 704 and that generates a corresponding output signal from which a gram load measurement may be derived . fig1 is a cross - sectional view of the gram load measurement assembly 700 , along cross - sectional line aa ′ of fig7 . fig1 is a detail cross - sectional view of the base assembly 702 of the gram load measurement assembly 700 . fig1 shows the hsa 802 mounted in and help captive by the top tooling assembly 704 , a load cell tower 804 and a load cell assembly 806 . the top tooling assembly 704 , according to one embodiment , may be configured to measure the force imparted upon a disk simulator assembly by the hgas of the captive hsa . the disk simulator assembly may be coupled to a load cell tower 804 such as to mechanically transmit the imparted force onto the load cell tower 804 . the load cell tower 804 , in turn , may be coupled to load cell assembly 806 in the base assembly 702 , which load cell assembly 806 may be configured to generate an output signal that may be proportional or otherwise related to the gram load being measured . fig1 is a detail cross - sectional view of the base assembly 702 of the gram load measurement assembly 700 . fig1 shows a hsa 802 held captive by the top tooling assembly 704 . in detail , the top tooling assembly 704 may comprise a disk drive actuator clamping assembly comprising a first pivot datum 810 and a second pivot datum 812 . the top tooling assembly 704 may be configured , according to one embodiment , to cause the first pivot datum 810 and the second pivot datum 812 to clamp down on the pivot bearing cartridge 42 ( also readily visible in fig1 and 3 ) of the hsa ( along actuator pivot axis 48 , for example ). the top tooling assembly 704 , in this manner , holds the hsa under test captive , to enable accurate measurement of the gram load forces . fig1 is a perspective view of an hsa mounted in a gram load measurement assembly 700 according to one embodiment . shown in fig1 is the vcm 801 , the actuator body into which the pivot bearing cartridge 42 is fitted , and actuator arms 813 terminated by the respective hgas of the hsa . according to one embodiment , the hsa and the disk simulator assembly are disposed within the gram load measurement assembly 700 such that there is no contact between the respective abss of the sliders ( or the slider in its entirety ) and any surface during the gram load measurement . indeed , according to one embodiment and as shown in fig1 , during the gram load measurement , it is the distal free ends of the hgas of the hsa that are made to selectively contact the disk simulator assembly 808 and / or any load cell bearing surface during the gram load measurement procedure , rather than abss of the sliders . according to one embodiment and as shown in fig1 , it is the suspension tabs 502 ( also called lift tabs ) disposed at the distal free end of the load beams of the hgas that are positioned to bear against corresponding surfaces of the disk simulator assembly 808 , thereby sparing the more proximally - disposed sliders any potentially damaging contact therewith . as shown , each of the suspension tabs 502 faces a bearing surface of the disk simulator assembly 808 against which the suspension tab will bear during the gram load measurement procedure , thereby exerting a force against that bearing surface , which force may be transmitted to and measured by the load cell assembly 806 within the base assembly 702 . as also shown , the sliders 108 and their respective abss are disposed well away from the disk simulator assembly 808 , sparing them from potential contamination and damage . to properly position the suspension tabs of the hsa under test to face the corresponding bearing surfaces of the disk simulator assembly 808 , the load beams thereof ( attached to the distal end of the actuator arms of the actuator assembly ) may be manipulated so as to separate facing sliders 108 away from one another . once separated , the suspension tabs 502 are in a configuration in which they may be inserted within the openings or features of the disk simulator assembly 808 . alternatively , the disk simulator assembly 808 may be moved into position such that the respective suspension tabs of the hgas fit within openings and face their corresponding bearing surfaces . in this configuration , the suspension tabs 502 face corresponding bearing surfaces if the disk simulator assembly 808 . according to one embodiment , a head spreader assembly is configured to separate the facing sliders 108 from one another . fig1 shows aspects of such a head spreader assembly 814 . the head spreader assembly 814 , according to one embodiment , may comprise a plurality of head spreader tabs , one for each of the hgas of the hsa . some of the head spreader tabs are shown in fig1 , at reference numeral 828 . in the implementation illustrated in fig1 , six such head spreader tabs are provided and actuated by a , for example , pneumatic air gripper assembly 816 . the pneumatic air gripper assembly 816 may comprise a plurality of spreader tab actuation elements 818 , each of which may be mechanically coupled to a corresponding one of the head spreader tabs 828 . according to one embodiment , when the gram load of , for example , head 0 ( coupled to the top - most hga in fig1 ) is to be measured , a corresponding one of the spreader tab actuation elements 818 may be actuated by the pneumatic air gripper assembly 816 to cause the head spreader tab coupled thereto move away from the hga with which it was in contact , thereby enabling the corresponding suspension tab 502 to come into contact with and bear against a corresponding surface on the disk simulator assembly 808 , which bearing force may then be measured by the load cell assembly 806 within the base assembly 702 . for example , when it comes time to measure the gram load of head 5 , the corresponding head spreader tab is moved away from the hga to which head 5 is coupled , causing the suspension tab 820 thereof to move towards and bear against a facing surface 822 , as suggested by the up - facing arrow . similarly , when it comes time to measure the gram load of head 6 , the corresponding head spreader tab is moved away from the hga to which head 6 is coupled , causing the suspension tab 824 thereof to move towards and bear against a facing surface 826 of the disk simulator assembly 808 , as suggested by the down arrow . fig1 is a simplified side view of the hgas , the disk simulator assembly 808 the head spreader tabs 828 , according to one embodiment . fig1 illustrates an initial state before or between gram load measurements . in this state , the head spreader tabs 828 have been actuated to spread the sliders of the hsa such that the suspension tabs 502 face , but do not contact , their corresponding facing surface on the disk simulator assembly 808 . as shown , pairs of hgas ( according to one embodiment , pairs thereof that comprise sliders configured to read and write data from separate but immediately adjacent disks 46 ) may be suitably deflected by the head spreader tabs 828 such that may be interdigitated within corresponding openings defined within the disk simulator assembly 808 . other hgas ( such as , for example , those to which the top - most and bottom - most sliders are coupled ) may be , as shown in fig1 , disposed so as to face a top - facing bearing surface and a bottom - facing bearing surface of the disk simulator assembly 808 , respectively . fig1 illustrates the manner in which the suspension tabs acts upon the disk simulator assembly 808 when a head spreader tab 828 is moved away from its associated hga by a corresponding head separator tab actuator coupled thereto , according to one embodiment . as shown therein , when it is desired to measure the gram load of head 0 ( shown as slider 108 0 , coupled to the top - most hga in fig1 ), the pneumatic air gripper assembly 816 may act upon the spreader tab actuation element 818 coupled to head spreader tab 828 0 . this releases the hga to which head 0 ( slider 108 0 ) is coupled , which elastically tends to move from its initial , deflected state in the direction indicated at 832 until the suspension tab 502 0 comes into contact with and bear against the facing surface 808 0 of the disk simulator assembly 808 . this force , illustrated in fig1 at 830 , is transmitted through the load cell tower 804 to the load cell assembly 806 in the base assembly 702 . the load cell assembly 806 may then generate an output related to the exerted force 830 , from which output a quantity representative of the gram load of head 0 may be derived . the gram loads of other sliders may be similarly measured , by moving a corresponding head spreader tab 828 away from the hga to thereby cause the suspension tab thereof to come into contact and bear against a facing bearing surface ( 808 1 , 808 2 . . . ) of the disk simulator assembly 808 . the gram load of the sliders may be measured sequentially or in any order . the measured / derived gram loads and / or other intermediate values may be stored in a memory disposed , for example , in the base assembly 702 and / or exterior thereto . as may be seen from fig1 , at no time do the sliders of the hgas come into contact with the disk simulator assembly 808 or any other surfaces during the gram load measurement procedure , thereby sparing the abss thereof damage or contamination that may otherwise occur had the sliders been the datum against which the gram load was measured . advantageously , one embodiment may be configured to carry out hga gram load measurements using the suspension tabs of the hgas using a top tooling assembly 704 that may comprise individually - actuable head spreader tabs 828 . according to one embodiment , the configuration of the pneumatic air gripper assembly 816 and the number and configuration of the spreader tab actuation elements 818 and that of the head spreader tabs 828 may be modified at will to conform to the structure ( e . g ., size , shape and number of actuator arms ) of different actuator assemblies . likewise , according to one embodiment , the disk simulator assembly 808 may be modular and may be configured for easy removal and replacement with a different disk simulator assembly configured for other actuator assemblies . the base assembly 702 may also be modular and may be configured to accommodate different top tooling assemblies 704 configured for different actuator assemblies . indeed , rather than modifying the top tooling assembly 704 to accommodate different actuator assemblies , different top tooling assemblies 704 may be configured for different actuator assemblies and may be configured to be hot swappable onto a same base assembly 702 . other permutations are possible . for example , the base and top tooling assemblies 702 , 704 may be integrated into a single device . according to one embodiment , precise control over the displacement imposed by the heads spreader tabs 828 on the hgas is desired , to prevent stacking up tolerances of displacement variations during gram load testing . for example , according to one embodiment , the displacement imposed upon the hgas by the head spreader tabs ( see , e . g ., the displacement imposed on head 0 from its state in fig1 to its state in fig1 ) may be controlled such that the stacking up of displacement errors across sliders is kept to less than about 10 % or less . according to one embodiment , the head spreader assembly 814 , comprising at least the pneumatic air gripper assembly 816 , the spreader tab actuation elements 818 and the head spreader tabs 828 , may be configured to minimize external forces applied to the constituent load beams of the actuator assembly in order to eliminate distortion and side effects of machine operation that may impact other parameters of the hsa . toward that end , the head spreader tabs 828 may be configured to have minimal contact with the load beam , with a minimized amount of shock load . fig1 is a flowchart of a method , according to one embodiment . as shown , the method may comprise , as shown at b 181 , clamping and holding captive an actuator assembly of a disk drive , the actuator assembly comprising a plurality of load beams . block b 182 calls for deflecting the plurality of load beams . as further shown in fig1 , block b 183 calls for causing suspension tabs coupled to respective free ends of the load beams to face respective bearing surfaces . as shown at b 184 , one of the deflected load beams may then be released such that the suspension tab coupled to the released load beam contacts and bears against a corresponding one of the bearing surfaces . as shown at block b 185 , the biasing force of the suspension tab bearing against the corresponding one of the bearing surfaces may then be measured . while certain embodiments of the disclosure have been described , these embodiments have been presented by way of example only , and are not intended to limit the scope of the disclosure . indeed , the novel methods , devices and systems described herein may be embodied in a variety of other forms . furthermore , various omissions , substitutions and changes in the form of the methods and systems described herein may be made without departing from the spirit of the disclosure . the accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of the disclosure . for example , those skilled in the art will appreciate that in various embodiments , the actual physical and logical structures may differ from those shown in the figures . depending on the embodiment , certain steps described in the example above may be removed , others may be added . also , the features and attributes of the specific embodiments disclosed above may be combined in different ways to form additional embodiments , all of which fall within the scope of the present disclosure . although the present disclosure provides certain preferred embodiments and applications , other embodiments that are apparent to those of ordinary skill in the art , including embodiments which do not provide all of the features and advantages set forth herein , are also within the scope of this disclosure . | 6 |
the overall concept of this invention is to integrate ( build in ) an interactive gaming component with exercise and / or fitness equipment ( machines ). at the very least , this provides an entertaining diversion , and if well implemented adds incentive to exercising by making it more fun . the interactive gaming component can be as simple as a standard video game with a display and hand controls built into the machine . this would function as an entertaining diversion unrelated to the exercise activity . in it &# 39 ; s best form , however , the invention correlates the game to the exercise and therefore uses input from the machine such as exercise rate ( e . g ., pedaling speed ) to control a game activity , and outputs game - related feedback to the user such as exercise resistance changes ( e . g ., pedal resistance ) and even sensory virtual reality effects such as vibration , tilt , impact , fan generated “ wind ”, sound effects , seat temperature , etc . thus , for example , the user is on an exercise bicycle ( e . g ., 10 , 10 ′) which controls a virtual bicycle in a race shown real - time on a monitor screen 36 , the user providing both pedaling speed and steering for the virtual bike through the pedals 16 and handgrips 20 of the actual exercise bike / machine 10 , 10 ′. through network communication connections ( e . g ., wired 44 , wireless 66 ), the user can even compete in real time with other exercise machine users in the same fitness center or in remote locations via internet connectivity . furthermore , the competing users can be on different types of game - exercise machines 10 , 10 ′ since the game and game controller 52 are preferably adaptable to work with the different machine types . even further , it is possible to compete between a user on a game - exercise machine 10 , 10 ′ and another user that is playing the same or related game on a non - exercise machine , for example on a commercial game console connected to a television display and a handheld joystick . the game activity does not have to be directly related to the type of exercise machine . for example , a virtual fighter could swing a sword , run , jump etc . with the nature of the activity being selected by a set of push buttons 32 on the machine handgrip ( s ) 20 , while the speed , frequency , and / or force of the sword blows ; the running speed ; the jumping distance / height , and the like being controlled by the user &# 39 ; s exercising speed ; and the virtual direction can be controlled by a thumb - operated joystick 34 on the handgrip 20 or even by directed force applied to the handgrip 20 itself . in another example , a leg - lift weight training machine ( not illustrated ) uses the frequency , timing , height , and / or duration of the lift to control virtual activities in a fighting game . given this teaching , game designers and fitness experts should be able to develop a wide variety of integrated game - exercise machine combinations according to this invention . the illustrated embodiment is a recumbent bicycle exercise machine 10 , 10 ′, shown in two of many possible forms , a first variety 10 being illustrated in fig1 - 7 and a second variety 10 ′ being illustrated in fig8 - 10 . given the teachings herein , it should be apparent that the inventive concept can be applied to a wide range of fitness / exercise machines ; for example , but not limited to : stationary bike , treadmill , stair stepper , rowing machine , elliptical , nordic ski simulator , specific muscle training machines , etc . for each machine , the interactive gaming component can be adapted to a corresponding sport or activity , and / or the various game inputs and outputs can be suitably adapted to a desired game . in general , the interactive gaming component being integrated with an exercise machine comprises : computer / game controller inputs from the user ( e . g ., sensors on the equipment including user - manipulated controls ) game outputs ( feedback ) to the user ( e . g ., visual , audible , sensory ) accessories ( e . g ., music player , multi - user interaction ) referring now to fig1 - 7 , a first embodiment of the inventive exercise - game machine 10 is an enhanced recumbent bicycle exercise machine . as in a standard recumbent bicycle exercise machine , the exercise - game machine 10 has a frame 14 mounted on floor stand feet 26 that extend laterally to prevent tipping over . a seat 12 having at least a seat bottom 24 and preferably a seatback 22 is mounted on the top rear of the frame 14 , preferably with some standard form of fore - aft and / or height adjustment capability . bicycle pedals 16 are appropriately mounted on the frame 14 and attached to a flywheel 58 with an associated braking / resistance mechanism 56 that is adjustable for increasing and decreasing the amount of pedaling resistance . finally , hand grips 20 are provided for the user , mounted on the seat 12 as shown or mounted elsewhere ( e . g ., as a handlebar 20 ). inventive additions to the recumbent bicycle fitness machine 10 , 10 ′ comprise interactive game components including a display 18 mounted on the front of the frame 14 at a position suitable for easy viewing by the user ; one or more pushbuttons 32 positioned in the handgrips 20 for easy actuation by the user &# 39 ; s fingertip ( s ), a joystick 34 positioned for thumb actuation ( optionally replaced on one or both handgrips 20 by a trigger button 34 ); input / output ( i / o ) devices 46 , 48 in the seat back 22 and seat bottom 24 , respectively ; a controller 52 ( including the functions of a game console ); a pedal speed sensor / motor 54 ; electronically controlled brake / resistance control 56 ; and a wireless lan interface 66 . the display 18 has , for example , a color monitor screen 36 that may also be a touchscreen ; a keypad and / or keyboard and / or push buttons 38 ; miscellaneous i / o 40 ( e . g ., switches , buttons , indicator lights , speaker , mike , fan , scent emitter , etc . ); and optionally a cd or dvd player 42 for music , video , and / or game storage and playing . cartridges , removable memory devices , and removable playback units ( mp3 , cd player , etc .) may also be connected via the player 42 . more details are provided hereinbelow . an added convenience feature for exercise machines like the illustrated recumbent bicycle 10 is a set of retractable wheels 28 ( e . g ., two or three on each side of the frame 14 ) that are controlled by a manual lever 30 . when the machine 10 is to be used , the lever 30 is turned to retract / raise the wheels 28 such that the machine 10 is supported on stationary front and back feet 26 as shown in fig1 and 7 . in order to easily roll the machine 10 to a different location , the lever 30 is turned to lower / extend downward the wheels 28 such that the machine 10 is lifted off of the front and back feet 26 and is rollingly supported by the free - rolling retractable wheels 28 , as shown in fig3 . a variant of this convenience feature is shown in fig8 - 10 which illustrate a second embodiment of a recumbent bicycle type of exercise - game machine 10 ′ according to the invention . the second machine 10 ′ utilizes rollers 62 on the front one of the legs 26 , such that to move the machine 10 ′, a person would lift the back end of the frame 14 ( e . g ., by the back one of the legs 26 ) and push or pull the machine 10 ′ as it rolls on the rollers 62 . fig8 - 10 also show some other forms of the interactive game component . a plug cable 44 is a power cord and / or a wired lan cable ( e . g ., ethernet ), and / or a plug cable for connecting external devices ( an audio player , for example ) to the exercise - game machine 10 , 10 ′. fig9 - 10 show speakers 60 mounted above the seat back 22 for stereo sound audible game output / feedback , and / or for entertainment music output ( e . g ., from a music cd player 42 ). fig8 and 10 show a multiple button 32 implementation in the handgrips 20 ( e . g ., buttons for the first and second fingers of each hand ). fig8 - 9 show arrangements and forms of the pedal speed sensor / motor 54 , flywheel 58 , brake / resistance control 56 , and pedals 16 that are different from those shown in fig1 - 7 . with reference to the recumbent bicycle exercise - game machine embodiments 10 , 10 ′ illustrated in the drawings , the interactive game components added to the exercise machine have the following exemplary details : computer / game controller / console 52 : this could be anything from a standard video game box with game cartridges , to a customized computer with lan 44 , wi / fi 66 , and / or internet connections 44 , 66 . the controller 52 is preferably located in or attached to an individual exercise - game machine 10 , 10 ′, but could also be remotely located , such as a central control computer 52 networked to multiple machines 10 , 10 ′ in a fitness center , each exercise - game machine 10 , 10 ′ having an i / o box for directing the input signals and output signals to / from sensors , actuators and the like . user inputs ( to the controller 52 ) include , for example : the pedal speed sensor 54 ; push buttons 32 and / or triggers 34 and / or thumb - operated joysticks 34 built into the handgrip ( s ) 20 ; force sensors 46 , 48 to detect direction and / or magnitude of force applied to the handgrips / handlebar / steering wheel 20 and / or seat bottom 24 and seat back 22 ( effectively making any of them into a joystick , a steering bar / wheel , a bike tilt detector , a flight stick , an isometric force detector , and so on ); a microphone 40 or 60 for detecting voice commands and other sounds ; a temperature sensor ( e . g ., 48 ), an odor sensor ( e . g ., 60 ), a moisture sensor ( e . g ., 48 ), etc . auxiliary inputs include , for example , the keypad / keyboard 38 , a touch screen 36 , buttons , switches , and the like 40 that are associated with general game controls and likely located in or nearby the video display screen / monitor 36 . in non - bicycle embodiments of the present invention , the “ pedal speed sensor 54 ” is a comparable detector ( measurer , sensor ) of exercise effort and / or action achievement ( e . g ., force , rate , speed , frequency , repetition count , tilt angle , etc .). for example , the sensor 54 could measure : isometric force level , nordic ski midpoint horizontal speed or cycle frequency , rowing cycle frequency , and the like . in general , inputs from the exercise machine 10 , 10 ′ are supplied by “ sensors ” that are sensingly attached to suitable parts of the machine 10 , 10 ′ and which are electrically connected ( by wires 50 , or wireless transmission , for example ) to input ports of the controller 52 . the sensors detect and / or measure events , effects and actions occurring outside the controller 52 and thus include things like a rotational speed sensor , microphone , pushbutton and so on . preferably the sensors are built - in , i . e ., integrated with the exercise machine 10 , 10 ′ rather than temporarily attached . feedback outputs ( from the controller 52 ) include , for example : visual images / video on a display screen 36 ; exercise resistance control 56 ( e . g ., magnetic resistance or physical brake force applied to a pedaled wheel 58 ); effects on speed ( e . g ., motor 54 ); vibration , tilt / movement , impact / bump actuators 46 , 48 ; “ wind ” generated by a fan ( e . g ., 40 ), optionally heated or cooled ; seat temperature heating or cooling ( e . g ., 46 , 48 ); lamp heating ( e . g ., 40 ); sounds from a speaker 60 ( which can be headphones ); moisture dispensers ( e . g ., 40 ), scent dispensers ( e . g ., 40 ), etc . in a deluxe embodiment , a closed - box “ simulator ” can provide a virtual reality total immersion environment that requires one or more physical activities ( exercise ) yielding user inputs to the experience . in general , outputs from the controller 52 are supplied by output ports that are electrically connected ( by wires 50 , or wireless transmission , for example ) to “ actuators ” that are actuatingly attached to suitable parts of the exercise machine 10 , 10 ′. the actuators exert physical effects on the machine 10 , 10 ′ and the user , and thus include things such as a display 36 , a motor 54 , a fan 40 , a speaker 60 and the like . preferably the actuators are built - in , i . e ., integrated with the exercise machine 10 , 10 ′ rather than temporarily attached . accessories include , for example , audio ( e . g ., music ) players , speaker ( s ), and / or headphones — built - in and / or provisions for plugging - in external devices , possibly supplied by the user . for example , a built - in cd player 42 is illustrated . audio players 42 include , for example , cd , cassette and mp3 players , radios , etc . appropriate player controls are provided , and for players 42 with removable media ( e . g ., cd ) then provisions are made for the user to load / unload the media . for example , provisions are made for temporarily connecting external audio players to the power and / or sound system of the exercise - game machine 10 , 10 ′. provisions include a pigtail plug - cord 44 for temporarily plugging into the headphone jack of a user &# 39 ; s portable audio player such that the player &# 39 ; s audio output is played through headphones , or amplified and broadcast by premium speakers 60 built into the fitness machine 10 , 10 ′. a suitable shelf or pocket 42 would also be provided for holding the portable player , and power could also be provided , for example with a 12 volt dc “ cigarette lighter ” jack and / or a 120 volt ac receptacle . although the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character — it being understood that only preferred embodiments have been shown and described , and that all changes and modifications that come within the spirit of the invention are desired to be protected . undoubtedly , many other “ variations ” on the “ themes ” set forth hereinabove will occur to one having ordinary skill in the art to which the present invention most nearly pertains , and such variations are intended to be within the scope of the invention , as disclosed herein . | 6 |
referring to the drawings in detail wherein like numerals designate like parts , fig1 of the drawings depicts an embodiment of the invention in which a slope build - up system for flat roofs , such as slag roof 10 , comprises top and bottom crossing perpendicular spanning members 11 and 12 of required lengths to span the existing roof 10 on which the slope build - up system is being installed . the members 11 and 12 are channel members and preferably have hat cross - sections , as shown , to resist bending in all directions . the top spanning members 11 are equidistantly spaced and parallel and occupy a common horizontal plane above and parallel to a horizontal plane in which the bottom spanning members 12 are disposed . the bottom members 12 are upwardly open and rest directly on the existing roof 10 . the top spanning members 11 are downwardly open and their top faces receive and support conventional pre - engineered roof panels 13 utilized in the retrofitted sloped roof being installed . the top and bottom spanning members 11 and 12 are adjustably interconnected by a multiplicity of vertically adjustable stanchions 14 , one of which is shown in detail in fig5 and 6 . each vertically adjustable stanchion 14 includes an interior channel section 15 interfitting with an exterior channel section 16 . the upper end portion of each inner stanchion section 15 is secured within the adjacent top spanning member 11 by a screw 17 engaging within a providing opening 18 in the back web of the stanchion section 15 near its top . similarly , the lower end portion of each outer stanchion section 16 is secured within the adjacent upwardly open bottom spanning member 12 by a screw 19 received through an opening 20 in the back wall of the outer stanchion section 16 . each stanchion 14 of the system is individually adjustable vertically in small increments independently of the other stanchions . to facilitate this fine adjustment , each interior stanchion section 15 is apertured through its side webs to produce a plurality of equidistantly spaced adjustment apertures 21 along its length on 3 / 4 &# 34 ; centers , for example . the mating outer stanchion section 16 is similarly provided in its side webs with adjusting apertures 22 on slightly greater centers , such as 1 &# 34 ; centers . these center distances are variable in the manufacturing of the system and are not critical , and are given as an example only . the arrangement , as best shown in fig5 allows for small increments of vertical adjustment of each stanchion 14 , which small increments could not be obtained if the apertures 21 and 22 were on equal centers in the stanchion sections 15 and 16 . when each stanchion 14 is vertically adjusted a required amount to impart a desired degree of slope to the roof being installed , such stanchion is locked in the selected adjusted position by a screw 23 , fig5 and 6 , placed through a pair of registering apertures 21 and 22 . this fine degree of adjustability of each stanchion 14 , independently of the other stanchions , enables the system to compensate for surface irregularities in the existing roof 10 while supporting the roof panels 13 in proper alignment in a common plane having the desired slope . the pre - engineered roof panels 13 are compatible with conventional roof clips 24 , fig5 which may be provided on the top spanning members 11 , if desired . otherwise , the panels 13 may rest directly on the members 11 and may be attached thereto with suitable fasteners . as shown in fig1 certain stanchions 14 along the margins of the retrofitted sloping roof are equipped at their bottoms with bearing plates 25 because these particular stanchions are beyond the reach of the bottom spanning members 12 . fig1 shows the installed roof above the existing roof 10 sloping from left to right as evidenced by the fact that the stanchions 14 at the left side of fig1 are vertically longer than those near the right side of fig1 . the slope build - up system shown in fig1 provides crossing braces 26 between stanchions 14 in two orthogonal planes . the braces 26 in one plane are above the lower spanning members 12 while those in the other plane are beneath the upper spanning members 11 . the crossing braces 26 beneath the spanning members 11 are provided in the system in rows between an adjacent pair of the lower spanning members 12 , fig1 and likewise the crossing braces 26 above the spanning members 12 are provided in rows between the upper spanning members 11 , fig1 . these rows of crossing braces 26 in two directions in the system are provided preferably at thirty foot intervals , and it is not required to provide the crossing braces between all pairs of the spanning members 11 and 12 . the opposite ends of the braces 26 are fixed to the stanchions 14 near the tops of their inner sections 15 and near the bottoms of their outer sections 16 . as best shown in fig7 each brace 26 is actually comprised of two brace sections 26a and 26b . apertures 26c in brace section 26a are spaced on smaller center distances , such as 3 / 4 &# 34 ; distances in comparison to apertures 26d in brace section 26b which are on 1 &# 34 ; centers , for example . when the two sections 26a and 26b are secured together in side - by - side contacting relationship by fasteners 26e , the same fine incremental length adjustment of the crossing braces 26 is enabled , as described previously for the stanchions 14 having the differently spaced apertures 21 and 22 . end apertures 27 provided near the opposite ends of the brace sections 26a and 26b enable the connecting of the crossing braces 26 to the stanchions 14 by additional screws similar to the screws 23 , as shown in fig7 . the slope build - up system further comprises at approximately thirty foot intervals across the system substantially horizontal braces 30 , fig1 and 2 . these braces underlie the spanning members 11 and 11a adjacent to a row of the stanchions 14 , as shown in the drawings . additionally , all components of the slope build - up system are precut and prepunched and utilize light gage metal for the sake of economy and convenience of installation . it can be seen that the system is highly versatile , readily adjustable to meet the varying irregularities of the existing roof 10 , and lends itself to convenient and fast installation with no necessity for expensive custom cutting and joining of system components , as in the prior art . fig2 of the drawings shows a second embodiment of the invention which differs from the embodiment in fig1 only in that the top spanning members 11a are above and parallel to the bottom spanning members 12a instead of being perpendicular thereto . the same vertically adjustable stanchions 14 , previously described , are connected between the spanning members 11a and 12a in the manner shown in fig5 . in all embodiments of the invention , the prepunched spanning members have openings for the screws 17 and 19 provided along their lengths so that the stanchions 14 can be installed at regular spaced intervals . the arrangement of the cross braces 26 between the stanchions 14 in two orthogonal planes is also the same as previously described for all embodiments of the invention . fig3 shows an embodiment of the invention in which the bottom horizontal spanning members are eliminated and , instead of these members , the bottoms of the adjustable stanchions 14 are equipped with bearing plates 25 . as shown in fig7 each bearing plate 25 carries a pair of spaced upstanding apertured lugs 28 which can receive a screw 29 , also engaging in a lowermost aperture 22 of the outer stanchion section 16 . the top spanning members 11b in fig3 remain as they are in the previous embodiments of the invention as do the cross braces 26 between the stanchions 14 . in all embodiments of the invention , it should now be apparent that the slope build - up system is adjustable not only to provide the desired drainage slope for the roof panels 13 but also to compensate for surface irregularities in the existing roof 10 . this compensation is enabled by the independent adjustability of the stanchions 14 in small increments , such as 1 / 4 &# 34 ;. the simplicity of the system and its adjustability enables quick installation of a sloping roof on an existing flat or nearly flat roof with a minimum of labor and a minimum number of components . it is to be understood that the forms of the invention herewith shown and described are to be taken as preferred examples of the same , and that various changes in the shape , size and arrangement of parts may be resorted to , without departing from the spirit of the invention or scope of the subjoined claims . | 4 |
according to one aspect of the invention , generation and real time manipulation of a test vector includes four main components including : vector tester hardware , appropriate initialization vector for initializing a microprocessor to a known state , an integrated debug trigger , and a test case image vector . to access the microprocessor &# 39 ; s machine information on a particular cycle of the test case vector , the vector initialization code is run on the microprocessor under test , followed by the code to program the integrated debug trigger , and then a partial version of vector initialization code . at this point , the original test case image vector is executed . this partial version of vector initialization code makes the microprocessor state machine behave as if running with the full vector initialization code , without resetting the integrated debug trigger state machine . the partial version of vector initialization code synchronizes the vector with the original test case image vector . therefore , the user may modify the integrated debug trigger vector , allowing the microprocessor to stop at a specific time and enable acquisition of the microprocessor internal state information via an appropriate scan mechanism . the vector tester may include an appropriate digital ic test system , such as the hp 83000 model f330 general - purpose vlsi test system . fig1 is a block diagram of a test system according to the invention . the system includes a state simulator 101 used to simulate test case code 102 to provide a chip interface test vector such as microprocessor test vector 103 . microprocessor test vector 103 is supplied to test vector generator 104 which functions as a vector converter in that it converts microprocessor test vector 103 to produce test case image vector 113 . test case image vector 113 is supplied to test vector integrator and tester controller 105 which manipulates test case image vector 113 together with partial version of initialization vector 114 and debug image template vector 107 in response to input provided by a user via user interface 108 . the user interface 108 may include a processor , a display and appropriate input devices such as keyboard , mouse etc . the debug image template vector 107 includes instructions and data where the data may be modified as required by the user . this modification by the user does not impact the instruction stream sent to the microprocessor 110 . test vector integrator and tester controller 105 also controls vector tester hardware 109 in which unit under test 110 has been placed . test vector integrator and tester controller 105 provide the insertion of image vector 111 to vector tester hardware 109 . whenever the vector tester hardware 109 detects a mismatch between the behavior of the unit under test 110 and the image vector 111 , vector tester hardware 109 sends the mismatch data back to test vector integrator and tester controller 105 . when a mismatch occurs the user can read the mismatched data and manipulate the inputs to test vector integrator and tester controller 105 to create a revised image vector used for subsequent testing . these inputs may be manipulated manually by the user or may be programmed for repeated observations . additionally , the full functionality of the onboard logic analyzer is also available to the user as described in u . s . pat . no . 5 , 867 , 644 entitled system and method for on - chip debug support and performance monitoring in a microprocessor , issued feb . 2 , 1999 to gregory ranson which has been previously incorporated by reference . referring again to fig1 when power is applied to microprocessor 110 , a portion of the microprocessor is initialized by a reset signal . microprocessor 110 attempts to fetch instructions at a specific address where the instructions are supplied by the part of image vector 111 , which corresponds to initialization vector 106 . each time microprocessor 110 attempts to access additional data , that data is also supplied by the part of image vector 111 which corresponds to initialization vector 106 . this continues until part of the image vector 111 which contains the initialization vector information is consumed . in a non debug mode of operation , microprocessor 110 would run the test case image vector immediately following the part of image vector 111 which corresponds to initialization vector 106 . once this data is consumed , the instructions are supplied by the part of image vector 111 , which contains debug image template vector 107 . these instructions are supplied by the vector tester hardware 109 and are processed by the microprocessor in the same manner as the data from the part of image vector 111 which corresponds to initialization vector 106 . the part of image vector 111 which contains a partial version of initialization vector 114 is consumed similarly . as previously described , this portion of the image vector 111 which contains a partial version of initialization vector 114 makes the microprocessor state machine behave as if running with the full vector initialization code without resetting the integrated debug trigger state machine . the part of the image vector which corresponds to the test case image vector 113 is executed similarly . the operation of apparatus 100 ( fig1 ) is more filly described now in connection with fig2 of the drawings . the method begins at step 201 , and at step 202 , the previously simulated input vector and test case image vector from step 203 are integrated to form an image vector . at step 204 the image vector is loaded into vector tester hardware to test the unit under test . the image vector is run on the unit under test at step 205 , and at step 206 , test output is extracted from the unit under test , via the vector tester hardware . the extracted output is displayed , via user interface 108 , on appropriate display 116 . the user interface 108 works in conjunction with processor 115 and the user interacts with processor 115 via input device 117 . in step 207 , a determination is made by the user as to whether the test is performed again with a modified test image vector . the user may establish various criteria for testing and refinement of the test image vector . for example , if the actual output from the microprocessor is sufficiently close to a precalculated expected output , the user may elect to terminate further testing and processing terminates at step 208 . conversely , if the output obtained from the microprocessor under test is not acceptable , then the user may elect to continue to refine the test image vector in an attempt to converge to an acceptable test image vector result . in another scenario , the user may elect to modify the test image vector to obtain test data from previous or subsequent cycles of the microprocessor under test , running a sequence of tests to obtain a continuum of test outputs and reconstruct the evolving state of the microprocessor . thus , at step 209 , the user , using user interface 108 and display 116 and input device 117 , may modify the test image vector and rerun generation of a new image vector at step 202 . fig3 illustrates computer system 300 adapted to use the present invention . central processing unit ( cpu ) 301 is coupled to system bus 302 . cpu 301 may be any general purpose cpu , such as an hp pa - 8500 or intel pentium processor . however , the present invention is not restricted by the architecture of cpu 301 as long as cpu 301 supports the inventive operations as described herein . system bus 302 is coupled to random access memory ( ram ) 303 , which may be sram , dram or sdram . rom 304 is also coupled to system bus 302 , which may be prom , eprom , or eeprom . ram 303 and rom 304 hold user and system data and programs as is well known in the art . system bus 302 is also coupled to input / output ( i / o ) controller card 305 , communications adapter card 311 , user interface card 308 , and display card 309 . the i / o card 305 connects to storage devices 306 , such as one or more of a hard drive , a cd drive , a floppy disk drive , a tape drive , to the computer system . communications card 311 is adapted to couple computer system 300 to network 312 , which may be one or more of a telephone network , a local ( lan ) and / or a wide - area ( wan ) network , an ethernet network , and / or the internet network and can be wire line or wireless . user interface card 308 couples user input devices , such as keyboard 313 and pointing device 307 , to computer system 300 . display card 309 is driven by cpu 301 to control display device 310 . | 6 |
in fig1 reference numeral 1 denotes a conventional folding box which has lettering , advertising text , advertising figures and the like as is denoted at reference numeral 2 for example . the box is provided with a suspending rail or tag 3 with a hole 4 with whose help the box can be suspended on a projecting pin along with other such boxes . the suspending tag is provided for example with a series of fig5 , 7 as instructions for use for employing the apparatus in accordance with the invention and may also be provided if necessary with further lettering or text as is denoted by reference numeral 8 . on the right - hand side , in the case of the embodiment shown , the box is opened . the folding flap 9 and the two side flaps 10 and 11 , respectively , are opened . a receiving or carrying plate 12 is drawn out of the box , a section of this plate being shown in detail in fig3 . it has openings , as indicated at 13 and 14 in fig3 through which troughs 15 and 16 formed in a sheet of plastic material 12a extend . in these troughs 15 and 16 , capsules 17 and 18 are contained or received . these capsules are just large enough to hold sufficient stain removing agent to clean a typical individual stain . for unusually large stains two or more capsules might be used . one capsule is shown in detail in plan view in fig2 and it will be described in more detail below . the troughs are covered by a further foil 19 . by pressing on the upper side of the troughs 15 and 16 , respectively , it is possible to press the capsules 17 and 18 out through the foil 19 . on one edge 20 of receiving plate 12 , folding flaps 20a are provided on which advertising text and / or instructions for use can be printed . the capsule 17 , shown in fig2 is made of gelatine or other plastic material and has a neck 21 , which is separated from the body of the capsule 17 , preferably , by a zone of weakness 22 . preferably , zone 22 is treated by drawing the neck during formation of the capsule , providing a slightly narrower and thinner walled zone 22 . this is done during the capsule sealing process , after the capsules have been filled . owing to this zone of weakness , it is possible to twist off the neck 21 of the capsule 17 as can be seen in fig4 . it is now possible to apply a pressing force as indicated by the arrows a , b to force the contents of the capsule , that is to say the stain removing agent 22 &# 39 ; in paste form to a strip of textile material 23 , for example . in the embodiment shown , a cutting saw is provided which is in the form of saw teeth at the edge 24 . this can be used to separate neck 21 from the capsule 17 . the cardboard plate 12 creates an edge sufficiently rigid and sharp that saw toothed edge 24 will cut through weakened zone 22 of capsule 17 . the saw teeth can be reinforced by extending the plastic layer and / or the foil layer to the saw teeth edge . instead of this edge with saw teeth , it is also possible to provide a separate cutting device in the package . it is , however , preferred to provide the cutting device in the form of saw toothed edge 24 because the possibility of the cutting device being lost is eliminated . as is known , stain removing agents in the form of paste must be removed after drying with the help of a brush or scraper . since such a brush is not always available , for example on a journey , another edge of the receiving plate 12 is corrugated as is shown by reference numeral 25 . owing to this corrugated construction a structure is produced with which the dried residues of the stain removing agent paste can be brushed off without any difficulties . naturally , the package can also be provided with a small handy brush , or by suitable cutting of one edge of the receiving plate 12 it is possible to provide a brush - like structure of a type other than the corrugated brush or scraper edge . in the embodiment shown only one filled receiving plate 12 is accommodated in the box 1 . it is , however , a matter of course that the apparatus in accordance with the invention can also be so constructed that by making the box 1 larger , several receiving plates or carrying plates filled with capsules 17 and 18 , respectively , can be arranged one on top of the other . the principle of the invention can also be seen to be useful for the reception or vending of liquid stain removing agents . from a cleaning standpoint , agents in paste form are preferred in that liquid stain removing agents do not generally ensure that after drying , no margin remains on the textile material or the like which is cleaned . it is , of course , understood that the above is merely a preferred embodiment of the invention and that various changes and alterations can be made without departing from the spirit and broader aspects of the invention . | 1 |
reference will now be made in detail to the present preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . in fig1 and 2 of the drawings , which show a preferred embodiment according to the present invention , the reference numeral 1 designates a seat including a seat cushion 2 and a seatback 3 . as shown clearly in fig . 2 , a seat cushion bracket 4 is provided on each of both sides of the seat cushion 2 and seatback brackets 5 are fixedly mounted to both sides of a seatback frame 3a extending about the seatback 3 . as shown in fig3 a - 6 , guide members 6 and 7 are fixed to a side surface of the seatback bracket 5 for receiving the seat cushion bracket 4 . a lever 8 is pivoted on a rear surface of the seatback bracket 5 by a pivot pin 9 . a cam member 10 is interposed between the guide member 6 and the lever 8 through a relatively large opening 5a in the seatback bracket 5 . member 10 is guided by a pair of projecting ledge - like portions 6a formed on the guide member 6 ( fig3 and 6 ) in a manner so that up and down movement of the cam member 10 is restricted , whereas left and right sliding movement of the cam member 10 , as presented in fig3 a , is unrestricted by fixed stops . furthermore , the cam member 10 is provided with a projection 10a which extends into an elongated wedge - shaped hole 8a ( fig4 and 7 ) formed on the lever 8 . a follower pin 12 , slidable in an elongated arcuate hole or slot 6b , which is concentric with the pivot pin 9 and formed in the guide member 6 , is mounted on the lever 8 and extends through the opening 5a and slot 6b to ac - ring 11 . the follower pin 12 is engageable with a ramp surface 10b ( figs . 3a and 7 ) of the cam member 10 . a lifting pin 13 is provided on the lever 8and is projected between the seatback bracket 5 and the guide member 6 through a relatively small , generally rectangular opening 5b formed on theseatback bracket 5 . a tensioned coil spring 14 is interposed between the seatback bracket 5 and the lever 8 , one end thereof being engaged with a lug 5c on the seatback bracket 5 and other end thereof being engaged with lug 8c formed on the lever 8 . the spring 14 always urges the lever 8 in the clockwise direction in fig3 a , that is to say , in a direction by which the ramp surface 10b of the cam member 10 and the follower pin 12 are engaged . the seat cushion bracket 4 , as shown in fig3 b , includes a tapered lockingrecess 15 adapted to receive a similarly tapered bolt portion 10c of the cam member 10 , a groove 16a parallel to the insertion direction of the seat cushion bracket 4 to the seatback bracket 5 and engageable with the lifting pin 13 , and an engaging groove 16 having an edge 16b inclined to the above - mentioned insertion direction . as described hereinafter , the seatback 3 is advanced from a position in which it is separated from the seat cushion 1 , as shown in fig2 to an assembled position with the seat cushion as shown in fig1 . when the seatback bracket 5 is assembled with the seat cushion bracket 4 , the latter bracket becomes inserted between the seatback bracket 5 and theguide members 6 and 7 . during such insertion , a top edge 4a ( fig3 b ) of the seat cushion bracket 4 contacts the lifting pin 13 to cause the lever 8 to be pivoted in a counter - clockwise direction against the force of the spring 14 as illustrated in fig3 a . the follower pin 12 is slid along theelongated arcuate slot 6b and the engagement of the follower pin with the ramp surface 10b on the cam member 10 is released by movement of the lever8 to the position shown in fig7 . the cam member 10 becomes slidable in the rightward direction as shown in fig3 a , and is thus slid to the rightalong the projecting portion 6a by an inclined edge of the elongated hole 8a in the lever 8 engaging with the projection 10a of the cam member 10 infig3 a . at the same time , the lifting pin 13 on the lever 8 is released from the top edge 4a of the seat cushion bracket 4 and is received in the groove 16a . the lever 8 is then rotated in the clockwise direction by the force of the spring 14 , as shown in fig7 toward the position shown in fig3 a . however , the lifting pin 13 on the lever 8 contacts with a side edge of the groove 16a to restrict such rotation of the lever 8 . as a result , the cam member 10 remains in the position shown in fig7 because the follower pin 12 remains elevated in the arcuate slot 6b . when the seat cushion bracket 4 is fully received between the seatback bracket 5 and guide members 6 and 7 , the lifting pin 13 on the lever 8 is released from the groove 16a into the groove 16 . the lever 8 pivots in a clockwise direction in fig7 due to the shape of the edge 16b and the force of the spring 14 . the cam member 10 , previously moved to the right position in fig7 by the projecting portion 10a engaging an edge of the elongated hole 8a in the lever 8 , is now moved to the left by another edgeof the hole 8a so that the bolt portion 10c on the cam member 10 moves intothe locking recess 15 of the seat cushion bracket 4 . in addition , the follower pin 12 moves down along the elongated hole 6b to engage the ramp surface 10b of the cam member 10 and retain the cam member 10 against further movement . the seatback bracket 5 is thus supported by the seat cushion bracket 4 , and the assembly of the seatback 3 to the seat cushion 2 is accomplished . in fig8 - 11 , the described components on the respective brackets 4 and 5 are shown in the fully assembled condition . thus , the tapered bolt portion10c of the cam member 10 is shown in fig8 to be firmly engaged in the correspondingly tapered lock recess 15 of the seat cushion bracket 4 by wedging action of the follower pin 12 on the lever 8 , pulled by the spring14 , against the ramp surface 10b of the cam member 10 . also , and as shown in fig9 the projection 10a on the cam member 10 is free of the edges ofthe hole 8a in the lever 8 . finally , as shown in fig1 and 11 , the forceurging the cam member 10 in the direction of the lock recess 15 on one edgeof the seat cushion bracket 4 is opposed by engagement of the opposite sideof the bracket 4 with the guide members 6 and 7 fixed to the seatback bracket 5 . as above - mentioned , the seatback 3 can be assembled to the seat cushion 2 simply by inserting the seatback bracket 5 over the seat cushion bracket 4 . consequently , full assembly of the seatback 3 and the seat cushion 2 can be attained after both have been completely finished separately , thereby assuring the quality of each component of the seat 1 . since the seatback bracket 5 and the seat cushion bracket 4 are located entirely within the seatback 3 in the assembling procedure , it is not required thatthe seatback bracket 5 and the seat cushion bracket 4 be covered by other material . further , the seatback 3 is supported on the seat cushion 2 by the fixed connection of the cam member 10 and the locking recess 15 , so the seatback 3 and the seat cushion 2 can be supported in a predetermined position simply and rigidly without influence by tolerance variations in the locking recess 15 and the cam member 10 . furthermore , since the cam member 10 is maintained in its locking state by the engagement of the rampsurface 10b , the follower pin 12 , and the urging force of the spring 14 , the seatback 3 is prevented from movement with respect to the seat cushion as shown in fig1 and 13 , it is possible to improve the rigidity of the lever 8 by adding sublever 17 to the lever 8 using the pins 9 and 12 by peening the ends of both pins against the sublever 17 , the seatback bracket 5 , and the guide member 6 . other embodiments of the invention will be apparent to those skilled in theart from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims . | 1 |
this invention relates to systems for detecting the speed and direction of motion of a moving part by performing logic functions on signal level transitions which are generated as portions of the part travel past a sensor . the system is capable of distinguishing between signals which result from substantially continuous motion of the part and signals which result from intermittent motion reversals or &# 34 ; jitter &# 34 ;. it is known to determine the motion of a part such as a rotating gear , wheel , or shaft by generating a signal exhibiting alternately opposite transitions between two discrete signal levels as a surface of the part travels past a sensor . such a signal may be generated by locating a magnetic pickup adjacent the periphery of a gear such that an electrical signal of varying amplitude is produced in the pickup as the gear teeth rotate . the speed of rotation may be readily determined as a function of rate of occurrence of the signal transition . see for example u . s . pat . no . 4 , 028 , 686 , issued june 7 , 1977 to michael a . wilson et al and the prior art cited therein . in a system of the type described above , signal transitions can result not only from continuous rotation of the gear past the magnetic pickup but also from &# 34 ; jitter &# 34 ;; i . e ., intermittent rotation in alternately opposite directions wherein a given gear tooth simply moves back and forth past the magnetic pickup . to distinguish between continuous motion and &# 34 ; jitter &# 34 ; the aforementioned patent to wilson et al teaches the use of multiple sensors to generate a plurality of phase - shifted signals each representing motion of the same part and the logical combination of those signals to produce a sequence of related signal quantities . true continuous motion is indicated only by the occurrence of a complete sequence of the related signals , a partial sequence being taken as the result of &# 34 ; jitter &# 34 ;. the system of wilson et al described above exhibits the disadvantage of requiring three or more sensors each with its attendant signal paths and magnetic pickup means . moreover , the system of wilson et al does not yield information identifying the direction of part motion or the net travel of a part moving for a significant period of time in one direction and later reversing to move for a significant period of time in the opposite direction . the u . s . pat . no . 4 , 142 , 152 , issued feb . 27 , 1979 to fincher teaches that the direction of movement of a rotating part can be obtained using only two sensors . however , the rotating part must itself be specially constructed so as to exhibit magnetic sections of precise circumferential length such that the two spaced sensors can be simultaneously actuated by a single magnetic section . the present invention is directed to overcoming one or more of the problems as set forth above . in one aspect of the invention a system is provided for monitoring the motion of a conventional dynamic part such as a rotating gear by generating two phase - shifted signals exhibiting transitions between discrete signal levels . the system distinguishes between continuous motion and &# 34 ; jitter &# 34 ;, and , in addition , yields information pertaining to the direction of motion . in general , this is accomplished in a system which comprises sensor means for generating first and second phase - shifted signals which vary cyclically between opposite signal levels at a rate dependent upon the speed of part motion , decoder means connected to receive the first and second phase - shifted signals for generating a sequence of discrete output quantities representing different relationships between the input signal levels , an up / down counter , and logic means interconnecting the output of the decoder means to the counter in such a fashion as to count up when the decoder output sequence occurs in one order , to count down when the decoder output sequence occurs in the opposite order , and to refrain from counting at all unless and until a complete sequence of decoder outputs occurs . fig1 illustrates an embodiment of the present invention in a system for monitoring the speed and direction of a rotating gear . fig2 is a schematic circuit diagram of a preferred signal generating means for use in the embodiment of fig1 . fig3 illustrates the preferred waveforms which are produced in the embodiment of fig1 . fig4 is a truth table for the decoder which is employed in the embodiment of fig1 . fig1 illustrates an embodiment of the invention which monitors the speed and direction of rotation of a gear 10 having peripheral teeth 12 . the system comprises a pair of magnetic sensors 14a and 14b which are disposed closely adjacent the gear teeth 12 to generate respective first and second signals which alternate between discrete signal levels as the gear teeth 12 rotate past the sensors 14a and 14b . line a of fig3 illustrates the preferred signal waveform produced by the sensor 14a and line b of fig3 illustrates the preferred waveform of the sensor 14b . the phase - shifted relationship between the signals appearing in fig3 is the result of the physical spacing between the sensors 14a and 14b measured along a line tangent to the direction of motion of the gear teeth 12 . the signal output of sensor 14a is connected through a signal shaping network 16 and a low pass filter 18 to the a input of a two - to - four line decoder 20 such as cd 4555 . similarly , sensor 14b is connected through signal shaping network 22 and low pass filter 24 to the b input of decoder 20 . the low - pass filters 18 and 24 protect against high frequency noise . shaping networks 16 and 22 square up the more sinusoidal signals from the pickup coils of sensors 14a and 14b . decoder 20 responds to the levels of the waveforms applied to the a and b inputs thereof and to the relationship between said levels to produce a sequence of four discrete output signals identified in fig1 as s0 , s1 , s2 and s3 . assigning the discrete levels of the waveforms at the a and b inputs of decoder 20 binary signal values of &# 34 ; 1 &# 34 ; and &# 34 ; 0 &# 34 ;, the output state of the decoder 20 is as represented in the truth table of fig4 . the outputs s0 through s3 of decoder 20 are connected through appropriate conductors to logic means which interpret the decoder outputs as well as the order in which said outputs occur to determine the speed and direction of rotation of the gear 10 relative to the sensors 14 . this logic means comprises a first state memory including nor gates 26 and 28 which are cross - connected to form a bistable circuit , a middle state memory comprising flip - flops 30 and 32 and a third state detector comprising and gates 34 and 36 and a third state clock memory including nor gates 38 and 40 which are cross - connected to form a bistable circuit . middle state memory flip - flops 30 and 32 may be implemented using integrated circuits cd 4013 and the combination of gates 34 , 36 and 38 may be implemented using half of integrated circuit cd 4085 . the output of gate 40 is connected to the clock input of counters 42 and 44 , each of which may be implemented using a cd 4029 integrated circuit . counters 42 and 44 are &# 34 ; up / down &# 34 ; counters , meaning that they may be incremented or decremented in accordance with the state of a signal applied to the u / d inputs of said counters by middle state memory flip - flop 30 as hereinafter described . eight outputs of counters 42 and 44 are connected by means of bus 46 to a processor 48 which is programmed to generate read commands and to interpret the 8 - bit counter contents word to determine the net rotational displacement of gear 10 . processor 48 determines the net direction of rotation by the state of &# 34 ; signbit &# 34 ; inverter 114 and the speed of rotation as a function of the binary number represented by the 8 bits of counters 42 and 44 in a given time period . processor 48 produces counter read signals on line 50 , said signals being applied to the pe ( preset ) inputs of counters 42 and 44 by way of line 54 to reset the counters 42 and 44 to their initial state after reading . counter 42 has the &# 34 ; carry - out &# 34 ; pin connected via inverter 121 to the &# 34 ; carry - in &# 34 ; pin of counter 44 . the carry - out of counter 44 is connected directly to the carry - in of counter 42 . it will be appreciated that the output of a conventional magnetic coil sensor does not exhibit a sharp square waveform of the type preferred for digital circuit operation . rather , it is sinusoidal in character and contains noise of a higher frequency super - imposed thereon . signal shapers 16 and 22 square off the sensor waveforms in accordance with a comparison to a dc reference . these square up waveforms still contain unwanted noise pulses of very short duration , such noise pulses being filtered out by circuits 18 and 24 . the detailed interconnections between the components of the embodiments of fig1 will now be described . the s3 output of decoder 20 is used as an initialization signal and is connected by way of line 56 to the reset input of each of the middle state memory flip - flops 30 and 32 to ensure that these flip - flops are reset whenever an input signal condition of &# 34 ; 00 &# 34 ; occurs . the s3 output is also connected by way of line 58 to one of the inputs of third state memory 38 and 40 . the occurrence of a high signal value at s3 thus terminates any previous clock signal and ensures a low output from gate 40 to prevent a clock signal pulse from reaching either of the counters 42 and 44 . the s0 output is connected by way of line 60 to an input of nor gate 26 and by way of line 62 to an input of and gate 36 . the s2 signal is connected by way of line 64 to an input of nor gate 28 and by way of line 66 to an input of and gate 34 . finally , the s1 output of decoder 20 is connected commonly by way of line 68 to the clock inputs of flip - flops 30 and 32 and also by way of line 70 to an input of nor gate 40 . in addition to being cross - coupled as previously mentioned , nor gates 26 and 28 have their outputs connected to the data inputs of flip - flops 32 and 30 respectively to set those flip - flops in accordance with which of the s 0 and s 2 signals occur first after the s 3 signal , the order of occurrence of these two signals being determinative of the direction of gear rotation . flip - flop 30 will be high if s 0 occurs after s 3 indicating forward motion and low if s 2 occurs . the output of flip - flop 30 is connected by way of line 72 to the count direction inputs of counters 42 and 44 and also to one of the inputs of and gate 34 in the third state detector . the output of flip - flop 32 is connected to an input of and gate 36 , the other inputs to both gates 34 and 36 having been previously described . the outputs of and gates 34 and 36 are connected as inputs to nor gate 38 , which acts as a latch circuit , since the output of nor gate 40 is connected back by way of line 74 to the third input of nor gate 38 . the three inputs to nor gate 40 comprise s 1 , s 2 , and the inverted value of its own output via line 74 and gate 38 . the output of nor gate 40 is connected to the clock inputs of counters 42 and 44 . thus the clock goes high on state s 1 if and only if s 0 or s 2 has followed s 3 . the read output signal line 50 is connected through inverter 76 and r / c time delay circuit 78 , 80 to one input of nor gate 82 , and to decoder 20 through inverter 52 . an uninverted read signal is connected to the other input of gate 82 . the output of gate 82 is connected by way of line 54 to the preset enable input of each of the counters 42 and 44 to preset them a time delay after the read has occurred . a preferred implementation of the signal generating sensor 14 is shown in fig2 to comprise an oscillator 90 having a tank circuit 106 in the form of a conductor which is linked through a magnetic core 98 imbedded in a plastic sensor body 102 . as is further and more fully described in copending application , u . s . ser . no . 150 , 252 filed feb . 4 , 1980 , entitled &# 34 ; velocity sensing system &# 34 ;, movement of the gear teeth 12 past the sensor body 102 varies the quantity of flux from permanent magnet source 100 which links the core 98 and hence tunes and detunes the tank circuit 106 of oscillator 90 to produce a recurring and alternating frequency shift between high and low frequency levels . the output of oscillator 90 is connected to an input of phase detector 92 along with a center frequency signal from voltage controlled oscillator 94 . the high and low frequency components from oscillator 90 occur on opposite sides of the center frequency from voltage controlled oscillator 94 and hence produce a substantially digital signal output from phase detector 92 ; i . e ., a signal having substantially the waveform shown in either of lines a or b of fig3 . the output waveform is shaped by shaping circuit 96 to form a square wave or rectangular wave signal which may be applied directly to the a input of decoder 20 as shown in fig1 . core 98 is the counterpart of sensor 14a in fig1 and adjacent core 104 is the counterpart of sensor 14b in fig1 it being understood that the line shown linking core 104 forms the tank circuit for a second oscillator 108 , phase detector 110 , and shaping network 112 and vco 113 which produce a second waveform in accordance with the circuit description already given . the operation of the circuit of fig1 will now be described with reference to application in determining the speed and direction of rotation of a motor drive gear in an hydraulic motor unit for a heavy offroad vehicle . rotation of gear 10 in one direction represents forward motion of one side of the vehicle and rotation of the gear 10 in the opposite direction represents reverse movement of that same side of the vehicle . track vehicles which are steered by different rates and / or directions of rotation of independent left and right drive motors comprise two systems of the type described herein , one on each side of the vehicle . assuming rotation of motor gear 10 in a forward direction , the waveforms illustrated in fig3 of the drawings result . these waveforms are shaped and filtered by circuits 16 , 18 , 22 and 24 and applied as input signals to the a and b inputs of decoder 20 . whenever the &# 34 ; 00 &# 34 ; conditions results , output s3 goes high applying a reset signal to both flip - flops 30 and 32 . in addition , an input is applied to gate 40 to reset the clock memory and prevent the clock signal from reaching either of the counters 42 and 44 . from state s3 decoder may either advance to s0 or regress to state s2 . assuming forward motion the output of decoder 20 advances to state s0 setting the output of gate 28 to a &# 34 ; 1 &# 34 ;. this applies a data signal of &# 34 ; 1 &# 34 ; to the input of flip - flip 30 and &# 34 ; 0 &# 34 ; to the data input of flip - flop 32 . a &# 34 ; 1 &# 34 ; also appears at one of the inputs to and gate 36 but has no effect since each of the middle state flip - flops 30 and 32 are temporarily reset . again no clock is passed to the counters 42 and 44 since the block memory ( 38 and 40 ) is reset . assuming continued rotation of gear 10 , the decoder advances to state s1 . note that if &# 34 ; jitter &# 34 ; is occurring the decoder would regress to state s3 and the flip - flops 30 and 32 would simply be reset . however , advancing to state s1 clocks the data through flip - flop 30 applying a signal to the direction input ( u / d ) of counters 42 and 44 by way of line 72 . at this point decoder output s0 may reoccur holding all flip - flops 30 , 32 , 26 and 28 in their previous condition . in addition , gate 34 now has both inputs high to cause the clock memory ( 38 and 40 ) to become set . a high signal is transmitted from 40 to the clock inputs of each of the counters 42 and 44 . this causes the counters to increment upwardly since the signal on line 72 is still high . the low order counter 44 counts on each pulse whereas the high order counter 42 counts only when the carry - in ( ci ) input is low ; i . e ., when there is a &# 34 ; carry - out &# 34 ; indicated by a low on carry - out ( co ) of counter 44 . counter 44 is prevented from counting when the counters 42 and 44 are full , by 121 . the maximum count at the circuit output is thus represented by the binary number &# 34 ; 01111111 &# 34 ;, with the high bit inverted by 114 . the sequence for a downcount is the opposite of the sequence for an upcount . s2 following s3 arms flip - flop 32 rather than flip - flop 30 and the transition from decoder output state s2 to s1 causes the output of flip - flop 32 to become a &# 34 ; 1 &# 34 ; while the output of flip - flop 30 remains at zero . this sets the output counters 42 and 44 to the downcount mode by holding the signal on line 72 to the low condition when a transition to decoder output state s0 produces a count signal . to read the counters 42 and 44 it is necessary to disable the counters to the extent of preventing a count change . therefore , whenever a read occurs indicated by the output on line 50 going high , the decoder 20 is disabled due to the enable input via inverter 52 going high and all outputs s0 through s3 go low . this prevents any of the flip - flops from changing state and prevents any clock signals from being transmitted to the counters 42 and 44 . when the signal on line 50 goes low , both inputs to gate 82 are low for a time period determined by the time constant of resistor 78 and capacitor 80 causing the output of gate 82 to pulse high . this presets the counters 42 and 44 to &# 34 ; 1000 0000 &# 34 ; and the circuit output to &# 34 ; 0000 0000 &# 34 ;, the first digit being inverted by inverter 114 . the maximum forward count is &# 34 ; 0111 1111 &# 34 ; and the maximum reverse count is &# 34 ; 1000 0000 &# 34 ;. no counts will be lost during a read operation provided that it occurs rapidly enough to prevent a transition of more than one state from the decoder during the period that line 50 is high . a net direction change can be obtained by eliminating the preset function from gate 82 , if only a fixed plus and minus travel of gear 10 is anticipated such that counter overflow will now occur . the circuit which has been described above is susceptible of application to areas other than vehicle speed and direction determination . it will be readily apparent to those skilled in the art that the system may be applied in any industrial application wherein the position of a gear , shaft or other angularly or linearly translating body must be accurately monitored and wherein it is important to distinguish between substantially continuous movement and &# 34 ; jitter &# 34 ;. examples include position control systems for mass transit vehicles , elevators and similar devices , conveyors , robots , machine tools and article handling systems . in addition , it will be apparent to the skilled artisan that the hardwired circuit of fig1 can be alternatively implemented using a microprocessor with sufficient memory and computational capability to perform the storage and logic functions of the process described herein . other aspects , objects and advantages of this invention can be obtained from a study of the drawings , the disclosure and the appended claims . | 6 |
fig1 shows a block diagram of a prior art secure communications system transmitter . data signal generator 2 provides a time dependent data signal , represented by s ( t ). the data signal , s ( t ) is input into a baseband modulator or encryptor 3 . the baseband modulator converts the data signal , s ( t ), into a phase shift keyed ( psk ) signal e ( t ) by combining e ( t ) with a pseudo - noise &# 34 ; word &# 34 ; or signal from a pseudo - noise generator 4 . a carrier frequency tone from carrier frequency 6 is modulated by the transmitter 5 to produce a varying spread frequency spectrum signal which appears to be ( and may actually be recorded ) noise . the transmission system shown in fig1 produces a noise - like time dependent and encrypted signal , f ( t ), sent to the rf transmitter or transmitting means 7 . fig2 shows a block diagram of a prior art secure communications system receiver . receiving antenna 8 recovers a signal , f &# 39 ;( t ), which is similar to the transmitted signal , f ( t ). the signal f &# 39 ;( t ) is amplified by a mixing operation with a carrier frequency in the rf receiver 9 . the recovered time dependent signal , f &# 39 ;( t ), from receiver 9 ( similar to encrypted signal f ( t ) in fig1 ), is input into a decipher unit 10 which de - encrypts ( removes the pseudo noise signal ) f &# 39 ;( t ) using a pseudo noise generator similar to fig1 to produce a time dependent signal , r ( t ), similar to the base band modulated time dependent signal , s ( t ) from fig1 . the data signal representation s &# 39 ;( t ) similarities to the data signal , s ( t ), depend upon the fidelity of the signal output from transmitter 5 and antenna 7 ( shown in fig1 ), the signal fidelity received at of the receiving antenna 8 , demodulation at receiver 9 and synchronization at the decipher device 10 . any loss in fidelity is in addition to jamming or other losses between antennas 7 and 8 . fig3 shows a block diagram of the preferred embodiment transmission portion of a holographic communications device and method . in essence , the idea is to &# 34 ; phase scramble &# 34 ; ( modulate ) the single frequency or narrow band width data signal or signals . this process is analogous to the holographic diffusion of a single laser frequency signal by means of a ground glass . the spread spectrum signals is transformed into real and imaginary components ( or phase and amplitude component signals ) by a fourier transform or related process ( similar to diffraction and propagation of a single frequency laser radiation from an object to be holographed ), and finally , the separate real and imaginary components ( which comprise the hologram ) are broadcast on disjoint frequency bands . the preferred embodiment of the invention is designed t transmit simultaneously two independent digital data signal ( s ), s 1 ( t ) and s 2 ( t ), which are represented by two signal generators 2 . alternate embodiments may provide from one to four data channels . signal s 1 ( t ) is assigned to the real channel and s 2 ( t ) is assigned to the imaginary channel . these data or information sources are typically in the form of a low frequency ( under 16 kbs ) series of digital pulses over a period of time called a frame . in the preferred embodiment , these frames are of 1 millisecond duration and are produced consecutively . any information or data that was originally in an analog form ( such as voice or compressed video ), is first converted into a digital form for use by generator 2 . each of the time dependent data signals s 1 ( t ) and s 2 ( t ) passes through a baseband modulator 3 where it is converted into a bipolar square waves . a positive part of the square wave corresponds to a binary one . the negative part correspond to a binary zero . the time dependent square wave signals x r ( t ) and x i ( t ) produced by modulators 3 are also called zero - frequency , phase - shift - keyed ( psk ) signals and form the two channels ( real and imaginary channels ) of a complex time dependent signal called x ( t ), where x ( t )= x r ( t )+ ix i ( t ). if four data signals are to be transmitted , the signals are also called zero frequency quadrature phase - shifted - keyed ( qpsk ) signals . the two components of the complex signal , x ( t ) are phase modulated in an encoder 14 by a pseudo random code signal e iq ( t ), produced by a pseudo noise generator 15 . the coverture imparted by the pseudo random signal may not be required in all applications , but is shown in the preferred embodiment . the encoder 14 is represented as a complex multiplier and has a time dependent output which is the complex product signal m ( t ), where m ( t )= x ( t ) e iq ( t ). in the preferred embodiment q ( t ) is a time dependent series of pseudo random , uniformly distributed numbers having values between - pi and + pi . m ( t ) is a series of pseudo random numbers having a zero - mean and uniform amplitude distribution . the frequency bandwidths of m ( t ) is at least 1000 times the bandwidth of the signal x ( t ) and depends upon the rate at which the pseudo random numbers are produced , i . e ., the greater the rate , the greater the bandwidth . the bandwidth of m ( t ) is called the &# 34 ; code spread bandwidth &# 34 ;. the modulated , time dependent signal , m ( t ), is then input to a transformer , 16 using a fourier transform , which can be implemented with a discrete fast fourier transform ( fft ) device . the transformer converts the phase modulated or encoded signal m ( t ) into a real time dependent component , y r ( t ), and an imaginary time dependent component , y i ( t ) which are the real and imaginary coefficients of the fft process . y r ( t ) and y i ( t ) are each a time dependent series of data frames consisting of pseudo random numbers with a zero - mean gaussian amplitude distribution and a rate identical to that of m ( t ). frame times are identical to that of the signals coming from the generators 2 . other embodiments may use other transforms , such as orthogonal transforms ( e . g ., hadamard or a chirp - z or a number theoretic ). the data signals , y r ( t ) and y i ( t ), are converted by a digital to analog ( d / a ) converter 17a to provide the inputs to a conventional radio frequency ( rf ) transmitter 17 . the transmitted signal in the preferred embodiment consists of frame of time dependent data over non - overlapping frequency bands obtained by modulating y r ( t ) and y i ( t ) onto two carriers of frequencies f1 and f2 produced by first and second oscillators 18 and 19 . the rf modulated signals are combined ( added together ) and then carried to the transmitting antenna 7 . the transmitter - 7 uses linear amplifiers with sufficient bandwidth to handle the gaussian amplitude statistics of the input signals . significant amplitude distortion produced by transmitter 17 may be tolerated due to the inherent phase modulation immunity to such distortions . the encrypting unit 3 of the prior art ( fig1 ) has been replaced by the encoder 14 and fourier transformer 16 . alternately , other phase modulation relationships , surface acoustic wave ( saw ) and / or chirp transformers could have been used . additionally , the use of analog devices may allow higher data capacity with wider spread bandwidths and may be smaller in size and weight compared to the digital implementation shown in the preferred embodiment . the transmitted signal is the one dimensional hologram of the phase encoded data signals m ( t ). it is comparable to the two dimensional laser holograms produced with diffuse illumination . it is &# 34 ; covert &# 34 ; because it has noise - like gaussian amplitude statistics over a wide bandwidth and is totally devoid of the clocked signals and &# 34 ; chips &# 34 ; produced by the prior art systems . like the laser hologram , it is also highly information - redundant because the high bandwidth , phase encoder ( a multiplier ) combined with the fft has spread the small bandwidth , data signal information ( the fourier transform &# 34 ; convolution &# 34 ; theorem for 2 signals multiplied in the time domain ). any piece of the transmitted hologram frame chosen at random ( as small as 5 %) may theoretically be used to retrieve the entire data signal frame . this level of redundancy is not found in the prior art . additionally , data signal information is also spread evenly over the two frequency bands . the real and imaginary signal components , y r ( t ) and y i ( t ), contain identical information about the data signals . loss of either frequency band to interference only slightly affects the receiver function , and does not significantly hinder the recovery of the entire transmitted data messages s 1 ( t ) and s 2 ( t ), except for a 3 db loss in the signal to noise ratio . fig4 is a block diagram of the preferred embodiment of a holographic communications receiving device and method . in essence , the receiver retraces the steps of the transmitter with the addition of the frame lockup module 24 and filters 25 . signals from the receiving antenna 20 are fed to the rf receiver 21 . both the antenna 20 and receiver 21 are similar to the prior art antenna 8 and receiver 9 shown in fig2 with the exception that the receiver has two channels to receive the disjoint frequency bands produced by the transmitter 17 of fig3 and the antenna is of wider bandwidth to receive both bands . the receiving antenna and receiver 21 need not faithfully receive all of the frequencies transmitted from the transmitter 17 shown in fig3 or all of the time information within a hologram frame , but only a significant portion . this is because &# 34 ; pieces &# 34 ; of the original data signal are transmitted over many frequencies and at many different times during a frame period as previously discussed . this feature of the holographic communications may be of significant importance for burst communications in the presence of hostile jamming or interference where parts of the frame are lost or portions of the frequency bands are disrupted or missing . the output of the receiver 21 is mixed down to the original spread bandwidths and baseband frequencies by mixer 22 using local oscillators at frequencies fl and f2 from oscillators 18 and 19 corresponding to the oscillators 18 and 19 of the transmitting station shown in fig3 . the two analog outputs of the mixer 22 , representing the real and imaginary channels of the received hologram , are converted to digital numbers using the analog to digital ( a / d ) converter 28 to produce the complex and time dependent digital signal y &# 39 ;( t - t ) = y r &# 39 ;( t - t ) + iy i &# 39 ;( t - t ). y &# 39 ;( t - t ) is then passed through the inverse fourier transform 23 . the quantity t is the unknown transit time delay between transmitter and receiver . transformer 23 uses exactly the same frame size and transformation rate as the fourier transformer 16 in fig3 but is not in frame registration due to the unknown time delay t . the output g ( t &# 39 ;) of the inverse fourier transformer 23 is equal to m ( t &# 39 ;) e . sup . ( i2 [ pi ] tt &# 39 ;), where m ( t &# 39 ;) = x ( t &# 39 ;) e . sup . ( iq ( t &# 39 ;). the signals x ( t &# 39 ;) and e iq ( t &# 39 ;) are not dependent on the delay time t . the signal g ( t &# 39 ;) may be despread ( decoded ) immediately by the complex conjugate phase code modulation provided by complex multiplier 14 . in the preferred embodiment , the conjugate phase code signal is represented by the exponent - iq ( t ) and is produced by generator 27 . the output of the decoder 14 is s &# 39 ;( t &# 39 ;) s1 &# 39 ;( t &# 39 ;) + is2 &# 39 ;( t &# 39 ;) which equals x ( t &# 39 ;) e . sup . ( itt &# 39 ;). since x ( t &# 39 ;) may represent psk or qpsk signals , the frequency modulation caused by the exponent ( i2 [ pi ] tt &# 39 ;) can cause serious bit errors unless removed . the removal of the frequency modulation exponent ( i2 [ pi ] tt &# 39 ;) is the function of the frame lockup module 24 . it is in essence a power spectrum analyzer providing an accurate frequency measurement of the modulation tone represented by the exponent ( i2 [ pi ] tt &# 39 ;). this frequency measurement sets a restart signal for the inverse fourier transformer 23 and puts the transform process into frame registration by causing t to be equal to 0 . the entire process of frame registration takes as little as one frame or one millisecond . this time is 2 to 4 orders of magnitude faster than the seconds or minutes normally required for code synchronization in the prior art . this feature makes the holographic communications particularly well suited for military communications where short transmission time ( bursts ) signals are involved . to facilitate this registration process , special data frames containing all ones may be periodically transmitted with known spreading codes q ( t ). the receiver then sees pure tones in module 24 and can register the frames even in the presence of 20 to 30 db of added link interference . this real signal reconstruction of the data signals is derived from only a portion of the frequency spectrum transmitted and may contain artifacts (&# 34 ; speckle &# 34 ; or false signals at certain frequencies ) caused by the original phase modulation . the complex output of the frame lockup 24 consists of two time dependent signals which are low pass filtered by module 25 and then passed into baseband demodulators 26 which convert the psk and qpsk signals into estimates ( reconstructions ) of the two original data signals r1 ( t &# 39 ;) and r2 ( t &# 39 ;). other embodiments may not require the filtering module 25 , depending upon the type of transformation , frequencies received and quality of the recovered data required . the decipher unit 10 of the prior art ( fig2 ) has been replaced by the inverse fourier transformer 23 and decoder 14 . other embodiments may use other phase decoder relationships , surface acoustic wave ( saw ) and / or chirp inverse transformers for higher frequency data signals and spreading code signals matching the method used in the transmitter . fig5 illustrates graphs of the waveforms on the real and imaginary channels of the transmitter as they exit the baseband modulators 3 in fig3 when qpsk modulation is used on each channel . x r ( t ) or the real channel is represented by the top graph while x i ( t ) or the imaginary channel is represented by the bottom graph . each channel graph represents the result of multiplexing two real digital signals using qpsk modulation . a total of 4 independent data signals are thus being multiplexed onto the holographic signal . the qpsk waveforms representing pairs ( i , j ) of bits from two channels are illustrated in fig5 a , while the signal space representation of these 4 waveforms is shown in fig5 b . there are 64 data bits from 4 channels multiplexed onto the real and imaginary channels in a frame time of 1 millisecond . the horizontal axis of each graph reflects time where 2048 corresponds to 1 millisecond . the bit periods in the graphs are delineated by vertical lines every 128 data points or chips along the time axis . fig6 illustrates a time scale magnification of the signal shown in fig5 . the top half of the figure contains the &# 34 ; real &# 34 ; qpsk waveform containing data signals 1 and 2 , and the lower half contains the &# 34 ; imaginary &# 34 ; qpsk waveform containing data signals 3 and 4 . fig7 illustrates graphs showing the spread spectrum , time dependent signals as they exit the phase modulator ( encoder ) 14 in fig3 . by using a q ( t ) time dependent code signal that has values which vary between - pi and + pi in generator 15 of fig3 the illustrated spread spectrum signals look like uniformly distributed white noise . the top graph portion represents the real channel and the bottom graph portion represents the imaginary channel . fig8 are graphs showing the real and imaginary time dependent signals ( top and bottom portions respectively ) representing the baseband hologram signal as it exits the fourier transformer 16 in fig3 . the periodic vertical lines are part of the graphics display used for reference only and are not part of the hologram signal . these signals have the appearance of white gaussian noise and a total absence of clock references and &# 34 ; chips &# 34 ; that are common to the prior art . because of these characteristics , the hologram signals have a much higher degree of &# 34 ; covertness &# 34 ; or &# 34 ; stealth &# 34 ; compared to the signal outputs from the prior art . fig9 illustrates a graph showing the frequency power spectrum of the time dependent hologram signal shown in fig8 . the spectrum shows no artifacts or spectral lines , just a uniform distribution of energy across the bandwidth . the horizontal axis represents frequency . peak frequency for the example is 1245 . 9 khz , where f 1 = 1 khz and f 2 = 2 . 048 mhz ( supplied by frequency generators 18 and 19 as shown in fig1 and 19 . fig1 illustrates graphs showing the receiver &# 39 ; s estimation of the 2 qpsk signal channels ( real and imaginary ) after they exit the low pass filters 25 in fig4 . bit periods are delineated by the periodic vertical lines on both graphs . y &# 39 ; r ( t &# 39 ;) is represented by the top graph while y &# 39 ; i ( t &# 39 ;) is represented by the bottom graph . each graph contains two data signals multiplexed together by the qpsk waveforms illustrated in fig5 . these graphs were obtained from the entire received hologram frame where zero - mean gaussian link noise was added to the channels to produce a bit signal to noise ratio eb / no = 18 db and s / n = 0 . 7 . the graphs illustrate that no data bits were received in error . fig1 illustrates graphs showing the receiver &# 39 ; s estimation of the same 2 qpsk signal channels discussed and shown in fig1 , but after 50 % of the holograms frame was lost . the graphs illustrate that no data bits were received in error . fig1 illustrates graphs showing the receiver &# 39 ; s estimation of the same 2 qpsk signal channels as shown and discussed in fig1 , but after 75 % of the hologram frame was lost . the graphs illustrate that no data bits were received in error . while the preferred embodiment of the invention has been shown and described , changes and modifications may be made therein within the scope of the appended claims without departing from the spirit and scope of this invention . | 7 |
referring to fig1 - 7 , various views of the wheelchair lift assist mechanism 10 according to at least one embodiment of the present mechanisms disclosed herein is show . a wheelchair 12 or any type of armchair can be manufactured inclusive of a mechanism 10 or the mechanism 10 can be retrofit to any existing wheelchair 12 or armchair . the mechanism 10 includes a seat portion 18 , one or more bars 24 , and one or more handles 26 . the one or more bars 24 are pivotally attached on either side of the seat portion 18 at a pivot point . the one or more handles 26 extend outward from the one or more bars 24 opposite the pivot point . the mechanism 10 further includes at least one attachment mechanism 30 or other means for pivotally connecting the mechanism 10 to the armrest of the wheelchair . in at least one embodiment , the seat portion 18 includes a seat 20 that is made of relatively flexible fabric material . it is understood that the seat 20 may be made of a rigid material or any other suitable material known in the arts . the fabric seat 20 is fastened to one or more tubes or rods 22 extending from the front to the rear of the seat portion 18 . the one or more bars 24 may be pivotally connected to tubes 22 by bolts 28 . while the pivot point could be created at any point along the tube 22 , in the preferred embodiment the pivot point is set slightly off center of the tube 22 toward the back of the mechanism 10 . while in operation this creates the forward tilt of seat 20 when a vertically downward force is applied to the one or more handles 26 , which acts to properly erect the patient 14 with the help of assistant 16 . the one or more bars 24 are also connected to the at least one attachment mechanism 30 , which in one embodiment is a j shaped bracket pivotally attached to the one or more bars 24 with a bolt 28 . the j shaped bracket forms a second pivot point in line with bracket 30 , which is hung from one or more arms of wheelchair 12 . the bracket 30 can conform to a variety of arm shapes and is shown as conforming to a cylindrical shape , in a preferred embodiment . a bolt 28 fixes the bracket 30 to the arm of the wheelchair 12 in an appropriate location , universally adjustable from chair to chair . the bars 24 are positioned at an approximate angle of 45 degrees to the horizontal upward and toward the rear of the mechanism , typical in most installations , and could be within a range of plus or minus 10 degrees . one or more handles 26 are fixed to one or more bars 24 in a secure manor . any type of rigid material such as steel , aluminum , plastic or other materials well known in the arts could be used for this construction . the operation of the mechanism 10 according to at least one embodiment of the mechanisms discussed herein is described with reference to fig8 - 9 . referring to fig8 a patient 14 is sitting at rest in a wheelchair 12 and is being tended by an assistant 16 . the mechanism 10 is in use in a rest position . the seat 20 conforms to the horizontal rest spot of the wheelchair 12 . the bars 24 are positioned at an approximate angle of 45 degrees to the horizontal , typical in most installations , and could be within a range of plus or minus 10 degrees . results are a modest , unobtrusive , simple to install mechanism 10 that is capable of providing comfort for the patient 14 . referring to fig9 a patient 14 is standing , being moved to this position by a vertical downward pressure provided by the assistant 16 via the handles 26 . the pressure is transferred through bars 24 to tubes 22 respectively raising seat 20 which tilts forward raising and ejecting patient 14 to a standing position . results are ease of use by an untrained assistant 16 that is providing a force capable to assist an ambulatory patient 14 to stand . while the foregoing invention has been described in some detail for purposes of clarity and understanding , it will be appreciated by one skilled in the art , from a reading of the disclosure , that various changes in form and detail can be made without departing from the true scope of the invention . | 0 |
fig1 a shows a perspective view of a belleville washer . the washers are manufactured using materials , such as alloy steels , to meet specific material requirements . they should exhibit good fatigue life and minimum relaxation . a high alloy content material is commonly used as the spring steel . fig1 b identifies dimensions of belleville springs commonly used . spring 10 is shown in fig1 a and fig1 b . d 1 is the diameter of the opening , d 2 is the external diameter of the spring , t is the thickness of the spring material , d is the maximum deflection of the spring when it is compressed , and e is the overall thickness of the spring in the uncompressed state . d = e − t . the spring may contain special properties for corrosion or other properties and may be coated with a number of different materials such as phosphate , galvanizing , mechanical zinc plating and electroless nickel plating . it may also be coated with the coating to minimize friction , which is discussed further below . referring to fig2 a , spring stack 20 is shown in cross section , including springs 22 in series configuration on spring carriers 24 , which are guided by mandrel 26 . forces are applied to the springs through load ring 28 ( a ) and load base 28 ( b ). referring to the inset of fig2 a , spring carrier 24 is formed by sleeve 21 and circumferential flange 25 . fig2 b depicts spring stack 20 in the state of maximum compression . springs 22 have been deflected to the point where the cone is collapsed ( i . e ., deflected by the distance “ d ” of fig1 b ). spring carriers 24 are in contact on mandrel 26 . fig2 c shows a perspective view of the washers and spring carrier 24 of fig2 a and 2b . carrier 24 is formed from sleeve 21 and circumferential flange 25 on the outside surface of the sleeve . flange 25 allows the washers to be spaced at a selected location on carrier 24 , normally at an equal distance from each end of the sleeve . spring carrier 24 is adapted to fit slidably on mandrel 26 . the outside diameter of spring carrier 24 is adapted to fit in the inside diameter ( d 1 of fig1 b ) of belleville spring 22 . referring to fig3 a , belleville springs 32 on one side of mandrel 36 are shown in a partial cross - sectional view . spring carrier 34 is placed between mandrel 36 and springs 32 . spring carrier 34 includes sleeve 31 and circumferential flange 35 . in fig3 a , springs 32 are either in a relaxed state or in a compressed state less than maximum compression . fig3 b shows spring 32 in the state of maximum compression allowed when springs are employed on spring carrier 34 . spring carrier 34 has an axial dimension , as measured from flange 34 to an end of sleeve 31 , greater than the maximum deflection (“ d ” of fig1 b ) of spring 32 . when the apparatus is deployed on mandrel 36 and load is applied , spring carrier 34 may serve to limit the deflection and the load applied to springs 32 . this load - limiting feature may be selected over a broad range of load from zero deflection or the relaxed state to maximum deflection of the springs . the width of circumferential flange 35 may also be selected to maintain an optimum spacing of springs 32 . flange 35 serves primarily to control the placement of springs 32 on spring carrier 34 . it preferably has enough width to provide the needed mechanical strength of the flange . referring to fig4 a , springs 42 are deployed on mandrel 46 using spring carriers 44 . as seen more clearly in the center inset , spring carrier 44 is made up of sleeve 41 . the smaller diameter of the inside surface of sleeve 41 is sized to fit slidably over mandrel 46 and the larger diameter of the outside surface of sleeve 41 is sized to fit in the inside diameter of springs 42 . spring carrier 44 has inside and outside surfaces of different diameter on each side of shoulders 47 ( a ) and 47 ( b ), which are placed at selected locations on the outside surface and inside surface , respectively , of carrier 44 . shoulder 47 ( a ) separates a larger and small diameter on the outside surface and shoulder 47 ( b ) separates a larger and smaller diameter on the inside surface of sleeve 41 . circumferential flange 45 may be used to facilitate placing springs 42 on carrier 44 . load ring 48 ( a ) and load base 48 ( b ) may be used to apply load to stack 40 . the outside diameter of one segment of carrier 44 is selected to fit in the inside diameter of another segment of carrier 44 . the carriers are disposed on mandrel 46 such that adjacent carriers overlap and thereby decrease lateral or bucking loads on mandrel 46 as springs 42 are compressed . overlapping of adjacent carriers creates rigidity to the stack of carriers and provides significant friction reduction in stack 40 as it is compressed and decompressed . a hysteresis curve for the compression and decompression will have significantly smaller area in the presence of overlapping carriers 44 than in the absence of such carriers . carriers 44 may be truncated so that an end carrier may allow the end spring to compress against load ring 48 ( a ) or load base block 48 ( b ). truncated carriers 49 ( upper inset and lower inset ) illustrate a preferred configuration of a spring carrier to be placed at the end of a stack . in fig4 b compressive load has been applied to deflect springs 42 to the point where adjacent springs carriers 44 are completely interlocked or overlapping and springs 42 have reached maximum deflection . spring carriers 44 have moved along their axis as each spring has been deflected a distance equal to the maximum deflection (“ d ” of fig1 b ). as discussed above with respect to fig3 a and 3b , the distance from an end of sleeve 41 to shoulder 47 ( a ) or 47 ( b ) may be less than the maximum deflection of spring 42 . in this case , when the apparatus is deployed on mandrel 46 and load is applied , then spring carrier 44 may serve to limit the deflection and the load applied to springs 42 . this load - limiting feature may be selected over a broad range of load from zero deflection or the relaxed state to maximum deflection of the springs . referring to fig4 c , a perspective view is shown of springs 42 on carriers 44 and mandrel 46 . sleeve 41 has shoulder 47 ( a ) on the outside surface and shoulder 47 ( b ) on the inside surface . circumferential flange 45 is placed at a selected position , preferably in the center of the larger diameter surface on the outside surface of sleeve 41 . shoulders 47 ( a ) and 47 ( b ) may be placed equal distances from the opposite ends of sleeve 41 . alternatively , the shoulders may be placed at different distances from the opposite ends of sleeve 41 . these distances will be shown in more detail in fig6 a . referring to fig5 spring stack 50 guided by cylinder 56 is shown . springs 52 are sized to fit the inside diameter of spring carriers 54 . the larger outside diameter of spring carrier 54 is sized to slidably fit inside cylinder 56 . spring carriers 54 are made of sleeve 51 ( see inset ) and have circumferential ledge 55 on the smaller diameter area of the inside surface . carriers 54 also have shoulders 57 ( a ) and 57 ( b ) at selected locations , similar to the carriers to be placed over a mandrel as shown in fig4 a . load blocks 58 ( a ) and 58 ( b ) transmit force to the stack of springs 52 . overlapping spring carriers for use inside a cylinder guide or on a mandrel may be designed to provide complete interlocking or overlapping when springs reach maximum deflection or may be designed to provide load - limiting capabilities by selection of axial dimensions . fig6 a illustrates dimensions of overlapping carriers . as can be noted in the figure , for the carriers to be moved with the springs to maximum spring deflection ( d ) when the carriers are completely overlapping or interlocked , dimensions may be selected such that : where t is spring thickness , w is width of the circumferential ledge , c is the distance between the inside and outside shoulders , l is the overlap of the carriers at the initial deflection of the springs and r is the remaining overlap from the initial deflection of the springs . if we dimension the spring carrier so that r = 2d , then : the carriers then would move from the position shown in fig6 a to that shown in fig6 b ( completely overlapping ) if d and t are spring properties that will be supplied by the manufacturer of the selected spring . c and l are design options for the carriers , which will determine the value of w if the springs are to reach maximum deflection when the carriers are completely interlocked . if load - limiting of the springs is to be provided by the carriers , the value of r ( along the inside surface ) under no - load conditions may be decreased , for example . alternatively , dimensions of the carriers may be adjusted along the outside surface . preferably , the spring carriers disclosed herein are coated with an anti - friction coating . many such coatings are available . a suitable coating is provided by the kolene qpq process , which is a product of kolene corporation . another suitable process is the armorall process . other known friction - reducing coatings , polymers , oils or additives may be used . embodiments disclosed heretofore employed a guide for the springs , either a mandrel or a cylinder . in other embodiments , a guide is not employed and the carriers are placed such that overlapping of adjacent carriers is sufficient to form a rigid structure that prevents sidewise movement of springs or buckling of a stack of springs . fig7 a illustrates such a stack , stack 70 . springs 72 are deployed on spring carriers 74 . note the absence of a mandrel , but adjacent carriers overlap sufficiently to provide a rigid structure , preventing buckling of the stack of springs . overlapping may be provided by pre - loading springs or by adjusting carrier dimensions to allow sufficient overlapping a zero spring deflection . carriers 74 have inside and outside surfaces of different diameter on each side of shoulders , as explained above for fig4 a . circumferential flange 73 facilitates placing springs 72 on carriers 74 . end pieces 78 ( a ) and 78 ( b ) may be used to apply force to the stack and to confine lateral movement of the end pieces of the carriers . fig7 b shows stack 70 in the totally compressed state . stack 70 of fig7 is similar to stack 40 of fig4 , except a mandrel guide is not present in fig7 . fig5 shows a stack using a cylinder as a guide . of course , a stack can be formed using the guides of fig5 without a cylinder guide if carriers are initially overlapped . such a stack may have the guide and spring configuration of fig5 with load blocks at the ends of the stack and no cylinder guide outside . although the present disclosure has been described in detail , it should be understood that various changes , substitutions and alterations can be made thereto without departing from the scope and spirit of the invention as defined by the appended claims . | 5 |
the epoxy resin composition for fiber - reinforced composite material of the present invention comprises [ a ] an epoxy resin , [ b ] a dicyandiamide , and [ c ] an imidazole compound as its critical components . the component [ a ] of the present invention is an epoxy resin . exemplary epoxy resins include bisphenol a type epoxy resins , bisphenol f type epoxy resins , bisphenol s type epoxy resins , biphenyl type epoxy resins , naphthalene type epoxy resins , novolac type epoxy resins , epoxy resins having fluorene backbone , epoxy resins prepared by using a copolymer of a phenol compound and dicyclopentadiene for the starting material , glycidyl ether type epoxy resins such as diglycidyl resorcinol , tetrakis ( glycidyloxy phenyl ) ethane , and tris ( glycidyloxy phenyl ) methane , and glycidylamine type epoxy resins such as tetraglycidyl diaminodiphenylmethane , triglycidyl aminophenol , triglycidyl aminocresol , tetraglycidyl xylene diamine . of these , the preferred are bisphenol a type epoxy resins , bisphenol f type epoxy resins , bisphenol s type epoxy resins , biphenyl type epoxy resins , naphthalene type epoxy resins , novolac type epoxy resins , epoxy resins having fluorine backbone , epoxy resins prepared by using a copolymer of a phenol compound and dicyclopentadiene for the starting material , glycidyl ether type epoxy resins such as diglycidyl resorcinol , tetrakis ( glycidyloxy phenyl ) ethane , and tris ( glycidyloxy phenyl ) methane , which may be used alone or as a combination of two or more . the component [ b ] of the present invention is a dicyandiamide . the dicyandiamide is a compound represented by the chemical formula ( h 2 n ) 2 c ═ n — cn , and the dicyandiamide is widely used as a curing agent of the epoxy resin in view of its excellent ability to impart the cured resin material composition with high mechanical properties and heat resistance . examples of the commercially available dicyandiamide include dicy7 , dicy15 ( manufactured by mitsubishi chemical corporation ). incorporation of the dicyandiamide [ b ] in the form of a powder is preferable in view of its storage stability at room temperature and stability of the viscosity in the production of the prepreg . preliminary dispersion of the dicyandiamide [ b ] in a part of the epoxy resin in the component [ a ] by using three rolls and the like is also preferable in view of producing a consistent epoxy resin composition to thereby improve physical properties of the cured article . when the dicyandiamide is incorporated as a powder , the average particle size is preferably up to 10 μm , and more preferably up to 7 μm . for example , when the epoxy resin composition is impregnated in the reinforcement fiber bundle by applying heat and pressure in the course of producing the prepreg , impregnation of the epoxy resin composition in the fiber bundle will be facilitated by the use of the dicyandiamide having the average particle size of up to 10 μm . total content of the dicyandiamide [ b ] is preferably a content such that amount of the active hydrogen group is in the range of 0 . 3 to 1 . 0 equivalent weight , and more preferably 0 . 3 to 0 . 6 equivalent weight in relation to the epoxy group in all epoxy resin components in the epoxy resin composition . when the content of the active hydrogen group is in such range , production of the cured resin material having well - balanced heat resistance and mechanical properties will be enabled . the component [ c ] in the present invention is an imidazole compound . in the present invention , the component [ c ] functions as a curing accelerator of the component [ b ]. exemplary imidazole compounds include those represented by the following formula ( i ): wherein r 1 to r 2 are hydrogen or an alkyl group , aryl group or aralkyl group having 1 or more substituents selected from halogen , hydroxy group , and cyano group and r 3 to r 4 are hydrogen or an alkyl group , aryl group or aralkyl group having 1 or more substituents selected from halogen , hydroxy group , and cyano group . the alkyl group as used herein is a substituent derived from a hydrocarbon which may have a straight chain , branched , or cyclic structure . the aryl group is a substituent derived from an aromatic hydrocarbon , and examples include those solely comprising an aromatic ring such as phenyl group and naphthyl group , and also , those containing an aromatic hydrocarbon structure as its moiety as in the case of tolyl group . an aralkyl group is an alkyl group having an aryl group as its substituent , and examples include benzyl group and phenylethyl group . exemplary imidazole compounds include 1 - benzyl - 2 - methyl imidazole , 1 - benzyl - 2 - ethyl imidazole , 1 - cyanoethyl - 2 - methyl imidazole , 1 - cyanoethyl - 2 - ethyl - 4 - methyl imidazole , and 1 - cyanoethyl - 2 - phenyl imidazole , which may be used alone or in combination of two or more . ( analysis of the epoxy resin composition using a differential scanning colorimeter ) in the present invention , curability of the epoxy resin composition is conducted , for example , by using a differential scanning colorimeter . the exotherm that can be observed in the measurement using a differential scanning colorimeter is the one generated by the reaction of the epoxy resin composition . accordingly , the exothermic chart plotted by using x axis for the time and y axis for the heat flow rate in an isothermal measurement represents time dependency of the reaction speed at the temperature of the measurement . therefore , the time of the exothermic peak top appearance is the time when the reaction is most active at the temperature of the measurement , and this time can be used as an index of the reactivity . ( isothermal analysis of the epoxy resin composition at 100 ° c . using a differential scanning colorimeter ) in the present invention , when the epoxy resin composition is isothermally analyzed at 100 ° c . by using a differential scanning colorimeter and time interval between reaching to 100 ° c . and reaching of the heat flow to the top of the peak is designated t ( 100 ), the t ( 100 ) is preferably up to 25 minutes and more preferably up to 24 minutes . use of an epoxy resin composition exhibiting the t ( 100 ) of up to 25 minutes for the matrix resin enables production of the prepreg having excellent high - speed curability . the prepreg produced by using an epoxy resin composition exhibiting the t ( 100 ) of greater than 25 minutes for the matrix resin has insufficient high - speed curability . ( isothermal analysis of the epoxy resin composition at 60 ° c . using a differential scanning colorimeter ) when the epoxy resin composition is isothermally analyzed at 60 ° c . and time interval between reaching to 60 ° c . and reaching of the heat flow to the top of the peak is designated t ( 60 ), the t ( 60 ) is preferably at least 15 hours and more preferably at least 21 hours . use of an epoxy resin composition exhibiting the t ( 60 ) of at least 15 hours minutes for the matrix resin enables production of the prepreg having excellent storage stability . the prepreg produced by using an epoxy resin composition exhibiting the t ( 60 ) of less than 15 hours for the matrix resin has insufficient storage stability . ( ratio of the number of the epoxy group to the number of imidazole ring in the epoxy resin composition ) in addition , the epoxy resin composition of the present invention has the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition of at least 25 and up to 90 . when this ratio is less than 25 , proportion of the self - polymerization in the epoxy resin will be increased and the cured resin material becomes brittle , and hence , the carbon fiber - reinforced plastic material prepared by using the epoxy resin composition for its matrix resin will suffer from reduced strength . on the other hand , when this ratio is in excess of 90 , curability of the epoxy resin composition will be insufficient and the cured resin material also becomes brittle , and the carbon fiber - reinforced plastic material prepared by using the epoxy resin composition for its matrix resin will also suffer from reduced strength . the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition can be calculated by the procedure as described below from epoxy equivalent weight of the epoxy resin composition and imidazole ring equivalent weight of the epoxy resin composition . when “ n ” types of the epoxy resins are simultaneously used in the epoxy resin composition , total parts by weight of the epoxy resin composition is “ g ”, and “ w x ” parts by weight of the epoxy resin x having the epoxy equivalent weight of “ e x ” ( g / eq ) is incorporated , the average epoxy equivalent weight in the epoxy resin composition can be calculated by the following mathematical equation ( 1 ) ( wherein x = 1 , 2 , 3 , . . . , n ). when the total parts by weight of the epoxy resin composition is “ g ”, and “ w ” parts by weight of the imidazole compound having an imidazole ring equivalent weight of “ i ” [ g / eq ] is incorporated in the epoxy resin composition , the imidazole ring equivalent weight in the epoxy resin composition can be calculated by the following mathematical equation ( 2 ): imidazole ring equivalent weight of the epoxy resin composition [ g / eq ]= g / ( w / i ) ( 2 ) ( iii ) ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition may be calculated by the following mathematical equation ( 3 ) using the values obtained in the ( i ) and ( ii ). ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition =( imidazole ring equivalent weight of the epoxy resin composition / average epoxy equivalent weight of the epoxy resin composition ) ( 3 ) the epoxy resin composition may preferably have an epoxy equivalent weight of at least 250 g / eq and up to 500 g / eq . when the epoxy equivalent weight is less than 250 g / eq or greater than 500 g / eq , the resulting cured article will exhibit poor balance between the modulus and the deformation , and the carbon fiber - reinforced plastic material prepared by using the epoxy resin composition for its matrix resin may also suffer from reduced strength . the imidazole compound used for the component [ c ] in the present invention is described in further detail . the imidazole compound used in the present invention is not limited for its state . while the imidazole compound may be a solid or a liquid , it is most preferably an imidazole compound which is soluble in the epoxy resin . when an imidazole compound soluble in the epoxy resin is used , the epoxy resin composition will have a reduced t ( 100 ) and the prepreg will have an improved high - speed curability . in addition , the cured resin material will have an improved balance between the modulus and the deformation due to the improved consistency of the epoxy resin composition . in the present invention , solubility and non - solubility of the imidazole compound in the epoxy resin is determined by the procedure as described below . the epoxy resin composition having the dicyandiamide excluded therefrom is first prepared since dicyandiamide in the epoxy resin composition of the present invention is an insoluble latent curing agent , and then , the state of the epoxy resin composition is visually confirmed . the epoxy resin composition is determined “ dissolved ” when the resulting epoxy resin composition is transparent , and “ not dissolved ” when the composition is opaque , namely , turbid or lumpy . an exemplary preferable imidazole compound used in the present invention is the one having the hydrogen at position 1 of the imidazole ring substituted . more preferred is the use of an imidazole compound having position 1 of the imidazole ring substituted with benzyl group or cyanoethyl group . an exemplary such compound is the one represented by the following general formula ( i ) wherein r 1 is benzyl group or cyanoethyl group , and r 2 , r 3 , and r 4 are respectively hydrogen atom , an aliphatic hydrocarbon group containing 1 to 20 carbon atoms , or phenyl group . many imidazole compounds having position 1 of the imidazole ring substituted with benzyl group or cyanoethyl group are liquid with high solubility in epoxy resin . examples of the commercially available imidazole include “ cureduct ” ( registered trademark ) 1b2mz , 1b2pz , 2mz - cn , 2e4mz - cn , and 2pz - cn ( manufactured by shikoku chemicals corporation ). also preferred for the compound having position 1 of the imidazole ring substituted is an adduct produced represented by the following general formula ( ii ) by the reaction of an imidazole compound with an epoxy compound . wherein r 5 , r 6 , r 7 and r 8 are respectively hydrogen atom , an aliphatic hydrocarbon group containing 1 to 20 carbon atoms , or phenyl group and y is single bond , an alkylene group , an alkylidene group , ether group , or sulfonyl group . examples of the commercially available adducts include “ cureduct ” ( registered trademark ) p - 0505 ( shikoku chemicals corporation ) and “ jer cure ” ( registered trademark ) p200h50 ( mitsubishi chemical corporation ). also preferred for the compound having position 1 of the imidazole ring substituted is an adduct produced represented by the following general formula ( iii ) by the reaction of an imidazole compound with an isocyanate compound . wherein r 9 , r 10 , r 11 and r 12 are respectively hydrogen atom , a aliphatic hydrocarbon group containing 1 to 20 carbon atoms , or phenyl group , and z is an alkylene group or an aromatic hydrocarbon group . an example of the commercially available adduct is g - 8009l ( dks co . ltd .). content of the component [ c ] in the composition is preferably 0 . 5 to 8 parts by weight , more preferably 1 to 6 parts by weight , and still more preferably 1 . 5 to 4 parts by weight in relation to 100 parts by weight of the epoxy resin ( component [ a ]). when the content of the component [ c ] is in such range , the cured resin material obtained from the resulting epoxy resin composition will enjoy good balance between the storage stability and the curing speed and exhibit good physical properties . an acidic compound may be added to the epoxy resin composition of the present invention as the component [ d ]. when an acidic compound is added , the epoxy resin composition will have an increased t ( 60 ) value , and the prepreg will enjoy an improved storage stability . the acidic compound used may be a bronsted acid or a lewis acid . the bronsted acid is preferably a carboxylic acid , and the carboxylic acids may be categorized into aliphatic polycarboxylic acids , aromatic polycarboxylic acids , aliphatic monocarboxylic acids , and aromatic monocarboxylic acids . exemplary compounds are as described below . exemplary aliphatic monocarboxylic acid include formic acid , acetic acid , propionic acid , butyric acid , isobutyric acid , valeric acid , caproic acid , enanthic acid , caprylic acid , octyl acid , pelargonic acid , lauryl acid , myristic acid , stearic acid , behenic acid , undecane acid , acrylic acid , methacrylic acid , crotonic acid , oleic acid , and derivatives of these acids . exemplary aliphatic polycarboxylic acid include oxalic acid , malonic acid , succinic acid , glutaric acid , adipic acid , pimelic acid , suberic acid , azelaic acid , sebacic acid , undecanedioic acid , dodecanedioic acid , tridecanedioic acid , tetradecanedioic acid , pentadecanedioic acid , and derivatives of these acids . exemplary aromatic monocarboxylic acids include benzoic acid , cinnamic acid , naphthoic acid , toluic acid , and derivatives of these acids . exemplary aromatic polycarboxylic acids include phthalic acid , isophthalic acid , terephthalic acid , trimellitic acid , pyromellitic acid , and derivatives of these acids . these aromatic monocarboxylic acids and aromatic polycarboxylic acids may be substituted with hydroxy group , a halogen , an alkyl group , an aryl group , or the like . when a bronsted acid is used for the acidic compound in the present invention , pka is preferably up to 4 . 3 . when such bronsted acid having a pka of up to 4 . 3 is used , the resulting prepreg will enjoy an improved storage stability . the pka of the bronsted acid may be measured by titration . in the case of an aromatic carboxylic acid , however , the pka may be roughly estimated by hammett &# 39 ; s rule . exemplary preferable aromatic carboxylic acids having a pka of up to 4 . 3 include benzoic acid , p - hydroxybenzoic acid , p - nitrobenzoic acid , isophthalic acid , 5 - hydroxybenzoic acid , and 5 - nitrobenzoic acid . the lewis acid is preferably boric acid and / or a borate , or the like . examples of the boric acid and / or the borate include boric acid , alkyl borates such as trimethyl borate , triethyl borate , tributyl borate , tri - n - octyl borate , tri ( triethylene glycol methyl ether ) borate , tricyclohexyl borate , trimenthyl borate , aromatic borates such as tri - o - cresyl borate , tri - m - cresyl borate , tri - p - cresyl borate , and triphenyl borate , and tri ( 1 , 3 - butanediol ) biborate , tri ( 2 - methyl - 2 , 4 - pentanediol ) biborate , and trioctylene glycol diborate . the borate used may also be a cyclic borate having a cyclic structure in its molecule . exemplary cyclic borates include tris - o - phenylene bisborate , bis - o - phenylene pyroborate , bis - 2 , 3 - dimethylethylene phenylene pyroborate , and bis - 2 , 2 - dimethyltrimethylene pyroborate . exemplary products containing such borate include “ cureduct ” ( registered trademark ) l - 01b ( shikoku chemicals corporation ) and “ curcduct ” ( registered trademark ) l - 07n ( shikoku chemicals corporation ). content of the component [ d ] as described above used is preferably 0 . 5 to 8 parts by weight , more preferably 1 to 6 parts by weight , and still more preferably 1 . 5 to 4 parts by weight in 100 parts by weight of the epoxy resin ( component [ a ]). when the content of the component [ d ] is in such range , the cured resin material obtained from the resulting epoxy resin composition will enjoy good balance between the storage stability and the curing speed and exhibit good physical properties . the epoxy resin composition of the present invention may also contain a thermoplastic resin as the component [ e ] to the extent not adversely affecting the merits of the present invention . while the thermoplastic resin is not the critical component of the present invention , incorporation of the epoxy resin composition enables control of the viscoelasticity and the cured article will be imparted with toughness . examples of such thermoplastic resin include polymethyl methacrylate , polyvinyl formal , polyvinyl butyral , polyvinyl acetal , polyvinylpyrrolidone , a polymer containing at least 2 members selected from aromatic vinyl monomer , cyanated vinyl monomer , and rubbery polymer as its constituents , polyamide , polyester , polycarbonate , polyaryleneoxide , polysulfone , polyethersulfone , and polyimide . examples of the polymer containing at least 2 members selected from aromatic vinyl monomer , cyanated vinyl monomer , and rubbery polymer as its constituents include acrylonitrile - butadiene - styrene copolymer ( abs resin ) and acrylonitrile - styrene copolymer ( as resin ). the polysulfone and the polyimide may be those having ether bond or amide bond in its backbone chain . the polymethyl methacrylate , polyvinyl formal , polyvinyl butyral , and polyvinylpyrrolidone are preferable since they have good compatibility with many epoxy resins including bisphenol a type epoxy resin and novolac type epoxy resin and they contribute to the efficient control of the flowability of the epoxy resin composition . the most preferred is polyvinyl formal . exemplary commercially available products of these thermoplastic resins include “ denka butyral ” ( registered trademark ) and “ denka formal ” ( registered trademark ) ( manufactured by denki kagaku kogyo kabushiki kaisha ) and “ vinylec ” ( registered trademark ) manufactured by inc corporation . in the case of the polymers of the polysulfone , polyether sulfone , and polyimide , the resin itself has high heat resistance . they are also polymers having a resin backbone having adequate compatibility with the epoxy resins frequently used in the applications requiring heat resistance , for example , structural members of an air craft , for example , glycidylamine epoxy resins such as tetraglycidyl diaminodiphenylmethane , triglycidyl aminophenol , triglycidyl aminocresol , and tetraglycidylxylenediamine . in additions , use of these resins enables efficient control of flowability of the epoxy resin composition . these resins also have the effect of improving impact strength of the fiber - reinforced resin composite material . examples of such polymers include “ radel ” ( registered trademark ) a ( manufactured by solvay advanced polymers ) and “ sumikaexcel ” ( registered trademark ) pes ( manufactured by sumitomo chemical company , limited ) for the polysulfone and “ ultem ” ( registered trademark ) ( manufactured by ge plastics ) and “ matrimid ” ( registered trademark ) 5218 ( manufactured by huntsman ) for the polyimide . in the epoxy resin composition of the present invention , 1 to 60 parts by weight of the thermoplastic resin is preferably incorporated in 100 parts by weight of the epoxy resin . the epoxy resin composition used in the present invention may also contain a coupling agent , thermosetting resin particles , electroconductive particles such as carbon black , carbon particles , or metal - plated organic particles , and an inorganic filler such as silica gel or clay to the extent not adversely affecting the present invention . incorporation of such components has the effect of viscosity adjustment , for example , by improving the viscosity of the epoxy resin composition or reducing the resin flowability , the effect of improving the modulus and heat resistance of the cured resin material , and the effect of improving the abrasion resistance . the epoxy resin composition of the present invention can be produced , for example , by machine kneading using a kneader , planetary mixer , three rolls , or twin screw extruder , or alternatively , by manual blending using a beaker and a spatula if homogeneous kneading is possible . next , the fiber - reinforced composite material is described . the fiber - reinforced composite material containing the cured epoxy resin composition of the present invention as its matrix can be produced by blending and integrating the epoxy resin composition of the present invention with a reinforcement fiber , and curing the blend . the reinforcement fiber used in the present invention is not particularly limited , and examples include glass fiber , carbon fiber , aramid fiber , boron fiber , alumina fiber , and silicon carbide fiber , which may be used in combination of two or more . of these , the preferred is the used of carbon fiber that enable production of a fiber - reinforced composite material having a light weight and high rigidity . with regard to the production of the fiber - reinforced composite material , it is preferable to preliminarily produce a prepreg comprising the epoxy resin composition and the reinforcement fibers in view of the ease of storage and good handling convenience . the prepreg can be obtained by impregnating the epoxy resin composition of the present invention in the reinforcement fibers . exemplary methods used for the impregnation include hot melting method ( dry method ). the hot melting method is a method wherein the epoxy resin composition whose viscosity is reduced by heating is directly impregnated in the reinforcing fibers , or a method wherein after preliminarily forming a film of epoxy resin composition by coating the rein composition on a release paper or the like , the film is laid on one surface or on both surfaces of the reinforcement fibers , and the resin is impregnated in the reinforcement fibers by applying heat and pressure . in the formation of the prepreg laminate , the method used for applying the heat and the pressure is not particularly limited and exemplary methods include press molding , autoclave molding , bucking molding , wrapping tape method , or internal pressure molding . the fiber - reinforced composite material containing the cured product of the epoxy resin composition of the present invention and the reinforcement fibers is well adapted for used in sport applications , general industrial applications , and aerospace applications . more specifically , in the sport applications , the fiber - reinforced composite material is preferable for used in golf shafts , fishing rods , tennis and badminton rackets , hockey sticks and other sticks , and skiing poles . furthermore , in the general industrial applications , fiber - reinforced composite material is preferable for use in structural material of vehicles such as automobiles , bicycles , ships , and railroad vehicles , drive shaft , plate springs , windmill blades , pressure vessel , flywheels , rollers for paper manufacture , roofing materials , cables , and mending / reinforcing materials . next , the present invention is described in further detail by referring to the following examples which by no means limit the scope of the present invention . the components used in the present invention are as described below . [ a ]- 1 “ jer ” ( registered trademark ) 828 ( liquid bisphenol a type epoxy resin having an epoxy equivalent weight of 189 manufactured by mitsubishi chemical corporation ) [ a ]- 2 “ jer ” ( registered trademark ) 1007 ( solid bisphenol a type epoxy resin having an epoxy equivalent weight of 1925 manufactured by mitsubishi chemical corporation ) [ a ]- 3 “ jer ” ( registered trademark ) 154 ( phenol novolac type epoxy resin having an epoxy equivalent weight of 178 manufactured by mitsubishi chemical corporation ) [ a ]- 4 “ hp ” ( registered trademark ) 7200h ( dicyclopentadiene type epoxy resin having an epoxy equivalent weight of 279 manufactured by dic corporation ). [ c ]- 1 “ curezol ” (( registered trademark ) 1b2mz ( imidazole ring equivalent weight , 172 ; 1 - benzyl - 2 - methylimidazole , a compound represented by the general formula ( i ) wherein r 1 is benzyl group , r 2 is methyl group , r 3 and r 4 are hydrogen atom manufactured by shikoku chemicals corporation ) [ c ]- 2 g - 8009l ( imidazole ring equivalent weight , 195 ; a compound represented by the general formula ( ii ) wherein r 5 and r 7 are ethyl group , r 6 and r 8 are methyl group , and a is hexamethylene group manufactured by dks co . ltd .) [ c ]- 3 “ cureduct ” ( registered trademark ) p - 0505 ( imidazole ring equivalent weight , 280 ; a compound represented by the general formula ( iii ) wherein r 9 and r 11 are ethyl group , r 10 and r 12 are methyl group , and b is isopropylidene group manufactured by shikoku chemicals corporation ) [ c ]- 4 “ curezol ” ( registered trademark ) 2pz ( imidazole ring equivalent weight , 144 ; 2 - phenylimidazole manufactured by shikoku chemicals corporation ) [ c ]- 5 “ curezol ” ( registered trademark ) 2e4mz ( imidazole ring equivalent weight , 110 ; 2 - ethyl - 4 - methylimidazole manufactured by shikoku chemicals corporation ). [ c ′]- 2 “ omicure ” ( registered trademark ) 24 ( 4 , 4 ′- methylene bis ( phenyldimethyl urea ) manufactured by pti japan ). [ d ]- 1 p - nitrobenzoic acid ( pka : 3 . 4 , manufactured by tokyo chemical industry co ., ltd .) [ d ]- 2 benzoic acid ( pka : 4 . 2 , manufactured by tokyo chemical industry co ., ltd .) [ d ]- 3 p - methoxybenzoic acid ( pka : 4 . 5 , manufactured by tokyo chemical industry co ., ltd .) [ d ]- 4 acetic acid ( pka : 4 . 8 , manufactured by tokyo chemical industry co ., ltd .) [ d ]- 5 “ cureduct ” ( registered trademark ) l - 07n ( a composition containing 5 parts by weight of a borate compound as the acidic compound manufactured by shikoku chemicals corporation ). [ e ]- 1 “ vinylec ” ( registered trademark ) k ( polyvinyl formal manufactured by jnc corporation ). the imidazole compound [ c ] or the curing accelerator [ c ′] and , when the acidic compound [ d ] is used , the acidic compound [ d ] were added to 10 parts by weight of [ a ]- 1 ( jer828 ) ( a liquid resin ) ( 10 parts by weight of the 100 parts by weight of the epoxy resin [ a ]), and the mixture was kneaded at room temperature by using a kneader . by using three rolls , the mixture was passed twice between the rolls to prepare curing accelerator master batch . after adding the dicyandiamide [ b ] to the curing accelerator master batch , by using a kneader , the mixture was kneaded at room temperature and , by using three rolls , the mixture was passed twice between the rolls to prepare curing agent master batch . after placing 90 parts by weight of the epoxy resin [ a ], namely , the epoxy resin [ a ] excluding the 10 parts by weight of the [ a ]- 1 ( jer828 ) used in the ( 1 ) and the thermoplastic resin [ e ] in a kneader , the mixture was kneaded while raising the temperature to 150 ° c ., and the kneading was continued at 150 ° c . for 1 hour to obtain a transparent viscous liquid . after cooling the viscous liquid to 60 ° c . while kneading , the curing agent master batch prepared in the ( 1 ) was added , and the mixture was kneaded at 60 ° c . for 30 minutes to prepare the epoxy resin composition . blend ratio of components in each example and comparative example is shown in tables 1 and 2 . 3 mg of the epoxy resin composition was weighed and placed on a sample pan , and isothermal measurement for 3 hours was conducted by using a differential scanning colorimeter ( q - 2000 manufactured by ta instrument ) after elevating the temperature from 30 ° c . to 100 ° c . at 100 ° c ./ minute . by using 42 seconds after the start of the temperature elevation for the starting time of the measurement , time interval between the measurement starting time and reaching of the heat flow to the top of the exothermic peak was measured as the time required to reach the peak top in the isothermal measurement at 100 ° c . the measurement was conducted for 3 samples per one measurement level , and their average was used . the average obtained in this measurement is referred as “ t ( 100 )”. 3 mg of the epoxy resin composition was weighed and placed on a sample pan , and isothermal measurement for 30 hours was conducted by using a differential scanning colorimeter ( q - 2000 manufactured by ta instrument ) after elevating the temperature from 30 ° c . to 60 ° c . at 100 ° c ./ minute . by using 18 seconds after the start of the temperature elevation for the starting time of the measurement , time interval between the measurement starting time and reaching of the heat flow to the top of the exothermic peak was measured as the time required to reach the peak top in the isothermal measurement at 60 ° c . the measurement was conducted for 3 samples per one measurement level , and their average was used . the average obtained in this measurement is referred as “ t ( 60 )”. it is to be noted that the value of the t ( 60 ) was indicated as “ at least 30 ” when the top of the peak did not appear after 30 hours . ( 3 ) method for calculating the ratio of the number of epoxy groups to the number of imidazole rings when “ n ” types of the epoxy resins were simultaneously used in the epoxy resin composition , total parts by weight of the epoxy resin composition was “ g ”, and “ w x ” parts by weight of the epoxy resin x having the epoxy equivalent weight of “ e x ” ( g / eq ) was incorporated , the average epoxy equivalent weight in the epoxy resin composition was calculated by the following equation ( 1 ) ( wherein x = 1 , 2 , 3 , . . . , n ). ( ii ) calculation of imidazole ring equivalent weight of the epoxy resin composition when “ w ” parts by weight of the imidazole compound having an imidazole ring equivalent weight of “ i ” [ g / eq ] is incorporated in the epoxy resin composition , the imidazole ring equivalent weight in the epoxy resin composition was calculated by the following equation ( 2 ): imidazole ring equivalent weight of the epoxy resin composition [ g / eq ]= g / ( w / i ) ( 2 ) ( iii ) calculation of the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition was calculated by the following equation ( 3 ) using the values obtained in the ( i ) and ( ii ). ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition =( imidazole ring equivalent weight of the epoxy resin composition / average epoxy equivalent weight of the epoxy resin composition ) ( 3 ) since dicyandiamide in the epoxy resin composition is an insoluble latent curing agent , the epoxy resin composition having the dicyandiamide excluded therefrom was prepared to confirm the solubility of the imidazole . more specifically , the imidazole compound [ c ] or the curing accelerator [ c ′] and , when the acidic compound [ d ] is used , the acidic compound [ d ] were added to 10 parts by weight of [ a ]- 1 ( jer828 ) ( a liquid resin ) ( 10 parts by weight of the 100 parts by weight of the epoxy resin [ a ]), and the mixture was kneaded at room temperature by using a kneader . by using three rolls , the mixture was passed twice between the rolls to prepare curing accelerator master batch . after placing 90 parts by weight in total of the epoxy resin [ a ], namely , the epoxy resin [ a ] excluding the 10 parts by weight of the [ a ]- 1 ( jer828 ) used in the preceding step and the thermoplastic resin [ e ] in a kneader , the mixture was kneaded while raising the temperature to 150 ° c ., and the kneading was continued at 150 ° c . for 1 hour to obtain a transparent viscous liquid . after cooling the viscous liquid to 60 ° c . while kneading , the curing agent master batch was added , and the mixture was kneaded at 60 ° c . for 30 minutes to visually confirm the state of the resulting epoxy resin composition . the epoxy resin composition was determined “ dissolved ” when the resulting epoxy resin composition was transparent , and “ not dissolved ” when the composition was opaque , namely , turbid or lumpy . after defoaming the epoxy resin composition in vacuum , the epoxy resin composition was cured in a mold which has been adjusted so that the cured article would have a thickness of 2 mm by using a “ teflon ” ( registered trademark ) spacer having a thickness of 2 mm at a temperature of 130 ° c . for 90 minutes to obtain the cured resin material in the form of a plate having a thickness of 2 mm . a test piece having a width of 10 mm and a length of 60 mm was cut out from this cured resin material , and three point bending was conducted by using instron type universal tester ( manufactured by instron corporation ) at a span of 32 mm and a crosshead speed of 100 mm / minute according to jis k7171 ( 1994 ) to measure the modulus and the deformation . the average when measured at the number of the sample of 5 was used for the values of the modulus and the deformation . the epoxy resin composition produced according to the & lt ; method for producing the epoxy resin composition & gt ; was coated on a release paper by using a film coater to produce a resin film having a metsuke (= a weight of resin / unit area ) of 74 g / m 2 . this resin film was placed in a prepreg producing apparatus , and by applying heat and pressure , the resin was impregnated from both surfaces of the sheet of carbon fiber “ torayca ” ( registered trademark ) t700s ( manufactured by toray industries , inc ., metsuke (= a weight of resin / unit area ) 150 g / m 2 ) prepared by unidirectionally aligning the fibers . the prepreg thereby produced had a resin content 33 % by mass . the high - speed curability of the prepreg was evaluated by cutting a 20 cm square test piece out of the prepreg , sandwiching the test piece between a “ teflon ” ( registered trademark ) sheet having a thickness of 150 μm , pressing the laminate at 150 ° c ., and evaluating the handling convenience when it was taken out . the handling convenience was evaluated by the following criteria , and a and b were evaluated as “ pass ”. a : the prepreg was not deformed when it was taken out after 3 minutes , b : the prepreg was deformed when it was taken out after 3 minutes , while it was not deformed when it was taken out after 5 minutes , c : curing speed was insufficient , and the prepreg was deformed when it was taken out after 5 minutes . the storage stability of the prepreg was evaluated by cutting a 10 cm square test piece out of the prepreg , leaving the test piece at room temperature for 100 days , and measuring increase in the glass transition temperature . the glass transition temperature was measured by placing 8 mg of the prepreg after the storage in a sample pan , and conducting the measurement by using a differential scanning colorimeter ( q - 2000 : manufactured by ta instrument ) and increasing the temperature from − 50 ° c . to 50 ° c . at a rate of 10 ° c ./ minute . middle point of the flexion points in the exothermic curve obtained was used for the tg . the unidirectional laminate used for the evaluation of the cfrp properties was produced by the method as described below . 13 plies of the unidirectional prepregs prepared by the & lt ; method for producing the prepreg & gt ; as described above were laminated by aligning the direction of the fibers . the prepreg laminate was tightly covered with nylon films , and the laminate was cured by applying heat and pressure for 2 hours in an autoclave at a temperature of 130 ° c . and internal pressure of 0 . 3 mpa to produce the unidirectional laminate . a test piece having a thickness of 2 mm , a width of 15 mm , and a length of 100 mm was cut out from the unidirectional laminate produced as described above . three point bending was conducted according to jis k7074 ( 1988 ) by using instron type universal tester ( manufactured by instron corporation ). the measurement was conducted at a span of 80 mm , a crosshead speed of 5 . 0 mm / minute , an indenter diameter of 10 mm , and a span diameter of 4 . 0 mm to obtain the 0 ° flexural strength . the average when measured at the number of the sample of 6 was used for the values of the 0 ° flexural strength . a test piece having a thickness of 2 mm , a width of 15 mm , and a length of 60 mm was cut out from the unidirectional laminate produced as described above . three point bending was conducted according to jis k7074 ( 1988 ) by using instron type universal tester ( manufactured by instron corporation ). the measurement was conducted at a span of 40 mm , a crosshead speed of 1 . 0 mm / minute , an indenter diameter of 10 mm , and a span diameter of 4 . 0 mm to obtain the 90 ° flexural strength . the average when measured at the number of the sample of 6 was used for the values of the 90 ° flexural strength . 40 parts by weight of “ jer ” ( registered trademark ) 828 , 30 parts by weight of “ jer ” ( registered trademark ) 1007 , and 30 parts by weight of hp7200h as the epoxy resin [ a ]; 4 . 0 parts by weight of dicy7 as the dicyandiamide [ b ] ( the curing agent ); 2 . 2 parts by weight of “ curezol ” ( registered trademark ) 1b2mz as the imidazole compound [ c ] ( the curing accelerator ); 3 . 0 parts by weight of p - nitro benzoic acid as the acidic compound [ d ]; 2 . 0 parts by weight of “ vinylec ” ( registered trademark ) k as the thermoplastic resin [ e ] were used , and the epoxy resin composition was prepared according to the & lt ; method for producing the epoxy resin composition & gt ;. this epoxy resin composition was evaluated for t ( 100 ) and t ( 60 ). t ( 100 ) was 24 minutes and t ( 60 ) was at least 30 hours . the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition was 26 , and the imidazole was dissolved in the epoxy resin . the epoxy resin composition was cured by the procedure described in the & lt ; method for producing the cured resin material and its evaluation & gt ; to prepare the cured resin material , and the cured resin material was subjected to the three point bending test which is also described in the & lt ; method for producing the cured resin material and its evaluation & gt ;. the cured resin material had good mechanical properties with the modulus of 3 . 5 gpa and the deformation of 7 . 3 mm . in addition , a prepreg was produced from the epoxy resin composition by the method described in & lt ; method for producing the prepreg and its evaluation & gt ;. the resulting prepreg had sufficient tack and drapability . when the resulting prepreg was evaluated for the high - speed curability and storage stability by the method described in & lt ; method for producing the prepreg and its evaluation & gt ;, the prepreg was cured at 150 ° c . to the degree not showing the deformation in 3 minutes , and at 25 ° c ., the prepreg did not show increase in the tg after storage for 100 days , and therefore , the prepreg had sufficient high - speed curability and storage stability . the prepreg was laminated and cured by the method described in the & lt ; evaluation of the carbon fiber - reinforced plastic ( cfrp ) material & gt ; to produce a unidirectional laminate , and when the three point bending test was conducted , the 0 ° flexural strength was 1498 mpa and the 90 ° flexural strength was 111 mpa , demonstrating the good mechanical properties of the cfrp . the epoxy resin composition , the cured resin material product , and the prepreg were prepared by repeating the procedure of example 1 except that the resin composition was changed to compositions respectively shown in table 1 . the resulting prepregs exhibited sufficient tack and drapability as in the case of example 1 . the epoxy resin composition of each example had the t ( 100 ), the t ( 60 ), and the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition were as shown in table 1 . when the prepreg was evaluated for the high - speed curability and the storage stability as in the case of the example 1 , the prepreg exhibited sufficient high - speed curability and storage stability in all levels . the cured resin material exhibited good values of the modulus and the deformation , and the cfrp also exhibited good mechanical properties . the epoxy resin composition , the prepreg , and the cured resin material were produced by repeating the procedure of the example 1 except that the curing accelerator was changed to dcmu99 ( 3 . 0 parts by weight ) and the acidic compound was not added . the resin composition and the results of the evaluation are shown in table 2 . the prepreg exhibited good storage stability and good properties of the cured article . the resulting prepreg , however , was insufficient in the high - speed curability with the t ( 100 ) value of the epoxy resin composition of 40 minutes ( namely , longer than 25 minutes ). the epoxy resin composition , the prepreg , and the cured resin material were produced by repeating the procedure of example 1 except that curing accelerator was changed to “ omicure ” ( registered trademark ) 24 ( 3 . 0 parts by weight ) and the acidic compound was not added . the resin composition and the results of the evaluation are shown in table 2 . the prepreg had good high - speed curability and the resulting cured resin material also had good properties . the resulting prepreg , however , was insufficient in the storage stability with the t ( 60 ) value of the epoxy resin composition of 10 hours ( namely , less than 15 hours ). the epoxy resin composition , the prepreg , and the cured resin material were produced by repeating the procedure of example 1 and using the composition of example 2 except that amount of the p - nitrobenzoic acid used was changed to 0 . 5 part by weight . the resin composition and the results of the evaluation are shown in table 2 . the prepreg had good high - speed curability and the resulting cured resin material also had good properties . however , the prepreg was insufficient in the storage stability with the t ( 60 ) value of the epoxy resin composition of 13 hours ( namely , less than 15 hours ). the epoxy resin composition , the prepreg , and the cured resin material were produced by repeating the procedure of example 1 by using the same composition as example 4 except that the amount of the g - 8009l used was 0 . 7 parts by weight and the amount of p - nitrobenzoic acid was 1 . 0 parts by weight . the resin composition and the results of the evaluation are shown in table 2 . the prepreg had good storage stability . however , the resulting prepreg was insufficient in the high - speed curability with the t ( 100 ) value of the epoxy resin composition of 38 minutes ( namely , longer than 25 minutes ). the balance between the modulus and the deformation of the cured resin material was also poor with the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition of 93 ( greater than 90 ). the 90 ° flexural strength of the cfrp was also as low as 84 mpa . the epoxy resin composition , the prepreg , and the cured resin material were produced by repeating the procedure of the example 1 by using the same composition as example 8 except that amount of the “ cureduct ” ( registered trademark ) p - 0505 was 4 . 5 parts by weight and the amount of the “ cureduct ” ( registered trademark ) l - 07n was 3 . 0 parts by weight . the resin composition and the results of the evaluation are shown in table 2 . the prepreg had good storage stability and high - speed curability . the balance between the modulus and the deformation of the cured resin material was also poor with the ratio of the number of the epoxy groups to the number of imidazole rings in the epoxy resin composition of 21 ( less than 25 ). the 90 ° flexural strength of the cfrp was also as low as 83 mpa . the epoxy resin composition , the prepreg , and the cured resin material were produced by repeating the procedure of the example 1 except that the curing accelerator was changed to “ curezol ” ( registered trademark ) 2e4mz ( 1 . 2 parts by weight ), and the acidic compound was not added . the resin composition and the results of the evaluation are shown in table 2 . the prepreg had good high - speed curability and the resulting cured resin material also had good properties . however , the prepreg was insufficient in the storage stability with the t ( 60 ) value of the epoxy resin composition of 4 hours ( namely , less than 15 hours ). the epoxy resin composition , the prepreg , and the cured resin material were produced by repeating the procedure of the example 1 except that the resin composition was changed as shown in table 2 . the results of the evaluation are shown in table 2 . while prepreg had good storage stability , it suffered from insufficient high - speed curability with the t ( 100 ) value of the epoxy resin composition of 40 minutes ( longer than 25 minutes ). the resulting cured resin material also suffered from poor balance between the modulus and the deformation . the cfrp also had low 0 ° flexural strength of 1385 mpa . the epoxy resin composition for fiber - reinforced composite material of the present invention is well adapted for use as the matrix resin of the fiber - reinforced composite material since it has high - level storage stability simultaneously with high - level high - speed curability , and the cured resin material after its curing has excellent mechanical properties . the prepreg and the fiber - reinforced composite material of the present invention are preferable for use in sport applications , general industrial applications , and aerospace applications . | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.