text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
referring now to the drawings and , first , particularly to fig1 thereof , there is shown therein an embodiment for feeding sheet material in accordance with the invention which has a transport - path configuration extending from a lower - disposed withdrawal or receiving site 4 to a higher - disposed transfer location 17 . suckers 3 are attached to a suction bar 1 which is movable about a swivel axis 2 . the suckers 3 lift sheet material 6 from a sheet pile 4 and feed it to a first timing - roller pair 7 . the first timing - roller pair 7 is formed of a swivelable upper transport member 7 . 1 and a permanently driven lower transport member 7 . 2 having a circumferential surface projecting into a first feed section 8 , which is limited by an upper guide plate 10 and a lower guide plate 11 . the upper transport member 7 . 1 is movable from an upper position thereof into a position wherein it is in engagement with the lower transport member 7 . 2 . the engaged position of the upper transport member 7 . 1 is indicated in phantom . the sheet material 6 is gripped by the first timing - roller pair 7 and is transported into the feed section 8 . the feed section 8 has a cross section 9 which narrows towards a second transport location , namely , a second timing - roller pair 12 . the second timing - roller pair 12 is formed of an upper engageable and disengageable transport member 12 . 1 and a lower permanently driven transport member 12 . 2 . the second timing - roller pair 12 is adjoined by a further feed section 13 which is engaged more steeply with a circumference or outer cylindrical surface of a sheet - conducting cylinder 18 accepting the sheet material 6 at a transfer location 17 . the further feed section 13 is formed of an upper and a lower guide plate 15 and 16 , respectively , defining a cross section 14 therebetween which narrows towards the transfer location 17 . at the transfer location 17 , the sheet material 6 is conveyed into opened cylinder grippers 19 of the cylinder 18 . a swiveling mechanism , which is described in detail hereinbelow , ensures that the upper transport member 7 . 1 of the first timing - roller pair 7 does not release the sheet material 6 until the sheet material 6 has been transferred safely and without loss of register to the second timing - roller pair 12 . the second timing - roller pair 12 , in turn , does not release the sheet material 6 to be fed to the sheet - conducting cylinder 18 until the sheet material 6 has been gripped in accurate register at the transfer location 17 by the cylinder grippers 19 . fig2 shows a transport - path configuration with sheet - guiding elements and infeed paths for thick and thin sheet materials . in this illustrated embodiment of the invention , as viewed in the transport direction of the sheet materials , sheet - guiding elements 20 are disposed above the feed sections 8 and 13 following or downstream of the first and second timing - roller sets 7 and 12 , respectively . the sheet - guiding elements 20 , shown herein as rubber rollers , pass through the upper guide plates 10 and 15 , respectively , of the feed sections 8 and 13 , respectively , so that they are able to act directly on the sheet material 6 to be transported . the sheet - guiding elements 20 are adjustably movable both in and opposite to the transport direction as indicated by the double arrows 20 . 2 . furthermore , the sheet - guiding elements 20 are also movably adjustable in the insertion depth thereof downwardly and upwardly in the feed sections 8 and 13 as indicated by the double arrows 20 . 1 . the adjusting - movement operations , as indicated by the double arrows 20 . 1 and 20 . 2 , may be effected both manually and through the intermediary of servomotors . in the case of the movement by servo - motors , it is possible , for example , for such servomotors to be moved under computer control to specific positions , for example , as a function of characteristic parameters stored in the memory of the computer . such parameters may be , for example , the sheet size or format , the weight of the sheet , the material thickness , and so forth . instead of being formed as rubber wheels , the sheet - guiding elements 20 may also be formed as ball - bearing races , brush - wheels or pencil - shaped brushes . it would also be conceivable for them to be constructed in the form of spring - loaded sheetmetal lips or air nozzles inserted into the guide plates of the feed sections . with sheet - guiding elements of such construction , it would be possible , for example , if the wheels were inclined , to tauten the sheet material transversely to the transport direction . it would also be possible to achieve a convex or concave deformation of the leading edge of the sheet . fig2 shows an infeed path 30 for thinner sheet material . the sheet material rests almost entirely on the lower guide plates 11 and 16 , so that , in order to have an effect upon the sheets , the sheet - guiding elements 20 should be positioned as closely as possible to the lower guide plates 11 and 16 . the driven transport members 7 . 2 and 12 . 2 also lie in a plane with the lower guide plates 11 and 16 , respectively , in order to prevent crumpling , for example , of thin material . in the processing of thicker printing stocks which , due to the inherent stiffness thereof , describe an infeed path 29 , for example , the sheet material 6 lies approximately centrally in the feed channels 8 and 13 . in the processing of thicker printing stocks , the sheet - guiding elements 20 are inserted more deeply into the feed channels 8 and 13 in order to move the sheet material 6 nearly on the path of thinner sheets . this ensures that , after passing the sheet control 21 ( note fig3 ), the sheet material always traverses the same distance to the transfer location 17 . thus , a precisely defined angular position of the machine , with reference to the zero position thereof , and a precise instant of transfer are defined . by the engagement of the sheet - guiding elements , sheets of identical thickness having paths which differ from one another due to a shaped leading edge are also prevented from entering into the cylinder grippers 19 at different instants of time . accordingly , the position of the sheet material 6 in the cylinder grippers 19 would not be defined , and this would have an effect upon the printed product . the swivelable transport members 7 . 1 and 12 . 1 mounted on respective transmission members 27 , 28 , shown in the form of swivel levers in fig3 are inserted through insertion openings 23 , 24 into the feed sections 8 and 13 . the insertion openings 23 and 24 are defined openings , the number of which is matched to the number and distribution of the sheet sizes or formats . they are distributed across the width of the feed sections 8 and 13 , because the transport members 7 . 1 and 12 . 1 are displaceable in parallel , as shown in fig3 on swivel shafts 25 and 26 thereof , depending upon the sheet size or format which is to be processed . the embodiment of the invention shown in fig3 has different feed sections 8 and 13 . according to this representation , the lower transport members 7 . 2 and 12 . 2 are provided with a timing - roller drive 22 , so that the outer cylindrical surfaces thereof rotate at identical speed . the driven transport members 7 . 2 and 12 . 2 are disposed below the guide plates 11 and 16 , respectively , and do not necessarily need to be in the form of rollers . it would also be conceivable to employ a belt - shaped conveyor or transport member surrounding the lower guide plates 11 and 16 . the lower guide plates 11 and 6 are supported by mountings 39 and 40 . the levers 27 and 8 , which are swivelable about the transmission members or swivel shafts 25 and 26 , move the transport members 7 . 1 and 2 . 1 into the positions thereof represented in phantom . the first feed section 8 is furnished with a sheet control 21 , which detects mis - fed sheets . the specific construction of this control device 21 , however , forms no part of the invention of the instant application , and may be of any suitable conventional type . it can be seen from this representation that the swivel shafts 25 and 26 on which , in turn , the swivel levers 27 and 28 are mounted are moved by transmission members or arms 34 and 35 , respectively . the arms 34 and 35 are provided at the lower ends thereof , as viewed in fig3 with rollers 33 , which roll on a bearing surface of a cam 32 . in the interest of clarity , only one of the cams is shown in fig3 . it would , however , also be possible to implement the timed engagement and disengagement movement of the upper transport members 7 . 1 and 12 . 1 into the feed sections 8 and 13 and back out of the latter by using a drive common to both transmission members 34 and 35 . it would also be conceivable to employ a drive using separate motors . through suitable contours of the control cams 32 , assurance is provided that the arm 34 produces a rotation of the swivel shaft 25 which , in turn , brings the swivel lever 27 with the transport member 7 . 1 into engagement with the revolving surface of the driven transport member 7 . 2 . this is performed at the instant at which a sheet which has been accepted from the suckers 3 of the suction bar 1 is located between the transport members 7 . 1 and 7 . 2 . when the timing roller 7 . 1 , which is rotatably mounted on the swivel lever 27 , comes into engagement with the driven transport members 7 . 2 , the sheet material is transported into the feed section 8 , the cross - sectional area 9 of which continuously decreases up to the second transport location 12 . the instant the sheet material 6 has been gripped by the transport members 12 . 1 and 12 . 2 , the transport members 7 . 1 and 7 . 2 release the material due to the contours of the control cams 32 . the sheet material is then transported into the feed section 13 by the transport members 12 . 1 and 12 . 2 . the instant the sheet material 6 has arrived at the transfer location 17 , it is accepted by the sheet - conducting cylinder 18 . at this instant , the sheet material 6 is released by the second timing - roller pair 12 which then , in turn , accepts a new sheet which has been released by the first timing - roller pair 7 . through suitable contours of the control cam 32 , or through suitable energizing periods of servomotors , guidance of sheet material through the feed sections 8 and 13 is realizable . the sheet - guiding elements are placed after or downstream from the first and second timing - roller pairs 7 and 12 , respectively , where they act upon the sheet material 6 so that the accuracy with which the sheet material 6 is fed into the cylinder grippers 19 of the sheet - conducting cylinder 18 is at a maximum during the passage thereof through the feed sections 8 and 13 . it is thus possible for the sheet material 6 to be transferred at a well defined instant of time and in a well defined position . transport from the sheet pile 4 to the transfer location 17 is ensured even in the case of sheet material 6 of small format or size . | 1 |
according to the presently described technology , a process for producing holes in a component , in particular of turbo engines , where each hole extends from a first surface at the exterior of the component to a second surface at the interior of the component , comprises the following steps : developing a 3 - d model of the geometry of the component , at least for the area of the holes ; adapting each hole on the basis of , the actual geometry of the component ; and / or generating a production program for each individual hole . the production of cool air holes requires that the outer and inner geometries ( cavities in the turbine blade ) of the individual part are known . this is provided via a 3 - d model of the individual component . a 3 - d model can be a surface model or a volume model . a 3 - d model can be developed via computer tomography ( ct ) but other processes are also conceivable . if the precision of the ct for the outer geometry is inadequate , then it is generated via an optical measurement process . ct and data from the optical process are linked to the 3 - d model . in so doing , it is also sufficient to transfer into the 3 - d model only the extracts which are necessary for producing holes in the individual component and its orientation ( for example , 6 - point nest ). on the basis of the 3 - d model of the individual component , each hole is adapted to the actual geometry within defined limits , where these limits can be the tolerances , ( e . g ., position , diameter , length of the cylinder , depth of the funnel , width of the funnel , length of the funnel , angle of the funnel ) by shifting the pattern of holes or the individual hole or group of holes , tilting the hole , displacing the hole , adapting the diameter , shifting the diffuser in the axis of the hole , tilting the diffuser with axis of the hole , or adapting the angle of the diffuser . in this way , one can avoid the misalignment of the exit of the hole due to the tolerance of the outer geometry ( for example , air foil ), whereby the covering of the component with the cooling film remains unaffected . furthermore , a funnel shape according to specification is achieved despite the tolerance of the outer geometry , which has an effect on the funnel shape . furthermore , drilling through the walls of the inner geometry due to tolerances of the inner geometry ( cavity or core or core misalignment ) can be avoided . furthermore , merging holes or an undershoot of minimum spacings due to the tolerances of the raw part can also be avoided . one eliminates , or reduces the effect on the position and shape of the cool air holes which is due to the component &# 39 ; s shifting , twisting , or tilting with respect to its nominal position , said shifting , twisting , or tilting being due to the tolerances of the outer surfaces on which the bases are formed ( application point , 6 - point nest ). furthermore , there is the possibility of producing holes at short distance of the other geometry . due to the knowledge of the actual geometry , the system for producing holes can be controlled so that before a shot through / breakthrough into the interior space occurs , the power for the production process is reduced . this avoids drilling through the other geometry . if the drilling process is stable , then the actual drilling depth can be calculated . if the process is insufficiently stable , then an in - process measurement of the drilling depth is made . in this way , process - stable production of holes becomes possible , which is not possible , or not possible in a process - stable production manner , i . e ., in the case of prior - art processes , due to the low back - feeding ( laser drilling ) or too small a distance to the adjacent contour ( erosion , electrochemical drilling ). this is useful in particular in the case of small blades of helicopter engines or engines of business jets since there the tolerances are higher in relation to the dimensions of the component than in the case of larger blades . finally , the possibility is provided of introducing holes into a component already partially provided with holes ( for example , in the case of mrp tasks ) in a manner which is adapted to the holes which are already present . after the adaptation , the production programs are generated with traversing motions , removal volumes , and process parameters ( feed rate , power , etc .) for the drilling processes for each individual hole of the respective component . these parameters can be ensured by testing . this makes possible the options that storing the production programs for each individual component can be dispensed with , or that only storing of the transformation matrices and the process parameters per component is necessary . the deviation in position of each individual component in the clamping device , said deviation being caused by systematic errors of the clamping device , is advantageously corrected numerically . the variation in the clamping process , in so far as necessary , can also be determined via a measurement and corrected numerically . the component is defined in the machine producing the holes , except for the uncertainty of the measurement , which with the correct choice of the means of measurement and the process parameters is negligible . via a comparison between the nominal 3 - d model of the component and the 3 - d model with the actual geometry of the individual component , it is determined whether adaptations are necessary . this step , however , can also be dispensed with if no changes are necessary . furthermore , a production arrangement according to the presently described technology for producing holes in a component , in particular of turbo engines , e . g . a hole - producing system , where each hole extends from a first surface at the exterior of the component to a second surface at the interior of the component , is characterized by the fact that the arrangement comprises a central computer unit which is connected to a device for developing a 3 - d model of the actual geometry of the component . furthermore , the production arrangement comprises devices for automatically adapting the hole on the basis of the actual geometry of the component and devices for automatically generating production programs for each individual hole . with this arrangement , the process of the present technology can be carried out . advantageously , the central computer unit is connected to a device for automatically correcting the deviation of the component &# 39 ; s position in the clamping device . furthermore , an advantageous extension of the production arrangement according to the present technology is characterized by an automatic drilling tool that is connected to the computer unit . the drilling tool can be provided for cutting , for electrochemical removal , or for erosion . additional measures improving the present technology are represented in more detail below together with the description of a preferred embodiment example of the present technology with the aid of the figures . refer now to fig1 - 3 . the figures are schematic representations and serve to explain the present technology . the same and similar components are represented by the same reference numbers . the specifications of directions relate to the turbo engine , unless otherwise specified . fig1 shows , in perspective representation and as a component , a turbine blade 1 of a gas turbine , such as , for example , an aircraft engine , in which numerous apertures 2 are formed as cool air holes having been formed according to the process according to the present technology . the cool air holes 2 run in general through the component wall 3 at an acute angle , which usually lies in the range of 12 ° to 35 ° with respect to the outer surface 4 of the component 1 and , for example , is 30 °. from a cavity in the turbine blade 1 , air from the compressor is conducted through the cool air holes 2 in order to conduct a film of cool air over the outer surface 4 of the turbine blade 1 . the turbine blade 1 consists of a metal , such as , for example , an ni - based or co - based alloy , but can also consist of a ceramic material and another heat - resistant material , and for the production of cool air holes 2 is clamped in a processing machine in which it can be traversed or turned along several axes . the relative motion between a drilling tool with which the forming of the cool air holes 2 is done and the component 1 to be processed is in general produced by moving the component 1 . likewise , this can be achieved , in general , by a more limited motion of the drilling tool or a superimposed motion . fig2 shows an extract from component 1 in a schematic cross - sectional view . therein the actual geometry of the outer surface 7 is represented with a thin line width and the nominal geometry of the outer surface with a thick line width . in this way , the actual basis for the production 8 and the nominal basis for the production 6 are defined . furthermore , an inner surface 9 is represented , which in the present embodiment example bounds a cooling duct reaching through to the rotor . depending on the choice of the production basis , nominal basis or actual basis 8 , either a hole 11 on the actual basis or a hole 10 on the nominal basis , with corresponding hole axes 13 , 12 , is generated . by the choice of the actual basis , drilling through the rear wall of the inner surface 9 is avoided . fig3 shows a second extract from component 1 in a schematic cross - sectional view , said component corresponding in essence to the component represented in fig2 . in contradistinction thereto , the component in fig3 comprises a second hole 16 , 17 , which comprises either a hole axis 15 based on the actual basis or a hole axis 14 based on the nominal basis . by the choice of the actual basis , drilling through the rear wall and merging of holes is avoided . with the production process according to the present technology , a hole on the actual basis is generated . in this way , one eliminates the effect on the position and shape of the cool air holes which is due to shifting , twisting , or tilting of the component with respect to its nominal position , said shifting , twisting , or tilting being due to the tolerances of the outer surfaces on which the bases are formed ( application point , 6 - point nest ). in addition , merging holes and drilling through the rear wall caused by tolerances , by outer and inner geometry , and the shifting and tilting of the inner and outer geometry are avoided . the invention has now been described in such full , clear , concise and exact terms as to enable any person skilled in the art to which it pertains , to practice the same . it is to be understood that the foregoing describes preferred embodiments and examples of the invention and that modifications may be made therein without departing from the spirit or scope of the invention as set forth in the claims . moreover , while particular elements , embodiments and applications of the present technology have been shown and described , it will be understood , of course , that the present technology is not limited thereto since modifications can be made by those skilled in the art without departing from the scope of the present disclosure , particularly in light of the foregoing teachings and appended claims . moreover , it is also understood that the embodiments shown in the drawings , if any , and as described above are merely for illustrative purposes and not intended to limit the scope of the invention , which is defined by the following claims as interpreted according to the principles of patent law , including the doctrine of equivalents . further , all references cited herein are incorporated in their entirety . | 6 |
as previously mentioned a transmission medium coupling a uwb transmitter and uwb receiver will typically give rise to a number of physical effects that complicate the function of the receiver . the transmission medium may comprise a wireless or wired transmission channel . the physical effects include multiple path reflections , which result in multiple pulses at the receiver or each transmitted pulse , in some cases these pulses being phase inverted . dispersion , frequency dependent continuation and other properties of the transmission medium distort the pulse shape . interference and noise sources are received in addition to the desired pulse data . noise sources include thermal noise ( from the receiver itself ), narrow band interference from radio transmitters sharing the same frequency spectrum , and broadband interference ( from switching and alike ). there may also be interference from co - located uwb systems sharing the same physical space for electrical cabling . a uwb receiver should preferably be capable of dealing with all these effects . referring now to fig4 , fig4 a shows an example of a transmitted uwb pulse , which in this example has a duration of approximately 100 ps . fig4 b shows the same pulse as it might be seen by a uwb receiver . as can be seen the received pulse has a plurality of multipath components and also exhibits distortion and other propagation effects . multipath components are received over a time scale which depends upon the transmission channel but which may , for example , be between 10 ns and 100 ns ( the pulses shown in this diagram are not to scale ), multipath at the longer end of this range being observed in wired systems such as uwb over mains ( ac power cable ) transmissions as described in the co - depending uk patent application no . 0222828 . 6 filed on 2nd oct . 2002 . the first received multipath component need not be the largest ( as shown in fig4 b ) and may be significantly distorted or even inverted . fig4 c illustrates a series of transmitted pulses and fig4 d an example of a corresponding received signal . it can be seen that multipath reflections from one pulse may overlap with the first signals from the next pulse . this problem is exasperated when timing modulation is applied to a transmitted pulse . fig5 shows a block diagram of a uwb receiver 500 embodying an aspect of the present invention . an incoming uwb signal is received by an antenna 502 , which may comprise a capacitive an / or inductive coupling to a cable system such as a mains power cable or a telephone cable . the received uwb signal is provided to an analog front end block 504 which comprises a low noise amplifier ( lna ) and filter 506 and an analog - to - digital converter 508 . a set of counters or registers 510 is also provided to capture and record statistics relating to the received uwb input signal . the analog front end 504 is primarily responsible for converting the received uwb signal into digital form . the digitised uwb signal output from front end 504 is provided to a demodulation block 512 comprising a correlator bank 514 and a detector 516 . the digitised input signal is correlated with a reference signal from a reference signal memory 518 which discriminates against noise and the output of the correlator is then fed to the defector which determines the n ( where n is a positive integer ) most probable locations and phase values for a received pulse . the output of the demodulation block 512 is provided to a conventional forward error correction ( fec ) block 520 . in one implementation of the receiver fec block 520 comprises a trellis or viterbi state decoder 522 followed by a ( de ) interlever 524 , a reed solomon decoder 526 and ( de ) scrambler 528 . in other implementations other codings / decoding schemes such as turbo coding may be employed . the output of fec block is then passed to a data sychronisation unit 530 comprising a cyclic redundancy check ( crc ) block 532 and de - framer 534 . the data sychronisation unit 530 locks onto and tracks framing within the received data separating mac ( media access control ) control information from the application data stream ( s ) providing a data output to a subsequent mac block ( not shown ). a control processor 536 comprising a cpu ( central processing unit ) with program code and data storage memory is used to control the receiver . the primary task of the control processor 536 is to maintain the reference signal that is fed to the correlator to track changes in the received signal due to environmental changes ( such as the initial determination of the reference wave form , control over gain in the lna block 506 , and on - going adjustments in the reference wave form to compensate for external changes in the environment ). referring now to the analog front end 504 in more detail , in a preferred arrangement the lna block 506 amplifies the signal received from the antenna or cable coupling . the amplifier design contains a fixed frequency passive filter that rejects signals out side of the fcc / etsc permitted spectral band ( 3 . 1 - 10 . 6 ghz ), as well as rejecting signals from the 5 ghz unii frequency band . rejection of such signal areas prevents strong narrow band transmissions from saturating the subsequent a / d converter . it is particularly important to reject signals that are likely to be co - located with a uwb device , such as 802 . 11 , bluetooth and mobile phone frequencies . the lna also contains a switchable attenuator that may be used to adjust the signal level fed to the a / d unit . the attenuator may be controlled directly by both the control processor 536 and the reference signal . the purpose of the attenuator is to avoid input saturation at the a / d unit , while maintaining sufficient sensitivity to detect the received pulse waveform . the reference waveform from the detector unit may also control the attenuation in real time , allowing different gain settings to be applied to different portions of the multipath signals that are received from a single pulse . the a / d converter 508 may take a variety of forms . in a preferred embodiment the a / d converter 508 is logically configured as a continuous sampler , effectively providing a continuous stream of samples at a suitable rate as determined by the upper frequency of the relevant uwb band and the nyqust criterion , for example 20 g samples per seconds ( 20 ghz ) for a 10 ghz upper frequency . physically , however , the a / d module may comprise a bank of samplers , for example 16 to provide 16 samples for each received pulse , successively triggered by a phase tapped clock to provide a snapshot of a portion of a received uwb signals at different phases which may then be used to provide an input to the correlator banks 514 of demodulation block 512 . in this way parallel blocks of signal samples may be provided at a rate of a few hundred megahertz , for example at substantially the pulse repetition frequency ( prf ) rate thus effectively reducing the primary digitisation clocks speed to this rate ; preferably each block substantially spans the duration of a received uwb pulse . implementing the sampler as a plurality of parallel sampling circuits operating of a phase tapped reference clock facilitates the fabrication of suitable sample ( and hold ) devices on conventional silicon processors . some examples of fast a / d converters are the described in the following documents , which are hereby incorporated by referenced : “ a 20 gsamples / s 8 - bit a / d convertor with a 1 mb memory in 0 . 18 μcmos presented by brian setterberg of agilent technologies , inc ., at the 2003 ieee international solid - state circuit conference ( isscc )”; “ a serial - link transceiver based on 8 - gsamples / s a / d and d / a converters in 0 . 25 μm cmos presented by chih - kong ken yang , vladimir stojanovic , siamak modjtahedi , mark a , horowitz and william f . ellersick , ieee journal of solid - state circuits , vol 36 , no 11 , november 2001 ”; published u . s . patent applications ser . nos . 2002 0167373 and 2002 0145484 . depending upon the application the a / d converter may either be a single - bit converter or a multi - bit converter , and may either monitor the received voltage level or the power level in the received signal . the a / d converter 508 may comprise a non - continuous sampler where the sampler is run only around the expected time of arrival of a received pulse ( or around a desired time slice when hunting for a received pulse ) and is substantially inactive at other times . in this way a high sampling rate may effectively be achieved but with advantages such as reduced power consumption . in general , it is desirable to gain as much information about the input signal as possible , favouring a multi - bit voltage sensitive sampling scheme . however , implementation constraints ( physical silicon area and power consumption ) mean that such a scheme is preferably only used for devices where immunity to noise ( including unexpected narrow band interference ) is important , for example where operation in close proximity to an 802 . 11 system is envisaged . in some arrangements sure bit conversion permits an acceptable compromise . non - continuous sampling can offset some of the disadvantages of such a sampler , but can constrain the range of possible delay modulation values that can be detected , thereby reducing the potential information that can be carried by each pulse . such a trade - off is often acceptable in systems where there are many co - located independent pulse transmissions , since the risk of ‘ collisions ’ between pulses from different transmissions is reduced . single bit sampling is prone to saturation but offers a significant saving in silicon cost and power consumption and is therefore preferable level based a / d converters benefit from accurate control the input signal gain . the afe 504 therefore preferably contains counters that monitor statistics of the input signal conversion , recording the number of values recorded in each of the sampling levels over some period of time . software running on the control processor periodically reads these values and resets the counters . the software may then use these to determine an optimium setting for the gain / attenuation control applied to the received signal by lna unit 506 . for such purposes , the software may assume that the received signal is , on average , a gaussian noise signal . referring now to the demodulator block 512 , this is responsible for extracting a data signal imposed on the pulses by a transmitter . the scheme described here is specifically designed to decode modulation by means of the pulse arrival time or by the pulse phase . it may also be adapted to detect modulation by means of the pulse shape ( spectral modulation ). the input to the demodulator is a stream of sample data from the afe 504 ; the output is a stream of decoded data bits . the output data rate is substantially constant fixed by the prf ( pulse repetition frequency ) and the number of bits encoded by each pulse . the operating parameters of the demodulator ( prf and bit - encoding ) are typically fixed for a given transmitter . however , the demodulator ( and other system parameters , such as afe gain ) may be time multiplexed by the mac processor in order to facilitate near simultaneous reception from multiple transmitters . the demodulator contains units to correlate the received signal against a reference signal ( programmed and maintained to track changes in the external signal propagation environment ) by control processor 536 . the detailed form of the demodulator is shown in fig6 . referring to fig6 , this shows a simplified block diagram of demodulator 512 of fig5 ; like elements to those of fig5 are indicated by like reference numerals . the input from the wireless antenna or wired interface and amplifier / filter unit 506 is implemented in discrete analog circuitry , and the a / d ( sampler ) 508 and demodulator 512 are implemented in the sampling clock domain which has , in one embodiment , an effective range of 25 ghz , corresponding to an actual clock rate of 250 mhz . the system control logic and output to the forward error correction apparatus also operates at 250 mhz . the correlator 514 comprises a bank of multiply - accumulate units 600 each of which receives an input signal sample ( comprising a set of samples of the input signal at successive sampling intervals ) and multiplies this by a reference sample ( comprising a set of samples of a reference waveform at successive sampling intervals ) provided by reference waveform synthesiser 518 . in the case of single bit a / d sampling the multiplier operation may be implemented using a simple xor gate . the accumulators average the ( correlation ) data over a number of pulses , by averaging over ( successive ) transmitted pulses bearing the same encoded data and / or averaging over multipath components . the reference signal generator or synthesiser 518 provides the reference signal to the multiply - accumulate units 600 under control of a pattern sequencer 602 . the pattern sequencer is controlled by a psr ( pseudo random ) sequence lock acquisition module 604 , preferably implemented in software as described later . conceptually the pattern sequencer 602 provides a reference waveform 606 to a plurality of delay units 608 to provide a plurality of successively delayed versions of the reference waveform to multiply - accumulate units 600 . however although illustrated as a pipeline system with multiply - accumulated delay taps equivalent to a sample period to reduce the effective clock speed the reference waveform is preferably applied in parallel to the multiply - accumulate units 600 as described later . such a parallel implementation is possible because the reference waveform is stored in memory and therefore a parallel set of differently delayed reference waveforms may be read out from the memory substantially simultaneously ; implementation of the demodulator would be significantly more complex were delay taps conceptually applied to the incoming received uwb signal sample data since without additional complexity this would not be readily available in the form of successively delayed time windows of samples of parallel in samples . the reference signal for the correlator is programmed into the reference signal generator 518 by software running on control processor 536 , which preferably uses a training algorithm to determine the receiver response ( that is , amptitude and phase distortion to a transmitted pulse ). the control processor 536 also maintains a clock phase locked to the prf ( pulse repetition frequency ) of the transmitter from which signals are being received by using the arrival times of detected pulses relative to an internal timing reference ( local crystal oscillator ). a power control output 610 from the reference waveform generator may also be employed to gate power to the a / d and sampling circuitry 508 to put this circuitry into a reduced power mode in periods where there is no expected received signal . this is particularly advantageous in systems using a multi - bit a / d since these often have a relatively large power consumption . a multiply - accumulate unit 600 provide outputs to a discriminator 612 which determines the sign and peak value ( or values if probabilistic outputs are supplied to the following stage of the ( absolute ) value maximum accumulator output ). the discriminator outputs provide an output data signal identifying the position of a received pulse and the pulse phase ( that is , normal or inverted ). a constellation decoder maps this position / phase data from the discriminator to an n - bit symbol which is then passed to the forward error correction block 520 . the demodulator 512 has a plurality of interfaces to other parts of the receiver system , each of which is preferably via a data synchroniser 616 a , b , c , such as a register or buffer . thus the multiply - accumulate units 600 provide an output to the control processor 536 for calibration of the receiver front end ( and preferably also the transmission channel ) and for location processing to facilitate physical location of a uwb receiver according to known techniques . the interface between the constellation decoder 614 and fec blocks 520 is preferably also implemented via a buffer . the psr lock acquisition module 502 preferably has a bidirectional interface to a software control function implemented on control processor 536 to provide functions such as physical location of the receiver , delay tracking , and data ( de ) whitening . referring next to fig7 this shows relative timings of transmitted data pulses and multipath components of such pulses as seen by the receiver . as can be seen from fig7 a typical delay span for a multipath reflection is between 1 and 100 ns whereas a typical interval between successive transmitted data pulses is between 2 and 10 ns . it can therefore be appreciated that a multipath reflection of a one pulse may arrive following a direct , line of sight transmission of the next pulse , or even of the next few pulses . the multipath reflections may also be phase inverted subject to different path distortions from the direct path . in a simple but less preferred arrangement the multiply - accumulate stages 600 of the correlator only integrate multipath energy over the inter - transmit pulse period so that , for example in fig7 , multipath components arriving outside the 2 - 10 ns delay range would be ignored . however in general typical multipath delays are greater than the average inter - transmit pulse period , and thus significant energy may be lost with this approach . the problem is exacerbated if pseudo - random timing jitter is applied to the timing of the transmitted pulses to achieve spectral whitening . for these reasons it is therefore preferable to implement two or more correlator banks , that is banks of multiply - accumulate units 600 as shown in fig6 , parallel to facilitate pipelining of the pulse integrations . such parallelism implemented by repetition of the correlator logic but in a preferred arrangement this parallelism is achieved by multiplexing the use of a single set of multiply - accumulate chains 600 , for example by keeping track of distinct sets of accumulator values in a static ram ( random access memory ) buffer memory . fig8 shows a schematic diagram of a uwb signal employing a preferred modulation scheme for the above described receiver and which may be generated by a transmitter described later with reference to fig1 . the signal of fig8 may be employed in a wireless or wired uwb transmission system . the signal 800 comprises a plurality of wavelets or pulses 802 each of which has either a normal or inverted form to encode a single bit of information data to be transmitted ; fig8 shows two normal ( rather than inverted ) examples of such pulses . as illustrated , according to a preferred such a wavelet or pulse comprises a positive - going portion 802 a and negative - going portion 802 b ; the order of these two portions may be reversed to invert the pulse , thus facilitating generation of normal and inverted pulses in hardware . the pulses 802 have a nominal pulse repetition frequency , for example of the order of 100 mhz . however an additional one or more information data bits may be modulated onto signal 800 by varying the precise position ( timing ) of a pulse dependent upon the data to be transmitted . for various reasons bi - phase modulation of a uwb signal has been the preferred modulation of many applications . however by also varying the pulse position more data may be encoded onto the uwb signal thus increasing the available data rate for the options for forward error correction at a given data rate and hence the range of a signal . in practical schemes it is further preferable to dither the pulse position ( in time ) in a deterministic manner to further whiten the uwb signal spectrum and hence reduce the overall signal profile and / or facilitate staying within regulatory boundaries . thus in addition to the precise timing of a pulse being dependent upon variable information data to be transmitted the pulse position may also be dependent upon a pseudo random or pn ( pseudo noise ) signal . such a pseudo random sequence is preferably deterministic so that although apparently random once the sequence and start point is known it can be reconstructed in a deterministic manner at the receiver to allow this pn modulation to be effectively subtracted from the received signal or compensated for in other ways . preferably the pn modulation is greater than the information data modulation since having a relatively small range of pulse positions about an expected pulse position ( once the effects of pn modulation have been compensated for ) simplifies demodulation of position - encoded data . in one preferred arrangement , described below , the positions a pulse can take in response modulation by information data are separated by one ( or more generally an integral number ) of reference ( and input ) uwb signal sampling intervals . thus in some preferred embodiments a pulse 802 may take one of eight or 16 different positions in time ( although other numbers of positions may be employed ) and correlator 514 correlates the input signal with reference signals at all of these positions substantially in parallel to , in a parallel operation , locate the actual or most likely position of a received pulse . as shown in fig8 according to a typical scheme the duration of a single doublet is typically between 50 ps and 100 ps and the correlator bank 514 performs parallel correlation operations over a time window 804 of approximately 1 ns , thus identifying the pulse as being in one of around 16 overlapping positions . the skilled person will understand that the above timings , and the number of parallel multiply - accumulate units 600 of correlator 514 may be varied according to the requirements of a particular implementation or application . fig9 a shows one example of an mac frame 900 for use with the receiver 500 when receiving a signal of the type shown in fig8 . this mac frame is , however , provided merely for illustrative purposes and many other different frame formats may be employed . the example mac frame 900 begins with a preamble sequence 902 comprising 32 bits of preamble data , for example pseudo random data for training . this is followed by a 4 byte header comprising a pseudo random sequence identifier and a pseudo random sequence seed ( for identifying a starting point in a sequence ), for example as a pair of 2 byte values . different pseudo random sequences may be employed by different transmitters to help avoid collisions between transmitted uwb data signals . the header is preferably structured to give the appearance of noise , and may therefore include a whitening function — for example the pseudo random sequence identifier and seed may each be selected so that the header appears essentially random . the header is followed by payload data 906 which may also be whitened of a fixed or variable length , for example 128 bytes . fig9 b schematically illustrates the positions of pilot tone pulses within a uwb signal 910 also comprising information - carrying pulses ( not shown ). in one arrangement one in every 100 pulses comprises a pilot tone pulse and , as can be seen from fig9 b , these pilot tone pulses occur at regularly spaced intervals to provide a low - level pilot tone within the uwb signal regulatory spectral mask . optionally the positions ( in time ) of the pilot tone pulses may be modulated to provide timing jitter , allowing more frequent or stronger pilot tone pulses within the spectral mask , although this is not necessary . fig1 a and 10 b illustrate an example of a uwb transmitter 1000 which may be employed to generate the information data modulated uwb signal 800 of fig8 . the transmitter structure of fig1 is provided by way of example only and other transmitter structures may also be employed to generate the uwb signal of fig8 . for simplicity forward error coding arrangements are not explicitly shown in the figure . referring to fig1 a a clock 1002 operating at , for example , 250 mhz provides a clock signal to a chain of delay elements 1004 a - e each providing a delay of , in this example , 40 ps . the successively delayed versions of the clock signal are provided to each of a plurality of monostable pulse generators 1006 , each of which also receives an enable and control input from a controller 1008 . when enabled by the controller 1008 a monostable 1006 provides an output pulse doublet ; the phase ( normal or inverted ) of the pulse doublet is also controllable by controller 1008 . the outputs from all of the monostable pulse generators 1006 are combined , in this example in summers 1008 and the combined output is provided to a transmit antenna 1010 . the controller 1008 receives a pseudo random sequence input from a pseudo noise generator 1012 , and also receives a data and control input 1014 , for example from a preceding forward error correction block and from a transmitter control processor . the data and control input receives information data to be transmitted by the transmitter and control signals such as a timing control signal to control when the transmitter is to transmit and / or pseudo noise sequence selection and start point control signals . the controller 1008 may comprise a state machine implemented in either software or dedicated hardware or a combination of the two . in operation the controller 1008 controls the timing of transmitted uwb pulses and the phase ( normal or inverted ) of these pulses by providing appropriate enable and phase control signals to the monostable pulse generators 1006 which are then triggered to provide output pulses at the corresponding time by the phase tapped clock from clock signal generator 1002 . referring now to fig1 b this shows an example of one implementation of a monostable 1006 for the transmitter of fig1 a . the monostable comprises two pulse generators 1020 a , b , one providing a positive - going pulse , the other providing a negative - going pulse , outputs from these two pulse generators being combined in a summer 1022 to provide a pulse doublet output signal 1024 . both of pulse generators 1020 a and 1020 b are controlled by a common enable line 1026 which when asserted enables the pulse generators to provide an output pulse in response to an input timing reference signal on line 1028 , but which when de - asserted disables the pulse generators from providing their outputs . in addition pulse generator 1020 b has a delay signal input 1030 which delays the production of its output pulse by two cycles to effectively invert the pulse doublet . thus according to whether or not the delay input 1030 is asserted a pulse doublet comprising either a positive or negative - going pulse or a negative then positive - going pulse is provided . a uwb transmitter such as a transmitter 1000 of fig1 may be combined with the uwb receiver of fig5 to provide a uwb transceiver . in this case it is preferable that the uwb transmitter and receiver portions of the transceiver are synchronised to a common prf clock to avoid self - collision , that is to avoid jamming reception of transmissions from a remote transmitter by local transmissions . referring next to fig1 , this shows details of the receiver 500 of fig5 , and in particular details of the signal acquisition and locking system , including details of the reference signal capture signal . like elements of those to fig5 and 6 are shown by like reference numerals . broadly speaking the functions of the psr lock acquisition module 604 are provided by a phase control processor and the functions of the pattern sequencer 602 of fig6 are provided by a combination of a reference waveform data table and of a psr sequence generator . as previously described the analog front end and a / d converter 504 provides a plurality of examples of a received uwb input signal in parallel to correlator 514 and each set of input signal samples is processed by a correlator comprising one of multiply - accumulate units 600 of correlator 514 to correlate the set of received samples in parallel with sets of reference signals representing differently delayed pulses . the sets of samples defining differently delayed versions of a referenced signal pulse are derived from a waveform of a pulse stored in a reference waveform data table 1100 . a reference received pulse is preferably stored in this table as a pulse shaped for each of a set of multi part components of the pulse together with data representing delay intervals between these multipath components , as shown in fig1 b . however differently delayed versions of a pulse may be provided by accessing a common wave shape data store for the pulse . as shown in fig1 b a reference or template waveform for a single received pulse having a plurality of multipath components comprises sample data 102 for a plurality of successive sample points of a multipath component of a pulse followed by delay data 1104 representing an interval between that multipath component of the pulse and the next multipath component . an input 1106 allows reference waveform data to be written into the referenced waveform data table 1100 . reference waveform data is provided to the correlator 514 from the data table 1100 under control of a psr sequence generator 1108 in synchronisms with a prf clock input 1110 . a phase control processor 1112 provides a prf clock to sequence generator 1108 and reference waveform data to data table 1100 . the phase control processor includes a processor and non - volatile program memory storing program code for pilot tone identification , to provide a software phase locked loop ( pll ), for multipath component identification , and for template wave shape retrieval and storage . a clock 1114 provides a clock signal to the phase control processor and receives tracking data from processor 1112 comprising a time advance / retard signal for controlling the phase of the clock and a frequency increase / decrease for controlling the frequency of the clock when the phase needs to be consistently advanced / retarded . the clock 1114 is thus adjustable to track movement of the receiver with respect to the transmitter by means of systematic adjustment in the clock timing ( which are generally small compared with the modulation ). as described further below clock 1114 acts as a slave to a similar clock in a remote transmitter and thus acts as a link clock ; typically it has a frequency in the range 50 - 250 mhz . the phase control processor 1112 provides a control output to a uwb transmitter 1116 , such as transmitter 1000 in fig1 , to control the transmitter to provide a uwb signal from a transmit antenna 1118 for use in training receiver . the control processor 1112 also receives a starter frame input signal 1120 from a mac state machine implemented in either hardware or software . the phase control processor 1112 further receives a set of inputs 1122 , one from each accumulator of correlator 514 , and a further input 1124 from the output of discriminator 612 . broadly speaking , in operation the phase control processor 1112 programs the reference waveform data table 1100 with an initial , predetermined wave shape and then identifies the uwb signal pilot tone and runs a software phase lock loop to lock onto this tone to provide a time reference . the processor then uses this to identify the wave shape of a received pulse , including its multipath components . optionally the processor 1112 may apply a fast fourier transform ( fft ) filter to remove narrow band interference . broadly speaking to locate the multipath components of a transmitted pulse the phase control processor 1112 scans a sample window by shifting the phase of the prf clock with respect to the internal clock from clock generator 1114 , integrating to obtain an average sampled data wave shape . initially the multipath component with the strongest signal is identified and the shape of this multipath component of the pulse determined from the input data , and then the processor hunts for other multipath components both backwards and forwards from the strongest signal ( because the direct line of sight pulse may not be the strongest ). as previously described the correlator operates with blocks of eight or 16 samples and these blocks are effectively positional in time with respect to the link clock reference from clock generator 1114 . preferably the multipath component pulse tracking procedure is repeated at a frequency in the order of kilohertz in order to track variations in the multipath channel and , in embodiments where implemented , to obtain physical location information relating to the receiver &# 39 ; s position . in wired uwb transmission systems the multipath environment may be quasi static in which case a channel characterisation procedure such as that described above may only be applied at switch on or , for example , when the error rate increases above a threshold . in the arrangement shown in fig1 a the phase control processor receives sampled input signal data via the correlator 514 . this simplifies the architecture of the receiver , although in other arrangements processor 1112 may receive sampled input signal data directly from analog front end 504 . to obtain sample input data from correlator 514 the input data may be correlated with a delta function such as a spike or impulse written into the wave form data table . fig1 a shows a flow diagram explaining further the operation of the phase control processor 1112 of fig1 a . to initial calibrate the receiver front end the control processor , at step s 1200 , instructs transmitter 1116 to local uwb pulses under control of the local clock generator 1114 . these pulses are received at a very high signal level and , moreover , processor 1112 knows when these pulses are transmitted and thus knows at what position in time the received input data is expected to comprise a transmitted pulse ( taking account of the delay introduced by the separation between transmit antenna 1118 and receive antenna 502 ( typically one or a few centimetres )). at step s 1202 processor 1112 programs wave form data table 1100 with a predetermined template , in particular an impulse , and hunts for the transmitted pulses by controlling the timing of psr sequence generator 1108 . this is conveniently performed by inhibiting generation of a pseudo random sequence so that the phase of the output of generator 1108 may be varied by using the psr seed as a phase offset adjust . once the locally transmitted pulses are identified the wave shape of a pulse as received and digitised by analog front end 504 is read from correlator 514 and written into the referenced wave form data table to serve as an initial reference wave form . this in effect calibrates out phase and gain non - linearities in the receiver front end . although the locally received signal is strong the wave shape data written into the data table 1100 may optionally comprise an average of a plurality of received pulses . once this initial calibration has been performed the phase control processor 1112 has the more difficult task of frequency and phase locking onto a signal from a remote transmitter and of tracking this signal . thus at step s 1206 processor 1112 controls the receiver to hunt for a signal at the pulse repetition frequency of the remote transmitter , that is at the pilot tone of the remote transmitter . the pilot tone frequency may not be known exactly but in preferred arrangements is limited to a small set of possible frequencies such as 50 mhz , 100 mhz , and 250 mhz and thus the receiver can pick each of these frequencies in turn to look for incoming uwb signals . the process of hunting for a signal at prf is illustrated in fig1 b . the receiver system first runs a correlation in a set of windows 1210 spaced by intervals at the prf frequency , averaging the correlation results over a plurality of such windows and , if no significant correlation is found , slips the windows , at the same frequency , to a slightly delayed position 1212 as shown in timeline ( ii ) to repeat the correlation and averaging procedure until pulses at the prf are found . once the prf frequency has been found , because the correlator 514 provides a plurality of outputs corresponding to a small range of delays either side of a desired time position it is straightforward to track variations in the prf . the clock generator 1114 ( and the equivalent in the transmitter ) is preferably crystal controlled and thus relatively stable and varies only slowly compared with the kilohertz pll tracking frequency . the more difficult task is to locate the remote transmitter prf in the first place , particularly as a pilot tone pulse is transmitted for of the order of only one in 100 pulses , and because the uwb signal is relatively low level , especially at longer ranges . these difficulties are addressed by averaging over a relatively long period in order to identify the systematic pilot tone impulses which appear at fixed times and distinguish , for example , from other uwb pulses which appear effectively at random times . depending upon the strength of the uwb signal and upon the range and transmit channel it may take as long as one or a few seconds to lock onto the relevant pilot tone as the correlator windows are slipped , which allows averaging over extremely large number of pulses . once the phase control processor has locked onto the prf of the remote receiver the processor can rely on the relative stability of clock generator 1114 and can thus rewrite the referenced wave form data table 1100 with an impulse and average over a plurality of pulses , typically between 100 and 1000 pulses , to determine the reference wave form for the transmit channel , and can then write this into the wave form data table . the number of pulses over which the signal needs to be averaged depends upon the range — one pulse may be enough at one metre and average of 10 4 pulses may be necessary at a range of 30 metres . once the reference wave form for a first multipath component of a transmitted pulse has been identified the phase control processor 1112 can hunt backwards and forwards from this to identify the next multipath component of the pilot tone , and this can be repeated to determine data for a plurality of multipath components of a transmitted pulse . the number of multipath components for which data is acquired depends upon a trade off between acquisition time and system sensitivity ( capturing energy from more multipath components facilitates greater sensitivity but takes longer to acquire ). it will be appreciated that once the pulse shapes and delays for multipath components of a pulse have been located in time and samples stored tracking the variations of these over time is relatively straightforward and may be accomplished by periodically averaging over say 100 to 1000 pulses , for example by time multiplexing correlator in a similar way to that described below . fig1 shows details of the reference wave form generation system . the psr sequence generator 1108 receives control signals from the control processor 1112 comprising a pilot tone to control the timing of the reference wave form generation , and a starter frame signal and a sequence seed to control pseudo random sequence modulation for pulse position dithering , and provides a read timing control output 1302 to a pattern controller 1300 . referring ahead to fig1 a , this shows the received multipath components of two successively transmitted pulses 1500 and 1502 , each with a plurality of multipath components 1500 a - c , 1502 a - c . it can be seen that the multipath components 1500 a , b of pulse 1500 arrive before the start of pulse 1502 but that the multipath component 1500 c of pulse 1500 arrives between multipath components 1502 a and 1502 b of pulse 1502 . in order to correlate the received signal with a reference wave form corresponding to pulse 1500 ( or 1502 ) the reference wave form data table 1100 should preferably be able to provide the appropriate multipath component of the pulses at the appropriate times even when these are interleaved as shown . although this is not essential it is preferable in order to be able to retrieve energy from more multipath components of a received signal . referring back now to fig1 a pattern generator 1300 provides a plurality of outputs 1304 for providing reference wave forms corresponding to a plurality of transmitted pulses having overlapping multipath components . thus , for example , if it is desired to process overlapping or interleaved multipath components from two successive transmitted pulses pattern controller 1300 provides two address outputs 1304 for addressing the wave form data table at appropriate times to provide portions of the reference wave form corresponding to the overlapping or interleaved portions of the multipath components . thus referring again to the example of fig1 a pattern controller 1300 provides a first address output for controlling data table 1100 to provide multipath components 1500 a , b , c and a second address output for addressing the table to provide the reference wave shapes for multipath components 1502 a , b , c at appropriate times . it will be appreciated that the number of address outputs of pattern controller 1300 depends upon the delay span of the number of significant multipath components of a pulse as compared with the inter - transmit pulse spacing . the reference wave form data table 1100 provides an output 1306 which comprises a time ordered combination of the multipath components of successfully transmitted components in the example of fig1 a multipath components 1500 a , 1500 b , 1502 a , 1502 c , 1502 b and so forth . in a preferred arrangement a single set of outputs provides these multipath components in a time multiplexed fashion for use with correlator 514 also operating in a time sliced or multiplexed configuration . however an alternative arrangement is illustrated in fig1 b in which data table 1100 has a plurality of sets of outputs , one for each transmitted pulse the receiver is concurrently able to process , which are combined in a summer 1310 and provided as a combined output for subsequent correlation . referring in more detail to the parallel data outputs from the reference wave form data table , the data table memory is configured to provide a plurality of blocks of reference signal data in parallel , each block of data being delayed with respect to a previous block of data . a block of data may comprise , for example , eight or 16 sample values of the stored reference wave form , preferably defining a multipath component of a pulse such as a one of components 1500 a , b , c of fig1 a . the blocks preferably overlap in time and in one arrangement each block is delayed from the previous block by one sample , 16 blocks defining 16 successfully delayed multipath pulse components being output in parallel . in this example this requires a bus comprises 256 parallel outputs from reference output data table 100 , but the majority of these outputs may be provided simply by appropriate wiring since 16 blocks each of 16 samples , each delayed by a sample requires only 32 parallel sample value outputs . each of these sample value outputs , it will be appreciated , may comprise a single or multi - bit value , depending upon whether or single or multi - bit a / d conversion is employed . depending upon the duration of a multipath component of a pulse such as multipath component 1500 a of fig1 a is stored within the reference wave form data table , a block of reference data may be added with zeros at either or both ends . the use of a reference wave form data table provides important benefits to the receiver system , in particular allowing use of a lower quality receiver analog front end than would otherwise be acceptable as the above described process of self - calibration , storing referenced wave form data table 1100 , can compensate for distortion within the receiver as previously described . in operation the psr sequence generator 1108 is responsive to the pseudo random sequence employed for transmitting the data to control the read timing from the reference wave form data table to compensate for the pseudo random ( but deterministic ) time modulation imposed on the variable , information — dependent phase and position modulation . pattern controller 1300 also provides an end of pattern output signal 1308 for use in resetting the correlator as described further below . fig4 shows details of the configuration of the multiply - accumulate units of correlator 514 . the correlator comprises a plurality , in one configuration 16 , of multiply units 1400 each coupled to a respective accumulator 1402 . each multiplier unit 1400 receives the same block 1404 of sampled input data , as illustrated comprising 16 successively delayed samples ( either one or multi - bit values ). each multiply unit 1400 also receives a block of reference signal samples 1406 , in one configuration comprising 16 successive samples of the reference signal wave form , from data table 1100 , but each of blocks 1406 is successively delayed so that the sampled input data is correlated in parallel by multiplier units 1400 with portions of the referenced signal wave form spanning a range ( as illustrated , 16 ) of successive time slices of the referenced wave form . the effect of this is to slide the sampled input data block or time slice along the referenced wave form until a correlation is found but it is easier in practice to firstly change the referenced wave form delay rather than the sampled received data delay , and secondly to perform a plurality of correlation in parallel rather than employ a single slide window . each of multiply units 1400 comprises a multiplier to multiply each input data sample with the corresponding reference data sample and provide an output to the corresponding accumulator 1402 so that the accumulator accumulates a correlation value from all ( in this case 16 ) correlation operations in parallel . each accumulator has an output 1408 coupled to a partial correlation store 1410 for writing an accumulated correlation value into the store . each accumulator also has an input 1412 from a read output of store 1410 to allow a partial correlation value written into the store to be read back from the store and added to a further correlation value in each respective accumulator . writing of data into the store and reading of data from the store is controlled by the phase control processor 1112 . the partial correlation store 1410 comprises a plurality of sets of memory locations , each set of memory locations storing a set of partial correlation values , one from each multiply - accumulate module ( t 1 . . . t 16 ). storage is provided for as many sets of partial correlation values as is needed to process a desired number of transmitted pulses as overlapping or interleaved multipath components . thus , for example , two sets of memory locations for partial correlation values are provided for storing partial correlation values where multipath components of two successively transmitted pulses overlap or interleave . data from each of the plurality of memory locations of a set of partial correlation results is provided on an output 1414 to discriminator module 612 . discriminator 512 also provides a memory clear output 1416 for clearing or setting to zero a set of partial correlation values , and receives an end of pattern signal 1308 from pattern controller 1300 . discriminator 612 provides an output 1418 to subsequent forward error correction modules such as a viterbi decoder . although reference has been made to store 1410 storing partial correlation , once the correlation of a complete set of multipath components of a received signal pulse is complete the accumulated correlation values from outputs 1418 are written into store 1410 thus providing a set of complete correlation values , that is taking account of all multipath components it has been decided to process , and these complete correlation values are available to the discriminator 612 via bus 1414 . to illustrate the operation of the correlator 514 of fig1 it is helpful to refer to fig1 a . broadly speaking the procedure is to correlate ( accumulate ) the first received multipath component 1500 a and to dump this into store 1410 , and then to correlate the next multipath component 1500 b , also accumulating the previously stored partial correlation for multipath component 1500 a by reading this from store 1410 adding this to the partial correlation value of multipath component 1500 b , and the total accumulated set of correlation values is then written back into store 1410 . this process is continued until a multipath component of a subsequent pulse is encountered , in this case multipath component 1502 a of pulse 1500 . the pattern controller 1300 of fig1 then controls the reference wave form data table 1100 to provide a pulse shape appropriate for correlating with multipath component 1502 a and following the correlation operation the result of this correlation is dumped into a separate set of memory locations within store 1410 , this set of memory locations being allocated to the second pulse . the correlation operation for multipath components of the received signal continues with the partial correlation results being written into the set of memory locations for either the first or second pulse as appropriate , the pattern generator controlling the wave form data table to generate a reference wave shape for the appropriate multipath component . thus continuing with the example of fig1 a multipath component 1500 c of the first pulse is next accumulated with the partial correlation value read from store 1410 for the first pulse and dumped back into store 1410 . in this case this is the final processed multipath component pulse of 1500 though the accumulated correlation values in store 1410 for the first pulse can then be taken as complete correlation values and processed by discriminator 612 . the signal indicating that the complete set of multipath components has been correlated is provided by pattern controller 1300 since this controller is able to determine that the final stored multipath component has been processed . however correlation of pulse 1502 continues with multipath component 1502 b and when the first multipath component of a third pulse ( is not shown in fig1 a ) received the set of partial correlation values which was previously used for pulse 1500 ( and which was cleared by discriminator 612 after the complete correlation values for pulse 1500 were processed ) is available for use for accumulating correlation values for this third pulse . fig1 b shows , diagrammatically , the correlation of a multipath component 1510 a of a received uwb signal pulse 1510 with a set of referenced pulses 1512 a , b of which , for clarity , only two are shown . the referenced signal pulses are time shifted to either side of the received multipath component 1510 a and correlation with each of these referenced signal pulses provides a correlation value as schematically illustrated in graph 1514 . the shape of this curve , and the height and width of its peak may alter depending upon the received signal and referenced signal shape . in fig1 b a set of ( full ) correlation values output from storage 1410 to discriminator 612 on bus 1414 is diagrammatically illustrated by bar chart 1516 in which each bar 1518 represents an accumulated correlation value for one of the delayed versions of the referenced signal multipath component 1512 . it can be seen that most of the accumulated correlation values are close to a mean level 1520 but one of the accumulated values represented by bar 1522 is significantly different from the others . this represents the most likely pulse position ; the bars 1524 , 1526 to either side of it represents next most probable pulse positions . bar 1522 a is significantly greater than the average 1520 which applies a positive correlation ( normal pulse ) whilst bar 1522 b has a correlation value which is significantly less ( more negative ) than the average which implies a negative correlation that is an inverted received signal pulse as compared with the reference . thus the correlator of fig1 b is able to co - determine both the likely position ( in time ) of a received signal pulse and also the phase ( normal or inverted ) of the pulse and hence to co - determine information data modulated to both pulse position and pulse phase simultaneously . the use of both position and phase simultaneously to encode information data significantly enhances the information data carrying capacity of the system . in the above described system the correlator is employed for correlating successive multipath components of received signal pulses . however essentially the same arrangement can also be used for accumulating relation values for successively transmitting impulses carrying the same data . in other words a transmitter and / or receiver may employ redundancy , using two or more transmit pulses to carry substantially the same data , at the receiver processing these as though they were merely multipath components of a single pulse . this reduces the effective data rate ( halving data rate where two pulses are received instead of one to transmit a given symbol ) but potentially increases the range of a transmission system by providing greater energy per transmitted symbol . such an arrangement may be employed adaptively , reducing the data rate but increasing reliability where transmission conditions are difficult or at the edge of range of a system . the reduction in effective data rate may be partially compensated for by increasing the pulse repetition frequency , providing that operation within the desired regulatory spectral envelope is maintained ; the transmit power may also be adaptively controlled to facilitate this . no doubt alternatives will occur to the skilled person . it will be understood that the invention is not limited to the described embodiments and encompasses modifications apparent to those skilled in the art lying within the scope of the claims appended hereto . without further elaboration , it is believed that one skilled in the art can , using the preceding description , utilize the present invention to its fullest extent . the preceding preferred specific embodiments are , therefore , to be construed as merely illustrative , and not limitative of the remainder of the disclosure in any way whatsoever . in the foregoing and in the examples , all temperatures are set forth uncorrected in degrees celsius and , all parts and percentages are by weight , unless otherwise indicated . the entire disclosures of all applications , patents and publications , cited herein and of corresponding united kingdom application no . 0316900 . 0 , filed jul . 18 , 2003 and u . s . provisional application ser . no . 60 / 518 . 342 , filed nov . 10 , 2003 are incorporated by reference herein . the preceding examples can be repeated with similar success by substituting the generically or specifically described reactants and / or operating conditions of this invention for those used in the preceding examples . from the foregoing description , one skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . | 7 |
as schematically shown in fig1 , the apparatus 1 , in accordance with the present invention comprises a supporting plane 2 whereon an element 3 or substratum to be worked is put and a moving structure 4 of a laser head 5 . the moving structure 4 of the laser head 5 is suspended upon the supporting plane 2 by means of a supporting structure 6 . in particular , the moving structure 4 of the laser head 5 comprises an arm 7 anchored to the supporting structure 6 and connected with moving means ( not shown , quite completely conventional ) capable to move the arm along a crosswise direction with respect to the longitudinal extension of the supporting plane 2 . the end of arm 7 opposite with respect to the supporting structure 6 is provided with rotating means such as a rotating disk 8 ( as schematically shown in fig1 ) comprising an external rotating portion whose external circumference carries the laser head 5 which is rotated around an axis x - x of said motor . in particular , such rotating disk can be formed by a “ brushless ” motor with an internal stator and an external rotor whose periphery carries the laser head 5 . the laser head 5 , as schematically shown in fig1 , comprises a tip 10 directed towards the supporting plane 2 so that it directs the laser beam coming out from the head along an axis y - y parallel to the rotating axis x - x of the rotating means and spaced from these . it is to notice that such positioning , as it will later be better disclosed , allows the laser head to advantageously move around the rotating axis x - x of the rotating means to ideally draw a circumference lying onto a plane parallel to the supporting plane 2 . moreover , the combination with the above said crosswise movement of arm 7 allows moving in any point of the element to be worked through only the two mentioned movements , i . e . one crosswise and the other one rotating , the first one directly carried out on practically single - pieced arm and the second one carried out directly on the laser head . in other words , through only these two movements and the relative two components that is an arm formed by a single piece and a rotating motor , it is possible to reach every part to be worked which otherwise can only be reached by means of the prior art complex structures described above . alternatively , the rotating disk 8 can be represented by a rotating shaft 11 , shown in fig2 , having an l - shape and rotatably connected with arm 7 . the rotating shaft 11 too is a single piece rotatably moved around an axis z - z perpendicular with respect to the supporting plane 2 by a conventional motor 9 . in particular , the free end of the shaft 11 , opposite to arm 7 , carries the laser head 5 . like the rotating disk 8 , also the rotating shaft 11 allows the laser head to move around the rotating axis z - z so that it can ideally draw a circumference lying onto a plane parallel to said supporting plane 2 . preferably , the laser head 5 is mounted onto said rotating means 8 , 11 so that it can rotate onto the exit axis y - y of the laser beam ( fig3 a ). in particular , the laser head 5 can in turn be provided with a motor 12 capable to rotate the tip 10 onto the axis y - y . for instance , the laser tip 10 can be provided with a rotating shaft 13 connected to said motor so that it can rotatably be moved onto said axis y - y . advantageously , moreover , the tip 10 can be connected to the rotating shaft 13 through a join 14 which allows the tip to move along an arc of a circle or , in other words , to incline with respect to the axis y - y . in fig3 b , it is shown an example of working position wherein the tip 10 has been rotated anticlockwise onto the axis y - y and inclined of an angle a with respect to said axis . similarly , if the laser head 5 is mounted on the external circumference of a rotating disk 8 motor , as the one previously described , the tip 10 will be able to rotate onto its own axis y - y and , in addition , to incline of a selected angle relatively to said axis . furthermore , the laser head 5 can be moved along its axis y - y through a further conventional operation , not shown , for trim regulations of its distance relative to the substratum to be worked based on its material and thickness , as well as on the power of the laser used for the working . it must be taken into account that , according to the present invention , the laser used is a fiber - type laser . in fact , it has been seen that the use of this kind of laser allows to advantageously simplify the apparatus structure greatly . for such a purpose , the laser head 5 can be reached from the outside by a conventional fiber cable designated to transmit the laser beam coming from a generator , for example , mounted on the supporting structure 6 but , anyhow , not actually belonging to the apparatus itself . as the apparatus is greatly versatile , any type of fiber laser known in the field can be used , obviously , according to the kind of material to be worked and its thickness . preferably , it can be used a last generation laser characterized by a direct exciting system of the active ytterbium ( yb ) doped fiber , through pumped - light laser diodes ( ld ). the apparatus according to the present invention is further implemented with an actuation and control unit ( not shown ) such as a computer capable of operating the movements of the entire moving structure based on predetermined programs uploaded on said unit . once set up some standard working parameters such as the type of material and its thickness , the laser head 5 can be equipped with a scanner beam capable of scanning the surface to be worked and of detecting the suitable values indicative of said surface characteristics . these values are then processed by the program in combination with the kind of working to be done either a cut or a superficial marking . at this point , the computer will actuate the entire apparatus in order to operate the desired working correctly . preferably , moreover , the supporting plane 2 , can be moved back and forth along a single longitudinal direction to allow not only the positioning of the element 3 to be worked near the laser head 5 , but also in combination with the movement of the laser head itself while working in order to make it easy to reach the farthest point of the element and in order to facilitate carrying out of particularly complex working according to difficult paths . as schematically shown in fig4 a , the rotating means 8 , 11 , for example , are positioned basically at the center of the flat element 3 to be worked . in this position the laser head 5 can move along the circumference described by the rotation of said rotating means and , therefore , to perform working , such as superficial engravings , holes or cuts along a wide path through a simple rotating movement . in addition , the rotating means 8 , 11 can be moved in sequence or in combination with the rotation , along the crosswise direction with respect to the supporting plane 2 so that the laser head 5 can reach any point of the central portion of flat element 2 ( fig4 b ). preferably , the supporting plane 2 can be moved further as in the foregoing description to allow the laser head 5 to reach even the farthest points of flat element 2 periphery and therefore have the possibility to treat every part of the element itself ( fig4 c ) thus making complex working through the combination of a rotating movement and a crosswise one . in accordance with a particularly preferred embodiment , the apparatus of the invention can be provided with detection sensors ( not shown ) or with a camera capable of detecting the positioning of the element to be worked on the supporting plane . for example , quite conventional optical sensors , such as photocells , can be positioned along the supporting plane 2 on both its longitudinal sides in order to detect the position of one or more elements to be worked while the plane is operated non - stop . this situation occurs in the case of a conveyor belt whereon various elements to be worked are loaded and come from a preceding work station and which thus can be worked non - stop . in fact , the detection system allows to detect the piece in proximity of the laser head 5 and to activate through the said activation and control unit , the laser beam activation any time an element is exactly under said laser head . it is apparent that the apparatus can thus work non - stop and can be integrated in a production line with several work stations . alternatively , a camera can , for example , be mounted on the supporting structure 6 in order to record the transit of the elements to be worked near the laser head 5 . the recording of said transit is sent to said activation and control unit which in turn , as previously , activates the laser beam of the laser head 5 . besides , the camera can control the working state in order to verify the correct execution of the laser treatment and block or correct the operation parameters such as the laser head movement and / or its power and / or its inclination always allowing the optimization of the final result . from what disclosed it is apparent that the apparatus for laser working of flat elements according to the present invention is very simple from the construction point of view and not so bulky in comparison with the apparatuses and systems of prior art . in particular , the moving structure is slender , not heavy and it doesn &# 39 ; t need particular adjustments or calibrations as the moving means are formed by few mechanically simple elements . this advantageously allows to be able to associate the apparatus after of before other apparatuses or systems forming a complete production line . for instance , apparatuses for drawing , threading or other operating apparatuses can be associated to the apparatus of the invention in order to form an outright production line . the optimum working range is the same as the diameter of the laser head rotation and moreover , in this range the moving parts are limited allowing a high working speed . anyway , it must be taken into account that the working range can be modified , enlarged implementing the possibility of moving the substratum onto the supporting plane . further , the capability of the laser head to incline and rotate with respect to the axis y - y at right angle to the plane 2 allows special working onto surfaces such as corrugated ones , always keeping the laser beam at right angle to the surface itself . the apparatus assembly is simple and doesn &# 39 ; t require complex solutions as mechanisms such as pantographs or robotized arms are avoided . in particular , it must be noticed that the rotating means can have dimensions less than one meter and can be connected to the supporting arm 7 in a conventional way without particular adjustments . for instance , the supporting arm 7 itself can be the stator of the rotating disk motor 8 and the laser head 5 can be mounted onto the rotating portion of said motor through a pin or an articulated join which allows said rotating and oscillatory movements . in addition , the use of an optical fiber laser doesn &# 39 ; t need mirrors usually used to direct the laser beam as in the conventional lasers . in fact , it is known that the calibrations required in order to position such mirrors correctly are particularly demanding . the laser generator , being a fiber one , can be easily changed for typology modifications as it is a separate piece of equipment of the invention and mounted onto it in a simple way . further modifications of the apparatus of the present invention are possible for a person skilled in the art without departing from the safeguarding field of the invention as defined in the appended claims . | 1 |
the present invention relates to a canopy assembly for protecting pleasure boats from rain , sun and wind . such canopy assemblies are primarily comprised of a pair of side frame tubes which may be of some 4 ″ in diameter , are elongated , straight and in this instance , hollow ; a pair of elongated hollow u - shaped end tubes , with a center section slightly curved and with straight outer ends slidably inserted axially into an adjacent end of a side tube . this conventional canopy assembly also is provided with a plurality of curved bow elements attached at each end to a side frame tube forming a bowed upper surface the framework over which a canopy is attached by a plurality of bungee cords and springs attached between grommets formed in the canopy edges , the bow elements , and the side end tubes . a bow element may also serve as the center section of a framework end tube . the conventional canopy assembly includes further a tubular weldment bracket at each straight outer end which bracket includes at least one circular spacer member for insertion into the outer , open end of an adjacent side frame tube . the upper framework and canopy just described is mounted on a quartet of upright posts or legs , one leg at each corner of the framework for support therefore , with the legs supported at their bottom ends by horizontally secured beams . referring to fig1 and 2 , one corner section ( 10 ) of a canopy assembly upper framework with a canopy ( 11 ) attached thereto is illustrated . an outer end ( 12 ) of an elongated , straight , hollow side frame tube ( 13 ) is depicted , into which a weldment tube outer end unit ( 14 ) is axially , slidably inserted . the weldment tube outer end unit ( 14 ) has , in this instance , a pair of longitudinally spaced , relatively flat , circular spacer elements ( 16 ), ( 17 ) secured thereto , which spacer elements ( 16 ), ( 17 ) have a diameter slightly less than the inner diameter of the side frame tube outer end ( 12 ), whereby the weldment tube outer end ( 14 ) and its spacer elements ( 16 ), ( 17 ) are axially slidable back and forth within the side frame tube outer end ( 12 ). the outer tubular end ( 18 ) of a framework end tube is shown , connected to a curved tube ( 19 ), with the curved tube ( 19 ) attached to an adjacent end ( 21 ) of a weldment tube ( 22 ), thus forming a right angular corner section ( 10 ) of the upper framework of the canopy assembly . the tubes ( 21 ), ( 22 ) and spacers ( 16 ), ( 17 ) form the weldment tube outer end unit ( 14 ). the corner portion ( 23 ) of the canopy is shown , draped over the side frame tube ( 13 ), the end tube outer end ( 18 ) and associated connecting member . the portion is held down by bungee cords ( 24 ), ( 26 ) connected between grommets ( 27 ) formed along the edge ( 28 ) of the canopy portion ( 23 ), and a bow element ( 29 ), each bow element ( 29 ) having a curved outer end ( 31 ) welded in a clamped manner to a portion ( 32 ) of the weldment tube ( 22 ). although the tubular members described thus far are circular and hollow , their cross - sectional shapes may be varied from circular , and they need not be completely hollow so long as their mating relationships coact as described . in practice , each framework end tube outer end ( 18 ) at each corner section ( 10 ) of the canopy assembly upper framework is slidably inserted into the adjacent outer end ( 12 ) of each side frame tube ( 13 ) until , for example , the clamping outer end ( 31 ) of a bow element ( 29 ) is closely adjacent to or even contiguous with the exposed face ( 33 ) ( fig5 and 6 ) of the outer end ( 12 ) of a side frame tube ( 13 ). the improvement of this invention comprises a semi - circularly curved sleeve ( 34 ) ( fig5 ) having a radius such that it can fit snuggly over the curved outer surface of the side frame tube outer end ( 12 ), and including further an oval shaped flange ( 36 ) ( fig4 ) extended at right angles to the longitudinal extent of the sleeve ( 34 ). an opening ( 37 ) ( fig4 ) is formed centrally within the flange ( 36 ). the sleeve ( 34 ) embraces the side frame tube outer end ( 12 ) whereby the flange ( 36 ) extends over and covers the outer face ( 33 ) of the said outer end ( 12 ) ( fig6 and 7 ). clamping members ( 35 ) hold the sleeve onto the side frame tube outer end ( 12 ). it will be noted that due to the curved extent of the clamping end ( 31 ) of the bow element ( 29 ) being less than a full circle , and as the oval shape ( fig4 ) of the flange ( 36 ) is less than the diameter of the side frame tube outer end ( 12 ), both the clamping end inner edge ( 38 ) ( fig7 ) and the flange ( 36 ) may lie in the same plane against the side frame tube outer end face ( 33 ), under certain circumstances . in this position of the sleeve ( 34 ) and its flange ( 36 ), the opening ( 37 ) is axially and longitudinally aligned with an opening ( 39 ) formed in each spacer element ( 16 ), ( 17 ) ( fig3 and 4 ), whereby a carriage bolt ( 41 ) may be inserted through the opening ( 39 ) in at least one spacer element ( 16 ), for example , with one end ( 42 ) of the bolt ( 41 ) also inserted through the flange opening ( 37 ), and with the enlarged head ( 43 ) of the bolt ( 41 ) engaged with the inner face ( 44 ) ( fig7 ) of the spacer element ( 16 ). the bolt ( 41 ) is held in place against the spacer ( 16 ) by a lock nut ( 46 ) threaded onto the bolt ( 41 ) and against the outer face ( 52 ) of the spacer element ( 16 ). lock washers ( 47 ), ( 48 ) ( fig7 ) are inserted over the bolt end ( 42 ), with an adjusting hex nut ( 49 ) threaded onto the bolt end ( 42 ). rotation of the adjusting nut ( 49 ) in one direction tends to tighten it against the outer face ( 51 ) of the flange ( 36 ), whereby continued rotation in the same direction of the nut ( 49 ) effects a slidable draw outwardly of the weldment tube outer end ( 22 ) ( fig7 ) relative to the side frame tube outer end ( 12 ) due to a jack screw action of the bolt ( 41 ) and nut ( 49 ), the flange ( 36 ) being held tight against the side frame tube outer end face ( 33 ). rotation of the adjusting nut ( 49 ) in an opposite direction loosens the engagement relationship of the adjusting nut ( 49 ) with the flange ( 36 ), whereby the weldment tube outer end ( 22 ) and its spacers ( 16 ), ( 17 ) are slidably movable , as before , axially into the side frame tube outer end ( 12 ). although these axial adjustment movements of the side frame tube outer end ( 12 ) and the adjacent weldment tube end ( 22 ) may be , for example , only about a total of one and one half inches ( 1½ ″), this variance will normally allow the installation of a canopy cover over a framework , which canopy has either shrunk or was extra long . it will be appreciated that only the use of a simple open end wrench ( not shown ) or like tool for rotating the adjusting nut ( 49 ) is all that is required for rotation of the nut ( 49 ) to effect the framework adjustments described . | 8 |
particularly , fig1 and 2 show two ( front and rear ) perspective view of the present device , in which the support plate or bracket 6 is visible , which has a median portion forming the flat engagement seat 106 . in the preferred embodiment of fig1 and 2 , said seat has four successive holes 506 for fastening the plate or bracket to four threaded holes 805 of the block 8 on the rear of the plate , as shown in fig2 . the arrangement of the four slotted holes 806 and the size thereof are such as to allow engagement of the block 8 on the motor fastening end , by couplings provided on the clamp , and normally used for packaging , which are typically at least one pair of threaded holes , spaced from each other in a horizontal direction and substantially coincident with the holes 806 of the block 8 . in order to enhance the adaptability of the block 8 to different positions of the threaded holes in the clamp or in the motor terminal , at least one of the holes of each pair of holes along a horizontal axis is shaped like a slot extending in said horizontal direction . however , when at least three holes are provided at the vertices of a triangle or four holes at the vertices of a quadrilateral , at least one of the holes or at least two of the holes , particularly two holes having different vertical positions may be slotted both in the horizontal and in the vertical directions , thereby having a cross shape . as is apparent from fig1 , the plate or bracket 6 has upper stiffening ribs 206 . the end portions 606 of the plate 6 are angled away from the motor and toward the cylinder 1 , and have such a length as to hold the cylinder 1 at a distance from the plate 6 , thereby allowing it to freely slide on the rod 2 . such angled terminal ends 606 of the plate 6 are fastened to the rod by specially shaped bolts . the upper rib 206 ends in the corner area , between the plate and the angled end at a certain distance from an end portion of the corresponding angled end 606 to allow easy coupling and attachment of the bolt for fastening the two portions of the rod 2 to the plate . in this embodiment , each end of the rod 2 is internally threaded and the rod is integrated in the bracket by specially shaped bolts 802 . the bolt 802 has an internal hole for the passage of oil and the threaded shank engages the internal threading of the end of the half rod 302 . the extension of the bolt head is externally threaded and has an internal tapered hole for sealing the fittings 702 which connect to the hydraulic fluid or oil circulation circuit . such fittings can be radial clamping fittings or combinations of threaded fittings on one side and radial clamping fittings on the other side . the oil delivered by the pump which is controlled by the steering wheel or by a different control device , like a helm wheel or the like is introduced in one of the two chambers separated by the piston 502 directly through the corresponding portion of the tubular rod 202 , 302 , thereby providing a device in which the fluid inlets / outlets are fixed in position relative to the bracket 6 and to the watercraft . fig1 and 2 also show the cylinder 1 sliding along the rod 2 , the cylinder being shown in its rightmost operating position . thanks to the oil delivered by the pump , the cylinder slides from right to left and vice versa , thereby transmitting its translational motion to the arm 7 which is directly linked to the cylinder 1 . fig1 also shown the outer profile of the expansion chambers 101 and the heads 201 . regarding the arm 7 , fig1 shows it as having two different sections : a prismatic section , at the end portion of said arm and a round section at the start portion of the arm 7 which is coupled with the cylinder portion provided therefor , which is not visible in fig1 . such arm 7 may be translated / rotated relative to the cylinder 1 in its round starting portion and may be further translated / rotated in its end portion , to provide the widest range of mounting solutions for coupling to the different motor types , as mentioned above . fig3 shows a top view of an alternative embodiment of the present device , wherein certain elements of fig1 and 2 are also shown . in this particular embodiment , the plate or bracket 6 has a flat engagement seat 106 which is offset relative to the side branches of the plate , whereby the block 8 of fig1 and 2 is no longer needed . particularly in fig3 , a particular embodiment of the plate or bracket 6 is shown , which has the upper stiffening rib 206 . the particular embodiment of the plate 6 causes the latter to be particularly light and sturdy , the ribs allowing to reduce the thicknesses of the plate , while maintaining a considerable flexural and torsional rigidity . from fig3 the particular shape of the plate 6 and the upper rib 206 is apparent , the latter ending at a certain distance from the portion in which the rod 2 is engaged in one passage port at each of the angled ends 606 of the plate 6 , thereby providing sufficient clearance to grasp the fastening bolt 802 . it shall further be noted that the plate may also have a lower stiffening rib , not shown , in addition to the upper rib , which is substantially provided opposite to the upper rib , where said upper rib is lacking . fig3 also shows the fittings 702 for oil or hydraulic fluid , when fitted into the end portion of the rod 2 . referring now to fig4 , which shows a front section of the cylinder , the rod and all relevant parts , the tubular rod 2 sealingly and slideably projects out of both heads of the cylinder 1 . therefore , the rod 2 has a tubular shape and is preferably composed of two separate rod segments 202 , 302 , which are dynamically interconnected by a central piston 502 . the latter divides the inner space of the cylinder into two chambers 4 , 5 . the conduits for feeding / discharging fluid to and from the corresponding chambers 4 , 5 of the cylinder 1 , which are formed by the two tubular right and left half - stems 202 , 302 open into or communicate with the corresponding variable volume chamber 4 , 5 of the cylinder 1 through at least one radial pipe , port or the like 402 . the ports 402 of the embodiment as shown in fig4 are formed by radial passageways in the body of each end of each half - stem 202 , 302 , at the connection with the piston 502 and are provided at the side of the piston 502 which is turned toward the outlet head of the corresponding half - stem 202 , 302 of the cylinder 1 . nevertheless , the holes or passageways 402 of the half - stems 202 , 302 for communication with the corresponding chambers 4 , 5 may be provided as radial inclined holes , or with sections differing from the one of fig4 . when the hydraulic fluid reaches the corresponding chamber 4 , 5 the chamber volume increase , due to the admission of oil , causes the cylinder 1 to move along the rod 2 , thereby generating the motion that will be transmitted to the arm 7 and will cause the outboard motor connected thereto to be steered . in fact , the oil or hydraulic fluid being used , due to the pressure generated by the pump , displaces the piston 502 that delimits the variable volume chambers 4 and 5 , each chamber being delimited by the corresponding face of the piston 502 and the facing cylinder head . said chambers 4 , 5 are delimited by the outer wall of the corresponding half - stem 202 , 302 , by the inner wall of the corresponding portion of the cylinder 1 , by the corresponding wall of the piston 502 and by the corresponding head 3 . those skilled in the art will appreciate how the oil or hydraulic fluid volume increase causes an axial thrust on the corresponding head , which is movable for its being linked to the cylinder , and translates along the rod , thereby driving the cylinder 1 . in the particular embodiment of fig4 , the heads 3 of the cylinder 2 are visible , which are connected to the latter by appropriate and known systems , or are made of one piece therewith . fig4 also shows the various seals between the elements of the cylinder 1 and between the cylinder 1 and the rod 2 , but the description of said seals is unnecessary , as they are well known to the skilled person . fig5 shows a section of a detail of fig3 , particularly of the area around the piston 502 , which actually forms the end portion of each of the right and left feed pipes 202 , 302 of the two half - stems . the piston 502 is directly attached to the rod 2 in a median position , and it may be noted that it also forms the fixed wall of the variable volume chambers 4 and 5 . fig5 also shows the plurality of seals between the various components of the device according to the present invention , although they will not be described herein , because said seals are prior art for those of ordinary skill . fig6 shows a front section view of the cylinder , the rod and the relevant parts of the preferred embodiment of fig1 and 2 , this particular embodiment showing , in addition to the parts that were described for the previous figures , the particular shape of the bolt 802 , which has threads engaging in the internal wall of the rod , as shown in fig6 . it shall be noted that , in this particular embodiment , the bolt 802 needs no locknut , which makes the device even lighter . referring to a further feature , which is apparent from fig1 to 5 , the inner space of the cylinder has two expansion chambers 101 which are formed by a radial extension of the chamber of the cylinder 1 and are situated at a higher position than the rest of the cylinder chamber , and especially than the ends of the half - stems 202 , 302 . these expansion chambers have one , two or more bleeder valves 401 , that are used as described above to bleed the hydraulic circuit and are mounted in the highest position of the circuit . as is shown in the figures , the expansion chambers 101 are disposed over the cylinder 1 and , in the particular selected embodiment , they are disposed outside the cylinder , but they may be also provided within the cylinder , which makes them invisible from the outside . thanks to this characteristic , the air within the circuit gathers in the expansion chambers 101 and may be easily bled by the bleeder valve . particularly referring to fig1 , the latter shows the arm 7 linked in its housing 301 , which is itself provided , in the preferred embodiment , as a parallelepiped outside the cylinder 1 and possibly made of one piece therewith . due to positioning needs , the arm 7 is movably coupled with its housing , the arm 7 being free to rotate within its housing 301 , thereby allowing its free end to be variously positioned , and to be adapted to the different possible positions of the steering means , which are present on currently available outboard motors of different types . also , fig4 shows a preferred variant embodiment of the arm , said idler arm being composed of two parts , that are mutually engaged , preferably in a nut and screw arrangement , possibly by using a nut or another fastener , to also allow the arm to be extended , still with the aim of providing a more versatile use . thanks to the connections in its housing 301 , said arm may rotate about an axis perpendicular to the cylinder axis , may translate along such axis , thereby becoming raised from the cylinder , may rotate by its free end portion , thanks to the joint placed on the arm 7 and may be also extended , still thanks to said joint . the various degrees of freedom as described above are preferably provided by using a nut - and - screw type housing 301 on the cylinder 1 , and an identical connection between the two arm parts . thus , it will be appreciated that the free end portion of the arm may be easily and widely adjustable , as described above . fig2 shows by black arrows the different degrees of freedom that the arm and its free end portion may have . fig4 shows an axial section of the cylinder , the rod and relevant parts , in which the perforated rod 2 is visible , which forms , thanks to the holes along the rod and the central piston 502 , the two feeding / discharging conduits formed by the two right and left half - stems 202 and 302 , which are fed with oil or hydraulic fluid , admitted through the two fittings 702 at the end portions of the rod . through the two channels of the two half - stems , formed by the piston 502 , oil or hydraulic fluid flows through the connection ports 402 into the variable volume chambers 4 and 5 . the connection ports 402 in the embodiment as shown in fig4 are provided by forming radial holes in the rod body at its piston end , although radial inclined holes may be formed , or having sections differing from that of fig4 . when the hydraulic fluid reaches the corresponding expansion chamber , the chamber volume increase , due to the admission of oil , causes the cylinder 1 to move along the rod 2 , thereby generating the motion that will be appropriately transmitted to the arm 7 and will cause the outboard motor connected thereto to be steered . in fact , the oil of hydraulic fluid being used , due to the pressure generated by the pump , displaces the piston 502 that delimits the variable volume chambers 4 and 5 , each chamber being delimited by the corresponding face of the piston 502 and the facing cylinder head . fig4 also shows the various seals between the elements of the cylinder 1 and between the cylinder 1 and the rod 2 , but the description of said seals is unnecessary , as they are well known to the skilled person . still in fig4 , the screw coupling means 402 of the selected embodiment are shown , which connect the rod 2 to the plate or bracket 6 , thereby holding the rod in position . | 1 |
firstly , an explanation will be given on an entire configuration of a turning working vehicle 1 referring to fig1 . in this embodiment , the turning working vehicle 1 is explained as an embodiment of a working vehicle . however , the working vehicle is not limited thereto and may alternatively be a vehicle with a hydraulic device , such as an agricultural vehicle , a construction vehicle and an industrial vehicle . as shown in fig1 , the turning working vehicle 1 has a traveling device 2 , a turning device 3 and a working device 4 . the traveling device 2 has a pair of left and right crawlers 5 , a left traveling hydraulic motor 5 l and a right traveling hydraulic motor 5 r . the left traveling hydraulic motor 5 l drives the left crawler 5 and the right traveling hydraulic motor 5 r drives the right crawler 5 , whereby the traveling device 2 can make the turning working vehicle 1 travel forward and backward and turn . a blade 17 for leveling work accompanying excavating work is provided in the traveling device 2 . the blade 17 is supported at one of front and rear sides of the traveling device 2 so as to be rotatable vertically , and is moved vertically by a blade cylinder 18 which is driven telescopically . the turning device 3 has a turning base 6 , a turning motor 7 , an operation part 8 and an engine 9 . the turning base 6 is arranged above the traveling device 2 and supported rotatably by the traveling device 2 . by driving the turning motor 7 , the turning device 3 can make the turning base 6 turn concerning the traveling device 2 . on the turning base 6 , the operation part 8 having various operation tools , the engine 9 which is a power source , and the like are arranged . the engine 9 has a droop characteristic with which engine rotation speed is decreased or increased gradually following variation of load . namely , when the load on the engine 9 is increased , output of the engine 9 is increased and the rotation speed of the engine 9 is decreased according to the droop characteristic . when increase of the load is continued , the load is over the maximum output of the engine and engine stall is caused . then , the engine stall is prevented by later - discussed control . the working device 4 has a boom 10 , an arm 11 , a bucket 12 , a boom cylinder 13 , an arm cylinder 14 , a bucket cylinder 15 and a swing cylinder 16 . one of ends of the boom 10 is supported by a front portion of the turning base 6 so as to be rotatable longitudinally , and the boom 10 is rotated by the boom cylinder 13 which is driven telescopically . furthermore , the end of the boom 10 is supported via a boom bracket as to be rotatable laterally , and is rotated by the swing cylinder 16 which is driven telescopically . one of ends of the arm 11 is pivoted on the other end of the boom 10 , and the arm 11 is rotated by the arm cylinder 14 which is driven telescopically . one of ends of the bucket 12 is supported by the other end of the arm 11 , and the bucket 12 is rotated by the bucket cylinder 15 which is driven telescopically . accordingly , in the working device 4 , a multi - articulated structure is configured which excavates earth , sand and the like with the bucket 12 . though a working device provided in the turning working vehicle 1 according to this embodiment is the working device 4 which performs the excavating work with the bucket 12 , the working device is not limited thereto and may alternatively be a similar hydraulic device , such as a working device which has a hydraulic breaker and performs the excavating work . next , an explanation will be given on a hydraulic circuit 20 of the hydraulic device in the turning working vehicle 1 referring to fig2 . the hydraulic circuit 20 has four hydraulic pumps 21 , 22 , 23 and 24 , and hydraulic oil is sent from the pumps via a control valve 30 to traveling hydraulic actuators ( the traveling hydraulic motors 5 l and 5 r ) and working hydraulic actuators ( the turning motor 7 and the cylinders 13 , 14 , 15 , 16 and 18 ). the hydraulic pumps 21 , 22 , 23 and 24 are driven by power from the engine 9 so as to discharge the hydraulic oil . the hydraulic pumps 21 and 22 are variable displacement type hydraulic pumps , and the third pump 23 and the pilot pump 24 are fixed displacement type hydraulic pumps . the hydraulic oil sent from the first pump 21 , the second pump 22 and the third pump 23 is supplied to the hydraulic actuators and then returned to a hydraulic oil tank 19 through a return oil passage 19 a . the hydraulic oil discharged from the first pump 21 is sent from an oil passage 21 a via switching valves 31 , 33 and 38 constituting the control valve 30 to the boom cylinder 13 , the bucket cylinder 15 and the right traveling hydraulic motor 5 r respectively . the hydraulic oil discharged from the second pump 22 is sent from an oil passage 22 a via switching valves 32 , 34 , 35 , 36 and 37 constituting the control valve 30 to the arm cylinder 14 , the swing cylinder 16 , the blade cylinder 18 , the turning motor 7 and the left traveling hydraulic motor 5 l respectively . the hydraulic oil discharged from the third pump 23 is sent from an oil passage 23 a via switching valves 31 , 32 , 33 , 35 and 36 constituting the control valve 30 to the turning motor 7 , the boom cylinder 13 , the arm cylinder 14 , the bucket cylinder 15 and the blade cylinder 18 respectively . when the switching valves 31 , 32 , 33 , 34 , 35 , 36 , 37 and 38 are switched respectively , the boom cylinder 13 , the arm cylinder 14 , the bucket cylinder 15 , the swing cylinder 16 , the blade cylinder 18 , the turning motor 7 , the right traveling hydraulic motor 5 r and the left traveling hydraulic motor 5 l are driven respectively . the oil passage 23 a at a discharge side of the third pump 23 is branched and connected to an electromagnetic proportional relief valve 43 , and the electromagnetic proportional relief valve 43 is controlled so that a relief pressure is reduced when load of the engine 9 is not less than a predetermined value . an explanation will be given on a control configuration and a control mode of the turning working vehicle 1 according to a first embodiment of the present invention referring to fig3 and 4 . an engine rotation speed detection means 41 detects an actual rotational speed n of the engine 9 . the engine rotation speed detection means 41 includes a sensor such as an electromagnetic pickup or a rotary encoder and is provided near an output shaft of the engine 9 . the engine rotation speed detection means 41 is connected to a controller 40 and transmits a detection signal to the controller 40 . the rotation speed of the engine is set by rotating an accelerator lever , and a set rotation speed ns is detected by a rotation angle detection means 42 . the rotation angle detection means 42 includes an angle sensor for example , and is provided in a rotation base part of the accelerator lever ( not shown ). the rotation angle detection means 42 is connected to a controller 40 and transmits a detection signal to the controller 40 . the electromagnetic proportional relief valve 43 is a pressure change means which changes a pressure of hydraulic oil from the third pump 23 . a primary side of the electromagnetic proportional relief valve 43 is connected to the oil passage 23 a and a secondary side of the electromagnetic proportional relief valve 43 is connected to the hydraulic oil tank 19 . the electromagnetic proportional relief valve 43 is configured so that a relief pressure ( relief amount ) of the hydraulic oil is changed by changing current supplied to a solenoid . the solenoid of the electromagnetic proportional relief valve 43 is connected to the controller 40 , and the relief pressure is changed by a control signal from the controller 40 . in the controller 40 of this embodiment , governor control is performed when the load of the engine 9 is less than a predetermined value , and the relief pressure is controlled corresponding to the magnitude of the load when the load is not less than the predetermined value . the said load is found from a map with a difference between the set rotation speed ns and the actual rotational speed n of the engine 9 , and the relief pressure of the electromagnetic proportional relief valve 43 is changed corresponding to the load . concretely , a flow shown in fig4 is performed . at a step s 11 , the controller 40 obtains the set rotation speed ns and the actual rotational speed n of the engine 9 . then , the control is shifted to a step s 12 . at the step s 12 , the controller 40 judges whether the actual rotational speed n of the engine 9 is lower than the set rotation speed ns or not . when the actual rotational speed n is lower , the control is shifted to a step s 13 . when not lower , the control is shifted to a step s 15 . at the step s 13 , the controller 40 calculates a deviation e between the set rotation speed ns and the actual rotational speed n of the engine 9 . then , the control is shifted to a step s 14 . at the step s 14 , the controller 40 changes the relief pressure of the electromagnetic proportional relief valve 43 into a relief pressure xe corresponding to the calculated deviation e . namely , the controller 40 calculates the load from the deviation e and the actual rotational speed n , and when the load is not less than the predetermined value , the controller 40 calculates the relief pressure xe corresponding to the deviation e and transmits a control signal to the solenoid of the electromagnetic proportional relief valve 43 so as to change the relief pressure into xe . then , the pressure of the hydraulic oil from the third pump 23 is changed into the relief pressure xe from a relief pressure xa of the case in which the load is less than the predetermined value , and the hydraulic oil excessing the relief pressure xe is returned to the hydraulic oil tank 19 . accordingly , the load of the engine 9 caused by the third pump 23 corresponding to energy of the difference of xa and xe can be reduced . then , the control is shifted to return and the flow is repeated . the larger the load is , the lower the relief pressure xe is set so as to prevent the engine stall . at the step s 15 , the controller 40 changes the relief pressure of the electromagnetic proportional relief valve 43 into the relief pressure xa . namely , the controller 40 transmits a current command corresponding to the relief pressure xa to the electromagnetic proportional relief valve 43 . accordingly , the pressure of the hydraulic oil from the third pump 23 is changed into the relief pressure xa , and the hydraulic oil excessing the relief pressure xa is returned to the hydraulic oil tank 19 . then , the control is shifted to return and the flow is repeated . as the above , in the turning working vehicle 1 according to the first embodiment of the present invention , when the load of the engine 9 is increased and the actual rotational speed n of the engine 9 becomes lower than the set rotation speed ns , the electromagnetic proportional relief valve 43 which is the pressure change means is operated corresponding to the deviation e between the actual rotational speed n and the set rotation speed ns so that the pressure of the hydraulic oil from the third pump 23 is changed . in more detail , the relief pressure of the electromagnetic proportional relief valve 43 is changed from the relief pressure xa into the relief pressure xe lower than the relief pressure xa , whereby the pressure of the hydraulic oil from the third pump 23 is reduced . accordingly , the load of the engine 9 caused by the third pump 23 which is the fixed displacement type hydraulic pump can be reduced so as to improve the effect of preventing the engine stall . furthermore , the load of the engine 9 caused by the third pump 23 can be reduced by not changing the third pump 23 from the fixed displacement type hydraulic pump to the variable displacement type hydraulic pump but providing the pressure change means , whereby cost is reduced . the pressure change means of this embodiment is configured by the electromagnetic proportional relief valve 43 , thereby being matched easily with the controller 40 . an explanation will be given on a control configuration and a control mode of the turning working vehicle 1 according to a second embodiment of the present invention referring to fig5 to 8 . points different from the first embodiment are mainly explained . in the second embodiment , in addition to the control of the first embodiment in which the pressure of the hydraulic oil from the third pump 23 is changed , control in which a flow rate of hydraulic oil discharged from the hydraulic pumps 21 and 22 is changed , that is , control in which a swash plate angle r of a movable swash plate in each of the hydraulic pumps 21 and 22 is changed is performed . an explanation will be given on the control in which the swash plate angle of the movable swash plate in each of the hydraulic pumps 21 and 22 is changed . as shown in fig5 , the swash plate of the first pump 21 is interlockingly connected to the swash plate of the second pump 22 , and the swash plate angle r of the swash plate of the first pump 21 can be changed by a swash plate angle change means 51 . in this embodiment , the swash plate angle change means 51 includes a hydraulic cylinder ( fig2 ). the swash plate angle change means 51 is connected to the swash plate of the first pump 21 and is actuated by operating an electromagnetic proportional control valve 52 . the electromagnetic proportional control valve 52 includes an electromagnetic valve having three parts and two positions ( see fig2 ) which supplies hydraulic oil from the pilot pump 24 to the swash plate angle change means 51 and discharges the hydraulic oil from the swash plate angle change means 51 . the electromagnetic proportional control valve 52 is provided between the pilot pump 24 and the swash plate angle change means 51 . the electromagnetic proportional control valve 52 is configured so that by changing a current flowing in a solenoid , a flow rate of the hydraulic oil flowing in the electromagnetic proportional control valve 52 is changed proportionally to the current . the electromagnetic proportional control valve 52 is connected to the controller 40 , and the flow rate is changed corresponding to a signal from the controller 40 ( current command ). a swash plate angle detection means 53 detects the swash plate angle r of the swash plate of the hydraulic pumps 21 and 22 . the swash plate angle detection means 53 includes a position sensor for example , and is provided in the swash plate angle change means 51 . the swash plate angle detection means 53 is connected to the controller 40 and transmits a detection signal to the controller 40 . in the controller 40 of this embodiment , when the load of the engine 9 is less than the predetermined value , governor control is performed , and when the load is not less than the predetermined value , the relief pressure of the electromagnetic proportional relief valve 43 and the swash plate angle of the swash plate of the hydraulic pumps 21 and 22 are controlled corresponding to the magnitude of the load . the load is found from the difference between the set rotation speed ns and the actual rotational speed n of the engine 9 with the map , and the relief pressure of the electromagnetic proportional relief valve 43 and the swash plate angle of the swash plate of the hydraulic pumps 21 and 22 are changed corresponding to the load . concretely , a flow shown in fig6 is performed . at a step s 21 , the controller 40 obtains the set rotation speed ns and the actual rotational speed n of the engine 9 and the swash plate angle r of the swash plate of the hydraulic pumps 21 and 22 . then , the control is shifted to a step s 22 . the step s 22 is similar to the step s 12 of the first embodiment . when the actual rotational speed n of the engine 9 is lower than the set rotation speed ns , the control is shifted to a step s 23 . when not lower , the control is shifted to a step s 27 . the step s 23 is similar to the step s 13 of the first embodiment . then , the control is shifted to a step s 24 . at the step s 24 , the controller 40 judges whether the swash plate angle r of the swash plate of the hydraulic pumps 21 and 22 is a limiting angle rm or not . the limiting angle rm is a limiting angle of the swash plate at which the discharge amount of the hydraulic oil from the hydraulic pumps 21 and 22 is the minimum . when the swash plate angle r is the limiting angle rm , the control is shifted to a step s 25 . when the swash plate angle r is not the limiting angle rm , the control is shifted to a step s 26 . at the step s 25 , the controller 40 changes the swash plate angle r of the swash plate of the hydraulic pumps 21 and 22 into a swash plate angle re corresponding to the deviation e . namely , the controller 40 operates the electromagnetic proportional control valve 52 so that the hydraulic oil discharged from the pilot pump 24 is supplied to and discharged from the swash plate angle change means 51 , whereby the swash plate angle is changed into the swash plate angle re and the discharge amount of the hydraulic oil from the hydraulic pumps 21 and 22 is changed to a discharge amount corresponding to the swash plate angle re . then , the control is shifted to return and the flow is repeated . at the step s 26 , the controller 40 acts similarly to the step s 14 of the first embodiment . then , the control is shifted to return and the flow is repeated . at the step s 27 , the controller 40 stops the control of the swash plate angle r of the swash plate of the hydraulic pumps 21 and 22 with the swash plate angle change means 51 and the electromagnetic proportional control valve 52 , and changes the relief pressure of the electromagnetic proportional relief valve 43 into xa . then , the control is shifted to return and the flow is repeated . the swash plate angle r of the swash plate of the hydraulic pumps 21 and 22 can be changed with not only the swash plate angle change means 51 but also three swash plate angle change means 54 , 55 and 56 ( see fig2 ) which are operated corresponding to the flow rate of the hydraulic oil discharged from the hydraulic pumps 21 , 22 and 23 . accordingly , when the control is stopped at the step , the swash plate angle r is changed corresponding to the discharge amount of the hydraulic oil discharged from the hydraulic pumps 21 , 22 and 23 . as the above , in the turning working vehicle 1 according to the second embodiment of the present invention , when the load of the engine 9 is increased and the actual rotational speed n of the engine 9 becomes lower than the set rotation speed ns , the swash plate angle change means 51 is operated corresponding to the deviation e between the actual rotational speed n and the set rotation speed ns so that the swash plate angle r of the swash plate of the hydraulic pumps 21 and 22 is changed into the swash plate angle re , and when the swash plate angle re is the limiting angle rm , the electromagnetic proportional relief valve 43 which is the pressure change means is operated corresponding to the deviation e so that the pressure of the hydraulic oil from the third pump 23 is changed . in more detail , the relief pressure of the electromagnetic proportional relief valve 43 is changed from the relief pressure xa into the relief pressure xe lower than the relief pressure xa , whereby the pressure of the hydraulic oil from the third pump 23 is reduced . accordingly , the load of the engine 9 caused by the third pump 23 and the load of the engine 9 caused by the first pump 21 and the second pump 22 can be reduced . therefore , the effect of preventing the engine stall is improved further . in comparison with the first embodiment , the pressure of the hydraulic oil from the third pump 23 is not reduced excessively , whereby balance of the work is not lost and working ability is not reduced . as shown in a flow in fig7 , in the controller 40 , when the load of the engine 9 is increased and the actual rotational speed n of the engine 9 becomes lower than the set rotation speed ns , the relief pressure of the electromagnetic proportional relief valve 43 is changed corresponding to the deviation e between the actual rotational speed n and the set rotation speed ns , and when the relief pressure x becomes a limiting pressure xm ( a limiting pressure at which the pressure of the hydraulic oil from the third pump 23 is the minimum ), the swash plate angle r of the swash plate of the hydraulic pumps 21 and 22 can be changed so as to change the discharge amount of the hydraulic pumps 21 and 22 . furthermore , as shown in a flow in fig8 , in the controller 40 , when the load of the engine 9 is increased and the actual rotational speed n of the engine 9 becomes lower than the set rotation speed ns , the relief pressure of the electromagnetic proportional relief valve 43 and the swash plate angle of the swash plate of the hydraulic pumps 21 and 22 can be changed simultaneously corresponding to the deviation e between the actual rotational speed n and the set rotation speed ns so as to change the pressure of the hydraulic oil from the third pump 23 and the discharge amount of the hydraulic pumps 21 and 22 simultaneously . in this case , the load of the engine 9 caused by the hydraulic pumps 21 , 22 and 23 is dispersed , whereby the balance of the work is not lost and the working ability is not reduced . an explanation will be given on a control configuration and a control mode of the turning working vehicle 1 according to a third embodiment of the present invention referring to fig9 and 10 . points different from the first and second embodiments are mainly explained . different from the turning working vehicle 1 of the first and second embodiments configured so that the load of the engine 9 is detected and the pressure of the hydraulic oil from the third pump 23 is changed , the turning working vehicle 1 according to the third embodiment is configured so that application of the load on the engine 9 is predicted beforehand and the pressure of the hydraulic oil from the third pump 23 is changed . according to this embodiment , the pressure change means changing the pressure of the hydraulic oil from the third pump 23 includes a low pressure side relief valve 61 , a high pressure side relief valve 62 and a switching valve 63 . the low pressure side relief valve 61 reduces the pressure of the hydraulic oil from the third pump 23 . a suction port of the low pressure side relief valve 61 is connected via the switching valve 63 to a discharge port of the third pump 23 . a discharge port of the low pressure side relief valve 61 is connected to the hydraulic oil tank 19 . a relief pressure of the low pressure side relief valve 61 is set to xl of the low pressure side . the high pressure side relief valve 62 increases the pressure of the hydraulic oil from the third pump 23 . a suction port of the high pressure side relief valve 62 is connected via the switching valve 63 to a discharge port of the third pump 23 . a discharge port of the high pressure side relief valve 62 is connected to the hydraulic oil tank 19 . a relief pressure of the high pressure side relief valve 62 is set to xh of the high pressure side . the switching valve 63 switches an oil passage which guides the hydraulic oil discharged from the third pump 23 to the low pressure side relief valve 61 and an oil passage which guides the hydraulic oil discharged from the third pump 23 to the high pressure side relief valve 62 . the switching valve 63 is provided between the third pump 23 and the low pressure side relief valve 61 and the high pressure side relief valve 62 . the switching valve 63 is an electromagnetic switching valve and is connected to the controller 40 and switches the oil passages following a signal from the controller 40 . an air conditioning device 64 conditions air in a cabin covering the operation part 8 . the air conditioning device 64 includes a compressor 64 a , a receiver dryer , an expansion valve , an evaporator and the like . the compressor 64 a of the air conditioning device 64 is provided on the output shaft of the engine 9 and is driven by power from the engine 9 . an air conditioning operation tool 65 is a means for operating the air conditioning device 64 . the air conditioning operation tool 65 is provided in the operation part 8 . the air conditioning operation tool 65 includes an on - off switch , a temperature control lever , an airflow control knob and the like . the on - off switch of the air conditioning operation tool 65 is connected to the controller 40 and transmits a detection signal ( on - off signal ) to the controller 40 . instead of the on - off switch of the air conditioning operation tool 65 , a detection means detecting operation of the compressor 64 a may alternatively be provided and connected to the controller 40 . the controller 40 operates the switching valve 63 following on - off operation of the air conditioning device 64 ( operation of the on - off switch of the air conditioning operation tool 65 ). concretely , a flow shown in fig1 is performed . at a step s 31 , the controller 40 judges whether the air conditioning device 64 is turned on or not , that is , whether the on - off switch of the air conditioning operation tool 65 is on or not . when the on - off switch is on , the control is shifted to a step s 32 . when the on - off switch is not on , the control is shifted to a step s 33 . at the step s 32 , the controller 40 changes the relief pressure x into xl . namely , the switching valve 63 is switched and the hydraulic oil discharged from the third pump 23 is supplied to the low pressure side relief valve 61 . accordingly , the pressure of the hydraulic oil from the third pump 23 is changed into the relief pressure xl . therefore , the hydraulic oil excessing the relief pressure xl is returned to the hydraulic oil tank 19 . then , the control is shifted to return and the flow is repeated . at the step s 33 , the controller 40 changes the relief pressure x into xh . namely , the switching valve 63 is switched and the hydraulic oil discharged from the third pump 23 is supplied to the high pressure side relief valve 62 . accordingly , the pressure of the hydraulic oil from the third pump 23 is changed into the relief pressure xh . therefore , the hydraulic oil excessing the relief pressure xh is returned to the hydraulic oil tank 19 . then , the control is shifted to return and the flow is repeated . accordingly , when the air conditioning device 64 is turned on , the pressure of the hydraulic oil from the third pump 23 is changed from the relief pressure xh of the high pressure side into the relief pressure xl of the low pressure side , whereby the load of the engine 9 caused by the third pump 23 can be reduced for a difference between xh and xl . therefore , when the compressor 64 a of the air conditioning device 64 is driven , the engine stall can be prevented . the pressure change means may alternatively be the electromagnetic proportional relief valve shown in the first embodiment so as to change the relief pressure continuously corresponding to a set temperature of the air conditioning device 64 or the like . as the above , in the turning working vehicle 1 according to the third embodiment of the present invention , the pressure change means is operated following on - off operation of the air conditioning device 64 ( operation of the on - off switch of the air conditioning operation tool 65 ) so as to change the pressure of the hydraulic oil from the third pump 23 . in detail , interlocking with the turning - on operation of the air conditioning device 64 , the switching valve 63 is operated so as to make the hydraulic oil from the third pump 23 flow to the low pressure side relief valve 61 , whereby the pressure of the hydraulic oil from the third pump 23 is reduced , and interlocking with the turning - off operation of the air conditioning device 64 , the switching valve 63 is operated so as to make the hydraulic oil from the third pump 23 flow to the high pressure side relief valve 62 , whereby the pressure of the hydraulic oil from the third pump 23 is increased . accordingly , by reducing the pressure of the hydraulic oil from the third pump 23 by the turning - on operation of the air conditioning device 64 , the load of the engine 9 caused by the third pump 23 can be reduced , whereby the effect of preventing the engine stall is improved . an explanation will be given on a circumference configuration of an engine 110 according to a fourth embodiment of the present invention referring to fig1 . in fig1 , in a hydraulic drive system 130 , thick lines show a main circuit and thin lines show a pilot circuit . in fig1 , in an air conditioning system 120 , thick lines show a coolant circuit . in fig1 , dotted lines show electric signal lines . the engine 110 and the hydraulic drive system 130 of this embodiment are different from those of the first to third embodiments . in the circumference of the engine 110 , a first pump 131 as a hydraulic pump , a second pump 132 as a hydraulic pump , a third pump 133 as a hydraulic pump , a compressor 121 , a controller 150 as a control means , a rack actuator 153 as a rotation speed change means , and an accelerator lever 155 as a target rotation speed set means are provided . an explanation will be given on a configuration of the engine 110 . an output shaft of the engine 110 is connected to an input shaft of the first pump 131 , an input shaft of the second pump 132 and an input shaft of the third pump 133 ( in this embodiment , the input shaft of the first pump 131 , the input shaft of the second pump 132 and the input shaft of the third pump 133 are configured by one shaft , and the shaft is an input shaft 201 in fig1 discussed later ), and the first pump 131 , the second pump 132 and the third pump 133 are driven by the engine . furthermore , the output shaft of the engine 110 is connected via a clutch 152 to an input shaft of the compressor 121 . an engine rotation speed sensor 151 as an actual rotation speed detection means is arranged near a crankshaft of the engine 110 . the engine rotation speed sensor 151 detects an actual rotation speed ne of the engine 110 . the engine rotation speed sensor 151 is connected to the controller 150 . the engine 110 is controlled so as to realize a target rotation speed , set by the accelerator lever 155 , with an electronic governor . in more detail , for realizing the target rotation speed set by the accelerator lever 155 , a fuel injection amount is changed and controlled by operation of the rack actuator 153 which is the rotation speed change means . the rack actuator 153 is connected to the controller 150 . an explanation will be given on a configuration of the hydraulic pumps . the first pump 131 , the second pump 132 and the third pump 133 are included in the hydraulic drive system 130 . the hydraulic drive system 130 has the left traveling hydraulic motor 5 l , the right traveling hydraulic motor 5 r , the blade cylinder 18 , the boom cylinder 13 , the arm cylinder 14 , the bucket cylinder 15 , and the swing cylinder 16 , which are mentioned above , as hydraulic actuators . in the hydraulic drive system 130 , the hydraulic pumps suck hydraulic oil stored in a hydraulic oil tank and apply pressure on the hydraulic oil , and then send the hydraulic oil to the hydraulic actuators . the first pump 131 and the second pump 132 are variable displacement type hydraulic pumps whose discharge amounts of the hydraulic oil can be changed by changing tilt angles of a movable swash plate 141 and a movable swash plate 142 . the movable swash plate 141 and the movable swash plate 142 are configured integrally . namely , the first pump 131 and the second pump 132 are configured so that a plurality of plungers are arranged in one cylinder block so as to be movable reciprocally , one suction port and two discharge ports are formed , the plungers contact with one swash plate , and the discharge amounts are changed simultaneously . the third pump 133 is a fixed displacement type hydraulic pump which is configured by a trochoid type or gear type pump whose discharge amount is fixed . the tilt angle of the movable swash plate 141 is limited ( controlled ) by a spring mechanism 147 , a first damper mechanism 161 and a rotation deviation damper mechanism 165 . the spring mechanism 147 biases the movable swash plate 141 so as to make the discharge amounts of the first pump 131 and the second pump 132 the maximum discharge amount , that is , to tilt the movable swash plate 141 at a predetermined tilt angle . the first damper mechanism 161 biases the movable swash plate 141 so as to control the discharge amounts of the first pump 131 and the second pump 132 corresponding to the discharge amount of the first pump 131 , that is , to control the tilt angle of the movable swash plate 141 . the tilt angle of the movable swash plate 142 is limited by a second damper mechanism 162 and a third damper mechanism 163 . the second damper mechanism 162 biases the movable swash plate 142 so as to control the discharge amounts of the first pump 131 and the second pump 132 corresponding to the discharge amount of the second pump 132 , that is , to control the tilt angle of the movable swash plate 142 . the third damper mechanism 163 biases the movable swash plate 142 so as to control the discharge amounts of the first pump 131 and the second pump 132 corresponding to the discharge amount of the third pump 133 , that is , to control the tilt angle of the movable swash plate 142 . an electromagnetic proportional control valve 169 controls a pilot pressure from a pilot pump ( not shown ) to the rotation deviation damper mechanism 165 . a solenoid which is a switching operation part of the electromagnetic proportional control valve 169 is connected to the controller 150 . an explanation will be given on a configuration of the compressor 121 . the compressor 121 is included in the air conditioning system 120 . the air conditioning system 120 has an outdoor heat exchanger , an expansion valve and an indoor heat exchanger ( not shown ). the air conditioning system 120 circulates a coolant with the compressor 121 so as to condition air in the operation part 8 . the clutch 152 is interposed between the output shaft of the engine 110 and the input shaft of the compressor 121 , and the clutch 152 switches on ( connection ) and off ( disconnection ). the clutch 152 includes an electromagnetic clutch and is connected to the controller 150 . the accelerator lever 155 is a means for setting the target rotation speed mne of the engine 110 . the accelerator lever 155 is arranged in the operation part 8 . an operation amount ( rotation angle ) of the accelerator lever 155 is detected by an angle sensor which is an operation amount detection means , and the angle sensor is connected to the controller 150 . the controller 150 controls totally the engine 110 , the air conditioning system 120 and the hydraulic drive system 130 . the controller 150 is connected to the engine rotation speed sensor 151 , the clutch 152 , the accelerator lever 155 and the electromagnetic proportional control valve 169 . an explanation will be given on a flow of engine stall avoidance control s 100 referring to fig1 . steps s 120 to s 130 show steps of speed sensing control . in the engine 110 , for example , when the load of the hydraulic pump is increased , the actual rotation speed ne of the engine is reduced and the reduction of the actual rotation speed is suppressed to a predetermined amount by the electronic governor until the load reaches a first set value a1 discussed later . when the engine load a is increased further from the first set value a1 , until the load reaches a second set value a2 , the electromagnetic proportional control valve 169 is operated and the tilt of the movable swash plate 142 is changed so as to reduce the discharge amount of the hydraulic oil of the first pump 131 and the second pump 132 . furthermore , when the engine load excesses the second set value a2 , the engine 110 is stalled . therefore , in the engine stall avoidance control s 100 , when the engine load a excesses the second set value a2 , the clutch 152 has been turned off for a predetermined time so as to cut off power transmission to the compressor 121 , whereby the engine 110 is prevented from being stalled . in this embodiment , the engine load is calculated based on the difference between the target rotation speed mne and the actual rotation speed ne . however , the detection of the load is not limited to this embodiment , and the load may alternatively be found based on a difference between a target rack position and an actual rack position which change the fuel injection amount , a difference between a target angle and an actual angle of the movable swash plate , or the pressure of the hydraulic oil , for example . at a step s 110 , the controller 150 calculates a rotation speed deviation dne by deducting the actual rotation speed ne detected by the engine rotation speed sensor 151 from the target rotation speed mne set with the accelerator lever 155 , and calculates the engine load a based on the rotation speed deviation dne . at a step s 120 , in the controller 150 , when the rotation speed deviation dne is increased and the engine load a is larger than the first set value a1 , the control is shifted to a step s 130 . on the other hand , when the engine load a is not larger than the first set value a1 , the control is shifted to a step s 200 , and the rotation speed deviation dne is controlled toward 0 with governor control . at the step s 130 , the controller 150 changes the tilt of the movable swash plate 142 by controlling the pilot pressure with the electromagnetic proportional control valve 169 so as to reduce the discharge amount of the hydraulic oil of the first pump 131 and the second pump 132 , that is , to reduce a load torque of the first pump 131 and the second pump 132 . the steps s 120 to s 130 show the steps of the speed sensing control . at a step s 140 , the controller 150 judges whether the rotation speed deviation dne is increased and the engine load a is larger than the second set value a2 after the speed sensing control is performed or not . when the engine load a is larger than the second set value a2 , the control is shifted to a step s 150 . at the step s 150 , the controller 150 turns off the clutch 152 , and the control is shifted to a step s 160 . at this time , the connection of the engine 110 and the compressor 121 is cut off , whereby the engine load a is reduced . at the step s 160 , whether a set time t1 passes after the clutch 152 is turned off or not is judged . when the set time t1 passes , the control is shifted to a step s 170 and the clutch 152 is turned on . an explanation will be given on effect of the engine stall avoidance control s 100 . according to the engine stall avoidance control s 100 , the engine stall can be avoided . namely , when the rotation speed deviation dne is increased and the load a is increased after the speed sensing control is performed , the connection of the engine 110 and the compressor 121 is cut off , whereby the load of the engine 110 is reduced and engine output is reduced so as to avoid the engine stall . an explanation will be given on a left stepped pin 210 and a right stepped pin 220 referring to fig1 . fig1 ( a ) is a schematic side view partially in section of a pump unit 200 . fig1 ( b ) is a schematic plan view partially in section of the pump unit 200 . in fig1 , for make the explanation plain , the first pump 131 and the second pump 132 are not shown . the pump unit 200 is configured by integrating the first pump 131 , the second pump 132 and the third pump 133 in one casing 300 . the pump unit 200 has the casing 300 , the input shaft 201 , plungers of the first pump 131 and the second pump 132 ( not shown ), the third pump 133 , the left stepped pin 210 , the right stepped pin 220 , a spring mechanism 230 and a swash plate 240 . the swash plate 240 corresponds to the movable swash plate 141 and the movable swash plate 142 in fig1 . the spring mechanism 230 corresponds to the spring mechanism 147 in fig1 . the left stepped pin 210 corresponds to the first damper mechanism 161 and the second damper mechanism 162 in fig1 . the left stepped pin 210 has a first diameter part ( small diameter part ) 211 and a second diameter part ( large diameter part ) 212 . the first diameter part 211 is formed at one of ends of the left stepped pin 210 . the second diameter part 212 is formed at the other end of the left stepped pin 210 , and the other end contacts with the swash plate 240 . the second diameter part 212 has larger diameter than the first diameter part 211 . in the casing 300 , spaces in which the left stepped pin 210 is housed are formed . in a first space 311 , the first diameter part 211 of the left stepped pin 210 is housed . in a second space 312 , the second diameter part 212 of the left stepped pin 210 is housed . a first oil passage 411 is communicated with one of ends of the first diameter part 211 . the first oil passage 411 is communicated with a discharge pipe of the first pump 131 . a second oil passage 412 is communicated with one of ends of the second diameter part 212 . the second oil passage 412 is communicated with a discharge pipe of the second pump 132 . a ratio of a pressure receiving area of the first diameter part 211 and a pressure receiving area of the second diameter part 212 is proportional to a ratio of a discharge capacity of the first pump 131 and a discharge capacity of the second pump 132 . according to the configuration , the left stepped pin 210 is biased toward the swash plate 240 corresponding to the discharge amount of the first pump 131 or the discharge amount of the second pump 132 . namely , a tilt angle of the swash plate 240 is changed with the left stepped pin 210 . the right stepped pin 220 corresponds to the third damper mechanism 163 and the rotation deviation damper mechanism 165 in fig1 . the right stepped pin 220 has a third diameter part ( small diameter part ) 223 and a fourth diameter part ( large diameter part ) 224 . the third diameter part 223 is formed at one of ends of the right stepped pin 220 . the fourth diameter part 224 is formed at the other end of the right stepped pin 220 , and the other end contacts with the swash plate 240 . the fourth diameter part 224 has larger diameter than the third diameter part 223 . in the casing 300 , spaces in which the right stepped pin 220 is housed are formed . in a third space 323 , the third diameter part 223 of the right stepped pin 220 is housed . in a fourth space 324 , the fourth diameter part 224 of the right stepped pin 220 is housed . a third oil passage 423 is communicated with one of ends of the third diameter part 223 . the third oil passage 423 is communicated with a discharge pipe of the third pump 133 . a fourth oil passage 424 is communicated with one of ends of the fourth diameter part 224 . the fourth oil passage 424 is communicated with a pilot pipe of the electromagnetic proportional control valve 169 . according to the configuration , the right stepped pin 220 is biased toward the swash plate 240 corresponding to the discharge amount of the third pump 133 or the pilot pressure controlled with the electromagnetic proportional control valve 169 . namely , the tilt angle of the swash plate 240 is changed with the right stepped pin 220 . | 5 |
fig1 is a side view of the torch tip 1 of the present invention . torch tip 1 has a substantially tubular shape , and can be viewed as an elongated tube having three distinct sections a , b , c . section a is the rearward section of torch tip 1 which is adapted at its rearward end to be connected to a source of fuel as by internally threaded means 2 or other means , such as quick connects . section a includes a middle portion 3 of substantially rectangular cross - section which has openings 4 through which air is introduced into torch tip 1 . openings 4 are shown here as four in number and as having a generally circular shape , but this is for illustrative purposes only , and it is understood that other shapes and / or numbers of openings 4 would be within the scope of the invention . an axially disposed jet nozzle 5 is included within the middle portion 3 of section a . the fuel gas passes from the source of fuel into and through jet nozzle 5 . the fuel gas ejected by jet nozzle 5 mixes with air which is introduced into tube 1 by openings 4 . an axial passageway 6 is provided in the forward portion of the rearward section a for the passaage of fuel gas and air into section b of the torch tip 1 . connecting means 2 , middle portion 3 and jet nozzle 5 are preferably made of brass . axial passageway 6 is suitably provided by a stainless steel tube 7 which extends into and is joined to middle portion 3 . section b is the middle section of torch tip 1 and is of a generally frustoconical shape . it is preferably made of stainless steel . this section provides a venturi effect causing a large quantity of air to be sucked in by the cold fuel gas ejected by jet nozzle 5 and expanded and mixed with the fuel gas prior to burning . this creates a highly efficient flame with good characteristics . section c is the forward section of torch tip 1 . it has a generally cylindrical shape , and is preferably made of stainless steel . the internal diameter of section c is larger than the diameter of passageway 6 . its outlet 8 constitutes the flame end of the torch tip . as shown in the cutaway portion of section c , a baffle 9 is positioned within this section . fig2 and 4 further illustrate baffle 9 of the present invention . baffle 9 includes a substantially circular wire screen 10 . wire screen 10 preferably defines a curved surface , situated in section c so that the central portion of the curve is the portion of the screen closest to flame end 8 of tube 1 . wire screen 10 is further preferably made out of stainless steel woven in a plain dutch weave pattern . surrounding wire screen 10 is a solid metallic annular ring 11 , also preferably of stainless steel . wire screen 10 is fastened in a groove in annular ring 11 , or is made integral with annular ring 11 by any other suitable means . extending from annular ring 11 are a plurality of outwardly and radially extending symmetrically positioned ribs 12 , preferably of stainless steel . ribs 12 serve to connect the annular ring with the inside of wall 13 of torch tip 1 . ribs 12 are constrained inside torch wall 13 by friction and / or crimps 14 in the torch tip wall , or by other suitable permanent attachment method . spaces 15 are provided at the outside edge of annular ring 11 , between ribs 12 . the phenomena occurring in the operation of the invention are not fully understood . to the extent which these have been detected and analyzed , they are discussed below . baffle 9 serves to stall the fuel and air mixture , further enhancing combustion . in operation , the temperatures of the object heated with air / mapp mixture is approximately 2 , 100 ° f . and for an air / propane mixture , approximately 1750 ° f . ( maap is a trademark of airco , inc . for methyl acetylene - propadiene ). the torch tip of the present invention burns with a blue flame which indicates a more complete combustion . this is in distinction to the swirl type device of the u . s . pat . no . 4 , 013 , 395 which has a large green area indicating unburned fuel . the fuel tip of the present invention can operate at a pressure behind the jet nozzle 5 orifice in the range of 12 psi to 50 psi on mapp . the device of the u . s . pat . no . 4 , 013 , 395 is limited to pressures of between 25 psi and 40 psi on mapp . in operation , the solid portion of baffle 9 , i . e . ring 11 and ribs 12 , is the high velocity area ; when the gas is at high velocity , the primary flame holding occurs on the forward surface of the solid portion . wire screen 10 is a low velocity area ; when gas is at a low velocity , the primary flame holding occurs on the wire screen . burning takes place from immediately in front of the baffle and extends outside of the tip , but does not touch the inside of wall 13 of the tip . therefore the tip does not get hot even when the gas is at a low velocity . the particular design of baffle 9 in the present invention provides a number of advantages . a wire screen alone , with no solid exterior portion would only work at a low velocity air / fuel mixture to baffle the gas and slow it down enough for the gas to burn . a totally wire baffle creates problems with thermal stability . as the temperature changes , the screen becomes wavy and changes shape . additionally , such a screen would not remain in place within the tube . a solid device likewise would not be adequate because the solid baffle would hold the gas back , which would make igniting the torch more difficult . the solid baffle would also produce the eddies in the gases , which create the mixing necessary for combustion , only over a limited velocity range . moreover , the torch tip employing a solid baffle would be ignitable at only one specific pressure point . the spaces 15 let the gas and air mixture through the baffle at a higher velocity . when the gas is ignited , there is slow moving gas coming through the wire screen and faster moving gas through the spaces 15 on the outside of annular ring 11 . the gas inside the screen will ignite first , providing enough heat for the gas on the outside of the annular ring to be ignited . the elements of the torch tip are configured and arranged so that the flow of gases passing through spaces 15 provides a venturi effect , causing a pressure reduction on the face of wire screen 10 which extracts gas molecules through the screen . combustion is accordingly caused to occur above wire screen 10 . wire screen 10 reverses the majority of the gas which contacts the screen ; this effect is enhanced where the screen defines a curved surface with the central portion of the curve being that portion of the screen closest to flame end 8 of tube 1 . as a result , dwell time of the gases in the torch tip is increased , and mixing of the gases is enhanced . the type of wire mesh suitable for screen 10 is that which provides sufficient resistance to greatly slow or stall passage of the gases through the screen , but allows enough gas to be extracted through for ignition . one wire screen which meets these requirements is plain dutch weave of 50 warp × 250 shute , with 0 . 0055 &# 34 ; warp and 0 . 0045 &# 34 ; shute , and 60 nominal micron retention . the device of the present invention creates a flame which will stay linear and substantially unnarrowed in the operable pressure range . the higher velocity of the gas and air mixture moving through space 15 imparts , as it flows past the article to which the flame is applied , a &# 34 ; wrapping &# 34 ; effect to the cone -- that is , the flame tends to wrap around the article to which it is applied . this wrapping effect provides for a more even distribution of heat than is achieved where the flame must be applied to one side of the article at a time . the device of the wormser patent also provides for a wrapping effect , but not to the same extent as the device of the present invention . fig5 - 8 illustrate a torch tip embodiment 21 generally similar to that shown in fig1 - 4 . the forward section c &# 39 ; is substantially the same as forward portion c in fig1 . the middle section b &# 39 ; differs from middle section b in fig1 by having a generally arcuate shape . middle section b &# 39 ; includes a generally frustoconical portion 35 , the larger diameter end of which is joined to the rearward portion of section c &# 39 ;. rearward section a &# 39 ; is adapted to be connected to a source of combustible gas , as by externally threaded end portion 22 , a quick connect or other means . section a &# 39 ; includes a middle portion 23 which , as shown , has four openings 24 , suitably circular or generally circular , for the intake of air and an axially disposed jet nozzle 25 . however , other shapes and numbers of openings may be employed . an axial passageway 26 is provided in the forward portion of the rearward section a &# 39 ;. axial passageway 26 is suitably provided by a tube 27 which extends into and is joined to middle portion 23 . fig6 , and 8 illustrate baffle 29 . baffle 29 includes a substantially circular wire screen 30 . surrounding wire screen 30 is a solid metallic modified annular portion 31 , the annular shape being modified in the sense that the outer portion is generally in the shape of a regular polygon with symmetrically spaced outwardly projecting radial ribs 32 . ribs 32 serve to connect the modified annular portion 31 with the inside of wall 33 of torch tip 21 , suitably with the aid of crimps 34 in the torch tip wall . except for the differences as illustrated in the figures and discussed above , the construction and operation of the embodiment of fig5 - 8 is otherwise similar to those of fig1 - 4 and provides the same advantage . fig9 illustrates baffle 36 , comprising a single element of variable density sintered powdered stainless steel . baffle 36 includes gas permeable inner portion 37 . the term &# 34 ; gas permeable &# 34 ;, as discussed earlier herein , refers to the property of greatly slowing , or even virtually stalling , a gas flowing against it , and reversing the flow of the majority of such gas ; gas passes through , greatly slowed , by wending its way between the particles comprising inner portion 37 . substantially annular gas impermeable portion 38 surrounds inner portion 37 . gas impermeable ribs 39 of baffle 36 serve to connect baffle 36 with the inside wall of the torch tip . fig1 illustrates baffle 40 , comprising a single element of variable density alumina . corresponding to baffle 36 , baffle 40 is provided with gas permeable inner portion 41 , gas impermeable generally annular outer portion 42 , and gas impermeable ribs 43 . as with baffle 9 and 29 , baffles 36 and 40 are constrained inside the torch wall by friction and / or crimps , or by any other suitable permanent attachment method . like the phenomena occurring in the operation of the invention , also not fully understood is the relative importance of the different elements , or the relationship of their dimensions necessary for operability . however , dimensions for particular embodiments which are operative are listed in the table . table______________________________________model number lpt4 lpt5 lpt6______________________________________distance along central 0 . 528 &# 34 ;- 0 . 750 &# 34 ; 0 . 640 &# 34 ;- 1 . 575 &# 34 ; 0 . 640 &# 34 ;- 1 . 87axis of baffle andtorch tip tube betweenfront end of baffleand flame end of torchtip tubelength of baffle along 0 . 187 &# 34 ; 0 . 205 &# 34 ; 0 . 205 &# 34 ; central axis of baffleand torch tip tubedistance along central 0 . 020 &# 34 ; 0 . 020 &# 34 ; 0 . 020 &# 34 ; axis of baffle andtorch tip tube betweenfront end of baffleand central portion offront side of wirescreendistance along central . 040 &# 34 ; . 040 &# 34 ; . 040 &# 34 ; axis of baffle andtorch tip tube betweenfront end of baffleand central portion ofrear side of wirescreendiameter of wire 0 . 300 &# 34 ; 0 . 440 &# 34 ; 0 . 540 &# 34 ; screenno . of ribs on baffle 3 5 5degrees of radius 120 ° 72 ° 72 ° between centers ofimmediately adjacentribsgeometrical config - annular circular inner circularuration of annular ring edge , pentago - inner edge , or modified annular nal outer edge pentagonalring outer edgediameter of baffle to 0 . 250 &# 34 ; 0 . 390 &# 34 ; 0 . 500 &# 34 ; inner edge of annularring or modifiedannular ringdiameter of baffle to 0 . 325 &# 34 ; -- -- outer edge of annularring or modifiedannular ringdiameter of baffle to 0 . 437 &# 34 ; 0 . 688 &# 34 ; 0 . 875 &# 34 ; end of ribdiameter of torch tip 0 . 437 &# 34 ; 0 . 688 &# 34 ; 0 . 875 &# 34 ; tube at flame endlength of rib between 0 . 100 &# 34 ; 0 . 100 &# 34 ; 0 . 100 &# 34 ; edges of rib whichintersect annularring or modifiedannular ringheight of rib from 0 . 056 &# 34 ; 0 . 075 &# 34 ; 0 . 100 &# 34 ; outer edge of annularring or modifiedannular ring to edgeof rib farthest fromannular ring or modi - fied annular ringdistance between 0 . 397 &# 34 ; 0 . 235 &# 34 ; 0 . 312 &# 34 ; nearest edges ofadjacent ribs atpoints where the ribsintersect the outeredge of the annularring or modifiedannular ring______________________________________ although the invention has been specifically described with reference to particular means and embodiments , it is to be understood that the invention is not limited to the particulars disclosed but extends to all equivalents within the scope of the claims . | 5 |
the present invention relates to an object launcher , and specifically to a single - handed device for engaging the object with the launcher , and more specifically to forming and throwing a snowball using the same apparatus , and most specifically to single - handedly forming a snowball using an apparatus and thereafter using the apparatus to launch the snowball thereby formed . the following description is presented to enable one of ordinary skill in the art to make and use the invention and is provided in the context of a patent application and its requirements . various modifications to the preferred embodiment and the generic principles and features described herein will be readily apparent to those skilled in the art . thus , the present invention is not intended to be limited to the embodiment shown but is to be accorded the widest scope consistent with the principles and features described herein . fig1 is a perspective view of a preferred embodiment for an objectizing and launching system 100 in a launching mode . system 100 includes a shaft 105 , a scoop 110 , a former 115 coupled to scoop 110 and a biasing system 120 for inducing former 115 into an open position . alternately , former 115 may be coupled to shaft 105 or other structure to achieve the desired relationship between scoop 110 and former 115 . as used herein , the term objectizing includes an act or acts of gathering , collecting , selecting , forming , shaping , grabbing and / or creating an object from one or more objects or media . alternately , former may be coupled to shaft 105 shaft 105 is constructed sufficiently rigid and flexible for the intended application , but preferably is constructed of a solid molded plastic or extruded aluminum tube body having about eighteen to about thirty inches of length . shaft 105 has a proximal end and a distal end , and includes a handle 125 at the proximal end and scoop 110 coupled at the distal end . in some implementations and embodiments , shaft 105 has a variable length and / or a variable flexibility resulting from telescoping elements or from mutually cooperating elements that otherwise slide relative to each other . a variable length shaft is useful for adapting system 100 for use by users of different heights , among other advantages , while the variable flexibility shaft is useful for adapting system 100 to different conditions for objectizing and launching objects . generally , as the flexibility of shaft 105 increases , objects may be launched greater distances . however , as shaft 105 also supports the collecting of an object , as the flexibility of shaft decreases , objects are often easier to be collected . scoop 110 serves as a preferred objectifier , which in the preferred embodiment includes collecting and holding a bolus of a compressible medium . this compressible medium includes snow or other substance that is able to be formed and shaped into a ball that retains its shape after forming / shaping . scoop 110 may also select a single item from a collection of items and retain it within a cavity . the cavity of scoop 110 is preferably one - half of a sphere that holds the bolus after it is collected . scoop 110 may be inclined relative to a longitudinal axis of shaft 105 . inclination of scoop 110 is adapted to assist in objectizing and for launching objects from within the cavity . in some embodiments and implementations , scoop 110 is coupled to shaft 105 using a mounting system that permits different lengths of shaft 105 to be used in cooperation with scoop 110 . for example , a threaded end at the distal end of shaft 105 may be used to mount to complementary threaded portion in scoop 110 . additionally , the mounting system may provide for varying the inclination angle according to a user preference . former 115 is a mating element cooperating with scoop 110 for objectizing an object or medium . in the preferred embodiment , former 115 includes a spherical cavity matching the cavity in scoop 110 for use as a compactor / former / shaper of the bolus . former 115 includes two positions relative to scoop 110 , a closed position and an open position . in the closed position , former 115 compresses the bolus and presses it into scoop 110 to form a generally spherical ball of the compressible medium ( e . g ., a snowball ). in the open position after ball formation , the ball is retained within scoop 110 and former 115 pivots down and away from scoop 110 . in the open position , former 115 does not interfere with a launching of the ball from scoop 110 when shaft 105 is swung in an arc about handle 125 . former 115 is also positioned relative to scoop 110 and shaft 105 to permit former 115 to be operated from single - handed manipulation of handle 125 , such as , for example , tapping former 115 against the ground or other object or structure to move former 115 from the open position to the closed position . in the preferred embodiment when scoop 110 and former 115 define matching semi - spheres , the closed position juxtaposes the two structures together sufficiently to form the bolus into the desired shape . this juxtaposition need not be completely closed , or even in some cases mostly closed . the degree of closure depends upon the nature and condition of the compressible medium and the user &# 39 ; s desire to collect , shape and form balls of varying quality . typically , the “ best ” balls are formed when scoop 110 and former 115 are completely closed , but these “ best ” balls may be perceived to require extra time to form by completely closing the elements . balls of lesser quality ( produced from less proximate juxtapositions ) may be produced faster , thus more balls per unit of time may be launched . in other embodiments , former 115 is a trapper that simply retains an object within the cavity of scoop 110 while the object is collected . scoop 110 and former 115 are preferably molded plastic semi - spheres , though other shapes and materials may be used . in some conditions , scoop 110 may require extra stiffness and / or use of a cutting edge along all or a portion of a periphery of the cavity to efficiently collect sufficient quantities of the compressible medium . biasing system 120 of the preferred embodiment includes an elastomeric band coupled between former 115 and shaft 105 to bias former 115 into the open position . the elastomeric band is replaceable and preferably provides a sufficient biasing force to maintain former 115 in an open or semi - open position so as to not interfere with a launch of an object from within a cavity of scoop 110 . in some configurations , former 115 will tend to the closed position as shaft 105 is swung through the arc , and that tendency is increased as shaft 105 becomes longer or the speed of the swing or of scoop 110 increases . other biasing systems may be used , to pull , push or otherwise separate former 115 from scoop 110 and induce former 115 into the open position . fig2 is a perspective view of objectizing and launching system 100 shown in fig1 in a forming mode . system 100 enters the forming mode by manipulation of handle 125 , and such manipulation may be performed using a single hand . this is in contrast to prior art systems that require a user to use two hands in operating the device . to enter the forming mode , system 100 juxtaposes former 115 to scoop 110 . in the preferred embodiment , this juxtaposition is achieved by rotating former 115 relative to scoop 110 , though other implementations may use a different configuration . also , former 115 is shown pivotally coupled to shaft 105 so that the former moves “ up ” and “ down ” when shaft 105 is vertical . former 115 may be configured to move ( e . g ., pivot ) “ side ” to “ side ” or some other relative orientation when shaft 105 is vertical . in operation , a user operates system 100 through single - handed manipulation of handle 125 . the user collects the bolus of the compressible medium ( e . g ., snow ) into scoop 110 . in some instances , the collection is achieved by scooping up a sufficient quantity to overflow the cavity of scoop 110 , and in other instances , scoop 110 is plunged into a large quantity of the medium , or former 115 is used as a “ plow ” to produce a suitable pile of medium that may be collected by scoop 110 . the user then manipulates handle 125 to cause former 115 to be juxtaposed sufficiently to scoop 110 to form the desired shape and consistency ball . the user achieves this by urging former 115 against the ground , building , other structure or other object to move it towards the closed position . in the preferred embodiment , it is accomplished by “ tapping ” former 115 against the ground to compress / pack and form the desired ball . releasing the closing force permits biasing system 120 to move former 115 to the open position . this retains the ball within the cavity of scoop 110 . the user may then , when desired , swing shaft 105 about an arc to launch the ball from the cavity of scoop 110 towards the desired target . system 100 is ready to collect and form other balls in quick succession . fig3 is a perspective view of a first alternate preferred embodiment for an objectizing and launching system 300 in a launching mode . system 300 includes a shaft 305 , a scoop 310 at a distal end of shaft 305 , a former 315 coupled to scoop 310 and a handle 320 integrated into a proximal end of shaft 305 . system 300 is similar to system 100 , modified as described below . shaft 305 is curved in a backward arch from handle 320 to scoop 310 . former 315 is pivotally coupled to shaft 305 or scoop 310 using a spring - loaded hinge that serves as a biasing system for system 300 . fig4 is a perspective view of objectizing and launching system 300 shown in fig3 in a forming mode . fig5 is a perspective view of a second alternate preferred embodiment for an objectizing and launching system 500 in a launching mode . system 500 is configured similarly to system 100 shown in fig1 and fig2 with the addition of a latching mechanism 505 and a release 510 . latching mechanism 505 is a hinged system that releasably locks when former 115 is sufficiently “ closed ” relative to scoop 110 . latching mechanism 505 is responsive to release 510 to stop inhibiting the return of former 115 to the open position . release 510 is preferably a cable , chain , wire or other connector coupled to ring mounted near handle 125 . in operation , when former 115 is moved sufficiently close to activate latching mechanism 505 . thereafter , former 115 does not open to permit launching of an object in scoop 110 until release 510 is actuated . in this configuration , the user would actuate release 510 immediately prior to launch . in this configuration , system 500 may be used to launch virtually any object that fits within scoop 110 and former 115 . fig6 is a perspective view of the objectizing and launching system shown in fig5 in a retaining mode . fig7 is a side perspective view of a third alternate preferred embodiment for an objectizing and launching system 700 in a launching mode . system 700 is integrated into another sporting implement , in this instance , a ski pole . system 700 includes a shaft 705 , a scoop 710 , a former 715 , a snow basket 720 and a handle 725 components as shown in fig1 through fig6 as described above . fig8 is a front perspective view of the objectizing and launching system shown in fig7 . scoop 710 is shifted relative to shaft 705 to enable scooping without interfering with the ski pole function . shaft 705 need not be coupled to a “ rim ” of scoop 710 , but could be attached nearly tangential to scoop 710 . similarly , former 715 may be desirably “ side - mounted ” to enable former 715 to be tapped closed without interfering with the ski pole functions . fig8 illustrates that scoop 710 may be integrated into shaft 705 and serve as a structural element . further , scoop 710 may be provided with a latching mechanism and release system as described above . in some implementations , scoop 710 is incorporated into the snow basket 720 . the above - described arrangements of apparatus and methods are merely illustrative of applications of the principles of this invention and many other embodiments and modifications may be made without departing from the spirit and scope of the invention as defined in the claims . these and other novel aspects of the present invention will be apparent to those of ordinary skill in the art upon review of the drawings and the remaining portions of the specification . | 5 |
referring now to fig1 to 7 , a hot medicinal compress apparatus which using electric power as a heat source is provided consistent with a first embodiment of the present invention . in this embodiment , the apparatus comprises a heater 2 and a medicine bag 3 , wherein the medicine bag 3 is constructed by a soft and tenacious liquid absorption material 7 which wraps up medicine powder 9 or a medicated cloth , in combination with a strong water absorption material 8 . the liquid absorption soft material 7 may be selected from cloth materials , the water absorption material 8 may be selected from cotton or cotton yarn ; and the medicine powder is putted over the cotton or cotton yarn , or as an alternative , a medicated cloth soaked with a medicinal liquid is putted over the cotton or cotton yarn , followed by wrapping them up in the liquid absorption material 7 ( e . g . cotton cloth ), with the cotton or cotton yarn as the lower face of the medicine bag . when wrapping the metal tube 17 with the medicine bag 3 , the metal tube is arranged to come contact with the lower face of the medicine bag in order to prevent the medicine power from being burnt caused by exposure of the medicine power to the heat source for long time , thereby reducing the potent of the medicine . in a more specific scheme , the cartridge comprises : the metal tube 17 ; a first layer of the liquid absorption soft material / cotton cloth 7 which wrapping up the strong water absorption material / cotton 9 , said first layer being wrapped around the outer wall surface of the metal tube 17 ; and a second layer of the liquid absorption soft material / cotton cloth 7 which wrapping up the medicine powder 8 in a manner that the medicine power leak would not take place , said second layer being wrapped around the outer surface of the first layer so that the strong water absorption material / cotton 9 is arranged between the medicine powder 8 and the metal tube 17 . an example of such a cartridge is made by a process comprising the steps of : putting the strong water absorption material / the cotton over the middle area of the front half section of a square cotton cloth and putting the medicine powder over the middle area of the rear half section of the cotton cloth ; folding up the left and right sides of the cotton cloth in light of the length of the metal tube so as to form a cloth strip in which the cotton and the medicine powder are wrapped , the width of said cloth strip being preferably equal to the length of the metal tube ; and wrapping the surface of the metal tube with the cloth strip from its front section to its rear section . the cotton layer is arranged between the medicine powder and the metal tube with the purpose of preventing the medicine power from being burnt caused by direct contact of the medicine power with the metal tube for long time , thereby reducing the potent of the medicine . the heater 2 comprises a handle 1 , a heating element 5 , a metal tube 17 , a heat conducting tube 4 having a plurality of axial protrusion ribs on the tube wall thereof , front and rear round step members 10 and 10 ′, a screw nut 12 , a stainless steel washer 11 , front and rear baffle rings 18 and 18 ′. the heating element 5 is an electrothermal tube and is mounted in the heat conducting tube 4 . the plurality of protrusion ribs are provided and evenly spaced along the circumference on the outer wall of the heat conducting tube 4 and the heat conducting tube is connected with the handle 1 via the rear round step member 10 ′ having a through hole along the central axis . the rear round step member 10 ′ is a cylindrical body having at least one round step at each of its two ends , one end of which has three steps 10 ′ a , 10 ′ b , 10 ′ c , and the outer most end is the round step 10 ′ c which has the minimum profile and is fixed in the mounting hole at the front end of the handle 1 . the step 10 ′ b adjacent to the step 10 ′ c is a square step on which a rear baffle ring 18 ′ having a foot rest is mounted ( see fig7 ). the rear baffle ring 18 ′ is an integrated body formed by a circular ring portion and a trapezoid portion wherein the trapezoid portion is the foot rest having a flat end 18 ′ a at its lower end , by which the foot rest can be placed firmly on the platform to support the heater . the step 10 ′ a has the same size and shape as the step 10 ′ b , on which a stainless steel washer 11 is mounted . the washer 11 has an outer diameter slightly larger than the maximum diameter portion 10 ′ d of the rear round step member 10 ′, serving as a position limiter to the metal tube 17 which is plugged on the maximum diameter portion of the step member to allow to leave a room between the metal tube 17 and the rear baffle ring 18 ′ in order to avoid generation of the friction when the metal tube 17 rotates . another end of the rear round step member ( i . e . the internal end ) has only one round step which is connected fixedly with the heat conducting tube 4 . the rear round step member 10 ′ has a through hole in communication with the through hole of the handle and with the inner cavity of the heat conducting tube 4 , in such a manner that the connection wire of the heating element 5 can pass through the central through holes in communication with each other . likewise , another end of the heat conducting tube ( i . e . the external end ) is also fixedly connected to the internal end step of the front round step member 10 which is symmetrically shaped with the rear step member 10 ′. the metal tube 17 has a length adapted for the distance between the two ends of the heat conducting tube 4 plus the combined length of the maximum diameter portions of the front and rear round step members , and it is respectfully plugged on the maximum diameter portions 10 d , 10 ′ d of the front and rear round step members . their dimensions are devised to be spatially matched with each other to allow the rotation of the metal tube . the front round step member 10 acts also as a stopper for the external end ( cover ) of the metal tube . similar to the rear round step member 10 ′, another end of the front round step member 10 ( i . e . the external end ) has three steps 10 a , 10 b , 10 c from in to out , these steps 10 a , 10 b , 10 c is respectively provided with the stainless steel washer 11 , the front baffle ring 18 having a foot rest and a screw thread connection ( i . e . the screw nut 12 ) which is used for fastening the baffle ring by connection with the screws of the smallest step . in this way , the front baffle ring 18 , the neighboring stainless steel washer 11 and the metal tube 17 may be easily removed . the front and rear baffle rings , each of which has a foot rest , allow the hot medicinal compress apparatus of the invention to be placed on a table . the screw nut has an air ventilation hole 16 in communication with the through hole of the front round step member for solving the problem of expanding with heat and contracting with cold in the heat conducting tube . the cartridge is made by wrapping the outer surface of the metal tube 17 of the heater with the medicine bag . the invention is preferably used in combination with a bottled medicine liquid which is a effective cure for the conditions or symptoms , in order to promote the potent of the medicine powder . preferably , the handle 1 is made of plastic material , on which there is a power supply switch 13 . the electric wire of the heating element 5 is connected with the switch 13 via the through holes of the rear round step member 10 ′ and the handle 1 . preferably , the front and rear step members 10 , 10 ′ are made of plastic materials with resistance to high temperature , for the purpose of enhancing electricity insulation and heat insulation as well as supporting the cartridge to allow the free rotation of the cartridge on the heat conducting tube . the demountable washer , baffle ring and screw nut are provided to allow the cartridge to rotate on the support of the round step members so as not to come out . due to the rolling of the medicinal liquid during the operation , there is a possibility that the medicinal liquid may overflow and permeates into the heater thereby to form a short circuit . in order to avoid this , the sealing ring 20 is arranged between the baffle ring and the stainless steel washer to prevent the medicinal liquid from permeating into the handle though the gaping . the present invention is advantageously used in combination with a bottled medicine liquid to facilitate the potent of the medicine . in fig8 - 9 , a hot medicinal compress apparatus is provided consistent with a second embodiment of the present invention . this embodiment provides the apparatus significantly differing in that combustion gas energy is used as a heat source . in this embodiment , the heating element is a combustion gas type heating element 6 ; a combustion gas storage container is arranged in the through hole of the handle , and a rear cover 19 is also provided on the handle ; the combustion gas heating element 6 is mounted in the heat conducting tube 4 , the fittings of the heating element 6 are connected with the gas storage container of the handle and the combustion gas switch and electronic igniter by passing through the though hole of the rear round step member . after the combustion gas switch and electronic igniter 14 is switched on , the combustion gas burns the heat conducting tube to heat the cartridge 3 . the air ventilation hole 16 in the center of the screw nut is provided to keep communication with the through hole of the front round step member for supplementing with air the heating element in the heat conducting tube 4 during the combustion . it is understood that many other embodiments of the present invention are also possible , and many corresponding modifications as well as variations can be made by those skills in the art as according to the disclosure of the present invention and without departing from the spirits and essentials thereof , while such modifications and variations fall into the scope of the claims of the present invention . | 0 |
shown in fig1 is a switched capacitor bandgap reference circuit 10 constructed in accordance with the preferred embodiment of this invention . the bandgap reference circuit 10 is comprised generally of first and second bipolar transistors 12 and 14 , respectively , a clock circuit 16 , a first switched capacitance circuit 18 , a second switched capacitance circuit 20 , and an amplifier circuit 22 . each of the first and second bipolar transistors 12 and 14 has the collector thereof connected to a positive supply v dd , the base thereof connected to a common reference voltage , say analog ground v ag , and the emitter thereof connected to a negative supply v ss via respective current sources 24 and 26 . in the preferred form , the current sources 24 and 26 are constructed to sink a predetermined ratio of currents , and transistor 12 is fabricated with a larger emitter area than the transistor 14 . since the transistors 12 and 14 are biased at different current densities they will thus develop different base - to - emitter voltages , v be . because the transistors 12 and 14 are connected as emitter followers , the preferred embodiment may be fabricated using the substrate npn in a standard cmos process . in the first switched capacitance circuit 18 , a capacitor 28 has an input connected via switches 30 and 32 to the common reference voltage v ag and the emitter of transistor 14 , respectively . in the second switched capacitance circuit 20 , a capacitor 34 has an input connected via switches 36 and 38 to the emitter of transistors 12 and 14 , respectively . capacitors 28 and 34 have the outputs thereof connected to a node 40 . in the preferred embodiment , switches 30 , 32 , 36 , and 38 are cmos transmission gates which are clocked in a conventional manner by the clock circuit 16 . switches 30 and 36 are constructed to be conductive when a clock signal a applied to the control inputs thereof is at a high state , and non - conductive when the clock signal a is at a low state . in contrast , switches 32 and 38 are preferably constructed to be conductive when a clock signal b applied to the control inputs thereof is at a high state and non - conductive when the clock signal b is at a low state . in this configuration , switches 30 and 32 will cooperate to charge capacitor 28 alternately to the base voltage of transistor 14 and the emitter voltage of transistor 14 , thus providing a charge related to v be of transistor 14 . simultaneously , switches 36 and 38 cooperate to charge capacitor 34 alternately to the emitter voltage of transistor 12 and the emitter voltage of transistor 14 , thus providing a charge related to the difference between the base to emitter voltages , i . e ., the δv be , of the transistors 12 and 14 . as will be clear to those skilled in the art , the voltage , v be , will exhibit a negative temperature coefficient ( ntc ). on the other hand , it is well known that the voltage δv be exhibits a positive temperature coefficient ( ptc ). thus , it will be clear that the weighted sum of these voltages , v be + kδv be , where k = c 34 / c 28 may be made substantially temperature independent by appropriate selection of the ratio of capacitors 28 and 34 . in the amplifier circuit 22 , an operational amplifier 42 has its negative input coupled to node 40 and its positive input coupled to the reference voltage v ag . a feedback capacitor 44 is coupled between the output of operational amplifier 42 at node 46 and the negative input of the operational amplifier 42 at node 40 . in the preferred form , a switch 48 is coupled across feedback capacitor 44 with the control input thereof coupled to clock signal c provided by clock circuit 16 . by periodically closing switch 48 , the operational amplifier 42 is placed in unity gain , and any charge on capacitor 44 is removed . as shown in fig2 the clock circuit 16 initially provides the clock signal a in a high state to close switches 30 and 36 , and clock signal b in a low state to open switches 32 and 38 . simultaneously , the clock circuit 16 provides the clock signal c in a high state to close the switch 48 . during this precharge period , feedback capacitor 44 is discharged , and , ignoring any amplifier offset , capacitors 28 and 34 are charged to the reference voltage , v ag , and the v be of the transistor 12 , respectively . a short time before the end of the precharge period , the clock circuit 16 opens switch 48 by providing the clock signal c in a low state . shortly thereafter , but still before the end of the precharge period , the clock 16 opens switches 30 and 36 by providing the clock signal a in the low state . at the end of the precharge period and the start of a valid output reference period , the clock circuit 16 closes switches 32 and 38 by providing the clock signal b in the high state . at this time , the voltage on the terminals of capacitor 28 changes by - v be of transistor 14 and the voltage on the terminals of capacitor 34 changes by the difference between the base to emitter voltages of the transistors 12 and 14 , ( v be12 - ve be14 ). this switching event causes an amount of charge q =- v be14 c 28 +( v be12 - v be14 ) c 34 to be transferred to capacitor 44 resulting in an output voltage of v ref =- 1 / c 44 [- v be14 c 28 +( v be12 - v be14 ) c 34 ] on node 46 . in the preferred form , this positive bandgap reference voltage , + v ref , is made substantially temperature independent by making the ratio of capacitors 28 and 34 equal to the ratio of the temperature coefficients of δv be and v be . if desired , a negative bandgap reference voltage , - v ref , may be obtained by inverting clock signal c so that the precharge and valid output reference periods are reversed . in general , the accuracy of the bandgap circuit 10 will be adversely affected by the offset voltage of the operational amplifier 42 . fig3 illustrates in schematic form , a modified form of amplifier circuit 22 &# 39 ; which can be substituted for the amplifier circuit 22 of fig1 to substantially eliminate the offset voltage error . amplifier circuit 22 &# 39 ; is comprised of the operational amplifier 42 which has its positive input coupled to the reference voltage v ag . a switch 50 couples the negative input of the operational amplifier 42 to the output terminal at node 46 . switch 48 is coupled in parallel to feedback capacitor 44 and periodically discharges the feedback capacitor . however , one terminal of the feedback capacitor 44 is now connected via a switch 52 to the output of the operational amplifier 42 at node 46 . capacitor 44 is also coupled to an input signal , v in , at node 40 . in addition , an offset storage capacitor 54 is coupled between node 40 and the negative input terminal of operational amplifier 42 , and a switch 56 is connected between node 40 and the reference voltage v ag . in this embodiment , the clock circuit 16 &# 39 ; generates the additional clock signals d and e , as shown in fig4 for controlling the switches 56 and 50 , respectively , with the inverse of clock signal d controlling switch 52 . in this configuration , the bandgap reference circuit 10 has three distinct periods of operation . during the precharge period , the clock circuit 16 &# 39 ; provides clock signals c , d , and e in the high state to close switches 48 , 56 and 50 and open switch 52 . during this period , capacitor 44 is discharged by switch 48 . the operational amplifier 42 is placed in unity gain by switch 50 , and the offset storage capacitor 54 is charged to the offset voltage , v os , of the operational amplifier 42 . near the end of the precharge period , the clock circuit 16 &# 39 ; provides clock signal e in the low state to open switch 50 , leaving capacitor 54 charged to the offset voltage of the operational amplifier 42 . a short time thereafter , the clock circuit 16 &# 39 ; provides clock signal d in the low state to open switch 56 and close switch 52 . since this switching event tends to disturb the input node 40 , a short settling time is preferably provided before clock circuit 16 &# 39 ; provides clock signal c in the low state to open switch 48 . thereafter , the charge stored on feedback capacitor 44 will be changed only by a quantity of charge coupled from the switched capacitor sections 18 and 20 . during this third period of circuit operation , labeled the valid output reference period , the reference voltage developed on the node 46 will be substantially free of any offset voltage error . if the offset capacitor 54 is periodically charged to the offset voltage , v os , the operational amplifier 42 is effectively autozeroed , with node 40 being the zero - off - set input node . while the invention has been described in the context of a preferred embodiment , it will be apparent to those skilled in the art that the present invention may be modified in numerous ways and may assume many embodiments other than that specifically set out and described above . accordingly , it is intended by the appended claims to cover all modifications of the invention which fall within the true spirit and scope of the invention . | 6 |
compounds of the present invention may be represented by the formula ## str3 ## wherein r is an aliphatic hydrocarbyl group of 1 to 12 carbon atoms substituted with 0 to 4 halogen atoms of atomic number 17 to 35 ( chlorine or bromine ), an alicyclic hydrocarbyl group of 3 to 8 carbon atoms substituted with 0 to 4 halogen atoms of atomic number 17 to 35 , an aryl group of 6 to 12 carbon atoms substituted with 0 to 5 halogen atoms of atomic number 9 to 35 ( fluorine , chlorine or bromine ), nitro , alkyl of 1 to 4 carbon atoms , alkoxy of 1 to 4 carbon atoms , alkylthio of 1 to 4 carbon atoms , or 0 to 1 alkylsulfoxy of 1 to 4 carbon atoms , alkylsulfonyl of 1 to 4 carbon atoms , trifluoromethyl , phenoxy , phenylthio , phenylsulfoxy , phenylsulfonyl , the phenoxy , phenylthio , phenylsulfoxy or phenylsulfonyl being substituted on the aromatic nucleus with 0 to 5 halogens of atomic number 9 to 35 or alkyl of 1 to 4 carbon atoms ; or a heterocyclic group of 5 to 6 atoms containing 1 to 2 heteroatoms of oxygen , sulfur or nitrogen and being attached to the urea nitrogen through a carbon atom ; r 1 is hydrogen or alkyl of 1 to 4 carbon atoms , r 2 is alkyl of 1 to 4 carbon atoms or alkoxy of 1 to 4 carbon atoms and r 3 is ## str4 ## wherein a is 0 to 1 and r 4 is hydrogen or cw &# 39 ; 3 , w &# 39 ; representing hydrogen or halogen of atomic number 9 to 35 , z is halogen of atomic number 9 to 35 , and x is ( 1 ) -- u &# 39 ; r 5 wherein u &# 39 ; is o or s , r 5 is hydrogen , alkyl of 1 to 4 carbon atoms substituted with 0 to 4 halogen atoms of atomic number 9 to 35 , phenyl substituted with 0 to 4 halogen atoms of atomic number 9 to 35 , nitro , alkyl of 1 to 4 carbon atoms , or alkoxy of 1 to 4 carbon atoms , with the proviso that when r 5 is hydrogen , u &# 39 ; is s ; ( 2 ) -- p ( o ) ( or 6 ) 2 , wherein r 6 is alkyl of 1 to 4 carbon atoms ; ## str5 ## wherein r 7 is hydrogen or alkyl of 1 to 4 carbon atoms substituted with 0 to 4 halogen atoms of atomic number 9 to 35 , or an amino group optionally substituted with 1 to 2 alkyl groups individually of 1 to 4 carbon atoms or 1 aryl group , and u &# 39 ; is as defined above ; ( 4 ) -- n ═ c ═ u &# 39 ;, wherein u &# 39 ; is as defined above ; ## str6 ## wherein u &# 39 ; and r 6 are as defined above ; ## str7 ## wherein r 8 is alkyl of 1 to 4 carbon atoms substituted with 0 to 4 halogen atoms of atomic number 9 to 35 and u &# 39 ; is as defined above ; ## str8 ## wherein r 6 is as defined above ; ## str9 ## wherein u &# 39 ; and r 6 are as defined above ; ( 9 ) fluorine , chlorine , bromine , iodine ; or preferably r is alkyl of 1 to 12 carbon atoms , optionally substituted with halogen atoms , cycloalkyl of 3 to 8 carbon atoms , preferably 5 to 6 carbon atoms optionally substituted with halogen atoms or phenyl optionally substituted with halogen , nitro , alkyl , alkoxy , alkylthio , alkylsulfoxy , alkylsulfonyl , trifluoromethyl , phenoxy , phenylthio , phenylsulfoxy , phenylsulfonyl , the phenoxy , phenylthio , phenylsulfoxy , or phenylsulfonyl being optionally substituted on the aromatic nucleus with halogen or alkyl . the substituents , alkylsulfoxy , alkylsulfonyl , phenoxy , phenylthio , phenylsulfoxy or phenylsulfonyl optionally substituted on the aromatic nucleus , as the case may be , are preferably attached to the phenyl group in the p - position . the trifluoromethyl group is preferably attached to the phenyl group in the o - position . it is particularly preferred that the total number of substituents on the aryl group ( or phenyl group ) not exceed 2 and that when one of the substituents is alkylsulfoxy , alkylsulfonyl , trifluoromethyl , phenoxy , phenylthio , phenylsulfoxy or phenylsulfonyl that the other substituent , if any , be halogen , nitro or alkyl . the preferred compounds of the present invention may thus be represented by the formula ## str10 ## wherein r 1 , r 2 and r 3 are as described above and y is halogen of atomic number 9 to 35 , nitro , alkyl of 1 to 4 carbon atoms , alkoxy of 1 to 4 carbon atoms , alkylthio of 1 to 4 carbon atoms , alkylsulfoxy of 1 to 4 carbon atoms , alkylsulfonyl of 1 to 4 carbon atoms , trifluoromethyl , phenoxy , phenylthio , phenylsulfoxy , phenylsulfonyl , the phenoxy , phenylthio , phenylsulfoxy or phenylsulfonyl being substituted on the aromatic nucleus with 0 to 5 halogen atoms of atomic number 9 to 35 or alkyl of 1 to 4 carbon atoms and n is 0 to 5 when y is halogen , nitro , alkyl , alkoxy or alkylthio , and 0 to 1 when y is alkylsulfoxy , alkylsulfonyl , trifluoromethyl , phenoxy , phenylthio , phenylsulfoxy or phenylsulfonyl . preferably y in the above formula ( ii ) is halogen of atomic number 9 to 35 ( fluorine , chlorine or bromine ), more preferably fluorine or chlorine , alkyl of 1 to 2 carbon atoms , alkoxy of 1 to 2 carbon atoms or trifluoromethyl , and n is preferably 0 or an integer from 1 to 2 . in the above formula , r 1 is preferably hydrogen and r 2 is preferably alkyl of 1 to 4 carbon atoms , more preferably methyl . preferably r 3 in the above formula is ## str11 ## wherein a is 0 or 1 and r 4 , x and z are as defined above . more preferably r 4 is hydrogen , trichloromethyl , trifluoromethyl or methyl and z is fluorine , chlorine or bromine . still more preferably , a is 0 and z is fluorine , chlorine or bromine . thus the particularly preferred compounds of the present invention may be represented by the formula ## str12 ## wherein r 1 , r 2 , y , n , x and z are as defined above . in particular , n will be from 1 to 2 and y will be fluorine , chlorine or bromine , particularly fluorine in the o - position , chlorine in the o -, m - or p - position and the bromine in the p - position . preferably r 5 is hydrogen , methyl , ethyl or phenyl , r 6 is methyl or ethyl , r 7 is hydrogen , methyl or ethyl or an amino group substituted with at least one alkyl group of 1 to 2 carbon atoms ( methyl or ethyl ) and r 8 is methyl or ethyl . more particularly , it is preferred that when x is either ## str13 ## that both u &# 39 ; s in the radical represent the same atom , that is , either oxygen or sulfur . the most preferred compounds of formula ( iii ) are those wherein x is halogen , especially fluorine , chlorine , or alkylthio , especially methylthio . compounds with x equal to fluorine are preferred in part because of their stability . representative groups which r 1 may represent include : hydrogen , methyl , ethyl , n - propyl , isopropyl , etc . the compounds of the present invention wherein x is oh and r 3 is ## str14 ## are prepared by reacting a urea with an aldehyde according to the following equation : ## str15 ## wherein r , r 1 , r 2 , z , r 4 and a are as defined above . the urea reactants are known compounds of the prior art . the aldehyde may be compounds such as chloral ( trichloroacetaldehyde ), pentachloropropinoylaldehyde , dichloroacetaldehyde , dichlorobromoacetaldehyde , etc . the reaction ( iv ) may be accomplished in the presence of a solvent or neat . generally , stoichiometric amounts of the urea and aldehyde will be used . a small amount of acid , preferably sulfuric acid or perchloric acid , may be used . the reaction temperature will be from 20 ° to 100 ° c . generally the reaction proceeds very rapidly and will be complete in a matter of a few minutes . reaction times of from 30 seconds to 10 hours are considered sufficient . the alpha - hydroxy compound is converted to the alphachloro compound ( i . e ., wherein x is chlorine ) by reacting the product of reaction ( iv ) either in purified form or in the reaction mixture of reaction ( iv ) with thionyl chloride according to the following equation : ## str16 ## wherein r , r 1 , r 2 , z , r 4 and a are as defined above . the reaction ( v ) can be accomplished by using from a molar amount of thionyl chloride to an excess of as much as 20 mols based on the urea . the reaction temperature will be from 20 ° to 100 ° c . and reaction time will be from 1 to 20 hours . if desired , reactions ( iv ) and ( v ) may be combined to prepare the product of reaction ( v ) by simply mixing the urea reactant of reaction ( iv ), the aldehyde reactant of reaction ( iv ) and the thionyl chloride of reaction ( v ). the product of reaction ( v ) can be recovered by slurrying in a solvent such as diethyl ether or methylene chloride , collecting the product on a filter , then properly purifying by recrystallizing from a 1 : 1 mixture of 1 , 2 - dimethoxyethane and methylene chloride or from a 1 : 1 acetone and methylene chloride mixture . in order to obtain the compounds wherein x is fluorine , bromine or iodine , the product of reaction ( v ) can be reacted with ammonium fluoride , ammonium bromide or ammonium iodide as shown in reaction ( vi ) below to obtain the final product : ## str17 ## wherein r , r 1 , r 2 , r 4 , z and a are as defined above . the reaction ( vi ) may also be conducted with an alkali metal fluoride , bromide or iodide , e . g ., potassium fluoride . the above reaction ( vi ) can be accomplished readily be mixing the reactants preferably in a solvent such as 1 , 2 - dimethoxyethane in an amount of from 2 to 50 % for a time from 1 to 20 hours at a temperature from 20 ° to 100 ° c . the solvent is then removed and the product slurried in ether and collected . generally the reactant in brackets will be in molar excess , in an amount from 5 to 100 % of the urea reactant of reaction ( vi ). the other products of the present invention can be prepared by reacting the alpha - chloro compound of reaction ( v ) with a variety of compounds , as shown in reaction ( vii ) below : ## str18 ## wherein r , r 1 , r 2 , r 4 , r 5 , r 6 , r 7 , r 8 , u &# 39 ;, z and a are as defined above . the above reaction ( vii ) can be accomplished readily by mixing the reactants preferably in a solvent such as 1 , 2 - dimethoxyethane in an amount from 2 to 50 % for a time from about 0 . 25 to 20 hours at a temperature from about 20 ° to 100 ° c . the solvent is then removed and the product slurried in ether and collected . generally the reactant in brackets will be in excess , in an amount of 5 to 100 % of the urea reactant of reaction ( vii ). in order to prepare the compounds wherein r 3 is ## str19 ## the product of reaction ( vii ) above is dehydrohalogenated at very mild basic conditions . the product of reaction ( vii ) is heated in a very mild base at a temperature from 0 ° to 30 ° c . for a period of time from 15 minutes to 2 hours to accomplish dehydrohalogenation . it is essential that the basic conditions be very mild ; otherwise decomposition of the product of reaction ( vii ) will occur . the present invention will be more fully understood by reference to the following examples . 1 - methyl - 3 - phenyl urea ( 7 . 5 g , 0 . 05 mol ) was reacted with 7 . 5 g . ( 0 . 05 mol ) of chloral without solvent . the mixture was shaken for a short period of time . after , 3 drops of perchloric acid were added and the mixture heated gently for a few minutes to give a homogenous viscous oil . upon cooling , a glass formed . the chemical analysis showed : % cl , calc . 35 . 8 , found 35 . 8 ; % n , calc . 9 . 4 , found 8 . 0 . n - methyl - n &# 39 ;- o - fluorophenyl urea ( 16 . 8 g , 0 . 1 mol ) was combined with 22 . 5 g ( 0 . 15 l mol ) chloral and 18 . 0 g ( 0 . 15 mol ) thionyl chloride . after several minutes , an exothermicity was noted and the reaction mixture became a homogenous yellow oil . after 5 minutes more , a precipitate began to form . after 11 / 2 hours , a 3 : 1 mixture of diethyl ether : petroleum ether was added and the product was collected on a filter and dried . the solid , which weighed 25 g , melted at 130 °- 141 ° c . and analyzed as follows : % cl , calc . 35 . 7 , found 37 . 3 ; % n , calc . 9 . 5 , found 9 . 5 . 1 -( 3 , 4 - dichlorophenyl )- 3 - methyl urea ( 15 . 2 g , 0 . 07 mol ) was combined with 15 . 0 g ( 0 . 1 mol ) of chloral and 5 drops of concentrated sulfuric acid . the mixture was heated for an hour to effect reaction , then stripped under vacuum . to the crude 1 -( 3 , 4 - dichlorophenyl )- 3 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 - methyl urea was added an excess of thionyl chloride and the mixture was heated gradually to a maximum of 65 ° c . diethyl ether was added to the crude product , and the insoluble product was collected on a filter , washed twice with diethyl ether and dried . the 15 . 3 g of product , which melted at 132 °- 140 ° c ., analyzed as follows : % cl , calc . 55 . 2 , found 46 . 0 . p - phenoxyaniline ( 11 . 7 g , 0 . 063 mol ) was dissolved in 25 ml 1 , 2 - dimethoxyethane ( ansul e - 121 ) and heated to 65 ° c . methyl isocyanate ( 3 . 7 g , 0 . 65 mol ) was added over a period of 10 minutes . heating and stirring were continued for 1 hour . then chloral ( 14 . 8 g , 0 . 1 mol ) was added to the hot solution , followed immediately by the addition of 11 . 9 g ( 0 . 1 mol ) thionyl chloride . it was kept at 65 ° c . for 41 / 2 hours . the solution was cooled to 40 °, and 25 ml of methylene chloride was added . the solution was refluxed for one more hour and then allowed to cool . the solid which formed upon cooling was filtered , washed with methylene chloride to give 5 . 0 g ( 20 % yield ) of a white powder , melting point 165 °- 167 ° c . a second crop , melting point 160 °- 162 ° c ., weighed 5 . 5 g ( 22 %). elemental analysis showed : % cl , calc . 34 . 8 , found 34 . 35 ; % n , calc . 6 . 9 , found 6 . 8 ; % c , calc ., 47 . 1 , found 47 . 5 ; % h , calc . 3 . 46 , found 3 . 3 . 1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 - fluorophenyl ) urea ( 16 . 7 g , 0 . 05 mol ) was dissolved by heating ( 30 °- 40 ° c .) in 100 cc dimethoxyethane , then methylmercaptan was bubbled into the hot solution for 20 minutes . an initial exothermicity occurred , then the temperature dropped gradually to 30 ° c . removal of the solvent yielded a solid , which after being slurried in ether was collected on a filter and dried . the crystalline solid , 7 g , melted at 127 °- 130 ° c . and analyzed as follows : % s , calc . 9 . 3 , found 8 . 0 ; % cl , calc . 30 . 8 , found 26 . 9 . 1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea ( 7 . 7 g , 0 . 02 mol ) was dissolved in 200 ml dimethoxyethane , followed by the addition of 1 . 5 g of ammonium acetate . the mixture was stirred for 2 hours , filtered , and stripped of solvent . the residual mush was added to ether and the ether - insoluble material filtered off . next , the ether was removed under vacuum . the residual oil was added to chloroform and some undissolved material was removed by filtration . the filtrate was evaporated to give 5 . 5 g of an oily product . the infrared and nmr spectra were consistent with the assigned structure . the chlorine analysis was : % cl , calc . 43 . 5 , found 41 . 7 . 1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea ( 7 . 7 g , 0 . 02 mol ) was dissolved in 200 ml dimethoxyethane , followed by addition of 1 . 5 g ( 0 . 02 mol ) of ammonium thiocyanate . the mixture was stirred for 2 hours , filtered and stripped of solvent . ether was added to the residue , which was again filtered to remove a small amount of solid . the remaining solvent was then removed , leaving a dark oil which solidified upon standing . this material had a melting point of 142 °- 146 ° c . the infrared spectrum of the material showed a broad absorption band at 4 . 9 micron ( for the -- n ═ c ═ s group ). elemental analysis showed : % cl , calc ., 43 . 6 , found 36 . 7 ; % s , calc . 7 . 9 , found 6 . 3 . other compounds of the present invention were prepared using the methods as described above . these compounds are listed in table i . the ureas of the present invention are , in general , herbicidal in both pre - and post - emergent applications . for pre - emergent control of undesirable vegetation , these ureas will be applied in herbicidal quantities to the environment , e . g ., soil infested with seeds and / or seedlings of such vegetation . such application will inhibit the growth of or kill the seeds , germinating seeds and seedlings . for post - emergent applications , the ureas of the present invention will be applied directly to the foliage and other plant parts . generally they are effective against weed grasses as well as broad - leaved weeds . some may be selective with respect to type of application and / or type of weed . pre - and post - emergent herbicidal tests on representative ureas of this invention were made using the following methods : acetone solutions of the test ureas were prepared by mixing 750 mg urea , 220 mg of a nonionic surfactant and 25 ml of acetone . this solution was added to approximately 125 ml of water containing 156 mg of surfactant . seeds of the test vegetation were planted in a pot of soil and the urea solution was sprayed uniformly onto the soil surface at a dose of 100 mg per cm 2 . the pot was watered and placed in a greenhouse . the pot was watered intermittently and was observed for seedling emergence , health of emerging seedlings , etc ., for a 3 - week period . at the end of this period , the herbicidal effectiveness of the urea was rated , based on the physiological observations . a 0 - to - 100 scale was used , 0 representing no phytotoxicity , 100 representing complete kill . the test ureas were formulated in the same manner as described above for the pre - emergent test . the concetration of the urea in this formulation was 5000 ppm . this formulation was uniformly sprayed on 2 similar pots of 24 - day - old plants ( approximately 15 to 25 plants per pot ) at a dose of 100 mg per cm 2 . after the plants had dried , they were placed in a greenhouse and then watered intermittently at their bases , as needed . the plants were observed periodically for phytotoxic effects and physiological and morphological responses to the treatment . after 3 weeks the herbicidal effectiveness of the urea was rated , based on these observations . a 0 - to - 100 scale was used , 0 representing no phytotoxicity , 100 representing complete kill . the amount of urea administered will vary with the particular plant part or plant growth medium which is to be contacted , the general location of application -- i . e ., sheltered areas such as greenhouses as compared to exposed areas such as fields -- as well as the desired type of control . for pre - emergent control of most plants , dosages in the range of about 0 . 5 to 20 lbs / acre will be used . such administration will give a concentration of about 2 to 80 ppm urea distributed throughout 0 . 1 acre - foot . for post - emergent application , such as foliar spray application , compositions containing about 0 . 5 to 8 lbs urea per 100 gals spray will be used . such application is equivalent to about 0 . 5 to 20 lbs urea per acre . the herbicidal compositions of this invention comprise an herbicidal amount of one or more of the above - described ureas intimately admixed with a biologically inert carrier . the carrier may be a liquid diluent , such as water or acetone , or a solid . the solid may be in the form of dust powder or granules . these compositions will also usually contain adjuvants such as a wetting or dispersing agent to facilitate their penetration into the plant growth medium or plant tissue and generally enhance their effectiveness . these compositions may also contain other pesticides , stabilizers , conditioners , fillers , and the like . one of the compounds of the present invention , namely 1 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea , was compared with the related compound of the prior art , namely 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea . the comparison was for herbicidal effectiveness , the testing procedure being substantially the same as described above . the results are shown in table iii . table i__________________________________________________________________________ elemental analysis melting halogen n s point , compound calc . found calc . found calc . found ° c . __________________________________________________________________________1 - methyl - 1 -( 1 - ethoxy - 2 , 2 , 2 - trichloroethyl - 3 -( 2 - fluoro - cl 27 . 2 27 . 6phenyl ) urea f 7 . 3 7 . 2 162 - 1631 - methyl - 1 -( 1 - ethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - chloro - phenyl ) urea 38 . 4 38 . 8 124 - 1271 - methyl - 1 -( 1 - ethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - trifluoro - cl 22 . 8 22 . 6methylphenyl ) urea f 18 . 3 18 . 6 123 - 1271 - methyl - 1 -( 1 - methoxy - 2 , 2 , 2 - trichloroethyl - 3 -( 3 - tolyl ) urea 32 . 6 30 . 5 8 . 6 8 . 2 133 - 1351 - methyl - 1 -( 1 - ethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chloro - phenyl ) urea 39 . 4 38 . 7 7 . 8 7 . 0 104 - 1061 - methyl - 1 -( 1 - methoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluoro - phenyl ) urea 32 . 2 32 . 2 8 . 5 8 . 5 152 - 1531 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluoro - phenyl ) urea 30 . 8 26 . 9 9 . 3 8 . 0 127 - 1301 - methyl - 1 -( 1 - ethylthio - 2 , 2 , 2 ,- trichloroethyl )- 3 -( 2 - fluoro - phenyl ) urea 29 . 5 29 . 1 8 . 9 8 . 4 144 - 1471 - methyl - 1 -( 1 - phenylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluoro - phenyl ) urea 26 . 0 25 . 3 7 . 9 7 . 8 121 - 1251 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - tolyl ) urea 31 . 1 30 . 6 9 . 4 9 . 8 132 - 1341 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chloro - phenyl ) urea 39 . 2 38 . 5 8 . 8 9 . 1 127 - 1301 - methyl - 1 -( 1 - ethylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chloro - phenyl ) urea 37 . 8 35 . 4 8 . 5 8 . 0 142 - 1451 - methyl - 1 -( 1 - ethylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 43 . 2 40 . 1 7 . 8 7 . 3 125 - 1281 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 44 . 7 41 . 4 8 . 1 7 . 4 151 - 1531 - methyl - 1 -( 1 - ethylthio - 2 , 2 , 2 - trichloroethyl )- 3 - phenyl urea 31 . 1 30 . 4 9 . 4 7 . 9 155 - 1570 , 0 - diethyl 1 -( n - methyl - n - 2 - fluorophenylcarbamoylamino )- 2 , 2 , 2 - trichloroethyl phosphonate 24 . 5 22 . 5 7 . 1 . sup . 1 7 . 4 . sup . 1 ≃ 9 50 , 0 - dimethyl 1 -( n - methyl - n - 3 - chlorophenylcarbamoylamino )- 2 , 2 , 2 - trichloroethyl phosphonate 33 . 5 34 . 2 7 . 3 . sup . 1 7 . 0 . sup . 1 oil0 , 0 - dimethyl 1 -[ n -( 3 , 4 - dichlorophenylcarbamoyl )- n - methyl - amino ]- 2 , 2 , 2 - trichloroethyl phosphonate 38 . 6 39 . 0 6 . 8 . sup . 1 7 . 0 . sup . 1 oil0 , 0 - diethyl 1 -[ n -( 3 - chlorophenylcarbamoyl )- n - methylamino ]- 2 , 2 , 2 - trichloroethyl phosphonate 31 . 4 28 . 8 6 . 9 . sup . 1 6 . 7 . sup . 1 oil1 -[ n &# 39 ;-( 2 - fluorophenylcarbamoyl )- n &# 39 ;- methylamino ]- 2 , 2 , 2 - trichloroethyl - n , n - dimethyldithio carbamate 25 . 4 24 . 0 15 . 3 13 . 9 142 - 1451 - methyl - 1 -( 1 - acetoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chloro - phenyl ) urea 38 . 0 34 . 6 7 . 5 7 . 0 150 - 1521 - methyl - 1 -( 1 - n - methylcarbamoyloxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 36 . 5 30 . 2 10 . 7 9 . 2 oil1 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea 29 . 8 30 . 0 9 . 0 9 . 0 133 - 134n -[ 1 -( n &# 39 ;- 3 - chlorophenylcarbamoyl - n &# 39 ;- methylamino )- 2 , 2 , 2 - trichloroethyl ] 0 , 0 - dimethylthiophosphoramide 31 . 2 25 . 2 7 . 1 6 . 7 oiln -[ 1 -( n -{ 3 , 4 - dichlorophenylcarbamoyl }- n - methylamino )- 2 , 2 , 2 - trichloroethyl ] 0 , 0 - dimethylthiophosphoramide 36 . 2 37 . 2 6 . 5 6 . 5 oil1 - methyl - 1 -( 1 - carbethoxymethylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 32 . 7 31 . 7 7 . 4 7 . 0 oil1 - methyl - 1 -( 1 - carbethoxymethylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 37 . 8 34 . 9 6 . 8 6 . 9 oil1 - methyl - 1 -( 1 - carbethoxymethylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea 25 . 4 25 . 7 7 . 7 7 . 4 oil1 - methyl - 1 -( 1 - carbethoxymethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 34 . 0 30 . 3 6 . 7 6 . 5 oil1 - methyl - 1 -( 1 - carbethoxymethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 39 . 2 36 . 7 6 . 2 5 . 4 oil1 - methyl - 1 -( 1 - carbethoxymethoxy - 2 , 2 , 2 - trichloroethyl )- 3 - cl 26 . 4 26 . 6 ( 2 - fluorophenyl ) urea f 4 . 7 4 . 8 oil0 , 0 - dimethyl s -( 1 -[ n - 3 - chlorophenylcarbamoyl - n - methyl - amino ]- 2 , 2 , 2 - trichloroethyl ) dithiophosphate 30 . 1 26 . 4 13 . 6 12 . 7 148 - 1510 , 0 - diethyl s -[ 1 -( n - 3 , 4 - dichlorophenylcarbamoyl - n - methylamino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate 28 . 4 26 . 5 12 . 8 12 . 2 158 - 1600 , 0 - dimethyl s -[ 1 -( n - 3 , 4 - dichlorophenylcarbamoyl - n - methyl - amino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate 35 . 0 32 . 4 12 . 6 11 . 6 181 - 1830 , 0 - dimethyl s -[ 1 -( n - 2 - fluorophenylcarbamoyl - n - methylamino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate 23 . 3 23 . 5 14 . 1 14 . 0 115 - 1170 , 0 - diethyl s -[ 1 -( n - 3 , 4 - dichlorophenylcarbamoyl - n - methyl - amino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate 33 . 1 32 . 6 12 . 0 11 . 8 170 - 1730 , 0 - diethyl s -[ n - 2 - fluorophenylcarbamoyl - n - methylamino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate 21 . 9 22 . 1 13 . 2 13 . 9 150 - 1531 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 - cyclohexyl urea 12 . 2 11 . 5 123 - 1241 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 - cyclopentyl urea 32 . 2 31 . 8 9 . 7 9 . 6 105 - 1061 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 - t - butylurea 33 . 4 33 . 5 10 . 1 10 . 0 98 - 1011 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 - dodecyl urea 24 . 7 24 . 8 7 . 4 7 . 5 66 - 68 . 51 - methyl - 1 -( 1 - methoxy - 2 , 2 , 2 - trichloro )- 3 -( 3 , 4 - dichlorophenyl ) urea 7 . 4 8 . 0 34 . 7 . sup . 2 35 . 9 . sup . 2 165 - 1681 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 - cyclohexyl urea 8 . 4 8 . 1 148 - 1501 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 - methyl 40 . 1 38 . 6 12 . 1 11 . 1 167 - 1681 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 - cyclopentyl urea 33 . 3 33 . 4 10 . 0 10 . 2 121 - 1231 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 - t - butyl 34 . 6 35 . 1 10 . 4 10 . 4 102 - 1031 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 - dodecyl 25 . 3 23 . 3 7 . 6 7 . 2 48 - 491 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 , 2 - trichloroethyl )- 3 - cyclohexyl urea 29 . 1 27 . 3 8 . 8 8 . 6 146 - 1491 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 - dichlorovinyl )- 3 - methyl 27 . 2 29 . 4 12 . 3 12 . 1 170 - 1731 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 , 2 - trichloroethyl )- 3 - cyclopentyl urea 30 . 3 29 . 3 9 . 1 9 . 0 135 - 1381 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 - dichlorovinyl )- 3 - cyclopentyl urea 22 . 5 22 . 5 10 . 2 10 . 0 147 . 5 - 1491 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 , 2 - trichloroethyl )- 3 - t - butylurea 31 . 3 30 . 4 9 . 4 9 . 3 109 - 1101 - methyl - 1 -( 1 - n - methylcarbamoyloxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 42 . 0 44 . 5 9 . 9 7 . 8 34 . 1 . sup . 2 33 . 7 . sup . 2 oil1 - methyl - 1 -( 1 - n - phenylcarbamoyloxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 36 . 6 36 . 2 8 . 7 6 . 5 42 . 1 . sup . 2 40 . 0 . sup . 2 oil1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 - chlorophenyl ) 45 . 2 49 . 4 139 - 1451 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 4 - chlorophenyl ) 45 . 2 41 . 9 175 - 1801 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 , 4 - dichlorophenylurea 45 . 5 43 . 6 190 - 1931 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 4 - bromophenyl ) 12 . 7 . sup . 3 13 . 4 . sup . 3 187 - 1901 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 - chlorophenyl ) 50 . 6 50 . 0 8 . 0 7 . 3 155 - 1601 - methyl - 1 -( 1 - chloro - 2 , 2 , 2 - tribromoethyl )- 3 -( 3 , 4 - dichloro - phenyl ) urea 11 . 6 . sup . 3 11 . 6 . sup . 3 5 . 4 5 . 5 155 - 1581 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - phenyl urea 44 . 9 34 . 4 8 . 9 8 . 4 164 - 1661 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 - chloro - 4 - bromo - phenyl ) urea 14 . 0 . sup . 3 13 . 7 . sup . 3 6 . 5 6 . 2 189 - 1901 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chloro - phenyl ) urea 42 . 8 39 . 4 8 . 4 9 . 5 oil1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 - trifluoro - cl 30 . 6 30 . 9methylphenyl ) urea f 16 . 4 16 . 2 145 - 1481 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 , 5 - dichloro - phenyl urea 55 . 4 50 . 3 7 . 3 7 . 5 150 - 1571 - methyl - 1 -( 1 , 2 , 2 - trichloro - 2 - bromoethyl )- 3 -( 2 - fluoro - phenyl ) urea 10 . 6 . sup . 3 10 . 5 . sup . 3 139 - 1421 - methyl - 1 -( 1 - bromo - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluoro - phenyl ) urea br . sup . 4 21 . 2 21 . 5 153 - 1551 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 4 - methoxy - phenyl ) urea 41 . 1 40 . 1 8 . 1 8 . 2 176 - 1791 - methyl - 1 -( 1 , 2 , 2 - trichloro - 2 - bromoethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 14 . 0 . sup . 3 13 . 8 . sup . 3 6 . 2 6 . 3 166 - 1691 - methyl - 1 -( 1 , 2 , 2 - trichloro - 2 - bromoethyl )- 3 -( 3 - chloro - phenyl ) urea cl . sup . 4 9 . 0 8 . 4 150 - 1521 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 - trifluoro - cl . sup . 4 9 . 3 9 . 2methylphenyl ) urea f 14 . 8 14 . 9 138 - 1421 - methyl - 1 -( 1 , 2 - diboromo - 2 , 2 - dichloroethyl )- 3 -( 2 - fluoro - phenyl ) urea br . sup . 4 19 . 5 16 . 2 6 . 8 7 . 5 130 - 1331 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -[ 3 - methyl - 4 -( 4 &# 39 ;- chlorophenylthio ) phenyl ] urea 37 . 5 35 . 4 6 . 8 6 . 8 152 - 1541 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -[ 3 - methyl - 4 -( 4 &# 39 ;- chlorophenylsulfonyl ) phenyl ] urea 35 . 1 29 . 0 6 . 3 6 . 8 168 - 1711 - methyl - 1 -( 1 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 8 . 9 8 . 9 38 . 0 . sup . 2 38 . 0 . sup . 2 118 - 1271 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -[ 4 -( 4 &# 39 ;- chloro - phenoxy ) phenyl ] urea 40 . 1 39 . 6 6 . 3 6 . 3 153 - 1561 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - pyridyl ) 35 . 6 32 . 2 14 . 1 12 . 0 oil1 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - thiazolyl ) urea 34 . 9 35 . 8 oil1 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - pyridyl ) 35 . 6 33 . 6 oil1 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - pyrimidyl ) urea 35 . 5 35 . 4 18 . 7 18 . 2 100 - 1041 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - cyclopentyl urea 9 . 1 8 . 7 132 - 1361 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - cylcohexyl urea 8 . 7 8 . 4 127 - 129 . 51 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - methyl urea 11 . 0 10 . 9 73 - 761 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - n - hexyl urea 8 . 7 9 . 2 45 - 551 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - t - butyl urea 9 . 5 9 . 7 32 . 5 . sup . 2 31 . 7 . sup . 2 84 - 881 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - n - dodecyl urea 34 . 7 33 . 5 6 . 9 6 . 3 39 - 411 - methoxy - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 - fluoro - cl 40 . 6 40 . 2phenyl ) urea f 5 . 4 5 . 8 75 - 781 - methyl - 1 -( 1 - fluoro - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - cl 48 . 1 43 . 8dichlorophenyl ) urea f 5 . 1 5 . 5 100 - 1021 - methyl - 1 -( 1 - fluoro - 2 , 2 , 2 - trichloroethyl )- 3 - phenyl cl 35 . 5 35 . 5urea f 6 . 3 5 . 7 152 - 1531 - methyl - 1 -( 1 - fluoro - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 5 - cl 32 . 5 32 . 3dimethylphenyl urea f 5 . 8 4 . 2 160 - 1621 - methyl - 1 -( 1 - fluoro - 2 , 2 , 2 - trichloroethyl )- 3 - cl 42 . 4 39 . 5 ( 3 - chlorophenyl ) urea f 5 . 7 6 . 1 132 - 134__________________________________________________________________________ . sup . 1 phosphorus . sup . 2 carbon analysis . sup . 3 analysis for total halogen in milliequivalents per gram . sup . 4 analysis for active halogen ( i . e ., the halogen on the carbon adjacent to the 1nitrogen atom ) table ii__________________________________________________________________________ herbicidal effectiveness pre / postcompound o w c m p l__________________________________________________________________________1 - methyl - 1 -( 1 - ethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea -- -- -- 93 / 85 100 / 85 100 / 901 - methyl - 1 -( 1 - ethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - tri - fluoromethylphenyl ) urea -- -- -- 85 / 100 80 / 98 90 / 601 - methyl - 1 -( 1 - methoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - tolyl ) urea -- 80 /-- -- -- -- 100 /-- 1 - methyl - 1 -( 1 - ethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chloro - phenyl ) urea -- -- -- --/ 100 75 / 95 75 / 1001 - methyl - 1 -( 1 - methoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea -- -- 90 /-- 70 /-- 85 / 100 --/ 951 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea 100 / 100 100 / 100 100 / 95 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - ethylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea 100 /-- 100 /-- 100 /-- 100 / 95 100 /-- 100 / 901 - methyl - 1 -( 1 - phenylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea 100 /-- -- 85 /-- 100 / 95 100 /-- 85 / 751 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - tolyl ) urea -- -- -- -- -- 80 / 901 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea -- -- -- --/ 70 -- --/ 701 - methyl - 1 -( 1 - ethylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea -- -- -- --/ 70 -- -- 1 - methyl - 1 -( 1 - ethylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea --/ 100 94 / 100 --/ 90 -- -- -- 1 - methyl - 1 -( 1 - methylthio - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea -- 75 / 93 -- -- -- -- 1 - methyl - 1 -( 1 - ethylthio - 2 , 2 , 2 - trichloroethyl )- 3 - phenyl urea -- -- -- 75 /-- -- -- 0 , 0 - diethyl 1 -( n - methyl - n - 2 - fluorophenylcarbamoyl - amino )- 2 , 2 , 2 - trichloroethyl phosphonate 95 /-- -- 90 /-- 95 / 70 95 /-- 95 /-- 0 , 0 - dimethyl 1 -( n - methyl - n - 3 - chlorophenylcarbamoyl - amino )- 2 , 2 , 2 - trichloroethyl phosphonate --/ 100 100 / 100 100 / 100 100 / 93 100 / 100 100 /-- 0 , 0 - dimethyl 1 -[ n -( 3 , 4 - dichlorophenylcarbamoyl )- n - methylamino ]- 2 , 2 , 2 - trichloroethyl phosphonate --/ 100 75 / 100 80 / 100 80 / 100 90 / 100 85 / 1000 , 0 - diethyl 1 -[ n -( 3 - chlorophenylcarbamoyl )- n - methyl - amino ]- 2 , 2 , 2 - trichloroethyl phosphonate 70 / 100 95 / 100 100 / 100 75 / 100 90 / 100 80 / 1001 - methyl - 1 -( 1 - acetoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea -- 100 /-- 100 /-- 100 / 100 100 / 100 100 / 1001 -[ n &# 39 ;-( 2 - fluorophenylcarbamoyl )- n &# 39 ;- methyl ] amino - 2 , 2 , 2 - trichloroethyl - n , n - dimethyldithio carbamate 90 / 100 95 / 95 100 / 85 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - acetoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 75 / 95 100 / 100 90 / 100 95 / 100 90 / 100 95 / 1001 - methyl - 1 -( 1 - n - methylcarbamoyloxy - 2 , 2 , 2 - trichloro - ethyl )- 3 -( 3 - chlorophenyl ) urea 80 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea -- -- 95 /-- 100 / 100 95 / 90 95 / 1001 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea 85 / 75 --/ 70 90 / 80 100 / 100 100 / 100 100 / 100n -[ 1 -( n &# 39 ;- 3 - chlorophenylcarbamoyl - n &# 39 ;- methylamino )- 2 , 2 , 2 - trichloroethyl ] 0 , 0 - dimethylthiophosphoramide 100 / 90 100 / 95 100 / 80 100 / 100 100 / 100 100 / 100n -[ 1 -( n - 3 , 4 - dichlorophenylcarbamoyl - n - methylamino )- 2 , 2 , 2 - trichloroethyl ] 0 , 0 - dimethylthiophosphoramide 90 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - carbethoxymethylthio - 2 , 2 , 2 - trichloro - ethyl )- 3 -( 3 - chlorophenyl ) urea 75 /-- 95 / 95 100 /-- 100 / 100 100 / 70 95 / 951 - methyl - 1 -( 1 - carbethoxymethylthio - 2 , 2 , 2 - trichloro - ethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 99 / 100 94 / 100 99 / 100 -- --/ 100 --/ 801 - methyl - 1 -( 1 - carbethoxymethylthio - 2 , 2 , 2 - trichloro - ethyl )- 3 -( 2 - fluorophenyl ) urea 100 / 100 100 / 100 95 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - carbethoxymethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 90 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - carbethoxymethoxy - 2 , 2 , 2 - trichloro - ethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea --/ 75 90 / 100 100 / 95 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - carbethoxymethoxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea 100 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1000 , 0 - dimethyl s -[ 1 -( n - 3 - chlorophenylcarbamoyl - n - methyl - amino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate -- -- -- --/ 80 -- --/ 750 , 0 - diethyl - s -[ 1 -( n - 3 - chlorophenylcarbamoyl - n - methyl - amino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate 70 /-- 85 /-- -- -- -- -- 0 , 0 - dimethyl s -[ 1 -( n - 3 , 4 - dichlorophenylcarbamoyl - n - methylamino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate --/ 73 --/ 90 -- -- -- -- 0 , 0 - dimethyl s -[ 1 -( n - 2 - fluorophenylcarbamoyl - n - methylamino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate 85 /-- 75 /-- 75 /-- 100 /-- 100 /-- 100 /-- 0 , 0 - diethyl s -[ 1 -( n - 3 , 4 - dichlorophenylcarbamoyl - n - methylamino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate -- -- -- --/ 70 -- -- 0 , 0 - diethyl s -[ 1 -( n - 2 - fluorophenylcarbamoyl - n - methyl - amino )- 2 , 2 , 2 - trichloroethyl ] dithiophosphate -- -- -- -- --/ 70 -- 1 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 - cyclohexyl urea 95 /-- 100 /-- 100 /-- 100 / 95 100 /-- 100 -- 1 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 - cyclopentyl urea -- 90 /-- 90 /-- 100 /-- 100 /-- 100 / 801 - methyl - 1 -( 1 - isothiocyanato - 2 , 2 , 2 - trichloroethyl )- 3 - t - butyl urea -- 90 /-- 95 /-- --/ 95 --/ 90 --/ 951 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 , 2 - trichloroethyl )- 3 - cyclohexyl urea 80 /-- 70 /-- -- 95 / 95 95 / 90 95 / 901 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 - dichlorovinyl )- 3 - methylurea -- -- -- -- --/ 70 --/ 951 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 - dichlorovinyl - 3 - cyclo - pentyl urea -- -- -- -- 75 /-- 85 /-- 1 - methyl - 1 -( 1 - methylsulfonyl - 2 , 2 , 2 - trichloroethyl )- 3 - t - butyl urea -- 80 /-- -- -- -- 75 /-- 1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 - fluorophenyl ) urea 100 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 90 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 - chloro - phenyl ) urea 90 / 80 97 / 80 93 / 85 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 4 - chloro - phenyl ) urea 100 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 , 4 - dichlorophenyl ) urea 70 / 70 92 / 85 100 / 75 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 4 - bromo - phenyl ) urea 65 / 50 90 / 90 95 / 0 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 - chloro - phenyl ) urea 90 / 70 100 / 85 95 / 60 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - phenyl urea 100 / 100 100 / 100 100 / 85 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 - chloro - 4 - bromophenyl ) urea 50 / 95 80 / 100 100 / 95 99 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 85 / 100 95 / 100 95 / 100 90 / 100 90 / 100 90 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 2 - trifluoro - methylphenyl ) urea -- 96 /-- 91 /-- --/ 85 --/ 90 --/ 851 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 3 , 5 - dichlorophenyl ) urea -- -- -- 100 / 80 100 /-- 100 / 701 - methyl - 1 -( 2 - bromo - 1 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl urea 100 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 - bromo - 1 , 2 , 2 - trichloroethyl )- 3 -( 2 - fluorophenyl ) urea 100 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 4 - methoxyphenyl ) urea 90 /-- 100 /-- 100 /-- 95 / 100 95 / 95 95 / 1001 - methyl - 1 -( 2 - bromo - 1 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 70 / 95 95 / 100 --/ 100 95 / 100 95 / 100 95 / 1001 - methyl - 1 -( 2 - bromo - 1 , 2 , 2 - trichloroethyl )- 3 -( 3 - chloro - phenyl ) urea 100 / 100 100 / 100 100 / 85 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachlorethyl )- 3 -( 3 - tri - fluoromethylphenyl ) urea 90 / 90 100 / 100 100 / 95 95 / 100 95 / 100 100 / 1001 - methyl - 1 -( 1 , 2 - dibromo - 2 , 2 - dichloroethyl )- 3 -( 2 - fluorophenyl ) urea --/ 100 -- 100 --/ 100 --/ 100 --/ 100 --/ 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -[ 3 - methyl - 4 -( 4 &# 39 ;- chlorophenylthio ) phenyl ] urea -- -- -- --/ 100 --/ 100 --/ 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -[ 3 - methyl - 4 -( 4 &# 39 ;- chlorophenylsulfonyl ) phenyl ] urea -- -- -- --/ 100 --/ 90 --/ 951 - methyl - 1 -( 1 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 100 / 100 100 / 100 100 / 100 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -( 4 - phenoxyphenyl ) urea 90 /-- 95 /-- 100 /-- 100 / 100 100 / 100 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 -[ 4 -( 4 &# 39 ;- chloro - phenoxy ) phenyl ] urea -- -- -- 90 /-- 100 / 100 100 / 1001 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - pyridyl ) urea 90 /-- 90 /-- 95 /-- -- -- --/ 901 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - thiazolyl ) urea 85 /-- 90 /-- 85 /-- 95 / 100 100 / 90 100 / 1001 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 - 2 - pyridyl ) urea --/ 95 80 / 95 --/ 90 --/ 100 70 / 100 90 / 1001 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 2 - pyrimidyl ) urea 70 /-- 90 /-- 90 /-- -- --/ 70 -- 1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - cyclopentyl urea -- 95 /-- 95 / 90 95 / 100 100 / 95 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - cyclohexyl urea 100 / 90 95 / 85 95 /-- 100 / 100 100 / 95 100 / 1001 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - methyl urea 80 /-- 90 /-- 90 /-- -- 90 /-- 70 /-- 1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - n - hexyl urea -- -- -- --/ 100 --/ 95 --/ 951 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - t - butyl urea 90 /-- 90 /-- 90 /-- 70 /-- -- -- 1 - methyl - 1 -( 1 , 2 , 2 , 2 - tetrachloroethyl )- 3 - n - dodecyl urea 80 /-- 90 /-- 90 /-- --/ 70 95 / 80 100 / 80 * 1 - methyl - 1 -( 1 - fluoro - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 4 - dichlorophenyl ) urea 20 / 30 85 / 30 95 / 95 95 / 90 99 / 90 99 / 100 * 1 - methyl - 1 -( 1 - fluoro - 2 , 2 , 2 - trichloroethyl )- 3 - phenyl urea 98 / 75 98 / 45 98 / 45 100 / 90 100 / 95 98 / 95 * 1 - methyl - 1 -( 1 - fluoro - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 , 5 - dimethylphenyl ) urea 85 / 0 98 / 0 98 / 0 100 / 10 100 / 10 100 / 0 * 1 - methyl - 1 -( 1 - fluoro - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 90 / 0 99 / 95 100 / 75 100 / 100 100 / 100 100 / 100__________________________________________________________________________ * tested at 33 micrograms / cm . sup . 2 table iii__________________________________________________________________________ ( comparison of compound of the present invention with prior artcompound ) o w c m p l__________________________________________________________________________1 - methyl - 1 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 85 / 100 95 / 100 95 / 100 90 / 100 90 / 100 90 / 1001 -( 1 - hydroxy - 2 , 2 , 2 - trichloroethyl )- 3 -( 3 - chlorophenyl ) urea 0 / 60 0 / 90 0 / 90 10 / 35 35 / 40 30 / 40 tables ii and iii :? o = wild oats ( avena fatua ) w = watergrass ( echinochloa crusgalli ) c = crabgrass ( digitaria sanguinalis ) m = mustard ( brassica arvensis ) p = pigweed ( amaranthus retroflexus ) l = lambsquarter ( chenopodium album )? | 2 |
please refer to fig1 a and fig1 b which schematically illustrate an inertial mouse device according to an embodiment of the present invention . the inertial mouse device 10 mainly includes a main body 100 in which an operational interface member 102 is disposed . the operational interface member 102 includes parts manipulated by the user for enabling designated functions of the system that the mouse device is working with . the inertial mouse device 10 further includes a first accelerometer 11 , a second accelerometer 12 , a gyroscope 13 , a microprocessor 14 and a transmission interface 15 . in an embodiment , the first accelerometer 11 and second accelerometer 12 detect motion accelerations of the mouse device in two perpendicular axes directions , e . g . an x - axis direction and a y - axis direction as shown in fig1 a , on the supporting plane 20 . the x - axis and y - axis are both parallel to a bottom face 104 of the mouse device 10 and perpendicular to a z - axis which represents an axis penetrating top and bottom of the mouse device , and represent an axis penetrating front and rear and an axis penetrating left and right of the mouse device , respectively . the bottom face 104 is substantially parallel to the supporting plane 20 where the mouse device 10 is rested , and thus the x - axis and y - axis are also parallel to the supporting plane 20 . on the other hand , the gyroscope 13 detects an angular motion associated with the z - axis , which will be described in more detail later . signals generated in response to the detections are then outputted to the microprocessor 14 electrically connected to the first and second accelerometers 11 and 12 and the gyroscope 13 . if the signals are analog signals such as voltage signals , it is preferred that analog - to - digital converters 111 , 121 and 131 are provided for converting the signals into a digital form to be processed by the microprocessor 14 . the microprocessor 14 is also electrically connected to the operational interface member 102 . in response to the signals received from the accelerometers , gyroscope and / or operational interface member , the microprocessor 14 outputs a signal to a computer system ( not shown ) via the transmission interface 15 for cursor control or execution of designated functions . the operational interface member 102 , for example , may include click switches and a scroll - bar control roller . in fig1 a , only left and right click switches are exemplified for illustration of the operational interface member 102 . the transmission interface 15 may but does not necessarily communicate with the computer system in a wireless manner . the above - mentioned units 11 ˜ 15 may be but are not necessarily mounted on a circuit board 101 which is disposed inside the main body 100 and parallel to the bottom surface 104 . on a condition that the supporting plane 20 is substantially horizontal , the first accelerometer 11 and the second accelerometer 12 detect the motion accelerations in the x - axis direction and the y - axis direction and generate the first acceleration a x and the second acceleration a y , respectively , defined as the follows : wherein v x denotes a first voltage value outputted by the first accelerometer 11 ; v ox denotes a first voltage offset or bias for the first accelerometer 11 ; v sx denotes a first conversion coefficient , e . g . a first voltage sensitivity for the first accelerometer 11 ; v y denotes a first voltage value outputted by the second accelerometer 12 ; v oy denotes a second voltage offset or bias for the second accelerometer 12 ; and v sy denotes a second conversion coefficient , e . g . a second voltage sensitivity for the second accelerometer 12 . on the other hand , on a condition that the supporting plane 20 is not horizontal , as illustrated in fig2 , the inertial mouse according to the present invention performs calibration for the detection signals in order to remove the component of acceleration resulting from the slanting plane 20 . as shown , the supporting plane 20 tilts from horizon at an angle θ x in x - axis and at an angle θ y in y - axis . accordingly , once the mouse device 10 is rested on the supporting plane 20 , the first accelerometer 11 is inherently imparted thereto a component of acceleration of g · sinθ x and the second accelerometer 12 is inherently imparted thereto a component of acceleration of g · sinθ y , where g is gravity acceleration . under this circumstance , the first accelerometer 11 and the second accelerometer 12 detect the motion accelerations in the x - axis direction and the y - axis direction and generate the first acceleration a x and the second acceleration a y with deviations . therefore , actual motion accelerations a x ′ and a y ′ is redefined as the follows : a x ′=( v x − v ox )/ v sx − g · sinθ x ( 3 ), a y ′=( v y − v oy )/ v sy − g · sinθ y ( 4 ). with the subtraction of g · sinθ x and g · sinθ y from primarily determined accelerations a x and a y , the components of gravity acceleration resulting from the slanting supporting plane are removed so as to realize actual motion accelerations a x ′ and a y ′. as for the tilting angle θ x in x - axis and the tilting angle θ y in y - axis , they can be estimated by the microprocessor 14 when the mouse device 10 is in a still state or moved at a constant velocity on the slanting supporting plane 20 , i . e . a x ′= 0 and a y ′= 0 . generally , it is hard to keep moving the mouse device at a constant velocity . therefore , the angles are basically determined in a still state of the mouse device 10 on the supporting plane 20 in the following discussion . since a x ′ and a y ′ are both zero , the following formulae are derived from the formulae ( 3 ) and ( 4 ): θ x = sin − 1 (( v x − v ox )/( g · v sx )) ( 5 ), θ y = sin − 1 (( v y − v oy )/( g · v sy )) ( 6 ). in an embodiment of the present invention , the determination of the still state of the mouse device is performed by sampling outputs of the accelerometers 11 and 12 at intervals , e . g . every 10 microseconds , and seeing how the outputs change with time . for example , if the accelerometers 11 and 12 output zero or constant voltages in a predetermined number of continuous sampling cycles , e . g . 10 cycles t n - 10 ˜ t n - 1 , it is determined that the mouse device is possibly still at the current time t n . however , in practice , the outputs would not be exactly constant and might slightly fluctuate due to , for example , noise . as such , as long as each of the outputs in each axis lies within a specified range or the deviation from a statistical average of the 10 cycles is less than a threshold , the outputs are considered to be constant . for reconfirmation , velocities realized by integrating the accelerations a x and a y with time in last sampling cycle t n - 1 are further referred to . it is determined that the mouse device is still at the current time t n if the velocities v x and v y are both less than a threshold . in contrast , for the velocities v x and v y both greater than the threshold , it is determined that the mouse device is moved with acceleration at the current time t n . on the other hand , if one of the velocities v x and v y is less than the threshold and the other is greater than the threshold , the present invention provides a further discriminating criterion for reconfirming whether the mouse device 10 is still on the supporting plane 20 or not . in an embodiment , the further discriminating step is performed by monitoring the voltage outputs in a much longer term than the primary discriminating step described above . for example , in the further discriminating step , previous 100 sampled voltage outputs are referred to . the determination of the still state of the mouse device in the further discriminating step is similar to that in the primary discriminating step described above . that is , as long as each of the sampled voltage outputs in each axis lies within a specified range or the deviation from a statistical average of the 100 cycles is less than a threshold , it is determined that the mouse device is still . the threshold used herein may be the same as or different from the threshold used in the primary discriminating step . the thresholds are preset and recorded in a memory device accessible by the microprocessor 14 . in brief , the angle θ x in x - axis and the angle θ y in y - axis are first estimated by the microprocessor 14 based on the formulae ( 5 ) and ( 6 ) when the mouse device 10 is in a still state or moved at a constant velocity on the slanting supporting plane 20 . afterwards , whenever the mouse device is moved , the actual motion accelerations a x ′ and a y ′ are calculated based on the formulae ( 3 ) and ( 4 ) introduced thereinto the angles θ x and θ y . after the actual motion accelerations a x ′ and a y ′ are realized , cursor control are performed by integrating the accelerations a x ′ and a y ′ with time to realize motion velocities v x ′ and v y ′, and integrating the motion velocities v x ′ and v y ′ with time to realize corresponding shifts in the x - axis and y - axis directions . the microprocessor 14 then processes the shifts in the x - axis and y - axis directions into a shift signal which is transmitted to the computer system for locating the destination of the cursor . in this way , the destination of the cursor can be relatively precisely located compared to prior art since the undesired component of gravity acceleration is offset . in addition to the tilting of the supporting plane , the precision of cursor control is also affected by user &# 39 ; s operating manners . for example , there might be a pivotal motion about z - axis while the user is moving the mouse device with his elbow or wrist as a pivot . the pivotal motion , since introducing a centrifugal force , adds an undesirable acceleration to the motion acceleration in the y - axis direction . the centrifugal force generated when the mouse device has an angular velocity about z - axis makes the motion acceleration in the y - axis direction imparted with an additional acceleration associated with the x - axis direction , i . e . ω z · v x , where ω z is the angular velocity and v x is the velocity of the mouse device in the x - axis direction . therefore , the component of centrifugal acceleration resulting from the pivotal motion of the mouse device about z - axis needs to be offset . furthermore , the tilting angles θ x and θ y are introduced thereinto a component of rotation angle θ z about z - axis and required to be calibrated into values θ x ′ and θ y ′. accordingly , the actual motion accelerations a x ″ and a y ″ in the x - axis and y - axis directions , respectively , are redefined as : a x ″=( v x − v ox )/ v sx − g · sinθ x ′ ( 7 ), a y ″=( v y − v oy )/ v sy − g · sinθ y ′− ω z · v x ( 8 ), wherein the determination of the parameters θ x ′, θ y ′, ω z and v x will be described hereinafter . the gyroscope 13 mentioned above with reference to fig1 a and fig1 b is used for determining the angular velocity ω z . when the mouse device 10 has an angular motion about z - axis , the gyroscope 13 detects the angular motion and outputs a voltage output v z to the microprocessor 14 accordingly . the microprocessor 14 then processes the voltage output v z into the angular velocity ω z based on the following formula : wherein v z denotes a voltage value outputted by the gyroscope 13 ; v oz denotes a third voltage offset or bias in measuring z - axis rotation ; and v sz denotes a third conversion coefficient , e . g . a third voltage sensitivity for the gyroscope 13 . the calibrated tilting angles θ x ′ and θ y ′ are defined as the following : wherein the rotation angle θ z about z - axis is determined by integrating the angular velocity ω z with time . the velocity v x in the x - axis direction can be determined by integrating the acceleration a x with time , as previously described . likewise , after the actual motion accelerations a x ″ and a y ″ are realized , cursor control are performed by integrating the accelerations a x ″ and a y ″ with time to realize motion velocities v x ″ and v y ″, and integrating the motion velocities v x ″ and v y ″ with time to realize corresponding shifts in the x - axis and y - axis directions . the microprocessor 14 then processes the shifts in the x - axis and y - axis directions into a shift signal which is transmitted to the computer system for locating the destination of the cursor . in this way , the destination of the cursor can be more precisely located compared to prior art since both the undesired component of gravity acceleration and the undesired component of centrifugal acceleration are offset . it is to be noted that in the above embodiments , it is assumed that the first and second accelerometers 11 and 12 are disposed in and parallel to the circuit board 101 which is further parallel to the bottom surface 104 . in practice , however , the first and second accelerometers 11 and 12 are hard to be perfectly parallel to the circuit board 101 and the circuit board is hard to be perfectly parallel to the bottom surface 104 . under this circumstance , the tilting angles should be further calibrated and the calibrated angles θ tx and θ ty relative to the horizon in x - axis and y - axis , respectively , are redefined as follows : wherein θ δx and θ δy are primitive tilting angles of the first and second accelerometers 11 and 12 relative to the circuit board 101 plus primitive tilting angles of the circuit board 101 relative to the bottom surface 104 . the angles θ δx and θ δy are previously measured and recorded in a memory accessible by the microprocessor 14 . in other words , the angles θ x and θ y in the formulae ( 3 ) and ( 4 ) are replaced with the calibrated angles θ tx and θ ty to realize motion accelerations a tx ′ and a ty ′. furthermore , with the rotation angle θ z about z - axis taken into account , the calibrated angles θ tx ′ and θ ty ′ relative to the horizon in x - axis and y - axis , respectively , are redefined as follows : θ tx ′= θ x · cosθ z + θ y · sinθ z + θ δx ( 14 ), θ ty ′= θ x · sinθ z + θ y · cosθ z + θ δy ( 15 ). in other words , the angles θ x ′ and θ y ′ in the formulae ( 7 ) and ( 8 ) are replaced with the calibrated angles θ tx ′ and θ ty ′ to realize motion accelerations a tx ″ and a ty ″. the acceleration - calibrating method described above is summarized in the flowcharts of fig3 a and fig3 b . in the above embodiments , the motion - sensing function of the mouse device is performed by two independent uni - axial sensing units . alternatively , the motion - sensing function of the mouse device may be performed by a single bi - axial sensing unit with two degrees of freedom . it is understood from the above descriptions that an inertial mouse device according to the present invention desirably performs calibration of accelerations to overcome the inherent limitations including a tilting supporting plane where the mouse device is rested , non - parallel installation of accelerometers on a circuit board of the mouse device , and centrifugal force accompanying manipulation of the mouse device so as to perform precise cursor control . while the invention has been described in terms of what is presently considered to be the most practical and preferred embodiments , it is to be understood that the invention needs not to be limited to the disclosed embodiment . on the contrary , it is intended to cover various modifications and similar arrangements included within the spirit and scope of the appended claims which are to be accorded with the broadest interpretation so as to encompass all such modifications and similar structures . | 6 |
referring now to the drawing figures , there is shown , in one preferred embodiment of my invention , an apparatus 10 for lifting , supporting and transporting a concrete finishing machine 12 ( fig1 only ) in a fully assembled state . the finishing machine 12 may be conventional type having an elongated double frame 14 from which is suspended a roller carriage assembly 16 and a pair of supporting standards 18 . such machines are used to finish the surfaces of concrete roadways and have heretofore been transportable between job sites only in a disassembled or broken down state . the apparatus 10 of the present example is in the form of a trailer having a chassis or frame 20 mounted on wheels 32 for travel overland and on roadways . a forward end of the frame 20 contains a pinal hook 24 ( fig1 only ) for connection in the usual manner to a pickup truck or other motor vehicle , not shown . the apparatus 10 includes a pair of spaced , parallel channels or guideways 26 and 28 containing elongated rubber or plastic mats 30 overlying a pair of slidable plates 31 and 32 along which the double frame 14 of the finishing machine 12 rests , which plates 31 and 32 are held at a fixed spacing with respect to one another by a pair of rigid cross members 33 and 34 . the channels 26 and 28 are rotatably mounted on four casters 36 which ride upon a circular steel track 38 supported upon portions of four channels 40 , 42 , 44 and 46 and connected side members 48 and 50 . a pivot pin assembly 52 connects to and through a plate 54 , which plate overlies and is attached to the channels 42 and 44 and thence through a cross member 56 which is , in turn , connected to the channels 26 and 28 to permit the channels to rotate . rotation of the channels 26 and 28 as , for example , from their positions as shown in fig3 to their positions as shown in fig4 is brought about merely by hand turning the frame 14 of the assembly 12 as in sits in the channels 26 and 28 . as shown most clearly in fig4 a first pair of large eye hooks 55 are affixed to forward end portions of the member 48 . a second pair of similar eye hooks 57 are connected to the undersides of forward end portions ( as viewed in fig3 ) of the channels 26 and 28 for rotational movement therewith . the eyes of the hooks 57 project upwardly from the sides of the channels 26 and 28 and are adapted to register over the eyes of the hooks 55 when the channels 26 and 28 are in the position shown in fig3 so that bolts or pins 63 ( see fig1 and 2 only ) can be inserted through registering pairs of the hooks 55 and 57 to lock the channels 26 and 28 in the traveling position . an elongated worm gear 58 extends from a collar 59 affixed to a side of the pivot pin assembly 52 to a collar 60 affixed to an upper surface of an angle bracket 61 . the bracket 61 is rigidly connected to and between rear end portions of the channels 26 and 28 ( see particularly fig3 - 4 ) so that it and the worm geaar 58 will rotate about the assembly 52 as the channels 26 and 28 rotate about the same axis . a handle and gear box 62 attached to the outer end of the worm gear 58 allows manual adjustment of the latter so that a worm 64 threadedly received on a central portion of the gear 58 and trapped within the cross member 33 causes a pressure to bear against the cross member 33 to translate or slide the plates 31 and 32 longitudinally in the channels 26 and 28 a distance of up to about eighteen inches for reasons later explained . a scissors lift or jack 64 having a first or outer pair of arms 66 pivotally connected at points 67 to a second or inner pair of arms 68 is adapted to extend and contract vertically in response to the operation of a hydraulic cylinder 70 to lift and lower the track 38 , pin assembly 52 , channels 26 and 28 and associated components . the cylinder 70 is pivotally connected to the chassis 20 and contains a movable piston which is pivotally connected to a cross member 72 which is , in turn , rigidly affixed to the arms 66 . pipes 74 and 76 ( see fig2 and 7 ) connected between central and upper end portions of the arms 68 , respectively , provide reinforcement and stability to the scissors lift 64 . the ends of the arms 66 are pivotally connected to lower and upper rollers 78 and 80 , respectively , while the arms 68 are pivotally connected to lower and upper rollers 82 and 84 , respectively . note that the rollers 78 and 80 on opposite ends of the arms 66 , while pivotal , are fixed and do not translate or roll along a course as the scissors lift 64 expands and contracts . on the other hand , the rollers 82 and 84 on opposite ends of the arms 68 not only pivot but roll along a course within lower and upper channels 86 and 88 as the lift 64 expands and contracts . the channels 86 are welded to the frame 20 . the channels 88 are , in reality , angle brackets welded onto channels and other existing structure to form a course for the rollers 84 and to confine the same which is a function similar to that of the channels 86 . now with reference particularly to fig8 the cylinder 70 is connected through a pilot operated check valve 90 to a hydraulic line 92 and thence to a hydraulic fluid pump 94 . a reservoir 96 contains hydraulic fluid for use by the pump 94 and the latter is driven by a 12 volt d . c . motor 97 . the motor 97 is connected through a switch 98 to a 12 volt battery 100 . a pilot line 102 connects the valve 90 to a hand - operated jack 104 . the hydraulic circuit is of conventional type . a safety feature resides in the hand jack 104 which must be pumped to a point wherein pressure in the line 102 is sufficiently high to overcome the effect of pressure in the line 92 to permit the check valve 90 to open and allow fluid to escape the cylinder 70 back to the reservoir 96 when the switch 98 is switched to the down mode . in the down mode , a handle of the switch 98 contacts and depresses a spring return switch to allow fluid to back up from the cylinder 70 through the line 92 to cause the cylinder 70 to retract to lower the load on the channels 26 and 28 . thus , the hydraulic circuit can not be put into the down mode without hand - operating the jack 104 to increase pressure in the pilot line 102 . in operation , the trailer 10 , having the channels 26 and 28 aligned as shown in fig4 is backed under a central portion of the double frame 14 of the concrete finishing machine 12 while the latter is set up on a job site . the frame members of the machine 12 are aligned over and along the mats 30 and plates 31 and 32 in the channels 26 and 28 . the channels 26 and 28 are then raised by the cylinder 70 until the mats 30 press tightly against the undersides of the frame 14 and lift the rollers 19 on the bottoms of the standards 18 off of the tubular tracks upon which they ride along the top of concrete barricades or the like on the job site . with the bearing pressure removed from the rollers 19 , the frame 14 is turned by hand so that the channels 26 and 28 are aligned as shown in fig1 - 3 and the rollers 19 are turned sideways and the standards are moved inwardly along the double frame 14 until they are suspended over the frame 20 of the trailer 10 as shown in fig4 . the pins 63 are then inserted in registering pairs of the eye hooks 55 and 57 to lock the channels 26 and 28 in the transport position as shown in fig1 - 3 . a pair of hand jacks 106 and 108 ( fig1 only ) are then raised to carry the bulk of the weight of the double frame 14 and remove the weight of the latter from bearing upon the scissors jack so that weight can be released from the cylinder 70 , whereby the latter can be relaxed . when reaching the job site with the machine 12 on the trailer 10 , the pins 63 are removed from the hooks 55 and 57 and the channels 26 and 28 are turned by hand - turning an end of the double frame 14 from the alignment of fig3 to the alignment of fig4 . the lift 64 can then be raised if necessary to place the rollers 19 in suspension at a level above where they are to be set upon rails . the trailer 10 is then backed into an approximate center position between the barricades along which the tubular rails lie and upon which the rollers 19 will ride . it will not matter that the trailer is too far to one side or the other between the barricades so long as the rollers 19 are within about eighteen inches of being aligned over the rails because the standards 18 can be moved along outer end portions of the double frame 14 to make up the difference and the worm gear 58 can be adjusted to move the plates 31 and 32 up to about eighteen inches to precisely align the rollers 19 over the rails on which they are to be set . although the present invention has been described and shown with respect to specific details of a certain preferred embodiment thereof , it is not intended that such details limit the scope and coverage of this patent otherwise than as is specifically set forth in the following claims . | 1 |
embodiments of the present invention provide methods and systems for a voltage converter that is capable of providing high energy to a high performance energy storage assembly for charging the energy storage assembly while efficiently and safely handling conditions of large relative differences between a line - in voltage and voltage level of the energy storage assembly while also being capable of use in reviving a energy storage assembly having a very low level state - of - charge . the following description is presented to enable one of ordinary skill in the art to make and use the invention and is provided in the context of a patent application and its requirements . in the following text , the terms “ energy storage assembly ” “ battery ”, “ cell ”, “ battery cell ” and “ battery cell pack ” “ electric double - layer capacitor ” and “ ultracapacitor ” may be used interchangeably ( unless the context indicates otherwise ” and may refer to any of a variety of different rechargeable configurations and cell chemistries including , but not limited to , lithium ion ( e . g ., lithium iron phosphate , lithium cobalt oxide , other lithium metal oxides , etc . ), lithium ion polymer , nickel metal hydride , nickel cadmium , nickel hydrogen , nickel zinc , silver zinc , or other chargeable high energy storage type / configuration . various modifications to the preferred embodiment and the generic principles and features described herein will be readily apparent to those skilled in the art . thus , the present invention is not intended to be limited to the embodiment shown but is to be accorded the widest scope consistent with the principles and features described herein . fig2 is a schematic block diagram of a bi - directional power factor correcting voltage converter 200 providing high energy to a high performance energy storage assembly 205 for charging energy storage assembly 205 while efficiently and safely handling conditions of large relative differences between a line - in voltage from an ac source 210 and a voltage level of energy storage assembly 205 . ac source 210 , e . g ., 240 volts , is coupled to an input of an optional emi filter 215 having an output coupled to a switching assembly including a pair of single - pole - double - throw switches ( switch s 2 and switch s 3 ). a first output port of emi filter 215 is coupled to a first throw of switch s 2 and a second output port of emi filter 215 is coupled to a first throw of switch s 3 . the switching assembly , responsive to its state , couples either ( i ) filtered line voltage from ac source 210 to a boost rectifier 220 or ( ii ) an auxiliary pole converter 225 to a modified boost rectifier 220 . a second throw of switch s 2 and of switch s 3 are coupled to auxiliary pole converter 225 and the first poles of switch s 2 and of switch s 3 are coupled to boost rectifier 220 . it will be appreciated that , due to the large power requirements , that one or more of the switches ( particularly switch s 2 and switch s 3 ) will be implemented by one or more contactors ( e . g ., relays or the like ). in standard operation , the switching assembly communicates the filtered line voltage from ac source 210 to boost rectifier 220 and then to energy storage assembly 205 to provide a standard charging current , for example a charging current of about 70 amps . the switching assembly does this by coupling the poles of switch s 2 and of switch s 3 to the first throws , respectively . in the special voltage condition situation , the switching assembly disconnects emi filter 215 from direct communication with boost rectifier 220 and communicates auxiliary pole converter 225 to energy storage assembly 205 through a modified boost rectifier 220 . auxiliary converter 225 provides a “ trickle ” current ( the trickle current may have substantial amps but is less than or equal to the standard charging current ), for example in the preferred embodiment the trickle current is about 35 amps in contrast to a standard charging current of 70 amps . the switching assembly does this by coupling the poles of switch s 2 and of switch s 3 to the second throws , respectively . a controller 230 sets the desired states and operation for the switches , transistors , and components of converter 200 as described herein . boost rectifier 220 may be constructed in various ways , a preferred implementation is shown in fig2 . boost rectifier 220 of the preferred implementation includes a pair of high current inductances ( l 1 and l 2 — though this implementation may be accomplished with a single inductance ) having first nodes coupled to a pole of switch s 2 and switch s 3 respectively and second nodes coupled to a full rectifying bridge having four npn insulated gate bipolar transistors q 1 - q 4 ( igbts ) and a smoothing capacitor c bus . ( in some implementations , a set of mosfets may be used .) emi filter 215 has a first output port coupled to a first throw of switch s 2 . the second node of inductance l 1 is coupled to an emitter of transistor q 3 and a collector of transistor q 4 . emi filter 215 has a second output port coupled to a first throw of switch s 3 . the second node of inductance l 2 is coupled to an emitter of transistor q 1 and a collector of transistor q 2 . the collectors of transistor q 1 and transistor q 3 are coupled to a first plate of smoothing capacitor c bus and a first terminal of energy storage assembly 205 . the emitters of transistor q 2 and transistor q 4 are coupled to a second plate of smoothing capacitor c bus and to a second terminal of energy storage assembly 205 . the components of boost rectifier 220 are sized for very high current levels , such as for example , currents used in charging the energy storage modules of an electric vehicle or other automotive or industrial application . as indicated above , these currents may be on the order of about 70 amps in the preferred embodiment . as noted above , there are times when the line - in voltage from ac source 210 is high and the voltage of energy storage assembly 205 is low that converter 200 does not operate properly without auxiliary converter 225 switched in - line . controller 230 detects this voltage condition and reconfigures converter 200 by switching in auxiliary pole converter 225 and modifying operation of boost rectifier 220 . to increase efficiency from reusing components , auxiliary pole converter 225 is switched in at the correct location to reuse inductances l 1 and l 2 which requires reconfiguration of transistors q 1 - q 4 as well to disable rectification and boosting in boost rectifier 220 . auxiliary pole converter 225 includes a rectifier 235 , an npn igbt q t , a diode d t , and a filter capacitor c t . when auxiliary pole converter 225 is switched in by coupling the poles of switch s 2 and switch s 3 to the second throws , respectively , controller 230 statically turns transistor q 2 and q 3 to the “ on ” state . a first input port of rectifier 235 is coupled to the first output port of emi filter 215 and a second input port of rectifier 235 is coupled to the second output port of emi filter 215 . a first rectified voltage node of rectifier 235 is coupled to a first plate of filter capacitor c t and to a collector of transistor q t . a second rectified voltage node of rectifier 235 is coupled to a second plate of filter capacitor c t , to an anode of diode d t , and to a second throw of switch s 3 . a cathode of diode d t is coupled to an emitter of transistor q t and to a second throw of switch s 2 . converter 200 controls current by switching transistor q t . components of auxiliary pole converter 225 are advantageously sized to be larger and supply a greater auxiliary trickle current than that provided by the prior art , in a more efficient manner , but still less charging current than the standard charging current . for example , the preferred implementation sizes the components of auxiliary pole converter 225 to provide about 35 amps of trickle current efficiently in contrast to the 7 amps provided by the prior art in a lossy manner . the efficiencies of the present invention include less energy lost through heat and less time spent in the trickle charge mode , resulting in a doubly efficient solution . additionally , as noted it is possible that with different energy storage module designs , it may become the case that converter 200 will operate more frequently in the special condition mode that would require more frequent use of auxiliary pole converter 225 . the more often that auxiliary pole converter 225 is needed , the greater the advantages of using the present invention , particularly in the high - performance automotive and industrial applications using high - performance energy storage modules . rectifier 220 does implement power factor correction in standard mode ( it can do power factor correction in standard mode but it will not do power factor correction in auxiliary mode ). for many implementations , power factor correction may not be a requirement , particularly as the non - standard charge situation addressed by auxiliary pole converter 225 is expected to be a temporary transient condition , and because of the present design providing significantly greater trickle currents , the time that the auxiliary pole is switched is greatly reduced . however , for some applications power factor correction may be required or desired . fig3 is a schematic block diagram of a power factor correcting voltage converter 300 providing high energy to a high performance energy storage assembly 305 for charging energy storage assembly 305 while efficiently and safely handling conditions of large relative differences between a line - in voltage from an ac source 310 and a voltage level of energy storage assembly 305 . ac source 310 , e . g ., 240 volts , is coupled to an input of an emi filter 315 having an output coupled to an input of a rectifier 320 . rectifier 320 includes a first rectified voltage node which is coupled to a first throw of a single pole , double throw switch s 2 . the pole of switch s 2 is coupled to a converter stage 325 and a second throw of switch s 2 is couple to an auxiliary pole converter 330 . it will be appreciated that , due to the large power requirements , that one or more of the switches ( particularly switch s 2 ) will be implemented by one or more contactors ( e . g ., relays or the like ). in standard operation , the pole of switch s 2 is coupled to the first throw which communicates the filtered rectified line voltage from ac source 310 to converter stage 325 and then to energy storage assembly 305 . in the special voltage condition situation , switch s 2 communicates auxiliary pole converter 330 to energy storage assembly 305 through a modified converter stage 325 by coupling the pole of switch s 2 to the second throw . auxiliary converter 330 provides a “ trickle ” current ( the trickle current may have substantial amps but is less than or equal to the standard charging current ), for example in the preferred embodiment the trickle current is about 35 amps in contrast to a standard charging current of 70 amps . a controller 335 sets the desired states and operation for the switches , transistors , and components of converter 300 . converter stage 325 may be constructed in various ways , a preferred implementation is shown in fig3 . converter stage 325 of the preferred implementation includes a high current inductance l 1 having a first node coupled to a pole of switch s 2 and a second node coupled to both an anode of a diode d 1 and to a collector of an npn igbt q 1 . a cathode of diode d 1 is coupled to a first plate of a smoothing capacitor c bus and a first terminal of energy storage assembly 305 . an emitter of transistor q 1 is coupled to a second rectified voltage node of rectifier 320 , a second plate of smoothing capacitor c bus and a second terminal of energy storage assembly 305 . the components of converter stage 325 are sized for very high current levels , such as for example , currents used in charging the energy storage modules of an electric vehicle or other automotive or industrial application . as indicated above , these currents may be on the order of about 70 amps in the preferred embodiment . as noted above , there are times when the line - in voltage from ac source 310 is high and the voltage on energy storage assembly 305 is low that converter 300 does not operate properly without auxiliary converter 330 switched in - line . controller 335 detects this condition and reconfigures converter 300 by switching in auxiliary pole converter 330 ( changing throws of switch s 2 and closing switch s 3 ) and reconfiguring operation of converter stage 325 . to increase efficiency from reusing components and to provide power factor correction , auxiliary pole converter 330 is switched in at the correct location to reuse rectifier 320 and inductance l 1 and controller 335 statically turns transistor q 1 “ off ” which puts diode d 1 in series with inductance l 1 ( and disables boosting of converter stage 325 ). auxiliary pole converter 330 includes an npn igbt q t , a diode d t , and a filter capacitor c t . a first terminal of a single pole single throw switch s 3 is coupled to the first rectified voltage node of rectifier 320 . a second terminal of switch s 3 is coupled to a first plate of filter capacitor c t and to a collector of transistor q t . a second plate of filter capacitor c t is coupled to the second rectified voltage node of rectifier 320 and to an anode of diode d t . a cathode of diode d t is coupled to an emitter of transistor q t and to a second throw of switch s 2 . when auxiliary pole converter 330 is switched in , controller 335 statically turns q 1 to the “ off ” state . converter 300 controls current in the special mode as auxiliary converter 330 acts as a buck converter reducing the line in voltage . components of auxiliary pole converter 330 are advantageously sized to be larger and supply a greater auxiliary trickle current than that provided by the prior art , in a more efficient manner , but still less than or equal to the standard charging current . for example , the preferred implementation sizes the components of auxiliary pole converter 330 to provide about 35 amps of trickle current efficiently in contrast to the 7 amps provided by the prior art in a lossy manner . the efficiencies of the present invention include less energy lost through heat and less time spent in the trickle charge mode , resulting in a doubly efficient solution . additionally , as noted it is possible that with different energy storage module designs , it may become the case that converter 300 will operate more frequently in the special condition mode that would require more frequent use of auxiliary pole converter 330 . the more often that auxiliary pole converter 330 is needed , the greater the advantages of using the present invention , particularly in the high - performance automotive and industrial applications using high - performance energy storage modules . it is also an attendant advantage of the disclosed embodiments that the voltage level from the auxiliary pole converters may be bucked down sufficiently low that the auxiliary pole converter voltages from converter 200 and converter 300 may be used in safely reviving a damaged battery module . the prior art is unable to provide a safe voltage for recharging such a battery module using the voltage drop across a resistor . the system above has been described in the preferred embodiment of charging a multicell energy storage module used in electric vehicle ( ev ) systems . in the description herein , numerous specific details are provided , such as examples of components and / or methods , to provide a thorough understanding of embodiments of the present invention . one skilled in the relevant art will recognize , however , that an embodiment of the invention can be practiced without one or more of the specific details , or with other apparatus , systems , assemblies , methods , components , materials , parts , and / or the like . in other instances , well - known structures , materials , or operations are not specifically shown or described in detail to avoid obscuring aspects of embodiments of the present invention . reference throughout this specification to “ one embodiment ”, “ an embodiment ”, or “ a specific embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention and not necessarily in all embodiments . thus , respective appearances of the phrases “ in one embodiment ”, “ in an embodiment ”, or “ in a specific embodiment ” in various places throughout this specification are not necessarily referring to the same embodiment . furthermore , the particular features , structures , or characteristics of any specific embodiment of the present invention may be combined in any suitable manner with one or more other embodiments . it is to be understood that other variations and modifications of the embodiments of the present invention described and illustrated herein are possible in light of the teachings herein and are to be considered as part of the spirit and scope of the present invention . it will also be appreciated that one or more of the elements depicted in the drawings / figures can also be implemented in a more separated or integrated manner , or even removed or rendered as inoperable in certain cases , as is useful in accordance with a particular application . additionally , any signal arrows in the drawings / figures should be considered only as exemplary , and not limiting , unless otherwise specifically noted . furthermore , the term “ or ” as used herein is generally intended to mean “ and / or ” unless otherwise indicated . combinations of components or steps will also be considered as being noted , where terminology is foreseen as rendering the ability to separate or combine is unclear . as used in the description herein and throughout the claims that follow , “ a ”, “ an ”, and “ the ” includes plural references unless the context clearly dictates otherwise . also , as used in the description herein and throughout the claims that follow , the meaning of “ in ” includes “ in ” and “ on ” unless the context clearly dictates otherwise . the foregoing description of illustrated embodiments of the present invention , including what is described in the abstract , is not intended to be exhaustive or to limit the invention to the precise forms disclosed herein . while specific embodiments of , and examples for , the invention are described herein for illustrative purposes only , various equivalent modifications are possible within the spirit and scope of the present invention , as those skilled in the relevant art will recognize and appreciate . as indicated , these modifications may be made to the present invention in light of the foregoing description of illustrated embodiments of the present invention and are to be included within the spirit and scope of the present invention . thus , while the present invention has been described herein with reference to particular embodiments thereof , a latitude of modification , various changes and substitutions are intended in the foregoing disclosures , and it will be appreciated that in some instances some features of embodiments of the invention will be employed without a corresponding use of other features without departing from the scope and spirit of the invention as set forth . therefore , many modifications may be made to adapt a particular situation or material to the essential scope and spirit of the present invention . it is intended that the invention not be limited to the particular terms used in following claims and / or to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include any and all embodiments and equivalents falling within the scope of the appended claims . thus , the scope of the invention is to be determined solely by the appended claims . | 8 |
[ 0029 ] fig1 is a block diagram of a video signal processing apparatus of the present invention . the invention is intended for a wide range of input composite video signals ( including synchronizing signals ) such as muse tv composite video signals , ntsc tv composite video signals , and high definition baseband tv composite signals . a signal selector 1 selects a video signal , a clamping circuit 2 adjusts the dc level , and an analog - to - digital converter 3 converts the video signal to a digital video signal . the digital video signal is then supplied to a first programmable signal processor 4 and an input synchronizing signal processor 8 . the input synchronizing signal processor 8 separates and regenerates the synchronizing signal from the input video signal and also generates a clock signal phase - locked to the horizontal phase standard signal of the input video signal . [ 0031 ] fig2 is a block diagram of the input synchronizing signal processor 8 . the input synchronizing signal processor 8 comprises a programmable counter in order to process multiple input composite video signals . such processor can be provided with a structure to switch functions and operations of each block according to multiple input composite video signals . first , a synchronizing signal detector 20 separates the horizontal synchronizing signal component and vertical synchronizing signal component from the digital video signal . for ntsc tv composite video signals , the dc level of the synchronizing signal is specified to be lower than the black level of the video signal . therefore , horizontal and vertical synchronizing signal components are separable by integrating the output after slicing based on the appropriate slice level setting in a synchronizing signal separator . for muse tv composite video signals , a frame synchronizing pulse , which is the vertical synchronizing signal component , is detectable by autocorrelation with time . the horizontal synchronizing signal component is separable by a counter activated by said frame synchronizing pulse . a digital composite video signal is input to the memory 25 for the synchronizing standard signal . in the case of muse tv composite video signals , the memory 25 extracts the waveform of the horizontal phase standard signal mixed in the composite video signal . in the case of ntsc tv composite video signals , the memory extracts a color burst signal for regenerating color subcarrier . the extracted digital signal waveform is sent to a cpu 12 . via the operation of a loop filter , the input voltage v 28 to be applied to the input voltage terminal 28 of a vco is calculated by the cpu and supplied to a vco 11 a to form a feedback loop . the vco 11 a is a wideband variable clock generator controlled by dc voltage , and is capable of generating a wideband clock pulse , for example , about 32 mhz for muse tv composite video signals , 28 mhz for ntsc tv composite video signals , and 50 mhz for vga ( video graphics array ) employing , for example , a positive feedback oscillator as an oscillation source . the output clock pulse φ 29 of the vco 11 a is sent to the analog - to - digital converter 3 , the programmable processor 4 , and the input synchronizing signal processor 8 , and used as a system clock pulse . the output horizontal synchronizing pulse from the synchronizing signal detector 20 is not used as it is , and requires to be stabilized using a feedback loop in order to process non - standard ntsc composite video signals such as reconstruction signals of the vtr . a horizontal synchronizing phase detector 21 a detects any phase error between the generated horizontal synchronizing pulse and the horizontal synchronizing signal detected by the horizontal synchronizing phase detector 21 a . the detection result is sent to the cpu 12 for calculating the dividing ratio to be used for a horizontal rate programmable counter 23 a to cancel the phase error . the cpu 12 sends the calculation result to the horizontal rate programmable counter 23 a to form a feedback loop . said calculation result indicates the number of input system clock pulses in one horizontal scanning period . the divided output of said horizontal rate programmable counter 23 is sent to a memory 5 as a write address . any phase error below the cycle frequency of the system clock is detected by the cpu 12 as a horizontal skew , and such phase error can be absorbed by applying a phase correction which cancels the skew in the programmable processor 4 . in addition , the pulse generating counter 24 a adjusts the divided output of the horizontal rate programmable counter 23 a to the required phase and pulse width , and sends it to an output synchronizing pulse processor 9 as a detected horizontal synchronizing pulse φ 31 . the pulse generating counter 24 a also adjusts the vertical synchronizing signal detected by the synchronizing signal detector 20 in fig2 to the required phase and pulse width , and outputs it as a detected vertical synchronizing pulse φ 32 . meanwhile , the digital video signal which has been input to the programmable processor 4 is decoded according to the format of the input video signal . fig5 is a preferred embodiment of a block diagram of the programmable processor . a processing element 50 is aligned in matrix based on mimd ( multiple instruction multiple data stream ) system , and each processing element 50 is connected by lattice network wiring . the processing element 50 comprises an arithmetic and logic unit ( alu ), an instruction register which controls the alu , and a data register for inputting numerical values . each register is connected to the cpu 12 by an exclusive wire so that methods of signal processing are dynamically changeable by rewriting the register according to the standard of input video signal or type of decode mode . table 1 is a comparison between the signal process of programmable signal processors and each signal format . as shown in table 1 , the programmable signal processor 4 separates y / c , decodes the chrominance signal , and processes acc for decoding ntsc tv composite video signals . for decoding ed 2 tv composite video signals , the programmable signal processor 4 separates y / c , decodes the chrominance signal , processes acc , and processes the horizontal high - emphasis signal ( hh ). the input system clock pulses φ 29 are used for these processes . for decoding muse tv composite video signals , the programmable signal processor 4 interpolates the still picture region and moving picture region of the signal , detects motion , and processes progressive scanning . signals decoded with the programmable signal processor 4 are written into the memory 5 for synchronizing with the system clock pulse for display . in general , regardless of asynchronous or synchronous processing , a readable / writable memory ( so - called read modified write ) is used for sending and receiving digital signals between circuits operated by different system clock signals . the write address for the memory 5 is formed by the input system clock pulse φ 29 generated from the input synchronizing signal processor 8 which generates an input synchronizing signal and a range of pulses synchronized to it . next , the output synchronizing pulse processor 9 is explained with reference to fig3 . the horizontal synchronizing signal φ 31 , vertical synchronizing signal φ 32 and external synchronizing signal φ 16 detected by the input synchronizing signal processor 8 form the phase - locked loop ( pll ) for synchronizing the system clock for display to the external synchronizing signal φ 16 . for picture - in - picture display tv sets , the external synchronizing signal φ 16 uses the synchronizing signal of the video signal to be displayed in the main picture as the standard of the synchronizing pulse for display , and generate an address data , based on the standard , for storing the video signal to be displayed in the sub - picture in the memory 5 . fig2 and fig3 omit signal processing of the external synchronizing signal , but the memory 5 can be synchronized to the external synchronizing signal just by switching over the write address . a write address generator is operated by field periodically , when inputting the external synchronizing signal , to absorb the difference in frame frequency . when inputting the internal synchronizing signal , the write address generator is operated by frame periodically . the picture - in - picture display is realized by writing two types of asynchronous digital video signals to the memory using the external synchronizing signal φ 16 , the input system clock pulse φ 69 synchronized to the signal φ 16 , and the internal input system clock pulse φ 29 , and reading out the digital video signal from the memory 5 using the same system clock pulses for display . for ntsc composite video signals , it is necessary to match the number of clock pulses to the display width ( number of picture elements ) for every line because video signal processing , such as interpolation of horizontal scanning line signals , is executed by line . it is also necessary to generate a clock pulse phase - locked to the line frequency ( horizontal scanning frequency ). a horizontal phase detector 21 b detects any phase error between the horizontal synchronizing pulse φ 34 generated from a horizontal rate programmable counter 23 b , which divides the approximately 28 - mhz clock to { fraction ( 1 / 1820 )}, and the detected horizontal synchronizing pulse φ 31 . the detection result is calculated with the cpu 12 to convert the result to voltage , and it is output as v 28 from the input voltage terminal 28 to control the oscillation frequency of a vco 11 b . the vco 11 b adds the output system clock φ 33 , synchronized to the horizontal scanning frequency of display apparatus , to the horizontal programmable counter 23 b to form a feedback loop . the synchronizing pulse processor for display apparatus 9 always operates with reference to the output system clock φ 33 as a standard clock . in general , the time constant of said feedback loop is set very long to form a stable output system clock locked to the line frequency of the input video signal and to avoid the influence of jitters from the input horizontal synchronizing signal . the horizontal rate programmable counter 23 b which is controlled by the horizontal synchronizing pulse adjusts the output horizontal scanning rate pulse to the required phase and pulse width using a pulse generator with counter 24 b , and outputs the pulse as a horizontal synchronizing pulse φ 35 for display . in the same way , the pulse generator with counter 24 b adjusts the phase and pulse width of the detected vertical synchronizing pulse and outputs it as a vertical synchronizing pulse φ 36 . for muse tv composite video signals , the frequency of the system clock signal φ 33 for display is approximately 44 mhz and the dividing ratio used in the horizontal rate programmable counter 23 b controlled by the horizontal synchronizing pulse is { fraction ( 1 / 1320 )}. the vco 11 a and vco 11 b are variable oscillators adjustable from about 10 mhz to 50 mhz in order to correspond to wideband output signals . the read - out address of the memory 5 is created in the output synchronizing pulse processor 9 . for ntsc tv composite video signals and muse tv composite video signals , the line memory is used to process video signals by line and convert read - out phase and frequency using the output system clock φ 33 . the programmable signal processor 6 decodes the composite video signal using the output system clock 33 and the output synchronizing pulse . as shown in table 1 , for decoding ntsc tv composite video signals , processes including line signal interpolation , caption signal insertion , and picture quality compensation are executed . for decoding ed2 signals , processes including line signal interpolation , regeneration of vertical temporal - emphasis processing signal ( vt ) or vertical high - emphasis processing signal ( vh ), caption signal insertion , and picture quality compensation are executed . multiple signal processing programs are stored in the rom , and the cpu 12 loads the required program for decoding video signals into the instruction register of the programmable signal processor depending on the type of video signal detected . decoded composite video signals are converted to analog signals via the digital - to - analog converter 7 , and output as video signals for display . at the same time , the output synchronizing pulse processor 9 generates a synchronizing pulse φ 18 which is shaped to the pulse waveform . [ 0050 ] fig4 illustrates a deflection signal generator 10 . when the display apparatus is a cathode ray tube ( crt ), the pulses driving the horizontal output transistor are fed back to a horizontal phase detector 21 c and form a pll circuit comprising the horizontal synchronizing pulse to stabilize the special operation of the horizontal deflection circuit for crt . the horizontal phase detector 21 c detects any frequency or phase errors between the output horizontal synchronizing pulse φ 35 and the pulses driving the horizontal output transistor φ 41 for deflection . the detection result is input to the cpu 12 , which contains a horizontal scanning signal processor which forms a feedback loop to calculate any phase error . the value to compensate for the calculated phase error is set as the dividing ratio to a horizontal rate programmable counter 23 c . next , the pulse generator with counter 24 c adjusts the phase and pulse width of the output of the horizontal rate programmable counter 23 c . since the above processes are executed in a unit of the system clock for display , any phase error below the clock rate of the system clock for display φ 33 is ignored . ( in other words , the system does not respond to such phase error .) a compensation circuit to the skew of clock signal 40 compensates continuously , in analog , the phase error calculated by the horizontal synchronizing signal processor forming a feedback loop in the cpu 12 , amplifies the pulse waveform of the generated horizontal frequency , and outputs it as the horizontal deflection output pulse φ 42 . the pulse generator with counter 24 c shapes the waveform of the vertical synchronizing output pulse φ 36 and outputs it as the vertical deflection output pulse φ 43 . depend on the horizontal deflection output pulse φ 42 and the vertical deflection output pulse φ 43 . by programmably switching operation of the deflection circuit according to the standard of video signals to be displayed , multiple display formats can be accepted . the present invention has programmable signal processors connected to the input terminal and the output terminal of the memory , thereby enabling one video signal processor to process video signals of many different broadcasting systems which have different synchronizing signal frequencies , field frequencies , and sampling frequencies , and data signals composed of composite synchronizing signals which have different sampling frequencies . | 7 |
an apparatus embodying the invention is shown generally at 10 in fig1 and comprises basically a photoplotter 12 and an associated control system 14 . the photoplotter 12 includes a table 16 having an upwardly facing horizontal support surface 18 for supporting a sheet 20 having an upwardly facing photosensitive surface 22 . an x - carriage 24 is movable in the illustrated x - coordinate direction by an associated drive motor 26 . for example , the drive motor 26 may rotate in unison two pinions ( not shown ) located at opposite ends of the carriage 24 and each engaging a rack extending along the associated side edge of the table . the x - carriage 24 supports a y - carriage 28 for movement relative to the x - carriage in the illustrated y - coordinate direction , the power for such motion , for example , being an associated motor 30 carried by the carriage 24 which turns a lead screw 32 also carried by the carriage 24 . a photohead 34 is carried by the y - carriage 28 and is operable in a flashing manner to repetitively project a spot 36 of light onto the photosensitive surface 22 . therefore , by moving the photohead 34 along a desired line or trace relative to the sheet 20 , by simultaneously driving the carriage 24 and carriage 28 in the x - and y - coordinate directions , while the photohead is operated to repetitively project spots of light , a line , such as the line 38 , may be exposed on the photosensitive surface 22 provided the speed of the photohead relative to the photosensitive surface is so related to the flash rate of the photohead that the projected spots overlap one another on the photosensitive surface . the exposure of lines on the photosensitive surface 22 is usually done for the purpose of creating some sort of graphic such as that of a printed circuit mask , on the sheet 20 , and such graphic usually involves the drawing of lines of many different widths . to allow for the exposure of different width lines , the photohead 34 has a large number of apertures of different size any one which may be selectively positioned between the flash lamp and the photosensitive surface 22 to control the size of the spot 36 exposed with each flash of the lamp . the arrangement and manner of selecting the apertures may vary widely . fig2 by way of example , shows the apertures to be provided by an aperture wheel 40 forming part of the photohead 34 and including a plurality of aperture plates 42 , 42 arranged along its outer periphery with each aperture plate 42 having an aperture 44 , the size of which varies from aperture plate to aperture plate . associated with the aperture wheel 40 is a flash lamp 46 located above the wheel . the wheel is rotatable about a vertical axis 48 by a motorized aperture select mechanism 50 , in response to an aperture select signal appearing on an input line 52 , to bring any selected one of the apertures 44 , 44 of the wheel into the path of the light emitted by the flash lamp during each flash . the light passing through the selected aperture 44 is then projected onto the photosensitive surface 22 of the sheet 25 by a projecting lens system 54 so that a focused spot 36 is imaged onto the photosensitive surface 22 during each flash of the lamp with the spot having a size directly related to the size of the selected aperture 44 . within the broader aspects of the invention , the apertures may have various shapes , but in the ususal case , and as illustrated , the apertures are circular in shape so that their sizes may be defined , as is hereinafter done , in terms of their diameters or in terms of the diameters of the spots exposed by the apertures . hereinafter , the &# 34 ; size &# 34 ; of an aperture is taken to be the diameter of the spot 36 which it creates on the surface 22 . that is , a 30 mil aperture is one which creates a spot having a 30 mil diameter . as also shown in fig2 the flashing of the flash lamp 46 is controlled by a flashing circuit 56 which causes the lamp 46 to flash at a rate commanded by a flash rate command signal appearing on an input line 58 . at this point it should be noted that a flash lamp in combination with its flashing circuit has a maximum achievable flash rate . that is , any attempt to drive the flash lamp at a higher rate causes it to miss flashes , to produce flashes of low intensity or to otherwise malfunction . in the illustrated case the maximum achievable flash rate for the flash lamp 46 is taken to be 5 kc . referring again to fig1 the control system 14 for the photoplotter 12 may vary in detail but basically includes a controller 60 , having a computer , of generally known construction for controlling the movement of the photohead 34 relative to the sheet 20 in the x and y coordinate directions and for otherwise controlling and supervising the functioning of the photohead 34 to cause it to expose the desired lines on the sheet 20 . the motors 26 and 30 may be servo motors responsive to analog signals supplied by the controller 60 , but in the illustrated case they are taken to be step motors each supplied with stepping pulses from the controller 60 through the lines 62 and 64 respectively . associated with the controller 60 is a tachometer means 66 which provides a speed signal on the line 68 having a value directly related to the speed of the photohead 34 relative to the photosensitive surface 22 . again , this tachometer means may take various different forms depending on the nature of the drive system used to move the photohead , but in the illustrated case , and by way of example , the tachometer means 66 includes an x - tachometer 70 associated with the line 62 and a y - tachometer 72 associated with the line 64 . the x - tachometer senses the stepping pulses appearing on the line 62 and produces an output signal x on the line 74 related to the frequency of the stepping pulses on line 62 and accordingly related to the speed at which the photohead is driven in the x - coordinate direction . likewise , the y - tachometer 72 produces a signal y on the line 76 related to the speed of movement of the photohead 34 in the y - coordinate direction . these two signals x and y are then combined in the computing circuit 78 to produce an output voltage signal v having a value related to the resultant speed of the photohead relative to the photosensitive surface . this voltage signal v is supplied to a voltage to frequency circuit 80 which produces as the speed signal on the line 68 a chain of speed pulses 82 , 82 having a repetition rate directly related to the speed of the photohead relative to the photosensitive surface . the flash lamp 46 is flashed at a rate dependent on the speed of the photohead 34 relative to the photosensitive surface . to achieve this the speed signal appearing on the line 68 is divided by a divisor or division factor to produce a flash rate command signal supplied to the line 52 . in the system of fig1 this division is performed by a dividing circuit 84 using a division factor supplied through the lines 86 by a memory 88 . the memory 88 stores a plurality of division factors associated on a one - to - one basis with the apertures 44 , 44 of the aperture wheel 40 and operates when a particular aperture is selected by the aperture select signal appearing on line 52 to supply the division factor associated with that aperture to the dividing circuit 84 through the lines 86 . the size of the selected aperture in combination with the rate at which the flash lamp is flashed for a given speed of movement of the photohead determines the number of flashes produced per spot diameter , and thus the division factor sent to the dividing circuit 84 by the memory 88 for each selected aperture sets a precise value on the number of flashes produced for each diameter of movement along the line to be exposed . preferably , the memory is so constructed that the information stored in it can be easily varied at the will of the operator to change the value of the division factor associated with each aperture . for this purpose , as shown in fig1 the memory may have associated with it a keyboard 90 or similar device allowing the operator to make changes in the stored information . in addition to supplying the dividing circuit 84 with a division factor for each selected aperture , the memory 88 also , for each selected aperture , provides the controller 60 with a velocity limit signal over the line 92 . this velocity limit signal has a magnitude argument , such as a digitally encoded quantity , having a value directly related to a limit velocity at which the photohead 34 is to be driven relative to the photosensitive surface 22 . this limit velocity is in turn so related to the size of the selected aperture , the division factor and the maximum achievable flash rate of the flash lamp that when the photohead is driven at the limit velocity the flash lamp will be flashed at a rate equal to or slightly less than the maximum achievable flash rate . thus , for each selected aperture the photohead is driven at as fast a maximum speed as possible taking into account the maximum achievable flash rate of the flash lamp and the desired quality of the exposed line . the memory 88 may separately store a plurality of division factors for the plurality of apertures and also separately store a plurality of velocity limit signals for the apertures , or it may include computing circuitry for computing one or the other of such factors and signals from other quantities stored in the memory . given the size of the selected aperture , the maximum achievable velocity or turning speed of the photohead and the maximum achievable flash rate of the flash lamp the ( 1 ) division factor , ( 2 ) velocity limit signal and ( 3 ) the number flashes per spot diameter are so interelated that only one of these three quantities need be selected and stored in the memory , the other two values being calculatable from the selected one . for simplifying the design of the dividing circuit 84 the division factors preferably are restricted to whole numbers and are the quantities which are directly subject to change by the operator in the first instance . given the desired division factor to use with a given aperture , the velocity limit associated with the aperture can be found by the following equation : ## equ1 ## where : v l = velocity limit in inches per minute of the photohead relative to the photosensitive surface for a given aperture . vhm = maximum achievable velocity ( tracing speed ) in inches per minute of the photothead relative to photosensitive surface . fl m = maximum achievable flash rate of the flash lamp in flashes per second . ft m = repetition rate of speed pulses in pulses per second output by the tachometer at the maximum achievable velocity ( vh m ) of the photohead relative to the sheet . also , given the division factor to use with a given aperture , the number of flashes per spot diameter it will produce is given by the following equation : ## equ2 ## where : a maximum achievable flash rate , fl m of 5 kc , a maximum tracing speed , vh m of 3600 inches per minute , and a maximum output of the tachometer , ft m of 450 kc an exemplary schedule of division factors , velocity limits and flashes per spot diameter associated with a set of apertures may , for example , be as follows : ______________________________________aperture ( spot ) division velocity limit flashes persize ( mils ) factor ( inches per min ) spot diameter______________________________________ 2 5 200 3 . 00 4 9 360 3 . 33 8 10 400 6 . 0010 11 440 6 . 8220 19 760 7 . 930 25 1000 9 . 0040 30 1200 10 . 0050 35 1400 10 . 7180 50 2000 12 . 00120 70 2800 12 . 86160 90 3600 13 . 33______________________________________ the operation of the fig1 system in drawing a line with a thirty mil aperture ( spot size ) and another line with an 80 mil aperture ( spot size ), assuming the conditions of the table set out above , is shown in fig3 . considering the line drawn with the 30 mil aperture , the plotter 34 starts at zero speed at the beginning of the line . the speed is then gradually increased by the controller 60 , during the &# 34 ; up - ramp &# 34 ; portion of the process , until the velocity limit speed of 1000 inches per minute is reached as dictated by the velocity limit signal supplied by the memory 88 to the computer 60 . point a represents the reaching of this limit velocity , and this limit velocity is maintained until reaching point b after which the plotter speed is reduced gradually until the end of the line is reached at point c , the phase from point b to point c being the &# 34 ; down - ramp &# 34 ; portion of the process . a feature of the invention is that during all phases of this line drawing process -- that is , during the &# 34 ; up - ramp &# 34 ; portion oa , during the constant velocity portion ab and , during the &# 34 ; down - ramp &# 34 ; portion bc , the number of flashes per spot diameter remains constant , the number of flashes per spot diameter for the 30 mil aperture of fig3 being 9 . in the case of the 80 mil aperture illustrated in fig3 the line drawing process is substantially the same as that for the 30 mil aperture except for the photohead reaching a higher limit speed . that is , when drawing with the 80 mil aperture the photohead 34 undergoes a gradual increase in speed between the points 0 and d until reaching the limit velocity of 2000 inches per minute dictated by the velocity limit signal supplied by the memory 88 to the controller 60 . this limit velocity is maintained until the point d , after which the photohead speed is gradually reduced between the points e and f . during all phases of this drawing with the 80 mil aperture the exposure takes place at the rate of 12 flashes per spot diameter as set out in the table . of course , it will be understood that by changing the division factors from those shown in the above table other numbers of flashes per spot diameter may be obtained for any aperture to vary the quality of the line exposed by that aperture . | 6 |
a security label constructed in accordance with an embodiment of the invention is illustrated in fig1 and 2 and generally designated 10 . the security label includes one or more individual piggyback labels 30 , each optionally including one or more authentication features 32 . the label is secured to a bulk container 100 . although the container shown is a conventional container that contains material , the term “ container ” as used herein refers to storage devices that store materials and / or products in an interior of the device , as well as devices that store material and / or products partially or fully outside the device . referring now to fig2 , the security label 10 includes a primary label 12 constructed of conventional label stock . the label stock may be constructed of paper , plastic , synthetic resin , metal , foil , or any other suitable material . disposed on the underside of the primary label 12 is a first adhesive 18 , which is of sufficient peel strength to secure the security label 10 to the bulk container 100 . in one embodiment , the adhesive 18 is a pressure - sensitive adhesive , however other adhesives or cements may be used as desired . the primary label 12 may also include an information field 11 consisting of information such as a product identifier , a manufacturer name , the lot number of the contents of the bulk container to which the label is adhered , a number of units of product in the bulk container , a number of units of the contents that are transferable to a second container , a mass , a volume , an expiration date , or any other useful information . the information fields used herein may be applied by hand or with a mechanical apparatus and can include words , symbols , numbers , barcodes , patterns , colors or other information as desired . a second adhesive layer 14 secures a release liner 16 to the primary label 12 . the adhesive may be of any type suitable for holding the release liner in place . the release liner may include tamper - evident indicia ( not shown ) that is revealed when the liner is exposed . optionally , however , the release liner 16 and second adhesive layer 14 may be substituted with a release agent ( not shown ) associated with the primary label 12 . the piggyback labels 30 may be removably disposed on the release agent . as shown in fig2 , one or more piggyback labels 30 are disposed on the release liner 16 . the piggyback labels collectively may be of the same dimension and therefore occupy the same space as the release liner 16 to provide a clean appearance . each piggyback label may include a label base 34 removably secured to the release liner with the third adhesive 36 . the piggyback label base 34 may be constructed of paper , plastic , synthetic resin , metal , foil or any other suitable material . each piggyback label 30 may further include a piggyback label information field 35 which includes any of the information recited above in the information field 11 of the primary label 10 . although the security label illustrated includes multiple piggyback labels , it is to be understood that any number of piggyback labels may be used . the piggyback labels 30 include an authentication feature 32 , which , as shown , is visible on the exterior of the piggyback label . the authentication feature 32 of the present invention may be any feature or combination of features that facilitates authentication of articles labeled with the piggyback label by overt , covert or forensic inspection . for example , the authentication feature may be a unique , fine - print layer , a microchip , a barcode , an ink , a coating , a unique number , a lenticular construction or the like . the authentication feature may also be any diffractive or holographic layer . as used herein , “ diffractive layer ” means a layer which exhibits an optical diffractive effect when exposed to light . such diffractive layers and holographic layers resist unauthorized photocopy duplication of the security label and / or piggyback label to provide an extra measure of security . suitable diffractive layers and holographic layers are described in u . s . pat . no . 6 , 533 , 180 to wood , which is hereby incorporated by reference . as will be understood , any of the above authentication features may also be placed in whole or in part on the primary label . the security labels 10 are fabricated from a continuous web ( not shown ) using conventional techniques . the piggyback label 30 are likewise manufactured from a continuous web and precut as individual labels . the piggyback labels 130 are secured to each respective primary label at spaced locations , and preferably , regularly spaced locations . the authenticating features may be secured to the piggyback labels 30 before , after or as the piggyback labels are joined with the primary labels . indicia is printed on the primary and / or piggyback labels with conventional printing techniques . once manufactured , a security label 10 of the invention is applied to a container 100 to indicate the contents of the container . the container 100 may be large plastic bulk container adapted to hold a large bulk quantity of pharmaceutical products , such as pills , tablets , capsules , powder or liquid . typically , the manufacturer of the pharmaceutical or other contents of the container applies the label before or after filling the container with the contents . after the container is filled in bulk , a cap 101 is applied to secure the pharmaceutical products in the container 100 . the filled bulk container is shipped to a pharmacy and entered into inventory . in one embodiment of the invention , a pharmacist or other licensed dispenser of pharmaceutical products obtains a prescription from patient &# 39 ; s health care provider . the pharmacist reviews the prescription and determines the appropriate pharmaceutical product to supply to the patient . the pharmacist then reviews the inventory of bulk pharmaceutical products stored in bulk containers at his disposal . the pharmacist may consult the information field 11 provided on the security labels 10 to confirm the contents of each respective bulk container 100 . with reference to fig3 , the pharmacist obtains the bulk container 100 that contains the drug identified in the prescription . the pharmacists removes a portion of the drugs , for example , a number of tablets 200 , from the bulk container . the pharmacist weighs , counts , measures the volume or otherwise evaluates the portion of the pharmaceutical products removed from the bulk container to ensure the quantity and / or mass matches that of the prescription . such measurement may be conducted using conventional apparatus such as scale , counters or volumetric measuring devices 600 . in another step , the pharmacist obtains a second container 500 , which in most cases is smaller than the bulk container 100 because it is required to hold to contain less product . the pharmacist transfers the pharmaceutical product 200 , to the second container . before or after this transfer , the pharmacist accesses the security label 10 on the bulk container 100 . where the security label 10 includes an expanded content device of the alternative embodiment described below , the pharmacist may open the expanded content label to access one or more piggyback labels for transfer to the container 500 . as desired , the security label may include instructions for the user to access the piggyback labels and / or how to place the labels on the consumer container . the pharmacist removes one or more piggyback labels 30 and transfers it to the consumer container 500 . upon removal of a piggyback label 30 from the primary label , a tamper - evident feature present on the primary label or in the release liner may be exposed , as explained in further detail below . as described above , the piggyback label includes an authentication feature 32 which , of course , is transferred with the piggyback label to the secondary consumer container 500 . the pharmacist may then secure the contents of the container 500 by placing a top or otherwise sealing the secondary container 500 . with the container labeled with the piggyback label 330 , a consumer c or other person may confirm that the drugs contained within the secondary container 500 are authentic and / or genuine , that is , that the pharmaceutical contents of the container 500 are exactly what they say they are . moreover , one can be certain that the contents of the second container 500 were transferred from a bulk container that contained genuine pharmaceutical products supplied directly by the pharmaceutical product manufacturer or intermediaries . optionally , where pharmaceutical products are dispensed in consistent , known increments from the bulk container 100 , the release liner may include indicia that represents the remaining number or volume of pharmaceutical products in the bulk container . accordingly , when a piggyback label is removed , a message appears to the remover that a certain amount of product remains in the container 100 . in turn , this assists the pharmacy in determining when it will be necessary to reorder pharmaceutical product . an alternative embodiment of the present invention will now be described with reference to fig4 and 5 , which illustrate an expanded content security label 110 including an expanded content device . an “ expanded content device ” means any booklet , pamphlet or construct of single or multiple leaflets , or formed as a single page or a number of pages , or a single panel or a number of panels , regardless of whether the leaflets are bound or unbound or folded relative to one another . the leaflets or pages or panels may be printed with any indicia including text or graphics of any kind . as shown , the expanded content security label 110 includes a map - like , expanded content device 119 , however , the expanded content device may open like the pages of a book , or any other configuration that makes accessing the piggyback labels or viewing information that is optionally included on the expanded content device 119 . the expanded content security label 110 also includes a primary label 112 having an adhesive on its underside . this adhesive may be identical to that in the embodiment described above . a folded - over primary panel 115 is secured to the primary label 112 with an adhesive 117 . in any configuration desired , the piggyback labels 130 are secured to the panel 115 , or where multiple pages are used , the piggyback labels may be secured to one or more of the individual pages . these piggyback labels may be substantially the same as those described in the embodiment above . for example , each piggyback label 13 may include a base 134 secured to a release liner 116 with an adhesive 136 , and authentication feature 132 . an overlaminate 140 overlays the booklet 119 , which includes the piggyback labels 130 secured thereto . the overlaminate is secured to the panel 115 with an adhesive 142 along at least one side . on another side , the overlaminate 140 is secured to a release coating 24 on or adjacent the primary label 112 . this release coating 24 provides excellent sealing and resealing characteristics , whereby the booklet 119 may be accessed many times while still being resealable by adhering the overlaminate 140 to the release coating with adhesive 142 . as shown in fig5 , the overlaminate 140 is transparent so that information field 142 on the uppermost portion of the leaflet is visible . optionally , the overlaminate 140 may be opaque . as will be understood , the overlaminate 140 may be secured to the primary label base 112 in any manner desired . optionally , the primary panel 115 may be adhered directly to the primary label base 112 . in this configuration , the overlaminate is adhered directly to the primary label base 112 as well . furthermore , the overlaminate need not be resealable . for example , the overlaminate may include perforated marginal portions so that the bulk overlaminate can be torn from the marginal portions to expose the booklet 119 . the above descriptions are those of the preferred embodiments of the invention . various alterations and changes can be made without departing from the spirit and broader aspects of the invention as defined in the appended claims , which are to be interpreted in accordance with the principles of patent law including the doctrine of equivalents . any references to claim elements in the singular , for example , using the articles “ a ,” “ an ,” “ the ,” or “ said ,” is not to be construed as limiting the element to the singular . | 0 |
the present invention is directed to the preparation of a series of room temperature , highly luminescent zns - capped cdse (( cdse ) zns ) nanocrystallites having a narrow particle size distribution . nanocrystallites of the present invention exhibit high quantum yields greater than about 30 % and preferably in the range of about 30 - 50 % and a narrow band edge luminescence spanning most of the visible spectrum from 470 nm to 625 nm . the core of the nanocrystallites is substantially monodisperse . by monodisperse , as that term is used herein , it is meant a colloidal system in which the suspended particles have substantially identical size and shape . for the purposes of the present invention , monodisperse particles deviate less than 10 % in rms diameter in the core , and preferably less than 5 % in the core . when capped quantum dots of the invention are illuminated with a primary light source , a secondary emission of light occurs of a frequency that corresponds to the band gap of the semiconductor material used in the quantum dot . as previously discussed , the band gap is a function of the size of the nanocrystallite . as a result of the narrow size distribution of the capped nanocrystallites of the invention , the illuminated quantum dots emit light of a narrow spectral range resulting in high purity light . spectral emissions in a narrow range of no greater than about 60 nm , preferably 40 nm and most preferably 30 nm at full width half max ( fwhm ) are observed . the present invention also is directed to a method of making capped quantum dots with a narrow particle size distribution . the capped quantum dots of the invention may be produced using a two step synthesis in which a size selected nanocrystallite is first synthesized and then overcoated with a passivation layer of a preselected thickness . in preferred embodiments , processing parameters such as reaction temperature , extent of monodispersity and layer thickness may be monitored during crystal growth and overcoating to provide a coated quantum dot of narrow particle size distribution , high spectral purity and high quantum efficiency . “ quantum yield ” as that term is used herein , means the ratio of photons emitted to that absorbed , e . g ., the photoluminescence quantum yield . the method is described for a ( cdse ) zns quantum dot , but it is understood that the method may be applied in the preparation of a variety of known semiconductor materials . the first step of a two step procedure for the synthesis of ( cdse ) zns quantum dots involves the preparation of nearly monodisperse cdse nanocrystallites . the particles range in size from about 23 å to about 55 å with a particle size distribution of about 5 - 10 %. these dots are referred to as “ bare ” dots . the cdse dots are obtained using a high temperature colloidal growth process , followed by size selective precipitation . the high temperature colloidal growth process is accomplished by rapid injection of the appropriate organometallic precursor into a hot coordinating solvent to produce a temporally discrete homogeneous nucleation . temporally discrete nucleation is attained by a rapid increase in the reagent concentration upon injection , resulting in an abrupt supersaturation which is relieved by the formation of nuclei and followed by growth on the initially formed nuclei . slow growth and annealing in the coordinating solvent results in uniform surface derivatization and regularity in the core structure . injection of reagents into the hot reaction solvent results in a short burst of homogeneous nucleation . the depletion of reagents through nucleation and the sudden temperature drop associated with the introduction of room temperature reagents prevents further nucleation . the solution then may be gently heated to reestablish the solution temperature . gentle reheating allows for growth and annealing of the crystallites . the higher surface free energy of the small crystallites makes them less stable with respect to dissolution in the solvent than larger crystallites . the net result of this stability gradient is the slow diffusion of material from small particles to the surface of large particles (“ ostwald ripening ”). growth of this kind results in a highly monodisperse colloidal suspension from systems which may initially be highly polydisperse . both the average size and the size distribution of the crystallites in a sample are dependent on the growth temperature . the growth temperature necessary to maintain steady growth increases with increasing average crystal size . as the size distribution sharpens , the temperature may be raised to maintain steady growth . as the size distribution sharpens , the temperature may be raised in 5 - 10 ° c . increments to maintain steady growth . conversely , if the size distribution begins to spread , the temperature may be decreased 5 - 10 ° c . to encourage ostwald ripening and uniform crystal growth . generally , nanocrystallites 40 angstroms in diameter can be grown in 2 - 4 hours in a temperature range of 250 - 280 ° c . larger samples ( 60 angstroms or more ) can take days to grow and require temperatures as high as 320 ° c . the growth period may be shortened significantly ( e . g ., to hours ) by using a higher temperature or by adding additional precursor materials . size distribution during the growth stage of the reaction may be approximated by monitoring the absorption line widths of the particles . modification of the reaction temperature in response to changes in the absorption spectrum of the particles allows the maintenance of a sharp particle size distribution during growth . it is also contemplated that reactants could be added to the nucleation solution during crystal growth to grow larger crystals . the particle size distribution may be further refined by size selective precipitation . in a preferred embodiment , this may be accomplished by manipulation of solvent composition of the nanocrystallite suspension . the cdse nanocrystallites are stabilized in solution by the formation of a lyophilic coating of alkyl groups on the crystallite outer surface . the alkyl groups are provided by the coordinating solvent used during the growth period . the interparticle repulsive force introduced by the lyophilic coating prevents aggregation of the particles in solution . the effectiveness of the stabilization is strongly dependent upon the interaction of the alkyl groups with the solvent . gradual addition of a non - solvent will lead to the size - dependent flocculation of the nanocrystallites . non - solvents are those solvents in which the groups which may be associated with the crystallite outer surface show no great affinity . in the present example , where the coordinating group is an alkyl group , suitable non - solvents include low molecular weight alcohols such as methanol , propanol and butanol . this phenomenon may be used to further narrow the particle size distribution of the nanocrystallites by a size - selective precipitation process . upon sequential addition of a non - solvent , the largest particles are the first to flocculate . the removal of a subset of flocculated particles from the initial solution results in the narrowing of the particle size distribution in both the precipitate and the supernatant . a wealth of potential organometallic precursors and high boiling point coordinating solvents exist which may used in the preparation of cdse dots . organometallic precursors are selected for their stability , ease of preparation and clean decomposition products and low cracking temperatures . a particularly suitable organometallic precursor for use as a cd source include alkyl cadmium compounds , such as cdme 2 . suitable organometallic precursors for use as a se source include , bis ( trimethylsilyl ) selenium (( tms ) 2 se ), ( tri - n - octylphosphine ) selenide ( topse ) and trialkyl phosphine selenides , such as ( tri - n - butylphosphine ) selenide ( tbpse ). other suitable precursors may include both cadmium and selenium in the same molecule . alkyl phosphines and alkyl phosphine oxide be used as a high boiling coordinating solvent ; however , other coordinating solvents , such as pyridines , furans , and amines may also be suitable for the nanocrystallite production . the preparation of monodisperse cdse quantum dots has been described in detail in murray et al . ( j . am . chem . soc ., 115 : 8706 ( 1993 )), which is hereby incorporated in its entirety by reference . next , the cdse particles are overcoated by introducing a solution containing zinc and sulfur precursors in a coordinating solvent ( e . g ., top ) into a suspension of cdse nanocrystallites at the desired temperature . the temperature at which the dots are overcoated is related to the quality of the resultant composite particle . overcoating the cdse particles at relatively higher temperatures may cause the cdse seed crystals to begin to grow via ostwald ripening and deterioration of the size distribution of the particles leading to broader spectral line widths . overcoating the particles at relatively low temperatures could lead to incomplete decomposition of the precursors or to reduced crystallinity of the zns shell . an ideal growth temperature may be determined for each cdse core size to ensure that the size distribution of the cores remains constant and that shells with a high degree of crystallinity are formed . in preferred embodiments , cdse crystallites are overcoated using diethyl zinc and hexamethyldisilathiane as the zinc and sulfur precursors . cdse crystallites having a diameter in the range of about 23å - 30 å are overcoated at a temperature in the range of about 135 - 145 ° c ., and preferably about 140 ° c . similarly , nanocrystallites having a diameter of about 35 å , 40 å , 48 å , and 55 å , respectively , are overcoated at a temperature of about 155 - 165 ° c ., and preferably about 160 ° c ., 175 - 185 ° c . and preferably about 180 ° c ., about 195 - 205 ° c ., and preferably about 200 ° c ., and about 215 - 225 ° c ., and preferably about 220 ° c ., respectively . the actual temperature ranges may vary , dependent upon the relative stability of the precursors and the crystallite core and overlayer composition . these temperature ranges may need to be modified 10 - 20 ° c ., depending upon the relative stability of the precursors . for example , when the more stable trialkyl phosphine chalcogenides ( like topse ) are used , higher temperatures are employed . the resulting ( cdse ) zns composite particles are also passivated with topo / top on their outermost surface . the zns precursor solution concentration and the rate of its addition to the cdse particles is selected to promote heterogeneous growth of zns onto the cdse nuclei instead of homogeneous nucleation to produce zns particles . conditions favoring heterogeneous growth include dropwise addition , e . g ., 1 - 2 drops / second , of the zns precursor solution to the cdse solution and maintenance of the zns precursor solution at low concentrations . low concentrations typically range from 0 . 0005 - 0 . 5 m . in some preferred embodiments , it may be desirable to include a final purification step in which the overcoated dots are subjected to size selective precipitation to further assure that mainly only ( cdse ) zns composite particles are present in the final product . in other embodiments , it may be desirable to modify the crystallite outer surface to permit formation of stable suspensions of the capped quantum dots . the outer surface of the nanocrystal includes an organic layer derived from the coordinating solvent used during the capping layer growth process . the crystallite surface may be modified by repeated exposure to an excess of a competing coordinating group . for example , a dispersion of the capped quantum dot may be treated a coordinating organic compound , such as pyridine , to produce crystallites which dispersed readily in pyridine , methanol , and aromatics but no longer dispersed in aliphatics . such a surface exchange process may be carried out using a variety of compounds which are capable of coordinating or bonding to the outer surface of the capped quantum dot , such as by way of example , phosphines , thiols , amines and phosphates . in other embodiments , the capped quantum dots may be exposed to short chained polymers which exhibit an affinity for the capped surface on one and which terminate in a moiety having an affinity for the suspension or dispersion medium . such affinity improves the stability of the suspension and discourages flocculation of the capped quantum dots . the synthesis described above produces overcoated quantum dots with a range of core and shell sizes . significantly , the method of the invention allows both the size distribution of the nanocrystallites and the thickness of the overcoating to be independently controlled . fig1 shows the absorption spectra of cdse dots with a particle size distribution of ( a ) 23 å , ( b ) 42 å , ( c ) 48 å and ( d ) 55 å in diameter before ( dashed lines ) and after ( solid lines ) overcoating with 1 - 2 monolayers of zns . by “ monolayer ” as that term is used herein , it is meant a shell of zns which measures 3 . 1 å ( the distance between consecutive planes along the [ 002 ] axis in the bulk wurtzite zns ) along the major axis of the prolate shaped dots . the absorption spectra represents the wavelength and intensity of absorption of light which is absorbed by the quantum dot . fig1 indicates a small shift in the absorption spectra to the red ( lower energies ) after overcoating due to the partial leakage of the exciton into the zns matrix . this red shift is more pronounced in smaller dots where the leakage of the exciton into the zns shell has a more dramatic effect on the confinement energies of the charge carriers . fig2 shows the room temperature photoluminescence spectra ( pl ) of the samples shown in fig1 before ( dashed lines ) and after ( solid lines ) overcoating with zns . the pl quantum yield increases from 5 - 15 % for bare dots to values ranging from 30 % to 50 % for dots passivated with zns . the pl spectra are much more intense due to their higher quantum yield of ( a ) 40 %, ( b ) 50 %, ( c ) 35 % and ( d ) 30 %, respectively . the quantum yield reaches a maximum value with the addition of approximately 1 . 3 monolayers of zns . a decrease in quantum yields at higher zns coverages may be due to the formation of defects in the zns shell . a color photograph demonstrates the wide spectral range of luminescence from the ( cdse ) zns composite quantum dots of the present invention . see , for example , fig3 of u . s . pat . no . 6 , 207 , 229 , which is incorporated by reference in its entirety . the photograph shows six different samples of zns overcoated cdse dots dispersed in dilute hexane solutions and placed in identical quartz cuvettes . the samples were irradiated with 356 nm ultraviolet light from a uv lamp in order to observe luminescence from all solutions at once . as the size of the cdse core increased , the color of the luminescence shows a continuous progression from the blue through the green , yellow , orange to red . their pl peaks occur at ( going from right to left in fig3 of u . s . pat . no . 6 , 207 , 229 ) ( a ) 470 nm , ( b ) 480 nm , ( c ) 520 nm , ( d ) 560 mn , ( e ) 594 nm and ( f ) 620 nm . in contrast , in the smallest sizes of bare topo - capped dots , the color of the pl is normally dominated by broad deep trap emissions and appears as faint white light . in order to demonstrate the effect of zns passivation on the optical and structural properties of cdse dots , a large quantity of ˜ 40 å (± 10 %) diameter cdse dots were overcoated with varying amounts of zn and s precursors under identical temperatures and variable times . the result was a series of samples with similar cdse cores , but with varying zns shell thicknesses . fig3 shows the progression of the absorption spectrum for these samples with zns coverages of approximately 0 ( bare topo capped cdse ), 0 . 65 , 1 . 3 , 2 . 6 and 5 . 3 monolayers . the right hand side of the figure shows the long wavelength region of the absorption spectra showing the lowest energy optical transitions . the spectra demonstrate an increased red - shift with the thicker zns overcoating as well as a broadening of the first peak in the spectra due to increased polydispersity of shell thicknesses . the left hand side of the spectra show the ultra - violet region of the spectra indicating an increased absorption at higher energies with increasing zns thickness due to direct absorption into the higher zns band gap zns shell . the evolution of the pl for the same ˜ 40 å diameter cdse dots with zns coverage is displayed in fig4 . as the coverage of zns on the cdse surface increases one observes a dramatic increase in the fluorescence quantum yield followed by a steady decline after ˜ 1 . 3 monolayers of zns . the spectra are red shifted ( slightly more than the shift in the absorption spectra ) and show an increased broadening at higher coverages . the inset to fig4 charts the evolution of the quantum yield for these dots as a function of the zns shell thickness . for this particular sample , the quantum yield started at 15 % for the bare topo capped cdse dots and increased with the addition of zns approaching a maximum value of 50 % at approximately ˜ 1 . 3 monolayer coverage . at higher coverages , the quantum yield began to decrease steadily until it reached a value of about 30 % at about 5 monolayers coverage . although the invention has been described with reference to the preparation and performance of cdse ( zns ), it will be readily apparent that the method of preparation may be used to obtain monodisperse overcoated quantum dots with various combinations of nanocrystallite core and overcoating . the method of the invention permits the preparation of a variety of capped nanocrystals having a very narrow particle size distribution and exhibiting improvements in color purity and intensity of their photoluminescent emissions . it is contemplated that a variety of cadmium chalcogenides , for example , cdx , where x = s , se , te may be prepared and overcoated according to the method of the invention . it is further contemplated that the overcoating may be varied and may include , by way of example only , zns , znse , cds and mixtures thereof . the invention is described with reference to the following examples , which are presented for the purpose of illustration and which are not intended to be limiting of the invention , the scope of which is set forth in the claims which follow this specification . preparation of cdse . trioctylphosphine oxide ( topo , 90 % pure ) and trioctylphosphine ( top , 95 % pure ) were obtained from strem and fluka , respectively . dimethyl cadmium ( cdme 2 ) and diethyl zinc ( znet 2 ) were purchased from alfa and fluka , respectively , and both materials were filtered separately through a 0 . 2 μm filter in an inert atmosphere box . trioctylphosphine selenide was prepare by dissolving 0 . 1 mols of se shot in 100 ml of top thus producing a 1 m solution of topse . hexamethyl ( disilathiane ) ( tms 2 s ) was used as purchased from aldrich . hplc grade n - hexane , methanol , pyridine and n - butanol were purchased from em sciences . the typical preparation of top / topo capped cdse nanocrystallites follows . topo ( 30 g ) was placed in a flask and dried under vacuum (˜ 1 torr ) at 180 ° c . for 1 hour . the flask was then filled with nitrogen and heated to 350 ° c . in an inert atmosphere drybox the following injection solution was prepared : cdme 2 ( 200 microliters , 2 . 78 mol ), 1 m topse solution ( 4 . 0 ml , 4 . 0 mmol ), and top ( 16 ml ). the injection solution was thoroughly mixed , loaded into a syringe , and removed from the drybox . the heat was removed from the reaction flask and the reagent mixture was delivered into the vigorously stirring topo with a single continuous injection . this produces a deep yellow / orange solution with a sharp absorption feature at 470 - 500 nm and a sudden temperature decrease to ˜ 240 ° c . heating was restored to the reaction flask and the temperature was gradually raised to 260 - 280 ° c . aliquots of the reaction solution were removed at regular intervals ( 5 - 10 min ) and absorption spectra taken to monitor the growth of the crystallites . the best samples were prepared over a period of a few hours steady growth by modulating the growth temperature in response to changes in the size distribution , as estimated from the sharpness of the features in the absorption spectra . the temperature was lowered 5 - 10 ° c . in response to an increase in the size distribution . alternatively , the reaction can also be stopped at this point . when growth appears to stop , the temperature is raised 5 - 10 ° c . when the desired absorption characteristics were observed , the reaction flask was allowed to cool to ˜ 60 ° c . and 20 ml of butanol were added to prevent solidification of the topo . addition of a large excess of methanol causes the particles to flocculate . the flocculate was separated from the supernatant liquid by centrifugation ; the resulting powder can be dispersed in a variety of organic solvents ( alkanes , ethers , chloroform , tetrahydrofuran , toluene , etc .) to produce an optically clear solution . size - selective precipitation . nanocrystallites were dispersed in a solution of ˜ 10 % butanol in hexane . methanol was then added dropwise to this stirring solution until opalescence persisted . separation of supernatant and flocculate by centrifugation produced a precipitate enriched with the largest crystallites in the sample . this procedure was repeated until no further sharpening of the optical absorption spectrum was noted . size - selective precipitation can be carried out in a variety of solvent / nonsolvent pairs , including pyridine / hexane and chloroform / methanol . surface exchange . crystallite surface derivatization can be modified by repeated exposure to an excess of a competing capping group . heating to ˜ 60 ° c . a mixture of ˜ 50 mg of topo / top capped crystallites and 5 - 10 ml of pyridine gradually dispersed the crystallites in the solvent . treatment of the dispersion with excess hexane resulted in the flocculation of the crystallites which are then isolated by centrifugation . the process of dispersion in pyridine and flocculation with hexane was repeated a number of times to produce crystallites which dispersed readily in pyridine , methanol , and aromatics but no longer dispersed in aliphatics . preparation of cdse . a second route to the production of cdse core replaces the phosphine chalcogenide precursors in example 1 with ( tms ) 2 se . the smallest (˜ 12 å ) cdse species are produced under milder conditions with injection and growth carried out at ˜ 100 ° c . the product was further treated as described in example 1 . preparation of ( cdse ) zns . nearly monodisperse cdse quantum dots ranging from 23 å to 55 å in diameter were synthesized and purified via size - selective precipitation as described in example 1 . a flask containing 5 g of topo was heated to 190 ° c . under vacuum for several hours then cooled to 60 ° c . after which 0 . 5 ml trioctylphosphine ( top ) was added . roughly 0 . 1 - 0 . 4 μmols of cdse dots dispersed in hexane were transferred into the reaction vessel via syringe and the solvent was pumped off . diethyl zinc ( znet 2 ) and hexamethyldisilathiane (( tms ) 2 s ) were used as the zn and s precursors , respectively . the amounts of zn and s precursors needed to grow a zns shell of desired thickness for each cdse sample were determined as follows : first , the average radius of the cdse dots was estimated from tem or saxs measurements . next , the ratio of zns to cdse necessary to form a shell of desired thickness was calculated based on the ratio of the shell volume to that of the core assuming a spherical core and shell and taking into account the bulk lattice parameters of cdse and zns . for larger particles the ratio of zn to cd necessary to achieve the same thickness shell is less than for the smaller dots . the actual amount of zns that grows onto the cdse cores was generally less than the amount added due to incomplete reaction of the precursors and to loss of some material on the walls of the flask during the addition . equimolar amounts of the precursors were dissolved in 2 - 4 ml top inside an inert atmosphere glove box . the precursor solution was loaded into a syringe and transferred to an addition funnel attached to the reaction flask . the reaction flask containing cdse dots dispersed in topo and top was heated under an atmosphere of n 2 . the temperature at which the precursors were added ranged from 140 ° c . for 23 å diameter dots to 220 ° c . for 55 å diameter dots . when the desired temperature was reached the zn and s precursors were added dropwise to the vigorously stirring reaction mixture over a period of 5 - 10 minutes . after the addition was complete the mixture was cooled to 90 ° c . and left stirring for several hours . butanol ( 5 ml ) was added to the mixture to prevent the topo from solidifying upon cooling to room temperature . the overcoated particles were stored in their growth solution to ensure that the surface of the dots remained passivated with topo . they were later recovered in powder form by precipitating with methanol and redispersing into a variety of solvents including hexane , chloroform , toluene , thf and pyridine . in some cases , the as - grown cdse crystallites were judged to be sufficiently monodisperse that no size - selective precipitation was performed . once these cdse particles had grown to the desired size , the temperature of the reaction flask was lowered and the zn and s precursors were added dropwise to form the overcapping . optical characterization . uv - visible absorption spectra were acquired on an hp 8452 diode array spectrophotometer . dilute solutions of dots in hexane were placed in 1 cm quartz cuvettes and their absorption and corresponding florescence were measured . the photoluminescence spectra were taken on a spex fluorolog - 2 spectrometer in front face collection mode . the room temperature quantum yields were determined by comparing the integrated emission of the dots in solution to the emission of a solution of rhodamine 590 or rhodamine 640 of identical optical density at the excitation wavelength . | 8 |
fig1 is a block diagram that schematically illustrates a computer network system 20 , in accordance with a preferred embodiment of the present invention . a server 22 communicates with clients 24 via a wide - area network ( wan ) 26 , typically the internet . to prevent ddos attacks on server 22 , a guard device 28 intercepts incoming packets from network 26 that are addressed to server 22 . optionally , the guard device may process outgoing traffic , as well . the guard device compares the ip source address and ttl field of each packet that it intercepts against reference values stored in a database 30 . ( although in the present embodiment database 30 is used to store ip / ttl records , it will be understood that substantially any suitable memory device and data structure may be used for storing this information , and not only a database .) if the source address and ttl value of an incoming packet match an entry in database 30 , guard device 28 passes the packet on to server 22 . alternatively , further anti - ddos processing measures may be carried out before the packet is delivered to the server . otherwise , if the source address and ttl value do not match an entry in the database , the guard device regards the packet as suspect and , typically , either discards the packet or passes it on to the server with limiting conditions . for example , the packet may be passed on with reduced priority or limited rate , or with a certain queuing service option or some randomly - selected limitation . the methods used by the guard device in building database 30 and validating incoming packets are described in detail hereinbelow . typically , guard device 28 comprises a general - purpose computer , which is programmed in software to carry out the functions described herein . the software may be downloaded to the computer in electronic form , over a network , for example , or it may alternatively be supplied to the computer on tangible media , such as cd - rom . further alternatively , guard device 28 may be implemented in dedicated hardware logic , or using a combination of hardware and software elements . the guard device may be a standalone unit , or it may alternatively be integrated with other communication or computing equipment , such as a firewall or intrusion detection system . for the sake of simplicity , fig1 shows guard device 28 as protecting only server 22 . in practical applications , however , the guard device may be used to protect a cluster , of servers , or it may be used to protect an entire lan , intranet or a collection of servers whose traffic is diverted to the guard device . the guard device may be deployed in configurations similar to firewalls known in the art . the methods described hereinbelow for detecting spoofed packets may also be used by a standalone computer , running appropriate software , without a separate guard device . before describing in detail the methods of operation of guard device 28 , it will be useful to review certain features of the ttl field and its use in ip networks . time - to - live ( ttl ) is a mechanism used in ip to ensure that packets never travel more than a limited number of hops in the internet . the value of the field is initialized to some value t , which is the bound on the number of hops the packet is allowed to traverse in the network . each router should decrement the ttl value of each packet passing through it . if the ttl value drops to zero , the packet is removed ( dropped ) from the internet . at any point in the network , the ttl value of an incoming packet originating from some source depends on the initial ttl value that was set by the source . different operating systems initialize the ttl field in ip packets they create to different values . the standard initial value is 256 , but other initial values that are known to exist are 128 ( windows ), 64 ( unix ), 60 , 32 and 30 . thus , when examining the ttl value of a packet , its initial value should be taken into account . because the vast majority of source - destination path lengths in the internet are smaller than even the smallest initial ttl value ( 30 ), it is generally possible to infer the number of hops the packet traversed from the source based on the value that appears in the packet at a given examination point . because some of the possible initial ttl values are confusingly close ( for example , 64 and 60 , or 32 and 30 ), it may be necessary in some cases to record two alternative path length values . ( note , however , that the operating systems that use initial ttl values of 60 and 30 are old and may become obsolete .) some operating systems use different initial ttl values for different transport protocols ( such as the user datagram protocol — udp and transport control protocol — tcp ). therefore , in authenticating ttl values , the transport protocol may be taken into consideration , as well . the ttl value of any packet received from the internet is a function of the length of the internet path between the packet source and the destination the paths taken by successive packets can change , however , so that different packets from the same source may have different ttl values . therefore , a mismatch between the ttl value of a packet received by guard device 28 and the reference value stored in database 30 is not conclusive evidence that the packet is spoofed . 1 . failures in the internet . 2 . changes in routing policies used in the internet . 3 . changes in the internet infrastructure or topology ( such as addition of a new link ). 4 . load balancing mechanisms . 5 . use of network address translator ( nat ) machines for internet access . 6 . protocol - dependent path variations , due to transport - layer processing at the packet source , for example , or to processing by intermediate devices , such as firewall machines . the first three types of events are generally rare , and typically result in stabilization of the characteristic ttl at a new value after a few seconds . guard device 28 can then validate the new value ( as described below ) and store it in database 30 . in practice , the inventors have found that more than 90 % of ip addresses exhibit stable ttl values over any given 24 - hour period . the last three types of events typically lead to continual variations of the ttl value within a small , consistent range . therefore , generally speaking , guard device 28 should be tolerant of small deviations of the ttl values of incoming packets from the corresponding values in database 30 . furthermore , a given packet source may generate different ip packets with different initial ttl values . as noted above , some operating systems use different initial ttl values for different transport protocols . as another example , when a packet must be retransmitted , due to a tcp timeout , the packet source often sets the initial ttl value to 256 in order to give the packet a longer internet lifetime , rather than the default initial ttl value that is usually used . guard device 28 is preferably programmed to recognize such eventualities and to allow the retransmitted packet to reach server 22 . thus , if the guard device determines that the characteristic ttl value for packets received from a given source address is 103 , for example , representing 25 hops from an initial value of 128 , then the guard device should also be prepared to accept packets from this source address with a ttl values of 231 , and possibly 39 , 35 , 7 and 5 , as well . moreover , as noted above , the actual number of hops traversed by a packet may be ambiguous . for example , if the received ttl value is 56 , the path length can be either 4 hops ( corresponding to an initial ttl value of 60 ) or 8 ( initial ttl value of 64 ). in such cases , guard device 28 may consider all the possible ttl values . additional ambiguity may arise because of the protocol - dependent initial ttl values used by some operating systems . when there are ambiguities of this sort , guard device 28 may use a confidence rating system to classify incoming packets with ttl values that may be correct , rather than a simple “ go / no go .” database 30 may hold reference ttl values as either absolute values ( such as 103 in the example above ), relative values ( 25 in this example ) or both . to keep this reference data up to date , guard device 28 preferably rechecks the values periodically , using the verification procedure described below . preferably , only authenticated ip source / ttl entries are kept in the database . to save memory space , the guard device may manage the database as a cache , discarding old entries that have not been used recently . as a further means for saving memory and processing time , database 30 may hold ttl values by subnet ( a ttl value for each different 24 - bit ip address prefix , for example ), in addition to or instead of entries for individual ip source addresses . fig2 is a flow chart that schematically illustrates a method used by guard device 28 for validating incoming packets from network 26 , in accordance with a preferred embodiment of the present invention . the method may be initiated when the guard device receives an incoming packet from the network , at a packet interception step 40 . alternatively , guard device 28 may become active only under stress conditions , in which a ddos attack on server 22 is suspected , due to particularly heavy incoming traffic or to other traffic statistics . in this case , some additional trigger is required for step 40 . for example , guard device 28 may become active when it detects an unusually large number of incoming tcp syn - ack or dns request packets . furthermore , some incoming packets may not be subject to suspicion , and therefore need not be validated by the guard device . for example , once a tcp connection has been established between server 22 and one of clients 24 , using the conventional tcp three - way handshake , each side of the connection can be certain that the ip address of the other side is legitimate , not spoofed . therefore , guard device 28 preferably allows tcp / ip packets on established connections to pass through to server 22 without interruption for validation . handling of the tcp handshake itself by the guard device is described further hereinbelow . on the other hand , all packets sent over connectionless protocols , such as udp or icmp , must generally be validated . packets using the domain name system ( dns ) protocol must generally be validated , as well . the need to validate packets of other protocol types ( or the absence of such need ) will be apparent to those skilled in the art . guard device 28 checks the ip source address of the incoming packet against database 30 , at a record checking step 42 . if there is a record in the database corresponding to this source address , the guard device checks the ttl value held in the database against the ttl value recorded in the packet header . the comparison may be either exact or relative . in exact comparison , the ttl value of the incoming packet must match the record in the database exactly . thus , if the ttl value recorded in the database is 103 ( as in the example cited earlier ), then the incoming packet is considered valid only if its ttl value is exactly 103 . the advantage of this approach is that it reduces the probability that a hacker mounting a ddos attack will successfully guess the correct ttl value to insert in a spoofed packet . the exact match criterion may be relaxed by ± 1 or ± 2 ttl steps in order to account for small variations due to load balancing , nat machines and protocol - dependent effects , as noted above . note that the exact comparison approach rejects ttl variations that may arise due to different initial ttl settings , as described above . alternatively or additionally , guard device 28 may validate an ip source address based on the ttl value . as long as an ip address is considered valid , the guard device allows all traffic from the address to pass through to server 22 . an ip source address can be validated , for example , simply by testing an incoming packet from the address . if the ttl value of the packet is correct , the ip source address is then considered valid for a certain period of time . as another example , the ip source address may be validated if the fraction of packets arriving from the address that have the correct ttl value is reasonably large ( say 20 %). the benefit of such an ip validation is that it allows faster handling of most packets , and reduces the overhead associated with testing the ttl . in relative comparison , guard device 28 checks the number of hops that the incoming packet has taken , rather than the exact value of the ttl field . in other words , referring again to the example above , if a value of 25 hops is recorded in database 30 for a given ip source address , then ttl values of 5 , 7 , 35 , 39 , 103 and 231 will be considered valid . as noted above , when there is more than one probable value for the number of hops , there may be even more possible ttl values . relative comparison , in contrast to exact comparison , reduces the likelihood of rejecting valid packets . when ttl values are stored in database 30 by subnet , only relative comparison can generally be used , since different packet sources in the same subnet may have different operating systems and will therefore set different initial ttl values . the relative match criteria are also preferably relaxed by a number of ttl steps to account for the small variations mentioned above , as well as for differences in path length within a subnet when database 30 stores ttl values by subnet . if the ttl value of the incoming packet matches the database value , guard device 28 allows the packet to pass on for further processing , at a packet delivery step 44 . the matching ttl value does not conclusively prove that the packet is not spoofed , since there is a certain probability that a hacker will have correctly guessed the expected ttl value . therefore , the packet may be subject to further anti - ddos processing before it is submitted to the server . alternatively , guard device 28 may pass the packet through directly to server 22 . in any case , the probability of a spoofed packet reaching the server is substantially reduced . if the ttl value of the incoming packet does not match a value in database 30 ( either because there is no entry for the ip source address of the packet , or because the ttl value in the database is different ), guard device 28 treats the packet as suspect , at an invalid packet processing step 46 . the simplest response for the guard device to implement is to consider the suspect packet to be invalid and discard it . this approach will lead the guard device to drop a certain number of valid packets . in most cases , higher - level protocols running on clients 24 will resend the packets later , by which time the guard device will have learned the appropriate ip source address and ttl value , as described below . alternatively , the guard device may allow the suspect packet to pass through to server 22 , but at a lower service level than the presumably valid packets delivered at step 44 . the decision as to how to treat suspect packets may be made by a system operator of server 22 and may also depend on the overall level of incoming traffic at the time the suspect packet is received . when guard device 28 has received a suspect packet for which there is no entry in database 30 , or in any case in which there is a likelihood that the suspect packet is , in fact , valid , the guard device attempts to verify that the ttl value of the packet is correct , at a ttl validation step 48 . preferably , the guard device sends a message to the ip source address of the suspect packet , and then examines the reply in order to verify the ttl value , at a ttl verification step 50 . this method is described in detail hereinbelow with reference to fig3 . if the ttl value is successfully verified , guard device 28 stores the value in database 30 along with the corresponding ip source address , at a database update step 52 . the verified ttl value is then available for use in validating packets received subsequently by the guard device . otherwise , if step 50 is unsuccessful , the ttl value and ip source address of the suspect packet are simply discarded , at a discard step 54 . optionally , guard device 28 limits the number of new source addresses that it will validate during any given period of time . otherwise , a hacker could bombard the guard device with packets from so many new addresses requiring validation , that the guard device might be unable to process the flow of legitimate packets . fig3 is a flow chart that schematically shows details of validation step 48 , in accordance with a preferred embodiment of the present invention . guard device 28 reads the ip source address and ttl value of the suspect incoming packet ( received at step 40 ), at a header reading step 60 . the guard device uses this information to construct an outgoing message packet addressed to the ip source address of the suspect packet , at a message generation step 62 . the message is of a type that requires the recipient to respond , in such a way that if the guard device receives a response , it will know that the source ip address is real , not spoofed . a number of different types of messages may be used for this purpose , for example : a tcp syn packet . this is the first step in the well - known tcp three - way handshake for establishing a tcp connection . the recipient is expected to respond with a tcp syn - ack packet , or with a rst packet if it rejects the connection . in either case , the returned packet will contain a ttl value and a sequence number corresponding to the packet sequence number of the original syn packet . the tcp syn packet may also include a cookie , as described below . a dns request packet . the recipient is expected to return a dns response packet , which will contain a ttl value and an identifier ( id ) field , corresponding to the id field inserted by the guard device in the request packet . a ping request sent over icmp . the ping reply will contain information that enables the guard device to determine the ttl value . preferably , a cookie containing encoded information is embedded in the 8 - bit code field of the icmp packet . in most cases , the ping reply will contain the same code field without change . preferably , guard device 28 inserts encoded information into the outgoing message packet ( for example , into the tcp syn or dns request packet ) that it sends at step 62 , in such a way that the encoded information will be returned in the response from the remote ip source address . this information assists the guard device in verifying the ttl value provided by the response . for example , the guard device may set a cookie in the sequence number of the tcp syn packet , and may set the source port field in the tcp header to be equal to the ttl value of the suspect packet that it has received . alternatively or additionally , the ttl value of the suspect packet may be encoded in the cookie . syn cookies are known in the art , although for purposes other than that described here . as another example , guard device may set a cookie in an outgoing dns request packet that it sends to an unrecognized ip source address . this approach is useful particularly for verifying the source of dns replies sent from clients 24 to server 22 . preferably , the guard device sets the recursive flag of the dns request to “ no .” the query contained in the dns request includes the original domain name of the incoming dns reply , concatenated with a cookie indicating the received ttl value and certain information received in the dns reply ( such as the original recursive flag and original dns id ). the new dns id of the outgoing dns request contains at tag indicating that a cookie has been inserted in the packet and a pointer to the cookie in the domain name field . these elements of the dns id enable the guard device to easily recognize packets that do not contain a cookie and to efficiently process the contents of packets that do include cookies , as described below . guard device 28 waits to receive the expected response from the remote ip source address , at a response reception step 64 . ( if no response is received , the guard device will take no further action with respect to this address .) in the case of the encoded tcp syn packet described above , for example , the response should be a syn - ack or rst packet . in this case , the guard device reads the sequence number of the received packet , and authenticates the packet by checking for the cookie in the sequence number . the guard device then reads the value of the ttl field from the ip header of the received packet , and compares this value to the destination port value in the packet &# 39 ; s tcp header , at a ttl comparison step 66 . the destination port value should be equal to the source port value set by the guard device in the syn packet , i . e ., to the ttl value of the suspect packet received earlier , at step 40 . if the current and previous ttl values are equal , the guard device concludes that the values are correct and valid , and stores the ip source address and ttl value in database 30 . when guard device 28 receives a dns reply , it first verifies the cookie . if the cookie is authenticated , the guard device compares the ttl value of the dns reply packet to the encoded ttl value in the dns domain name . if the comparison is successful , the remote ip source address is verified as a domain name server . preferably , if the “ recursive desired ” flag was set in the original dns request from the domain name server , the guard device now sends another dns request to domain name server , using the original domain name and original dns id . otherwise , the guard device sends a reply to server 22 , “ redirecting ” it to the same external domain name server in order to avoid timeout and referral to a different domain name server . other methods may also be used for encoding information in the outgoing tcp syn or dns request packet at step 62 . as another example , the ttl value of the suspect packet may be encoded in the sequence number of the syn packet sent to the ip source address . when the guard device receives the syn - ack or rst packet in response , it decodes the sequence number in order to retrieve the previous ttl value and compare it to the ttl field of the current packet at step 66 . the procedure of fig3 may also be applied when guard device 28 receives an incoming tcp syn or syn - ack packet at step 40 , and the ip source address and ttl value of the packet do not match any entry in database 30 . since there is not yet a connection established between server 22 and the client 24 that sent the syn or syn - ack packet , the guard device cannot know whether the ip source address of the incoming packet is legitimate or spoofed . it therefore suspends or discards the syn or syn - ack packet that it received . the guard device then sends its own tcp syn packet to the ip source address of the incoming packet , and waits to receive the syn - ack or rst response packet in order to verify the ttl value , as described above . when the client subsequently resends its original syn or syn - ack , the verified ttl value will have been entered in database 30 , and guard device 28 will allow the packet to pass through to server 22 . as noted above , guard device 28 may actively screen incoming packets at all times , or it may alternatively screen packets only under certain stress conditions . in the latter case , even while the guard device is inactive , it may still collect ttl values for inclusion in database 30 . for example , the guard device may observe tcp handshakes carried out by server 22 and various clients 24 over network 26 . a client initiating such a handshake sends a syn packet to server 22 , which responds by sending a syn - ack packet back to the client . the client must then respond with its own ack in order to complete the connection . the syn , syn - ack and ack packets contain the appropriate sequence numbers . if the “ client ” is a spoofed source , it will not receive the syn - ack , and therefore will not return the final ack . thus , if guard device 28 observes syn and ack packets from the same ip source address , with the same ttl value and the appropriate sequence number in the ack packet , it can be assured that the ip source address and ttl value are valid , and may make an entry in database 30 accordingly . although the preferred embodiments described herein are based specifically on ip and on certain transport and application protocols that run over ip , the principles of the present invention may similarly be applied using other network , protocols , as well as other transport and application protocols meeting the functional requirements described above . it will thus be appreciated that the preferred embodiments described above are cited by way of example , and that the present invention is not limited to what has been particularly shown and described hereinabove . rather , the scope of the present invention includes both combinations and subcombinations of the various features described hereinabove , as well as variations and modifications thereof which would occur to persons skilled in the art upon reading the foregoing description and which are not disclosed in the prior art . | 7 |
the preferred embodiments of the present invention will be described in detail in accordance with the accompanying drawings . in a cell , the message &# 39 ; s arrival follows a poisson distribution . the call service duration of each user follows an exponent distribution . during the infinitesimal time interval δt , the signal arrival probability in every time interval is λδt . thus , the probability that the service time t is beyond a certain time t is : , where μ is the leaving probability of service , so the average call interval is 1 / μ second . by deduction , the relationship between the service rate and the service duration can be obtained , that is , the service rate r is in proportional to the leaving probability μ in formula ( 1 ): r = α · μ . where α is given by α = r 0 / μ 0 , r 0 , r 0 denotes the initial service rate , μ 0 denotes the leaving probability when the initial service rate is r 0 . from the above conclusion , the service rate directly affects on the leaving probability μ . the leaving probability μ is an important parameter of the interruption probability . so it is impossible to keep other conditions unchanged when changing the service rate . thus , simply decreasing the service rate cannot enlarge the system capacity . in order to correctly determine the adjusting of the service rate , it is necessary to clearly analyze the relationship between the data rate and the capacity ( or the interruption probability ). the affect of the service rate on the system capacity is described as follows . cdma system is a strict interference limited system . in order to ensure that the service wouldn &# 39 ; t be blocked , the following formula must be met . , where i 0 is the maximum received power ( i . e . the sum of the maximum received interference power and the useful signal , and normalized by bandwidth ), n 0 is the power density of the background noise , and η is a constant , which is typically within the range of 0 . 1 to 0 . 25 . ∑ i = 1 n ∑ j = 1 k i saf i j ( 1 + h ) e bi r i + n 0 w & gt ; i 0 w ( 2 ) , where w is the system bandwidth , i . e ., spread bandwidth , n 0 is the power density of the background noise , i 0 is the maximum received power density , n is the total number of service types in a cell ; k i is the user number of the i th service ; r i is the service data rate of the i th service , e bi is the bit energy of the i th service , where i denotes the i th service type ( i ≦ n ); saf ij denotes the active state of the i th service type of the j th user , h is the overhead channel interference generated by the synchronization signal which is used to re - setup physical link when the data is transmitted in a discontinued manner . η = n 0 i 0 , e b i i 0 r i = c i , m i = ∑ j = 1 k i saf i j , where m i denotes the user number of the i th service type which is in active state in a system . assume the probability that the i th service type of the j th user is in active state is ρ i , that is p r ( saf ij = 1 )= ρ i , then the probability that the i th service type of the j th user is in non - active state is p r ( saf ij = 0 )= 1 − ρ = q i , where ρ donates the service active probability . obviously , m i follows poisson distribution . since the services are independent with each other , the formula also follows poisson distribution . thus , the erlang capability of the system can be expressed by the system interruption probability : p out r = p r [ ∑ i = 1 n c i m i ( 1 + h ) & gt ; w ( 1 - η ) ] ( 3 ) from the above formula ( 3 ), the single service interruption probability could be given by p out = - β r ∑ k = [ k 0 ′ / r ] ∞ ( β r ) k k ! = { 1 k 0 ′ / r & lt ; 1 1 - - β r ∑ k = 0 [ k 0 ′ / r ] - 1 ( β r ) k k ! k 0 ′ / r ≥ 1 ( 4 ) , where β and k ′ 0 are constants , β = ρλα , λ is the service arrival probability , ρ is the service active probability ; α = r 0 / μ 0 , r 0 is the initial service rate , μ 0 is the service leaving probability of the data rate r 0 ; k ′ 0 = w ( 1 − η )/( e b1 ( 1 + h )), h is the interference of the overhead channel , e b1 is the bit energy of the i st service ; r specifically refers to a certain service and a certain service data rate that will be adjusted ; k =[ k ′ 0 / r ] denotes the integer of k ′ 0 / r . from the above , the system erlang capacity could be expressed by the system interruption probability . thus , the system interruption probability is an index of the system capability . from the system interruption probability , on the basis of the conclusion and deduction on theory , the affect of the service rate on the system capability can be obtained . thus , it is necessary to select a proper service rate r to maximize - β r ∑ k = 0 [ k 0 ′ / r ] - 1 ( β r ) k k ! , and then a minimum interruption probability can be obtained . further , the maximum capacity under a given interruption probability can be obtained . h ( n ) = β - β x n * k 0 ′ ( β x n * ) n n ! ( 5 ) , where n is the discrete point in [ k ′ 0 / r ]− 1 for the continual attenuation amplitude of the function - β r ∑ k = 0 [ k 0 ′ / r ] - 1 ( β r ) k k ! , and where x n * is a point within the continual scope [ n k 0 ′ , n + 1 k 0 ′ ] . hence , two discrete functions are defined according to the equation ( 5 ) h 1 ( n ) = β - β n / k 0 ′ k 0 ′ · ( β n / k 0 ′ ) n n ! h 2 ( n ) = β - β ( n + 1 ) / k 0 ′ k 0 ′ · ( β ( n + 1 ) / k 0 ′ ) n n ! ( 6 ) obviously , both h 1 ( n ) and h 2 ( n ) are of degressive functions of n . thus , h ( n ) is also a degressive function of n . g ( n ) = - β n / k 0 ′ ( β n / k 0 ′ ) n n ! , n = 1 , 2 … ( 8 ) the following conclusion can be obtained by comparing the three discrete functions h 1 ( n ), h 2 ( n ) and g ( n ) 1 ) if h 1 ( n )≦ g ( n ) for every n , then when n →∞ i . e . the service rate r → 0 , the system interruption probability will be minimum ; 2 ) if h 2 ( n )≧ g ( n ) for every n , then when n = 1 i . e . the service rate r = k ′ 0 , the system interruption probability will be minimum , and the system capacity achieves the maximum . by analyzing , a more practical method for adjusting service rate for data service and dynamically increasing the system capacity can be obtained . some special data service may be prevented from the adjustment . during the adjusting procedure , it is possible to adjust the service rate of a certain data service or a certain type of data services . [ 0060 ] fig1 is a flow diagram of the present invention . as shown in fig1 the method for dynamically adjusting system capacity in the mobile communication system of the present invention comprises the following steps . first , the system continually detects the load of the current cell , and compares the current load with a load threshold defined by the system ; if the current load is less than the load threshold defined by the system , which means the system is in low load state , the service rate of data service is not adjusted or the service rate is recovered to its original value to improve transmission rate . if the current load is more than or equal to the defined load threshold , which means the system is in heavy load , the dynamic adjustment on the system capacity is started to change the service rate of the data service . second , the service rate of the data service is adjusted according to the following method : a ) obtaining the system interruption probability and the values of constants k ′ 0 and β according to the parameters of the system , where the parameters of the system including the system bandwidth w , the service arrival probability λ , the service active probability ρ , the service rate r , the service leaving probability μ , the interference of overhead channel h , the power density of background noise n 0 , and the parameter η etc . in theory , the system interruption probability could be given by formula . for a system with a single service , the system interruption probability could be obtained by formula ( 4 ), and for a system with two services , the system interruption probability could be obtained by : p out r = p r [ c 1 m 1 + c 2 m 2 & gt ; w ( 1 - η ) 1 + h ] = 1 - ∑ i = 1 ⌊ w ( 1 - η ) / c 1 ( 1 + h ) ⌋ [ ∑ j = ⌈ [ w ( 1 - η ) 1 + h - c 1 i ] / c 2 ⌉ ⌊ w ( 1 - η ) / c 2 ( 1 + h ) ⌋ ( λ 2 ρ 2 / μ 2 ) j j ! - ( λ 2 ρ 2 μ 2 ) ] ( λ 1 ρ 1 μ 1 ) i i ! - ( λ 1 ρ 1 μ 1 ) in practice , the system interruption probability could be given by simulation . the system interruption probability provides the theory foundation for the present invention . based on the theory foundation , the present invention deduces a practical method for adjusting the service rate . in practice , it is not necessary to get the system interruption probability at every moment but only needed to know whether the system is overload . β = ρλα , λ is the service arrival probability , ρ is the service active probability ; α = r 0 / μ 0 , r 0 is the initial service rate , μ 0 is the service leaving probability corresponding to the service rate of r 0 ; k ′ 0 = w ( 1 − η )/( e b1 ( 1 + h )), h is the interference of the overhead channel , e b1 is the bit energy of the first service ; r specifically refers to the data rate of a certain service and a certain type of services that will be adjusted ; k =[ k ′ 0 / r ] denotes the integer of k ′ 0 / r . b ) based on the constants β and k ′ 0 obtained in step a ) and in accordance with equations ( 6 ) and ( 8 ), obtaining the value of the three discrete functions h 1 ( n ), h 2 ( n ) and g ( n ), then comparing them with each other ; obviously , formula ( 7 ) can be obtained by deduction . formula ( 7 ) indicates that the discrete functions h 1 ( n ), h 2 ( n ) are degressive functions of n . hence , if h 2 ( n )& lt ; h 1 ( n )& lt ; g ( n ), according to the above conclusion 1 ), it is known that when service rate r → 0 , the system interruption probability is minimum and the system capacity is infinite . in practice , because of the limitation of the service itself , the service rate can not be decreased freely . however , through properly decreasing the service rate , the interruption probability could be decreased and the system capacity could be improved . let the service rate r e be the allowable minimum of the service rate r min , i . e . r e = r min . in this situation , the maximum system capacity is maximum and the system interruption probability is minimal . the minimal system interruption probability is the limit of the adjustment . if at the moment the statistical interruption probability is still greater than the defined system interruption probability , it means the requirement of the defined system interruption probability cannot met by service rate adjustment , and the system capacity cannot be improved any more . after the service rate of the data service is adjusted , it returns to the system . if h 1 ( n )& gt ; h 2 ( n )& gt ; g ( n ) or h 2 ( n )& lt ; h 1 ( n )& lt ; g ( n ), then it is known from the above conclusion ( 2 ) that when service rate r → k ′ 0 , the system interruption probability is minimum . if at the moment p out & gt ; p e , where p e denotes the defined system interruption probability , it is necessary to increase the service rate to decrease the interruption probability and the system capacity ; if p out & lt ; p e , then it is necessary to decrease the service rate to increase the interruption probability and the system capacity , in practice , for maximum system capacity i . e . the maximum number of user which satisfies the requirement of the expected interruption probability , the corresponding expected service rate r e should be on the utmost right of [ w ( 1 - η ) / e b k e + 1 , w ( 1 - η ) / e b k e ] , i . e . r e = w ( 1 - η ) / e b k e - ɛ , 0 & lt ; ɛ & lt ; w ( 1 - η ) / e b k e ( k e + 1 ) , w ( 1 - η ) / e b k e ( k e + 1 ) , e b specifically refers to the bit energy of a certain service or a certain type of services that will be adjusted . after adjusting the data rate , it returns to the system . when finishing the adjustment of the service rate of the data service , it returns to detect the cell load again . if the current load is less than the threshold defined by the system , in order to improve the transmission rate , the service rate is not adjusted anymore . or the service rate is recovered to its original value . [ 0078 ] fig2 is a block diagram of a preferred embodiment of the present invention . as shown in fig2 a antenna subsystem 211 of a mobile terminal 21 receives a pilot signal of a forward link from a base station 22 , and delivers it to a multiplexing module 212 . the multiplexing module 212 separates the forward frequency signal and delivers it to a signal processing subsystem 213 . the signal processing subsystem 213 delivers the processed signal to a power control subsystem 214 . the power control subsystem 214 measures the quaclity of the received signal and generates a measurement report . the measurement report together with a feedback link signal is delivered to &# 39 ; the base station 22 via the multiplexing module 212 and the antenna subsystem 211 . at the base station 22 , the signal is multiplexed and processed , then delivered to the base station controller 23 . during the information processing , when frame processing is undergone in the base band processing module , the user &# 39 ; s sir can be obtained . the user &# 39 ; s sir is compared with the expected sir . the mobile terminal 21 changes the transmission power according to the comparison result . in the base station controller 23 , a frame recovery module 231 outputs data to a data distribution module 232 , which distributes three outputs to a power control subsystem 233 , a resource management module 234 and a service subsystem 235 respectively . the load control module 2341 of the resource management module 234 detects the status of the system load continually according to the message from the base station , and compares the current system load with the upper limit of the load defined by the system . if the detected system load is greater than the defined upper limit , the service rate of a certain data service or a certain type of data services in the resource management module is adjusted in accordance with the present invention . if the detected system load is less than the defined upper limit , the service rate of a certain data service or a certain type of data services in the resource management module is adjusted in accordance with the present invention , such that the adjusted service rate remains in or recovers to the original service rate of the data service . as many apparently widely different embodiments of the present invention can be made without departing from the spirit and scope thereof , it is to be understood that the invention is not limited to the specific embodiments thereof except as defined in the appended claims . | 7 |
the following description is merely exemplary in nature and is in no way intended to limit the disclosure , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the term module , circuit and / or device refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that execute one or more software or firmware programs , a combinational logic circuit , and / or other suitable components that provide the described functionality . as used herein , the phrase at least one of a , b , and c should be construed to mean a logical ( a or b or c ), using a non - exclusive logical or . it should be understood that steps within a method may be executed in different order without altering the principles of the present disclosure . the present disclosure relates to a low cost thermal solution for dissipating heat when high power integrated circuits ( ics ) are used in drive systems . for example , the present invention may be used in hard disk drive ( hdd ) and digital versatile disc ( dvd ) systems . the hdd includes a hard disk assembly ( hda ) and a hdd printed circuit board assembly ( hdd pcba ) with one or more integrated circuits ( ics ) and / or other electronics components mounted thereon . some types of hdds include an external case that is connected to the hdd pcb . while the certain portions of the present disclosure relate to hdd systems , the present disclosure can also be used to dissipate heat within dvd systems . the ics tend to generate a lot of heat due to high data flow speeds of the hdd or dvd and integration of more functions and features . as the form factor of the hdd or dvd becomes smaller , the pcb also becomes smaller . dissipating heat generated by the ic or ics of the pcb becomes more challenging . according to the present disclosure , the drive assembly case can be used as a thermal heatsink by making the surface of one or more ics directly contact the drive assembly case and / or using a thermal interface material to allow the thermal contact between the ic or ics and the drive assembly case . referring now to fig2 a and 2b , the drive assembly case can be used as a thermal heatsink by making the printed circuit board ( pcb ) contact the drive assembly case through a thermal interface material . more particularly , in fig2 a a pcb 100 includes an outer side 101 and an inner side 102 . first and second integrated circuits ( ics ) 104 and 108 and / or other components 112 are mounted on the outer and / or inner sides 101 and 102 of the pcb 100 . a drive assembly case 118 is connected to the inner side 102 of the pcb 100 . a second side of the ic 108 includes a thermal interface material 120 that is located between the ic 108 and the drive assembly case 118 . the terminal interface material 120 thermally couples the second side of the ic 108 to the drive assembly case 118 . as a result , heat generated by the ic 108 is dissipated by the relatively large surface area of the drive assembly case 118 . in fig2 b , the ic 108 directly contacts the drive assembly case 118 . referring now to fig3 , additional thermal vias can be added at the contact area of pcb to further improve thermal performance . one side 149 of a pcb 150 includes first and second ics 154 and 158 and / or other components 155 . the pcb 150 includes vias 160 that extend from the one side 149 of the pcb 150 to another side 151 thereof . a thermal interface material 164 thermally couples opposite ends of the vias 160 of the pcb 150 to a drive assembly case 166 . other components of the hdd or dvd may be connected to either side of the pcb 150 as shown . direct contact between the vias and the drive assembly case can also be used . referring now to fig4 , for hdds or dvds with the external cases over the pcb , the external case can be used as a thermal heatsink by making the surface of one or more ics directly contact the external case and / or through a thermal interface material . a pcb 200 includes first and second ics 202 and 204 and / or other components 206 mounted thereon . the pcb 200 is mounted to the drive assembly case 210 and covered by an external cover 212 . the ic 204 includes an outer surface 219 that contacts a thermal interface material 220 . the thermal interface material 220 , in turn , contacts the external cover 212 . referring now to fig5 , more thermal vias can be added at the contact area of pcb to further improve the thermal performance . the pcb 200 includes vias 230 that extend through and / or provide a thermal path through the pcb 200 . a thermal interface material 240 provides a thermal path between the vias and the drive assembly case 210 . as can be appreciated , while only one ic is shown in contact with the drive assembly case in fig2 - 5 , the solution can be applied to two or more ics on the pcb . furthermore , while fig2 b shows direct physical contact between the drive assembly case and the ic , fig3 - 5 may also be arranged in direct physical contact as well . furthermore , embodiments may include ics in direct and / or indirect contact via the thermal interface material . suitable examples of thermal interface materials include thermal conductive adhesive tape , thermal conductive elastomer , thermal conductive compound and thermal grease although other thermal interface materials can be used . referring now to fig6 a , the present invention can be implemented in mass data storage and / or a dvd of a high definition television ( hdtv ) 420 . the hdtv 420 receives hdtv input signals in either a wired or wireless format and generates hdtv output signals for a display 426 . in some implementations , signal processing circuit and / or control circuit 422 and / or other circuits ( not shown ) of the hdtv 420 may process data , perform coding and / or encryption , perform calculations , format data and / or perform any other type of hdtv processing that may be required . the hdtv 420 may communicate with mass data storage 427 that stores data in a nonvolatile manner such as optical and / or magnetic storage devices . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the hdtv 420 may be connected to memory 428 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the hdtv 420 also may support connections with a wlan via a wlan network interface 429 . referring now to fig6 b , the present invention may implement and / or be implemented in mass data storage of a vehicle control system and / or a vehicle - based dvd . in some implementations , the present invention implement a powertrain control system 432 that receives inputs from one or more sensors such as temperature sensors , pressure sensors , rotational sensors , airflow sensors and / or any other suitable sensors and / or that generates one or more output control signals such as engine operating parameters , transmission operating parameters , and / or other control signals . the present invention may also be implemented in other control systems 440 of the vehicle 430 . the control system 440 may likewise receive signals from input sensors 442 and / or output control signals to one or more output devices 444 . in some implementations , the control system 440 may be part of an anti - lock braking system ( abs ), a navigation system , a telematics system , a vehicle telematics system , a lane departure system , an adaptive cruise control system , a vehicle entertainment system such as a stereo , dvd , compact disc and the like . still other implementations are contemplated . the powertrain control system 432 may communicate with mass data storage 446 that stores data in a nonvolatile manner . the mass data storage 446 may include optical and / or magnetic storage devices for example hard disk drives hdd and / or dvds . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the powertrain control system 432 may be connected to memory 447 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the powertrain control system 432 also may support connections with a wlan via a wlan network interface 448 . the control system 440 may also include mass data storage , memory and / or a wlan interface ( all not shown ). referring now to fig6 c , the present invention can be implemented in mass data storage and / or a dvd of a cellular phone 450 that may include a cellular antenna 451 . in some implementations , the cellular phone 450 includes a microphone 456 , an audio output 458 such as a speaker and / or audio output jack , a display 460 and / or an input device 462 such as a keypad , pointing device , voice actuation and / or other input device . the signal processing and / or control circuits 452 and / or other circuits ( not shown ) in the cellular phone 450 may process data , perform coding and / or encryption , perform calculations , format data and / or perform other cellular phone functions . the cellular phone 450 may communicate with mass data storage 464 that stores data in a nonvolatile manner such as optical and / or magnetic storage devices for example hard disk drives hdd and / or dvds . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the cellular phone 450 may be connected to memory 466 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the cellular phone 450 also may support connections with a wlan via a wlan network interface 468 . referring now to fig6 d , the present invention can be implemented in mass data storage and / or a dvd of a set top box 480 . the set top box 480 receives signals from a source such as a broadband source and outputs standard and / or high definition audio / video signals suitable for a display 488 such as a television and / or monitor and / or other video and / or audio output devices . the signal processing and / or control circuits 484 and / or other circuits ( not shown ) of the set top box 480 may process data , perform coding and / or encryption , perform calculations , format data and / or perform any other set top box function . the set top box 480 may communicate with mass data storage 490 that stores data in a nonvolatile manner . the mass data storage 490 may include optical and / or magnetic storage devices for example hard disk drives hdd and / or dvds . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the set top box 480 may be connected to memory 494 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the set top box 480 also may support connections with a wlan via a wlan network interface 496 . referring now to fig6 e , the present invention can be implemented in mass data storage and / or a dvd of a media player 500 . in some implementations , the media player 500 includes a display 507 and / or a user input 508 such as a keypad , touchpad and the like . in some implementations , the media player 500 may employ a graphical user interface ( gui ) that typically employs menus , drop down menus , icons and / or a point - and - click interface via the display 507 and / or user input 508 . the media player 500 further includes an audio output 509 such as a speaker and / or audio output jack . the signal processing and / or control circuits 504 and / or other circuits ( not shown ) of the media player 500 may process data , perform coding and / or encryption , perform calculations , format data and / or perform any other media player function . the media player 500 may communicate with mass data storage 510 that stores data such as compressed audio and / or video content in a nonvolatile manner . in some implementations , the compressed audio files include files that are compliant with mp3 format or other suitable compressed audio and / or video formats . the mass data storage may include optical and / or magnetic storage devices for example hard disk drives hdd and / or dvds . the hdd may be a mini hdd that includes one or more platters having a diameter that is smaller than approximately 1 . 8 ″. the media player 500 may be connected to memory 514 such as ram , rom , low latency nonvolatile memory such as flash memory and / or other suitable electronic data storage . the media player 500 also may support connections with a wlan via a wlan network interface 516 . still other implementations in addition to those described above are contemplated . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the disclosure can be implemented in a variety of forms . therefore , while this disclosure includes particular examples , the true scope of the disclosure should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , the specification and the following claims . | 6 |
unless specified otherwise , all wt % values quoted hereinafter are percentages by weight based on total weight of the hair treatment composition . by “ insoluble ” is meant that the material is not soluble in water ( distilled or equivalent ) at a concentration of 0 . 1 %, at 25 ° c . this present invention relates to the use of silicone psas for hair care applications . the term “ silicone pressure sensitive adhesive ” ( spsa ) refers to pressure sensitive adhesives comprising a silicone resin and a polydiorganosiloxane . these “ pressure sensitive adhesive ” ( psa ) materials are permanently tacky at room temperature and able to develop measurable adhesion to a surface simply upon contact or by the application of a light pressure . generally they do not require heat . no chemical reaction takes place between the adhesive and the adherent , no curing of the adhesive is necessary and no solvent is required to be lost during the adhesion process . in the context of the present invention there are 3 types of silicone psas : i ) one class of silicone pressure sensitive adhesives consists of a mixture of ( i ) a silanol end - blocked polydiorganosiloxane fluid , e . g . a polydimethylsiloxane polymer and ( ii ) a trimethylsilyl end - blocked polysilicate resin such as a silicate resin consisting of a benzene - soluble resinous copolymer containing silicon - bonded hydroxyl radicals and consisting essentially of triorganosiloxy units of the formula r □ sio1 / 2 and tetrafunctionalsiloxy units of the formula sio4 / 2 in a ratio of about 0 . 6 to 0 . 9 triorganosiloxy units for each tetrafunctionalsiloxy unit present in the copolymer , wherein each r is a monovalent organic radical independently selected from the group consisting of hydrocarbon radicals of from 1 to 6 inclusive carbon atoms . u . s . pat . no . 2 , 736 , 721 to dexter et al . and u . s . pat . no . 2 , 814 , 601 to currie et al . teach such or similar silicone pressure sensitive adhesives . ii ) a preferred class of silicone psas are prepared by condensing the silicone fluid and the silicate . in this preferred condensation reaction , the silicate resin and the silicone fluid are mixed together in the presence of a catalytic amount of a silanol condensation catalyst and then the silicate resin and the silicone fluid are condensed , for example , by heating under reflux conditions for 1 to 20 hours . examples of silanol condensation catalysts are primary , secondary and tertiary amines , carboxylic acids of these amines and quaternary ammonium salts . iii ) a further optional step can also employ an alkenyl - functional polymer and a crosslinking agent containing silicone - bonded hydrogen atoms , they are cured by a hydrosilation addition reaction using a platinum - type catalyst as described in u . s . pat . no . 4 , 988 , 779 . in such systems the molar ratio of silicon bonded hydrogen groups to silicone bonded alkenyl groups is typically greater than 1 . however these systems are not highly preferred . a preferred silicone psa comprises ( a ) 40 to 70 parts by weight of at least one silicone copolymer resin and ( b ) 30 to 60 parts by weight of at least one polydiorganosiloxane . the silanol content of the silicone pressure sensitive adhesive composition is reduced by chemically treating at least a portion of ( a ), ( b ) or the mixture of ( a ) and ( b ) with at least one chemical treating agent ( c ) that reacts with silicon - bonded hydroxyl groups to reduce the silicon - bonded hydroxyl content of the composition . preferably the silicon - bonded hydroxyl content of the composition is reduced to a range of between 8000 and 13 , 000 . the silicone resin copolymers ( i ) usually contain silicon - bonded hydroxyl radicals in amounts which typically range from about 1 to 4 weight percent of silicon - bonded hydroxyl radicals and comprise triorganosiloxy units of the formula r 3 sio 1 / 2 and tetrafunctional siloxy units of the formula sio 4 / 2 in a mole ratio of from 0 . 6 to 0 . 9 r 3 si 1 / 2 units for each sio 4 / 2 unit present . blends of two or more such copolymers may also be used . there should be at least some and preferably at least 0 . 5 % silicon - bonded hydroxyl content to enable the polydiorganosiloxane component to copolymerize with the copolymer resin and / or to react with the end blocking agent being added to chemically treat the silicone pressure - sensitive adhesive composition . each r denotes , independently , a monovalent hydrocarbon radical having from 1 to 6 inclusive carbon atoms such as methyl , ethyl , propyl , isopropyl , hexyl , cyclohexyl , vinyl , allyl , propenyl and phenyl . preferably , the r 3 sio 1 / 2 units are me 3 sio 1 / 2 units and / or me 2 r 1 sio 1 / 2 units wherein is r 1 is a vinyl (“ vi ”) or phenyl (“ ph ”) radical . more preferably , no more than 10 mole percent of the r 3 sio 1 / 2 units present in resin copolymer ( i ) are me 2 r 2 sio 1 / 2 units and the remaining units are me 3 sio 1 / 2 units where each r 2 is a vinyl radical . most preferably , the r 3 sio 1 / 2 units are me 3 sio 1 / 2 units . the preferred class of silicone psas ( ii ) usually comprise one or more polydiorganosiloxanes comprising arsio units terminated with endblocking trasio 1 / 2 units , where each r is as defined in the paragraph above . each a radical is selected from radicals such as r or halohydro - carbon radicals of from 1 to 6 inclusive carbon atoms such a chloromethyl , chloropropyl , 1 - chloro - 2 - methylpropyl , 3 , 3 , 3 - trifluoropropyl and f 3 c ( ch 2 ) 5 radicals . thus the polydiorganosiloxane can contain me 2 sio units , phmesio units , mevisio units , ph 2 sio units , methylethylsiloxy units , 3 , 3 , 3 - trifluoropropyl units and 1 - chloro , 2 - methylpropyl units and the like . preferably , the arsio units are selected from the group consisting of r 2 sio rr ′ sio units , ph 2 sio units and combinations of both where r and r ′ are as for r in the paragraph above , at least 50 mole percent of the r ′ radicals present in the polydiorganosiloxane ( ii ) are methyl radicals and no more than 50 mole percent of the total moles of arsio units present in each polydiorganosiloxane of ( ii ) are ph 2 sio units . more preferably , no more than 10 mole percent of the arsio units present in each polydiorganosiloxane ( ii ) are mersio units where r is as above defined and the remaining arsio units present in each polydiorganosiloxane are me 2 sio units . most preferably , substantially all of the arsio units are me 2 sio units . each t radical is r , oh , h or or ′ radicals where each r ′ is an alkyl radical of from 1 to 4 inclusive carbon atoms such as methyl , ethyl , n - propyl , and isobutyl radicals . h , oh and or ′ provide a site for reaction with the endblocking triorganosilyl units of ingredient ( iii ) and also provide a site for condensation with other such radicals on polydiorganosiloxanes ( ii ) or with the silicon - bonded hydroxyl groups present in resin copolymer ( i ). use of polydiorganosiloxanes where t is oh is most preferred because the polydiorganosiloxane ( ii ) can then readily copolymerize with the resin copolymer ( i ). when an appropriate catalyst such as hcl , which is generated when chlorosilanes are used , or ammonia , which is generated when organosilazanes are used , as endblocking agents , then triorganosiloxy ( e . g ., r 3 sio 1 / 2 such as ( ch 3 ) 3 sio 1 / 2 or ch 2 ch ( ch 3 ) 2 sio 1 / 2 ) unit terminated polydiorganosiloxanes can be employed because some of the triorganosiloxy units can be cleaved when the condensation reaction is conducted with heating . the cleavage exposes a silicon - bonded hydroxyl radical which can then condense with silicon - bonded hydroxyl radicals in the copolymer resin , with endblocking triorganosilyl units or with other polydiorganosiloxanes containing h , oh or or ′ radicals or silicon - bonded hydroxyl radicals exposed by cleavage reactions . mixtures of polydiorganosiloxanes containing different substituent radicals may also be used . each of the polydiorganosiloxanes ( ii ) preferably have a viscosity of from 100 centipoise to 30 , 000 , 000 centipoise at 25 ° c . ( 100 millipascal - seconds to 30 , 000 pascal seconds ( pa · s ) where 1 centipoise equals 1 millipascal second ). as is well - known , viscosity is directly related to the average number of diorganosiloxane units present for a series of polydiorganosiloxanes of varying molecular weights which have the same endblocking units . polydiorganosiloxanes having a viscosity of from about 100 to 100 , 000 centipoise at 25 ° c . range from fluids to somewhat viscous polymers . these polydiorganosiloxanes are preferably pre - reacted with resin copolymer ( i ) prior to condensation in the presence of endblocking agent ( iii ) to improve the tack and adhesion properties of the resulting psa as will be further described . polydiorganosiloxanes having viscosities in excess of 100 , 000 centipoise can typically be subjected to the condensation / endblocking step ( ii ) of the present invention without pre - reaction . polydiorganosiloxanes having viscosities in excess of 1 , 000 , 000 centipoise are highly viscous products often referred to as gums and the viscosity is often expressed in terms of a williams plasticity value ( polydimethylsiloxane gums of about 10 , 000 , 000 centipoise viscosity typically have a williams plasticity value of about 50 mils ( 1 . 27 mm ) or more at 25 ° c .). examples of endblocking agents ( iii ) are ( me3si ) 2nh , ( vime2si ) 2nh , ( mephvisi ) 2nh , ( cf3ch2ch2me2si ) 2nh , ( me3si ) 2nme , ( clch2me2si ) 2nh , me3siome , me3sioc2h5 , ph3sioc2h5 , ( c2h5 ) 3sioc2h5 , me2phsioc2h5 , ( i - c3h7 ) 3sioh , me3si ( oc3h7 ), mephvisiome , me3sicl , me2visicl , mephvisicl , ( h2cchch2 ) me2sicl , ( n - c3h7 ) 3sicl , ( f3ccf2cf2ch2ch2 ) 3sicl , ncch2ch2me2sicl , ( n - c6h13 ) 3sicl , meph2sicl , me3sibr , ( t - c4h9 ) me2sicl , cf3ch2ch2me2sicl , ( me3si ) 20 , ( me2phsi ) 20 , brch2me2siosime3 , ( p - fc6h4me2si ) 20 , ( ch3cooch2me2si ) 20 , [( h2ccch3cooch2ch2 ) me2si ] 20 , [( ch3cooch2ch2ch2 ) me2si ] 20 , [( c2h5oocch2ch2 ) me2si ] 20 , [( h2cchcooch2 ) me2si ] 20 , ( me3si ) 2s , ( me3si ) 3n , me3sinhconhsime3 , f3ch2ch2me2sinmecoch3 , ( me3si )( c4h9 ) ncon ( c2h5 ) 2 , ( me3si ) phnconhph , me3sinhme , me3sin ( c2h5 ) 2 , ph3sinh2 , me3sinhocch3 , me3sioocch3 , [( ch3conhch2ch2ch2 ) me2si ] 20 , me3sio ( ch2 ) 40sime3 , me3sinhocch3 , me3sicch , ho ( ch2 ) 4me2si ) 20 , ( hoch2ch2och2me2si ) 20 , h2n ( ch2 ) 3me2sioch3 , ch3ch ( ch2nh2 ) ch2me2sioch3 , c2h5nhch2ch2s ( ch2 ) gme2sioc2h5 , hsch2ch2nh ( ch2 ) 4 me2sioc2h5 , hoch2ch2sch2me2sioch3 . preferably , the endblocking agent employed is ( me3si ) 2nh . a preferred silicone psa emulsion can be prepared by mixing the silicone psa in suitable solvents to give a dispersed phase . it is advantageous if this dispersed phase comprises 20 to 80 % by weight of the silicone pressure sensitive adhesive . preferably at least one solvent will be a volatile solvent , meaning a solvent with a boiling point below 300 ° c . one or more of the solvents is preferably a silicone . the psa / solvent mixture is optionally emulsified in water using one or more surfactants . the preferred surfactants are anionic or nonionic surfactants , especially a blend of anionic and nonionic surfactants . the silicone solvent can be a linear polydiorganosiloxane such as hexamethyldisiloxane , octamethyltrisiloxane , decamethyltetrasiloxane , dodecamethylpentasiloxane or a polydimethylsiloxane of viscosity 1 cst , or can be a cyclic siloxane such as decamethylcyclopentasiloxane or octamethylcyclotetrasiloxane or can be a mixture of one or more linear polydimethylsiloxanes with one or more cyclic siloxanes . other solvents include ethyl acetate and hydrocarbons ( e . g heptane , hexane , isododecane ). the compositions of the invention may further comprise from 0 . 001 % to 10 % by weight of a hair styling polymer . more preferred amounts of hair styling polymer in the compositions of the invention are from 0 . 1 % to 5 % by weight of the composition , even more preferably from 0 . 5 % to 3 % by weight . however it is highly preferable if additional hair styling polymersthey are not present or present in levels below 0 . 01 wt % of the total composition . hair styling polymers are well known . suitable hair styling polymers include commercially available polymers that contain moieties that render the polymers cationic , anionic , amphoteric or nonionic in nature . suitable hair styling polymers include , for example , block and graft copolymers . the polymers may be synthetic or naturally derived . copolymers of vinyl acetate and crotonic acid ; terpolymers of vinyl acetate , crotonic acid and a vinyl ester of an alpha - branched saturated aliphatic monocarboxylic acid such as vinyl neodecanoate ; copolymers of methyl vinyl ether and maleic anhydride ( molar ratio about 1 : 1 ) wherein such copolymers are 50 % esterified with a saturated alcohol containing from 1 to 4 carbon atoms such as ethanol or butanol ; acrylic copolymers containing acrylic acid or methacrylic acid as the anionic radical - containing moiety with other monomers such as : esters of acrylic or methacrylic acid with one or more saturated alcohols having from 1 to 22 carbon atoms ( such as methyl methacrylate , ethyl acrylate , ethyl methacrylate , n - butyl acrylate , t - butyl acrylate , t - butyl methacrylate , n - butyl methacrylate , n - hexyl acrylate , n - octyl acrylate , lauryl methacrylate and behenyl acrylate ); glycols having from 1 to 6 carbon atoms ( such as hydroxypropyl methacrylate and hydroxyethyl acrylate ); styrene ; vinyl caprolactam ; vinyl acetate ; acrylamide ; alkyl acrylamides and methacrylamides having 1 to 8 carbon atoms in the alkyl group ( such as methacrylamide , t - butyl acrylamide and n - octyl acrylamide ); and other compatible unsaturated monomers . the additional styling polymer may also contain grafted silicone , such as polydimethylsiloxane . resyn ® 28 - 2930 available from national starch ( vinyl acetate / crotonic acid / vinyl neodecanoate copolymer ); ultrahold ® 8 available from basf ( ctfa designation acrylates / acrylamide copolymer ); the gantrez ® es series available from isp corporation esterified copolymers of methyl vinyl ether and maleic anhydride ); luviset pur ® available from basf . other suitable anionic hair styling polymers include carboxylated polyurethanes . carboxylated polyurethane resins are linear , hydroxyl - terminated copolymers having pendant carboxyl groups . they may be ethoxylated and / or propoxylated at least at one terminal end . the carboxyl group can be a carboxylic acid group or an ester group , wherein the alkyl moiety of the ester group contains one to three carbon atoms . the carboxylated polyurethane resin can also be a copolymer of polyvinylpyrrolidone and a polyurethane , having a ctfa designation pvp / polycarbamyl polyglycol ester . suitable carboxylated polyurethane resins are disclosed in ep - a - 0619111 and u . s . pat . no . 5 , 000 , 955 . other suitable hydrophilic polyurethanes are disclosed in u . s . pat . nos . 3 , 822 , 238 ; 4 , 156 , 066 ; 4 , 156 , 067 ; 4 , 255 , 550 ; and 4 , 743 , 673 . amphoteric hair styling polymers which can contain cationic groups derived from monomers such as t - butyl aminoethyl methacrylate as well as carboxyl groups derived from monomers such as acrylic acid or methacrylic acid can also be used in the present invention . one specific example of an amphoteric hair styling polymer is amphomer ® ( octylacrylamide / acrylates / butylaminoethyl methacrylate copolymer ) sold by the national starch and chemical corporation . examples of nonionic hair styling polymers are homopolymers of n - vinylpyrrolidone and copolymers of n - vinylpyrrolidone with compatible nonionic monomers such as vinyl acetate . nonionic polymers containing n - vinylpyrrolidone in various weight average molecular weights are available commercially from isp corporation — specific examples of such materials are homopolymers of n - vinylpyrrolidone having an average molecular weight of about 630 , 000 sold under the name pvp k - 90 and are homopolymers of n - vinylpyrrolidone having an average molecular weight of about 1 , 000 , 000 sold under the name of pvp k - 120 . other suitable nonionic hair styling polymers are cross - linked silicone resins or gums . specific examples include rigid silicone polymers such as those described in ep - a - 0240350 and cross - linked silicone gums such as those described in wo 96 / 31188 . examples of cationic hair styling polymers are copolymers of amino - functional acrylate monomers such as lower alkyl aminoalkyl acrylate , or methacrylate monomers such as dimethylaminoethyl methacrylate , with compatible monomers such as n - vinylpyrrolidone , vinyl caprolactam , alkyl methacrylates ( such as methyl methacrylate and ethyl methacrylate ) and alkyl acrylates ( such as ethyl acrylate and n - butyl acrylate ). copolymers of n - vinylpyrrolidone and dimethylaminoethyl methacrylate , available from isp corporation as copolymer 845 , copolymer 937 and copolymer 958 ; copolymers of n - vinylpyrrolidone and dimethylaminopropylacrylamide or methacrylamide , available from isp corporation as styleze ® cc10 ; copolymers of n - vinylpyrrolidine and dimethylaminoethyl methacrylate ; copolymers of vinylcaprolactam , n - vinylpyrrolidone and dimethylaminoethylmethacrylate ; polyquaternium - 4 ( a copolymer of diallyldimonium chloride and hydroxyethylcellulose ); polyquaternium - 11 ( formed by the reaction of diethyl sulphate and a copolymer of vinyl pyrrolidone and dimethyl aminoethylmethacrylate ), available from isp as gafquat ® 734 , 755 and 755n , and from basf as luviquat ® pq11 ; polyquaternium - 16 ( formed from methylvinylimidazolium chloride and vinylpyrrolidone ), available from basf as luviquat ® fc 370 , fc 550 , fc 905 and hm - 552 ; polyquaternium - 46 ( prepared by the reaction of vinylcaprolactam and vinylpyrrolidone with methylvinylimidazolium methosulphate ), available from basf as luviquat ® hold . examples of suitable naturally - derived polymers include shellac , alginates , gelatins , pectins , cellulose derivatives and chitosan or salts and derivatives thereof . commercially available examples include kytamer ® ( ex amerchol ) and amaze ® ( ex national starch ). also suitable for use as additional styling polymers in the compositions of the invention are the ionic copolymers described in wo 93 / 03703 , the polysiloxane - grafted polymers disclosed in wo 93 / 23446 , the silicone - containing polycarboxylic acid copolymers described in wo 95 / 00106 or wo 95 / 32703 , the thermoplastic elastomeric copolymers described in wo 95 / 01383 , wo 95 / 06078 , wo 95 / 06079 and wo 95 / 01384 , the silicone grafted adhesive polymers disclosed in wo 95 / 04518 or wo 95 / 05800 , the silicone macro - grafted copolymers taught in wo 96 / 21417 , the silicone macromers of wo 96 / 32918 , the adhesive polymers of wo 98 / 48770 or wo 98 / 48771 or wo 98 / 48772 or wo 98 / 48776 , the graft polymers of wo 98 / 51261 and the grafted copolymers described in wo 98 / 51755 . in certain embodiments of the invention , the styling polymer is preferably a copolymer having a backbone comprising a polyether and , depending from the backbone , a plurality of poly ( vinyl ester ) groups . at least some of the ester groups are hydrolysed to the corresponding alcohol , preferably at least 50 %, more preferably at least 75 %, most preferably at least 95 % of the groups are hydrolysed to the corresponding alcohol . the poly ( vinyl ester ) chains optionally contain other functional groups in and / or on the polymer chain , such as , for example , amide and / or keto groups . the copolymer has a polyether backbone which is obtainable by the polymerisation of one or more alkylene oxides . the polyether may comprise a single alkyleneoxy group or a mixture of two or more alkyleneoxy groups . the polyether may , for example , be based on ethylene oxide , propylene oxide , butylene oxide , other alkylene oxides , polyglycerol and mixtures thereof . optionally , the backbone comprises linkages other than those based on polyether , such as , for example , amide or keto linkages . preferably , the copolymer comprises a polyethyleneglycol backbone . the copolymer is preferably polyethyleneglycol - co - polyvinylalcohol having polyvinylalcohol groups bound to the polyethyleneglycol i . e ., subtantially all of the poly ( vinyl ester ) groups are preferably hydrolysed in the copolymers used in the compositions of the invention . the copolymer can be produced by methods which are well - known to those skilled in the art . for example , the copolymers are obtainable by graft polymerisation . in a method comprising graft polymerisation , poly ( vinyl ester ) groups are preferably grafted onto a polyether and are subsequently hydrolysed to convert at least some of the ester groups to the corresponding alcohol . for example , de 1 077 430 , the contents of which are incorporated herein by reference , describes a process for the preparation of graft polymers of vinyl esters on polyalkylene glycols . the preparation of graft copolymers of polyvinyl alcohol on polyalkylene glycols by hydrolysis of the vinyl esters is described in de 1 094 457 and de 1 081 229 , both also incorporated herein by reference . the weight average molecular weight of the polyether is preferably from 1 to 100 kda . preferred copolymers for use in compositions of the invention have a molar ratio of polyether to total poly ( vinyl ester ) and polyvinylalcohol groups in the range of from about 95 : 5 to 5 : 95 , more preferably about 30 : 70 to about 50 : 50 . typically , such copolymers have a molar ratio of polyether to total poly ( vinyl ester ) and polyvinylalcohol groups of about 40 : 60 . the copolymer may be non - cross - linked or cross - linked and it is preferred that the copolymer is cross - linked . suitable cross - linking agents are those compounds which can bind to two or more polyether , poly ( vinyl ester ) and / or poly ( vinyl alcohol ) chains and include , for example , pentaerythritol triallyl ether . the compositions of the invention may comprise a surfactant in addition to that required for the preparation of any psa emulsion . the surfactants which are suitable for use in the compositions of the invention may be nonionic , cationic , anionic , zwitterionic or a mixture of such surfactants depending on the product form . the hair styling compositions of the invention preferably comprise a non - ionic surfactant , in an amount of up to 5 %, preferably from 0 . 01 % to 1 %, most preferably from 0 . 02 % to 0 . 8 % by weight based on total weight . examples of suitable non - ionic surfactants are condensation products of aliphatic ( c8 - c 18 ) primary or secondary linear or branched chain alcohols or phenols with alkylene oxides , usually ethylene oxide and generally having at least 15 , preferably at least 20 , most preferably from 30 to 50 ethylene oxide groups . other suitable non - ionics include esters of sorbitol , esters of sorbitan anhydrides , esters of propylene glycol , fatty acid esters of polyethylene glycol , fatty acid esters of polypropylene glycol , ethoxylated esters and polyoxyethylene fatty ether phosphates . of particular use are those non - ionic surfactants of general formula r ( eo ) x h , where r represents a straight or branched chain alkyl group having an average carbon chain length of 12 - 18 carbon atoms and x ranges from 30 to 50 . specific examples include steareth - 40 , steareth - 50 , ceteareth - 30 , ceteareth - 40 , ceteareth - 50 and mixtures thereof . suitable commercially available examples of these materials include unicol sa - 40 ( universal preserv - a - chem ), empilan km50 ( albright and wilson ), nonion ps - 250 ( nippon oils & amp ; fats ), volpo cs50 ( croda inc ), and incropol cs - 50 ( croda inc ). compositions of the present invention can also include water , preferably distilled or de - ionised , as a carrier for the psas , when used in an emulsion form in addition to it being a carrier or a solvent for other components . when present the water will typically be present in amounts ranging from 30 % to 98 %, preferably from 50 % to 95 % by weight . compositions of the present invention can also include solvents , as a carrier or solvent for the psas and other components . when present the solvent will typically be present in amounts ranging from 30 % to 98 %, preferably from 50 % to 95 % by weight . examples of solvents are hydrocarbons , esters , alcohols etc . hair conditioning agents such as hydrocarbons , esters , silicone fluids , and cationic materials may be included in the compositions of the invention . hair conditioning agents may typically be present in compositions of the invention in amounts of from 0 . 001 % to 10 % by weight , preferably 0 . 1 % to 3 % by weight . hair conditioning agents may be single compounds or mixtures of two or more compounds from the same class or different general classes . hair conditioning agents may be included in any of the compositions of the invention , regardless of whether they contain a hair styling polymer . in one embodiment of the invention , the compositions ( such as aerosol mousse formulations , for example ) comprise a hair conditioning agent and are substantially free of hair styling polymer . suitable hydrocarbons can be either straight or branched chain and can contain from about 10 to about 16 , preferably from about 12 to about 16 carbon atoms . examples of suitable hydrocarbons are decane , dodecane , tetradecane , tridecane , and mixtures thereof . suitable oily or fatty materials are selected from hydrocarbon oils , fatty esters and mixtures thereof . straight chain hydrocarbon oils will preferably contain from about 12 to about 30 carbon atoms . also suitable are polymeric hydrocarbons of alkenyl monomers , such as c 2 - c 6 alkenyl monomers . specific examples of suitable hydrocarbon oils include paraffin oil , mineral oil , saturated and unsaturated dodecane , saturated and unsaturated tridecane , saturated and unsaturated tetradecane , saturated and unsaturated pentadecane , saturated and unsaturated hexadecane , and mixtures thereof . branched - chain isomers of these compounds , as well as of higher chain length hydrocarbons , can also be used . suitable fatty esters are characterised by having at least 10 carbon atoms , and include esters with hydrocarbyl chains derived from fatty acids or alcohols , monocarboxylic acid esters include esters of alcohols and / or acids of the formula r ′ coor in which r ′ and r independently denote alkyl or alkenyl radicals and the sum of carbon atoms in r ′ and r is at least 10 , preferably at least 20 . di - and trialkyl and alkenyl esters of carboxylic acids can also be used . particularly preferred fatty esters are mono -, di - and triglycerides , more specifically the mono -, di -, and tri - esters of glycerol and long chain carboxylic acids such as c 1 - c 22 carboxylic acids . preferred materials include cocoa butter , palm stearin , sunflower oil , soyabean oil and coconut oil . the oily / fatty material is suitably present at a level of from 0 . 05 to 10 , preferably from 0 . 2 to 5 , more preferably from about 0 . 5 to 3 wt %. examples of suitable silicone conditioning agents useful herein can include either cyclic or linear polydimethylsiloxanes , phenyl and alkyl phenyl silicones , and silicone copolyols . cationic conditioning agents useful herein can include quaternary ammonium salts or the salts of fatty amines , such as cetyl ammonium chloride , for example . compositions according to the invention may , optionally , comprise from 0 . 1 % to 10 % by weight of a volatile silicone as the hair conditioning agent . volatile silicones are well known in the art and are commercially available and include , for example linear and cyclic compounds . volatile silicone oils are preferably linear or cyclic polydimethylsiloxanes containing from about three to about nine silicon atoms . the compositions of the invention may optionally comprise a cross - linked silicone polymer . the cross - linked silicone polymer is preferably a non - rigid emulsion - polymerised and may be present in compositions of the invention in an amount of up to 10 % by weight based on the total weight of the composition , more preferably from 0 . 2 % to 6 % by weight , most preferably from 0 . 5 to 5 % by weight . preferred silicone polymers for use in the invention are polydiorganosiloxanes , preferably derived from suitable combinations of r 3 sio 0 . 5 units and r 2 sio units where each r independently represents an alkyl , alkenyl ( e . g ., vinyl ), alkaryl , aralkyl , or aryl ( e . g . phenyl ) group . r is most preferably methyl . the preferred silicone polymers of the invention are cross - linked polydimethyl siloxanes ( which have the ctfa designation dimethicone ), and cross - linked polydimethyl siloxanes having end groups such as hydroxyl ( which have the ctfa designation dimethiconol ). good results have been obtained with cross - linked dimethiconol . cross - linking of the silicone polymer is typically introduced concurrently during emulsion polymerisation of the polymer through the inclusion of the required amount of trifunctional and tetrafunctional silane monomer units , for example , those of formula : r si ( oh ) 3 wherein r represents an alkyl , alkenyl ( e . g . vinyl ), alkaryl , aralkyl or aryl ( e . g . phenyl ) group , preferably methyl . the degree of cross - linking of the silicone polymer can be measured as the percentage of branched monomer units in the silicone polymer and is from 0 . 05 % to 10 %, preferably being in the range 0 . 15 % to 7 %, e . g . from 0 . 2 % to 2 %. increasing cross - linking is found to improve styling benefits but also to reduce conditioning performance somewhat , so compromise levels must be selected with properties optimised to suit consumer preferences in different cases . good overall performance has been obtained with dimethiconol 0 . 3 % cross - linked . suitable emulsion polymerised cross - linked silicone polymers are commercially available or can be readily made using conventional techniques well known to those skilled in the art . cross - linked silicone polymers are described in ep 818190 , the contents of which are incorporated herein by reference . the compositions of the invention may optionally comprise cationic surfactants , used singly or in admixture . cationic surfactants useful in compositions of the invention contain amino or quaternary ammonium hydrophilic moieties , which are positively charged when , dissolved in the aqueous composition of the present invention . examples of suitable cationic surfactants are those corresponding to the formula : in which r 1 , r 2 , r 3 , and r 4 are independently selected from ( a ) an aliphatic group of from 1 to 22 carbon atoms , or ( b ) an aromatic , alkoxy , polyoxyalkylene , alkylamido , hydroxyalkyl , aryl or alkylaryl group having up to 22 carbon atoms ; and x is a salt - forming anion such as those selected from halogen , ( e . g . chloride , bromide ), acetate , citrate , lactate , glycolate , phosphate nitrate , sulphate , and alkylsulphate radicals . the aliphatic groups can contain , in addition to carbon and hydrogen atoms , ether linkages , and other groups such as amino groups . the longer chain aliphatic groups , e . g ., those of about 12 carbons , or higher , can be saturated or unsaturated . the most preferred cationic surfactants for conditioner compositions of the present invention are monoalkyl quaternary ammonium compounds in which the alkyl chain length is c8 to c14 . in which r 5 is a hydrocarbyl chain having 8 to 14 carbon atoms or a functionalized hydrocarbyl chain with 8 to 14 carbon atoms and containing ether , ester , amido or amino moieties present as substituents or as linkages in the radical chain , and r 6 , r 7 and r 8 are independently selected from ( a ) hydrocarbyl chains of from 1 to about 4 carbon atoms , or ( b ) functionalized hydrocarbyl chains having from 1 to about 4 carbon atoms and containing one or more aromatic , ether , ester , amido or amino moieties present as substituents or as linkages in the radical chain , and x is a salt - forming anion such as those selected from halogen , ( e . g . chloride , bromide ), acetate , citrate , lactate , glycolate , phosphate nitrate , sulphate , and alkylsulphate radicals . the functionalised hydrocarbyl chains ( b ) may suitably contain one or more hydrophilic moieties selected from alkoxy ( preferably c 1 - c 3 alkoxy ), polyoxyalkylene ( preferably c 1 - c 3 polyoxyalkylene ), alkylamido , hydroxyalkyl , alkylester , and combinations thereof . preferably the hydrocarbyl chains r 1 have 12 to 14 carbon atoms , most preferably 12 carbon atoms . they may be derived from source oils which contain substantial amounts of fatty acids having the desired hydrocarbyl chain length . for example , the fatty acids from palm kernel oil or coconut oil can be used as a source of c8 to c12 hydrocarbyl chains . typical monoalkyl quaternary ammonium compounds of the above general formula for use in shampoo compositions of the invention include : ( i ) lauryl trimethylammonium chloride ( available commercially as arquad c35 ex - akzo ); cocodimethyl benzyl ammonium chloride ( available commercially as arquad dmcb - 80 ex - akzo ) [ n ( r 1 )( r 2 )(( ch 2 ch 2 o ) x h )(( ch 2 ch 2 o ) y h )] + ( x ) − r 1 is a hydrocarbyl chain having 8 to 14 , preferably 12 to 14 , most preferably 12 carbon atoms or a functionalised hydrocarbyl chain with 8 to 14 , preferably 12 to 14 , most preferably 12 carbon atoms and containing ether , ester , amido or amino moieties present as substituents or as linkages in the radical chain ; r 2 is a c 1 - c 3 alkyl group or benzyl group , preferably methyl , and x is a salt - forming anion such as those selected from halogen , ( e . g . chloride , bromide ), acetate , citrate , lactate , glycolate , phosphate nitrate , sulphate , methosulphate and alkylsulphate radicals . suitable examples are peg - n lauryl ammonium chlorides ( where n is the peg chain length ), such as peg - 2 cocomonium chloride ( available commercially as ethoquad c12 ex - akzo nobel ); peg - 2 cocobenzyl ammonium chloride ( available commercially as ethoquad cb / 12 ex - akzo nobel ); peg - 5 cocomonium methosulphate ( available commercially as rewoquat cpem ex - rewo ); peg - 15 cocomonium chloride ( available commercially as ethoquad c / 25 ex - akzo ) [ n ( r 1 )( r 2 )( r 3 )(( ch 2 ) n oh )] + ( x ) − r 1 is a hydrocarbyl chain having 8 to 14 , preferably 12 to 14 , most preferably 12 carbon atoms ; r 2 and r 3 are independently selected from c 1 - c 3 alkyl groups , and are preferably methyl , and x − is a salt - forming anion such as those selected from halogen , ( e . g . chloride , bromide ), acetate , citrate , lactate , glycolate , phosphate nitrate , sulphate , and alkylsulphate radicals . suitable examples are lauryldimethylhydroxyethylammonium chloride ( available commercially as prapagen hy ex - clariant ) mixtures of any of the foregoing cationic surfactants compounds may also be suitable . quaternary ammonium chlorides , e . g . alkyltrimethylammonium chlorides wherein the alkyl group has from about 8 to 22 carbon atoms , for example octyltrimethylammonium chloride , dodecyltrimethylammonium chloride , hexadecyltrimethylammonium chloride , cetyltrimethylammonium chloride , octyldimethylbenzylammonium chloride , decyldimethylbenzylammonium chloride , stearyldimethylbenzylammonium chloride , didodecyldimethylammonium chloride , dioctadecyldimethylammonium chloride , tallow trimethylammonium chloride , cocotrimethylammonium chloride , and the corresponding salts thereof , e . g ., bromides , hydroxides . cetylpyridinium chloride or salts thereof , e . g ., chloride in the conditioners of the invention , the level of cationic surfactant is preferably from 0 . 01 to 10 , more preferably 0 . 05 to 5 , most preferably 0 . 1 to 2 wt % of the total composition . conditioner compositions of the invention preferably additionally comprise a fatty alcohol material . the combined use of fatty alcohol materials and cationic surfactants in conditioning compositions is believed to be especially advantageous , because this leads to the formation of a lamellar phase , in which the cationic surfactant is dispersed . by “ fatty alcohol material ” is meant a fatty alcohol , an alkoxylated fatty alcohol , or a mixture thereof . representative fatty alcohols comprise from 8 to 22 carbon atoms , more preferably 16 to 20 . examples of suitable fatty compositions of the present invention are formulated into hair styling compositions which may take a variety of forms , including , for example , mousses , gels , lotions , creams , sprays and tonics . these product forms are well known in the art . the compositions of the invention are preferably foaming compositions . foaming compositions are those compositions which are capable of forming a foam on dispensation from a suitable container , such as a pressurised aerosol container . more preferably are in the form of an aerosol hair mousse . aerosol - form compositions of the invention will include an aerosol propellant which serves to expel the other materials from the container , and forms the mousse character in mousse compositions . the aerosol propellant included in styling compositions of the present invention can be any liquefiable gas conventionally used for aerosol containers . examples of suitable propellants include dimethyl ether and hydrocarbon propellants such as propane , n - butane and iso - butane . the propellants may be used singly or admixed . water insoluble propellants , especially hydrocarbons , are preferred because they form emulsion droplets on agitation and create suitable mousse foam densities . the amount of the propellant used is governed by normal factors well known in the aerosol art . for mousses the level of propellant is generally up to 35 %, preferably from 2 % to 30 %, most preferably from 3 % to 15 % by weight based on total weight of the composition . if a propellant such as dimethyl ether includes a vapour pressure suppressant ( e . g . trichloroethane or dichloromethane ), for weight percentage calculations , the amount of suppressant is included as part of the propellant . for aerosol sprays the levels of propellant are usually higher ; preferably from 30 to 98 wt % of the total composition , more preferably 50 to 95 wt %. preferred propellants are selected from propane , n - butane , isobutane , dimethyl ether and mixtures thereof . preferably , the propellant comprises dimethyl ether and at least one of propane , n - butane and isobutane . the method of preparing aerosol hair styling mousse compositions according to the invention follows conventional aerosol filling procedures . the composition ingredients ( not including the propellant ) are charged into a suitable pressurisable container which is sealed and then charged with the propellant according to conventional techniques . compositions of the invention may also take a non - foaming product form , such as a hair styling cream or gel . such a cream or gel will include a structurant or thickener , typically at a level of from 0 . 1 % to 10 %, preferably 0 . 5 % to 3 % by weight based on total weight . examples of suitable structurants or thickeners are polymeric thickeners such as carboxyvinyl polymers . a carboxyvinyl polymer is an interpolymer of a monomeric mixture comprising a monomeric olefinically unsaturated carboxylic acid , and from about 0 . 01 % to about 10 % by weight of the total monomers of a polyether of a polyhydric alcohol . carboxyvinyl polymers are substantially insoluble in liquid , volatile organic hydrocarbons and are dimensionally stable on exposure to air . suitably the molecular weight of the carboxyvinyl polymer is at least 750 , 000 , preferably at least 1 , 250 , 000 , most preferably at least 3 , 000 , 000 . preferred carboxyvinyl polymers are copolymers of acrylic acid cross - linked with allylsucrose or allylpentaerythritol as described in u . s . pat . no . 2 , 798 , 053 . these polymers are provided by b . f . goodrich company as , for example , carbopol 934 , 940 , 941 and 980 . other materials that can also be used as structurants or thickeners include those that can impart a gel - like viscosity to the composition , such as water soluble or colloidally water soluble polymers like cellulose ethers ( e . g . methylcellulose , hydroxyethylcellulose , hydroxypropylmethylcellulose and carboxymethylcellulose ), guar gum , sodium alginate , gum arabic , xanthan gum , polyvinyl alcohol , polyvinyl pyrrolidone , hydroxypropyl guar gum , starch and starch derivatives , and other thickeners , viscosity modifiers , gelling agents , etc . it is also possible to use inorganic thickeners such as bentonite or laponite clays . the hair styling compositions of the invention can contain a variety of non - essential , optional components suitable for rendering the compositions more aesthetically acceptable or to aid use , including discharge from the container , of the product . such conventional optional ingredients are well known to those skilled in the art , e . g . preservatives such as benzyl alcohol , methyl paraben , propyl paraben and imidazolidinyl urea , fatty alcohols such as cetearyl alcohol , cetyl alcohol and stearyl alcohol , ph adjusting agents such as citric acid , succinic acid , sodium hydroxide and triethanolamine , colouring agents such as any of the fd & amp ; c or d & amp ; c dyes , perfume oils , chelating agents such as ethylenediamine tetraacetic acid , and polymer plasticising agents such as glycerin and propylene glycol the invention will now be further illustrated by the following , non - limiting examples . examples of the invention are illustrated by a number , comparative examples are illustrated by a letter . dc ® dc ® dc ® dc ® 5 - 7300 5 - 7200 5 - 7200 5 - 7200 product code 18393 - 45 17724 - 65 - a 17724 - 65 - b 17724 - 65 - c % internal phase 60 60 60 60 ( solvent + psa ) psa : solvent ratio 40 : 60 60 : 40 60 : 40 60 : 40 solvent isodo - 1 cst pdms 1 cst pdms 1 cst pdms decane resin : polymer 65 : 35 65 : 35 65 : 35 55 : 45 ratio particle size 4 . 312 μm 10 μm 4 μm 14 μm d50 ( microtrack ) emulsifier anionic anionic anionic anionic raw material % wt . raw ingredient trade name supplier material psa emulsion 1 dc ® 5 - 7200 dow corning 2 . 8 17724 - 65 - c cetearyl alcohol laurex cs albright & amp ; 0 . 64 wilson behenyl trimethyl genamin kdmp clariant 0 . 32 ammonium chloride isopropyl isopropyl uniqema 2 myristate myristate cationic acrylic salcare sc96 allied 1 . 2 homopolymer colloids dispersed in an emollient ester 18 trained panellists used the both prototype formulations and a control in duplicate for three days each in their homes and have scored the products using a 100 point scale on a number of attributes including stickiness of hair and stickiness of hand . 4 a raw % wt . % wt . material active active ingredient trade name supplier ingredient ingredient dc ® — dow 1 . 7 5 - 7200 corning 17724 - 65 - b copolymer of luviquat * basf plc 2 3 - methyl - 1 - fc550 vinyl - 1h - imidazolium chloride and 1 - vinyl - 2pyrrolidone ( 50 : 50 ) cetearyl laurex cs albright 0 . 6 0 . 6 alcohol & amp ; wilson behenyl genamin clariant 0 . 3 0 . 3 trimethyl kdmp ammonium chloride isopropyl isopropyl uniqema 2 2 myristate myristate polyoxy - emalex nihon 1 1 ethylene ( 10 ) 710 emulsion lauryl ether co ., ltd propane / cap 40 calor gas 8 8 butane gas water deionised local up to 100 up to 100 water supply the panellists typically apply 5 g of product to their hair . they typically wash their hair every night and apply the mousse to their hair the following morning following their usual styling routine . the panellists used each product for 3 consecutive days and scored it on the third day using the score - sheet provided . once all mousses have been evaluated in the order set out the test is completed . normalised average scores * (%) 4 a stickiness of hand − 9 16 stickiness of hair 3 9 volume down 8 6 example 4 gives similar volume control to comparative example a , but it is perceived as less sticky on hair and much less sticky on hands . the styling performance of two psa emulsions was compared to that of luviquat * fc550 a conventional styling polymer . a set of 5 2 g / 25 cm switches made from ‘ virgin ’ spanish hair was washed with 16 % wt . sles . 2eo . 1 ml solution was applied along the length of the hair and agitated for 30 sec . the switches were then rinsed with warm water for 30 sec . further 1 ml surfactant solution was applied and the hair was agitated for 30 sec again followed by 1 min rinse with warm water . the towel dried hair was then treated with the examples exemplified below : % active ingredient b 5 6 copolymer of 3 - luviquat * basf plc 1 . 2 methyl - 1 - vinyl - fc550 1h - imidazolium chloride and 1 - vinyl - 2pyrrolidone ( 50 : 50 ) psa emulsion dc ® 5 - 7200 dow 1 . 2 17724 - 65 - a corning psa emulsion dc ® 5 - 7300 calor gas 1 . 2 18393 - 45 polyoxyethylene emalex 710 nihon 1 1 1 ( 10 ) lauryl ether emulsion co ., ltd propane / butane cap40 cap 40 8 8 8 gas water local up to up to up to supply 100 100 100 1 g of mousse was applied to each set of 5 2 g / 25 cm hair switches ensuring even distribution . each switch was wound on a pegboard . the pegboards were then placed in a drying cabinet @ 65 ° c ./ 10 % rh for 3 h . prior removing the curls , the pegboards were left at ambient conditions for 30 min . the curls were then hung on a panel and placed in humidity chamber at 30 ° c ./ 90 % rh . the curls were photographed every 5 min and a record of the curl length was kept . the generated colour digital images were rendered into grey - scale format . the grey - scale images were subsequently converted into a binary form ( i . e . composed only of black and white pixels ). the dimensionless 2d projection area of each switch was used as a measure for the extent of switch spread out ( i . e . loss of curliness ). the projection area was calculated from the number of black pixels . the data were normalised by taking the ratio of the projection area to the average switch projection area calculated for the set of switches treated with example 6 . b 5 6 water normalised projection 1 . 34 ± 0 . 13 1 . 27 ± 0 . 13 1 2 . 2 + 0 . 13 area after 1 h & amp ; 30 ° c ./ 90 % rh the pressure sensitive adhesives give similar or better curl retention to that of the styling polymer . the styling performance of pressure sensitive adhesive emulsion was tested against conventional conditioning silicone and x - linked silicone used in styling formulations . % active ingredient 7 c d psa emulsion dc ® 5 - 7200 dow 1 . 2 17724 - 65 - a corning methylpolysiloxane dow dow 1 . 2 emulsion corning 2 - corning ( 1mmcs ) 1784 hvf emulsion cross - linked dow dow 1 . 2 methylpolysiloxane corning 2 - corning 1787 hvf emulsion polyoxyethylene emalex 710 nihon 1 1 1 ( 10 ) lauryl ether emulsion co ., ltd propane / butane cap40 cap 40 8 8 8 gas water local up to up to up to supply 100 100 100 three sets of 5 2 g / 25 cm ‘ virgin ’ spanish hair were washed and treated with formulations 7 , c and d as described above . the switches were then hung vertically and left to dry @ 20 ° c ./ 50 % rh . the dried switches were photographed and the obtained images were analysed in the manner described above to obtain the average normalised projection area , which was used as a measure of the extent of switch expansion . example 7 was used for control . 7 c d normalised projection area 1 1 . 8 ± 0 . 1 3 . 6 ± 0 . 4 the pressure sensitive adhesive gives much lower hair volume than the conditioning and the styling silicone . | 0 |
fig1 is a schematic view of an exemplary configuration of a content managing system according to a first exemplary embodiment . the content managing system includes a content managing server 1 , an image forming apparatus 2 , and a signage controller 3 which are connected to one another through a network 5 so as to communicate with one another . the image forming apparatus 2 is operated by a user 6 . the content managing server 1 which is an information processing apparatus serving as a server and which operates in response to a request from the image forming apparatus 2 includes electronic components , such as a central processing unit ( cpu ) having a function for processing information and a hard disk for storing information , in the body thereof . the content managing server 1 controls the signage controller 3 . the image forming apparatus 2 has at least a scan function , a print function , and an external communication function , and includes functional units for achieving the above - described functions , and electronic components , such as a cpu and a dynamic random access memory ( dram ), in the body thereof . the signage controller 3 which controls a display apparatus 4 so that images and characters are displayed , and which receives information necessary for the display by communicating with the content managing server 1 includes electronic components , such as a cpu and a dram . the network 5 is a communication network and is , for example , a wired or wireless communication network , such as the internet , an intranet , or a local area network ( lan ). in the above - described configuration , when the user 6 uses the image forming apparatus 2 to scan a document 7 , document information generated by scanning the document 7 is transmitted to the content managing server 1 , and is stored . the user 6 writes a distribution time or the like of the document information on a setting sheet described below , and scans the setting sheet by using the image forming apparatus 2 . then , distribution setting information generated through the scanning is transmitted to the content managing server 1 , and is stored . the content managing server 1 distributes the document information and the distribution setting information to the signage controller 3 , and the signage controller 3 causes the document information to be displayed on the display apparatus 4 on the basis of the distribution setting information . some or all of the functions of the content managing server 1 may be included in the image forming apparatus 2 or the signage controller 3 . fig2 is a block diagram illustrating an exemplary configuration of the content managing server 1 according to the first exemplary embodiment . the content managing server 1 includes a controller 10 which includes a cpu , which controls the units , and which executes various programs , a memory 11 which includes a storage medium such as a hard disk and which is used to store information , and a communication unit 12 which communicates with the outside via a network . the controller 10 executes a content management program 110 described below , thereby functioning as a document receiving unit 100 , a setting - sheet output unit 101 , a setting receiving unit 102 , a charging unit 103 , a content distributing unit 104 , and the like . the document receiving unit 100 receives document information obtained by scanning the document 7 on the image forming apparatus 2 , from the image forming apparatus 2 , and stores the document information as document information 111 in the memory 11 . when the document receiving unit 100 receives the document information 111 , the setting - sheet output unit 101 causes the image forming apparatus 2 to output a setting sheet for setting a distribution condition of the document information 111 . the setting receiving unit 102 receives distribution setting information obtained by scanning the setting sheet on the image forming apparatus 2 , and stores the distribution setting information as distribution setting information 113 in the memory 11 . the setting receiving unit 102 may include a unit that recognizes setting specified in image information obtained by scanning the setting sheet and that converts the recognized result into distribution setting information , or the image forming apparatus 2 may perform such conversion . after the setting receiving unit 102 stores the distribution setting information 113 , the charging unit 103 performs a charging process in the image forming apparatus 2 . when the charging unit 103 completes the charging process , the content distributing unit 104 distributes the document information 111 and the distribution setting information 113 to the signage controller 3 . the memory 11 is used to store the content management program 110 which causes the controller 10 to function as the above - described units 100 to 104 , the document information 111 , content management information 112 , the distribution setting information 113 , and the like . fig3 is a schematic view of an exemplary structure of the content management information 112 . in the content management information 112 , a document id for identifying the document information 111 , the file name of the document information , and the file name of the distribution setting information are stored in such a manner as to be associated with one another . actions according to the first exemplary embodiment will be described by classifying them into ( 1 ) document - information registration operations , ( 2 ) distribution - setting - information registration operations , ( 3 ) charging operations , ( 4 ) distribution operations , and ( 5 ) reregistration operations . fig4 a to 4d are diagrams for describing exemplary operations performed in the content managing system . fig7 is a flowchart of exemplary operations performed by the content managing server 1 when posting is performed . as illustrated in fig4 a , the user 6 uses the image forming apparatus 2 to scan the document 7 . the image forming apparatus 2 scans the document 7 to generate document information , and transmits the document information to the content managing server 1 . the document receiving unit 100 of the content managing server 1 receives the document information from the image forming apparatus 2 , and stores the document information as the document information 111 in the memory 11 ( s 1 ). at that time , the document receiving unit 100 inputs a new document id in the content management information 112 illustrated in fig3 , and associates the document id with the document information ( s 2 ). for example , the document receiving unit 100 inputs a document id of “ 003 ” for the document information whose document information name is “ ghi . jpg ”. at this time point , the distribution setting information field is set to blank because no distribution setting information has been associated with the document information . then , the setting - sheet output unit 101 transmits an inquiry about a display schedule to the signage controller 3 to check the display schedule of the signage controller 3 ( s 3 ). for example , assume that a response is received which indicates that the time zone “ 03 : 00 to 06 : 00 ” corresponds to “ off hours ”, that the time zone “ 12 : 00 to 15 : 00 ” is “ unavailable because other post documents are displayed ”, and that the other time zones are available . the term “ posting ” indicates some or all of the procedures performed by the user 6 so as to display the content of the document 7 on the display apparatus 4 . the setting - sheet output unit 101 may perform this checking process on the basis of the content management information 112 and the distribution setting information 113 of the other documents stored in the memory 11 of the content managing server 1 . alternatively , the content managing server 1 may manage the display schedule . as illustrated in fig4 b , the setting - sheet output unit 101 causes the image forming apparatus 2 to output a setting sheet 8 which is used to set a distribution condition of the document information 111 and which reflects the above - described response ( s 4 ). the setting sheet 8 has a configuration , for example , illustrated in fig5 described below . fig5 is a schematic view of an exemplary configuration of the setting sheet 8 . fig6 is a schematic view of another exemplary configuration of the setting sheet 8 . in a setting sheet 8 a which is an exemplary setting sheet 8 , for example , when a time zone is unavailable because the time zone corresponds to “ off hours ”, such as the time zone “ 03 : 00 to 06 : 00 ”, or because the time zone is “ unavailable because other post documents are displayed ”, such as the time zone “ 12 : 00 to 15 : 00 ”, the time zone is displayed in gray and no checkboxes are provided so that it is indicated that it is impossible to perform setting for the time zone . options for setting items , such as “ display time zone ”, “ display period ”, and “ day of week for display ” are displayed along with checkboxes . an item “ output setting sheet again ” is an item used in “( 5 ) reregistration operations ”, and will be described below . an item “ delete ” is an item for deleting the document information 111 corresponding to the scanned document 7 . on the back side of the setting sheet 8 a , a copy of the posted document 7 may be printed so that the user 6 may check which document corresponds to the setting sheet 8 a after the posting operations . like a setting sheet 8 b illustrated in fig6 described below , the posted document 7 and the setting items may be printed on the same side . then , as illustrated in fig4 c , the user 6 writes a distribution time or the like of the document information 111 on the setting sheet 8 , and causes the image forming apparatus 2 to scan the setting sheet 8 . for example , assume that the checkboxes for “ 06 : 00 to 09 : 00 ” and “ 15 : 00 to 18 : 00 ” in “ display time zone ” are checked , and that the checkbox “ one week ” in “ display period ” is checked . the image forming apparatus 2 scans the setting sheet 8 to generate distribution setting information , and transmits the distribution setting information to the content managing server 1 . the setting receiving unit 102 receives the distribution setting information from the image forming apparatus 2 , and stores the distribution setting information as the distribution setting information 113 in the memory 11 ( s 5 ). the file name of the stored distribution setting information 113 is input in the content management information 112 . in the example illustrated in fig3 , the file name “ ghi ” is input in the distribution setting information field for the document id “ 003 ”. a case in which the checkbox “ delete ” is not checked on the setting sheet 8 will be described ( no in step s 6 ). after the setting receiving unit 102 stores the distribution setting information 113 , the charging unit 103 performs a charging operation on the image forming apparatus 2 ( s 7 ). the image forming apparatus 2 displays the amount of money required to be paid , on a display thereof . as illustrated in fig4 d , the user 6 pays the charge , for example , by putting money into a slot provided on the image forming apparatus 2 , or by holding a card against a prepaid card reader . when the charge is paid , the image forming apparatus 2 transmits the information describing that the charge has been paid , to the content managing server 1 . then , when the charging unit 103 completes the charging process , the content distributing unit 104 distributes the document information 111 and the distribution setting information 113 to the signage controller 3 ( s 8 ). the signage controller 3 displays the document information on the display apparatus 4 on the basis of the distribution setting information . in the above - described example , the document information 111 is displayed in the time zones “ 06 : 00 to 09 : 00 ” and “ 15 : 00 to 18 : 00 ” in one week . in step s 6 , when the checkbox “ delete ” is checked ( yes in step s 6 ), the setting receiving unit 102 deletes the document information 111 received in step s 1 , from the memory 11 ( s 9 ). the reregistration operations described below are operations performed when the setting sheet 8 is scanned again after “( 1 ) document - information registration operations ”, “( 2 ) distribution - setting - information registration operations ”, “( 3 ) charging operations ”, and “( 4 ) distribution operations ” which are described above are performed . fig8 is a flowchart of exemplary operations performed by the content managing server 1 when posting is performed again . to change the condition which has been set , the user 6 uses the image forming apparatus 2 to scan the setting sheet 8 which was used before . a case in which the checkbox “ output setting sheet again ” is checked will be described . the image forming apparatus 2 scans the setting sheet 8 to generate distribution setting information , and transmits the distribution setting information to the content managing server 1 . the setting receiving unit 102 of the content managing server 1 receives the distribution setting information from the image forming apparatus 2 ( s 10 ). if the checkbox “ output setting sheet again ” is checked ( yes in step s 11 ), the setting - sheet output unit 101 transmits an inquiry about a display schedule to the signage controller 3 to check the display schedule of the signage controller 3 ( s 12 ). when the content managing server 1 manages the display schedule , the checking process is performed in the content managing server 1 . then , the setting - sheet output unit 101 causes the image forming apparatus 2 to output a setting sheet 8 which is used to set a distribution condition of the document information 111 again and which reflects the response from the signage controller 3 or the content managing server 1 ( s 13 ). when the user 6 writes a new condition on the newly output setting sheet 8 and causes the image forming apparatus 2 to scan the setting sheet 8 , the content managing server 1 performs operations described in steps s 5 to s 9 . thus , the old distribution setting information 113 is updated . if the checkbox “ output setting sheet again ” is not checked in step s 11 ( no in step s 11 ), and if the checkbox “ delete ” is not checked ( no in step s 14 ), the charging unit 103 performs a charging process on the image forming apparatus 2 ( s 15 ), and the content distributing unit 104 refers to the content management information 112 on the basis of the document id , and distributes the document information with the distribution setting information 113 having the same condition as that transmitted the last time , to the signage controller 3 ( s 16 ). if these operations are performed after the period which is set first elapses , the user 6 does not have to perform the same setting procedure again . it is assumed that the above - described operations are performed on the same image forming apparatus 2 . when the operations are performed on a different image forming apparatus 2 , the document information 111 with the distribution setting information 113 having the same condition as that used the last time may be transmitted to a different signage controller 3 associated with the different image forming apparatus 2 . in this case , these operations may be performed before the period which is set first elapses . a setting item “ distribution area ” may be provided , and distribution to signage controllers 3 installed in multiple places may be performed . if the checkbox “ delete ” is checked in step s 14 ( yes in step s 14 ), the setting receiving unit 102 refers to the content management information 112 , and deletes the document information 111 corresponding to the document id from the memory 11 ( s 17 ). the document information 111 is also deleted from the signage controller 3 . then , the distribution setting information 113 and the display schedule are updated . a second exemplary embodiment is different from the first exemplary embodiment in that a distribution condition is set by operating an operation unit of the image forming apparatus 2 . in the description below , operations similar to those in the first exemplary embodiment will not be described . the operations “( 4 ) distribution operations ” and “( 5 ) reregistration operations ” which are similar to those in the first exemplary embodiment will not be described . actions according to the second exemplary embodiment will be described by classifying them into ( 1 ) document - information registration operations , ( 2 ) distribution - setting - information registration operations , and ( 3 ) charging operations . fig9 a to 9d are diagrams for describing exemplary operations performed in the content managing system according to the second exemplary embodiment . as illustrated in fig9 a , the user 6 uses the image forming apparatus 2 to scan the document 7 . the image forming apparatus 2 scans the document 7 to generate document information , and transmits the document information to the content managing server 1 . the document receiving unit 100 of the content managing server 1 receives the document information from the image forming apparatus 2 , and stores the document information as the document information 111 in the memory 11 . at that time , the document receiving unit 100 inputs a new document id in the content management information 112 illustrated in fig3 , and associates the document id with the document information . then , the setting receiving unit 102 transmits an inquiry about a display schedule to the signage controller 3 to check the display schedule of the signage controller 3 . when the content managing server 1 manages the display schedule , the checking process is performed in the content managing server 1 . then , as illustrated in fig9 b , the setting receiving unit 102 displays a setting screen which is used to set a distribution condition of the document information 111 and which reflects the response from the signage controller 3 or the content managing server 1 , on the display of the image forming apparatus 2 . the setting screen has a configuration , for example , similar to that of the example illustrated in fig5 . then , the user 6 inputs a distribution time or the like of the document information 111 on the setting screen . the image forming apparatus 2 generates distribution setting information from the setting information , and transmits the distribution setting information to the content managing server 1 . the setting receiving unit 102 receives the distribution setting information from the image forming apparatus 2 , and stores the distribution setting information as the distribution setting information 113 in the memory 11 . the file name of the stored distribution setting information 113 is input to the content management information 112 . as illustrated in fig9 c , the setting - sheet output unit 101 causes the image forming apparatus 2 to output a setting sheet 8 c which reflects the distribution setting information 113 . the setting sheet 8 c is used to reregister setting information , and has a configuration illustrated in fig1 described below . fig1 is a schematic view of an exemplary configuration of the setting sheet 8 c . in the setting sheet 8 c , selected items among the setting items “ display time zone ”, “ display period ”, “ day of week for display ”, and the like are displayed with checked checkboxes , and options which may be used for modification are also displayed with unchecked checkboxes . the item “ delete ” is one for deleting the document information 111 corresponding to the scanned document 7 . on the back side of the setting sheet 8 c , a copy of the posted document 7 may be printed so that the user 6 may check which document corresponds to the setting sheet 8 c . as in the setting sheet 8 b illustrated in fig6 , the posted document 7 and the setting items may be printed on the same side . after the setting sheet 8 c is output from the image forming apparatus 2 , the charging unit 103 performs a charging operation on the image forming apparatus 2 . the image forming apparatus 2 displays the amount of money required to be paid , on the display . as illustrated in fig9 d , the user 6 pays the charge , for example , by putting money into the slot provided on the image forming apparatus 2 , or by holding a card against the prepaid card reader . when the charge is paid , the image forming apparatus 2 transmits the information describing that the charge has been paid , to the content managing server 1 . a third exemplary embodiment is different from the first exemplary embodiment in that document information is uploaded from a terminal , that a distribution condition is set from a terminal , and that a setting sheet is printed by a printer connected to a terminal . in the description below , operations similar to those in the first exemplary embodiment will not be described . the operations “( 4 ) distribution operations ” and “( 5 ) reregistration operations ” which are similar to those in the first exemplary embodiment will not be described . actions according to the third exemplary embodiment will be described by classifying them into ( 1 ) document - information registration operations , ( 2 ) distribution - setting - information registration operations , and ( 3 ) charging operations . fig1 a to 11d are diagrams for describing exemplary operations performed in the content managing system according to the third exemplary embodiment . as illustrated in fig1 a , the user 6 operates a terminal 9 a so that document information is uploaded . the uploading operation is performed by using a dedicated application , a web browser , or the like . the terminal 9 a transmits the document information to the content managing server 1 . the document receiving unit 100 of the content managing server 1 receives the document information from the terminal 9 a , and stores the document information as the document information 111 in the memory 11 . at that time , the document receiving unit 100 inputs a new document id in the content management information 112 illustrated in fig3 , and associates the document id with the document information . then , the setting receiving unit 102 transmits an inquiry about a display schedule to the signage controller 3 to check the display schedule of the signage controller 3 . when the content managing server 1 manages the display schedule , the checking process is performed in the content managing server 1 . then , as illustrated in fig1 b , the setting receiving unit 102 displays a setting screen which is used to set a distribution condition of the document information 111 and which reflects the response from the signage controller 3 or the content managing server 1 , on a display of the terminal 9 a . the setting screen has a configuration , for example , similar to that of the example illustrated in fig5 . then , the user 6 inputs a distribution time or the like of the document information 111 on the setting screen . the terminal 9 a generates distribution setting information from setting information , and transmits the distribution setting information to the content managing server 1 . the setting receiving unit 102 receives the distribution setting information from the image forming apparatus 2 , and stores the distribution setting information as the distribution setting information 113 in the memory 11 . the file name of the stored distribution setting information 113 is input to the content management information 112 . then , the setting - sheet output unit 101 outputs the setting sheet 8 c which reflects the distribution setting information 113 , from a printer 9 b connected to the terminal 9 a . the setting sheet 8 c is used to reregister setting information . the setting sheet 8 c is output from the printer 9 b connected to the terminal 9 a . alternatively , the document id may be displayed on the terminal , or may be transmitted to a portable terminal or the like through email . the document id which is input from the operation unit of the image forming apparatus 2 may be used to output the setting sheet 8 c from the image forming apparatus 2 . as illustrated in fig1 c , the user 6 uses the image forming apparatus 2 to scan the setting sheet 8 c . the image forming apparatus 2 scans the setting sheet 8 c and transmits the scanned information to the content managing server 1 . the content managing server 1 refers to the content management information 112 , and specifies the distribution setting information 113 and the document information 111 which the user 6 wants to distribute , on the basis of the information of the setting sheet 8 c . then , the charging unit 103 performs a charging process on the image forming apparatus 2 . the image forming apparatus 2 displays the amount of money to be paid , on the display . as illustrated in fig1 d , the user 6 pays the charge , for example , by putting money into the slot provided on the image forming apparatus 2 , or by holding a card against the prepaid card reader . when the charge is paid , the image forming apparatus 2 transmits the information describing that the charge has been paid , to the content managing server 1 . the present invention is not limited to the above - described exemplary embodiments . various modifications may be made without departing from the gist of the present invention . the first to third exemplary embodiments described above may be combined with one another as appropriate . a procedure and a configuration for checking if information in the document 7 is not contrary to public policy or morality and is appropriate may be provided . for example , before document information is transmitted from the image forming apparatus 2 to the content managing server 1 , the document information is to be transmitted by way of a server for checking , which has a check function , and the server for checking checks if the document information is appropriate . for example , the checking procedure is performed as follows . the server for checking separates text portions from image portions by performing image processing on the document information . then , for the text portions , a check process is performed by checking a word and the sequence of strings before and after the word against a preregistered database . for the image portions , a check process is performed , for example , by retrieving similar images and analyzing the amount of skin portions . when the server for checking determines that the document information is inappropriate , the content managing server 1 causes the image forming apparatus 2 to print , instead of the setting sheet 8 , printed material on which a message that it is not possible to post the document because it is inappropriate is described . thus , the user 6 may recognize that the document 7 is inappropriate . in the above - described exemplary embodiments , the functions of the units 100 to 104 of the controller 10 are implemented by using programs . all or some of the units may be implemented by using hardware such as an application - specific integrated circuit ( asic ). programs used in the above - described exemplary embodiments may be provided by storing the programs in a recording medium such as a compact disc - read - only memory ( cd - rom ). replacement , deletion , addition , and the like of the steps described in the above - described exemplary embodiments may be performed as long as the gist of the present invention is not changed . the foregoing description of the exemplary embodiments of the present invention has been provided for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . obviously , many modifications and variations will be apparent to practitioners skilled in the art . the embodiments were chosen and described in order to best explain the principles of the invention and its practical applications , thereby enabling others skilled in the art to understand the invention for various embodiments and with the various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the following claims and their equivalents . | 7 |
the dryer 10 illustrated in the figure serves for drying laundry in a highly effective and energy - efficient manner . a dryer 10 of this kind is used , primarily , in commercial laundries . in the case of the shown dryer 10 , air for drying the laundry is heated by a single burner 11 . however , the dryer 10 can also have a plurality of burners 11 which are arranged in parallel or in series . the burner 11 may be any desired burner 11 , preferably a gas burner or an oil burner . the dryer 10 has an external housing 12 , preferably a closed , box - like housing 12 in which a drying drum 14 which can be driven in rotation about a horizontal rotation axis 13 , the said burner 11 , a circulating - air fan 15 and corresponding aid - guidance ducts are arranged . the drying drum 14 which can be driven in rotation serves to accommodate the items of laundry which are to be dried . the items of laundry are not shown in the figure . the drying drum 14 also has a loading and unloading opening — likewise not shown . in particular , the casing of the cylindrical drying drum 14 is designed to be permeable to air so that air which serves for drying purposes can flow through the drying drum 14 and the laundry which is to be dried and is located in the said drum . the drying drum 14 is partially surrounded by arcuate walls , which are impermeable to air , at a short distance from the cylindrical casing . the walls lie on a circular path which runs in a concentric manner about the rotation axis 13 . the walls preferably leave free diametrically opposite openings , specifically an upper air - inlet opening 16 and a lower air - outlet opening 17 . the circulating - air fan 15 is located above the drying drum 14 in the housing 12 , it being possible for the said circulating - air fan to be another air - flow generator , for example a blower . in addition to the circulating - air fan 15 , the burner 11 is arranged approximately centrally in the upper region of the housing 12 , specifically such that the axes of the flames run approximately horizontal transverse to the rotation axis 13 . an exhaust - air nozzle 18 is located in a bevelled , upper , right - hand - side region of the housing 12 . the exhaust - air nozzle 18 has an associated temperature sensor — not shown — with which the exhaust - air temperature can be determined . a circulating - air flap 19 is provided in the interior of the housing 12 beneath the exhaust - air nozzle 18 . the circulating - air flap 19 can be pivoted about a preferably horizontal pivot axis 20 by a drive — not shown . the circulating - air flap 19 can be pivoted to such an extent that firstly it completely closes the exhaust - air nozzle 18 in an open position and secondly completely opens the exhaust - air nozzle 18 in a closed position and completely interrupts or suppresses a flow of circulating air to the air - inlet opening 16 in the drying drum 14 . any desired intermediate positions of the circulating - air flap 19 are possible between the said extreme positions . the angular position of the circulating - air flap 19 can be determined by an angle sensor — not shown . in the case of the described dryer 10 , the drying process proceeds as follows : at the beginning of the drying process , air 21 which is heated by the burner 11 is conducted via the air - inlet opening 16 to the drying drum 14 which is driven in rotation and contains the laundry which is to be dried and is located in the said drying drum . as it flows along the damp laundry , the heated air 21 absorbs moisture . as a result , moist air 22 is discharged out of the drying drum 14 through the air - outlet opening 17 . the moist air 22 is transported away by the circulating - air fan 15 . when the circulating - air flap 19 is completely closed , all the moist air 22 is routed to the outside through the exhaust - air nozzle 18 . the discharged moist air 22 is replaced by fresh air which is heated by the burner 11 and arrives at the drying drum 14 through the air - inlet opening 16 as heated air 21 without circulating air . as the drying process progresses , the amount of moisture in the moist air 22 decreases . a portion of the moist air 22 is then supplied , past the burner 11 , to the drying drum 14 containing the laundry which is to be dried and is contained in the said drying drum again as circulating air . for this purpose , the circulating - air flap 19 is partially opened by pivoting in the clockwise direction ( in relation to the figure ) about the pivot axis 20 . the circulating - air flap 19 is opened to such an extent that the desired circulating - air stream is set , that is to say a targeted proportion of the moist air 22 is supplied to the drying drum 14 again as circulating air 24 and a remaining portion of the moist air 22 is conducted through the exhaust - air nozzle 18 to the outside as exhaust air 23 . the proportion of exhaust air 23 which is conducted to the outside is replaced by fresh air which is heated by the burner 11 and is supplied through the air - inlet opening 16 to the drying drum 14 as heated air 21 together with the circulating air . in this case , only that portion of the moist air 22 which is conducted to the outside as exhaust air 23 is replaced . as the drying period increases , the proportion of circulating air 24 is successively increased . to this end , the circulating - air flap 19 is gradually opened further , with the result that it closes the exhaust - air nozzle 18 more and more , and less moist air 22 , which still contains a considerable amount of residual heat , escapes to the outside through the exhaust - air nozzle 18 . the method according to the invention will be explained in greater detail below with reference to the dryer 10 which is described above : according to the invention , current factors are formed from a plurality of drying parameters during the drying process . the factors are used firstly to control or to regulate the drying process and secondly to terminate the drying process . however , the invention is not restricted to this . the method according to the invention can also relate to terminating the drying process on the basis of the factor or controlling or regulating the drying process on the basis of the continually determined factors . in the present exemplary embodiment , the angular position of the circulating - air flap 19 which is determined by an angle sensor , the feed - air temperature which is determined by a temperature sensor , that is to say the temperature of the fresh air which is to be heated by the burner 11 , the exhaust - air temperature which is likewise determined by a temperature sensor , that is to say the temperature of the moist air 22 which leaves the exhaust - air nozzle 18 , and the surface temperature of the dried laundry are used as drying parameters to form the factors . the surface temperature of the dried laundry is determined by a sensor which is associated with the drying drum 14 , for example an infrared sensor , in a contact - free manner . the said drying parameters are continually determined during the entire drying process specifically continuously or at regular time intervals , that is to say with intervals between successive determination operations for the factors , it being possible for the said intervals to be determined in respect of duration . this produces current factors based on the current drying phases . the factors can have respective associated drying periods , with the result that time - related factors or factors which are standardized in respect of time are formed . the factors are determined by computer using , for example , a microcomputer on the basis of the mollier diagram ( h - x diagram ). in order to determine the end of the drying process , a switch - off value is defined in relation to the laundry which is to be dried in each case , specifically depending on the type of laundry , in particular the type of fabric and / or the thickness of the laundry . when the determined factor reaches this value , the drying process is automatically terminated . the switch - off value is defined such that it lies between 0 and 100 , where 0 is wet laundry and 100 is severely excessively dried laundry which no longer contains hardly any residual moisture , while a switch - off value below 100 corresponds to the optimum drying point . this switch - off value is defined in accordance with the type of laundry . the switch - off value is the setpoint value of the factor . when the factor reaches the switch - off value , this means that the optimum drying point of the laundry has been reached . the drying process is then terminated . in order to be able to establish when the switch - off value which represents the optimum drying point for the respective laundry is reached , the factor is preferably determined continuously during the entire drying process . if the intention is only for the drying process to be automatically terminated on the basis of the factor , it may be sufficient to begin forming the factor only after a certain initial drying time has elapsed . determination of the factor is started when , according to experience , the majority of the drying process is concluded but it is certain that the switch - off value which is defined for the laundry in question has not yet been reached . in order to control or regulate the drying process , drying - time - related factors are preferably determined over the entire drying process in succession , specifically either at regular time intervals or continuously one after the other . this produces a series of factors for the drying period in question . the factors are preferably recorded , in particular stored , based on the associated drying period , that is to say at the time point starting from the beginning of the drying operation at which they were determined . the determined time - related factors are compared with setpoint values which are associated with the drying period in question . the factor which is determined at this drying period is compared with the setpoint value of a specific drying period . the drying process is correspondingly controlled or regulated in the event of a deviation . for the purpose of controlling or regulating the drying process , deviations in each factor which is based on a specific drying period can be established for the setpoint value which relates to the same drying period and accordingly the drying process can be controlled or regulated by reference to corresponding drying parameters . it is also feasible to form a trend or prognosis from a plurality of successive factors . the drying parameters are correspondingly influenced . it is also feasible for specific drying parameters to be influenced on the basis of the current comparison of the factor with the setpoint value while other drying parameters on the basis of the profile or the trend of a plurality of factors and their comparison with the temporally matching setpoint values remain unchanged . the position of the circulating - air flap 19 is preferably controlled , that is to say a corresponding value for the angular position of the circulating - air flap 19 is set and / or the falling curve of the laundry in the drying drum 14 is changed , on the basis of the factors , in particular their comparison with the associated setpoint values . this is done in such a way that a falling curve which changes as the laundry becomes increasingly dry is adapted by a corresponding change in the rotation speed of the drying drum 14 . in this way , the falling curve of the laundry can be matched to the current degree of drying of the laundry in the drying drum 14 so that the falling curve which is optimum for the laundry which is to be dried is always produced in the drying drum 14 which is driven in rotation . by controlling or regulating the circulating - air flap position on the basis of the measured angular position of the said circulating - air flap , the proportion of circulating air can be increased in an optimum manner , specifically preferably continuously , as the laundry is increasingly progressively dried as a function of the factor which is continuously determined over the drying process and preferably by comparison of the respectively determined factor with the associated setpoint value . in this way , as much still - hot circulating air as possible can be re - used for drying the laundry as a result of being returned to the drying drum 14 . this leads to particularly energy - efficient drying . it is also feasible to change , in particular to control or to regulate , other drying parameters using the factors which are determined during drying . these can be , for example , the rotation speeds of the drying drum 14 and / or the circulating - air fan 15 , but also the temperature to which the burner 11 heats the air 21 . the method according to the invention is suitable not only for the dryer 10 which is described in the introductory part , but also for dryers of different construction , specifically those for commercial laundries in particular . | 5 |
fig1 shows a first embodiment of a washing device 10 . this comprises an outlet 1 with at least one nozzle set 2 . the nozzle set 2 , in turn , comprises two or more nozzles 3 . fluid at a high pressure and thus a high speed or energy is dispensed in a directed manner with the nozzles 3 on operation . the nozzles 3 of a nozzle set 2 are directed such that the dispensed fluid jets intersect one another and preferably meet at one point . the fluid is atomised by way of this , and thus creates a high moistening / wetting effect . the fluid as a rule is water , wherein however another fluid or a mixture of water with a further substance such as soap , disinfectant etc . may be dispensed at one , several , or all nozzles . the fluid is led to the outlet 1 preferably via a hose 19 or generally via an outlet conduit which is designed with regard to the operating pressure of the outlet , thus may withstand this operating pressure . the outlet conduit may be assembled in a fixed manner . the outlet may be a shower sprinkler assembled in a fixed manner or a shower sprinkler which is movable and is held by hand , or a shower head . the liquid is heated by the heater 5 having an energy supply 13 , and is delivered by a pump 6 and brought to an increased operating pressure . in another embodiment of the invention , the heater 5 is arranged in front of the pump 6 in the flow direction , so that therefore the pump 6 is designed for delivering the already heated water . preferably a micro - filter 7 is arranged at the feed of the fluid 11 or is arranged at another location of the fluid path , in order to prevent the nozzles 3 from becoming blocked . in the shown embodiment of the invention , the supply of the fluid is a cold water supply 11 . the filter 7 is preferably provided for filtering particles with a size of more than 100 , in particular over 50 micrometers , from the water or the liquid . fig2 shows a further embodiment which has no heating 5 but instead of this is supplied via a mixing tap 8 , with which water from a cold water supply 11 and a warm water supply 12 are mixed to the desired temperature . a soap feed 15 is drawn in as a further embodiment of the invention , via which soap may be admixed to the water by way of a mixing device 14 . instead of soap , also other fluid or powder - like additives may be admixed in this manner . the mixing device 14 may usefully be switched on and off , so that one may switch between one operating mode “ lathering ” with soap , and an operating mode “ rinsing ” without soap . in this case , the mixing device 14 must be arranged extremely close to the shower head , so that only water leaves to shower head as soon as possible after switching of the mixing device 14 . preferably , the delivered water quantity per unit of time , thus the throughput is increased with the operating mode “ rinsing ” compared to the operating mode “ lathering ”, for example by way of switching over between different nozzle sets 2 , or by way of raising the water pressure by the pump 6 , or by way of variation of the nozzle diameter . fig3 shows one design of a protective body 4 . a fluid jet which does not hit another fluid jet , or does this only in an inadequate manner , may be captured by the protective body 4 . this may particularly be the case if a nozzle is blocked or damaged . one prevents the jet from directly impacting the skin or the eyes by way of the protective body 4 . the protective bodies or suitable formations of the outlet 1 are also arranged in a manner such that they in each case lie in the jet direction of the individual nozzles 3 , but with a functionally correct operation of the outlet 1 are not essentially hit by the atomised fluid , thus are essentially of no hindrance to the sprayed fluid . fig4 shows a construction unit 16 of a washing device . depending on the embodiment , the previously presented elements , such as in particular the heater 5 , the pump 6 , the micro - filter 7 , and , as the case may be , also the mixing device 14 and the soap feed 15 etc ., are grouped together in a compact unit in a housing , in the construction unit 16 . the housing comprises an energy supply 13 and a cold water supply 11 , and feeds the outlet 1 via the hose 19 . optionally , operating elements 18 for the control or regulation ( closed loop control ) of the temperature or pressure may be arranged on a recessed operating unit 17 . in another variant ( drawn in a dashed manner ), the operating elements 18 are arranged on the construction unit 16 itself . in another preferred embodiment of the invention , the construction unit 16 has the same elements with the exception of the pump 6 , and is connected to an external pump for increasing the pressure . the external pump may supply several such construction units 16 . a washing device system according to this embodiment , thus , comprises at least one construction unit 16 and an external pump and a pressurised water conduit for feeding the at least one construction unit 16 by the pump 6 . preferably , the pump 6 and the heater 5 , activated by the operating unit , are switched on for operating the washing device for dispensing heated water . warm water may be taken in a quasi direct manner , thus without any significant heating - up time , since the heater 5 preferably has no storage means . as the case may be , for this , the pump may be switched on with a small delay of a few seconds , i . e . less than 2 or 5 or 10 seconds . alternatively , the pump 6 in this time may be controlled from standstill , and be gradually run up to the normal delivery power , so that the dispensing temperature may be increased already from the beginning . in another preferred embodiment of the invention , the switching - on and switching - off of the washing device is controlled by an electrical switch or sensor at the outlet 1 . alternatively , a mechanical valve is arranged on the outlet 1 or in the feed conduit 19 . when the user opens the valve , a pressure change in the feed conduit 19 takes place , which is detected by a sensor in the construction unit 16 , whereupon the washing device , with pump and , as the case may be , also the heater 5 , is switched on by way of the control of the construction unit 16 . fig5 shows an installation with several washing devices 10 . only one cold water supply 11 and the energy supply 13 is present at each of the washing devices 10 . the washing devices 10 are for example arranged at several locations of a building or a mobile washing installation . fig6 shows a washing installation or shower cubicle . several outlets 1 which are preferably supplied with heated pressurised water via a common supply unit 16 , are arranged in this above and laterally of the washing space . it has been found that a very good homogenous heat distribution and a pleasant shower sensation arise by way of this . the same effect arises also with only one nozzle head when the shower cubicle remains closed . the thermal transmission to body is very good despite the small quantity of water which is used . the small drops very quickly heat the room air , which provides a homogeneous sensation of warmth . the homogeneous heat distribution is due to the fact that the air is very quickly warmed by way of the large surface area of the droplets . the droplets cool immediately on account of their low mass . a temperature equilibrium occurs very quickly . fig7 schematically shows an arrangement of two nozzles 3 in a plan view a ), seen in the direction of a main spray direction of the device , and in a lateral view b ). the jets 21 of the liquid which are aligned onto one another meet in a impact point or collision point 20 . the two jets 21 define a first plane . the water droplets which are sprayed by the impact form a spray body which is symmetrical to a further plane , wherein the second plane is essentially perpendicular to the first plane . an angle θ between the jets 21 and a bisecting line of an angle are drawn in the lateral view . fig8 shows the structure of a water disk , as arises with impacting water jets . as in fig7 , the main spray direction also runs downwards in fig8 . the shown parameters : v o ; jet speed ; r : distance of the impact point to the disk edge ; 2θ : impact angle ; h : thickness of the disk ; 2r ; jet diameter ; φ : angular position . if two equally strong water jets are directed against one another , then a thin water disk is formed between them . the disk disintegrates at a certain distance from the point of impact of the two jets , and produces fine drops by way of this . if the two water jets are equally strong , then the vertical components of their impulses neutralise on impact , and a thin water layer propagates horizontally by way of the pressure which has arisen at the moment of impact . the disk is destroyed as soon as holes arise , which increase further in size on account of the surface tension of the water . the nozzles and , thus , the produced fluid jets as a rule are round , but may also have a rectangular cross section or generally have a prismatic shape . calcifications in the nozzles are not formed at all or are then eroded again by way of ( for the sanitary field ) high operating pressures and the low water temperatures . fig9 schematically shows a perspective view of a nozzle set 2 with three nozzles 3 . water disks , whose planes , seen from above and with equally strong jets , lie in the angle bisecting line between the jets , arise at the impact point . in an analogous manner , more than 3 nozzles 3 may also be arranged essentially on a circle and be directed onto the point of impact . half the impact angle φ lies in each case between the jets and the perpendicular axis of symmetry of the nozzle set 2 . each of the nozzles 3 is supplied with fluid via a nozzle supply conduit 22 by way of the common pump 6 . the nozzle supply conduits 22 are only drawn in schematically in the figure , but in reality they are formed e . g . by way of cavities between the individual parts of the outlet 1 . in another preferred embodiment of the invention , different nozzles 2 are supplied with different liquids , thus given three nozzles with two or three different liquids . such different fluids may for example be soaps , soap solutions , disinfectants , etc . in another preferred embodiment of the invention , the outlet 1 comprises several nozzle sets which are arranged next to one another in a row or are arranged on a circular arc or circle . in a further embodiment of the invention , the outlet 1 comprises at least two nozzle sets , wherein the nozzles 3 are arranged at least approximately in a plane , and the impact points of the two nozzle sets 2 are distanced to one another in a direction which runs at least approximately perpendicular to this plane . fig1 schematically shows such an arrangement in a plan view a ) and a lateral view b ): two nozzle sets 2 , 2 ′ are arranged transversely to one another : the jets 21 of each nozzle set 2 , 2 ′ define a plane of the nozzle set 2 , 2 ″. the planes of the two nozzle sets 2 , 2 ′ are at an angle to one another , and in the shown example are at least approximately at right angles . the impact points of the two nozzle sets 2 , 2 ′ are preferably distanced to one another , but both lie on the intersection line of the two planes . fig1 shows an outlet 1 with a soap feed 23 . the soap feed 23 is arranged in the outlet 1 above the impact point 20 , so that the fed soap drops or runs into the region of the impact point 20 . the soap is entrained and mixed by way of the water jets which impact one another . the soap feed 23 is preferably controllable or may be switched on and off . for this , it comprises , for example , a control means , for example a closure or a valve or a pump which is controllable , which means may be switched on and off via control lead or by hand . in a preferred embodiment of the invention , the soap feed , as a metering means , comprises an intermediate storage means . the intermediate storage means is filled with a certain quantity of soap on actuation of the control means , and subsequently dispenses this again successively to the fed water , as in fig1 , to the impact point 20 , until it is empty . the soap may be fluid or powder - like , and may be led with the soap feed 23 closer to the impact point 23 than is indicated in the figure . in this manner , other fluids or powder - like additives may also be admixed instead of soap . also gaseous additives may be supplied or blown with its own nozzle as a gas jet onto the impact point 23 in a directed manner . fig1 shows a nozzle body 40 as part of an outlet 1 . the nozzles are formed by bores in a nozzle body . three nozzles are shown by way of example , but combinations of two , four or more nozzles may be realised in the same manner . in the simplest case , the nozzle body 40 is of one piece . in the embodiment of fig1 , the nozzle body comprises an upper nozzle disk 41 and a lower nozzle disk 42 which are arranged rotatable to one another . the two nozzle disks 41 , 42 are pressed against one another , for example , by way of a central screw 45 and / or by way of a flange ring 46 . the fastening on the outlet 1 may likewise be effected with a central screw 45 and / or the flange ring 46 . fig1 shows the nozzle body 40 in cross section and the two nozzle disks 41 , 42 separately , in each case in a plan view . the nozzle body 40 is arranged in the outlet 1 , such that the upper nozzle disk 41 is impinged with the fluid under pressure , and the lower nozzle disk 42 faces the spray direction . the upper nozzle disk 41 comprises a set of upper bores 43 , and the lower nozzle disk 42 at least two sets of lower bores 44 . the position of the upper bores 43 may be selectively brought to correspond with the position of one of the sets of the lower bores 44 by way of rotating the nozzle disks to one another . thus different sets of lower bores 44 are in operation in a selective manner . these are preferably designed in a different manner , so that different spray characteristics result , depending on the selection of the lower set of bores . this different design may , for example , relate to the diameter of the nozzles or their mutual alignment . in another preferred embodiment of the invention , the upper nozzle disk 41 comprises several sets of upper bores 43 , which in each case are fed with different fluids or fluid combinations . the lower nozzle disk 42 in this embodiment only comprises one set of lower bores 44 , and may be connected in each case to one of the sets of the upper bores 43 by way of rotation , so that a different composition of the sprayed fluid results , depending on the selection of the upper set of bores . fig1 shows a single - piece nozzle body 40 or a lower nozzle disk 42 , in cross section , as well as details of the nozzle openings . the nozzle body 40 or the nozzle disk 42 is preferably manufactured of metal or a technical plastic , for example by way of injection molding , wherein the nozzle channels 48 are preferably formed by way of moving slides . the plastic , for example , is polyoxymethylene ( pom ) or polyamide ( pa ) or polyphenylene sulphide ( pps ) and may be provided with inclusions of other materials . fig1 shows a detailed view of a cross section through a first embodiment for the design of the nozzle openings , preferably whilst using a two - component injection molding method . one nozzle opening at the outer end of a nozzle channel 48 is formed by a projecting tube piece 46 of a softer plastic , which is peripherally injected by the harder technical plastic of the nozzle body 40 or of the nozzle disk 42 . the softer plastic may be deformed by , so that furring breaks away . fig1 shows a detailed view of a cross section through a second embodiment for the design of the nozzle openings . a nozzle opening at the outer end of a nozzle channel 48 is formed by a pipe piece 47 of metal , for example chrome steel , which is peripherally injected by the technical plastic of the nozzle body 40 or the nozzle disk 42 . with this , the exit openings of the nozzles may be formed with greater precision than would be possible with the manufacture solely of plastic . one the one hand the nozzles are adequately long and comprise a smooth inner surface , by which means a laminar flow is achieved , for achieving a precise jet . preferably , the nozzles are at least double the length of their diameter . on the other hand , the reflection edges at the end of the nozzle inner side are shaped in a suitable manner , preferably by way of them forming a right angle . this is preferably the case for all embodiments of the invention . the tube pieces may be formed on a single piece of metal and be peripherally injected together , as is shown in fig1 , for achieving a high precision . in particular , the nozzle channels 48 may be formed in a disk - like insert or differently shaped insert 49 . the insert 49 is peripherally injected with the plastic , for forming the nozzle body 40 or the nozzle disk 42 , wherein the plastic has a continuation of the nozzle channels 48 . fig1 shows an outlet 1 with an atomisation body 34 . the atomisation body 34 is linearly displaceable in the direction of an axis 33 and / or arranged in a rotatable manner about this axis 33 . a drive unit 32 effects this movement or movements , and for this comprises one or two individual drives or motors . at least one nozzle 3 is directed onto the atomisation body 34 , so that the fluid jet of this nozzle 3 impinges the atomisation body 34 on operation of the washing device 10 . with a linearly displaceable atomisation body 34 , the jet hits a differently oriented surface and / or a differently structured surface , according to the position of the atomisation body 34 . for example , with the atomisation body 34 of fig1 , which for example is an ellipsoid of revolution , a jet hits a sector of the surface at a height angle α with respect to the equator of the ellipsoid . thus , the impact angle of the jet onto the atomisation body 34 and the average direction of the atomised jet vary in dependence on the height angle α . in a preferred embodiment of the invention , the atomisation body 34 has different surface structures along the displacement axis , so that different atomisation characteristics may be achieved by way of displacing the atomisation body 34 . for example , with the atomisation body 34 of fig1 , the surface for different regions of height angles α may in each case have different roughnesses . fig1 shows an atomisation body 34 with this characteristic , but without it having an ellipsoid as a basic shape . the atomisation body 34 is essentially rotationally symmetrical and / or prismatic with respect to the axis or rotation axis 33 . for example , along the rotation axis 33 , it comprises a first sector 341 with a toothed surface , a second sector 342 with a smooth surface and a third sector 343 with a roughened surface , similar to sandpaper . by way of displacing the atomisation body 34 , the jet is atomised on the one or other sector 341 , 342 , 343 with completely different characteristics . in the shown embodiment , therefore each of the sectors has a different surface structure and one or more different orientations of the surface with respect to a jet . in another embodiment according to fig1 , the atomisation body 34 is a rotation cylinder , thus has different surface structures with a constant impact angle and reflection angle with a displacement along the axis 33 . such an embodiment may be applied in a rotating or non - rotating manner , wherein in both cases the different surfaces of the sectors 341 , 342 , 343 may be applied by way of displacement along the axis 33 . such an atomisation body 34 may be applied with different operating modes , wherein certain embodiments for the invention may also be directed only to individual ones of these operating modes . in a first operating mode , the water jets or fluid jets 21 in the nozzles 3 are produced with a high pressure , and the linear displacement ability of the atomisation body 34 is used in order to obtain different or dynamically variable atomisation bodies . for this , it is not absolutely necessary for the atomisation body 34 to also be rotatable or to be rotated . the energy for atomisation originates from the high speed of the jets . by way of moving the atomisation body 34 , be it by way of rotation and / or displacement , differently structured surface regions may be brought into the region of the jet 21 . in a second operating mode , the atomisation body 34 is rotatable with a high speed about the rotation axis 33 . the energy for atomisation originates from the rotation of the atomisation body 34 , so that the nozzles may be operated at high pressure but also at low pressure , which means that they may be operated without a pump 6 . thereby , the atomisation body 34 may also be displaceable as in the first operating mode , but it may also be non - displaceable . fig2 shows an atomisation body 34 in the form of an ellipsoid of revolution , with further sectors 344 , 345 , 346 with different surface structures . on rotating the atomisation body 34 about the rotation axis 33 , different sectors 344 , 345 , 346 are hit by the jet 21 . the impact angle and the reflection angle are changed by way of displacement along the rotation axis 33 . this displacement body 34 is thus not envisaged for a rapid rotation for atomisation . the further sectors 344 , 345 , 346 correspond to different “ degrees of longitude ” whilst the sectors 341 , 342 , 342 of fig1 and 19 correspond to different “ degrees of latitude ” or height angles α . fig2 and 22 show a disk as an atomisation body . here at least one nozzle 3 is directed onto a disk surface 36 or onto the disk edge 37 . the disk surface 36 may have different surface structures depending on the radius , which is indicated in fig2 by a shaded region . the disk surface 36 may also be profiled , which means that the disk surface 36 is not plane , but has a rotationally symmetrical profile as a function of the radius . with this , different impact angles and reflection characteristics may be achieved by way of displacing the nozzle 3 along the radius . the disk surface 36 , in a different embodiment of the invention , is curved according to fig2 , for example in the form of a spherical surface , so that the reflection angle is also dependent on the radius of the impact point . suitable rotational speeds for rotating atomisation bodies 34 range from 5 , 000 to 200 , 000 rpm . the average droplet size in the atomised jet is varied by way of varying the rotational speed , wherein the droplet size is dependent on the relative speed between the jet and the atomisation body 34 . it has been shown that a droplet size of about 20 to 80 micrometers requires a relative speed of about 50 m / s this for example means that for this , with a stationary atomisation body 34 , the jet must have a speed of about 50 m / s . vice versa , if the jet has a speed of only a few m / s , then the atomisation body 34 must move at this speed at the impact point . this for example means that a surface point of a disk or a cylinder with a diameter of 30 mm must rotate at approx . 30 , 000 rpm . fig2 shows pressures and throughput rates f for various nozzle diameters and nozzle numbers . with each curve , the respective value x / y represents a nozzle number x and a nozzle diameter y in millimeters , thus for example 2 / 0 . 7 represents an arrangement with 2 nozzles of 0 . 7 mm diameter . in a preferred embodiment of the invention , the maximal throughput quantity of the outlet is 3 l / min and preferably 1 . 5 to 2 l / min , which corresponds to a heating device with a heating power of about 3 kw . preferably , 3 nozzles with a diameter of 0 . 4 mm are operated at a pressure of 20 bar . half the impact angle φ is preferably 45 °. most , thus about 80 % or more of the produced droplets thereby preferably have a diameter of below 100 micrometers . fig2 shows a heating power requirement p in kw for different water throughput quantities in liters per minute in dependency on the produced temperature difference δt . a throughput quantity of 14 l / min corresponds to a normal shower , 12 l / min corresponds to an adjustable shower , 9 l / min to an economy shower and 1 . 5 l / min corresponds to one embodiment of the invention . a continuous power of 25 kw is required in order for example to heat the continuously running water to a temperature difference of 30 ° at 12 liters / minute . thereby , an optimal efficiency of the heating is assumed . with a throughput quantity of 1 . 5 l / min only about 2 kw is required . this lies within the framework of a heater 5 which may be supplied by a common house installation with 230v alternating current or 400v three - phase current . fig2 shows a heating element for low throughput quantities of 1 . 2 and 3 l / min , as may be realised according to the invention . for this , maximal realisable values for heating powers are drawn in : a lower horizontal line at a first heating power of approx . 3 . 6 kw and a higher upper horizontal line at a second heating power of appear . 6 kw . this corresponds to a supply at 230 or 400 volts at 16 amps . the shower water must be heated to about 20 to 35 degrees depending on the season and the desired water temperature . this corresponds to the shaded region in the representation . in this region , thus an electrical instantaneous ( tankless ) heating may be used for throughput quantities between 1 and 2 liters . a storage heater or boiler or a more powerful heater is required for greater throughput quantities . | 4 |
the present invention is based upon the discovery and isolation of a highly inducible 30 kda protein that is released by , and accumulates in media conditioned by , cultured murine macrophage - like cells ( raw 264 . 7 ) following stimulation with lps , tnf , or il - 1 . a partial amino acid sequence of this isolated polypeptide was identical to the sequence of the hmg1 protein , also known as amphoterin , a protein not before linked to the pathogenesis of any disease . this information was used to clone a cdna encoding hmg1 , which sequence was expressed to provide recombinant protein , which protein was used to generate specific anti - hmg1 antibodies . therapeutic and diagnostic efficacy was determined in a series of predictive in vitro and in vivo experiments . the experiments are detailed in the examples section . for example , following administration of endotoxin ( ld 100 ) to mice , serum hmg1 levels increased later ( at 16 h ) than well - known “ early ” mediators of sepsis ( such as tnf and il - 1 ) and plateau levels of hmg1 were maintained for 16 to 32 hours . patients with lethal sepsis had high serum hmg1 levels , which were not detected in normal healthy volunteers . moreover , acute experimental administration of rhmg1 to test animals , whether alone or in combination with sub - lethal amounts of lps , caused marked pathological responses and even death . more distributed dosing schedules of lower amounts of rhmg1 led to significant weight loss in treated animals . these results give evidence that hmg1 is a mediator of endotoxemia and particularly a late mediator , as opposed to known “ early ” mediators such as tnf and il - 1 . these data further show the importance of serum hmg1 as a marker for the severity or potential lethality of sepsis and related conditions . in addition , treatment with anti - hmg1 antibodies provided full protection from ld 100 doses of lps in mice . hmg1 is inducible bad tnf and il - 1β , and dose - dependently stimulates tnf release from hupbmcs . tnf is a marker of macrophage activation , so it is likely ( without limitation as to implied mechanisms or being bound by theory ) that hmg1 promotes downstream re - activation of cytokine cascades which , in turn , mediates late pathogenesis and lethality in sepsis and related conditions involving activation of pro - inflammatory cytokine responses . thus , hmg1 likely occupies a central role in mediating the inflammatory response to infection and injury , and antagonists of hmg1 will be of therapeutic benefit in sepsis and related conditions of inflammatory cascade activation . the appearance of hmg1 in the inflammatory cytokine cascade is suitable to propagate later phases of the host response and contribute to toxicity and lethality . the predictive data provided herein support the therapeutic efficacy of hmg1 antagonists and provide evidence in support of the aforementioned theory regarding mechanism of action . the in vivo treatment data showed the efficacy of hmg1 antagonists in general , and anti - hmg1 antibodies in particular , for treating conditions mediated by the inflammatory cytokine cascade in general and particularly sepsis conditions , including , for example , septic shock , sepsis syndrome or other “ sepsis - like ” conditions mediated by inflammatory cytokines . further , the independent pathogenicity , and toxicity / lethality of hmg1 shows that hmg1 antagonists are particularly effective when co - administered with antagonists of “ early ” inflammatory mediators such as tnf , mip , il - 1 and il - 6 . in summary , hmg1 is a cytokine mediator of inflammatory reactions because : 1 ) hmg1 is released from macrophages and pituicytes following stimulation with bacterial toxins or with pro - inflammatory cytokines ( tnf or il - 1β ); 2 ) hmg1 accumulates in serum of animals exposed to lps and in patients with sepsis ; and 3 ) hmg1 - specific antibodies protect against mortality in a predictive lethal endotoxemia animal model of clinical sepsis and related conditions . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered to a patient either by itself ( complex or combination ) or in pharmaceutical compositions where it is mixed with suitable carriers and excipients . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered parentally , such as by intravenous injection or infusion , intraperitoneal injection , subcutaneous injection , or intramuscular injection . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered orally or rectally through appropriate formulation with carriers and excipients to form tablets , pills , capsules , liquids , gels , syrups , slurries , suspensions and the like . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered topically , such as by skill patch , to achieve consistent systemic levels of active agent . the inventive pharmaceutical composition or inventive pharmaceutical combination can be formulated into topical creams , skin or mucosal patches , liquids or gels suitable for topical application to skin or mucosal membrane surfaces . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered by inhaler to the respiratory tract for local or systemic treatment . the dosage of the inventive pharmaceutical composition or inventive pharmaceutical combination of the present invention can be determined by those skilled in the art from this disclosure . the pharmaceutical composition or inventive pharmaceutical combination will contain an effective dosage ( depending upon the route of administration and pharmacokinetics of the active agent ) of the inventive pharmaceutical composition or inventive pharmaceutical combination and suitable pharmaceutical carriers and excipients , which are suitable for the particular route of administration of the formulation ( i . e ., oral , parenteral , topical or by inhalation ). the active agent is mixed into the pharmaceutical formulation by means of mixing , dissolving , granulating , dragee - making , emulsifying , encapsulating , entrapping or lyophilizing processes . the pharmaceutical formulations for parenteral administration include aqueous solutions of the active agent or combination in water - soluble form . additionally , suspensions of the active agent may be prepared as oily injection suspensions . suitable lipophilic solvents or vehicles include fatty oils such as sesame oil , or synthetic fatty acid esters , such as ethyl oleate or triglycerides , or liposomes . aqueous injection suspensions may contain substances which increase the viscosity of the suspension , such as sodium carboxymethyl cellulose , sorbitol , or dextran . the suspension may optionally contain stabilizers or agents to increase the solubility of the active agent or combination to allow for more concentrated solutions . pharmaceutical formulations for oral administration can be obtained by combining the active agent with solid excipients , such as sugars ( e . g ., lactose , sucrose , mannitol or sorbitol ), cellulose preparations ( e . g . starch , methyl cellulose , hydroxypropylmethyl cellulose , and sodium carboxymethyl cellulose ), gelaten , gums , or polyvinylpyrrolidone . in addition , a disintegrating agent may be added , and a stabilizer may be added . the present invention provides antisense oligomers having a sequence effective to inhibit or block the expression of the hmg1 gene or mrna sequence . antisense technology which uses specific - oligonucleotides to inhibit expression of target gene products , is developing as a therapeutic modality for human disease . several selection criteria are available to contribute to the optimization of antisense oligonucleotide antagonists . for example , it is advisable to choose sequences with 50 % or more gc content . preferred sequences span the aug initiation codon of the target protein , but sites in the coding region and 5 ′ utr may perform equally well . such sequences are generally about 18 - 30 nucleotides long and chosen to overlap the atg initiation codon from the hmg1 cdna sequence to inhibit protein expression . longer oligomers are often found to inhibit the target to a greater extent , indicating that a preferred length is about 25 mer for the first oligonucleotides chosen as antisense reagents . typically , three oligonucleotide sequences are chosen with regard to these criteria , and compared for antagonist activity to control oligonucleotide sequences , such as “ reverse ” oligonucleotides or those in which about every fourth base of the antisense sequence is randomized . therefore , a preferred sequence for making antisense oligomer sequences to hmg1 is a 25 mer sequence chosen to overlap the atg initiation codon ( underlined ) from the hmg1 cdna sequence : gaggaaaaataactaaac atg ggcaaaggagatcctaagaag [ seq id no . 5 ] and such preferred antisense sequences are used to construct antisense oligonucleotide agents ( and suitable controls ) for an in vitro comparison as antagonists of hmg1 . these in vitro data are predictive of human clinical utility using antisense agents of comparable design . the antibodies disclosed herein may be polyclonal or monoclonal ; may be from any of a number of human , non - human eukaryotic , cellular , fungal or bacterial sources ; may be encoded by genomic or vector - borne coding sequences ; and may be elicited against native or recombinant hmg1 or fragments thereof with or without the use of adjuvants , all according to a variety of methods and procedures well - known in the art for generating and producing antibodies . generally , neutralizing antibodies against hmg1 ( i . e ., those that inhibit biological activities of hmg1 particularly with regard to its pro - inflammatory cytokine - like role ) are preferred for therapeutic applications while non - neutralizing antibodies may be as suitable for diagnostic applications . examples of such useful antibodies include but are not limited to polyclonal , monoclonal , chimeric , single - chain , and various human or humanized types of antibodies , as well as various fragments thereof such as fragments and fragments produced from specialized expression systems . the diagnostic assay provided here uses anti - hmg1 antibodies that can be either polycolonal or monoclonal or both . the diagnostic procedure can utilize standard antibody - based techniques for measuring concentrations of the gene product of hmg1 genes in a biological fluid . preferred standard diagnostic procedures are elisa assays and western techniques . this example provides the results of an experiment to identify and isolate later released macrophage - derived factors that play , a role in sepsis and in related conditions typified by inflammatory cytokine activity . the experiment reported in this example examined murine macrophage raw 264 . 7 cell - conditioned media after stimulation of the cultures with tnf . murine macrophage raw 264 . 7 cells were obtained from american type culture collections ( atcc , rockville , md ., usa ), and proliferated in culture under dmem supplemented with 10 % fetal bovine serum and 1 % glutamine . when confluency reached 70 - 80 %, the medium was replaced by serum - free opti - mem i medium and cultures were stimulated with pro - inflammatory cytokines ( e . g . tnfα or il - 1 ) or bacterial endotoxin ( lps ). the proteins released from the above stimulated macrophage cultures were surveyed . specifically , at different time points , cells and cell - conditioned media were separately collected by centrifugation ( 3000 rpm , 10 minutes ). proteins in the conditioned medium were concentrated by ultrafiltration over amicon membranes with mr cutoff of 10 kda ( amicon inc ., beverly , mass ., usa ), subsequently fractionated by sds - page , and stained with coomassie blue ( 1 . 25 % coomassie blue r250 in 30 % methanol / 10 % acetic acid ). after destaining with 30 % methanol / 7 % acetic acid , protein ( s ) of interest ( i . e ., those that preferentially accumulated in conditioned media of stimulated cultures ) was isolated by excision from the sds - page gel , and subjected to n - terminal sequencing analysis ( commonwealth biotechnologies , inc ., richmond , va . usa ). comparison of sds - page gel analysis of profiles of proteins accumulated in control ( without tnfα stimulation ) versus tnf - stimulated raw 264 . 7 cells revealed a strongly inducible 30 kda protein whose concentration in the cell - conditioned medium was significantly increased after stimulation for 16 hours . amino acid sequence analysis of this isolated protein revealed its n - terminal sequence as gly - lys - gly - asp - pro - lys - lys - pro - arg - gly - lys - met - ser - ser [ seq id no . 1 ]. a review of relevant gene databases found a 100 % identity to the n - terminal amino acid sequence of hmg1 . these data identified hmg1 as a “ late - appearing ” product of lps - stimulated macrophage cultures and therefore as a candidate pro - inflammatory mediator . this activity was confirmed by administration of recombinantly produced hmg1 and / or of anti - hmg1 antibodies in cellular and animal model systems that are predictive of human clinical conditions . this example shows which cell sources are capable of releasing hmg1 in response to tnf , il - 1 and / or lps . cells studied include gh 3 pituicytes , murine macrophage raw 264 . 7 cells , human primary peripheral blood mononuclear cells ( hupbmcs ), human primary t cells , rat adrenal pc - 12 cells , and rat primary kidney cells ( table 1 ). the rat pituitary gh 3 cell line was obtained from american type culture collection ( atcc , rockville , md ., usa ), and cultured in deme supplemented with 10 % fetal bovine serum and 1 % glutamine . human pbmcs and t cells were freshly isolated from whole blood of healthy donors and cultured in rpmi 1640 supplemented with 10 % human serum as previously described ( zhang et al ., j . exp . med . 185 : 1759 1768 , 1997 ). when confluency reached 70 - 80 %, the medium was replaced by serum - free opti - mem i medium and cultures stimulated with proinflammatory cytokines ( e . g ., tnfα or il - 1 ) or bacterial endotoxin ( lps ). although human t cell , rat adrenal ( pc - 12 ) cells , and rat primary kidney cells contained cell - associated hmg1 as demonstrated by western blotting analysis of whole cell lysates using hmg1 - specific antibodies ( see example 4 below ), hmg1 did not significantly accumulate in the medium of these cultures after stimulation with either tnf , il - 1β , or lps ( table 1 ). tnf , il - 1β ( minimal effective concentration = 5 ng / ml for each ) and bacterial endotoxin ( lps , minimal effective concentration = 10 ng / ml ) induced the release of hmg1 from human pbmcs in a time - and dose - dependent manner ( table 1 ). ifnγ alone ( 0 - 200 u / ml ) did not induce hmg1 release from any of the above cells , but when added in combination either with tnf or il - 1β , ifnγ dose - dependently enhanced hmg1 release from macrophages , with a maximal 3 - fold enhancement by ifnγ at a concentration of 100 u / ml . the release of hmg1 was not due to cell death , because cell viability was unaffected by tnf , il - 1β , or lps , as judged by trypan blue exclusion ( 90 - 92 ± 5 % viable for control vs . 88 - 95 ± 4 % in the presence of 100 ng / ml tnf , il - 1β or lps ). the amount of hmg1 released by pituicytes and macrophages inversely correlated with the intracellular concentration of hmg1 , as determined by western blotting analysis , indicating that the released material is , in part , derived from pre - formed cell - associated hmg1 protein . potential sources of circulating hmg1 in vivo were assessed by hybridization of an hmg1 - specific probe to mrna prepared from various normal human tissues ( blot substrate available from commercial sources ), with the results summarized in fig5 . several macrophage - rich tissues ( lung , liver , kidney , pancreas and spleen ) exhibited the most abundant hmg1 mrna expression ; less was observed in pituitary , bone marrow , thymus , lymph node and adrenal gland . in addition to providing information as to the relative tissue distribution of hmg1 expression , this study shows the practicality and utility of assaying for hmg1 - specific nucleic acid sequences in tissue samples . this example details procedures to produce hmg1 by well - known recombinant dna technologies . the hmg1 open reading frame was amplified by pcr and subcloned into an expression vector ( pcal - n ). briefly , the 648 - bp open reading frame of hmg1 cdna was pcr amplified ( 94 ° c . 1 ′, 56 ° c . 2 ′, 72 ° c . 45 ″, 30 cycles ) from 5 ng rat brain quick - clone cdna ( catalog # 7150 - 1 , clontech , palo alto , calif ., usa ) using primers containing the following sequences , 5 ′- ccc gc g gat cc a tcg agg gaa gga tgg gca aag gag atc cta - 3 ′ [ seq id no . 2 ], and 5 ′- ccc gc a agc tt a ttc atc atc atc atc ttc t - 3 ′ [ seq id no . 3 ]. the 680 bp pcr product ( 4 μg ) was digested with bam hi and hind iii , and cloned into the bam hi / hind iii cloning sites of the pcal - n vector ( stratagene , la jolla , calif ., usa ). the recombinant plasmid was transformed into e . coli bl21 ( de3 ) plyss ( novagen , madison , wis ., usa ), and positive clones were screened and confirmed by dna sequencing on both strands using a tag dyedeoxy terminator cycle sequencing kit on the abi 373a automated fluorescent sequencer ( applied biosystels , foster city , calif ., usa ). to express recombinant hmg1 , positive clones were cultured at 37 ° c . with vigorous shaking , ( 250 rpm ) until od 600 reached 0 . 6 , when iptg ( 1 mm ) was added . twelve hours after iptg induction , bacterial cells were harvested by centrifugation ( 6500 rpm , 15 minutes ), and lysed by freeze - thaw cycles . the water - soluble fraction was collected after centrifugation ( 30 minutes , 12 , 000 rpm ), and recombinant hmg1 was purified on a calmodulin - binding resin column as instructed by the manufacturer ( stratagene ). bacterial endotoxin was removed from the recombinant hmg1 by using detoxi - gel endotoxin - removing gel ( pierce , rockford , ill . usa , cat . # 20344 ), and residual lps content was determined by the limulus amebocyte lysate test ( lal test , cat . # 50 - 648u , qcl - 1000 chromogenic lal , bio - whittaker , inc ., walkersville , md ., usa ). purified recombinant hmg1 was added to cultures of human peripheral blood mononuclear cells ( hupbmcs ), and supernatants assayed for tnf by elisa four hours after stimulation . the lps - neutralizing agent polymyxin b ( 10 μg / ml ) was added concurrently with recombinant hmg1 to eliminate the effect of any contaminating lps on tnf release . additionally recombinantly derived hmg1 was administered to test animals , with or without the additional endotoxemic challenge of exogenous lps , to study the pathogenic potential of high levels of hmg1 in vivo ( see fig2 b and 2c ). in some experiments , serum samples were secured from hmg1 - treated animals to be assayed for tnf as detailed herein ( see fig1 b ). the above procedure provides recombinant hmg1 as a fusion peptide comprising a 3 . 0 kda calmodulin - binding domain and a thrombin cleavage site as an amino terminal extension in register with the hmg1 peptide sequence . in some experiments , the fusion tag was removed from an aliquot of the recombinant protein and the bioactivity of the full fusion protein was compared to the cleaved hmg1 peptide ; no significant difference in bioactivity was noted and additional experiments ( especially those requiring administration of recombinantly produced hmg1 to animals ) typically were conducted with the ( uncleaved ) fusion protein . as demonstrated in fig3 a and 3b , in vitro or in vivo administration of recombinantly derived hmg1 induced a brisk tnf response , confirming the identification of hmg1 as a late - appearing lps - induced macrophage - derived endogenous mediator with pro - inflammatory activity . this example provides the results of experiments to generate and use polyclonal antibodies against hmg1 . briefly , polyclonal antibodies against an oligopeptide corresponding to the n - terminal amino acid sequence of hmg1 , or against purified recombinant hmg1 , were generated in rabbits according to standard procedures well known in the art . briefly , eight copies of an oligopeptide with the sequence gkgdpkkprgkmssc [ seq d no . 4 ] were anchored to radially branching lysine dendrites ( small immunogenically inert core ). these large macromolecules were injected three times both subcutaneously and intradermally ( 0 . 5 - 1 . 0 mg per injection ) into rabbits at week 1 , 2 , and 4 after pre - bleed at day 0 . two weeks after the last immunization , rabbits were bled and boosted intramuscularly with 1 . 0 mg of antigen followed by a second bleeding two weeks later . alternatively , to produce polyclonal antibodies against recombinant hmg1 , rabbits were immunized with recombinant hmg1 fusion peptide ( 100 μg per injection ) following a similar protocol . monoclonal antibodies reactive against hmg1 ( i . e ., that bind , and in some cases , neutralize or antagonize the biological activity of hmg1 ) are conveniently prepared according to methods well known in the art using the hmg1 antigens described herein or other hmg1 peptide fragments as immunogens . such monoclonal - antibodies , and / or the hybridomas that produce them , are useful to produce various “ humanized ” antibodies reactive against hmg1 ( all according to methods known in the art ), which humanized antibodies are useful as taught herein . hmg1 - specific antibodies were used to measure by western blotting analysis the inducible release of hmg1 from raw 264 . 7 cells after treatment with tnf or lps ( fig1 ). briefly , proteins were fractionated by sds - page on a 4 - 20 % gradient gel , transferred to a pvdf membrane , and blotted with rabbit antiserum raised against either the n - terminal synthetic hmg1 antigen or against recombinant hmg1 . the signal was detected using a ecl kit as instructed by the manufacturer ( amersham life science inc ., arlington heights , ill ., usa ), and levels of hmg1 were determined by measuring optical intensity of bands on western blots digitized for analysis using nih 1 . 59 image software , with reference to a standard curve of purified recombinant hmg1 . no hmg1 protein was detected in raw 264 . 7 cells - conditioned medium in the absence of tnf or lps treatment , but hmg1 accumulated in conditioned medium to high levels after such stimulation , reaching a plateau at 8 - 28 hours after stimulation ( fig1 a ). in summary , the data presented in examples 1 , 3 and in fig1 a show that the release of hmg1 from macrophages is stimulus - specific and time - and dose - dependent , with maximal accumulation observed within 8 hours after stimulation with tnf at concentrations as low as 5 ng / ml . it is well appreciated that sepsis , septic shock and related conditions may occur in humans in response to stimuli that differ qualitatively or quantitatively from the single large , lethal lps bolus used in this predictive model . nevertheless , experimental endotoxemia has been a valuable and predictive model system by which to identify critical components of the inflammatory cytokine cascade and by which to identify specific antagonists with predicted clinical utility . in this regard , hmg1 antagonists are perhaps more therapeutically attractive than tnf antagonists in view of the later appearance of hmg1 versus tnf in the response to endotoxin . this example illustrates an in vivo experiment in rodents measuring serum hmg1 levels after administration of a sublethal dose of lps ( ld 50 ). mice or rats were treated with lps , and sera were collected at different time points , and assayed for levels of hmg1 by western blotting analysis . the serum concentrations of hmg1 were estimated by measuring the optical band intensity with reference to a standard curve of purified hmg1 . serum levels increased significantly by 16 hours after lps , and remained high for at least 32 hours ( fig1 b ), and were not detectable in vehicle - treated control animals . these data show that hmg1 represents a particularly attractive target for diagnosis of , and pharmaceutical intervention against sepsis and related disorders of cytokine toxicity because hmg1 is a late - appearing mediator in the inflammatory cytokine cascade . this example provides the results of a predictive is in vivo assay to measure therapeutic activity or antagonists of hmg1 in relation to treatment of sepsis and related conditions of cytokine - mediated toxicity . in this example , the hmg1 antagonist was an anti - hmg1 antibody preparation . controls treated with pre - immune serum developed lethargy , piloerection , diarrhea , and succumbed to death within 48 hours . these clinical signs of endotoxemia were significantly prevented by administration of anti - hmg1 antibodies . male balb / c mice ( 6 - 7 weeks , 20 - 23 grams ) were randomly grouped ( 10 animals per group ) and pre - treated either with control pre - immune ) or anti - hmg1 serum ( as made in example 4 ) 30 minutes before administration ( intraperitoneally ) of a lethal dose of lps ( 50 mg / kg in 1 × pbs ). other experimental groups received additional doses of anti - hmg1 serum at + 12 or , + 12 , and + 36 hours after lps administration . animals were observed for appearance and survival for at least two weeks . polyclonal antibodies against recombinant hmg1 were generated in rabbits , and anti serum was assayed for specificity and titer by elisa and western blotting procedures . the polyclonal antiserum immunospecifically recognized ( bound to ) recombinant hmg1 in western blot analysis , for instance , and discriminated rhmg1 from other proteins in both crude bacterial lysates and as a purified protein that had been diluted into mouse serum . using chemiluminescence - amplified detection methods in western blotting analysis , polyclonal anti - hmg1 antiserum at dilutions up to 1 : 1000 was useful to detect as little as 50 pg rhmg1 protein . administration of anti - hmg1 antiserum in the indicated ( fig2 a ) amounts at − 0 . 5 ( if one dose ), − 0 . 5 and 12 ( if two doses ), or − 0 . 5 , 12 and 36 ( if three doses ) hours relative to lps challenge ( at time 0 ) was protective against lps - induced lethality , and repeated dosing schedules provided better protection . fig2 b illustrates that rhmg1 causes dose - dependent lethality in endotoxic mice . male balb / c mice ( 20 - 23 grams ) were randomized in groups of ten to receive lps ( 3 . 15 mg / kg ; a non - lethal dose ) alone or in combination with purified recombinant hmg1 protein . administration of hmg1 at the indicated doses 2 , 16 , 28 and 40 hours after lps challenge significantly increased the lethality of the underlying endotoxemia . fig2 c illustrates the independent lethal toxicity of hmg1 as a function of dose . purified rhmg1 was administered to male balb / c mice ( five mice per treatment group ) as a single i . p . bolus at the indicated dosage . mice were observed for at least 48 hours , and 60 % of mice treated with rhmg1 at a dose of 500 μg / mouse died within 24 hours of rhmg1 challenge , indicating a single dose ld 50 of less than 500 μg / mouse . the protection conferred by anti - hmg1 antibodies was specific , because administration of pre - immune serum , which showed no immunospecific reactivity to hmg1 on western blots , did not spare subjects from lps - mediated mortality ( fig2 a ). moreover , hmg1 - specific antibodies did not cross - react with other macrophage - derived cytokines ( e . g . il - 1 and tnf ), eliminating the possibility that antibodies conferred protection by binding and thereby neutralizing these mediators . protection against sepsis , sepsis associated pathogenesis and sepsis - related diseases involving activation of pro - inflammatory cytokine cascades may be improved by combination therapy targeted against more than one component of the cytokine cascade . antagonists of hmg1 in this regard can be combined with specific antagonists of tnf , il - 1 , mif and other inflammatory mediators , or with more broadly active antagonists of inflammatory responses that inhibit multiple components of the inflammatory cascade ( e . g ., aspirin , nsaids , anti - inflammatory steroids , etc . ), to provide even more effective therapeutic modalities . protection against lps toxicity was antibody dose - related , and more frequent dosing with higher amounts of antibody reduced mortality by up to 70 % ( fig2 a ). mice were observed for at least 2 weeks in all experiments , and no late mortality occurred , indicating that anti - hmg1 antibody treatment confers lasting protection against lps lethality , and does not merely delay the time of death . this example provides data that establish an association between hmg1 and human sepsis , and thereby support an indication for using hmg1 antagonists generally and anti - hmg1 antibodies in particular in human sepsis and related conditions of cytokine toxicity . serum hmg1 levels in normal healthy individuals and critically ill patients were measured using the polyclonal antibodies generated as in example 4 in a western blot format with reference to a standard curve of rhmg1 . hmg1 was not detectable in normal controls , but accumulated to high levels in critically ill patients with sepsis ( table 2 ). these data show that elevated serum hmg1 levels are observed in patients with sepsis , and the highest levels of serum hmg1 are observed in lethal cases ( table 2 ). these data further indicate the therapeutic importance of hmg1 antagonists in sepsis and also provide evidence for the diagnostic utility of an assay for sepsis and severity ( i . e ., potential lethality ) of sepsis by measuring serum concentrations of hmg1 . this diagnostic assay is also useful for diagnosing the severity of allied conditions involving activation of the inflammatory cytokine cascade . additional subjects were screened for serum hmg1 levels in association with lethal versus non - lethal sepsis , with results ( cumulative with table 2 ) as described in fig6 . the data summarized in fig6 represent serum samples obtained from eight healthy subjects and twenty - five septic patients infected with gram positive [ bacillus fragilis ( 1 patient ), enterococcus facecalis ( 1 patient ), streptococcus pneumonia ( 4 patients ), listeria monocytogenes ( 1 patient ), or staphylococcus aureus ( 2 patients )], gram negative [ escherichia coli ( 7 patients ), klebsiella pneumonia ( 1 patient ), acinetobacter calcoaceticus ( 1 patient ), pseudomonas aeruginosa ( 1 patient ), fusobacterium nucleatum ( 1 patient ), citrobacter freundii ( 1 patient )], or unidentified pathogens ( 5 patients ). serum was fractionated by sds - page gel electrophoresis , and hmg1 levels were determined by western blotting analysis with reference to standard curves of purified rhmg1 diluted in normal human serum . the detection limit by western blotting analysis is 50 pg . note that hmg1 is not detectable in normal controls , but significantly increased in septic patients . the average level of hmg1 in serum of non - surviving septic patients ( n = 13 patients , mean hmg1 level = 83 . 7 ± 22 . 3 ng / ml ) is significantly higher than in survivors ( nt = 12 , mean hmg1 level = 25 . 2 ± 15 . 1 ng / ml , p & lt ; 0 . 05 ). these data provide direct evidence of the utility of screening tissue ( including , without limitation blood or serum ) samples for hmg1 sequences ( protein or nucleic acid ) as a diagnostic and prognostic indicator of the presence of sepsis and related disorders of cytokine activation and of the severity and likely clinical course of such diseases and conditions . the present results provide evidence that hmg1 is a late released mediator element of the inflammatory cytokine cascade . addition of recombinant hmg1 to primary human peripheral blood mononuclear cells led to the dose - dependent induction of tnf within four hours after stimulation ( fig3 a ). this stimulation by recombinant hmg1 of tnf release by hupbmcs was not due to lps contamination because : ( i ) purified recombinant hmg1 was not contaminated by lps as judged by an lal endotoxin assay ; ii ) addition of the lps - neutralizing agent polymyxin b did not affect hmg1 - induced tnf release ; and iii ) proteolytic cleavage of recombinant hmg1 preparations with trypsin completely abolished the tnf release activity for the pbmc cultures . hmg1 stimulation also induced macrophages to release nitric oxide ( no ) to confirm that hmg1 induced serum tnf release in vivo , purified recombinant hmg1 was administered intraperitoneally to balb / c mice , and blood samples were collected to be assayed for tnf by the l929 assay . as shown in fig3 b , tnf was not detectable in serum of control animals , but was significantly increased two hours after administration of recombinant hmg1 protein . repetitive administration of recombinant gene product of the hmg1 gene ( 100 μg / mouse / day ) caused significant body weight loss ( fig4 ) in mice . without limitation on as to mechanism and without being bound by theory , these data are consistent with the hypothesis that hmg1 acts as a feed - forward stimulator of the pro - inflammatory cascade under both in vitro and in vivo conditions . these in vivo data in a predictive model of weight loss also provide predictive evidence that a pharmaceutical formulation comprising hmg1 or a therapeutically active fragment thereof is an effective weight loss therapy . serum hmg1 levels in hypophysectomized versus control rats also were measured by quantitation of western blot intensities as described above . there were significantly higher hmg1 levels within 12 hours after endotoxic challenge ( lps at 1 . 0 mg / kg ) in hypophysectomized rats ( approx . 75 ng / ml ) as compared to controls ( approx . 25 ng / ml ). these results indicate that pituicytes are not the major source of serum hmg1 levels and that macrophages may play a quantitatively more important role . | 0 |
the polygonal tiles of the invention preferably comprise an asphalt type base binder , generally known as bitumen , and can contain a wide variety of filler materials . the bitumen base binder can be any of the variety of distillation products and by - products normally considered useful for pavement binders and include straight run bitumen , cut back bitumen and rubberized bitumen . the bitumen can be naturally occurring such as natural lake asphalt material which is a bitumen product normally containing finely divided mineral matter . in many instances however it is appropriate to reduce the viscosity of natural asphalt material by the addition of distilled bitumens . the bitumen base binder can comprise recycled pavement products , or can comprise waste bitumen products and the like . the bitumen binder typically contains added fillers , usually comprising finely divided materials such as gravel , sand and the like . colored pigments , stones and the like may be added to create ornamental effects . recycled ground tire pieces and the like may be added to create greater wear resistance . tiles may comprise varying layers of materials , such as top ornamental layers comprising abrasion resistant and / or colored gravels and the like . the reinforcing means comprises a net like plastic gridwork imbedded in the asphalt at about the midpoint of its thickness . by plastic gridwork is meant any material which can be formed into a rigid or semi - rigid gridwork structure . typically such plastic grid should be at least so rigid as to help the tile maintain its form during transporting and for ease of tile installation . any suitable plastic material , which can be formed into a rigid or semi - rigid grid , can be used as a reinforcing means . typically , the malleable metals such as aluminum , copper , the mild irons and the like make suitable grids . preferred grids are typically comprised of the plastic organic polymer compounds such as the polymers of ethylene , polypropylene , polyester , polyamides , epoxy compounds . the grid of the reinforcing means must be relatively dense , comprising defined open spaces not less than about one sixteenth square inches in area to not more than about one and one half square inches in area . it has been found that grids comprising less open space tend to need greater forming pressures when manufacturing the tiles to prevent premature delamination , while those with larger open spaces tend to be inadequate in maintaining the form of the bitumen material structure . referring now to the figures , like reference numerals are meant to indicate like parts in the embodied paving tiles . fig1 and 3 , embody a rectangular reinforced paving tile 20 comprising a net - like support structure 1 embedded within a bitumen composition containing rectangular structure having interlocking end extensions . end surfaces 2 and 3 of the tile , comprise the terminating surfaces of abutting lower surface interlocking extensions 6 and 7 . the extensions are less than about one half the thickness of the paving tile , where they join the body of the tile , and extend outward from the tile a distance from about one to about six times the thickness of the paving tile . the extensions increase in thickness during their outward extension . end surfaces 4 and 5 , comprise the terminating surfaces of abutting upper interlocking extensions 8 and 9 , which also are less than approximately one half of the thickness of the paving tile at the body of the tile . these extensions also extend outward from the tile a distance from about one to about six times the thickness of the paving tile and also increase in thickness in their outward extension . in each instance of common polygonal tiles , the combined thickness of the lower surface interlocking extensions and the upper surface interlocking extensions , at any common point of the distance of their extension outward from the body of the tile , should be about the same or less than the maximum thickness of the tile . similarly , the outward extension of the lower surface interlocking extension from the body of the structure should be about the same or less than the outward extension from the body of the upper surface interlocking extensions . thus , interlocking extensions 6 or 7 are arranged to angularly interlock with interlocking extensions 8 or 9 of a polygonal structure , adhering through the weight of the tile itself initially and thereafter by the normal interflow of the bitumen material that occurs as the tiles weather . typically , the weight of the tile itself combined with the normal temperature variations of a typical summer and coupled with the weight of the traffic that the paving is intended to support are sufficient to assure the adherence of the overlapping , interlocking tiles . it should be understood however that it is also contemplated that the arranged tiles can be further compressed such as by tamping , roller pressure means and the like and / or that they be heated to assure a contiguous fit through the interflow of the bitumen material . provision is specifically and preferably made for the application of adhesive material to each or any of the contacting surfaces of the interlocking extensions , designated in the figures as surfaces 10 . the application of such adhesives can assure a contiguous fit when the surface being paved is especially rough or uneven . the upper surface of the paving tile of the figures can be beveled 11 at the edges to provide a decorative effect . in an embodiment of a polygonal tile comprising a three sided or other uneven number sided form , it is typically desirable that the tile be manufactured such that both the upper surface and the lower surface are decoratively interchangeable . fig4 represents a three sided equilateral embodiment 20a comprising two lower surface interlocking extensions 6 and 7 and an upper surface interlocking extension 8 . as is apparent , any interlocking combination of contacting surfaces 10 is easily attained by selecting the appropriate surface interlocking extension from a like tile . | 4 |
the present invention is a multiple stage compressor that produces a very high pressure ratio such that cooling of the last stage or stages of the compressor air required . the compressor is intended to be used in a gas turbine engine such as an aero engine or an igt engine . however , the present invention could be used in any turbomachine in which a multiple stage compressor is used that produces the high pressure ratio in which cooling of the last stage airfoils is required to prevent thermal damage . fig1 shows a cross section of the compressor of the present invention in which a number of stages are present with each stage having a stator or guide vane located upstream from an associated rotor blade . in a typical multiple stage compressor of an aero engine , the outer diameter of the compressor is about at a constant radial diameter while the inner diameter is conical shaped with a decreasing airfoil spanwise height in the downstream direction . the inlet air to the compressor is at atmospheric pressure . the compressor progressively compresses the air as the compressed air passes through the multiple stages . as the air is compressed , the temperature of the compressed air increases . a typical compressor will increase the compressed air temperature about 90 degrees f . in each stage . in the last stages , the compressed air can be at such a high temperature that the airfoils can be damaged from the high temperature . the material properties of these airfoils are such that the high temperature compressed airs passing through these airfoils exceed the safe temperature level for the materials . in the present invention is fig1 , the last stage vanes 12 and blades 11 include closed loop cooling air passages to pass cooling air through the airfoils without discharging the cooling air into the high temperature compressed air stream through the compressor . the internal airfoil cooling passages can be any type of prior art closed loop cooling passage circuit that makes use of well known convection cooling and impingement cooling of airfoils . compressed cooling air from a middle stage 15 of the compressor is bled off and passed through a cooling air passage in the rotor shaft assembly and into the inlet of the internal cooling air passage of the rotor blade . the cooling air passes through the rotor blade cooling passage and then flows through a return air passage also in the rotor shaft to be discharged into the compressor at a stage 16 upstream from the bled off stage . this is due to the loss of pressure in the cooling air from passing through the cooling passages in the rotor shaft and the rotor blade . to cool the last stage stator vane 11 , cooling air is also bled off from the compressor at a middle stage 13 and directed through a cooling air passage and into the internal cooling air passage formed within the stator vane . the cooling air passes through the vane cooling passage , and is then directed through a return air cooling air passage and into the compressor at a stage 14 upstream from the bled off location . this is also due to the loss of pressure in the cooling air from passing through the cooling supply passages in the casing and the stator vane . the bleed off air used for cooling of the last stage airfoils is from the lowest stage that would produce enough pressure to pass through the cooling circuit for the airfoils while still allowing for the spent cooling air to be discharged into an upstream stage of the compressor . the further down the compressor stages that the cooling air is bled off from , the higher the temperature of the cooling air used to pass through the airfoils for cooling . bleeding off the compressed air used for the cooling and then re - supplying the cooling air back into the compressor minimizes the loss in the compressor . the heat picked up from the cooling air passing through the cooling passages within the airfoils is passed back into the compressor mainstream air . the only significant losses are due to the pressure loss from the cooling air passing through the cooling passages from the bleed off location to the re - supply location . in other embodiments , other stages of the blades and vanes in the compressor can also be cooled by passing bleed off cooling air through the internal cooling passages and then re - supplying the cooling air to the compressor . the number of stages in the compressor that require cooling would depend upon the compressed air temperature passing through those stages . also , the stage at which the cooling air is bled off will depend upon the required pressure for the cooling air that is needed to pass through the cooling air passages and be discharged back into the compressor . the re - supply locations will depend upon the pressure difference between the main stream compressed air and the re - supply cooling air . the re - supply cooling air must be at a higher pressure than the mainstream compressor air or a backflow will occur . since the airfoil internal cooling passage is a closed loop passage ( no cooling air is discharged from the airfoil out into the mainstream compressor air flow ), the pressure of the cooling air can be lower than the pressure of the main stream compressed air passing through that airfoil . also , in another embodiment , the cooling air can be discharged into the turbine section to provide cooling for turbine airfoils such as rotor blades and stator vanes and then discharged into the hot gas flow passing through the turbine if the pressure differential is high enough to prevent backflow into the turbine airfoils . in another embodiment , the cooling air from the compressor airfoils can be passed through a turbocharger to increase the pressure of the cooling air , and then passed into the combustor to be burned with the fuel . with this embodiment , the heated cooling air is burned with the fuel to produce the hot gas flow that is passed through the turbine to drive the rotor shaft . fig2 shows an embodiment of the present invention in which the cooling air does not pass through the last stage airfoils . in the closed loop cooling circuit of fig1 , if an airfoil was to crack then the hot compressed air from the compressor can leak into the internal cooling passages of the last stage airfoils . to prevent this , the fig2 embodiment uses heat pipes 21 and 23 that extend into the last stage airfoils 11 and 12 to draw heat away and into heat exchangers 22 and 24 . the compressed air bled off from the compressor at 13 and 15 is passed through the heat exchangers 22 and 24 to draw heat away from the heat pipes 21 and 23 and thus the last stage airfoils 11 and 12 to cool the airfoils . with the use of heat pipes in the last stage airfoils 11 and 12 , no high temperature compressed air can leak into the cooling air passages . | 5 |
hereinafter , a domed camera , which is an embodiment of an imaging device of the present invention , will be described in detail with reference to the accompanying drawings . however , components , types , combinations , shapes , relative arrangement of the components , and the like are not meant to limit a scope of the invention thereto but are simple examples of explanation unless specifically described otherwise . in addition , the same portions and matters are denoted by the same reference numerals and signs , and repeated descriptions thereof will be omitted . as illustrated in fig1 , a domed camera 1 of the present embodiment includes a case portion 60 , a domed cover 70 that is transparent or translucent , and a camera module 10 that is provided within the domed cover 70 . when the domed camera 1 is actually attached to a ceiling , the domed camera in a state illustrated in fig1 is turned upside down and is then attached to the ceiling . however , for convenience of description , the domed camera in a direction illustrated in fig1 will be described . as illustrated in fig2 , the camera module 10 includes a lens 101 that acquires an optical image , a cmos image sensor 104 that generates an image signal by performing photoelectric conversion of the optical image that is acquired by the lens 101 , a dsp 102 that performs image processing on the image signal that is generated by the cmos image sensor 104 , a dsp substrate 103 on which the dsp 102 is mounted , a heat transfer member 105 that transfers heat of the dsp 102 , a cmos substrate 106 on which the cmos image sensor 104 is mounted , a heat transfer member 107 that transfers heat of the cmos substrate 106 , and a cover 108 that protects the camera module 10 . since one surface of the heat transfer member 105 comes into contact with the dsp 102 and the other surface thereof conies into contact with the cover 108 , the heat of the dsp 102 is transferred to the cover 108 through the heat transfer member 105 . since one surface of the heat transfer member 107 comes into contact with the cmos substrate 106 and the other surface thereof comes into contact with a rear plate 110 to be described below , the heat of the cmos image sensor 104 is transferred to the rear plate 110 through the cmos substrate 106 and the heat transfer member 107 . when an imaging direction , that is a direction including the lens 101 , is set as a front direction of the camera module 10 , a front plate 109 is attached to the front of the cover 108 as illustrated in fig3 . in addition , the rear plate 110 is attached to two right and left positions of the rear of the cover 108 , with an insulation sheet 112 interposed therebetween , wherein the insulation sheet is formed of a resin material such as polyethylene terephthalate ( pet ) and has low heat conductivity . heat transfer between the rear plate 110 and the cover 108 is suppressed by the insulation sheet 112 , the rear plate 110 includes two protrusion portions 110 a , which protrude in the downward direction of the camera module in fig3 , at right and left positions thereof . two screw holes 110 b are formed on a rear surface of the rear plate 110 . in addition , a concave portion 110 c having a circular shape about the optical axis 111 is formed in the rear plate 110 . fig4 a is a perspective view of he camera module 10 that is obliquely seen from the rear of the camera module 10 . fig4 is a perspective view of the camera module 10 that is obliquely seen from the front of the camera module 10 . both fig4 a and 4b show a state where the front plate 109 , the rear plate 110 , a front bracket 201 , and a rear bracket 203 are attached to the camera module 10 . concave portions 109 a , 109 b , and 109 c having a circular shape are formed on the circumference of the same circle about the optical axis 111 on a front surface of the front plate 109 . the l - shaped front bracket 201 is attached to the camera module so as to cover a front surface and a right side surface of the camera module 10 . arc - like elongate holes 201 a , 201 b , and 201 c are formed in the front bracket 201 about the optical axis 111 so as to correspond to the concave portions 109 a , 109 b , and 109 c . the elongate holes 201 a , 201 b , and 201 c are coupled to the concave portions 109 a , 109 b , and 109 c . thus , the front bracket 201 is configured to be rotatable about the optical axis 111 . a tilting rotation axis 202 is also formed in the front bracket 201 . the tilting rotation axis 202 is an axis for rotating the camera module 10 in a tilting direction . in addition , the front bracket 201 and the front plate 109 are coupled to each other by using a screw 205 having step flange so as not to be disengaged from each other . in addition , as illustrated in fig4 a , the l - shaped rear bracket 203 is attached to the camera module so as to cover a rear surface and a left side surface of the camera module 10 . a circular hole 203 a coupled to the concave portion 110 c of the rear plate 110 is formed in the rear bracket 203 . in addition , although not shown in the drawing , two arc - like elongate holes are formed in the rear bracket 203 about the optical axis 111 so as to correspond to the screw hole 110 b that is formed in the rear plate 110 . then , screws 204 a and 204 b are coupled to the screw hole 110 b through the two elongate holes , thereby fixing the rear bracket 203 . since the concave portion 110 c and the circular hole 203 a are coupled to each other , the rear bracket 203 is configured to be rotatable about the optical axis 111 when the screws 204 a and 204 b are loosened . in addition , a tilting driving motor 401 to be described below is attached to a portion which is on the reverse side of the rear bracket 203 in fig4 a and 4b . both the front bracket 201 and the rear bracket 203 are an l - shaped bracket as described above , and together constitute a quadrangular shape in which the front bracket and the rear bracket cover the camera module 10 by fixed to each other via screws at two positions . when an upper direction in fig5 is set as an upper direction of the camera module , an upper heat sink 301 is fixed to a top portion of the cover 108 by using a screw ( not shown ) as illustrated in fig5 . as illustrated in fig6 , a lower heat sink 302 is fixed to the two protrusion portions 110 a of the rear plate 110 , which protrude from a lower surface of the camera module 10 , by using screws . an insulation sheet , which is not shown in the drawing , is interposed between the lower heat sink 302 and the camera module 10 , and the lower heat sink 302 is fixed to the camera module 10 by using a screw . a rear heat sink 303 is fixed to the rear bracket 203 provided on a rear surface of the camera module 10 by using a screw . gaps are formed between the rear heat sink 303 , the upper heat sink 301 , and the lower heat sink 302 so as not to allow heat transfer therebetween . an appearance of each of the upper heat sink 301 , the lower heat sink 302 , and the rear heat sink 303 is configured to have an approximately spherical shape about a rotation center of panning and tilting of the camera module 10 which will be described below . as described above , the heat of the dsp 102 of the camera module 10 is transferred to the top surface of the cover 108 through the heat transfer member 105 , and the heat of the cmos image sensor 104 is transferred to the rear bracket 203 , which is fixed to the rear plate 110 , through the cmos substrate 106 , the heat transfer member 107 , and the rear plate 110 . therefore , as illustrated in a side view of fig7 , the heat of the dsp 102 is transferred to the upper heat sink 301 through the cover 108 above the camera module 10 as indicated by an arrow a , and is then radiated to the outside . the heat of the cmos image sensor 104 is transferred to the rear heat sink 303 from the rear bracket 203 behind the camera module 10 as indicated by an arrow b , and is then radiated to the outside and is also transferred to the lower heat sink 302 from the protrusion portion 110 a of the rear plate 110 below the camera module 10 as indicated by an arrow c , and is then radiated to the outside from the lower heat sink 302 . since heat transfer between the cover 108 and the rear plate 110 is suppressed by the insulation sheet 112 , heat transfer between the upper heat sink 301 and the lower heat sink 302 and between the upper heat sink 301 and the rear heat sinks 303 is suppressed . as illustrated in a configuration diagram of the domed camera 1 of fig8 , the case portion 60 includes a case outer circumferential portion 60 a having a cylindrical shape , and a case upper surface portion 60 b . in addition , a case base 606 is attached to a bottom of the case portion 60 . when the domed camera 1 is attached to a ceiling , the case base 606 is attached to the ceiling and is then coupled to the case portion 60 , thereby allowing the domed camera 1 to be detachably attached to the ceiling . a panning driving motor 50 is attached to the case upper surface portion 60 b . a panning / tilting driving unit 40 is attached to a to surface of the panning driving motor 50 , and is rotatably driver ) in a panning direction by the panning driving motor 50 . the panning / tilting driving unit 40 includes a tilting driving motor 401 . the tilting driving motor 401 holds the rear bracket 203 , and the panning / tilting driving unit 40 holds the tilting rotation axis 202 , and thus the camera module 10 is held by the panning / tilting driving unit 40 . since the tilting driving motor 401 is located at a position which is on the reverse side of the camera module 10 in fig8 , the tilting driving motor is shown as a dashed line in fig8 . the panning driving motor 50 rotates the panning / tilting driving unit 40 , and thus the camera module 10 rotates in a panning direction , thereby allowing an imaging direction to be changed to the panning direction . in addition , the tilting driving motor 401 rotates the camera module 10 , and thus the imaging direction may be changed to the tilting direction . meanwhile , a fan bracket 602 and a duct cover 601 are attached to the case base 606 at the bottom of the case portion 60 . fig9 a illustrates a state where the fan bracket 602 is attached to the case base 606 . a fan 605 for circulating air within the domed camera 1 is attached to the fan bracket 602 . fig9 b illustrates a state where the duct cover 601 is additionally attached to the top of the case base 606 to which the fan bracket 602 , illustrated in fig9 a , is attached . as illustrated in fig9 b , the duct cover 601 is provided with an air - blowing duct 603 for discharging air , which is sent by the fan 605 , to the inside of the domed cover 70 by passing through the case upper portion 60 b , and an upper inhalation duct 604 a ( 604 a 1 , 604 a 2 , 604 a 3 , and 604 a 4 ) that inhales the air from the inside of the domed cover 70 . the air - blowing duct 603 and the upper inhalation duct 604 a are formed along an inner circumference of the domed cover 70 . in addition , at least one of the air - blowing duct 603 and the upper inhalation duct 604 a is constituted by a plurality of ducts along the inner circumference of the domed cover 70 . in the present embodiment , the upper inhalation duct 604 a is constituted by a plurality of ( four ) ducts along the inner circumference of the domed cover 70 . when the duct cover 601 is superposed on the fan bracket 602 , the air - blowing duct 603 is formed immediately on the fan 605 . in addition , in the fan bracket 602 , an inhalation groove 604 b is formed to correspond to the upper inhalation duct 604 a , and the inhalation duct 604 is formed by the upper inhalation duct 604 a and the inhalation groove 604 b . in this manner , the case base 606 to which the duct cover 601 and the fan bracket 602 are attached is attached to the bottom of the case portion 60 . in addition , although not shown in the drawing , the case portion 60 is provided with a slip ring for exchanging a signal with the camera module 10 , a circuit board for controlling the camera module 10 or supplying power , and so on . arrows illustrated in fig1 indicate a flow of air . as illustrated in fig1 , air that is discharged to the inside of the domed cover 70 from the air - blowing duct 603 is transferred upwards in fig1 along an inner wall of the domed cover 70 , and reaches a head portion of the domed cover 70 . then the air is transferred downwards in fig1 along the inner wall of the domed cover 70 and is inhaled into the inhalation duct 604 as illustrated in fig9 a and 9b , since the plurality of upper inhalation ducts 604 a are formed along the inner circumference of the domed cover 70 , the air discharged into the domed cover 70 from the air - blowing duct 603 further spreads in a circumferential direction along the inner circumference of the domed cover 70 and is then inhaled into the inhalation duct 604 . thus , the air is widely circulated within the domed cover 70 . the air inhaled into the inhalation duct 604 passes between the duct cover 601 and the fan bracket 602 and is then transferred to the fan 605 again . therefore , the air is circulated between the inside of the domed cover 70 and a space surrounded by the duct cover 601 and the fan bracket 602 by the fan 605 , and thus the air is never mixed with external air . for this reason , since external dust is not introduced into domed camera 1 , imaging is not obstructed . in addition , when the domed camera 1 is attached to the ceiling or the like , the head portion ( a spherical tip ) of the domed cover 70 is located at the lowest position , and thus the temperature of the domed camera decreases . however , since air in the head portion may be circulated , heat radiation may be effectively performed . since the air circulating within the domed cover 70 flows along an inner surface of the domed cover 70 , the air comes into contact with the upper heat sink 301 , the lower heat , sink 302 , and the rear heat sink 303 which have an approximately spherical shape . thus , the heat sinks are cooled . the heat of the dsp 102 is radiated from the upper heat sink 301 . the heat of the cmos image sensor 104 is radiated from both the rear heat sink 303 and the lower heat sink 302 . in this manner , since the heat of the cmos image sensor 104 is radiated from two heat sinks , the heat of the cmos image sensor 104 is radiated from the heat sink having a wider surface area than the dsp 102 , therefore heat radiation of the cmos image sensor 104 may be sufficiently performed . in addition , the heat sink used for the heat radiation of the cmos image sensor 104 and the heat sink used for the heat radiation of the dsp 102 are configured as different members , and mutual heat transfer is suppressed . thus , even if the temperature of the upper heat sink 301 increases due to heat radiation of the dsp 102 , the heat radiation of the cmos image sensor 104 is not obstructed . when the heat sink is located in the vicinity of the case upper portion 60 b , there is a concern that the flow rate of the air coming into contact with the heat sink may be decreased . however , in the present embodiment , the heat radiation of the cmos image sensor 104 is performed at two positions , that is , the rear side and the lower side of the camera module 10 . for this reason , when rotation is performed in a tilting direction , even though one heat sink is located in the vicinity of the case upper portion 60 b where air does not flow smoothly , the other heat sink is located at a position where air flows smoothly . in this manner , the heat radiation of the cmos image sensor 104 may be sufficiently performed without regard to an angle of tilting . with such a configuration , the temperature of the cmos image sensor 104 may be decreased further than the dsp 102 . in addition , each heat sink is configured to have an approximately spherical shape about a rotation center of panning and tilting of the camera module 10 . for this reason , even though the imaging direction of the camera module 10 is changed by performing panning and tilting , a state of heat radiation does not change significantly , thereby allowing heat radiation to be stably performed . as described above , the front bracket 201 and the rear bracket 203 are attached to the rear plate 110 from the rear of the camera module 10 by using two screws 204 . for this reason , the camera module 10 may be rotated with respect to the front bracket 201 and the rear bracket 203 about the optical axis 111 of the camera module 10 by loosening the two screws 204 . the camera module 10 may be inclined in a direction in which the camera module 10 rotates about the optical axis in accordance with component accuracy and assembling accuracy . as a result , a captured image may be inclined . the domed camera 1 of the present embodiment rotates the camera module 10 by loosening the screws 204 for fixing the rear bracket 203 , thereby allowing a gradient of the captured image to be corrected . in addition , since the screws may be operated from the rear of the camera module 10 , which is at the side opposite to the lens 101 , and the adjustment may be performed while not obstructing the imaging and viewing the captured image . in addition , in the present embodiment , although an example has been described in which a plurality of heating units having different maximum allowable temperatures are cooled , heating units having different features may be used . for example , the present invention may be applied to a case of including a plurality of heating units having significantly different amounts of heat generation or a case where an amount of heat generation of one of plurality of heating units significantly varies . according to an imaging device of the present invention , heat radiation can be appropriately performed according to features of a heating unit of the imaging device . while this invention has been particularly shown and described with reference to exemplary embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 7 |
fig1 illustrates a code reader 10 that operates in accordance with the present invention . the code reader 10 includes a housing 11 which incorporates active components , including electrical circuitry to implement the functions described below . the display 13 is disposed on the housing 11 and is operative to display test results , code reader functions and monitor status information as described more fully below . erase button 15 functions to erase diagnostic trouble codes ( dtcs ) and freeze frame data and resets monitor status . scroll button 17 functions to scroll the display 13 to view diagnostic trouble codes when more than one dtc is present . link button 19 functions to link the code reader with the vehicle &# 39 ; s powertrain control module ( pcm ) to retrieve any dtcs that are present in memory and to view readiness monitor status . power button 21 operates to turn the code reader on and off . referring to fig2 the display 13 is shown in more detail . the display includes various icons as described below . the icons are arranged and ordered in such a way to optimize display of information in a single review , while deleting icons that are unrelated to the particular type of vehicle in interest . i / m monitor status display illustrates various monitors that correlate to monitors in the vehicle being tested . the monitors include a variety of functions , not all of which may be supported by a particular vehicle . in accordance with the present invention , only those monitored functions that are supported by the present vehicle are lit . where a monitor is supported , but not operative to provide test data , an indication of such may be provided , e . g ., by blinking the appropriate indicator . where a monitor is supported , but determined to be inoperative in relation to prescribed parameters , an indication is also provided , e . g ., by altering the substance or color of the appropriate display . the vehicle icon 25 indicates whether or not the code reader is being properly powered to the vehicle &# 39 ; s data link connector . the link icon 27 indicates whether or not the code reader is communicating ( linked ) with the vehicle &# 39 ; s on - board computer . the computer icon 29 provides an indication as to whether or not the monitor is optionally connected to a computer link . the battery icon 31 indicates the status of the code reader internal battery . the display 33 displays the dtc number for any diagnostic trouble code identified by the code reader . each particular fault is assigned a code number that is specific to that fault . the translator display 35 displays the fault code that corresponds to the dtc illustrated at display 33 . as such , the translator display avoids the need for a user to separately refer to a list of trouble codes that may correspond to a particular dtc . as such , the code reader allows for more complete information within a single display , for the convenience of the user . the translator display is implemented by means of a look - up table within the code reader that operates to produce the trouble code descriptor ( translation ). the pending display 37 indicates if the display dtc is a pending code . a code icon 39 identifies the code number sequence display area . the mil icon 41 indicates the status of the malfunction indicator lamp ( mil ). the mil icon is visible only when a dtc has commanded the mil to illuminate on the vehicle &# 39 ; s dash . the code reader assigns a sequence number to each dtc that is present in the pcms memory , in ascending order , starting with 01 . the code number sequence 43 indicates which dtc is being displayed , and how many such codes are in memory , e . g ., displaying code number 2 of 6 stored codes . fig3 implements a sequence of steps that are implemented by the present invention . the steps collectively allow the display of information , as illustrated in more detail at fig2 . moreover , the steps are representative of the functions operative to identify the type of vehicle being tested , the monitors supported by that type of vehicle , and the vehicle conditions correlating to trouble codes from the same type of vehicle . as such , information is collected , condensed , sorted and displayed in a simple format that belies the sophistication of analysis . as illustrated in fig3 the code reader is connected to the vehicle test connector and a link is established between the code reader and the vehicle computer . different types of vehicles generate different types of signals . by analysis of the signals received by the code reader , e . g ., the monitor signals being generated , the vehicle type can be determined . where only certain monitors are supported , the display is operative to illuminate only the supported monitors , and not others . as such , the display of monitor functions is limited to those functions supported by the particular vehicle being tested . trouble codes communicated from the vehicle computer are also displayed in the code reader . the code reader further operates to correlate the trouble codes to a vehicle condition description , which is also displayed in the code reader . as such , information is collected , processed and displayed in a form that minimizes the need for any supplemental source to identify the vehicle in question and the monitors supported by that vehicle . additionally , the invention avoids the need for additional references to correlate the display trouble codes to particular vehicle conditions . accordingly , the invention provides significant ease of use and convenience useful to practical operation . as will be recognized by one of ordinary skill in the art , various changes and modifications may be made to the invention without departing from the broader scope of the invention , as described herein . | 6 |
hereinafter , the invention will be described more fully with reference to the accompanying drawings , in which exemplary embodiments of the invention are shown . fig1 is a perspective view of a zoom lens barrel assembly according to an embodiment of the invention . referring to fig1 , the zoom lens barrel assembly unfolds in 2 steps and performs a 5 - magnification optical zooming function . the zoom lens barrel assembly includes an external cylinder 80 installed in a base 90 , a first zoom ring 20 movably disposed in the external cylinder 80 , and a second cylinder 70 . the second cylinder 70 is disposed to move forward or backward from the external cylinder 80 in an axial direction ( in a z direction ). the first zoom ring 20 is disposed to move forward or backward from the second cylinder 70 in the axial direction . the zoom lens barrel assembly can perform a zooming function because the first zoom ring 20 and the second cylinder 70 , which move from the external cylinder 80 fixed in the base 90 in the axial direction , are unfolded in 2 steps . thus , a whole thickness or length of the zoom lens barrel assembly can be reduced when the first zoom ring 20 and the second cylinder 70 are accommodated in the external cylinder 80 , thereby easily implementing a small - sized and thin - shaped camera . a driving unit 5 that generates a driving force for performing the zooming function and a focus driving unit 7 that generates a driving force for performing a focusing function are disposed in exterior surfaces of the base 90 and the external cylinder 80 . fig2 is a cross - sectional perspective view of the zoom lens barrel assembly of fig1 , according to an embodiment of the invention . fig3 is an exploded perspective view of the zoom lens barrel assembly of fig1 , according to an embodiment of the invention . referring to fig2 and 3 , the zoom lens barrel assembly comprises the first zoom ring 20 that supports a first lens group 10 , a guide ring 30 disposed around the first zoom ring 20 , a second zoom ring 50 that supports a second lens group 40 , a first cylinder 60 disposed between the first zoom ring 20 and the second zoom ring 50 , a second cylinder 70 that is disposed around the guide ring 30 , and movably supports the first zoom ring 20 and the first cylinder 60 , and an external cylinder 80 that is disposed around the second cylinder 70 . the external cylinder 80 acts as a support structure that maintains a fixed state in the zoom lens barrel assembly . when the zoom lens barrel assembly operates and performs the zooming function , the first zoom ring 20 protrudes forward in the axial direction ( in the z direction ) with respect to the second cylinder 70 . the first zoom ring 20 has a cylindrical shape , supports the first lens group 10 , and comprises a first protrusion 21 that protrudes to the outside of the first zoom ring 20 . the first lens group 10 is coupled to a front of the first zoom ring 20 using a lens support portion 11 disposed therebetween . the first zoom ring 20 moves forward or backward in the axial direction , and thus a position of the first lens group 10 with respect to the axial direction can be adjusted . the guide ring 30 has a hollow cylindrical shape and is disposed outside the first zoom ring 20 . an inner wall surface of the guide ring 30 comprises a first guide slot 31 that rectilinearly extends in the axial direction , through which the first protrusion 21 of the first zoom ring 20 passes , and a second guide slot 32 that is inclined in the axial direction and extends in the circumferential direction . the first guide slot 31 guides a movement of the first protrusion 21 to cause the first zoom ring 20 to perform a rectilinear motion in the axial direction . a rectilinear guide protrusion 35 that protrudes to the outside of the guide ring 30 is screwed to a rectilinear groove portion 85 that rectilinearly extends in the inner wall surface of the external cylinder 80 in the axial direction . thus , although the guide ring 30 is disposed in the second cylinder 70 , the guide ring 30 does not rotate with respect to the external cylinder 80 and rectilinearly moves in the axial direction , together with the second cylinder 70 , when the second cylinder 70 rotates with respect to the external cylinder 80 . the first cylinder 60 is disposed in the guide ring 30 . the first cylinder 60 has a hollow cylindrical shape , comprises a second protrusion 61 that protrudes to the outside of the first cylinder 60 , and moves in the axial direction while rotating . the second protrusion 61 of the first cylinder 60 is inserted into the second guide slot 32 of the guide ring 30 so that the guide ring 30 can movably support the first cylinder 60 . an exterior diameter of the first cylinder 60 is smaller than an interior diameter of the first zoom ring 20 . thus , when the first zoom ring 20 and the first cylinder 60 are guided by the guide ring 30 and move in the axial direction , the first cylinder 60 can be inserted into the first zoom ring 20 . the second zoom ring 50 is movably disposed in the first cylinder 60 . the second zoom ring 50 supports the second lens group 40 . the second lens group 40 is coupled to the second zoom ring 50 using a lens support portion 41 disposed therebetween . the second zoom ring 50 comprises a third protrusion 51 that protrudes to the outside of the second zoom ring 50 . the third protrusion 51 of the second zoom ring 50 is inserted into a second zoom ring guide groove 62 formed in an inner wall surface of the first cylinder 60 , and thus the rotation of the first cylinder 60 causes the third protrusion 51 to be guided by the second zoom ring guide groove 62 , and the second zoom ring 50 to rectilinearly move in the axial direction . a cutting portion 52 that extends in the axial direction is formed in an exterior wall surface of the second zoom ring 50 in order to prevent the second zoom ring 50 from rotating , and to rectilinearly move in the axial direction . a guide portion 55 that is coupled to the cutting portion 52 and guides a motion of the second zoom ring 50 in the axial direction is disposed between the second zoom ring 50 and the first cylinder 60 . the guide portion 55 is screwed to a guide portion guide groove 64 that extends in the inner wall surface of the first cylinder 60 in the circumferential direction , and thus the first cylinder 60 rotates while the guide portion 55 guides the cutting portion 52 . the guide portion 55 is coupled to the cutting portion 52 , thereby fixing a position of the second zoom ring 50 in the circumferential direction of the guide portion 55 . as described above , because the rotation of the first cylinder 60 causes the second zoom ring 50 to move in the first cylinder 60 in the axial direction , which changes a relative position of the second lens group 40 in the axial direction with respect to the first lens group 10 , the zooming function is realized . although the cutting portion 52 and the guide portion 55 are used to guide the second zoom ring 50 to rectilinearly move in the axial direction without rotating during the rotation of the first cylinder 60 in the present embodiment , the invention is not limited thereto . for example , fig7 is an exploded perspective view of a zoom lens barrel , according to another embodiment . in fig7 , a pin 155 extending in the axial direction and a guide slot 152 extending in the second zoom ring 150 in the axial direction , through which the pin 155 is inserted , may be used to guide the second zoom ring 150 to rectilinearly move in the axial direction during the rotation of the first cylinder 60 . the second cylinder 70 is rotatably disposed around the guide ring 30 . the second cylinder 70 has a hollow cylindrical shape and comprises a fourth protrusion 71 that protrudes to the outside of the second cylinder 70 . an inner wall surface of the second cylinder 70 comprises a first groove portion 72 to which the first protrusion 21 passing through the first guide slot 31 of the guide ring 30 is screwed , and a second groove portion 73 to which the second protrusion 61 passing through the second guide slot 32 of the guide ring 30 is screwed . thus , the second cylinder 70 movably supports the first zoom ring 20 and the first cylinder 60 and guides a movement of the first zoom ring 20 and the first cylinder 60 . the first groove portion 72 comprises a first inclination portion 72 a that is inclined from a boundary 78 of one end of the second cylinder 70 to a boundary 79 of another end thereof and extends in the circumferential direction , and a second inclination portion 72 b that is inclined from an end portion of the first inclination portion 72 a to the boundary 78 and extends in the circumferential direction . the first inclination portion 72 a performs a function of moving the first zoom ring 20 forward in the axial direction with respect to the second cylinder 70 . the second inclination portion 72 b performs a function of moving the first zoom ring 20 backward in the axial direction with respect to the second cylinder 70 . a third groove portion 82 is formed in an inner wall surface of the external cylinder 80 . the second cylinder 70 is disposed in the external cylinder 80 , and the fourth protrusion 71 of the second cylinder 70 is screwed to the third groove portion 82 , so that the external cylinder 80 rotatably supports the second cylinder 70 . because the fourth protrusion 71 is guided by the third groove portion 82 of the external cylinder 80 , rotation of the second cylinder 70 causes the second cylinder 70 to move in the axial direction . a gear 75 that extends in the circumferential direction is installed on an exterior wall surface of the second cylinder 70 . the driving portion 5 of fig1 is connected to the gear 75 , and thus a driving force generated by the driving portion 5 is transferred to the gear 75 , and the second cylinder 70 rotates with respect to the external cylinder 80 . the base 90 is coupled to an end portion of the external cylinder 80 . an optical device 91 that converts image light transmitted through the first lens group 10 and the second lens group 40 into an electrical signal is disposed in the base 90 . the optical device 91 is disposed at a position corresponding to the first lens group 10 and the second lens group 40 . a third lens group 100 is disposed between the optical device 91 and the second lens group 40 . the third lens group 100 can move in the axial direction so as to realize a focusing function . the third lens group 100 is supported by a third zoom ring 110 . the focus driving unit 7 is coupled to the third zoom ring 110 . the third zoom ring 110 can move in the axial direction by a driving force generated by the focus driving unit 7 , and thus a position of the third lens group 100 in the axial direction can be adjusted . the second guide slot 32 comprises a sustaining portion 32 a that extends in the circumferential direction parallel to a boundary 38 of one end of the guide ring 30 , and a changing portion 32 b that is inclined from an end portion of the sustaining portion 32 a to a boundary 39 of another end of the guide ring 30 and extends in the circumferential direction . the sustaining portion 32 a performs a function of sustaining a position of the first cylinder 60 in the axial direction with respect to the guide ring 30 during an initial predetermined section in which the second cylinder 70 starts rotating . the changing portion 32 b performs a function of changing the position of the first cylinder 60 in the axial direction with respect to the guide ring 30 . the second zoom ring guide groove 62 formed in the inner wall surface of the first cylinder 60 comprises a rectilinear portion 62 a that rectilinearly extends in the axial direction from a boundary 68 of one end of the first cylinder 60 toward a boundary 69 of another end thereof , a backward inclination portion 62 b that is inclined from an end portion of the rectilinear portion 62 a toward the boundary 68 of the one end of the first cylinder 60 and extends in the circumferential direction , and a forward inclination portion 62 c that is inclined from the backward inclination portion 62 b toward the boundary 69 of the other end of the first cylinder 60 and extends in the circumferential direction . the rectilinear portion 62 a performs a function of moving the second zoom ring 50 forward in the axial direction with respect to the first cylinder 60 . the backward inclination portion 62 b performs a function of moving the second zoom ring 50 backward in the axial direction with respect to the first cylinder 60 . the forward inclination portion 62 c performs a function of moving the second zoom ring 50 forward in the axial direction with respect to the first cylinder 60 . fig4 is a cross - sectional view of the zoom lens barrel assembly of fig1 , according to an embodiment of the invention . fig5 is a cross - sectional view of the zoom lens barrel assembly of fig4 that is adjusted at a wide - angle lens and performs zooming , according to an embodiment of the invention . fig6 is a cross - sectional view of the zoom lens barrel assembly of fig4 that is adjusted at a telephoto - angle lens and performs zooming , according to an embodiment of the invention . when the zoom lens barrel assembly is accommodated in a camera or other optical device , all of the second cylinder 70 , the first cylinder 60 , and the first zoom ring 20 are accommodated in the external cylinder 80 . the zoom lens barrel assembly adopts a 2 - step barrel structure in which the second cylinder 70 and the first zoom ring 20 protrude in the axial direction with respect to the external cylinder 80 , and thus having a small thickness or short length when the zoom lens barrel assembly is accommodated in an optical device such as a camera , while implementing a high - magnification zooming function . if the driving portion 5 operates and generates a driving force , the second cylinder 70 rotates with respect to the external cylinder 80 . the rotational force of the second cylinder 70 is transferred to the first protrusion 21 of the first zoom ring 20 screwed to the first groove portion 72 and to the second protrusion 61 of the first cylinder 60 screwed to the second groove portion 73 . the guide ring 30 does not rotate with respect to the external cylinder 80 and rectilinearly moves in the axial direction , together with the second cylinder 70 , when the second cylinder 70 rotates with respect to the external cylinder 80 . therefore , the first zoom ring 20 can rectilinearly move in the axial direction according to the first protrusion 21 passing through the first guide slot 31 of the guide ring 30 . the first cylinder 60 can rotate with respect to the guide ring 30 and move in the axial direction according to the second protrusion 61 passing through the second guide slot 32 of the guide ring 30 . relative positions of the first lens group 10 and the second lens group 40 are changed owing to the rotation of the second cylinder 70 , and thus the zoom lens barrel assembly can be adjusted at a wide - angle lens as shown in fig5 or at a telephoto - angle lens as shown in fig6 . the embodiments described herein may comprise a memory for storing program data , a processor for executing the program data , a permanent storage such as a disk drive , a communications port for handling communications with external devices , and user interface devices , including a display , keys , etc . when software modules are involved , these software modules may be stored as program instructions or computer - readable codes , which are executable by the processor , on a non - transitory or tangible computer - readable media such as read - only memory ( rom ), random - access memory ( ram ), a compact disc ( cd ), a digital versatile disc ( dvd ), magnetic tapes , floppy disks , optical data storage devices , an electronic storage media ( e . g ., an integrated circuit ( ic ), an electronically erasable programmable read - only memory ( eeprom ), and / or a flash memory ), a quantum storage device , a cache , and / or any other storage media in which information may be stored for any duration ( e . g ., for extended time periods , permanently , brief instances , for temporarily buffering , and / or for caching of the information ). the computer - readable recording medium can also be distributed over network - coupled computer systems ( e . g ., a network - attached storage device , a server - based storage device , and / or a shared network storage device ) so that the computer - readable code may be stored and executed in a distributed fashion . this media can be read by the computer , stored in the memory , and executed by the processor . as used herein , a computer - readable storage medium excludes any computer - readable media on which signals may be propagated . however , a computer - readable storage medium may include internal signal traces and / or internal signal paths carrying electrical signals therein any references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . for the purposes of promoting an understanding of the principles of the invention , reference has been made to the embodiments illustrated in the drawings , and specific language has been used to describe these embodiments . however , no limitation of the scope of the invention is intended by this specific language , and the invention should be construed to encompass all embodiments that would normally occur to one of ordinary skill in the art . the invention may be described in terms of functional block components and various processing steps . such functional blocks may be realized by any number of hardware and / or software components configured to perform the specified functions . for example , the invention may employ various integrated circuit components , e . g ., memory elements , processing elements , logic elements , look - up tables , and the like , which may carry out a variety of functions under the control of one or more microprocessors or other control devices . similarly , where the elements of the invention are implemented using software programming or software elements the invention may be implemented with any programming or scripting language such as c , c ++, java , assembler , or the like , with the various algorithms being implemented with any combination of data structures , objects , processes , routines or other programming elements . functional aspects may be implemented in algorithms that execute on one or more processors . furthermore , the invention could employ any number of conventional techniques for electronics configuration , signal processing and / or control , data processing and the like . the words “ mechanism ” and “ element ” are used broadly and are not limited to mechanical or physical embodiments , but can include software routines in conjunction with processors , etc . the particular implementations shown and described herein are illustrative examples of the invention and are not intended to otherwise limit the scope of the invention in any way . for the sake of brevity , conventional electronics , control systems , software development and other functional aspects of the systems ( and components of the individual operating components of the systems ) may not be described in detail . furthermore , the connecting lines , or connectors shown in the various presented are intended to represent exemplary functional relationships and / or physical or logical couplings between the various elements . it should be noted that many alternative or additional functional relationships , physical connections or logical connections may be present in a practical device . moreover , no item or component is essential to the practice of the invention unless the element is specifically described as “ essential ” or “ critical ”. the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural . furthermore , recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . finally , the steps of all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ” or “ for example ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . numerous modifications and adaptations will be readily apparent to those skilled in this art without departing from the spirit and scope of the invention . according to the embodiments of the invention , 5 - magnification optical zooming can be implemented using a 2 - step zoom lens barrel assembly that unfolds a first zoom ring and a second cylinder in 2 steps , and thus the 2 - step zoom lens barrel assembly has a reduced number of parts . further , the number of relatively moving barrels is reduced , and thus a zoom lens barrel assembly having a small thickness or short length is realized when the zoom lens barrel assembly is accommodated in an optical device such as a camera . while the invention has been particularly shown and described with reference to exemplary embodiments thereof , it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the following claims . | 6 |
fig1 is a computerized operational interface diagram of the automatic synthesizer apparatus of the present invention for producing radiopharmaceutical tumor imaging agent gallium - 68 - dotatate . the system started with initiating program in computer for the selection of connection port between the computer and the apparatus of the present invention , and followed by pressing the connection button on the operational panel of the apparatus . when the operation process completed , the program is ended and a record file output . txt will be generated by the system for recording values of time , humidity and sensors , which can be initiated for output to work for the system . fig2 is a schematic diagram of the automatic synthesizer apparatus of the present invention for producing radiopharmaceutical tumor imaging agent gallium - 68 - dotatate . in the fig2 , r 1 - r 4 denote reagent vials , of which the first reagent vial r 1 filled with 0 . 6m or 0 . 1m hydrochloride 4 ml with gallium - 68 nuclides ; the second reagent vial r 2 filled with sodium acetate 2 . 5m 1 . 5 ml , the third reagent vial r 3 filled with a dotatate solution 50 μl or deionized water ( di water ) 8 ml alternatively ; the fourth reagent vial r 4 filled with absolute ethanol 1 . 1 ml ; v 1 - v 5 denote collection vials , and v 6 denotes a reserve collection vial , of which the first collection vial v 1 contains solution of hydrochloride , acetate sodium and dotatate with gallium - 68 nuclide obtained through reaction in the gallium - 68 - dotatate reactor g 1 and purification in the c - 18 reversed chromatography column ( c - 18 rpc ) c 1 ; the second collection vial v 2 contains di water eluent through the gallium - 68 - dotatate reactor g 1 and the c - 18 reversed chromatography column c 1 ; the third collection vial v 3 contains di water eluent directly through the c - 18 reversed chromatography column c 1 ; the fourth collection vial v 4 contains absolute ethanol eluent ; and the fifth collection vial v 5 contains solution of gallium - 68 - dotatate dissolved in absolute ethanol . in the fig2 , a 1 - a 8 denote solenoid valves for process control , of which the first solenoid valve a 1 controls flow of the gallium - 68 radioactive solution in the first reagent vial r 1 in or out of the vial , if the impurity is high or the gallium - 68 radioactive solution is in excess , the first solenoid valve a 1 will let the solution flow to waste vial w 1 ; the second solenoid valve a 2 controls flow of the di water into the ga - 68 - dotatate reactor g 1 and the c - 18 reversed phase chromatography column c 1 the third solenoid valve a 3 controls flow of the absolute ethanol into the ga - 68 - dotatate reactor g 1 and the c - 18 reversed phase chromatography column c 1 , the fourth solenoid valve a 4 controls flow of hydrochloric acid , sodium acetate and dotatate with gallium - 68 nuclide after being mixed and heated in the ga - 68 - dotatate reactor g 1 and passing through c - 18 reversed phase chromatography column c 1 before being collected in the first collection vial v 1 , and controls flow of the di water eluent into the second collection vial v 2 ; the fifth solenoid valve a 5 control flow of the di water eluent into the third collection vial v 3 ; the sixth solenoid valve a 6 controls flow of solution after passing through c - 18 reversed phase chromatography column c 1 to the fifth solenoid valve a 5 or the seventh solenoid valve a 7 ; the seventh solenoid valve a 7 controls flow of the absolute ethanol eluent into the fourth collection vial v 4 and through the eighth solenoid valve a 8 into the fifth collect vials v 5 ; the eighth a 8 solenoid valve controls flow of absolute ethanol eluent to the fifth collect vials v 5 or into the reserve vial v 6 ; the details of the operation process will be described in the fig3 . by use of the software program , the process control of the present invention only needs to press “ connect ” button or “ disconnect ” button , simplifying the process control and solving problems encountered with bulk software programs in the conventional equipment . in the fig3 , the logic diagram of the automatic synthesizer apparatus of the present invention is described in four stages , excluding the portion of prior art within the dotted area . ( 1 ) from first reagent vial r 1 : with the first micro pump p 1 , the ga - 68 containing 0 . 6m or 0 . 1m hydrochloride eluent 4 ml is used for washing tin dioxide or titanium dioxide contained in the generator g 0 , and conveying the product thus obtained into the ga - 68 - dotatate reactor g 1 , and the redundant hydrochloride will be fed into the waste vial w 1 . ( 2 ) from second reagent vial r 2 : with the second micro pump p 2 , pumping 2 . 5m sodium acetate 1 . 5 ml into ga - 68 - dotatate reactor g 1 , heating up to 95 degree c ., and , after two minutes , conveying into c - 18 reversed phase chromatography column c 1 for purification and being collected in collection vial v 1 . ( 3 ) from third reagent vial r 3 : with the third pump p 3 , conveying di water 2 ml from the third reagent vial r 3 through ga - 68 - dotatate reactor g 1 and c - 18 reversed phase chromatography column c 1 into the collection vial v 2 , and the other 6 ml di water being fed directly into c - 18 reversed phase chromatography column c 1 and then collected in the collection vial v 3 . ( 4 ) from fourth reagent vial r 4 : with the fourth pump p 4 , pumping the 0 . 6 ml absolute ethanol into ga - 68 - dotatate reactor g 1 , and through c - 18 reversed phase chromatography column c 1 for purification , then collected in the fourth collection vial v 4 , and the other 0 . 5 ml absolute ethanol fed through c - 18 reversed phase chromatography column c 1 , then the purified ga - 68 - dotatate collected in the fifth collection vial v 5 as final product of the present invention . in the fig4 , the flow diagram of the automatic synthesizer apparatus of the present invention is shown for producing gallium - 68 - dotatate , including steps : step s 1 : adding ga - 68 containing 4 ml hydrochloride into ga - 68 - dotatate reactor , wherein the ga - 68 containing hydrochloride is obtained by use of ga - 68 containing 0 . 6m hydrochloride eluent washing in ga - 68 tin dioxide generator or 0 . 1m hydrochloride eluent washing in ga - 68 titanium dioxide and the radioactivity of ga - 68 to be determined less than 630 mbq , the high impurity or redundant ga - 68 radioactive liquid will be fed into waste vial w 1 . step s 2 : adding 2 . 5 m sodium acetate 1 . 5 ml as ph buffer . step s 3 : adding 50 μl of the mixture of dotatate and di water in a ratio of 1 mg / ml into ga - 68 - dotatate reactor . step s 4 : heating the mixture of step s 1 through s 3 in the ga - 68 - dotatate reactor at a range of 90 ˜ 95 degree c . about two minutes for radioactive labeling . step s 5 : feeding absolute ethanol 4 ml through c - 18 rpc c 1 first , followed by di water 2 ml through c - 18 rpc c 1 for the pretreatment . step s 6 : feeding the product from s 4 through c - 18 rpc c 1 with speed at 1 ˜ 1 . 5 ml / min and then into the first collection vial v 1 . step s 7 : feeding di water through ga - 68 - dotatate reactor , then c - 18 rpc , and into the second collection vial v 2 . step s 8 : feeding 6 ml di water through c - 18 rpc into the third collection vial v 3 . step s 9 : feeding absolute ethanol through ga - 68 - dotatate reactor g 1 , then c - 18 rpc , and into the fourth collection vial v 4 . step s 10 : feeding absolute ethanol through c - 18 rpc and obtained the product 0 . 5 ml ga - 68 - dotatate in the fifth collection vial v 5 . in the fig5 , the example one of embodiment of the automatic synthesizer apparatus of the present invention is described for producing gallium - 68 - dotatate , including six stages : in stage 1 , including ( 1 ) step 1 : preparation of 0 . 6m ga - 68 containing hydrochloride 4 ml , obtained by use of ga - 68 containing 0 . 6m hydrochloride eluent washing through tin dioxide based ga - 68 generator , and the radioactivity to be determined larger than 630 mbq ; ( 2 ) step 11 : preparation of 50 μl mixture of dotatate and di water in a ratio of 1 mg / ml ; ( 3 ) step 12 : preparation of 2 . 5 m sodium acetate 1 . 5 ml as ph buffer . in stage 2 , including ( 1 ) step 2 : mixing the products obtained from step 1 , 11 , 12 in ga - 68 - dotatate reactor ; ( 2 ) step 21 : heating the mixture product from step 2 at 90 ˜ 95 degree c . about two minutes ; ( 3 ) step 3 : feeding absolute ethanol 4 ml , then di water 2 ml through 3 cc , 500 mg c - 18 rpc for pretreatment , and feeding the product from step 21 through c - 18 rpc into collection vial v 1 ; in stage 3 , including ( 1 ) step 22 : feeding 2 ml of di water through ga - 68 - dotatate reactor following the completion of stage 2 , then through c - 18 rpc , and into the second collection v 2 . in stage 4 , including ( 1 ) step 31 : feeding 6 ml di water through c - 18 rpc following the completion of stage 3 , and into the third collection vial v 3 . in stage 5 , including ( 1 ) step 23 : feeding 0 . 6 ml absolute ethanol through ga - 68 - dotatate reactor following the completion of stage 4 , then c - 18 rpc , and into the fourth collection vial v 4 . in stage 6 , including ( 1 ) step 32 : feeding 0 . 5 ml absolute ethanol through c - 18 rpc after completion of stage 5 , and finally into the fifth collection vial v 5 to obtain the product of 0 . 5 ml ga - 68 - dotatate . fig6 is example two of embodiment of the automatic synthesizer apparatus of the present invention for producing gallium - 68 - dotatate , including 6 stages : in the stage 1 , including ( 1 ) step 1 : preparation of 0 . 1m ga - 68 containing 4 ml hydrochloride , obtained by use of 0 . 1m ga - 68 containing hydrochloride eluent washing through titanium dioxide based ga - 68 generator , and the radioactivity to be measured at value larger than 630 mbq ; ( 2 ) step 11 : preparation of 50 μl mixture of 50 μg dotatate and di water in a ratio of 1 mg / ml ; ( 3 ) step 12 : preparation of 2 . 5 m sodium acetate 0 . 3 ml as ph buffer . in stage 2 , including ( 1 ) step 2 : mixing the products obtained in step 1 , 11 , 12 from stage 1 in ga - 68 - dotatate reactor ; ( 2 ) step 21 : heating the mixture product from step 2 at 90 ˜ 95 degree c . about two minutes ; ( 3 ) step 3 : feeding absolute ethanol 4 ml , then di water 2 ml through 3 cc , 500 mg c - 18 rpc for pretreatment , and feeding the product from step 21 through c - 18 rpc into collection vial v 1 ; in stage 3 , including ( 1 ) step 22 : feeding 2 ml di water through ga - 68 - dotatate reactor following the completion of stage 2 , then through c - 18 rpc , and into the second collection v 2 . in stage 4 , including ( 1 ) step 31 : feeding 6 ml di water through c - 18 rpc following the completion of stage 3 , and into the third collection vial v 3 . in stage 5 , including ( 1 ) step 23 : feeding 0 . 6 ml absolute ethanol through ga - 68 - dotatate reactor following the completion of stage 4 , then c - 18 rpc , and into the fourth collection vial v 4 . in stage 6 , including ( 1 ) step 32 : feeding 0 . 5 ml absolute ethanol through c - 18 rpc after completion of stage 5 , and finally into the fifth collection vial v 5 to obtain the product of 0 . 5 ml ga - 68 - dotatate . from the above mentioned description , the automatic synthesizer apparatus of the present invention for producing radiopharmaceutical tumor imaging agent gallium - 68 - dotatate has advantages including improving yield of production , simplifying the process of control , and solving problems encountered with bulk software programs associated with the conventional equipments . the foregoing invention has been described in detail by way of illustration and example for purposes of clarity and understanding . it will be apparent to those of ordinary skill in the art that variations , changes , modifications and alterations may be applied to the compositions and / or methods described herein without departing from the true spirit , concept and scope of the invention . | 1 |
[ 0027 ] fig1 shows a combination lock 10 with a dial matching frame 20 thereon such that the user can clearly identify the combination of the dials for unlocking the lock . as illustrated in the figures , the combination lock 10 includes a lock body 11 and a latch 12 , wherein the lock body 11 further has a locking hole 111 and a plurality of parallel dials 112 provided around the exterior of the lock body 11 . each of the dials 112 can be independently rotated with respect to the lock body 11 and is provided with numerals 113 ( or symbols ) surrounding the surface thereof . when each of the dials 112 is rotated to a preset combination at the predetermined dial matching position , the lock body 11 may be unlocked . otherwise , when one or more numerals 113 of the dials 112 at the matching position do not match with the preset combination , the lock body 11 remains at the locked state . the application of this kind of combination lock 10 is well known to the persons skilled in the art and thus , the detailed description is not provided . the combination lock 10 also includes a latch 12 . according to this invention , the latch 12 may be a u - shaped rigid body or a flexible wire , such as a steel cable . in the preferred embodiments discussed in this invention , the latch 12 includes a steel cable 121 having a desired length with one end thereof connected with the lock body 11 , and the other end of the latch 12 is provided with a locking rod 122 which may be inserted into the locking hole 111 to be locked by the lock body 11 when it is adjusted to the locked state . thus , the lock body 11 and the latch 12 are locked together and form a closed loop . of course , the locking rod 122 may be released from the locking hole 111 when the lock body 11 is at the unlocked state , in addition to the lock body 11 and the latch 12 , the combination lock 10 disclosed in the preferred embodiment of this invention further comprises a dial matching frame 20 which is used to provide the reference position and enhance the identifiability for the user to match the dials 112 . accordingly , the user can clearly identify a set of numerals 113 on the dials 112 through the dial matching frame 20 . generally , the dial matching frame 20 includes a frame body 21 which defines at least one window 22 enclosed by an appropriate perimeter . as illustrated in fig2 and 3 , after the dial matching frame 20 is mounted on the lock body 11 ( to be further described later ), the numerals 113 can be clearly identified by the user through the window 22 . the size of the window 22 can be appropriately designed in view of the dimension of the numerals 113 on the dials 112 , such that under normal viewing angle , the user can only see one set of the numerals 113 on the dials 112 . that is , only the set of numerals 113 adjusted to the matching position can be seen through the window 22 . in the preferred embodiments of this invention , the dial matching frame 20 and the lock body 11 may be separable components , wherein the dial matching frame 20 and the lock body 11 respectively have mating holes 23 and mating blocks 13 of the same number at corresponding locations such that the dial matching frame 20 can be mounted on the lock body 11 by inserting the mating blocks 13 into the mating holes 23 . in actual application , the mating block 13 may further incorporate a resilient head 131 which is deformable upon an external force for passing through the mating hole 23 , so that the dial matching frame 20 can be mounted on the lock body 11 . as shown in fig4 each of the dial matching frame 20 and the lock body 11 may have a fastening hole 14 and 24 , respectively , at a corresponding location , and a fastening member 30 is further provided to pass through the two fastening holes 14 and 24 so as to fasten the dial matching frame 20 on the lock body 11 . [ 0033 ] fig5 a and 5b show the dial matching frames 20 a and 20 b with different structures as compared with that disclosed in fig3 . as shown in fig5 a , the dial matching frame 20 a has small windows 22 a on its surface in the same number with that of the dials 112 . each of the small windows 22 a is designed according to the type and size of the numerals 113 , and may also be designed into various shapes to present unique and novel visual effects . in fig5 a , the small windows 22 a are round , and of course may be other geometrical shapes or specially designed shapes . further , as illustrated in fig5 b , instead of the enclosed circular shape shown in fig5 a , the small windows of the dial matching frame 20 b may be in the form of a semicircular opening 22 b . although the dial matching frame 20 b with the opening 22 b may not completely encircle the numerals 113 , the numerals 113 of the dials 112 at the dial matching position can still be clearly identified in such a design . in view of the above , it is understood that the dial matching frame 20 , 20 a or 20 b is a dial displayer provided on the combination lock 10 so as to facilitate the user to match the combination of the lock 10 . the dial matching frame 20 , 20 a or 20 b should have at least one displaying window 22 , 22 a or opening 22 b . the dial matching frame 20 may further include a lens 40 inserted thereinto , as shown in fig6 . particular , the lens 40 may be a convex lens to magnify the numerals 113 through the window 22 . moreover , the dial matching frame 20 may be made of a fluorescent material such that the combination lock 10 can still be used in a dark environment since the display of the numerals 113 are enhanced by the light emitting from the dial matching frame 20 . [ 0035 ] fig7 shows another type structure of the dial matching frame 20 . as illustrated in the drawing , the dial matching identification mechanism may be a resilient member 50 with restorability after stretching . in addition , the lock body 11 has two positioning parts 15 at the predetermined dial matching positions on both sides of the dials 112 , respectively . the resilient member 50 is stretched and wrapped around the positioning parts 15 . the resilient member 50 thus forms a frame body surrounding the dial matching position and defines a window 51 to provide the indication function . in order to have stable attachment so that the resilient member 50 will not be easily or unexpectedly separated from the positioning parts 15 , the resilient member 50 should have shorter length than the distance between the two positioning parts 15 . therefore , the resilient member 50 must be properly stretched prior to being wrapped around the positioning parts 15 and thus , the resilient member 50 is constantly under the recovering force and is stably engaged with the positioning parts 15 . furthermore , the positioning parts 15 may comprise recessed grooves 151 so that the resilient member 50 can be inserted thereinto and will not be separated very easily . accordingly , not only the dial matching frame 20 made of hard material can provide the user with dial matching function for the combination lock 10 , the resilient member 50 with restorability after stretching may also be used to achieve the identical function . [ 0037 ] fig8 discloses another preferred embodiment of this invention . the latch 12 has an integrally formed dial matching frame 20 c . the latch 12 also includes the steel cable 121 with one end thereof connected with the lock body 11 . the other end of the latch 12 is provided with the locking rod 122 which may be inserted into the locking hole 111 to be locked by the lock body 11 when it is adjusted to the locked state . at this time , the latch 12 is fixed with the lock body 11 . the locking rod 122 may be released from the locking hole 111 when it is at the unlocked state . alternatively , the dial matching frame 20 c may be integrally formed with the lock body 11 . in either way , the window 22 c of the dial matching frame 20 c is set to be at the dial matching position above the dials 112 when the locking rod 122 is inserted into and locked within the locking hole 111 , as shown in fig9 . the dial matching frame 20 c may be constructed as that shown in the figure as an annular framework surrounding the latch 12 . the dial matching frame 20 c has not only an engraved window 22 c , but also dialing holes 25 c for the user to rotate the dials 112 . this kind of dial matching frame 20 c provides the function of identifying the matching position of the dials for the user through the window 22 c , it also provides certain degree of protection over the latch 12 to prevent damage thereto due to collision between the latch 12 and other articles . [ 0040 ] fig1 illustrates another type of preferred embodiment for a dial matching frame 20 d according to this invention . the overall dial matching frame 20 d is not solely extended from the lock body 11 or the latch 12 , but combined by two half frames 201 d , 202 d extending from the lock body 11 and the latch 12 respectively . thus , when the locking rod 122 is inserted into the locking hole 111 , the two half frames 201 d and 202 d match with each other above and is placed across all the dials 112 at the predetermined dial matching position and form at least one window 203 d above the dials 112 in order to show the numerals 113 thereon . in other words , the dial matching frame 20 d is formed by two concave plates extending toward each other from the lock body 11 and the latch 12 respectively . it is not integrally formed in one piece . [ 0042 ] fig1 discloses a modified structure based on the previous preferred embodiment . the dial matching frame 20 e is formed by two straight plates 204 e and 205 e extending from the lock body 11 and the latch 12 respectively and misaligned with each other . it should be pointed out that , the lens inserted into the dial matching frame as shown in fig6 and the use of a fluorescent material to make the dial matching frame , may also be applied to the dial matching frames 20 c , 20 d as shown in fig8 and 10 so as to enhance the displaying effects of the combination numerals . this invention provides a dial matching frame to be utilized on a combination lock . it is a dial matching indication device that clearly marks the reference position for matching the dials . therefore , the user may quickly and accurately identify the combination of a series of numerals ( or symbols ) of the dials through the dial matching indication device for unlocking the combination lock . in addition , the dial matching identification function provided by the device of this invention will not be easily deteriorated by the usage of the lock . this invention is related to a novel creation that makes a breakthrough in the art . aforementioned explanations , however , are directed to the description of preferred embodiments according to this invention . since this invention is not limited to the specific details described in connection with the preferred embodiments , changes and implementations to certain features of the preferred embodiments without altering the overall basic function of the invention are contemplated within the scope of the appended claims . | 8 |
the present invention comprises a medical device in combination with a thermoplastic fluoropolymer , which is preferably an amorphous fluoropolymer . the fluoropolymer may optionally contain various additives . the thermoplastic fluoropolymer is a copolymer of tetrafluoroethylene ( tfe ) and perfluoroalkylvinylether ( pave ) that is free of cross - linking monomers and curing agents . the perfluoroakylvinylether may be perfluoromethylvinylether ( pmve ), perfluoroethylvinylether ( peve ) or perfluoropropylvinylether ( ppve ). the desirable mechanical characteristics , particularly tensile strength and toughness , are surprising given the absence of cross - linking monomers , curing agents , and process aids and fillers that would otherwise render such materials inadequately biocompatible . the copolymer of tfe and pmve is generally preferred , and may be made by emulsion polymerization techniques . the pmve content ranges from 40 to 80 % by weight , while the complemental tfe content ranges from 60 to 20 % by weight . these materials have a secant modulus at 100 % elongation of between 1 and 7 mpa ( per astm d412 - 98 , using ½ scale type iv dogbone with 250 mm / minute crosshead speed and 40 mm grip separation ). the material has a durometer in the range of 50 - 90 shore a . durometer measurements are made at room temperature ( about 23 ° c .) by the method of astm d2240 - 91 using a shore durometer type o with a shore model cv - 71200 conveloader ( shore instrument co ., freeport , n . y .). the durometer uses a hemispherical indenter of 1 . 2 mm radius . samples tested by this method should be at least 6 mm thick ; two or more samples may be stacked if necessary to achieve the minimum 6 mm thickness . five durometer readings should be taken at five different points on each sample ; these five readings are then averaged with the resulting mean value taken as the representative hardness value of the sample . thickness measurements are the average of three or more measurements with a set of measuring calipers . where n , the number of carbon atoms in the side chain , equals 1 to 3 . for n = 1 , the pave is pmve ; for n = 2 the pave is peve and for n = 3 the pave is ppve . copolymers of tfe / pave can be analyzed for copolymer composition with various characterization techniques known to those of skill in the art , including both nuclear magnetic resonance ( nmr ) spectroscopy and fourier transform infrared ( ftir ) spectroscopy , with nmr as the primary method , complemented and confirmed by ftir . various tfe / pave copolymer samples were analyzed by dsc using instruments such as a perkin elmer dsc7 equipped with pyris for windows ® software version 3 . 72 . when scanned as described previously , it was determined that the materials were amorphous . fig1 a is a transverse cross section of an elongate article 14 of round cross section such as a metal wire ( for example , as from a self - expanding stent or an electrical conductor ), or a polymeric suture , provided with a coating 12 of the present invention . coating 12 covers the entire surface of the article 14 to create a coated article 10 which may be of any shape . article 14 may be of any material other than the tfe / pave material of the coating . typical metallic materials for article 14 may be metals such as stainless steels , nitinol alloys , platinum , gold , silver , etc . alternatively , polymeric materials useful as article 14 include ptfe or eptfe , polyethylene terephthalate ( pet ), polydimethylsiloxane ( silicone ), polyurethane ( pu ), or various other polymers known for use as medical devices . while the figure indicates that the entire outer surface of article 14 is provided with coating 12 , it is apparent that only selected portions of the surface of article 14 may be covered as desired . as coating 12 covers the entire surface ( i . e ., all surfaces ) of article 14 , it is referred to as a continuous coating , that is , an uninterrupted coating that fully covers the article 14 . partial coatings that are interrupted in any of a variety of possible ways ( e . g ., covering some surfaces while other surfaces remain uncovered , or dot - matrix pattern coatings , etc .) are considered to be discontinuous coatings . coatings may be in single or multiple layers . any layer can contain one or more additives such as therapeutic agents . any of the layers may be provided in porous ( e . g ., containing void spaces ) forms or non - porous forms . fig1 b is a transverse cross section of an article 16 of rectangular cross section such as a stent element from a laser - cut balloon expandable stent , provided with a coating 12 of the present invention . again , the article 16 may be made from a variety of materials and the coating 12 may be full or partial . fig1 c is a transverse cross section of the same article 16 shown by fig1 b except that a partial coating 12 of the present invention is provided , on only one surface of the article . fig1 d is a transverse cross section of the same article 16 shown by fig1 b except that first coating layer 12 a of the present invention is used that is provided with an additive , and then a second layer 12 b of the coating material is provided as a capping layer which does not contain an additive . fig1 e is a transverse cross section of the same article 16 shown by fig1 b except that two opposing sides of the article are provided with differently - filled coating layers 12 c and 12 d . fig1 f is a transverse cross section of the same article 16 shown by fig1 b except that one surface of the article is provided with a first continuous layer of the inventive coating 12 a containing a first additive , and a second discontinuous layer 12 e of the coating material is provided containing a second additive different from the first additive . it is apparent that discontinuous layer 12 e may be applied in any desired pattern , to any or all surfaces , etc . so that any desired pattern that is less than fully covering ( i . e ., continuous ) may be produced . fig1 g is a transverse cross section of the same article 16 shown by fig1 b except that a discontinuous layer 12 e of the coating material is provided on both surfaces of the article 16 , leaving portions of the article surface exposed between the discontinuous segments of the coating . fig1 h is a transverse cross section of the same article 16 shown by fig1 b except that the article is provided with pockets 18 that are filled with a first coating 12 e containing an additive with a continuous second layer 12 b of the material being used as a cap over the first layer contained by the pockets in the article . fig1 j is a cross section of multiple metallic stent elements of the present invention provided with a continuous coating that fully covers the stent elements and spans the interstices between the stent elements . fig2 a is a perspective view of a laser - cut balloon expandable stent , intended as representative of stents generally . stent 22 is provided with a coating of the thermoplastic fluoropolymer . as stated previously , the coating may be continuous or discontinuous , and may be provided with a variety of additives . the stent 22 is made from a suitable material such as any of various polymers or various metals including stainless steels or nitinols . while the stent shown is a balloon expandable stent , it is apparent that other types of stents including self - expanding stents may be coated as well . stent 22 is provided with a series of apices 24 that are plastically deformable during diametrical expansion of the stent . fig2 b is an enlarged top view of a flattened section 22 a of the stent 22 of fig2 a prior to deployment . apices 24 have a relatively small radius prior to expansion . fig2 c is an enlarged top view of the flattened section 22 a of fig2 b following deployment involving expansion of stent elements . the previous relatively small radius of apices 24 is now increased due to plastic deformation resulting from stress applied during expansion . this deformation of stent apices 24 is problematic for many prior stent coatings in that they often crack or otherwise disrupt , with the result that the intended elution rate of any therapeutic agent contained in the coating can be significantly compromised . macroscopic cracking of the coating may be ascertained by expanding an endoluminal device under ambient conditions in an amount of 50 percent ( measured as change in the outside diameter of the device ) in accordance with the instructions for use for the particular device ( if applicable ), followed immediately by visual examination ( aided if necessary by 10 × magnification ). the coating is typically unaffected by such a normal stent expansion , even when the coating is provided with a high additive content . a device that is substantially free of such macroscopic cracks will have at most only a few minor cracks . the capability of the coating of the present invention to be unaffected by deformation of stent components resulting from typical expansion ( generally in the form of bending ) can be demonstrated by providing a coating onto the surface of a wire . the coating should be applied in a desired amount , loaded with the desired additive in the desired amount . a straight length of wire having a round cross section of about 0 . 5 mm diameter should be used , with the wire being made of the same metal as a desired stent . after the coating has adequately dried , the wire is subjected to any sterilization procedure intended for the similarly coated stent . following sterilization , the wire is bent at least 90 degrees at about the middle of its length , to a bend radius of 1 . 5 mm ( i . e ., to a bend radius of three times the wire diameter ). the radius is measured to the inner meridian of the bent wire so that the wire can be bent around a form having a radius of 1 . 5 mm . with the present invention , typically no cracking or other similar disruption of the coating will occur . fig3 a describes a stent - graft 32 of the present invention wherein stent 22 is provided with a graft covering 34 . the graft covering may be provided over the inner surface of the stent as described by fig3 a , or over the outer surface of the stent , or both the outer and inner surfaces of the stent . stent 22 may be any type of stent , including balloon expandable or self - expanding . the stent 22 described by fig3 a is intended only to be representative of stent forms generally and as such is not intended as limiting . the graft material may be made from a variety of materials including any known graft materials , for example , polyethylene terephthalate , silicone , polyurethane or eptfe . stent - graft 32 is beneficially provided with a coating of the present invention that may optionally contain any of a variety of additives as described previously . a stent - graft such as described by fig3 a may be provided with a continuous coating of the coating material , wherein the tfe / pave coating covers the stent elements and the graft covering material . the entire graft covering may be coated including inner and outer surfaces . if the graft covering extends over only the inner or the outer surface of the stent ( or any portion of those surfaces ), the remaining surfaces of the stent that are not covered by the graft material may also be provided , or alternatively not provided , with the coating . likewise , if desired , only the exposed portions of the stent 22 may be provided with the coating , leaving the graft material uncoated . because the coating adheres tenaciously to many types of surfaces , the coating may , for many inventive combinations of stent and graft materials , optionally be used as an adhesive to attach stent surfaces to the portions of the graft surfaces . alternatively , as shown by fig3 b , the stent - graft may be provided with a discontinuous coating 12 e according to the present invention . this discontinuous coating can take a variety of forms as suggested by fig3 b . as shown , a dot - matrix coating 12 e is applied over portions of the outer surface of the graft material covering the stent . as noted previously , the dot - matrix coating may be provided with any of various additives in desired amounts . different dots within the dot - matrix pattern may be provided with different therapeutic agents if desired . it is also apparent that different coatings may be used on different surfaces of a stent - graft . for example , a coating containing a first therapeutic agent may be provided to the luminal surface while another coating containing a second therapeutic agent different from the first may be applied to the exterior surface . fig4 a describes a tubular vascular graft 42 provided with a coating of the present invention . the coating may be continuous or discontinuous ( including , for example , dot - matrix patterns ) as described previously . additives may be added to the coating as desired for any of a variety of purposes , also as described previously . the vascular graft substrate material may be , for example , any known graft material such as eptfe , pet or pu . as shown by the transverse cross section of fig4 b , the coating 12 may be provided on the luminal surface of the graft substrate 44 . alternatively , as shown by the transverse cross section of fig4 c , the coating 12 may be provided as a middle layer between inner and outer layers of vascular graft substrate 44 . in another alternative , the coating may be provided on the abluminal surface of the graft . if a porous vascular graft substrate is used , the coating may be impregnated into a portion or the entirety of the void space within the porous substrate . in another embodiment , the perspective view of fig4 d shows an eptfe vascular graft substrate 44 provided with a helical wrap 46 of eptfe film that has been provided as a narrow tape . eptfe films are made generally as taught by u . s . pat . nos . 3 , 953 , 566 and 4 , 187 , 390 to gore . the void space of the eptfe film 46 may be impregnated with the coating described , or alternatively , the graft or the helically wrapped film may be coated as desired on any surface with the coating . in another alternative , because the coating may be provided in the form of a film , the helical wrap 46 may be in the form of the coating material . in still another embodiment , the entire tubular vascular graft may be made from the coating material . such a vascular graft may be provided with a variety of additives as noted previously . such a graft may be formed with external mechanical support , such as molded in ridges , rings or struts . it is thus apparent that the coating may be applied in thicknesses as desired , to enhance the mechanical integrity or to provide other improved mechanical behavior to various medical devices in various ways . coatings such as these may also incorporate additives . fig5 is a longitudinal , partial cross - section of a catheter guidewire device 52 or alternatively a helically wound electrical conductor 52 provided with a coating 12 . coating 12 may be provided continuously as shown or alternatively in a discontinuous form if desired ; likewise the coating may be provided with one or more additives if desired . the coating 12 may also be provided as a helical wrap of a tape made from the coating material . fig6 a is an isometric view of an implantable cornea prosthesis or keratoprosthesis . keratoprosthesis 60 , preferably having an eptfe peripheral skirts or skirts 63 and 64 , is attached to a fluoropolymer cornea substitute 66 . the skirts have a porosity that can be tailored to promote rapid ingrowth and attachment into surrounding native tissue . fig6 b is a cross - sectional view of an implantable keratoprosthesis 60 , taken along section lines 62 , showing a first eptfe skirt layer 63 , a second eptfe skirt layer 64 and an polymeric cornea substitute layer 66 . the cornea substitute layer 66 can be shaped to conform to surrounding native tissue and have a thickness , flexibility and creep resistance suitable for long term ocular implantation . in addition , the eptfe skirts can be pre - treated with a wetting agent such as poly ( vinyl alcohol ) to promote rapid post implant wetting , which enhances to initial anchoring to surrounding tissue . keratoprosthesis 60 can be produced , for example , by a lamination process in which one or more layers of eptfe 63 , 64 are aligned onto a polymeric corneal layer 66 and compression molded to form a laminate . the material of polymeric corneal layer 66 can also be used to form an implantable lens or other light - transmitting device . additives such as ultraviolet absorbers , pigments or therapeutic agents can also be incorporated into the polymeric layer 66 , or into other optical devices such as lenses or transparent coatings . the following examples are intended to describe various embodiments possible with the scope of the present invention . as such , they are not intended to be limiting with regard to variables such as stent type , choice of pave polymer , coating thickness , surface on which a coating is placed , coated vs . uncoated portions of devices , therapeutic agent contained in one or more layers of the coating , type of therapeutic agent incorporated , etc . a sample of tfe / pmve copolymer was made by emulsion polymerization resulting in average emulsion particle size of 32 nanometers ( particle size estimated using light scattering methods ), exhibiting the following properties : mean tensile strength of 15 . 2 mpa , mean 100 % secant modulus of 2 . 37 mpa , average tensile set of 0 %, and pmve content of about 66 % by weight . this copolymer sample was compression molded to produce a thin film of 0 . 18 mm thickness . approximately 15 micrograms of the thin film in the form of a square sample of about 0 . 2 mm length per side was utilized for determination of the copolymer degradation temperature by themogravimetric analysis . the high - resolution scan covered the temperature range of 0 - 800 ° c . at heating rate of 20 ° c . per minute . test results indicated that material degradation initiated at approximately 400 ° c ., with a weight loss of less than about 0 . 5 % at 400 ° c . in an isothermal sweep , in which temperature was held at 330 ° c . for 1 hr , the same copolymer experienced a total weight loss of less than about 0 . 5 %. the exceedingly low weight loss associated with these severe thermal conditions demonstrates the high thermal stability of this thermoplastic material . a similar procedure can be used to demonstrate the thermal stability of a drug - containing tfe / pmve material . the drug is first eluted from the material , and then the thermogravimetric analysis is performed as described above . thin films of tfe / pmve copolymer described by example 1 , were produced via melt extrusion at temperatures exceeding 200 ° c . a film possessing a thickness of approximately 0 . 2 mm was used to construct a laminate with pockets of chlorhexidine dihydrochloride , an antimicrobial agent . a polypropylene template with 0 . 7 mm diameter holes arranged in a rectangle pattern was made to facilitate manufacturing of the device . the holes were evenly spaced approximately 2 mm apart , from edge to edge . this template was placed on top of one of the tfe / pmve extruded sheets , then dusted with chlorhexidine dihydrochloride . the template was removed , leaving a dot - matrix pattern of the drug on the surface of the extruded film . a second sheet of extruded polymer was gently placed on top of the first sheet . the composite of polymer sheets and drug was wrapped in aluminum foil , placed between two metal plates , heated in an oven set at 115 ° c . for 15 minutes , removed from the oven , immediately pressed between the two hot metal plates for 15 minutes , and then removed from the metal plates and aluminum foil . this process created encapsulated drug pockets between the polymer films . the composite exhibited excellent bond characteristics . the bond strength was so high that all attempts to delaminate the polymer films resulted in destruction of the composite . a cross - sectional view of the composite device 70 is shown in fig7 a . first film layer 72 is provided as a cap over second film layer 74 , with film layer 74 being provided with a dot - matrix pattern 76 of a desired drug . the device 70 is shown as it would appear when punctured with a needle 78 . fig7 b illustrates device function following removal of the puncturing needle , allowing immediate release of drug from dots 76 that are affected by the needle puncture 79 . an approximately 1 cm by 1 cm square of finished material was placed into phosphate buffered saline ( pbs ) at 37 ° c ., periodically sampled for antimicrobial content , and punctured with a 16 - gauge needle . the release of the chlorhexidine dihydrochloride as a function of puncturing the composite and time in solution is shown in fig7 c . it is important to note that chlorhexidine dihydrochloride was continuously released at a minimal level until the composite was punctured with the needle . thus , an additional dose of the drug can be delivered on demand as a consequence of puncturing drug pockets . the copolymer of example 1 was obtained in a 4 wt % solution of fc - 75 . the working drug formulation was a mixture of 2 ml of 4 wt % polymer , 8 ml of fc - 75 , and 150 mg of dexamethasone ( 52 wt % drug based on total weight of coating solids ; dexamethasone obtained from pharmacia & amp ; upjohn , kalamazoo mich .). the formulation was made by weighing dexamethasone into a test tube , adding fc - 75 , vortexing vigorously to complete mixing , adding the polymer , and ensuring complete mixing with additional vortexing . a 10 cm length of gore - tex vascular graft ( part number ut05070l , wl gore & amp ; associates , flagstaff ariz .) was used to demonstrate the drug release coating . the 5 mm inside diameter graft was mounted onto a mandrel for coating . the mandrel was rotated by hand as an airbrush ( badger standard set model 350 airbrush set at 220 kpa gauge air pressure , badger air brush co ., franklin park , ill . ), held at a constant distance of approximately 3 . 8 cm from the graft surface , was moved back and forth across the graft while spraying a coating of the above - described polymer - drug formulation . the vascular graft was continuously spray - coated for approximately 10 minutes , after which time the graft was transferred to an oven set at 60 ° c . for 2 minutes . microscopic examination of cross sections of such a coated graft indicated that the coating penetrated into the void spaces of the microstructure of the porous eptfe vascular graft . physical examination of these coated graft samples indicated that the coating was well adherent . after the drug layer was applied , the vascular graft was divided into two sections , 5 and 4 cm in length . a slight contraction of the graft in the longitudinal direction was noted after the coating was applied , as the total length measured about 9 cm after coating . this contraction was believed to be the result of drying of the relatively heavy coating . the 5 cm section was coated with a capping layer that did not contain any drug . the capping formulation consisted of 2 ml of 4 wt % polymer mixed with 8 ml of fc75 . the solution was sprayed in a similar manner as above in five 30 second spray intervals . spraying intervals were separated by a 15 second interval of not spraying . the 4 cm section was sprayed in eight 30 second intervals , alternating with 15 second intervals of not spraying . the 5 cm long section was taken for determination of total drug loading . loading determinations were performed by placing the sample in 5 ml of ethanol in a glass test tube for 15 hours at 55 ° c . after ethanol extraction , the solution was analyzed for dexamethasone content using a uv spectrophotometer ( dexamethasone wavelength : 244 nanometers ). the loading was determined to be 7 . 5 +/− 1 . 0 mg / cm graft length . it is apparent that there are many different possible applications of the coating polymer , with or without a therapeutic agent , to vascular grafts made of virtually any known graft materials . for example , tfe / pmve not containing any drugs ( e . g ., the capping material ) could also have been spray coated directly onto the vascular graft surface . the coating may be applied between layers of the vascular graft , or may be applied to the luminal surface of a vascular graft . a sample of the same tfe / pmve copolymer of example 1 was prepared . the polymer was dissolved in fc - 75 to obtain a 4 wt % solution . a spray formulation was consisting of a dexamethasone emulsion plus dispersion was investigated first . two ml of this 4 wt % polymer solution was diluted with 8 ml of fc - 75 and mixed in a 15 ml plastic test tube , with periodic vortexing . 12 . 5 mg of dexamethasone as a powder and 200 microliters of a saturated ethanol solution containing dexamethasone ( approximately 15 mg / ml of dexamethasone ) were added to the solution . the system was vortexed for 1 minute to ensure complete mixing . it contained 10 wt % drug based on total weight of coatings solids , with wt % drug content calculated as drug mass /( drug + polymer mass ), multiplied by 100 . the system was then coated onto a straight length of 0 . 51 mm diameter silver - plated copper wire . this wire was intended to serve as a model of a structural element used in various medical devices , such as stents . the wire was spray - coated with the polymer using a badger standard set model 350 airbrush , for 1 minute , at an air pressure of 220 kpa , and placed in an air forced furnace for 5 minutes at 60 ° c . ethanol extraction of such a coated wire segment followed by uv spectrophotometric analysis yielded 6 . 4 micrograms of drug per cm of wire length . after the drug layer was applied , a capping layer that did not contain any drug was sprayed onto the wire . the capping formulation consisted of 2 ml of 4 wt % polymer mixed with 8 ml of fc - 75 . the solution was sprayed in a similar manner as described above . the total coating on the wire was approximately 10 microns thick . a spray formulation consisting of a single emulsion of dexamethasone was also investigated . the working formulation was made by combining 2 ml of the 4 wt % polymer solution with 8 ml of fc - 75 and allowing the system to mix in a 15 ml plastic test tube , with periodic vortexing . 400 microliters of a saturated ethanol solution containing dexamethasone ( approximately 15 mg / ml of dexamethasone ) was added to the copolymer solution . the system was vortexed for 1 minute before coating to ensure complete mixing . the coating on this wire was approximately 5 microns thick . the coating contained 4 . 1 wt % drug based on total weight of coating solids . ethanol extraction of wire segment followed by uv spectrophotometric analysis yielded 17 . 5 micrograms per cm of wire length . a powder coating formulation was also investigated . two ml of the 4 wt % polymer solution was combined with 8 ml of fc - 75 , then mixed in a 15 ml plastic test tube , with periodic vortexing . a polymer base coat was applied to the wire for 2 min . while still wet , the wire was suspended in a blender that had been pulsed briefly to air suspend dexamethasone . a capping layer that did not contain any drug was sprayed on the wire . the capping formulation consisted of 2 ml of 4 wt % polymer mixed with 8 ml of fc - 75 . the solution was sprayed in a similar manner as described above . the coating on this wire was approximately 5 microns thick . no theoretical loading was calculated . ethanol extraction of wire segment followed by uv spectrophotometric analysis yielded 63 . 5 micrograms per cm wire length . samples of the coated wires were taken for sem analysis and the determination of drug release . the graph of fig8 a demonstrates the extended elution times possible with the different emulsion spray formulations , based on three samples made as described above ( open circles depict the emulsion plus dispersion formulation , filled circles depict the single emulsion and filled triangles depict the powder coating formulation ). each of the three types of coating resulted in smooth and uniform surfaces before and after drug release as evidenced by sem analysis . these findings suggest that drug elution occurred on a molecular level . fig8 b is an sem ( about 20 × magnification ) showing the crack - free mechanical integrity of the single emulsion coating of the different emulsion spray formulation process when the coated wire was bent in excess of a 90 degree angle , at a radius of about 1 . 1 mm as measured to the inside meridian of the bent wire . in all of these embodiments , the tfe / pmve coating remained intact after complete elution of the drug . a sample of tfe / pmve copolymer , made from emulsion polymerization resulting in an average emulsion particle size of about 120 nanometers , was prepared having the following properties : mean tensile strength of 26 . 7 mpa , mean 100 % secant modulus of 2 . 7 mpa , mean tensile set of 12 %, and pmve content of about 60 % by weight . neither this tfe / pmve copolymer nor any tfe / pmve copolymer used in any the examples contained any cross - linking monomers or curing agents or system . the copolymer was added to fc - 75 fluorinated solvent , to make a 4 wt % solution . the fc - 75 fluorinated solvent , 3m fluorinert , was obtained from 3m specialty chemicals division , st . paul , minn . 55144 . the working formulation was made by diluting 2 ml of the 4 wt % polymer solution with 8 ml of fc - 75 and allowing the system to mix in a 15 ml plastic test tube , with periodic vortexing . stents made in accordance with the teachings of u . s . pat . no . 5 , 925 , 061 to ogi , et al . were laser cut and polished by laserage technology corp ., waukegan , ill . 60087 . all stents were cut from 316h stainless steel tubing possessing a wall thickness of 0 . 127 mm . the outside diameter of the stents was 1 . 57 mm while the length was 21 mm . each stent was temporarily placed onto a small wire for handling during the coating process . the wire was curved at one end to prevent the stent from slipping off . once secured on the wire , the stent was dipped into the polymer solution , sprayed with compressed air to minimize any bridging of the coating between adjacent stent elements , and placed in an air forced furnace for 5 minutes at 60 ° c . the dipping procedure may be repeated if multiple coatings are desired . for this example the dipping procedure was repeated 4 times . scanning electron photomicrographs of uncoated and coated stents were taken before and after diametrically expanding up to 4 . 5 mm inner diameter with an angioplasty balloon . the expansion ratio was approximately 3 . scanning electron micrographs of the coated stent surfaces after balloon expansion show complete and uniform coverage of the metal surface by the polymer coating , regardless of stent shape or geometry . subsequent to balloon expansion a portion of the stent surface was scraped with a surgical blade to test for coating integrity . this was done by positioning the blade perpendicular to the surface of the stent element , applying a downward force and dragging the blade a short distance . fig9 is a scanning electron photomicrograph ( about 260 × magnification ) of the surface after the scrape test . the coating was only removed from the regions of blade contact . there appeared to be no gross delamination or shrink - back of the coating from the scraped region , indicating good adhesion of the coating . other stents were coated with a polymer solution , which included the copolymer of tfe / pmve described by example 1 . the polymer was dissolved in fc - 75 to obtain 4 wt % solution . the working formulation was made by diluting 2 ml of the 4 wt % polymer solution with 8 ml of fc - 75 and allowing the system to mix in a 15 ml plastic test tube , with periodic vortexing . coated stents were made and tested as described above for example 5 , yielding the same results regarding complete and uniform metal surface coverage and smoothness of the coating surface . no gross delamination of the coating was observed . coated stents made in this manner were steam sterilized ( 134 ° c . at 216 kpa for 12 minutes followed by a 30 minute drying cycle ), balloon expanded to 3 mm diameter , and subjected to sem analysis for determination of coating stability . the scanning electron photomicrographs of fig1 a ( about 100 × magnification ) and fig1 b ( about 200 × magnification ) show that after processing and expansion , the polymer coating was still adherent to irregular shapes , without any evidence of delamination or tearing , demonstrating coating integrity even after steam sterilization and subsequent expansion . a copolymer - drug coating , where the tfe / pmve copolymer is described by example 1 , was applied to balloon expandable stents of the same type as used in example 5 . the amount of dexamethasone was approximately 400 micrograms per stent , applied by single emulsion spray coating as was done previously with the wire coating in example 4 . the stent was balloon expanded to a diameter of 3 . 5 mm prior to initiating drug release studies . sem analysis of the device surface subsequent to balloon expansion evidenced no delamination or separation of the coating from the metal . release studies performed on another of these coated balloon expanded stents demonstrated that the drug was released in a controlled fashion . after completion of release studies , the sample underwent sem analysis . the coating showed no delamination or separation from the metal . the polymer - drug coating thickness was estimated to be approximately 3 microns . a sample of the same tfe / pmve copolymer , made as described for example 1 , was prepared . the polymer was dissolved in fc - 75 to obtain a 4 wt % solution . one hundred and twenty mg of dexamethasone as a powder was weighed into a 15 ml plastic test tube , 6 ml of fc - 75 was added , and the system was mixed vigorously to ensure complete mixing . two grams of the 4 wt % tfe / pmve polymer solution was added and the mixture was vortexed . this formulation is 60 wt % dexamethasone on a total solids basis . the formulation was applied to balloon expandable stents of the same type used in example 5 . these stents were coated with the copolymer - drug solution through a dip coating processes in which the stents were suspended from a thin wire , immersed in the formulation , sprayed with compressed air at 1 . 7 kpa air pressure , and placed in a convection oven set at 60 ° c . briefly for compete drying . one group of stents received 1 dip coating and another group 3 dip coatings . stents from each group were distended with the use of 3 . 5 mm ptfe balloons before and after sterilization with eto at a total cycle time of 15 hours , including an eto sterilization time of 1 . 3 hours at 67 . 7 ° c . stents were examined with the use of a light microscope at magnification of up to 90 ×. microscopic examination of samples before and after expansion with or without eto sterilization showed the coating to be tough , and well adhered , and without evidence of cracking . fig1 a is a light micrograph ( about 15 × magnification ) of a drug / polymer coated stent according to this example that has been subjected to eto sterilization at 67 . 7 ° c ., before expansion . three drug - polymer coat layers were applied to this stent as described above . fig1 b ( about 15 × magnification ) describes the same stent after balloon expansion using a 3 . 5 mm diameter eptfe / elastomer composite balloon ( made generally as taught by example 7 of u . s . pat . no . 6 , 120 , 477 to campbell et al .). it is anticipated that virtually any suitable commercially available catheter balloon of suitable size would provide the same stent expansion results . a sample of tfe / ppve copolymer was obtained , which was synthesized by emulsion polymerization , resulting in average emulsion particle size of 83 nanometers , exhibiting the following properties : mean tensile strength of about 12 . 2 mpa , mean 100 % secant modulus of 4 . 30 mpa , average tensile set of 31 %, and ppve content of about 56 % by weight . the polymer was dissolved in fc - 75 to obtain a 20 wt % solution . the working formulation was made by diluting 2 ml of the 20 wt % polymer solution with 8 ml of fc - 75 and allowing the system to mix in a 15 ml plastic test tube , with periodic vortexing . balloon expandable stents of the same type used in example 5 were utilized . each stent had a small wire temporarily looped through one end for handling during the subsequent dip - coating process . once secured on the wire , the stent was dipped into the polymer solution , sprayed with compressed air , and placed in an air forced furnace for 5 minutes at 60 ° c . the dipping procedure was repeated to bring the total number of layers to 2 . a portion of the tfe / ppve coated stents were then expanded without being eto sterilized using a balloon as described for example 8 , and examined with the use of a light microscope . additional coated stents underwent eto sterilization with a total cycle time of 15 hours , including an eto sterilization time of 1 . 3 hours at 67 . 7 ° c . after sterilization the stents were expanded using a balloon of the type described for example 8 , and examined with a light microscope at magnification of up to 90 ×. microscopic examination of samples before and after expansion with or without eto sterilization showed the coating to be tough , well adherent , and without evidence of cracking . fig1 a is a light micrograph ( about 15 × magnification ) of a tfe / ppve polymer coated stent according to this example that has been subjected to eto sterilization at 67 . 7 ° c . before balloon expansion . fig1 b is a light micrograph ( about 30 × magnification ) of the same stent following balloon expansion using a balloon as described in example 8 . approximately 60 mg of dexamethasone powder was weighed into a 15 ml plastic test tube , 6 ml of fc - 75 was added , and the system was mixed vigorously to ensure complete mixing . two hundred mg of 20 wt % tfe / ppve polymer solution ( made per example 9 ) was added and the mixture was vortexed . this formulation is 60 wt % dexamethasone on a total solids basis . balloon expandable stents of the same type used in example 5 were utilized . each stent had a small wire temporarily looped through one end for handling during the subsequent dip - coating process . once secured on the wire , the stent was dipped into the polymer solution , sprayed with compressed air at 1 . 7 kpa air pressure , and placed in an air forced furnace for 5 minutes at 60 ° c . stents were distended with the use of 3 . 5 mm ptfe balloons before and after sterilization with eto at a total cycle time of 15 hours , including an eto sterilization time of 1 . 3 hours at 67 . 7 ° c . stents were examined with the use of a light microscope at magnification of up to 90 ×. microscopic examination of samples before and after expansion with or without eto sterilization showed the coating to be tough , well adherent , and without evidence of cracking . fig1 a is a light micrograph ( about 15 × magnification ) of a drug - tfe / ppve - polymer coated stent made according to this example and subjected to eto sterilization at 67 . 7 ° c ., before balloon expansion . fig1 b is a light micrograph ( about 30 × magnification ) of the same stent after balloon expansion using a balloon as described in example 8 . self - expanding stent having interstices coated with tfe / pmve to form a stent - graft more of the same tfe / pmve copolymer , made as described by example 1 , was obtained in a 2 wt % solution of fc - 75 . the copolymer was added to a beaker for submersion of devices for coating . a self - expanding stent frame ( 4 cm length , 5 mm inner diameter ) made from 0 . 152 mm diameter nitinol metal wire was also obtained . a thin wire was temporarily attached to one end of the stent as a handle and the stent frame was dipped into the solution , removed , and completely air - dried . the process was repeated until a polymer film coating extended between the nitinol wires , as shown by the finished device of fig1 ( about 10 × magnification ). the film initially contained void spaces , but these voids were filled as more layers were added . this process can be practiced to produce a polymer stent cover that is perforated ( i . e ., containing occasional void spaces or openings through the coating that extends between adjacent wires ) or continuous ( without openings ). balloon - expandable stent having interstices coated with tfe / pmve to form a stent - graft a sample of the same tfe / pmve copolymer , made as described by example 1 , was prepared . the polymer was dissolved in fc - 75 to obtain a 4 wt % solution . the working formulation was made by diluting 2 . 5 ml of the 4 wt % polymer solution with 5 ml of fc - 75 and allowing the system to mix in a 15 ml plastic test tube , with periodic vortexing . balloon expandable stents of the same type used in example 5 were utilized . each stent had a small wire temporarily looped through one end for handling during the subsequent dip - coating process . once secured on the wire , the stent was dipped into the polymer solution , and placed in an air forced furnace for 5 minutes at 60 ° c . the dipping procedure was repeated until the void space between the stent elements is spanned with a continuous solid polymer coating . once completed the stent - grafts were distended using a balloon as described in example 8 , and examined with a light microscope at magnification of up to 90 ×. fig1 a is a light micrograph ( about 30 × magnification ) of a tfe / pmve polymer coated stent - graft according to this example shown before expansion while fig1 b is a light micrograph ( about 30 × magnification ) describing the same stent after balloon expansion using a balloon as described in example 8 . the finished , coated stent - graft has occasional perforations or openings through the graft covering where substantial amounts of deformation of adjacent stent elements occurred during expansion . fig1 b shows one such opening . the more opaque regions of the coating adjacent to some stent elements were determined to be internal void spaces or “ pockets ” in the coating that were formed during stent expansion . they do not represent openings through the coating . while this is believed to be an artifact of the type of balloon - expandable stent used , it remains noteworthy that a large majority of the stent - graft covering was not occupied by these openings . for some applications , a stent - graft with occasional openings may be desirable . the stent - graft shown in this figure was not subjected to eto sterilization . balloon - expandable stent having interstices coated with tfe / pmve to form a stent - graft a sample of the same tfe / pmve copolymer , made as described by example 1 , was prepared . the polymer was dissolved in fc - 75 to obtain a 4 wt % solution . the working formulation was made by diluting 3 ml of the 4 wt % polymer solution with 3 ml of fc - 75 and allowing the system to mix in a 15 ml plastic test tube , with periodic vortexing . stents made as taught by u . s . pat . no . 4 , 733 , 665 to palmaz , of 2 mm compacted diameter , were utilized . each stent had a small wire temporarily looped through the end for handling during the subsequent dip - coating process . once secured on the wire , the stent was dipped into the polymer solution , and then placed in a forced - air furnace set at 60 ° c . for a period of 5 minutes . this procedure was repeated to bring the total number of layers to 7 . a medi - tech 4 mm balloon ( boston scientific , medi - tech , universal product no . m001164180 , natick mass .) was utilized to expand the stent - graft device . some uneven distention of the device was noted and was believed to be related to the stent and not the polymer coating . fig1 a is a light micrograph ( about 30 × magnification ) of this tfe / pmve polymer coated stent - graft before expansion . fig1 b ( about 15 × magnification ) shows the same stent - graft immediately after balloon expansion to 4 mm . the coating fully covers all of the stent interstices between adjacent stent elements , without any openings . the more opaque regions of the coating adjacent to some stent elements were determined to be internal void spaces or “ pockets ” in the coating that were formed during stent expansion . they do not represent openings through the coating . the stent - graft in this figure was not subjected to sterilization . stent - grafts having an eptfe graft covering , coated with tfe / pmve containing dexamethasone more of the same tfe / pmve copolymer of example 1 was obtained in a 2 . 5 wt % solution of fc - 75 . the drug formulation was a mixture of 2 ml of 2 . 5 wt % polymer , 8 ml of fc - 75 , and 120 mg of dexamethasone . this solution was well - mixed by shaking and then sprayed with a badger standard set model 350 airbrush set at 220 kpa gauge air pressure . nitinol wire - based , self - expanding , stents having a length of 4 cm , of the type used in example 11 , were obtained . porous expanded ptfe material was used to cover both the internal and external stent frame surfaces . the inner eptfe layer was constructed using an eptfe tubing of about 25 microns thickness . the outer surface of this inner layer was provided with a thin coating of the tfe / pmve copolymer for subsequent use as a thermally - activated adhesive to join the eptfe and stent layers . the outer eptfe layer was constructed by wrapping a 25 micron thick eptfe tape about the outer stent surface . both of these eptfe materials were of about 25 micron average fibril length . these devices were placed into a convection oven set at 320 ° c . for five minutes to activate the adhesive . after removal from the oven and cooling to room temperature , the resulting 4 cm long stent - grafts were cut into three sections . the scalloped end sections were cut to into 1 . 5 cm lengths and the mid - section was cut into a 1 cm length . each of these sections was mounted onto a mandrel , rotated by hand and spray coated . the airbrush was held approximately 3 . 8 cm from the graft surface . spraying was continuously performed for 30 seconds , after which time the coated stent - graft on the mandrel was transferred to an oven set at 60 ° c . for 2 minutes . this spraying and heating process was repeated for up to 21 times . the devices were processed in three groups of 4 where , within each group , one stent - graft was for loading determination and the remaining 3 for release studies . the first group received 16 coats , the second 21 , and the third 19 coats . loading was periodically measured with the one stent - graft and the coating cycles adjusted to yield devices of comparable drug content . a capping layer was applied with a solution of polymer made from 2 ml of the 2 . 5 wt % in 8 ml of fc - 75 . this was sprayed in a similar manner as was the drug containing formulation . three groups consisting of three different capping layers were created by applying 5 , 10 and 15 capping coats to the appropriate stent - graft group . the capping mass ratios are shown in fig1 . samples were subjected to drug release studies , determination of total drug loading , and sem analysis . for the release study , a sample of 1 . 5 cm length was placed into pbs and maintained at 37 ° c . periodically , the fluid was collected , stored , and replaced with fresh pbs . collected samples were assayed by uv spectrophotometric analysis to measure dexamethasone concentration . fig1 shows the cumulative mass of dexamethasone released as a function of time . loading determinations were performed by placing the sample in 5 ml of ethanol in a glass test tube over night at 60 ° c . after ethanol extraction , the solution was analyzed by a uv spectrophotometer for dexamethasone content . loading values for the 1 . 5 cm long stent - grafts were estimated to be 13 . 3 , 12 . 8 and 15 mg for the respective groups . the capping mass was determined through gross weight change and determined to be 3 . 0 , 6 . 0 , and 8 . 5 mg , respectively . additionally , stainless steel balloon expandable stents ( about 1 . 5 mm unexpanded diameter ) were obtained as described above . the stent was powder - coated with fep . an eptfe tube of about 1 . 4 mm diameter , 80 micron wall thickness and having a microstructure having an average fibril length of about 23 microns was obtained . this eptfe tube was placed over a mandrel , the powder - coated stent placed over the tube , and another eptfe tube of the same type was placed over the stent . the assembly was temporarily wrapped with an eptfe film and placed in an oven set at 320 ° c . for five minutes . the eptfe tubes were thereby bonded to the stent , thereby encapsulating it and forming a stent - graft . after removal from the oven and cooling to room temperature , the temporarily - applied eptfe film was removed . next , three different spray formulations of tfe / pmve copolymer made as described by example 1 were utilized for coating the stent - graft . all formulations used polymer obtained in a 2 . 9 wt % solution of fc - 75 . the first drug formulation was a mixture of 1 ml of 2 . 9 wt % polymer , 5 ml of fc - 75 , and 25 mg of dexamethasone . this solution was well mixed by vortexing and sprayed with a badger standard set model 350 airbrush set at 220 kpa gauge pressure . the stent - graft devices were placed onto mandrels and rotated by hand during the spraying process . the airbrush was held about 3 . 8 cm from the graft surface . in this manner only the abluminal surfaces of the devices were coated . the second drug formulation was 1 ml of 2 . 9 wt % polymer , 5 ml of fc - 75 , 25 mg of dexamethasone , and 500 microliters of ethanol . the system was mixed by sonication for 15 min . and vortexed briefly . the third drug formulation was 1 ml of 2 . 9 wt % polymer , 5 ml of fc - 75 , 100 mg of dexamethasone , and 500 microliters of ethanol . these coated expandable stent - grafts were balloon - expanded to a diameter of 4 . 5 mm and the polymer - drug coating was examined by sem for integrity . the coating remained intact on the abluminal surface of the eptfe after balloon expansion . visual examination indicated that the coating appeared to change dimension with the diametrically expanding eptfe in that it appeared to continue to be well - adhered to the eptfe surface . despite being forcibly distended with a balloon to a diameter three times larger than the compacted diameter , the coating remained well - adhered to the eptfe surface of the stent - grafts . self - expanding stent - grafts of 15 mm length , of the same type as described by examples 11 and 14 , were obtained . polymer was obtained in a 4 wt % solution of fc - 75 . the working drug formulation was a mixture of 6 ml of 4 wt % polymer , 24 ml of fc - 75 , and 450 mg of dexamethasone ( pharmacia & amp ; upjohn , kalamazoo , mich . usa ). the formulation was made by weighing dexamethasone into a test tube , adding fc - 75 , vortexing vigorously to complete mixing , adding the polymer , and ensuring complete mixing with additional vortexing . this solution was sprayed with a badger , standard set model 350 , spray paint gun set at 220 kpa gauge air pressure to coat devices . self - expanding stent - grafts of 15 mm length and 4 , 4 . 5 , and 5 mm diameters , of the type described in example 14 , were utilized . after the stent - grafts were mounted onto a mandrel , the mandrel was rotated by hand as the airbrush was moved back and forth across the stent - grafts . the airbrush was held at a constant distance of approximately 6 cm from the stent - graft surface . the coating was continuously sprayed for approximately 15 minutes , after which time the mandrel was transferred to an oven set at 60 ° c . for 2 minutes . a capping layer was applied with a solution of polymer made from 2 ml of the 4 wt % in 8 ml of fc - 75 . this was sprayed for about 2 . 5 minutes , in a similar manner as the drug containing formulation , to obtain a capping mass of about 1 . 7 mg . several samples at this stage of processing were retained for the determination of drug loading amount . in order to provide the stent - grafts with a porous outer layer that would allow for tissue ingrowth , two layers of helically - wrapped eptfe film were applied to the outer surface of the coated stent grafts . the film - wrapped stent - grafts were then heated to 200 ° c . for 3 minutes to bond layers . ends were trimmed to allow the film to conform to the profile of the stent graft ends . each stent - graft was diametrically compacted to an outer diameter of approximately 2 . 1 mm ; this may be accomplished by various means known to those of skill in the art of self - expanding stents . the stent - grafts were constrained in the compacted state with a constraint wrap of more eptfe film ( not adhered ), and were subjected to eto sterilization with a total cycle time of 15 hours , including an eto sterilization time of 1 . 3 hrs at 54 . 4 ° c . some of the stent - graft devices were mounted onto a 3 mm angioplasty balloon , distended to the point of breaking the eptfe film constraint wrap , and then fully distended with appropriate balloon sizes consistent with stent - graft diameters . the following tests were performed on the stent - grafts : total drug loading measurement , drug release characteristics , balloon deployment , and sem analysis . loading determinations were performed by placing each sample in 5 ml of ethanol in a glass test tube over night at 60 ° c . after ethanol extraction , the solution was analyzed by a uv spectrophotometer for dexamethasone content . for the drug release study , a small drop of alcohol was applied to the abluminal surface of the eptfe stent - graft . the alcohol - wetted samples were immediately placed into pbs and maintained at 37 ° c . periodically , the fluid was collected , stored , and replaced with fresh pbs . collected samples were assayed by uv spectrophotometric analysis to measure dexamethasone concentration . total loading of dexamethasone was determined to be approximately 10 to 14 mg per stent - graft , and the polymer - drug layer was calculated to contain 63 wt % dexamethasone . fig1 shows the cumulative mass of dexamethasone released as a function of time for the control device ( filled triangles ) and test devices ( open and filled circles ). the control device was not compacted , sterilized , nor balloon distended ; the test devices were subjected to all of these steps . the absence of spikes in the curves for the test grafts indicates the absence of cracking of the coating . had the coating cracked , the drug elution curve would have demonstrated discontinuities associated with non - uniform delivery . the two test stent - grafts show remarkable consistency in the release of dexamethasone after having been subjected to the physically challenging thermal and mechanical stresses . furthermore , the test stent - grafts have retained the basic release characteristics of the control device with minimum deviation . from visual inspection of the curves in fig1 , it is evident that the curves are all very similar . from a pharmacokinetic standpoint two systems are generally equivalent if they deliver the same total quantity of drug and at the same rate ( duration of delivery ). the total drug delivered is take at the plateau regions of fig1 , and is determined to be 7 . 66 mg for control , and 6 . 935 mg and 6 . 811 mg for test samples . on a percentage basis the test samples are within 11 % of the control . this is remarkable in that the total drug loading for the devices is 10 mg , but only a consistent fraction of this is released as some remains trapped within the matrix . the test samples that underwent mechanical and thermal stress did not provide a total dose meaningfully different than the control . these results attest to the surprising robustness of the drug delivery matrix under the conditions of high drug loading , severe mechanical and thermal stress , including balloon distention . these findings are even more significant inasmuch as the amount of drug loading was so high that it exceeded typical therapeutic levels . balloon - expandable stent having interstices coated with tfe / ppve to form a stent - graft a sample of tfe / ppve copolymer described by example 9 was prepared . the polymer was dissolved in fc - 75 to obtain a 20 wt % solution . the working formulation was made by diluting 2 ml of the 20 wt % polymer solution with 8 ml of fc - 75 and allowing the system to mix in a 15 ml plastic test tube , with periodic vortexing . balloon expandable stents of the same type used in example 5 were utilized . each stent had a small wire temporarily looped through one end for handling during the subsequent dip - coating process . once secured on the wire , the stent was dipped into the polymer solution , and placed in an air forced furnace for 5 minutes at 60 ° c . the dipping procedure was repeated to bring the total number of layers to 6 . a portion of the stent - grafts were expanded before sterilization with a balloon as described in example 8 , and examined with the use of a light microscope . additional coated stent - grafts underwent eto sterilization with a total cycle time of 15 hours , including an eto sterilization time of 1 . 3 hours at 67 . 7 ° c . after sterilization the stent - graft was distended using a balloon as described in example 8 , and examined with a light microscope at magnification of up to 90 ×. as the occlusive stent - graft expands , openings through the coating are created , the size , location , and morphology of which are related to the metal stent design . the implications of this are that the metal stent design can be utilized to produce a stent - graft having openings through the coating when expanded of predetermined size , and the metal stent design could be made to not facilitate the formation of openings resulting in an occlusive stent - graft post expansion . fig1 a is a light micrograph ( about 15 × magnification ) of the tfe / ppve - polymer coated stent - graft of this example shown before expansion , while fig1 b ( about 20 × magnification ) shows the same stent - graft after balloon expansion using a balloon as described in example 8 . stent - grafts in this figure were eto sterilized as described for previous examples . a sample of the tfe / ppve copolymer described by example 9 was prepared . the polymer was dissolved in fc - 75 to obtain a 20 wt % solution . the working formulation was made by diluting 2 ml of the 20 wt % polymer solution with 8 ml of fc - 75 and allowing the system to mix in a 15 ml plastic test tube , with periodic vortexing . a tfe / pmve copolymer formulation containing the drug dexamethasone was also prepared . the tfe / pmve copolymer was dissolved in fc - 75 to obtain a 4 wt % solution . one hundred and twenty mg of dexamethasone as a powder was weighed into a 15 ml plastic test tube , 6 ml of fc - 75 was added , and the system was mixed vigorously to ensure complete mixing . two grams of the 4 wt % tfe / pmve polymer solution was added and the mixture was vortexed . this formulation is 60 wt % dexamethasone on a total solids basis . balloon expandable stents of the same type used in example 5 were utilized . each stent had a small wire temporarily looped through one end for handling during the subsequent dip - coating process . once secured on the wire , the stent was dipped into the tfe / ppve polymer solution , and placed in an air forced furnace for 5 minutes at 60 ° c . the dipping procedure was repeated to bring the total number of layers to 6 . an additional layer containing the drug dexamethasone in tfe / pmve was applied to the abluminal stent - graft surface . this was sprayed onto the stent - graft using a badger , standard set model 350 airbrush set at 220 kpa gauge air pressure . an end portion of the stent - graft was mounted onto a mandrel and then the mandrel was rotated by hand as the airbrush was moved back and forth across the stent - graft surface . the coating was continuously sprayed for approximately 15 seconds , after which time the mandrel was transferred to an oven set at 60 ° c . for 2 minutes . a portion of the stent - grafts were expanded with a balloon as described in example 8 , and examined with the use of a light microscope . a coated stent - graft underwent eto sterilization with a total cycle time of 15 hours , including an eto sterilization time of 1 . 3 hours at 67 . 7 ° c . after sterilization the stent - graft was distended using a 3 . 5 mm ptfe balloon and examined with a light microscope at magnification of up to 90 ×. the drug - containing layer of tfe / pmve did not separate from the base material of tfe / ppve ; and appeared to be tough , well adherent , and without evidence of cracking , demonstrating a high degree of stability . it is apparent that different copolymers of the pave family can be easily integrated into a single device construct , with or without additives . fig2 a is a light micrograph ( about 25 × magnification ) of the tfe / ppve - polymer coated stent - graft including the tfe / pmve drug - containing layer , shown before expansion . fig2 b ( about 30 × magnification ) shows the same stent - graft following expansion with a balloon of the type described in example 8 . while the covering shows occasional periodic and well - defined perforations or openings through the expanded stent - graft , the large majority of the stent - graft is unperforated . the stent - graft shown in these figures was not subjected to eto sterilization . while the principles of the invention have been made clear in the illustrative embodiments set forth herein , it will be obvious to those skilled in the art to make various modifications to the structure , arrangement , proportion , elements , materials and components used in the practice of the invention . to the extent that these various modifications do not depart from the spirit and scope of the appended claims , they are intended to be encompassed therein . | 0 |
with reference now to the drawings , and in particular to fig1 to 7 thereof , a new and improved container seal removal apparatus embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . more specifically , the container seal removal apparatus 10 of the invention essentially comprises a first leg plate 11 mounted to a second leg plate 12 at a junction 13 , with the first and second leg plates defining an acute angle therebetween and arranged in a spring - biased spaced relationship relative to one another . a tubular axle 14 is orthogonally directed through the junction to permit securement of the apparatus about a hook , key chain , and the like for ease of storage thereof . a magnetic mounting member 29 is mounted to an exterior surface of the first leg plate 11 to permit securement of the organization relative to a ferrous support surface ( not shown ). the first leg plate includes a first semi - cylindrical head 15 defined about a first axis 15a , with the second leg plate 12 including a second leg plate semi - cylindrical head 16 defined about a second axis 16a oriented parallel to the first axis 15a . the first head 15 includes a first head abutment flange 17 arranged in a spaced confronting relationship relative to a second head abutment flange 18 , with the first and second flanges 17 and 18 tangentially aligned relative to the respective first and second semi - cylindrical heads 15 and 16 to permit the grasping and securement of a container foil seal 27 therebetween , in a manner as illustrated in fig2 . a first leg positioning flange 19 is orthogonally mounted to a forward side edge of the first leg plate 11 , with a second leg positioning flange 20 orthogonally mounted to a forward side edge of the second leg plate 12 , with the first and second flanges 19 and 20 projecting towards one another in a parallel relationship to provide an abutment surface for a respective prying leg 23 and a piercing leg 24 that are pivotally mounted in adjacency relative to the respective first and second leg plates 11 and 12 through the axle 14 . a first resilient projection 21 is orthogonally mounted to a rear side edge of the first leg plate 11 , with a second resilient projection 22 mounted orthogonally to a rear side edge of the second leg plate 12 to permit capturing in a selective manner the prying leg 23 and the piercing leg 24 between the respective flanges and projections mounted to the respective first and second legs , in a manner as illustrated in fig1 . the prying leg 23 includes a forward pry blade 25 coplanar with the prying leg 23 to permit prying of a foil seal 27 relative to a container 28 , wherein the piercing leg 24 includes a u - shaped bifurcated piercing head 26 including a plurality of spikes 26a defining a recess therebetween formed with a continuous cutting edge between the spikes to permit the severing of a foil seal for ease of removal of the foil seal relative to a container 28 . a modified first semi - cylindrical head member 30 may be utilized in lieu of the first semi - cylindrical head 15 formed with a head cavity 31 , including a head top wall 32 spaced from a head bottom wall , with an l - shaped top wall slot 33 spaced from a cavity l - shaped slot 34 , wherein the slots 33 and 34 are arranged in a parallel coextensive relationship mounting a positioning bar 38 orthogonally therebetween , with the positioning bar 38 projecting upwardly above the head top wall 32 . positioning bar 38 is orthogonally and fixedly mounted to a support bar 35 that in turn includes a plurality of engaging pins 36 mounted fixedly and orthogonally to the support bar 35 , with each pin 36 coaxially aligned with the pin bore 37 that is directed through the abutment flange 17 . a plurality of spring members 39 are captured between the support bar 35 and an interior surface of the abutment flange 17 to normally bias the pins in a retractable orientation , in a manner as illustrated in fig5 . upon projection of the pins relative to the flange 17 , the pins are arranged to enhance engagement of a foil seal between the first and second head abutment flanges 17 and 18 when the positioning bar 38 is directed forwardly and laterally within the l - shaped slots 33 and 34 . as to the manner of usage and operation of the instant invention , the same should be apparent from the above disclosure , and accordingly no further discussion relative to the manner of usage and operation of the instant invention shall be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawing and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . | 1 |
the present invention supports connecting , fastening , joining , or coupling one waveguide to another waveguide . a waveguide connecting system can be readily assembled and / or adjusted in compact devices , such as satellites , that provide little interstitial space to accommodate assembly tools . the connection system can be compact and / or lightweight and can provide manufacturability advantages . a system for connecting waveguides will now be described more fully hereinafter with reference to fig1 - 4 , which show representative embodiments of the present invention . fig1 and 2 depict cross - sectional views of a waveguide connector and further show a distribution of assembly forces . fig3 and 4 depict overhead views of waveguide connector clamping devices . the invention can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those having ordinary skill in the art . furthermore , all “ examples ” or “ exemplary embodiments ” given herein are intended to be non - limiting , and among others supported by representations of the present invention . turning now to fig1 , 2 , and 3 , these figures illustrate a system 100 for connecting waveguides 115 , 120 in accordance with an exemplary embodiment of the present invention as shown in fig1 and 2 . fig1 illustrates a cross - sectional view of the system 100 for connecting waveguides 115 , 120 according to one exemplary embodiment of the present invention . fig2 illustrates assembly and alignment forces 210 , 220 associated with the waveguide connector system 100 of fig1 according to one exemplary embodiment of the present invention . fig3 illustrates an apparatus 175 for connecting two waveguides 115 , 120 to one another according to one exemplary embodiment of the present invention . more specifically , fig3 illustrates an overhead view of the clamping apparatus 175 that fig1 and 2 illustrate in a cross - sectional format . the connector system 100 joins , connects , couples , attaches , or otherwise links one section of waveguide 115 to another section of waveguide 120 . the waveguides 115 , 120 can be hollow tubes or conduits that carry or convey electromagnetic energy , for example transmitting radio frequency signals in a communication system . in one exemplary embodiment , the waveguides 115 , 120 support the propagation of electromagnetic energy in the range of 43 . 5 to 44 . 5 gigahertz . in one exemplary embodiment , the waveguides 115 , 120 can carry electromagnetic signals that have a wavelength of approximately 0 . 265 inches or 6 . 73 millimeters . the waveguides 115 , 120 can comprise an opening 155 ( fig1 ) that is cylindrical , square , or circular and that guides the electromagnetic energy , for example . the waveguides 115 , 120 can have a composition based on metal or a conductive material , for example . alternatively , the waveguides can comprise a dielectric material . as shown in fig1 and 2 , the waveguide 115 has a flange , rim , washer - shaped protrusion , or some other salient feature 130 that faces a corresponding flange , rim , washer - shaped protrusion , or some other salient feature 125 of the waveguide 120 . that is , the waveguide 115 has a flange 130 on one end that adjoins or butts to the flange 125 of the waveguide 120 . in this manner , the two adjoining flanges 125 , 130 provide surfaces for mating and aligning the waveguides 115 , 120 , one to the other . the flanges 125 , 130 typically exhibit symmetry about the longitudinal axis 250 ( fig2 ) of the respective waveguides 120 , 115 to which each is attached . for example , each flange 125 , 130 can have the form of a disk or a washer that is centered about the waveguides 120 , 115 . alternatively , the flanges 125 , 130 can be square , rectangular , oval , or some other form . each flange 130 , 125 is typically fabricated on a lathe or a metal turning machine and is then attached to the respective waveguide tubing 115 , 125 via a brazing , welding , pressing , or gluing operation . alternatively , the tubing 115 , 120 and its associated flange 130 , 125 can be formed as a unitary or seamless structure , for example in a mold or via swaging an end of a malleable piece of stock tubing . in fig1 of the illustrated embodiment , the flange 125 has a recess 165 or a receptacle that receives a portion 160 of the flange 130 . that is , the flange 125 comprises a female portion 165 that mates with a male portion 160 of the adjoining flange 130 . the mated flanges 125 , 130 can comprise a shoulder , a recess , an indentation , a depression , a countersunk region , or a hollowed - out area , for example . in other words , the flange 130 can seat in or with the flange 125 . the seating capability facilitates assembling the system 100 in a cramped environment of a communication system or a satellite , for example . moreover , the male and female features 160 , 165 provide lateral alignment without unnecessarily constraining rotation 185 of the waveguide / flange 125 , 130 with respect to the waveguide / flange 120 , 125 . thus , a technician that is assembling the satellite can readily rotate 185 ( fig2 ) the waveguide 120 relative to the waveguide 115 until a desired rotational position is achieved . as illustrated in fig1 , the waveguide 120 has an optional reed 180 or a flat strip of metal disposed therein that influences the waveguide &# 39 ; s transmission properties according to its relative rotational position . applying a rotating motion 185 to the waveguide 120 rotates the reed 180 relative to the waveguide 115 as shown in fig2 , thereby producing an adjustable change in the electromagnetic energy transmitting there through . for example , the reed 180 can impact polarization , amplitude , or phase . in one exemplary embodiment a pin ( not explicitly shown in the figures ) sets or fixes the rotational positions of the waveguide flanges 125 , 130 , thereby preventing relative rotation 185 . as shown in fig2 , the clamping system 175 comprises a first member 105 that is disposed on one lateral side of the adjoining flanges 125 , 130 and a second member 110 that is disposed on an opposite lateral side of the adjoining flanges 125 , 130 . the clamping system 175 can be viewed a device or machine that joins , grips , supports , or compresses the flanges 125 , 130 . the clamping members 105 , 110 can be pieces or components of metal or other materials formed with common fabricating techniques such as machining or molding . the clamping member 105 embraces a first circumferential portion 145 of the adjoining flanges 125 , 130 . the clamping member 110 embraces a second circumferential portion 140 of the adjoining flanges 125 , 130 . more specifically , the clamping member 105 has a groove 170 into which a portion 145 of the adjoining flanges 125 , 130 is disposed . meanwhile , the clamping member 110 has a groove 172 into which another portion 140 of the adjoining flanges 125 , 130 is disposed . the grooves 170 , 172 can each be or comprise a slot , a recess , an indentation , a channel , a notch , a concave contour , or an inwardly curved surface . as shown in fig3 , the fasteners 310 mechanically link the two clamping members 105 , 110 together . as exemplarily illustrated , the fasteners 310 can be bolts , screws , or similar threaded devices . each of the fasteners 310 has a thread axis 350 that is essentially or approximately perpendicular to the longitudinal axis 250 ( fig2 ) of the coupled waveguides 115 , 120 . alternatively , as illustrated in fig3 a , the angle 375 between the thread axis 350 and the longitudinal axis 250 ( fig2 ) can be obtuse . the fasteners 310 typically pass through a hole in the clamping member 105 and thread into a threaded hole in the clamping member 110 . as a consequence of the fastener orientation , a technician can readily access the heads 315 of the fasteners 310 with a tool , such as a screwdriver , a socket wrench , a spanner , or an open - ended box wrench , to turn the fasteners 310 . tightening the fasteners 310 applies lateral force 210 ( fig2 ) that moves the clamping member 105 towards the clamping member 110 . in other words , when the technician turns the fasteners 310 clockwise ( assuming right - hand threads ), the clamping members 105 , 110 move together . when the clamping members 105 , 110 move together , the circumferential area 145 of the adjoining flanges 125 , 130 moves deeper into the groove 170 of the clamping member 105 . likewise , tightening the screws 310 pushes ( or pulls ) the circumferential area 140 of the adjoining flanges 125 , 130 into the groove 172 of the clamping member 110 . as the rims of the flanges 125 , 130 move into the grooves 170 , 172 , the groove sidewalls 150 contact and press against the sides of the adjoining flanges 125 , 130 . thus , the sidewalls 150 or the concave contours of the grooves 170 , 172 apply compressive force 220 to the flanges 125 , 130 to move them together into fixed positions . in other words , tightening the fasteners 310 produces lateral motion and force 210 . the flanges 125 , 130 receive at least some portion of the lateral force 210 . contact between the groove sidewalls 150 ( fig1 and 2 ) and the flanges 125 , 130 translates the lateral motion and compressive force 210 into longitudinal motion and force 220 , as shown in fig2 . the longitudinal motion and force 220 presses the flanges 125 , 130 together thereby connecting the flange 130 and its associated waveguide 115 to the flange 125 and its associated waveguide 120 . thus , tightening the fasteners 310 couples the waveguides 115 , 120 together so that electromagnetic energy can flow efficiently between the waveguides 115 , 120 . turning now to fig4 , this figure illustrates an apparatus 400 for connecting a first and a second waveguide to a third and a fourth waveguide according to an exemplary embodiment of the present invention . that is , the figure illustrates a clamping system 400 that couples a first plurality of waveguides to a second plurality of waveguide via two clamping members 405 , 410 that function similar to the clamping members 105 , 110 discussed above with reference to fig1 , 2 and 3 . where as the clamping members 105 , 110 embrace a pair of adjoining flanges 125 , 130 , the clamping members 405 , 410 embrace multiple pairs of adjoining flanges ( not explicitly depicted in fig4 ). the clamping system 400 comprises a repeating connection unit 425 , with each unit 425 coupling one waveguide to another waveguide . the number of repeating connection units 425 determines the number of flanged waveguides that the system 400 can connect together . in this manner , the system 400 can be extended to handle arrays of flanged waveguides , with an arbitrary number of waveguides in each array . the clamping member 405 is typically a unitary or seamless component , for example machined from a single piece of metal or plastic stock . likewise , the clamping member 410 is typically fabricated from one piece of stock . fasteners 310 join the first clamping member 405 to the second clamping member 410 . the clamping members 405 , 410 have grooves ( not explicated depicted in fig4 ) into which waveguide flanges are disposed . tightening the fasteners 310 moves the clamping members 405 , 410 together . as discussed above with reference to fig1 , 2 , and 3 , moving the clamping members 405 , 410 together presses the rims of the waveguide flanges into the grooves , thereby forcing the flanges together and connecting a first waveguide array to a second waveguide array . in summary , an exemplary embodiment of the present invention can couple a first conduit for carrying electromagnetic energy to a second conduit for carrying electromagnetic energy in a manner that promotes efficient energy transfer and that facilitates waveguide assembly and adjustment . from the foregoing , it will be appreciated that an embodiment of the present invention overcomes the limitations of the prior art . those skilled in the art will appreciate that the present invention is not limited to any specifically discussed application and that the embodiments described herein are illustrative and not restrictive . from the description of the exemplary embodiments , equivalents of the elements shown therein will suggest themselves to those skilled in the art , and ways of constructing other embodiments of the present invention will suggest themselves to practitioners of the art . therefore , the scope of the present invention is to be limited only by the claims that follow . | 7 |
in the method of fabricating led assembly of the present invention shown in fig1 at first step , a plurality of unit leds 10 welded onto an electrical board 11 which has been already cut into a desired shape , then lead conductors 12 are welded to the electrical board 11 at a proper position . the unit leds are disposed according to a definite way so as to exhibit a lustrous and beautiful high quality mixed color later on . in the second step shown in fig2 the string of leds 10 buried in a framed gutter 13 and fixed therein , the gutter 13 shall be well fitted for the unit leds 10 in every respect such that the resin to be injected thereinto in the next step will not overflow thereby ensuring a good product quality . in the third step shown in fig3 the framed gutter 13 together with the led assembly 10 is put in a mold cavity of a mold 14 which is to be closed both from right and left , and the led assembly 10 is settled thereat . in the fourth step shown in fig4 polyacrylic resin 16 is injected into the framed gutter 13 from an injection port 15 , and a copper stick 17 is simultaneously inserted thereinto to stabilized the injection operation . it should be noted that an annular groove 18 will be formed at the rear part of the injected polyacrylic resin 16 . however , a rubber ring 19 ( not shown ) can be filled therein for preventing entry of water drips in a rainy day so as to protect the product from defection . in the fifth step shown in fig5 a finished product of led assembly 21 is taken out from the mold 14 thus completing the whole fabrication steps . in the present invention , the time required for polyacrylic resin 16 injection per round is only about 30 sec . with temperature descending from 90 ° c . down to below 60 ° c . fully in compliance with internationally standardized led fabrication specification , and the rate of yield attains as high as 99 %. for comparison , in a conventional fabrication method using epoxy resin or silicone rubber as a packaging material , and heating in an oven at a temperature above 120 °, the rate of yield obtainable is below 90 % accompanying with dissatisfactory structure of resin package , and unsmoothness of the finished product . for a further comparison between the product fabricated according to a convention method and that according to the present invention , reference should be made to fig6 a and 6b . as shown in fig6 a , the product molded with epoxy resin or silicone rubber is finished in such a state that the surface between adjacent unit leds is formed in an arcuate fig2 , an incident light 23 ( from a lamp source or sun light ) is reflected in diffusing state lacking uniformity in brightness and homogeneity in color . on the contrary , the fabrication method according to the present invention is employed in fig6 b wherein the product is molded with polyacrylic resin by injection process lasting for approximately 30 sec at a temperature descending from 90 ° c . to below 60 ° c . it should be noted that the product fabricated in a withstandable temperature and time duration has a resultant planar surface 24 between adjacent unit leds which acts as a reflecting mirror against an incident light ( from a lamp source or sun light ) so that there are no shortcomings as that of the product fabricated according to the conventional techniques . fig7 shows a view of method of fabricating led assembly in another embodiment of the present invention . as shown in fig7 this led assembly is applicable as a traffic signal lamp for cross roads . it is characterized in that the led assembly 25 containing red , green and yellow colors is screwed onto a screw socket 27 without using any luminary but only adding a light shade 26 . with this construction , by the aid of direct emission property of led light , the light signal of one of the cross road at the instant of variation from yellow to red is not visible from the driver waiting at the other cross road so as to evade his / her too early starting thereby eliminating a possible traffic accident as that is apt to happen in case a conventional traffic signal lamp in a non - shaded luminary is installed on a cross road intersection . in the first step of fabrication in another embodiment shown in fig8 a plurality of unit leds 30 is welded onto an electrical circuit board 31 which has been already cut into a desired shape . fig9 shows the second step of method of fabricating led assembly in another embodiment of the present invention , it differs from the step shown in fig1 that lead conductors 32 are not connected to a circuit board 31 in advance , but are passed through the guide hole 33 in a preformed housing before connecting to the circuit board 31 . afterward the circuit board 31 is pushed and engaged to an inner flange 34 of the housing to be fixed thereof , and then the led assembly is buried in a framed gutter 35 . fig1 shows the third step of method of fabricating led assembly in another embodiment of the present invention , the framed gutter 35 together with the led assembly is settled in a mold 36 , in this case as the inner part of the framed gutter 35 is divided in two spacing by the circuit board 31 , a front room 37 a and a rear room 37 b , so that the resin has to be injected thereinto through respective inlet ports 38 a and 38 b . fig1 shown the forth step of method of fabricating led assembly in another embodiment of the present invention , wherein a finished led assembly 39 is taken out of the mold cavity after carrying out injection molding about 30 sec . from 90 ° c . to 60 ° c . with 99 % rate of yield . table 1 is a comparison between properties of polyacrylic resin employed in the present invention and epoxy resin employed in prior techniques . in all , after having made careful consideration over the above detailed description of the present invention , it will be clearly understood that the present invention has several noteworthy features which are prominently superior to any conventional techniques , and are as follows : 1 . the product has good appearance , smooth contour surfaces due to adequate resin attachment , well - organized disposal of components excellent water tightness and low production cost with nearly 100 % rate of yield . 2 . a noteworthy contribution to environmental protection that generation of poisonous gas due to heating resin material at high temperature for a long time that is the problem , inherent to conventional methods is eliminated because harmless polyacrylic resin is used with a very short time duration of heating under relatively low temperature in the present invention . those who are skilled in the art will readily perceive how to modify the invention . therefore the appended claims are to be construed to cover all equivalent structures which fall within the true scope and spirit of the invention . | 8 |
hereinafter , referring to the drawings , an explanation will be given of an exemplary embodiment which is an example of this invention . now , in the attached drawings , like reference numerals refer to like elements and the repeated explanation will be avoided . since the explanation made herein is directed to the best mode for carrying out this invention , this invention should not be limited to this best mode . referring to fig1 to 7 , an explanation will be given of an image forming system s 1 according to an exemplary embodiment of this invention . the image forming system s 1 , as shown in fig1 , includes a printer pr 1 serving as an image forming device , a cable 100 connected through an input / output interface such as usb , and a personal computer pc 1 serving as an information processing device . in this exemplary embodiment , a single printer pr 1 and a single information processing device pc 1 are connected , but without being limited to such a case , two or more printers and two or more information processing devices may be connected . further , in this exemplary embodiment , it is assumed that the printer pr 1 is a laser system of printer using toner as a color material , but without being limited to such a case , this invention may be applied to a full - color printer , a composite machine or an ink - jet system of printer . fig2 shows a typical configuration of the printer pr 1 and personal computer pc 1 . the printer pr 1 includes a control device 10 constructed of a microcomputer for various kinds of arithmetic processing , an operating panel 11 constructed of a liquid crystal display device for displaying various kinds of information and a printing mechanism unit 12 for making an image on a printing sheet . the control device 10 includes a cpu 50 for executing arithmetic processing ; an interface 51 for outputting displayed data to the operating panel 11 ; a rom 52 for storing various programs ; a ram 53 which is used as a working area of the cpu 50 ; an printing unit interface 54 for outputting image data to the printing mechanism unit 12 ; a hard disk drive ( hdd ) 55 for storing various kinds of data ; an interface control unit 56 for controlling a usb port 58 , a network port 59 and a parallel port 60 ; and an image processing unit 57 for processing the image data . stored in a predetermined area of the hard disk drive 55 are image data d 1 of a virtual cd - rom serving as a virtual recording medium accommodating the program such as the printer driver of the printer pr 1 and discriminating information d 2 of the printer pr 1 . the virtual cd - rom refers to a general term of the technique which virtually handles a file on the hard disk as the cd - rom set in a cd - rom drive . by previously copying the contents of the co - rom on the hard disk drive , even if there is not the cd - rom , as occasion demands , it can be assumed as if the cd - rom were set in the virtual cd - rom drive . namely , from the os or application software on the side of the personal computer pc 1 , the virtual cd - rom drive can be also handled in the same manner as a physical drive . thus , the software operates as if it were read from a real cd - rom drive . some kinds of software do not operate if they are not start up from the cd - rom . therefore , the technique of the virtual cd - rom can be conveniently adopted when such software is started up without using the cd - rom . more specifically , for example , even if the cd - rom for installing the printer driver attached at the time of shipping of the printer pr 1 is lost or damaged to be disabled , without taking the labor and time of getting a substitute from the manufacturer , the installing processing can be done instantly , thereby improving user &# 39 ; s convenience . for the manufacturer of the printer pr 1 , by storing the image data d 1 of the virtual cd - rom for installing in the hard disk drive 55 , attachment of the cd - rom can be done without , thereby leading to an advantage of cost reduction . further , unlike the case of the system of downloading the printer driver through the network as the internet on the side of the personal computer pc 1 , connection to the network is not indispensable . thus , even if there is not the network connecting environment , the installing processing can be smoothly done . it should be noted that dedicated software and a data file having a specific format therefor are required in order to employ the above virtual cd - rom . specifically , if the data are copied from an optical medium such as cd - rom to another medium simply in units of files , the information on the sectors of the optical medium to which the data belong , physical information on a disk and information on volume labels will be lost . on the other hand , by using an image file saving function loaded in dedicated writing software , the data can be saved with specific information such as information structure or physical information of the optical medium being held . further , image data ( also named as a disk image or an image file ) refers to the data in which complete contents and structure of a file system are stored in a single file . the virtual disk image generally employed includes an iso system or a standard iso system ( 9660 image : system which can be created by many cd / dvd writing tool and permits an original cd / dvd to be restored from the image ). next , an explanation will be given of the discriminating information d 2 stored in the hard disk drive 55 . the discriminating information d 2 is constructed of a discriminating code allotted to the same kind of printers ( printer device id for discriminating the printer and cd - rom device id for discriminating the cd - rom ). the printer device id , although not be particularly limited , may be data having the format based on a predetermined communication protocol as illustrated in fig3 ( a ). the cd - rom device id , although not be particularly limited , may be data having the format as illustrated in fig3 ( b ). by discriminating these printer device id and cd - rom device id by the personal computer pc 1 , for example , if the connection to the same printer is to be done twice or more , it can be decided that the processing of installing the printer driver is not necessary , or that the program corresponding the pertinent personal computer pc 1 has been stored . next , referring to fig2 and 4 , an explanation will be given of the structure of the personal computer pc 1 . the personal computer pc 1 , as shown in fig4 , includes a personal computer body 150 incorporating e . g . a main control unit 200 , a display 300 constructed of a liquid crystal monitor which is connected to the body 150 to display various kinds of information , a usb port 250 , etc . through the usb port 250 having plural of usb connecting terminals , the personal computer pc 1 is connected to a mouse 301 serving as a pointing device , a keyboard serving as an input unit and an external storage device 303 formed of a hard disk drive and a printer pr 1 . the main control unit 200 includes a cpu 201 for executing various kinds of arithmetic processing ; a rom 202 storing various kinds of programs such as bios ; a ram 203 used as a working area of the cpu 201 ; an interface 204 to which the usb port 250 is connected ; a hard disk drive ( hdd ) 350 in which various programs such as an os ( operation system ) 400 , a printer driver 401 , an application software program 402 and data are stored ; and a video memory 206 used as an image processing area . the interface 204 of the main control unit 200 is adapted to monitor the usb port 250 by execution of a predetermined program by the cpu 201 so that when the usb cable connected to the printer pr 1 is connected to any usb terminal of the usb port 250 , its connecting status can be detected . when the connecting status is detected , the printer device id and the cd - rom device id as illustrated in fig3 are received from the printer pr 1 side ; if it is determined that the printer pr 1 connected is a printer still not installed with the printer driver , the hard disk drive 55 of the printer pr 1 is accessed . further , using the image data d 1 of the virtual cd - rom of the hard disk drive 55 , the processing of installing the program such as the printer driver into a predetermined area of the hard disk drive 350 of the personal computer pc 1 side is done . now , referring to the flowchart shown in fig5 , an explanation will be given of the processing procedure between the printer pr 1 and the personal computer pc 1 . first , if the printer pr 1 is connected to the personal computer pc 1 through the usb cable 100 , in the personal computer pc 1 , “ plug - and - play ” processing of the usb is started ( step s 100 ). now , the “ plug - and - play ” refers to the function that when the usb cable with any device connected is inserted in the usb connector , this is recognized automatically . on the printer pr 1 side , “ plug - and - play ” response processing of the usb is started so that the printer id as illustrated in fig3 ( a ) is transmitted to the personal computer pc 1 . thus , in the personal computer pc 1 , printer connecting processing is started ( step s 101 ). further , from the printer pr 1 , the cd - rom device id as illustrated in fig3 ( b ) is transmitted to the personal computer pc 1 . thus , cd - rom connecting processing for the virtual cd - rom is started ( step s 102 ), in the printer pr 1 , processing of virtual cd - rom connecting function additional response is executed ( step s 201 ). by the processing of the virtual cd - rom connecting function additional response , a file system is started which is accessible to the image data d 1 of the virtual cd - rom drive of the hard disk drive 55 within the printer pr 1 in the same manner as to an ordinary cd - rom drive . if the virtual cd - rom implementing function is valid , on the operating panel 11 of the printer pr 1 , for example , “ virtual cd - rom is valid ” for a “ function menu ” ( fig6 ( a )). if the virtual cd - rom implementing function is invalid , for example , “ virtual cd - rom is invalid ” for the “ function menu ” ( fig6 ( b )). in this case , only the usb printer device id is notified . next , from the personal computer pc 1 side , a cd - rom connecting request is sent to the printer pr 1 . in response to this , the printer pr 1 places the image data d 1 of the virtual cd - rom drive of the hard disk drive 55 in a state accessible by “ read - only ” from the personal computer pc 1 ( step s 202 ). the printer pr 1 issues a cd - rom connecting response to the personal computer pc 1 . thus , the personal computer pc 1 completes the cd - rom connecting processing which permits the image data d 1 of the virtual cd - rom drive of the hard disk drive 55 to be viewed ( handled ) as the ordinary cd - rom drive ( step s 103 ). further , coming with the start of the printer connecting processing in step s 101 , the personal computer pc 1 requires installing of the printer driver from a user ( step s 104 ). for example , as illustrated in fig7 , an exhibition of urging the user to install the printer driver is made on the display 300 of the personal computer pc 1 . exemplarily illustrated in fig7 are exhibitions “ a new printer has been connected ”, “ model name ”, message “ do you install the printer driver for this printer ?”, “ ok ” and “ cancel ”. on the basis of these exhibitions , the user gives an instruction by mouse - clicking the exhibition of “ ok ” if installing is permitted , or the exhibition of “ cancel ” if installing is not executed . next , on the instructing screen as illustrated in fig7 , if installing of the printer driver is permitted , the processing of installing the printer driver is executed on the basis of the operation specification of the os ( operating system ) installed in the personal computer pc 1 ( step s 105 ). by the processing of installing the printer driver , from the personal computer pc 1 side , a software read - out request is issued for the printer pr 1 . in response to the request , the printer pr 1 transmits the software ( printer driver ) to the personal computer pc 1 ( step s 203 ). in the personal computer pc 1 , the image data d 1 of the virtual cd - rom drive of the hard disk drive 55 recognized as the ordinary cd - rom in step s 103 is selected as e . g . an “ f drive ”. if there is any application software program other than the printer driver , it will be installed in the same manner , thereby completing the processing ( step s 106 ). thus , the printer pr 1 becomes usable in the personal computer pc 1 . in this way , in accordance with the image forming system s 1 according to this exemplary embodiment , even if the cd - rom for installing the printer driver attached at the time of shipping of the printer pr 1 is lost or damaged to be disabled , without taking the labor and time of getting a substitute from the manufacturer , the installing processing can be done instantly , thereby improving user &# 39 ; s convenience . even when the cd - rom attached is kept , in installing the printer driver , the user can do without the work of setting the cd - rom in the cd - rom drive of the personal computer pc 1 , thereby improving the user &# 39 ; s convenience . further , for the manufacturer of the printer pr 1 , by storing the image data d 1 of the virtual cd - rom for installing for the printer driver in the hard disk drive 55 , it is possible to omit attachment of the cd - rom itself for the printer driver , thereby giving an advantage of cost reduction . further , unlike the case of the system of downloading the printer driver through the network as the internet on the side of the personal computer pc 1 , connection to the network is not indispensable . thus , even if there is not the network connecting environment , the installing processing can be smoothly done . hitherto , the concrete explanation has been given of the invention accomplished by the inventor on the basis of the exemplary embodiment . however , the exemplary embodiment disclosed in this specification is exemplary in all points so that this invention should not be limited to the technique disclosed . specifically , the technical scope of this invention should not be construed limitedly on the basis of the explanation of the above exemplary embodiment , but construed on the basis of the description of the scope of claims . any technique equivalent to the technique described in the claims and any change in the claims should be included in this invention . for example , after the printer driver and others have been installed , the virtual cd - rom in the connected state can be removed by the operation of removing hardware included in the os . for the personal computer pc 1 which has once connected the printer pr 1 to complete installing of the printer driver and others , in order that the virtual cd - rom is not connected again , setting of “ valid ” or “ invalid ” may be permitted by the setting menu of the operating panel 11 of the printer pr 1 side . | 6 |
with reference to fig5 a block diagram is shown of a preferred embodiment of a digital facsimile receiver system 10 incorporating the error processing system of the present invention . it should be understood that a wide range of approaches can be taken in implementing the present invention including both a hardware approach and the microprocessor approach specifically illustrated in fig5 . the system of fig5 includes a central processing unit 12 which has access to a read only memory 14 and a random access memory 16 . a communication interface 18 connects the central processing unit 12 to a communication channel 19 and a facsimile printer interface 20 connects the central processing unit to a facsimile printer through a line 22 . a total of 2300 scan lines per page are typically received and typical transmission links include the public switched telephone network , which can be the communication channel 19 . the communication interface 18 is typically a modem and central processing unit 12 may be motorola m68000 microprocessor . typically , the central processing unit 12 would be part of a microcomputer which also contains 64k bytes of ram 16 and 64k bytes of rom 14 . the facsimile printer interface 20 is a conventional component . in operation , in a typical facsimile system , a single scan line consists of 1728 picture elements . as each scan line is decompressed by the central processing unit , the scan line is stored in the random access memory 16 and is used as a reference to decompress the next compressed line . read only memory 14 contains the decompression and error processing algorithms which operate on the two line storage in random access memory 16 . once the decompression and error processing are complete , the information is passed to facsimile printer interface 20 . for purposes of the present invention , the read only memory 14 and the random access memory 16 do not need to have 64k bytes of storage . the storage in random access memory 16 only needs to be adequate to store two lines of data together with sufficient storage to accommodate the error processing program . the read only memory should be sufficiently large to store the error processing program . 64k bytes are more than ample for this purpose . fig6 shows a sample line of a modified read code . the first item shown in fig6 is an end of line ( eol ) code 30 indicating the end of the previous line . tag bit 32 identifies the present line as a one - dimensional line . accordingly , each of the codes in the line corresponds to a set number of white or black spaces to be printed . the next code 34 indicates nine white spaces which are shown printed at 36 . next , five black spaces are indicated by the code shown at 38 . these black spaces shown are printed at 40 . next , the code in section 42 indicates three white spaces shown printed at 44 . the code in section 46 indicates two black spaces shown printed at 48 . the code in section 50 indicates two white spaces shown printed at 52 . the code in section 54 indicates two black spaces shown printed at 56 . the code in section 58 indicates three white spaces shown printed at 60 . the code in section 62 indicates two black spaces shown printed at 64 . the code in section 66 indicates eight white spaces shown printed at 68 . the code in section 70 indicates four black spaces shown printed at 72 . finally , 1688 white picture elements are transmitted to complete the line . standard coding procedure calls for any run length greater than 64 picture elements to be transmitted using a &# 34 ; make - up code &# 34 ; followed by a &# 34 ; terminating code &# 34 ;. in this case , code 74 represents a make - up code of 1664 white elements and code 76 represents 24 white elements giving a total of 1688 white elements which are shown at 78 . this completes the data for one line since the total picture elements is now 1728 . fill 80 may then be transmitted and eol code 82 is transmitted to show that the line is completed . fill 80 comprises a string of zeros and may be placed in the message flow to create a pause . the fill ensures that the transmission time of data , fill and eol is not less than the minimum transmission time of the total coded scan line established in a pre - message control procedure . the eol code 82 is followed by a tag bit code 83 indicating that the next line is a two - dimensional line . it will be understood that all of the coding procedures are conventional for modified read code established for group 3 apparatus by the ccitt and do not constitute part of the present invention . fig7 shows a flow chart of the error processing program to be stored in read only memory 14 . the program starts at step 100 where any initialization , etc . takes place . control then passes to step 102 where the next eol code is located . this corresponds to code 30 in fig6 . the tag bit 32 following the eol code is then read in step 104 to determine whether the subsequent line is a one - dimensional coded line or a two - dimensional coded line . if the line is one - dimensional , control passes to step 106 where a one dimensional decoding and error processing routine , to be discussed below , is carried out . if the tag bit indicates a two - dimensional line , control passes to step 106 &# 39 ; where a two - dimensional decoding and error processing routine is carried out . from step 106 , control passes to decision block 108 where it is determined whether errors were detected in block 106 . if no errors were detected , a flag is set in block 109 indicating synchronization and control passes to block 110 . similarly , for a two - dimensional line , control passes from block 106 &# 39 ; to block 108 &# 39 ; where it is determined whether any errors were detected in block 106 &# 39 ;. if no errors were detected , control passes to step 110 . in step 110 , the tag bit following the next eol is read to determine whether the following line is one - dimensional or two - dimensional . if the tag bit indicates a one - dimensional line , control passes to block 112 where a determination is made as to whether the following codes are two additional eol codes followed by &# 34 ; one &# 34 ; tag bits . if the answer is yes , this indicates that transmission is over and the program stops at 114 . otherwise , control returns to block 106 where the next line is decoded and processed for errors . if the decision in block 110 indicates that the following line is a two - dimensional line , control returns to block 106 &# 39 ; where the line is decoded and processed for errors . if the decision in step 108 or 108 &# 39 ; indicates that errors have been located , control passes to step 116 where it is determined whether the synchronization flag has been set or not . if the synchronization flag has been set , this indicates that the previous line was properly decoded and control passes to step 118 where the error portion of the output line is replaced with the corresponding portion of the previous output line and the line is written to the output . control then passes to step 120 where the synchronization flag is reset to indicate lack of synchronization . in step 116 , if the synchronization flag is reset , this indicates that the previous line also has an error . in this case , control passes to step 122 where the error portion of the output line is replaced with white and the completed line is then written to the output . it will be noted that steps 118 and 120 require that the error portion of the output line be defined as being four color changes to the left of the point where the actual error has been detected . this feature of the invention will be discussed further below . from step 120 , control passes to step 124 where it is determined whether or not the error causing the &# 34 ; yes &# 34 ; response at step 108 was a premature eol followed by a &# 34 ; one &# 34 ; code indicating a following one - dimensional line . if the answer is &# 34 ; yes &# 34 ;, control passes directly to step 106 where the subsequent line is decoded . otherwise , control passes to step 102 where the next eol code is found . the program of fig8 can be used either at step 106 or at step 106 &# 39 ;. this program is entered at step 106a and control passes to step 106d where the coded bit stream to be decoded is compared to one entry of the applicable code table . in step 106c a decision is made as to whether a match was found . if no match was found , control passes to step 106d where it is determined whether all of the elements of the code table have been checked . if not , control returns to step 106b where the next element of the code table is compared . this process repeats itself until all elements of the code table have been checked . if no match is found , control passes from step 106d to step 106e where an error is declared by setting an error flag . if a match is found in step 106c , control passes to step 106f where it is determined whether the match is an end of line followed by a tag bit indicating a one - dimensional line . if this is the case , control passes to step 106e where an error is declared . the error is a premature end of line 1 . if no error is found at step 106f , control passes to step 106g where it is determined whether the matched code is an end of line code followed by a two - dimensional line code . if it is , control passes to step 106e where an error is declared . if not , control passes to step 106h where the appropriate number of black or white picture elements are output as appropriate . control then passes to line 106i where it is determined whether greater than 1728 pels have been output . if the answer is yes , the line is too long and the error flag is set at step 106e . if not , control passes to step 106j where it is determined whether the number of output pels is equal to 1728 . if not , the line is not completed and control passes to step 106k where the coded bit stream pointer and output line pointer are updated . in this step , the coded bit stream pointer is moved to the beginning of the code following that which was just decoded . control then passes to step 106b where the remainder of the coded bit stream is once again compared to the elements of the code table . this procedure continues until the output line is complete at which time control passes to step 106l where it is determined whether the next coded bits constitute an end of line code . if not , control again passes to step 106e where the error flag is set . if an end of line is found , control passes to step 106m where the error flag is reset to indicate that no error has been detected . in fig7 at step 108 , the error flag which was either set or reset at steps 106e and 106m is queried to determine whether any errors were detected . referring again to fig6 examples of typical errors will now be discussed . assume that the code in section 58 in fig6 is an improper code and does not match any of the codes of the code table . in this case , an error will be detected at steps 106c and 106d of the flow chart of fig8 . in this case the program , as shown in fig7 will return four color changes and replace the line starting with the code at section 42 through the end of the line either with white or with the previous line , depending on whether or not synchronization or lack of synchronization was previously declared . if , for example , the final two bits of the code in section 76 are in error , the decoded line will be detected as being too long . in this case , the program of fig7 will go back four color changes and replace the pels corresponding to the codes in sections 62 , 66 , 70 and 74 either with white or with the previous line depending on whether synchronization or lack of synchronization is indicated . if , for example , a premature end of line is located instead of the code in section 66 , the program will go back four color changes and replace the end of the line starting from the pels corresponding to the code in section 50 either with white or with the preceding line depending on the state of the synchronization . also , in the case of a premature end of the line code , if the premature end of the line includes a tag bit indicating a one - dimensional line , control passes to step 106 in fig7 so that an attempt is made to decode the line immediately following the premature end of line code . if , on the other hand , the premature end of line code indicates a two - dimensional code to follow , control returns to step 102 of fig7 and the next end of the line code is located . in the case of fig6 this would be the code in section 82 . if , during decoding , the end of fill 80 is reached and no eol code is found , the program will count back four color changes and terminate the line using either the previous line or white starting with the pels corresponding to the code in section 66 , depending on the state of the synchronization flag . the foregoing description is set forth for purposes of illustrating the present invention but is not considered limitative thereof . clearly , numerous additions , substitutions and other modifications can be made without departing from the scope of the invention as set forth in the appended claims . | 7 |
in all the figures of the drawing , sub - features and integral parts that correspond to one another bear the same reference symbol in each case . referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown a section through the front view of a printing device 1 with a transport and back - pressure device in a first variant . such a printing device may be employed in a franking machine , an addressing machine or another mail processing appliance with mail - item transport . the printing device 1 is disposed in a housing 4 with an orifice 3 for the mail - item feed . a transport direction for a fed mail item is marked by an arrow and runs downstream from left to right in the z - direction . the mail item , when being transported , comes to rest against a guide plate 2 . a transport and drive device 5 is located on one side of the guide plate 2 . a driven draw - in roller 71 is likewise located on the same side of the guide plate 2 . a motor 13 generates the drive force required . orifices 9 and 11 for the driven draw - in roller 71 and for a driven transport drum 51 are disposed in the guide plate 2 so as to be offset in the z - direction . a nondriven back - pressure device 6 and a nondriven pilot - control mechanism 7 are disposed on the other side , opposite the guide plate 2 . a feed deck 8 limits the thickness of the fed mail item to 10 mm . orifices 81 , 82 are disposed , offset in the z - direction , in the feed deck 8 . the orifices 11 , 81 and 9 , 82 are located opposite one another . the orifice 81 is provided for back - pressure rollers 61 , 62 of the back - pressure device 6 , which are mounted on a resilient rocker 66 , and the orifice 82 is provided for a draw - in roller 72 of the pilot - control mechanism 7 , the draw - in roller being mounted on a resilient rocker 76 . the rockers 66 , 76 are formed preferably in each case from two angle levers which are mounted pivotably at a fixed location and on which a spring 63 , 73 acts in each case . the angle levers are coupled to one another via a lifting rod 77 . for a highly accurate transmission of the drive force to the print carrier , the transport drum 51 is employed , inside which there is sufficient room for accommodating ink containers ( cartridges ) of two ink - jet printing heads 21 , 22 ( fig2 ). the printing device thereby has a highly compact construction . the two ink - jet printing heads 21 , 22 , which are disposed with their ink containers in the transport drum 51 and in fig1 are concealed by the latter , are disposed exchangeably . for example , ½ - inch bubble - jet printing heads can be used and can be taken out in the y - direction after they have first been moved in the x - direction . the x - direction and y - direction are orthogonal to the transport direction ( z - direction ). a bearing axle 516 of the transport drum 51 is parallel to the x - direction . a worm wheel 517 is fastened on the bearing axle 516 and is connected to a motor axle 131 of the direct - current motor 13 via a worm pinion 16 and a coupling sleeve 15 . the ink - jet printing head 21 , 22 ( see fig2 ) is disposed in the x - direction , in such a way that its nozzles are located at the edge of the transport drum 51 , in order to emit ink drops on demand , opposite to the y - direction , onto a surface of the print carrier in the printing region . nozzles of the two ink - jet printing heads 21 , 22 are oriented in the direction of the print carrier orthogonally to the transport direction and orthogonally to the bearing axle 516 of the transport drum 51 . there is provision for disposing an orifice 111 , not shown , in the guide plate 2 next to the orifice 11 , so as to be offset in the x - direction , for ink - jet printing from the nozzles of the ink - jet printing head 21 , 22 , the orifice 111 having a size corresponding to the printing region . the compact device , in which the nozzles of the ink - jet printing heads 21 , 22 are disposed so near to an edge 511 of the transport drum 51 that virtually no distortions can occur in the printing image , is , of course , advantageous . a further advantage is that the transport drum 51 can be manufactured with high precision in an uncomplicated way , thus giving rise to a uniform transport of the print carriers ( i . e . mail items ) under the ink - jet printing heads 21 , 22 . a non - illustrated main circuit board for control controls the printing device . markings are applied to an end face 512 of the transport drum 51 , near a circumference of the transport drum 51 , and are distributed over the circumference . the markings are , for example , reflecting dashes that are detected by a reflex - light barrier of an encoder 52 and are converted by the microprocessor of the above - mentioned control into printing pulses in the ratio 1 : 1 . fluctuations in the transport speed therefore have no influence on a printing image produced . alternatively to this , the encoder 52 may be disposed on the motor axle 131 . [ 0052 ] fig2 shows a perspective rear view of the printing device 1 from above . the mail - item feed again takes place in the z - direction . the transport drum 51 is set in motion by the motor 13 , via the worm wheel 517 fastened on the bearing axle 516 , when a non - illustrated sensor for mail - item detection emits a signal and the microprocessor establishes a printing demand . located upstream are the driven draw - in roller 71 , on the same side of the guide plate 2 as the transport drum 51 , and the draw - in roller 72 of the additional pilot - control mechanism 7 for drawing in print carriers ( letters , mail items ) up to 10 mm . the upper draw - in roller 71 is coupled to a driven wheel 711 which is driven via a drive belt 519 which is set in motion by a driving wheel 518 on the bearing axle 516 ( fig3 ). the driving wheel 518 and the driven wheel 711 are , for example , toothed - belt wheels and the drive belt 519 is a toothed belt . the non - driven draw - in roller 72 is mounted rotatably on an axle 761 of the front rocker 76 of the pilot - control mechanism 7 . the mutually parallel legs that carry the axle 761 of the draw - in roller 72 are connected fixedly via a spacer piece 768 . the rocker 76 is mounted pivotably about a fixed bearing axle 766 . any influence exerted on the printing image by the pair of draw - in rollers is ruled out in that the pressure forces and coefficients of friction between the transport drum 51 and a back - pressure roller 61 are configured to be at least one order of magnitude higher than those with respect to the pairing of the draw - in rollers 71 , 72 . to increase the coefficients of friction , the transport drum 51 has , on its outer surface , at least one annular friction covering 513 , 514 conforming to the circumference of the transport drum . 51 . the back - pressure rollers 61 , 62 are mounted rotatably on an axle 661 of the rear rocker 66 of the back - pressure device 6 . the mutually parallel legs of the rocker 66 , the legs carrying the axle 661 of the rollers 61 , 62 , are connected via a spacer piece 668 . the rocker 66 is mounted pivotably about a fixed bearing axle 666 . the transport drum 51 and the sprung back - pressure rollers in the vicinity of the printing region makes it possible to dispense with further devices for transport downstream in the region of the print - carrier ejection . this rules out the situation where the further device of transport leads to a print offset . the two ½ - inch ink - jet printing heads 21 , 22 project with their ink containers into the orifice 515 of the transport drum 51 . this ensures that the 1 - inch printing region is very near to the force transmission region . the correspondence side of the ½ - inch ink - jet printing head 21 , 22 lies in the x - direction and is configured in a particular predetermined way . corresponding contacting units 211 and 221 are adapted to the correspondence side of the ½ink - jet printing heads 21 , 22 for electronic signal conversion and mechanical connection . [ 0055 ] fig3 illustrates a perspective front view of the printing device from below . advantageously , the rockers 66 and 76 are formed in each case from two angle levers 662 , 663 and 762 , 763 mounted pivotably at a fixed location . the two angle levers 662 , 663 and 762 , 763 of each of the rockers 66 and 76 are parallel to one another . they are fixedly connected to one another with their first legs , which in each case carry the axles 661 and 761 of the rollers 61 , 62 and 72 , via a spacer piece 668 and 768 and with heir second legs 664 , 665 and 764 , 765 via a spacer piece 667 and 767 . a bolt 65 or 75 is fastened for spring suspension to the latter legs 664 , 665 and 764 , 765 respectively . advantageously , the rockers 66 and 76 can be produced as a plastic molding by the injection - molding method . the rockers 66 and 76 in each case pivot about the fixed bearing axles 666 and 766 . however , the pivoting of the rocker 76 takes place by virtue of the thickness of a print carrier , but that of the rocker 66 takes place by virtue of the coupling of the latter to the front rocker 76 via a lifting rod 77 . the springs counteracting the respective differing outward pivoting of the rockers 66 and 76 are configured as tension springs 63 and 73 , the tension springs acting on the legs 664 , 665 and 764 , 765 of the angle levers 662 , 663 and 762 , 763 and being fastened to a bolt 65 or 75 for spring suspension . the tension springs 63 and 73 are fastened at the other end to a fixed bolt 64 and 74 respectively for spring suspension . the fixed bolts 64 and 74 are an integral part of a supporting frame , not shown , or of the housing 4 or are fastened to the latter in a way known per se . due to the spring force of at least the first tension spring 63 , the back - pressure rollers 61 , 62 act on the print carrier through the orifice 81 in the feed deck 8 . due to the spring force of the second tension spring 73 , the lower draw - in roller 72 can act on the upper draw - in roller 71 or on the print carrier through the orifice 82 in the feed deck 8 . in this case , the orifice 82 is disposed next to the orifice 81 , the orifice 81 being offset to the further orifice 82 in the z - direction . the tension spring 63 of the rear rocker 66 and the tension spring 73 of the front rocker 76 exert in each case a sprung back pressure on the print carrier resting against the driven draw - in roller 71 , against the driven transport drum 51 or against the guide plate 2 . the print carrier is , for example , a mail item , not illustrated in fig3 . the legs 664 , 665 of the angle levers of the rear rocker 66 are coupled to the legs 764 , 765 of the angle levers of the front rocker 76 via the lifting rod 77 , in such a way that an opening of the front rocker 76 having the draw - in roller 72 results in a lesser opening of the rear rocker 66 having the back - pressure roller 61 , 62 . a movement of the front rocker 76 caused by the thickness of the print carrier is transmitted at least partially to the rear rocker 66 . for this purpose , a bolt 7671 , of the front rocker 76 along a transport path , is disposed in a hole 771 of the lifting rod 77 at one end of the latter . the bolt 65 , of the rear rocker 66 along the transport path , is disposed in a long hole 772 of the lifting rod 77 at the other end of the latter . the long hole 772 in the lifting rod 77 makes it possible , on the one hand , for the rear rocker 66 having the back - pressure rollers 61 , 62 to open further and , on the other hand , for the draw - in rollers 71 , 72 to close . the spring constant of the tension spring 63 is substantially higher than , but at least double , that of the tension spring 73 . for example , a pressing force of 5 to 20 newton prevails between the draw - in rollers 71 , 72 , but a pressing force of 10 to 50 newton prevails between the transport drum 51 and the back - pressure rollers 61 , 62 , so as not to influence adversely the transport or the printing image by the pilot control . [ 0059 ] fig4 illustrates a section through the front view of the printing device with the transport and back - pressure device 5 according to a second variant . the transport and drive device 5 corresponds essentially to the device already explained according to the first variant . however , the guide plate 2 and the feed deck 8 , including the orifices therein , have been omitted for reasons of simplification . another difference is the configuration of the encoder 52 near the motor axle 131 . fastened on the motor axle 131 is an encoder disk 524 that a light barrier 523 of the encoder 52 senses . alternatively to this , the encoder 52 may be disposed on the transport drum 51 . the back - pressure device 6 according to the second variant is formed of at least one long rocker 68 mounted pivotably at a fixed location and of at least one short rocker 69 mounted pivotably at a fixed location . the above - mentioned rockers in each case pivot about a fixed bearing axle 696 , in each case counter to a spring force . it should be stressed , as regards the back - pressure device 6 according to the second variant , that this manages without a pilot - control mechanism . since two annular friction coverings 513 and 514 for increasing the coefficients of friction are disposed on the outer surface of the transport drum 51 in conformity to the circumference of the latter , the back - pressure device 6 is equipped with two long rockers 67 , 68 which are mounted pivotably at a fixed location and each carry at least one nondriven back - pressure conveyor belt 671 , 672 and 681 , 682 . the latter draws even relatively thick mail items into the force transmission region , without the pilot - control mechanism 7 , and then adapts more closely to the mail item resting against the circumference of the transport drum 51 and increases the feeding surface between the mail item and the transport drum 51 . supporting rollers 6711 , 6721 , 674 and 6811 , 6821 , 684 are mounted rotatably on axles 675 , 676 and 685 , 686 . the back - pressure conveyor belt can be pretensioned by an axle 673 and 683 of the inner deflecting rollers . the axle 673 and 683 can be fixed by a locking nut 6731 and 6831 . [ 0060 ] fig5 shows a view from below of the back - pressure device 6 according to the second variant . the construction of the long rockers 67 , 68 is preferably approximately identical . the construction is in each case box - shaped with a middle web carrying a spring guide boss 679 , 689 , on which engages one side of a compression spring 47 , 48 which is supported on its other side ( in a way not shown ) on the bottom or frame of the housing 4 . only one of the two long rockers 67 , 68 mounted pivotably at a fixed location has the integrated short rocker 69 which is mounted pivotably at a fixed location and which is likewise supported on the housing bottom or on the frame via a spring guide boss 699 and a compression spring 43 . the short rocker 69 is mounted pivotably on the common fixed bearing axle 696 and carries a lower non - driven draw - in roller 691 ( fig4 ). a non - illustrated sensor for mail - item detection is also disposed , upstream of the pair of draw - in rollers 71 , 691 , in corresponding further orifices in the guide plate 2 and / or in the feed deck 8 . the measurement location is disposed in the vicinity of the transport path upstream of one of the printing heads positioned in the printing position . disposed at the measurement location in the orifice 3 are rigid light guide elements which are configured as transparent plastic light guides for fixing and focusing an ir light beam and which transmit ir light co a main circuit board 14 of the housing bottom . an interruption in the ir light beam leads to the activation of the motor 13 . the short rocker 69 is mounted pivotally on the common fixed bearing axle 696 in a first box - shaped orifice 6801 of the long rocker 68 . the short rocker has two legs 694 , 695 and carries the lower non - driven draw - in roller 691 rotatably on an axle 692 disposed between the two legs . a middle piece 693 between the legs 694 , 695 of the short rocker 69 carries the spring guide boss 699 . the compression spring 43 of the short rocker 69 and the compression springs 47 , 48 of the long rockers 67 , 68 bring about a sprung back pressure on a print carrier resting against the driven draw - in roller 71 , against the driven transport drum 51 or against the guide plate 2 . due to a spring force of the first compression spring 47 , 48 , the non - driven back - pressure conveyor belt 671 , 672 or 681 , 682 acts on the print carrier through the orifice 81 in the feed deck 8 . a spring constant of the first compression spring 47 , 48 is substantially higher than that of the second compression spring 43 . due to a spring force of the second compression spring 43 , the non - driven lower draw - in roller 691 acts on the print carrier 12 through the orifice 82 in the feed deck 8 and lays the print carrier against the guide plate 2 or against the driven draw - in roller 71 . the lower non - driven draw - in roller 691 and the driven draw - in roller 71 form a pair or draw - in rollers 71 , 691 which thus exerts a lower transport force on the print carrier , for example a mail item , not shown . the at least one non - driven back - pressure conveyor belt 671 , 672 or 681 , 682 is mounted on rollers in a second box - shaped orifice 6702 , 6802 of the at least one long rocker 67 , 68 . the non - driven back - pressure conveyor belt 671 , 672 is depicted cut away for the purpose of explaining the roller configuration . the roller configuration is identical for each of the long rockers 67 , 68 . two outer supporting rollers 6711 , 6721 and 6811 , 6821 are mounted rotatably on the axles 676 and 686 and are mounted at a distance from one another by spacer disks 6713 , 6723 and 6813 , 6823 . a guide edge 6712 , 6722 and 6812 , 6822 of the outer supporting rollers prevents the above - mentioned back - pressure conveyor belt 671 , 672 and 681 , 682 from sliding down . a middle support roller 674 or 684 engages into the interspace of the outer supporting rollers located at a distance from one another and is mounted rotatably on the axle 675 and 685 . the inner deflecting rollers 677 , 678 and 687 , 688 are mounted rotatably on the axles 673 and 683 and have a reduced diameter , as compared with that of other supporting rollers . this results in the back - pressure conveyor belt 671 , 672 and 681 , 682 being guided from the outset along an ascending run on the above - mentioned roller configuration as far as the middle supporting roller 674 and 684 in each case . by virtue of the above - mentioned guidance , an additional pilot - control mechanism may be dispensed with for mail - item thicknesses ( letter thicknesses ) of below 10 mm . the invention is not restricted to the present embodiment . on the contrary , a number of variants may be envisaged within the scope of the claims . thus , further different versions of the invention may obviously be developed or employed which , emanating from the same basic idea of the invention , are embraced by the accompanying claims . | 1 |
the present invention discloses an instant response pressure sensor which senses extremely small pressures applied against the sensor . the feature of early response makes it suitable for being used as an immediate sensor such as a pressure sensitive electronic pen , or a pressure sensitive volume button for an electronic apparatus . . . etc . fig4 a ˜ 4 b show a first embodiment according to the present invention . fig4 a shows a first embodiment of an instant response pressure sensor which has a top substrate 10 t , a top electrode 11 t configured on a bottom side of the top substrate 10 t , a top piezoresistor 12 t configured on a bottom side of the top electrode 11 t , a bottom piezoresistor 12 b configured under the top piezoresistor 12 t , a bottom electrode 11 b configured on a bottom side of the bottom piezoresistor 12 b , and a bottom substrate 10 b configured on a bottom side of the bottom electrode 11 b . a top surface of the bottom piezoresistor 12 b is configured to contact a bottom surface of the top piezoresistor 12 t with an infinite resistance therebetween before a pressure is applied against the pressure sensor . fig4 b shows an interface between the top piezoresistor and the bottom piezoresistor . a bottom surface of the top piezoresistor 12 t is rugged in a microscopic view , and a top surface of the bottom piezoresistor 12 b is also rugged in a microscopic view , therefore partial area contacts 121 exist therebetween and an infinite resistance is displayed therebetween due to extremely small area contact . fig5 a ˜ 5 c show an operation of the first embodiment fig5 a shows that the pressure sensor displays a current i 0 which is zero ampere ( i 0 = 0 ) and a resistance r 0 which is infinity ( r 0 =∞) before it is depressed . at this moment , the bottom surface of the top piezoresistor 12 t is shown at a position p 0 . fig5 b shows that the pressure sensor displays a current i 1 which is larger than zero ampere ( i 1 & gt ; 0 ), a measurable resistance r 1 is displayed which is smaller than r 0 ( r 1 & lt ; r 0 ) when the pressure sensor is depressed initially . in other words , the pressure sensor is lightly depressed and at this moment , the bottom surface of the top piezoresistor 12 t is shown at a position p 1 . fig5 c shows that the pressure sensor displays a current i 2 larger than the current i 1 ( i 2 & gt ; i 1 ), a measurable resistance r 2 is displayed which is smaller than r 1 ( r 2 & lt ; r 1 ) when it is depressed further more . in other words , the pressure sensor is depressed heavier than the position it was as shown in fig5 b . at this moment , the bottom surface of the top piezoresistor 12 t is at a position p 2 . fig6 shows resistance v . press journey for the first embodiment fig6 shows that the resistance r 0 of the first embodiment is infinity when the bottom surface of the top piezoresistor 12 t is at a position p 0 . the resistance r 1 is displayed for the first embodiment when the bottom surface of the top piezoresistor 12 t is depressed at a position p 1 . referring to fig6 a trigger position px for the first embodiment can be found in between position p 0 and p 1 , namely p 0 & lt ; px & lt ; p 1 , and a corresponding resistance rx can be detected for the trigger position px , where ∞& gt ; rx & gt ; r 1 . fig7 shows a comparison of the electric characteristics between the present invention and the prior art . a left lower curve shows the electric characteristics for the present invention . a right upper curve shows the electric characteristics for the prior art . under similar operation , the present invention has a trigger position at px and the prior art has a trigger position at p 2 ; where p 2 & gt ; px . that means the present invention can trigger very earlier than a prior art . correctly to say , the present invention triggers at the very beginning when a pressure applied against the pressure sensor , even an extremely small pressure is applied . meanwhile , the press journey is extremely small before trigging . fig8 a ˜ 8 b show a second embodiment according to the present invention fig8 a shows that an instant response pressure sensor has a top electrode 11 t ; a piezoresistor 12 t is configured on a bottom side of the top electrode 11 t ; a bottom electrode 11 b is configured under the piezoresistor 12 t ; wherein the piezoresistor 12 t contacts the bottom electrode 11 b with an infinite resistance before a pressure applied against the pressure sensor , where i = 0 . a top substrate 10 t is configured on a top side of the top electrode 11 t , and a bottom substrate 10 b is configured on a bottom side of the bottom electrode 11 b . fig8 b shows an interface between the piezoresistor and the bottom electrode since a bottom surface of the piezoresistor 12 t is rugged in a microscopic view so that partial area contacts exist to maintain an infinite resistance between the piezoresistor and the bottom electrode . fig9 shows that a current i passes through the top electrode 11 t , the piezoresistor 12 t and the bottom electrode 11 b when a pressure is applied against the pressure sensor , where i & gt ; 0 . fig1 a ˜ 10 b show a third embodiment according to the present invention fig1 a shows that an instant response pressure sensor has a top electrode 11 t ; a piezoresistor 12 b is configured under a bottom side of the top electrode 11 t ; wherein the top electrode 11 t contacts the piezoresistor 12 b with an infinite resistance before a pressure applied against the pressure sensor , where i = 0 ; a bottom electrode 11 b is configured on a bottom surface of the piezoresistor 12 b . a top substrate 10 t is configured on a top side of the top electrode 11 t ; and a bottom substrate 10 b is configured on a bottom side of the bottom electrode 11 b . fig1 b shows an interface between the top electrode and the piezoresistor since a top surface of the piezoresistor 12 b is rugged in a microscopic view so that partial area contacts exist to maintain an infinite resistance between the top electrode 11 t and the piezoresistor 12 b . fig1 shows that a current i passes through the top electrode 11 t , the piezoresistor 12 b and the bottom electrode 11 b when a pressure is applied against the pressure sensor , where i & gt ; 0 . fig1 a ˜ 12 b show a fourth embodiment according to the present invention fig1 a shows that an instant response pressure sensor has a piezoresistor 12 t ; a first electrode 11 lb , and a second electrode 11 rb coplanar with the first electrode 11 lb , are configured under a bottom side of the piezoresistor 12 t ; wherein the piezoresistor 12 t contacts the top surface of the two electrodes 11 lb , 11 rb with an infinite resistance therebetween before a pressure applied against the pressure sensor , where i = 0 ; a top substrate 10 t is configured on a top side of the piezoresistor 12 t ; and a bottom substrate 10 b is configured on a bottom side of the two electrodes 11 lb , 11 rb . fig1 b shows an interface between the piezoresistor and the two electrodes since a bottom surface of the piezoresistor 12 t is rugged in a microscopic view so that partial area contacts exist to maintain an infinite resistance between it and the two bottom electrodes 11 lb , 11 rb . fig1 shows that a current i passes through the left electrode 11 lb , the piezoresistor 12 t and the right electrode 11 rb when a pressure is applied against the pressure sensor , where i & gt ; 0 . fig1 a ˜ 14 b show a fifth embodiment according to the present invention fig1 a shows that an instant response pressure sensor has a first electrode 11 lt , and a second electrode 11 rt coplanar with the first electrode 11 lt ; a piezoresistor 12 b is configured under a bottom side of the two electrodes 11 lt , 11 rt ; wherein the electrodes contact the top surface of the piezoresistor 12 b with an infinite resistance therebetween before a pressure applied against the pressure sensor , where i = 0 . a top substrate 10 t is configured on a top side of the two electrodes 11 lt , 11 rt ; and a bottom substrate 10 b is configured on a bottom side of the piezoresistor 12 b . fig1 b shows an interface between the two electrodes and the piezoresistor since a top surface of the piezoresistor 12 b is rugged in a microscopic view so that partial area contacts exist to maintain an infinite resistance between the piezoresistor 12 b and the two electrodes 11 lt , 11 rt . fig1 shows that a current i passes through the left electrode 11 lt , the piezoresistor 12 b and the right electrode 11 rt when a pressure is applied against the pressure sensor , where i & gt ; 0 . fig1 shows a first application of the pressure sensor according to the present invention an electronic pen 60 has an instant response pressure sensor 61 of the present invention configured on a backside of a tip base 62 . the tip base 62 is configured on a back side of a pen tip 61 . the instant response pressure sensor 61 is configured for sensing a pressure applied against the pen tip 61 ; an electrical signal is generated corresponding to the pressure applied for a further processing . a circuit board 64 is configured on a backside of the instant response pressure sensor 63 , for processing the signal received from the instant response pressure sensor 63 . the circuit board 64 electrically couples to a control circuit 66 , the control circuit 66 electrically couples to a computer 67 which in turn electrically couples to a display 68 . a sensing panel 65 is configured for sensing the pressure applied from the pen tip 61 . the sensing panel 65 electrically couples to the computer 67 , so that the display 68 can display an image delineated by the pen 60 . fig1 shows a second application of the pressure sensor according to the present invention fig1 shows that a mobile phone 70 has a volume control button 71 ; the volume control button 71 has top end 711 depressible to increase the volume , and has a bottom end 712 depressible to decrease the volume . a first instant response pressure sensor 72 is configured on a bottom side of a top end 711 of the button 71 for sensing pressures applied against the top end 711 of the button 71 . a second instant response pressure sensor 73 is configured on a bottom side of the bottom end 712 of the button 71 for sensing pressures applied against the bottom end 712 of the button 71 . a first electrical signal is generated corresponding to the pressure applied against the top end 711 of the button 71 for a further processing , and a second electrical signal is generated corresponding to the pressure applied against the bottom end 712 of the button for a further processing . while several embodiments have been described by way of example , it will be apparent to those skilled in the art that various modifications may be configured without departs from the spirit of the present invention . such modifications are all within the scope of the present invention , as defined by the appended claims . | 6 |
the following detailed description is of the best currently contemplated modes of carrying out exemplary embodiments of the invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention , since the scope of the invention is best defined by the appended claims . various inventive features are described below that can each be used independently of one another or in combination with other features . broadly , embodiments of the present invention generally provide photo - catalytic cells in which reflectors may be positioned to reflect uv energy and increase a proportion of emitted uv energy that strikes titanium dioxide in the cell at high incident angles . referring now to the figures , it may be seen that an exemplary embodiment of a photo - catalytic cell 10 may comprise an electronics box 12 ; a light pipe indicator 14 ; a power cord 16 ; a chamber 18 ; honeycomb targets 20 ; uv reflectors 22 - 1 , 22 - 2 and 22 - 3 ; and a uv emitter or lamp 24 . the honeycomb targets 20 may be coated with titanium dioxide . in operation , air may pass across the honeycomb targets 20 while uv energy may be applied to the target 20 by the lamp 24 . a photo - catalytic reaction may take place in the presence of the uv energy . the reaction may produce bactericidal molecules in the air . referring now particularly to fig3 , the efficacy of the uv reflectors 22 - 1 may be illustrated . if the reflector 22 - 1 were not present , an emitted ray 26 might pass through the honeycomb target 20 without impinging on the titanium dioxide . however , when one of the reflectors 22 - 1 is present , an illustrative emitted ray 28 - 1 of uv energy may impinge on the uv reflectors 22 - 1 . the ray 28 - 1 may be reflected to become a reflected ray 28 - 2 . it may be seen that the reflected ray 28 - 2 may impinge on a surface of the honeycomb target 20 . it may be seen that a hypothetical unreflected ray 26 , which might follow a path parallel to that of the ray 28 - 1 , might pass through the honeycomb target 20 without impinging on the target 20 . thus , presence of the reflector 22 - 1 in the path of the ray 28 - 1 may result in avoidance of loss of the uv energy from the ray 28 - 1 . the reflectors 22 - 1 may be relatively small as compared to the size of the honeycomb target 20 . the small size ( about 10 % of the size of the target 20 ) may allow for minimal air flow obstruction . in spite of their relatively small size , the reflectors 22 - 1 may be effective because they may reflect virtually all of the ( normally lost ) uv energy that is emitted in a direction that is almost orthogonal ( i . e ., within ± 5 ° of orthogonality ) to the outer vertical plane of the honeycomb target 20 . hence , uv energy would pass thru the honeycomb target without touching the tio2 surface . but by “ reflecting ” the uv rays onto the “ opposite side ” target matrix — that energy could be captured and utilized so as to add to the total ion count within the desired cloud of ionized molecules . in other words , the number of ions created by any incoming uv ray is proportional to the sine of the incident angle ( theta ) between the uv ray path and the tio2 surface that a given ray is impacting . at theta = 90 deg sine ( 90 )= 1 maximum energy gathered at theta = 0 deg sine ( 0 )= 0 minimum energy gathered reflectors 22 - 3 may be interposed between the lamp 24 and walls of the chamber 18 . uv energy striking the reflectors 22 - 3 may be reflected onto the honeycomb target 20 . thus presence of the reflectors 22 - 3 may result in avoidance of loss of uv energy that might otherwise be absorbed or diffused by walls of the chamber 18 . similarly , reflectors 22 - 2 may be placed in corners of the chamber 18 to reflect uv energy onto the honeycomb target 20 . the reflectors 22 - 1 , 22 - 2 and / or 22 - 3 may be constructed from material that is effective for reflection of energy with a wavelength in the uv range ( i . e ., about 184 nanometers [ nm ] to about 255 nm ). while soft metals such as gold and silver surfaces may be effective reflectors for visible light , their large grain size may make them less suitable than metallic surfaces with a small grain size ( i . e ., hard metals ). thus , hard metals such as chromium and stainless steel and other metals that do not readily oxidize may be effective uv reflectors and may be particularly effective for use as uv reflectors in the photo - catalytic cell 10 . material with a uv reflectivity of about 90 % or higher may be suitable for use in the reflectors 22 - 1 , 22 - 1 and 22 - 3 . lower reflectively produces lower effectiveness . to achieve the level of reflection required , it may be necessary to “ micro - polish or buff ” a selected materials reflective surface to achieve the specifications defined in para 22 ]- 24 ] below . advantageously , reflecting surfaces of the reflectors 22 should be electrically conductive . specifically , outer surface coatings ( added for oxidation protection ) like glass , clear plastics , clear anodization ( i . e . non - conductive ) may diminish ( considerably ) any performance enhancement of the photo - catalytic cell 10 . also it is important that reflecting surfaces of the uv reflector 22 produce surface specular reflection . ( specular reflection being a “ mirror - like reflection ” of light — in which a single incoming light ray is reflected into a single outgoing direction ) specular reflection is distinct from “ diffuse ” reflection where an incoming light ray is reflected into a broad range of directions . diffuse reflection may diminish performance enhancement of the photo - catalytic cell 10 . in an exemplary embodiment of the photo - catalytic cell 10 , the reflectors 22 - 1 , 22 - 2 and 22 - 3 may be chromium - plated plastic . chromium - plated plastic may be a desirably low cost material with a desirably high degree of reflectivity for uv energy . so called “ soft chrome ” such as the plating used to produce a mirror - like finish that is seen on automobile chromed surfaces may be advantageously employed . it may be noted that there may be other cell shape designs which are not rectangular . for example , the cell 10 may be circular , tubular , or may have an otherwise complex shape . for these non - rectangular shaped cells , an optimum reflector design may be curved or otherwise non - flat in shape . it should be understood , of course , that the foregoing relates to exemplary embodiments of the invention and that modifications may be made without departing from the spirit and scope of the invention as set forth in the following claims . | 1 |
surprisingly it has been found that compounds of general formula ( i ) wherein the groups l and r 1 to r 5 have the meanings given hereinafter act as inhibitors of specific cell cycle kinases . thus , the compounds according to the invention may be used for example to treat diseases connected with the activity of specific cell cycle kinases and characterised by excessive or abnormal cell proliferation . the present invention therefore relates to compounds of general formula ( i ) r 1 , r 2 which may be identical or different , denote hydrogen or optionally substituted c 1 - c 6 - alkyl , or r 1 and r 2 together denote a 2 - to 5 - membered alkyl bridge which may contain 1 to 2 heteroatoms , r 3 denotes hydrogen or a group selected from among optionally substituted c 1 - c 12 - alkyl , c 2 - c 12 - alkenyl , c 2 - c 12 - alkynyl and c 6 - c 14 - aryl , or a group selected from among optionally substituted and / or bridged c 3 - c 12 - cycloalkyl , c 3 - c 12 - cycloalkenyl , c 7 - c 12 - polycycloalkyl , c 7 - c 12 - polycycloalkenyl , c 5 - c 12 - spirocycloalkyl , c 3 - c 12 - heterocycloalkyl which contains 1 to 2 heteroatoms , and c 3 - c 12 - heterocycloalkenyl which contains 1 to 2 heteroatoms , or r 1 and r 3 or r 2 and r 3 together denote a saturated or unsaturated c 3 - c 4 - alkyl bridge which may contain 1 heteroatom , r 4 denotes a group selected from among hydrogen , — cn , hydroxy , — nr 6 r 7 and halogen , or a group selected from among optionally substituted c 1 - c 6 - alkyl , c 2 - c 6 - alkenyl , c 2 - c 6 - alkynyl , c 1 - c 5 - alkyloxy , c 2 - c 5 - alkenyloxy , c 2 - c 5 - alkynyloxy , c 1 - c 6 - alkylthio , c 1 - c 6 - alkylsulphoxo and c 1 - c 6 - alkylsulphonyl , l denotes a linker selected from among optionally substituted c 2 - c 10 - alkyl , c 2 - c 10 - alkenyl , c 6 - c 14 - aryl , — c 2 - c 4 - alkyl - c 6 - c 14 - aryl , — c 6 - c 14 - aryl - c 1 - c 4 - alkyl , optionally bridged c 3 - c 12 - cycloalkyl and heteroaryl which contains 1 or 2 nitrogen atoms , n denotes 0 or 1 m denotes 1 or 2 r 5 denotes a group selected from among optionally substituted morpholinyl , piperidinyl , piperazinyl , piperazinylcarbonyl , pyrrolidinyl , tropenyl , r 8 - diketomethylpiperazinyl , sulphoxomorpholinyl , sulphonylmorpholinyl , thiomorpholinyl , — nr 8 r 9 and azacycloheptyl , r 6 , r 7 which may be identical or different , denote hydrogen or c 1 - c 4 - alkyl , and r 8 , r 9 denote unsubstituted nitrogen substituents at r 5 , which may be identical or different , denote either hydrogen or a group selected from among c 1 - c 6 - alkyl , — c 1 - c 4 - alkyl - c 3 - c 10 - cycloalkyl , c 3 - c 10 - cycloalkyl , c 6 - c 14 - aryl , — c 1 - c 4 - alkyl - c 6 - c 14 - aryl , pyranyl , pyridinyl , pyrimidinyl , c 1 - c 4 - alkyloxycarbonyl , c 6 - c 14 - arylcarbonyl , c 1 - c 4 - alkylcarbonyl , c 6 - c 14 - arylmethyloxycarbonyl , c 6 - c 14 - arylsulphonyl , c 1 - c 4 - alkylsulphonyl - and c 6 - c 14 - aryl - c 1 - c 4 - alkylsulphonyl -, optionally in the form of the tautomers , the racemates , the enantiomers , the diastereomers and the mixtures thereof , and optionally the pharmacologically acceptable acid addition salts thereof . r 1 to r 4 , r 6 and r 7 are as hereinbefore defined , and l denotes a linker selected from among optionally substituted c 2 - c 10 - alkyl , c 2 - c 10 - alkenyl , c 6 - c 14 - aryl , — c 2 - c 4 - alkyl - c 6 - c 14 - aryl , — c 6 - c 14 - aryl - c 1 - c 4 - alkyl , optionally bridged c 3 - c 12 - cycloalkyl and heteroaryl which contains 1 or 2 nitrogen atoms n denotes 1 m denotes 1 or 2 r 5 denotes a group which is bound to l via a nitrogen atom , selected from among optionally substituted morpholinyl , piperidinyl , r 8 - piperazinyl , pyrrolidinyl , tropenyl , r 8 - diketomethylpiperazinyl , sulphoxomorpholinyl , sulphonylmorpholinyl , thiomorpholinyl , — nr 8 r 9 and azacycloheptyl , r 8 , r 9 denote unsubstituted nitrogen substituents at r 5 , which may be identical or different , hydrogen or a group selected from among c 1 - c 6 - alkyl , — c 1 - c 4 - alkyl - c 3 - c 10 - cycloalkyl , c 3 - c 10 - cycloalkyl , c 6 - c 14 - aryl , — c 1 - c 4 - alkyl - c 6 - c 14 - aryl , pyranyl , pyridinyl , pyrimidinyl , c 1 - c 4 - alkyloxycarbonyl , c 6 - c 14 - arylcarbonyl , c 1 - c 4 - alkylcarbonyl , c 6 - c 14 - arylmethyloxycarbonyl , c 6 - c 14 - arylsulphonyl , c 1 - c 4 - alkylsulphonyl and c 6 - c 14 - aryl - c 1 - c 4 - alkylsulphonyl , optionally in the form of the tautomers , the racemates , the enantiomers , the diastereomers and the mixtures thereof , and optionally the pharmacologically acceptable acid addition salts thereof . r 1 to r 4 , r 6 and r 7 are as hereinbefore defined , l denotes a linker selected from among optionally substituted c 2 - c 10 - alkyl , c 2 - c 10 - alkenyl , c 6 - c 14 - aryl , — c 2 - c 4 - alkyl - c 6 - c 14 - aryl , — c 6 - c 14 - aryl - c 1 - c 4 - alkyl , optionally bridged c 3 - c 12 - cycloalkyl and heteroaryl which contains 1 or 2 nitrogen atoms n denotes 0 or 1 m denotes 1 or 2 r 5 denotes a group which is bound to l via a carbon atom , selected from among r 8 - piperidinyl , r 8 r 9 - piperazinyl , r 8 - pyrrolidinyl , r 8 - piperazinylcarbonyl , r 8 - tropenyl , r 8 - morpholinyl and r 8 - azacycloheptyl , and r 8 , r 9 denote unsubstituted nitrogen substituents at r 5 , which may be identical or different , hydrogen or a group selected from among c 1 - c 6 - alkyl , — c 1 - c 4 - alkyl - c 3 - c 10 - cycloalkyl , c 3 - c 10 - cycloalkyl , c 6 - c 14 - aryl , — c 1 - c 4 - alkyl - c 6 - c 14 - aryl , pyranyl , pyridinyl , pyrimidinyl , c 1 - c 4 - alkyloxycarbonyl , c 6 - c 14 - arylcarbonyl , c 1 - c 4 - alkylcarbonyl , c 6 - c 14 - arylmethyloxycarbonyl , c 6 - c 14 - arylsulphonyl , c 1 - c 4 - alkylsulphonyl and c 6 - c 14 - aryl - c 1 - c 4 - alkylsulphonyl , optionally in the form of the tautomers , the racemates , the enantiomers , the diastereomers and the mixtures thereof , and optionally the pharmacologically acceptable acid addition salts thereof . l , m , n and r 3 to r 9 are as hereinbefore defined , and r 1 , r 2 which may be identical or different , denote a group selected from among hydrogen , me , et , pr , or r 1 and r 2 together form a c 2 - c 4 - alkyl bridge , optionally in the form of the tautomers , the racemates , the enantiomers , the diastereomers and the mixtures thereof , and optionally the pharmacologically acceptable acid addition salts thereof . r 1 , r 2 , m , n and r 5 to r 8 are as hereinbefore defined , and r 3 denotes a group selected from among optionally substituted c 1 - c 10 - alkyl , c 3 - c 7 - cycloalkyl , c 3 - c 6 - heterocycloalkyl and c 6 - c 14 - aryl or r 1 and r 3 or r 2 and r 3 together denote a saturated or unsaturated c 3 - c 4 - alkyl bridge which may contain 1 to 2 heteroatoms , r 4 denotes a group selected from among hydrogen , ome , oh , me , et , pr , oet , nhme , nh 2 , f , cl , br , o - propargyl , o - butynyl , cn , sme , nme 2 , conh 2 , ethynyl , propynyl , butynyl and allyl , and l denotes a linker selected from among optionally substituted phenyl , phenylmethyl , cyclohexyl and branched c 1 - c 6 - alkyl , optionally in the form of the tautomers , the racemates , the enantiomers , the diastereomers and the mixtures thereof , and optionally the pharmacologically acceptable acid addition salts thereof . the invention further relates to compounds of formula i for use as pharmaceutical compositions . of particular importance according to the invention are compounds of formula i for use as pharmaceutical compositions with an antiproliferative activity . the invention also relates to the use of a compound of formula i for preparing a pharmaceutical composition for the treatment and / or prevention of cancer , infections , inflammatory and autoimmune diseases . the invention also relates to a method of treating and / or preventing cancer , infections , inflammatory and autoimmune diseases , characterised in that a patient is given an effective amount of a compound of formula i . the invention also relates to pharmaceutical preparations , containing as active substance one or more compounds of general formula ( i ) or the physiologically acceptable salts thereof , optionally combined with conventional excipients and / or carriers . the invention also relates to a process for preparing a compound of general formula ( i ), r 1 - r 5 , m , n and l are as hereinbefore defined , characterised in that a compound of general formula ( ii ) r 1 - r 3 are as hereinbefore defined and a is a leaving group , is reacted with an optionally substituted compound of general formula ( iii ), r 4 is as hereinbefore defined and r 10 denotes oh , nh - l - r 5 , — o - methyl , — o - ethyl , and optionally then the product of general formula ( iv ) r 1 to r 4 is as hereinbefore defined and r 10 denotes oh , — nh - l - r 5 , — o - methyl or — o - ethyl , optionally after previous hydrolysis of the ester group — cor 10 , is reacted with an amine of general formula ( v ) r 1 - r 3 are as hereinbefore defined and a is a leaving group . the term alkyl groups , including alkyl groups which are a part of other groups , denotes branched and unbranched alkyl groups with 1 to 12 carbon atoms , preferably 1 - 6 , most preferably 1 - 4 carbon atoms , such as , for example : methyl , ethyl , propyl , butyl , pentyl , hexyl , heptyl , octyl , nonyl , decyl and dodecyl . unless otherwise stated , the abovementioned terms propyl , butyl , pentyl , hexyl , heptyl , octyl , nonyl , decyl and dodecyl include all the possible isomeric forms . for example , the term propyl includes the two isomeric groups n - propyl and iso - propyl , the term butyl includes n - butyl , iso - butyl , sec . butyl and tert .- butyl , the term pentyl includes iso - pentyl , neopentyl , etc . in the abovementioned alkyl groups one or more hydrogen atoms may optionally be replaced by other groups . for example these alkyl groups may be substituted by fluorine . all the hydrogen atoms of the alkyl group may optionally also be replaced . the term alkyl bridge , unless otherwise stated , denotes branched and unbranched alkyl groups with 1 to 5 carbon atoms , for example methylene , ethylene , propylene , isopropylene , n - butylene , iso - butyl , sec . butyl and tert .- butyl etc . bridges . methylene , ethylene , propylene and butylene bridges are particularly preferred . in the alkyl bridges mentioned 1 to 2 c - atoms may optionally be replaced by one or more heteroatoms selected from among oxygen , nitrogen or sulphur . the term alkenyl groups ( including those which are a part of other groups ) denotes branched and unbranched alkylene groups with 2 to 10 carbon atoms , preferably 2 - 6 carbon atoms , most preferably 2 - 3 carbon atoms , provided that they have at least one double bond . examples include : ethenyl , propenyl , butenyl , pentenyl etc . unless otherwise stated , the abovementioned terms propenyl , butenyl , etc also include all the possible isomeric forms . for example , the term butenyl includes 1 - butenyl , 2 - butenyl , 3 - butenyl , 1 - methyl - 1 - propenyl , 1 - methyl - 2 - propenyl , 2 - methyl - 1 - propenyl , 2 - methyl - 2 - propenyl and 1 - ethyl - 1 - ethenyl . in the abovementioned alkenyl groups , unless otherwise stated , one or more hydrogen atoms may optionally be replaced by other groups . for example , these alkyl groups may be substituted by the halogen atom fluorine . all the hydrogen atoms of the alkenyl group may optionally also be replaced . the term alkynyl groups ( including those which are a part of other groups ) denotes branched and unbranched alkynyl groups with 2 to 10 carbon atoms , provided that they have at least one triple bond , for example ethynyl , propargyl , butynyl , pentynyl , hexynyl etc ., preferably ethynyl or propynyl . in the abovementioned alkynyl groups , unless otherwise stated , one or more hydrogen atoms may optionally be replaced by other groups . for example , these alkyl groups may be substituted by fluorine . all the hydrogen atoms of the alkynyl group may optionally also be replaced . the term aryl denotes an aromatic ring system with 6 to 14 carbon atoms , preferably 6 or 10 carbon atoms , preferably phenyl , which , unless otherwise stated , may carry one or more of the following substituents , for example : oh , no 2 , cn , ome , — ochf 2 , — ocf 3 , — nh 2 , halogen , for example fluorine or chlorine , c 1 - c 10 - alkyl , preferably c 1 - c 5 - alkyl , preferably c 1 - c 3 - alkyl , most preferably methyl or ethyl , — o — c 1 - c 3 - alkyl , preferably — o - methyl or — o - ethyl , — cooh , — coo — c 1 - c 4 - alkyl , preferably — o - methyl or — o - ethyl , — conh 2 . examples of heteroaryl groups wherein up to two carbon atoms are replaced by one or two nitrogen atoms include pyrrole , pyrazole , imidazole , triazole , pyridine , pyrimidine , while each of the abovementioned heteroaryl rings may optionally also be anellated to a benzene ring , preferably benzimidazole , and unless otherwise stated these heterocycles may carry one or more of the following substituents , for example : f , cl , br , oh , ome , methyl , ethyl , cn , conh 2 , nh 2 , optionally substituted phenyl , optionally substituted heteroaryl , preferably optionally substituted pyridyl . examples of cycloalkyl groups are cycloalkyl groups with 3 - 12 carbon atoms , for example cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl or cyclooctyl , preferably cyclopropyl , cyclopentyl or cyclohexyl , while each of the abovementioned cycloalkyl groups may optionally also carry one or more substituents , for example : oh , no 2 , cn , ome , — ochf 2 , — ocf 3 , — nh 2 or halogen , preferably fluorine or chlorine , c 1 - c 10 - alkyl , preferably c 1 - c 5 - alkyl , preferably c 1 - c 3 - alkyl , more preferably methyl or ethyl , — o — c 1 - c 3 - alkyl , preferably — o - methyl or — o - ethyl , — cooh , — coo - c 1 - c 4 - alkyl , preferably — coo - methyl or — coo - ethyl or — conh 2 . particularly preferred substituents of the cycloalkyl groups are ═ o , oh , nh 2 , methyl or f . examples of cycloalkenyl groups are cycloalkyl groups with 3 - 12 carbon atoms which have at least one double bond , for example cyclopropenyl , cyclobutenyl , cyclopentenyl , cyclohexenyl or cycloheptenyl , preferably cyclopropenyl , cyclopententyl or cyclohexenyl , while each of the abovementioned cycloalkenyl groups may optionally also carry one or more substituents . examples of heterocycloalkyl groups , unless otherwise described in the definitions , include 3 - to 12 - membered , preferably 5 -, 6 - or 7 - membered , saturated or unsaturated heterocycles which may contain as heteroatoms nitrogen , oxygen or sulphur , for example tetrahydrofuran , tetrahydrofuranone , γ - butyrolactone , α - pyran , γ - pyran , dioxolane , tetrahydropyran , dioxane , dihydrothiophene , thiolan , dithiolan , pyrroline , pyrrolidine , pyrazoline , pyrazolidine , imidazoline , imidazolidine , tetrazole , piperidine , pyridazine , pyrimidine , pyrazine , piperazine , triazine , tetrazine , morpholine , thiomorpholine , diazepan , oxazine , tetrahydro - oxazinyl , isothiazole , pyrazolidine , preferably morpholine , pyrrolidine , piperidine or piperazine , while the heterocyclic group may optionally carry substituents , for example c 1 - c 4 - alkyl , preferably methyl , ethyl or propyl . examples of polycycloalkyl groups are optionally substituted , bi -, tri -, tetra - or pentacyclic cycloalkyl groups , for example pinane , 2 , 2 , 2 - octane , 2 , 2 , 1 - heptane or adamantane . examples of polycycloalkenyl groups are optionally bridged and / or substituted 8 - membered bi -, tri -, tetra - or pentacyclic cycloalkenyl groups , preferably bicycloalkenyl or tricycloalkenyl groups , if they have at least one double bond , for example norbornene . examples of spiroalkyl groups are optionally substituted spirocyclic c 5 - c 12 alkyl groups . generally , the term halogen denotes fluorine , chlorine , bromine or iodine , preferably fluorine , chlorine or bromine , most preferably chlorine . the leaving group a denotes either identical or different leaving groups such as for example - o - methyl , — scn , chlorine , bromine , iodine , methanesulphonyl , trifluoromethanesulphonyl or p - toluenesulphonyl , preferably chlorine . the compounds according to the invention may be present in the form of the individual optical isomers , mixtures of the individual enantiomers , diastereomers or racemates , in the form of the tautomers and also in the form of the free bases or the corresponding acid addition salts with pharmacologically acceptable acids — such as for example acid addition salts with hydrohalic acids , for example hydrochloric or hydrobromic acid , or organic acids , such as for example oxalic , fumaric , diglycolic or methanesulphonic acid . the substituent r 1 may denote hydrogen or a group selected from among optionally substituted and / or branched c 1 - c 6 - alkyl , preferably methyl or ethyl , more preferably methyl or ethyl . the substituent r 2 may denote hydrogen or a group selected from among optionally substituted and / or branched c 1 - c 6 - alkyl , preferably methyl or ethyl . r 1 and r 2 together may denote a 2 - to 5 - membered alkyl bridge , preferably an ethylene , propylene or butylene bridge which may contain 1 to 2 heteroatoms , preferably oxygen or nitrogen , more preferably ethylene , propylene . the substituent r 3 may denote hydrogen or a group selected from among optionally substituted and / or branched c 1 - c 12 - alkyl , preferably ethyl , propyl , butyl , pentyl or hexyl , more preferably propyl , butyl , pentyl or hexyl , c 2 - c 12 - alkenyl , preferably c 5 - c 7 - alkenyl , c 2 - c 12 - alkynyl , preferably c 5 - c 7 - alkynyl and c 6 - c 14 - aryl , preferably phenyl , a group selected from among optionally substituted and / or bridged c 3 - c 12 - cycloalkyl , preferably cyclopentyl or cyclohexyl , c 3 - c 12 - cycloalkenyl , preferably c 5 - c 7 - cycloalkenyl , c 7 - c 12 - polycycloalkyl , c 7 - c 12 - polycycloalkenyl , c 5 - c 12 - spirocycloalkyl , c 3 - c 12 - heterocycloalkyl , preferably pyranyl or piperinyl , pyrrolidinyl , pyrazinyl or morpholinyl which contains 1 to 2 heteroatoms , preferably oxygen or nitrogen , and c 3 - c 12 - heterocycloalkenyl which contains 1 to 2 heteroatoms , preferably oxygen or nitrogen . most preferably , the substituent r 3 denotes isopropyl , isobutyl , isopentyl , cyclopentyl , phenyl or cyclohexyl . r 1 and r 3 or r 2 and r 3 together may denote a saturated or unsaturated c 3 - c 4 - alkyl bridge which may contain 1 heteroatom , preferably oxygen or nitrogen . the substituent r 4 may denote a group selected from among hydrogen , — cn , hydroxy , — nr 6 r 7 and halogen , preferably chlorine or fluorine , more preferably chlorine or a group selected from among optionally substituted c 1 - c 6 - alkyl , preferably methyl , ethyl or propyl , c 2 - c 6 - alkenyl , preferably ethenyl or propenyl , c 2 - c 6 - alkynyl , preferably ethynyl , propynyl or butynyl , c 1 - c 5 - alkyloxy , preferably methoxy , ethoxy or propargyloxy , c 2 - c 5 - alkenyloxy , c 2 - c 5 - alkynyloxy , c 1 - c 6 - alkylthio , c 1 - c 6 - alkylsulphoxo and c 1 - c 6 - alkylsulphonyl . most preferably , the substituent r 4 denotes methoxy , methyl , ethoxy , ethyl , propargyloxy or chlorine . l may denote a linker selected from among optionally substituted c 2 - c 10 - alkyl , preferably ethyl , propyl , butyl or pentyl , c 2 - c 10 - alkenyl , c 6 - c 14 - aryl , preferably phenyl , — c 2 - c 4 - alkyl - c 6 - c 14 - aryl , — c 6 - c 14 - aryl - c 1 - c 4 - alkyl , preferably - phenyl - methyl optionally bridged c 3 - c 12 - cycloalkyl , preferably cyclohexyl , and heteroaryl which contains 1 or 2 nitrogen atoms . r 5 may denote a group selected from among optionally substituted morpholinyl , piperidinyl , piperazinyl , piperazinylcarbonyl , pyrrolidinyl , tropenyl , r 8 - diketomethylpiperazinyl , sulphoxomorpholinyl , sulphonylmorpholinyl , thiomorpholinyl , — nr 8 r 9 and azacycloheptyl , preferably piperidinyl , morpholinyl , pyrrolidinyl , sulphoxomorpholiny , piperazinyl , thiomorpholinyl or tropenyl . the groups r 6 and r 7 may be identical or different and may denote hydrogen or c 1 - c 4 - alkyl , preferably methyl or ethyl . the groups r 8 and r 9 may be unsubstituted nitrogen substituents at r 5 , they may be identical or different and denote either hydrogen or a group selected from among c 1 - c 6 - alkyl , preferably methyl , ethyl or propyl , — c 1 - c 4 - alkyl - c 3 - c 10 - cycloalkyl , preferably — ch 2 - cyclopropyl , c 3 - c 10 - cycloalkyl , c 6 - c 14 - aryl , preferably phenyl , — c 1 - c 4 - alkyl - c 6 - c 14 - aryl , preferably benzyl , pyranyl , pyridinyl , pyrimidinyl , pyranyl , c 1 - c 4 - alkyloxycarbonyl , c 6 - c 14 - arylcarbonyl , c 1 - c 4 - alkylcarbonyl , c 6 - c 14 - arylmethyloxycarbonyl , c 6 - c 14 - arylsulphonyl , c 1 - c 4 - alkylsulphonyl and c 6 - c 14 - aryl - c 1 - c 4 - alkylsulphonyl . most preferably , the substituent r 8 denotes methyl , ethyl or propyl . most preferably , the substituent r 9 denotes methyl , ethyl or propyl . r 10 may be a substituent selected from among oh , nh2 - lr5 , — o - methyl and — o - ethyl , preferably oh , lr5 , — o - methyl or — o - ethyl . all the groups mentioned in the definition of r 1 to r 10 may optionally be branched and / or substituted . the compounds according to the invention may be prepared by synthesis methods a described hereinafter , while the substituents of general formulae ( a1 ) to ( a9 ) have the meanings given hereinbefore . this method is to be understood as an illustration of the invention without restricting it to the subject matter thereof . a compound of formula ( a1 ) is reacted with a compound of formula ( a2 ) to obtain a compound of formula ( a3 ) ( diagram 1a ). this reaction may be carried out according to wo 0043369 or wo 0043372 . compound ( a1 ) is commercially obtainable , for example , from city chemical llc , 139 allings crossing road , west haven , conn ., 06516 , usa . compound ( a2 ) may be prepared by procedures known from the literature : ( a ) f . effenberger , u . burkhart , j . willfahrt liebigs ann . chem . 1986 , 314 - 333 ; b ) t . fukuyama , c .- k . jow , m . cheung , tetrahedron lett . 1995 , 36 , 6373 - 6374 ; c ) r . k . olsen , j . org . chem . 1970 , 35 , 1912 - 1915 ; d ) f . e . dutton , b . h . byung tetrahedron lett . 1998 , 30 , 5313 - 5316 ; e ) j . m . ranajuhi , m . m . joullie synth . commun . 1996 , 26 , 1379 - 1384 .). in step 1a , 1 equivalent of the compound ( a1 ) and 1 to 1 . 5 equivalents , preferably 1 . 1 equivalents of a base , preferably potassium carbonate , potassium hydrogen carbonate , sodium carbonate or sodium hydrogen carbonate , calcium carbonate , most preferably potassium carbonate , are stirred in a diluent optionally mixed with water , for example acetone , tetrahydrofuran , diethylether , cyclohexane , petroleum ether or dioxane , preferably cyclohexane or diethylether . at a temperature of 0 to 15 ° c ., preferably 5 to 10 ° c ., 1 equivalent of an amino acid of formula ( a2 ), dissolved in an organic solvent , for example acetone , tetrahydrofuran , diethylether , cyclohexane or dioxane , is added dropwise . the reaction mixture is heated to a temperature of 18 ° c . to 30 ° c ., preferably about 22 ° c ., with stirring and then stirred for a further 10 to 24 hours , preferably about 12 hours . then the diluent is distilled off , the residue is combined with water and the mixture is extracted two to three times with an organic solvent , such as diethylether or ethyl acetate , preferably ethyl acetate . the combined organic extracts are dried and the solvent is distilled off . the residue ( compound a3 ) may be used in step 2 without any prior purification . the compound obtained in step 1a ( a3 ) is reduced at the nitro group and cyclised to form the compound of formula ( a4 ) ( diagram 2a ). in step 2a , 1 equivalent of the nitro compound ( a3 ) is dissolved in an acid , preferably glacial acetic acid , formic acid or hydrochloric acid , preferably glacial acetic acid , and heated to 50 to 70 ° c . preferably about 60 ° c . then a reducing agent , for example zinc , tin or iron , preferably iron filings , is added to complete the exothermic reaction and the mixture is stirred for 0 . 2 to 2 hours , preferably 0 . 5 hours , at 100 to 125 ° c ., preferably at about 117 ° c . after cooling to ambient temperature the iron salt is filtered off and the solvent is distilled off . the residue is taken up in a solvent or mixture of solvents , for example ethyl acetate or dichloromethane / methanol 9 / 1 and semisaturated nacl solution , and filtered through kieselgur , for example . the organic phase is dried and evaporated down . the residue ( compound ( a4 )) may be purified by chromatography or by crystallisation or used as the crude product in step 3a of the synthesis . the compound obtained in step 2a ( a4 ) may be reacted by electrophilic substitution as shown in diagram 3a to obtain the compound of formula ( a5 ). in step 3a 1 equivalent of the amide of formula ( a4 ) is dissolved in an organic solvent , for example dimethylformamide or dimethylacetamide , preferably dimethylacetamide , and cooled to about − 5 to 5 ° c ., preferably 0 ° c . then 0 . 9 to 1 . 3 equivalents of sodium hydride and 0 . 9 to 1 . 3 equivalents of a methylating reagent , e . g . methyl iodide , are added . the reaction mixture is stirred for 0 . 1 - 3 hours , preferably about 1 hour , at about 0 to 10 ° c ., preferably at about 5 ° c ., and may optionally be left to stand for a further 12 hours at this temperature . the reaction mixture is poured onto ice water and the precipitate is isolated . the residue ( compound ( a5 )) may be purified by chromatography , preferably over silica gel , or by crystallisation , or used as the crude product in step 4a of the synthesis . the amination of the compound ( a5 ) obtained in step 3a to yield the compound of formula ( a9 ) ( diagram 4a ) may be carried out using the methods known from the literature of variants 4 . 1 a ( a ) m . p . v . boarland , j . f . w . mcomie j . chem . soc . 5 1951 , 1218 - 1221 ; b ) f . h . s . curd , f . c . rose j . chem . soc . 1946 , 343 - 348 ., 4 . 2 a ( a ) banks j . am . chem . soc . 1944 , 66 , 1131 b ) ghosh and dolly j . indian chem . soc . 1981 , 58 , 512 - 513 ; c ) n . p . reddy and m . tanaka tetrahedron lett . 1997 , 38 , 4807 - 4810 . for example , in variant 4 . 1 a , 1 equivalent of the compound ( a5 ) and 1 to 3 equivalents , preferably about 2 equivalents of the compound ( a6 ) are heated without a solvent or in an organic solvent such as for example sulpholane , dimethylformamide , dimethylacetamide , toluene , n - methylpyrrolidone , dimethylsulphoxide or dioxane , preferably sulpholane , for 0 . 1 to 4 hours , preferably 1 hour , at 100 to 220 ° c ., preferably at about 160 ° c . after cooling , the product ( a9 ) is crystallised by the addition of organic solvents or mixtures of solvents , e . g . diethylether / methanol , ethyl acetate , methylene chloride , or diethylether , preferably diethylether / methanol 9 / 1 , or purified by chromatography . for example , in variant 4 . 2 a , 1 equivalent of the compound ( a5 ) and 1 to 3 equivalents of the compound ( a6 ) are stirred with acid , for example 1 - 10 equivalents of 10 - 38 % hydrochloric acid and / or an alcohol , for example ethanol , propanol , butanol , preferably ethanol , at reflux temperature for 1 to 48 hours , preferably about 5 hours . the product precipitated ( a9 ) is filtered off and optionally washed with water , dried and crystallised from a suitable organic solvent . for example , in variant 4 . 3 a , 1 equivalent of the compound ( a5 ) and 1 to 3 equivalents of the compound ( a7 ) are dissolved in a solvent , for example toluene or dioxane and combined with a phosphine ligand , for example 2 , 2 ′- bis -( diphenylphosphino )- 1 , 1 ′- binaphthyl and a palladium catalyst , for example tris ( dibenzylidene - acetone )- dipalladium ( 0 ) and a base , for example caesium carbonate , and refluxed for 1 - 24 h , preferably 17 h . the reaction mixture is purified for example over silica gel and the product ( a8 ) is isolated from the solution or obtained by suitable crystallisation . the product ( a8 ) is dissolved in a suitable solvent , for example dioxane and mixed with acid , for example semiconcentrated hydrochloric acid , for example in the ratio of solvent to acid of 3 : 1 . then the mixture is refluxed for 1 - 48 h , for example 12 h , and the precipitate formed is isolated . if desired the product ( a9 ) is purified by crystallisation . for example , 1 equivalent of the compound ( a9 ) is dissolved with 1 equivalent of an activating reagent , e . g . o - benzotriazolyl - n , n , n ′, n ′- tetramethyluronium tetrafluoroborate ( tbtu ) and a base , for example 1 . 5 equivalents of diisopropylethylamine ( dipea ) in an organic diluent , for example dichloromethane , tetrahydrofuran , dimethylformamide , n - methylpyrrolidone , dimethylacetamide , preferably dichloromethane or dimethylformamide . after the addition of 1 equivalent of the amine ( a10 ) the reaction mixture is stirred for 0 . 1 to 24 hours , preferably about 2 hours at 20 ° c . to 100 ° c . the product of formula ( a11 ) is obtained for example by crystallisation or chromatographic purification . the new compounds of general formula ( i ) may be synthesised analogously to the following examples of synthesis . these examples are , however , intended only as examples of procedures to illustrate the invention further , without restricting the invention to their subject matter . the preparation of some intermediate compounds used to synthesise the examples is also described hereinafter . to synthesise the compounds of examples 94 and 95 first an intermediate 50 . 0 g ( 0 . 48 mol ) of d - alanine methyl ester × hcl and 49 . 1 g ( 0 . 50 mol ) cyclohexanone were placed in 300 ml dichloromethane and then combined with 41 . 0 g ( 0 . 50 mol ) sodium acetate and 159 . 0 g ( 0 . 75 mol ) sodium triacetoxyborohydride . the mixture was stirred overnight and then 300 ml of 10 % sodium hydrogen carbonate solution were added . the aqueous phase was extracted with dichloromethane . the combined organic phases were washed with 10 % sodium hydrogen carbonate solution , dried over na 2 so 4 and evaporated down . 72 . 5 g of the compound z1a were placed in 500 ml water and 76 . 6 g ( 0 . 39 mol ) of 2 , 4 - dichloro - 5 - nitropyrimidine in 500 ml diethyl ether were added . at a temperature of − 5 ° c . 100 ml 10 % potassium hydrogen carbonate solution were added dropwise . the mixture was stirred for 3 h at − 5 ° c . and for a further 12 h at ambient temperature . the organic phase was separated off and dried over na 2 so 4 . on evaporation the product crystallised out . 48 . 0 g of the compound z1 b were dissolved in 350 ml glacial acetic acid and heated to 60 ° c . 47 . 5 g of iron powder were added , while the temperature rose to 105 ° c . the reaction mixture was stirred for three hours at 80 ° c ., then filtered hot through cellulose and evaporated down . the residue was stirred in water and ethyl acetate , suction filtered and the light - grey precipitate was washed with ethyl acetate . the filtrate was washed with dilute ammonia and water , the organic phase was dried over na 2 so 4 , filtered through activated charcoal and evaporated down . some more light - grey solid was obtained . 32 . 1 g of the compound z1c were placed in 300 ml dimethylacetamide and combined with 13 ml ( 0 . 2 mol ) methyl iodide . at − 5 ° c . 6 . 4 g ( 0 . 16 mol ) sodium hydride as a 60 % dispersion in mineral oil was added batchwise . after 2 h the reaction mixture was poured onto 800 ml ice water . the precipitate formed was suction filtered and washed with petroleum ether . 4 . 0 g of the compound z1d and 2 . 3 g ( 15 mmol ) 4 - amino - 3 - methylbenzoic acid were suspended in 50 ml ethanol and 120 ml water , combined with 2 ml conc . hydrochloric acid and refluxed for 48 h . the precipitate formed on cooling was suction filtered and washed with water , ethanol and diethyl ether . to synthesise the compounds example 188 and example 203 first of all an intermediate compound z2 a solution of 128 . 2 g ( 0 . 83 mol ) d - alanine ethyl ester × hcl and 71 . 5 g ( 0 . 85 mol ) cyclopentanone in 1500 ml dichloromethane was combined with 70 . 1 ( 0 . 85 mol ) sodium acetate and 265 . 6 g ( 1 . 25 mol ) sodium triacetoxyborohydride . the reaction mixture was stirred for 12 h and then poured into 1 . 5 l of a 10 % sodium hydrogen carbonate solution . the aqueous phase was extracted with dichloromethane . the combined organic phases were dried over na 2 so 4 and evaporated down . 66 . 0 g of the compound z2a were placed in 500 ml water and combined with 85 . 0 g ( 0 . 44 mol ) 2 , 4 - dichloro - 5 - nitropyrimidine in 500 ml diethyl ether . at − 5 ° c . 100 ml 10 % potassium hydrogen carbonate solution were added dropwise and the reaction mixture was stirred for 48 h at ambient temperature . the aqueous phase was extracted with diethyl ether , the combined organic phases were dried over na 2 so 4 and evaporated down . the dark red solid was stirred with petroleum ether and suction filtered . 88 . 0 g of the compound z2b were dissolved in 1000 ml glacial acetic acid and at 60 ° c . combined batchwise with 85 g iron powder , while the temperature rose to 110 ° c . it was stirred for 1 h at 60 ° c ., then suction filtered hot through cellulose and evaporated down . the brown solid was stirred with 700 ml water and suction filtered . 53 . 3 g of the compound z2c were dissolved in 300 ml dimethylacetamide and combined with 13 ml ( 0 . 21 mol ) methyl iodide . at − 5 ° c . 5 . 0 g ( 0 . 21 mol ) sodium hydride as a 60 % dispersion in mineral oil were added batchwise . after 12 h the reaction mixture was poured onto 1000 ml ice water and the precipitate formed was suction filtered . 4 . 0 g of the compound z2d and 2 . 8 g ( 16 mmol ) 4 - amino - 3 - chlorbenzoic acid were suspended in 25 ml ethanol and 60 ml water , combined with 3 ml conc . hydrochloric acid and refluxed for 43 h . the precipitate formed on cooling was suction filtered and washed with water , ethanol and diethyl ether . to synthesise the compounds of examples 19 , 21 , 22 , 23 , 45 , 55 , 58 , 116 , 128 , 131 , 133 , 134 , 136 , 138 , 177 , 217 , 231 , 239 , 46 , 184 , 166 and 187 first of all an intermediate compound z3 54 . 0 g ( 0 . 52 mol ) d - 2 - aminobutyric acid were suspended in 540 ml methanol and slowly combined with 132 g ( 1 . 1 mol ) thionyl chloride while cooling with ice . the mixture was refluxed for 1 . 5 h and then evaporated down . the oil remaining was combined with 540 ml tert - butylmethylether and the colourless crystals formed were suction filtered . 74 . 2 g of the compound z3a and 43 . 5 ml ( 0 . 49 mol ) cyclopentanone were dissolved in 800 ml dichloromethane . after the addition of 40 . 0 g ( 0 . 49 mol ) sodium acetate and 150 . 0 g ( 0 . 71 mol ) sodium triacetoxyborohydride at 0 ° c . the mixture was stirred for 12 h at ambient temperature and then 500 ml of 20 % sodium hydrogen carbonate solution were added . the aqueous phase was extracted with dichloromethane . the combined organic phases were washed with water , dried over mgso 4 and evaporated down . 40 . 0 g of the compound z3b and 30 . 0 g ( 0 . 22 mol ) potassium carbonate were suspended in 600 ml acetone and combined with 45 . 0 g ( 0 . 23 mol ) 2 , 4 - dichloro - 5 - nitropyrimidin in 200 ml acetone while cooling with ice . after 12 h a further 5 . 0 g 2 , 4 - dichloro - 5 - nitropyrimidin were added and stirred for 3 h . the reaction mixture was evaporated down , taken up in 800 ml ethyl acetate and 600 ml water and the aqueous phase was extracted with ethyl acetate . the combined organic phases were washed with water , dried over mgso 4 and evaporated down . 100 g of the compound z3c were dissolved in 650 ml glacial acetic acid and at 70 ° c . 20 g of iron powder were added batchwise . the mixture was stirred for 1 h at 70 ° c ., then for 1 . 5 h at 100 ° c . and then filtered hot through kieselgur . the reaction mixture was evaporated down , taken up in methanol / dichloromethane , applied to silica gel and purified with ethyl acetate by soxhlet extraction . the solvent was removed and the residue stirred with methanol . 25 . 0 g of the compound z3d and 6 . 5 ml ( 0 . 1 mol ) methyl iodide were placed in 250 ml dimethylacetamide and at − 10 ° c . 3 . 8 g ( 0 . 95 mol ) sodium hydride as a 60 % dispersion in mineral oil was added . it was stirred for 20 min at 0 ° c ., then for 30 min at ambient temperature and finally ice was added . the reaction mixture was evaporated down and combined with 300 ml water . the precipitate formed was suction filtered and washed with petroleum ether . 6 . 0 g of the compound z3e and 5 . 1 g ( 31 mmol ) 4 - amino - 3 - methoxybenzoic acid were suspended in 90 ml ethanol and 350 ml water , combined with 3 . 5 ml conc . hydrochloric acid and refluxed for 48 h . the reaction mixture was evaporated down , the residue stirred with methanol / diethyl ether and the precipitate formed was suction filtered . to synthesise the compound of examples 81 , 82 , 93 , 137 first of all an intermediate compound z4 25 . 0 g ( 0 . 19 mol ) of ethyl 1 - aminocyclopropane - 1 - carboxylate × hcl and 16 . 8 g ( 0 . 20 mol ) of cyclopentanone were dissolved in 300 ml of dichloromethane and combined with 16 . 4 g ( 0 . 20 mol ) of sodium acetate and 61 . 7 g ( 0 . 29 mol ) of sodium triacetoxyborohydride . it was stirred overnight and the reaction mixture was then poured onto 400 ml of 10 % sodium hydrogen carbonate solution . the aqueous phase was extracted with dichloromethane . the combined organic phases were dried over na 2 so 4 and evaporated down . 42 . 5 g ( 0 . 22 mol ) of 2 , 4 - dichloro - 5 - nitropyrimidine in 350 ml of diethyl ether were added to a mixture of 34 . 5 g of the compound z4a in 350 ml water . at − 5 ° c . the mixture was combined with 80 ml 10 % potassium hydrogen carbonate solution and stirred overnight at ambient temperature . the aqueous phase was extracted with diethyl ether . the combined organic phases were dried over na 2 so 4 and evaporated down . 20 . 1 g of the compound z4b were dissolved in 200 ml glacial acetic acid and combined batchwise at 60 ° c . with 19 . 1 g iron powder , during which time the temperature rose to 100 ° c . the mixture was stirred for 3 h at 60 ° c ., then suction filtered through cellulose and evaporated down . the residue was stirred in water and ethyl acetate and the yellow precipitate was suction filtered . the filtrate was washed with dilute ammonia and water , the organic phase dried over na 2 so 4 and evaporated down . after the addition of diethyl ether additional product crystallised out . 7 . 8 9 of the compound z4c and 2 . 6 ml ( 0 . 04 mol ) methyl iodide were dissolved in 100 ml dimethylacetamide and at − 5 ° c . 1 . 5 g ( 0 . 04 mol ) sodium hydride were added batchwise as a 60 % dispersion in mineral oil . after 2 h the reaction mixture was poured onto ice water and the precipitate formed was suction filtered . 3 . 0 g of the compound z4d and 1 . 9 g ( 11 mmol ) 4 - amino - 3 - methoxybenzoic acid were suspended in 40 ml ethanol and 80 ml water , combined with 2 ml conc . hydrochloric acid and refluxed for 20 h . a further 0 . 5 g of 4 - amino - 3 - methoxybenzoic acid were added and refluxed for48 h . the precipitate formed on cooling was suction filtered and washed with water , ethanol and diethyl ether . yield : 2 . 1 g of a compound z4 ( colourless crystals ) m . p . : 222 - 223 ° c . to synthesise the compounds of examples 162 , 43 , 53 , 161 , 202 , 211 , 215 and 212 first of all an intermediate compound z5 a mixture of 73 . 4 ml ( 0 . 5 mol ) ethyl 2 - bromoisobutyrate , 87 . 1 ml ( 0 . 75 mol ) of 3 - methyl - 1 - butylamine , 82 . 5 g ( 0 . 6 mol ) sodium iodide and 76 . 0 g ( 0 . 6 mol ) of potassium carbonate in 1000 ml ethyl acetate was refluxed for3 days . any salts present were filtered off and the filtrate evaporated down . 49 . 0 g ( 0 . 25 mol ) of 2 , 4 - dichloro - 5 - nitropyrimidine and 38 . 3 g ( 0 . 28 mol ) of potassium carbonate were suspended in 500 ml acetone and at 0 ° c . combined with 93 . 0 g of the compound z5a in 375 ml acetone . the reaction mixture was stirred overnight at ambient temperature , filtered and evaporated down . the residue dissolved in ethyl acetate was washed with water and the organic phase dried over mgso 4 and evaporated down . 22 . 7 g of the compound z5b were dissolved in 350 ml glacial acetic acid and at 60 ° c . combined batchwise with 17 . 4 g iron powder . after the addition had ended the mixture was refluxed for 0 . 5 h , filtered hot and evaporated down . the residue was taken up in 200 ml dichloromethane / methanol ( 9 : 1 ) and washed with sodium chloride solution . the organic phase was suction filtered through kieselguhr , dried over mgso 4 , evaporated down and purified by column chromatography ( eluant : ethyl acetate / cyclohexane 1 : 1 ). 1 . 9 g of the compound z5c were dissolved in 32 ml dimethylacetamide and while cooling with ice combined with 0 . 3 g ( 7 mmol ) sodium hydride as a 60 % dispersion in mineral oil . after 10 min 0 . 5 ml ( 7 mmol ) methyl iodide were added and stirred for 3 h at ambient temperature . the reaction mixture was evaporated down and combined with water . the precipitate formed was suction filtered and washed with petroleum ether . 14 . 0 g of the compound z5d and 10 . 0 g ( 0 . 06 mol ) 4 - amino - 3 - methoxybenzoic acid were suspended in 200 ml dioxane and 80 ml water , combined with 10 ml conc . hydrochloric acid and refluxed for 40 h . the precipitate formed on cooling was suction filtered and washed with water , dioxane and diethyl ether . to synthesise the compounds of examples 88 , 194 , 229 and 89 first of all an intermediate compound z6 6 . 0 g ( 0 . 06 mol ) l - 2 - aminobutyric acid was placed in 80 ml 0 . 5 m sulphuric acid and at 0 ° c . combined with 5 . 5 g ( 0 . 08 mol ) sodium nitrite in 15 ml water . the reaction mixture was stirred for 22 h at 0 ° c ., combined with ammonium sulphate and filtered . the filtrate was extracted with diethyl ether and the combined organic dried over mgso 4 and evaporated down . 200 ml methanol were combined successively with 65 . 0 ml ( 0 . 89 mol ) thionyl chloride and 76 . 0 g of the compound z6a in 50 ml methanol while cooling with ice . the resulting mixture was stirred for 1 h at 0 ° c . and 2 h at ambient temperature and then the methanol and remaining thionyl chloride were eliminated in vacuo at 0 ° c . 30 . 0 ml ( 0 . 17 mol ) of trifluoromethanesulphonic acid anhydride were placed in 150 ml dichloromethane and while cooling with ice a solution of 20 . 0 g of the compound z6b and 14 . 0 ml ( 0 . 17 mol ) pyridine in 50 ml dichloromethane was added within one hour . the mixture was stirred for 2 h at ambient temperature , any salts formed were suction filtered and then washed with 100 ml water . the organic phase was dried over mgso 4 and evaporated down . 42 . 0 g of the compound z6c in 200 ml dichloromethane was added dropwise within one hour to a solution of 15 . 5 ml ( 0 . 17 mol ) of aniline and 24 . 0 ml ( 0 . 17 mol ) of triethylamine in 400 ml dichloromethane while cooling with ice . the mixture was stirred for 1 h at ambient temperature and a further 2 h at 35 ° c . the reaction mixture was washed with water , dried over mgso 4 and evaporated down . the residue remaining was purified by distillation ( 95 - 100 ° c ., 1 * 10 − 3 mbar ). 14 . 0 g of the compound z6d and 16 . 0 g ( 0 . 1 mol ) potassium carbonate were suspended in 100 ml acetone and at 10 ° c . combined with 16 . 0 g ( 0 . 08 mol ) of 2 , 4 - dichloro - 5 - nitropyrimidine . the mixture was stirred for 4 h at 40 ° c ., any salts formed were suction filtered and the filtrate evaporated down . the residue was taken up in 300 ml ethyl acetate and washed with water . the organic phase was dried over mgso 4 and evaporated down . 31 . 0 g of the compound z6e were dissolved in 200 ml glacial acetic acid and at 60 ° c . combined batchwise with 10 g iron powder , during which time the temperature rose to 85 ° c . the mixture was stirred for a further hour at 60 ° c ., filtered through kieselguhr and evaporated down . the residue was stirred with methanol . at − 20 ° c . 0 . 6 g ( 16 mmol ) of sodium hydride as a 60 % dispersion in mineral oil were added batchwise to a mixture of 4 . 5 g of the compound z6f and 1 . 0 ml ( 16 mmol ) methyl iodide in 100 ml dimethylacetamide . after 1 h the reaction mixture was combined with 50 ml water and evaporated down . the residue was stirred with 200 ml water , the precipitate is suction filtered and washed with petroleum ether . a suspension of 1 . 5 g of the compound z6g and 1 . 4 g ( 8 mmol ) of methyl 4 - amino - 3 - methoxybenzoate in 30 ml toluene was combined with 0 . 4 g ( 0 . 6 mmol ) of 2 , 2 ′- bis -( diphenylphosphino )- 1 , 1 ′- binaphthyl , 0 . 23 g ( 0 . 3 mmol ) of tris ( dibenzylideneacetone )- dipalladium ( 0 ) and 7 . 0 g ( 21 mmol ) of caesium carbonate and refluxed for 17 h . the reaction mixture was applied to silica gel and purified by column chromatography ( eluant : dichloromethane / methanol 9 : 1 ). 1 . 7 g of the compound z6h were dissolved in 50 ml dioxane , combined with 15 ml of semiconc . hydrochloric acid and refluxed for 12 h . after cooling the precipitate formed was suction filtered . to synthesise the compound of examples 26 , 20 , 32 , 56 , 101 , 112 , 209 first of all an intermediate compound z7 50 . 0 g ( 0 . 36 mol ) d - alanine methyl ester x hcl was suspended in 500 ml of dichloromethane and 35 ml of acetone and combined with 30 . 0 g ( 0 . 37 mol ) of sodium acetate and 80 . 0 g ( 0 . 38 mol ) of sodium triacetoxyborohydride . the mixture was stirred for 12 h and then poured onto 400 ml of 10 % sodium hydrogen carbonate solution . the organic phase was dried over na 2 so 4 and evaporated down . a suspension of 51 . 0 g of the compound z7a in 450 ml water was combined with 80 . 0 g ( 0 . 41 mol ) of 2 , 4 - dichloro - 5 - nitropyridine in 450 ml of diethyl ether . at − 5 ° c . 100 ml of 10 % potassium hydrogen carbonate solution were added dropwise . the reaction mixture was stirred for 3 h , the organic phase dried over na 2 so 4 and evaporated down . 18 . 6 g of the compound z7b were dissolved in 200 ml glacial acetic acid and at 60 ° c . combined batchwise with 20 . 0 g iron powder . the mixture was stirred for 2 h at 60 ° c . and then suction filtered through cellulose . the residue was dissolved in ethyl acetate and washed with water and conc . ammonia . the organic phase was dried over na 2 so 4 and evaporated down . the residue was crystallised from diethyl ether . 17 . 0 g of the compound z7c and 7 ml ( 0 . 1 mol ) methyl iodide were dissolved in 200 ml dimethylacetamide and at − 5 ° c . combined with 4 . 0 g ( 0 . 1 mol ) of sodium hydride as a 60 % dispersion in mineral oil . the reaction mixture was stirred for 30 min and then poured onto 300 ml ice water . the precipitate formed was suction filtered and stirred with petroleum ether . 0 . 9 g of the compound z7d and 1 . 5 g ( 9 mmol ) 4 - amino - 3 - methoxybenzoic acid were heated to 210 ° c . for 30 min . after cooling the residue was stirred with ethyl acetate and the precipitate obtained was suction filtered . the following acids were prepared , for example , analogously to the methods of synthesis described : the compounds were prepared according to the following references : a ) s . schuetz et al . arzneimittel - forschung 1971 , 21 , 739 - 763 b ) v . m . belikov et al . tetrahedron 1970 , 26 , 1199 - 1216 . c ) e . b . butler and mcmillan j . amer . chem . soc . 1950 , 72 , 2978 . other amines were prepared as follows , in a modified manner compared with the literature described above . 8 . 7 ml morpholine and 9 . 3 ml 2 - nitropropane were prepared , while cooling with ice , 7 . 5 ml formaldehyde ( 37 %) and 4 ml of a 0 . 5 mol / l naoh solution were slowly added dropwise (& lt ; 10 ° c .). then the mixture was stirred for 1 h at 25 ° c . and 1 h at 50 ° c . the solution was treated with water and ether and the aqueous phase was extracted 3 × with ether . the combined org . phase was dried over naso4 and combined with hcl in dioxane ( 4 mol / l ), the precipitate formed was suction filtered . 5 g of the white powder were dissolved in 80 ml methanol and with the addition of 2 g rani treated with hydrogen at 35 ° c . and 50 psi for 40 minutes . this yielded 3 . 6 g of 1 , 1 - dimethyl - 2 - morpholin - 1 - yl - ethylamine . 5 g of 1 , 3 dimorpholine - 2 - nitropropane obtained from messrs . aldrich was dissolved in 80 ml methanol and treated with hydrogen for 5 . 5 h at 30 ° c . and 50 psi with the addition of 2 g rani . this yielded 4 . 2 g of 1 , 3 dimorpholin - 2 - amino - propane . the preparation of this amine is described in the following reference : s . mitsuru et al . j . med . chem . 2000 , 43 , 2049 - 2063 20 g ( 100 mmol ) of 4 - tert - butyloxycarbony - aminopiperidine were dissolved in 250 ml ch 2 cl 2 and stirred for 12 h at rt with 10 g ( 100 mmol ) tetrahydro - 4h - pyran - 4 - one and 42 g ( 200 mmol ) nabh ( oac ) 3 . then water and potassium carbonate were added , the org . phase was separated off , dried and the solvent was eliminated in vacuo . the residue was dissolved in 200 ml ch 2 cl 2 and stirred for 12 h at rt with 100 ml trifluoroacetic acid . the solvent was eliminated in vacuo , the residue taken up with chcl 3 and evaporated down again , then taken up in acetone and the hydrochloride was precipitated with ethereal hcl . yield : 14 . 3 g ( 56 %). 3 . 9 g ( 30 mmol ) of 4 - dibenzylcyclohexanone were dissolved in 100 ml of ch 2 cl 2 and stirred for 12 h at rt with 3 . 9 g ( 45 mmol ) of morpholine and 9 . 5 g ( 45 mmol ) nabh ( oac ) 3 . then water and potassium carbonate were added , the org . phase was separated off , dried and the solvent was eliminated in vacuo . the residue was purified through a silica gel column ( about 20 ml silica gel ; about 500 ml of ethyl acetate 90 / methanol 10 + 1 % conc . ammonia ). the appropriate fractions were evaporated down in vacuo . yield : 6 . 6 g ( 60 %) of cis - isomer and 2 g ( 18 %) of trans - isomer . 33 g ( 112 mmol ) of 4 - dibenzylcyclohexanone were dissolved in 300 ml meoh , combined with 17 . 4 g ( 250 mmol ) of hydroxylamine hydrochloride and stirred for 4 h at 60 ° c . the solvent was evaporated down in vacuo , combined with 500 ml water and 50 g potassium carbonate and extracted twice with 300 ml of dichloromethane . the org . phase was dried , evaporated down in vacuo , the residue was crystallised from petroleum ether , dissolved in 1 . 5 l of etoh and heated to 70 ° c . 166 g of sodium were added batchwise and the mixture was refluxed until the sodium dissolved . the solvent is eliminated in vacuo , the residue combined with 100 ml water and extracted twice with 400 ml of ether . the org . phase is washed with water , dried , evaporated down in vacuo and the trans isomer is isolated using a column ( about 1 . 5 l silica gel ; about 2 l of ethyl acetate 80 / methanol 20 + 2 % conc . ammonia ). yield : 12 . 6 g ( 41 . 2 %). 6 . 8 g ( 23 mmol ) of trans - 1 - amino - 4 - dibenzylaminocyclohexane was dissolved in 90 ml of dmf and stirred for 8 h at 100 ° c . with 5 ml ( 42 mmol ) of 2 , 2 ′- dichloroethyl ether and 5 g of potassium carbonate . after cooling 30 ml of water was added , the precipitated crystals were suction filtered and purified through a short column ( about 20 ml silica gel , about 100 ml ethyl acetate ). the residue is crystallised from methanol and conc . hcl as the dihydrochloride . yield : 7 . 3 g ( 72 . 4 %). 7 . 2 g ( 16 . 4 mmol ) of trans - dibenzyl - 4 - morpholino - cyclohexylamine were dissolved in 100 ml of meoh and hydrogenated on 1 . 4 g of pd / c ( 10 %) at 30 - 50 ° c . the solvent was eliminated in vacuo and the residue was crystallised from ethanol and conc . hcl . yield : 3 . 9 g ( 93 %); m . p . 312 ° c . 2 . 0 g ( 6 . 8 mmol ) of trans - 1amino - 4 - dibenzylaminocyclohexane ( see example 2 ) was dissolved in 50 ml dmf and stirred for 48 h at rt with 1 . 6 g ( 7 mmol ) of 1 , 5 - dibromopentane and 2 g of potassium carbonate . the mixture was cooled , combined with water , extracted twice with 100 ml of dichloromethane , dried and the solvent was eliminated in vacuo . the residue is purified over a column ( about 100 ml silica gel , about 500 ml ethyl acetate 80 / methanol 20 + 1 % conc . ammonia ). the desired fractions were evaporated down in vacuo and crystallised from petroleum ether . yield : 1 . 2 g ( 49 %). 1 . 7 g ( 4 . 8 mmol ) of trans - dibenzyl - 4 - piperidino - cyclohexylamine were dissolved in 35 ml meoh and hydrogenated on 350 mg of pd / c ( 10 %) at 20 ° c . the solvent was eliminated in vacuo and the residue crystallised from ethanol and conc . hcl . yield : 1 . 1 g ( 78 %). 4 . 1 g ( 25 . 3 mmol ) of 4 - dibenzylcyclohexanone was dissolved in 50 ml of dichloromethane and stirred for 12 h at rt with 7 . 4 g ( 25 . 3 mmol ) of n - phenylpyperazine and 7 . 4 g ( 35 mmol ) of nabh ( oac ) 3 . then water and potassium carbonate were added , the org . phase was separated off , dried and the solvent was eliminated in vacuo . the residue was purified over a silica gel column ( ethyl acetate 80 / methanol 20 + 0 . 5 % conc . ammonia ). yield : 1 . 7 g ( 15 . 8 %) of cis - isomer and 0 . 27 ( 2 . 5 %) of trans - isomer . 270 mg ( 0 . 61 mmol ) of trans - dibenzyl -[ 4 -( 4 - phenyl - piperazin - 1 - yl )- cyclohexyl ]- amine were dissolved in 5 ml meoh and hydrogenated on 40 mg of pd / c ( 10 %) at 20 - 30 ° c . the solvent was eliminated in vacuo and the residue crystallised from ethanol and conc . hcl . yield : 110 mg ( 69 %). 9 . 8 g ( 33 . 4 mmol ) of 4 - dibenzylcyclohexanone was dissolved in 100 ml dichloromethane and stirred for 12 h at rt with 5 . 6 g ( 40 mmol ) of n - cyclopropylmethylpiperazine and 8 . 5 g ( 40 mmol ) of nabh ( oac ) 3 . then water and potassium carbonate were added , the org . phase was separated off , dried and the solvent was eliminated in vacuo . the residue was purified over a silica gel column ( about 50 ml silica gel , about 3 l ethyl acetate 95 / methanol 5 + 0 . 25 % conc . ammonia . the appropriate fractions were evaporated down in vacuo . the faster eluting cis compound crystallised from ethyl acetate . the trans - compound was crystallised from ethanol + conc . hcl . yield : 8 . 5 g ( 61 %) cis - isomer and 2 . 2 ( 13 %) trans - isomer . 8 . 5 g ( 20 mmol ) of cis - dibenzyl -[ 4 -( 4 - cyclopropylmethyl - piperazin - 1 - yl )- cyclohexyl ]- amine were dissolved in 170 ml meoh and hydrogenated on 1 . 7 g pd / c ( 10 %) at 30 - 50 ° c . the solvent was eliminated in vacuo and the residue was crystallised from ethanol and conc . hcl . yield : 4 . 4 g ( 91 %). 0 . 15 g of the compound z10 , 0 . 14 g tbtu , 0 . 13 ml dipea were dissolved in dichloromethane and stirred for 20 minutes at 25 ° c . then 90 μl 1 -( 3 - aminopropyl )- 4 - methylpiperazine was added and stirred for a further 2 hours at 25 ° c . the solution was then diluted with dichloromethane and extracted with water . the product was precipitated by the addition of petroleum ether , ether and ethyl acetate to the organic phase . yield : 0 . 16 g of beige solid 0 . 10 g of the compound z10 , 0 . 1 g tbtu , 0 . 08 ml dipea were dissolved in 4 ml dichloromethane and stirred for 20 minutes at 25 ° c . then 44 μl dimethylaminopropylamine were added and stirred for a further 2 hours at 25 ° c . the solution was then diluted with dichloromethane and extracted with water . the product was precipitated by the addition of petroleum ether , ether and acetone to the organic phase . yield : 0 . 08 g yellow solid . 0 . 15 g of the compound z10 , 0 . 14 g tbtu , 0 . 13 ml dipea were dissolved in 5 ml dichloromethane and stirred for 20 minutes at 25 ° c . then 75 μl 1 -( 2 - aminoethyl ) piperidine were added and stirred for a further 2 hours at 25 ° c . the solution was then diluted with dichloromethane and extracted with water . the product was precipitated by the addition of petroleum ether , ether and ethyl acetate to the organic phase . yield : 0 . 14 g yellow solid . 0 . 1 g of the compound z2 , 0 . 09 g tbtu , 0 . 05 ml dipea were dissolved in 15 ml dichloromethane and stirred for 20 minutes at 25 ° c . then 33 mg 1 - methyl - 4 - aminopiperidin were added and the mixture was stirred for a further 3 hours at 25 ° c . the solution was extracted with 20 ml water , then evaporated down in vacuo . the product was crystallised using ether . yield : 0 . 047 g of white crystals . 0 . 1 g of the compound z2 , 0 . 09 g tbtu , 0 . 5 ml dipea were dissolved in 15 ml dichloromethane and stirred for 30 minutes at 25 ° c . then 50 mg 4 - amino - 1 - benzylpiperidin were added and the mixture was stirred for a further 3 hours at 25 ° c . the solution was extracted with 20 ml water , then evaporated down in vacuo . then the residue was chromatographed over silica gel and the isolated product was crystallised with ether . yield : 0 . 015 g of white crystals . 0 . 17 g of the compound z1 , 0 . 19 g tbtu , 0 . 11 ml dipea were dissolved in 50 ml dichloromethane and stirred for 30 minutes at 25 ° c . then 63 mg of 1 - methyl - 4 - aminopiperidine were added and the mixture was stirred for a further 17 hours at 25 ° c . 50 ml of water and 1 g of potassium carbonate were added to the solution and the organic phase was separated off using a phase separation cartridge , then evaporated down in vacuo . then the product was purified by silica gel chromatography and the purified product was crystallised with ether . yield : 0 . 1 g of white crystals . 0 . 17 g of the compound z1 , 0 . 19 g tbtu , 0 . 11 ml dipea were dissolved in 50 ml dichloromethane and stirred for 30 minutes at 25 ° c . then 77 mg of exo - 3 - β - amino - tropane were added and the mixture was stirred for a further 17 hours at 25 ° c . 50 ml of water and 1 g of potassium carbonate were added to the solution and the organic phase was separated off using a phase separation cartridge , then evaporated down in vacuo . then the product was purified by silica gel chromatography and the purified product was crystallised with ether . yield : 0 . 03 g of white crystals . 0 . 15 g of the compound z3 , 0 . 12 g tbtu , 0 . 12 ml dipea were dissolved in 5 ml dichloromethane and stirred for 30 minutes at 25 ° c . then 50 mg 1 - methyl - 4 - aminopiperidin were added and the mixture was stirred for a further 2 . 5 hours at 25 ° c . the solution was then extracted with water and then evaporated down . the residue was dissolved in warm ethyl acetate and crystallised from ether and petroleum ether . yield : 0 . 025 g of white crystals . m . p . : 203 ° c . as the base 0 . 2 g of the compound z8 , 0 . 2 g of tbtu , 0 . 1 ml of dipea were dissolved in 10 ml dichloromethane and stirred for 30 minutes at 25 ° c . then 100 mg of 1 - methyl - 4 - aminopiperidine were added and the mixture was stirred for a further 17 hours at 25 ° c . the solution was then extracted with a dilute potassium carbonate solution and evaporated down . the residue was crystallised using ether . yield : 0 . 12 g of white crystals 0 . 2 g of compound z8 , 0 . 2 g of tbtu , 0 . 3 ml of dipea were dissolved in 5 ml dichloromethane and stirred for 1 h at 25 ° c . then 0 . 13 g of 4 - amino - 1 - benzylpiperidine were added and the mixture was stirred for a further hour at 25 ° c . the solution was then diluted with 10 ml methylene chloride and extracted with 20 ml water . then the product was purified over silica gel and crystallised from ethyl acetate and ether . yield : 0 . 23 g of the compound z8 . 0 . 23 g of the benzylamine z8 are dissolved in 10 ml methanol , combined with 50 mg of pd / c and hydrogenated under 3 bar for 3 h at 25 ° c . by adding petroleum ether and ethyl acetate white crystals are produced . these are chromatographed over silica gel and crystallised from ethyl acetate and ether . yield : 0 . 075 g of white crystals . 0 . 1 g of compound z10 , 0 . 09 g of tbtu , 0 . 3 ml of dipea were dissolved in 4 ml of dichloromethane and stirred for 20 minutes at 25 ° c . then 67 mg xx amine was added and stirred for a further 2 hours at 25 ° c . the solution was then diluted with dichloromethane and extracted with water . it was then chromatographed over silica gel and the residue was dissolved in acetone , combined with ethereal hcl and the precipitate formed was isolated . yield : 0 . 09 g light yellow solid 0 . 1 g of the compound z10 , 0 . 11 g of tbtu , 0 . 14 ml of dipea were dissolved in 2 ml dimethylformamide and stirred for 3 h at 50 ° c . then 55 mg of 4 - morpholinomethylphenylamine was added . the reaction mixture was then cooled to ambient temperature within 17 h . then the dimethylformamide was eliminated in vacuo , the residue was taken up in dichloromethane and extracted with water . it was then chromatographed over silica gel and the product crystallised from ethyl acetate and ether . yield : 0 . 06 g yellowish crystals 0 . 2 g of the compound z4 , 0 . 2 g of tbtu , 0 . 1 ml of dipea were dissolved in 10 ml dichloromethane and stirred for 30 minutes at 25 ° c . then 0 . 1 g of 1 - methyl - 4 - aminopiperidine were added and the mixture was stirred for a further 17 hours at 25 ° c . the solution was then extracted with aqueous potassium carbonate solution and then evaporated down . the product was crystallised using ether . yield : 0 . 16 g of white crystals . 0 . 1 g of the compound z5 , 0 . 07 g of tbtu , 0 . 15 ml of dipea were dissolved in 5 ml dichloromethane and stirred for 20 minutes at 25 ° c . then 0 . 04 g 1 - methyl - 4 - aminopiperidine were added and the mixture was stirred for a further 2 hours at 25 ° c . the solution was then diluted with 15 ml dichloromethane and extracted with 20 ml water . the residue was dissolved in meoh and acetone , combined with 1 ml ethereal hcl and evaporated down . a crystalline product was produced using ether , ethyl acetate and a little meoh . yield : 0 . 1 g of white crystals . 0 . 1 g of the compound z6 , 0 . 12 g of tbtu , 0 . 12 ml of dipea were in 10 ml dichloromethane dissolved and stirred for 30 minutes at 25 ° c . then 0 . 04 g of 1 - methyl - 4 - aminopiperidine were added and the mixture was stirred for a further 2 hours at 25 ° c . the solution was then diluted with 10 ml dichloromethane and extracted with 10 ml water . a crystalline product was produced using ether , ethyl acetate and petroleum ether . yield : 0 . 6 g of white crystals . 0 . 1 g of the compound z6 , 0 . 08 g of tbtu , 0 . 08 ml of dipea were dissolved in 10 ml dichloromethane and stirred for 30 minutes at 25 ° c . then 37 μl g n , n - dimethyineopentanediamine were added and the mixture was stirred for a further 2 hours at 25 ° c . the solution was then diluted with 10 ml dichloromethane and extracted with 10 ml water . the product was then chromatographed over silica gel and crystallised from ethyl acetate , ether and petroleum ether . yield : 0 . 005 g of white crystals . 0 . 15 g of the compound z7 , 0 . 16 g of tbtu , 1 ml of dipea were dissolved in 5 ml dichloromethane and stirred for 30 minutes at 25 ° c . then 0 . 1 g 4 - morpholinocyclohexylamine were added and the mixture was stirred for a further 17 hours at 25 ° c . the residue was then combined with 10 ml of 10 % potassium carbonate solution , the precipitate was isolated and washed with water . it was then dissolved in dichloromethane and evaporated down again . the product was crystallised from ethyl acetate . yield : 0 . 1 g of white crystals . 150 mg of the compound z9 and 93 mg of amine were dissolved in 5 ml dichloromethane and stirred with 160 mg of tbtu and 1 ml of dipea for 12 h at rt . the solvent was eliminated in vacuo , the residue was combined with 10 ml of 10 % potassium carbonate solution . the precipitate was suction filtered , washed with water , taken up in dichloromethane , dried and the solvent eliminated in vacuo . the residue was crystallised from ethyl acetate . yield : 82 . 0 mg ; m . p . 253 ° c . ( as base ). 150 mg of the compound z8 and 73 mg of trans - 4 - piperidino - cyclohexylamine were dissolved in 5 ml dichloromethane and stirred with 160 mg ( 0 . 50 mmol ) of tbtu and 1 ml of dipea for 12 h at rt . the solvent was eliminated in vacuo , the residue was combined with 10 ml of 10 % potassium carbonate solution . the precipitate was suction filtered , washed with water , taken up in dichloromethane , dried and the solvent eliminated in vacuo . the residue was crystallised from ethyl acetate . yield : 87 . 0 mg ; m . p . 237 ° c . ( as base ). 100 mg of the compound z9 and 42 mg of 3 - amino - 1 - ethyl - pyrolidine were dissolved in 10 ml dichloromethane and stirred with 90 mg of tbtu and 0 . 5 ml of dipea for 12 h at rt . the solvent was eliminated in vacuo , the residue was combined with 10 ml of 10 % potassium carbonate solution . the precipitate was suction filtered , washed with water , taken up in dichloromethane , dried and the solvent was eliminated in vacuo . the residue was crystallised from ethyl acetate / petroleum ether . yield : 24 . 0 mg . 100 mg of the compound z11 and 73 mg of 4 - amino - 1 tetrahydro - 4h - pyran - 4 - yl - piperidine were dissolved in 10 ml dichloromethane and stirred with 90 mg of tbtu and 0 . 5 ml of dipea for 1 h at rt . the solvent was eliminated in vacuo , the residue was combined with 10 ml of 10 % potassium carbonate solution . the precipitate was suction filtered , washed with water , taken up in dichloromethane , dried and the solvent was eliminated in vacuo . the residue was crystallised from ethyl acetate / petroleum ether . yield : 89 mg . 150 mg of the compound z5 and 150 mg of trans - 4 -( 4 - cyclopropylmethyl - piperazin - 1 - yl )- cyclohexylamine ( as the hydrochloride ) were dissolved in 5 ml of dichloromethane and stirred with 160 mg of tbtu and 2 ml of dipea for 2 h at rt . the solvent was eliminated in vacuo , the residue was combined with 10 ml of 10 % potassium carbonate solution . the precipitate was suction filtered , washed with water , taken up in dichloromethane , dried and the solvent eliminated in vacuo . the residue was purified over a column ( 20 ml silica gel , 300 ml ethyl acetate 90 / methanol 10 + 2 % conc . ammonia ). the appropriate fractions were evaporated down in vacuo and crystallised from ethyl acetate . yield : 140 mg ; m . p . 187 ° c . ( as base ). 390 mg of the compound z11 and 240 mg of trans - 4 -( 4 - tbutyloxycarbonyl - piperazin - 1 - yl )- cyclohexylamine were dissolved in 2 . 5 ml of nmp and stirred with 482 mg of tbtu and 1 ml triethylamine for 2 h at rt . then 100 ml of water and 200 mg of potassium carbonate were added , the precipitate was suction filtered , washed with water and purified through a silica gel column . the appropriate fractions were evaporated down in vacuo , dissolved in 2 ml dichloromethane , combined with 2 ml of trifluoroacetic acid and stirred for 2 h at rt , combined with another 100 ml of water and 200 mg potassium carbonate and the precipitate was suction filtered and washed with water . then the precipitate was purified through a silica gel column . the appropriate fractions were evaporated down in vacuo and the residue was crystallised from ethanol and conc . hydrochloric acid . yield : 95 mg ; m . p . 291 ° c . 60 mg of the compound of example 232 was dissolved in 10 ml ethyl acetate and stirred with 1 ml of acetic anhydride and 1 ml of triethylamine for 30 min . at rt . the solvent was eliminated in vacuo , the residue combined with water and ammonia , the crystals precipitated were suction filtered and washed with water and a little cold acetone . yield : 40 mg ; m . p . 248 ° c . 1 . 2 g of the compound z9 and 0 . 5 g of 1 , 4 - dioxaspiro [ 4 . 5 ] dec - 8 - ylamine were dissolved in 20 ml dichloromethane and stirred with 1 . 28 g of tbtu and 4 ml of triethylamine for 12 h at rt . then 50 ml of water and 0 . 5 g of potassium carbonate were added , the org . phase was separated off , dried and evaporated down in vacuo . the residue was crystallised from ethyl acetate , combined with 25 ml of 1 n hydrochloric acid and 20 ml of methanol and stirred for 30 min at 50 ° c . the methanol was eliminated in vacuo , the precipitate was suction filtered , washed with water and dried . the residue was taken up in 20 ml dichloromethane , stirred with 0 . 5 g of thiomorpholine and 0 . 5 g of nabh ( oac ) 3 for 12 h at rt . then water and potassium carbonate were added , the org . phase was separated off , dried and the solvent was eliminated in vacuo . the residue was purified over a silica gel column . the appropriate fractions were evaporated down in vacuo and the hydrochloride was precipitated with ethereal hcl . yield : 86 mg of trans - isomer ; amorphous powder . 200 mg of the compound z3 in 5 ml dichloromethane was combined with 0 . 1 ml of diisopropylethylamine and 180 mg of tbtu and stirred for 30 min . then 191 mg of 4 -( 4 - methyl - piperazin - 1 - yl )- phenylamine were added and the mixture was stirred overnight . the reaction mixture was combined with water and the aqueous phase extracted with dichloromethane . the combined organic phases were dried over na 2 so 4 and z9 orated down . the residue was purified by column chromatography ( eluant : dichloromethane / methanol 100 : 7 ). the compounds of formula ( i ) listed in table 1 , inter alia , are obtained analogously to the procedure described hereinbefore . the abbreviations x 1 , x 2 , x 3 , x 4 and x 5 used in table 1 in each case denote a link to a position in the general formula shown under table 1 instead of the corresponding groups r 1 , r 2 , r 3 , r 4 and l - r 5 . as has been found , the compounds of general formula ( i ) are characterised by their wide range of applications in the therapeutic field . particular mention should be made of those applications in which the inhibition of specific cell cycle kinases , particularly the inhibiting effect on the proliferation of cultivated human tumour cells but also the proliferation of other cells , such as endothelial cells , for example , plays a part . as could be demonstrated by facs analysis , the inhibition of proliferation brought about by the compounds according to the invention is mediated by the arrest of the cells , particularly at the g2 / m phase of the cell cycle . the cells arrest , independently of the cells used , for a specific length of time in this phase of the cell cycle before programmed cell death is initiated . an arrest in the g2 / m phase of the cell cycle is triggered , for example , by the inhibition of specific cell cycle kinases . studies in model organisms such as schizosaccharomyces pombe or xenopus , or investigations in human cells have shown that the transition from the g2 phase to mitosis is regulated by the cdk1 / cyclin b kinase ( nurse , 1990 ). this kinase , which is also known as the “ mitosis promoting factor ” ( mpf ), phosphorylates and thereby regulates a number of proteins , such as e . g . nuclear lamins , kinesin - like motor proteins , condensins and golgi matrix proteins , which play an important part in the breakdown of the nuclear envelope , in centrosome separation , the formation of the mitotic spindle apparatus , chromosome condensation and the breakdown of the golgi apparatus ( nigg . e ., 2001 ). a murine cell line with a temperature - sensitive cdk1 kinase mutant shows a rapid breakdown of the cdk1 kinase and a subsequent arrest in the g2 / m phase after a temperature increase ( th &# 39 ; ng et al ., 1990 ). the treatment of human tumour cells with inhibitors against cdk1 / cyclin b such as e . g . butyrolactone also leads to an arrest in the g2 / m phase and subsequent apoptosis ( nishio , et al . 1996 ). another kinase which is involved in the g2 and mitosis phase is polo - like kinase 1 ( plk1 ), which is responsible for the maturation of the centrosomes , for the activation of the phosphatase cdc25c , as well as for the activation of the anaphase promoting complex ( glover et al ., 1998 , qian , et al ., 2001 ). the injection of plk1 antibodies leads to a g2 arrest in untransformed cells whereas tumour cells arrest in the mitosis phase ( lane and nigg , 1996 ). in addition , the protein kinase aurora b has been described as having an essential function during entry into mitosis . aurora b phosphorylates histone h3 at ser 1 and thereby initiates chromosome condensation ( hsu , j . y . et al ., 2000 ). a specific cell cycle arrest in the g2 / m phase may , however , also be triggered e . g . by the inhibition of specific phosphatases such as e . g . cdc25c ( russell and nurse , 1986 ). yeasts with a defective cdc25 gene arrest in the g2 phase , while overexpression of cdc25 leads to early entry into the mitosis phase ( russell and nurse , 1987 ). however , an arrest in the g2 / m phase can also be triggered by the inhibition of certain motor proteins , so - capped kinesins such as e . g . eg5 ( mayer et al ., 1999 ), or by agents which stabilise or destabilise microtubules ( e . g . colchicin , taxol , etoposide , vinblastin , vincristin ) ( schiff and horwitz , 1980 ). in view of their biological properties the compounds of general formula i according to the invention , their isomers and their physiologically acceptable salts are suitable for the treatment of diseases characterised by excessive or abnormal cell proliferation . such diseases include , for example : viral infections ( e . g . hiv and kaposi &# 39 ; s sarcoma ); inflammatory and autoimmune diseases ( e . g . colitis , arthritis , alzheimer &# 39 ; s disease , glomerulonephritis and wound healing ); bacterial , fungal and / or parasitic infections ; leukaemias , lymphoma and solid tumours ; skin diseases ( e . g . psoriasis ); bone diseases ; cardiovascular diseases ( e . g . restenosis and hypertrophy ). they are also suitable for protecting proliferating cells ( e . g . hair , intestinal , blood and progenitor cells ) from damage to their dna caused by radiation , uv treatment and / or cytostatic treatment ( davis et al ., 2001 ). the new compounds may be used for the prevention , short - term or long - term treatment of the abovementioned diseases , also in combination with other active substances used for the same indications , e . g . cytostatics . the activity of the compounds according to the invention was determined in the cytotoxicity test on cultivated human tumour cells and / or in a facs analysis , for example on helas3 cells . in both test methods , the compounds exhibited a good to very good activity , i . e . for example an ec 50 value in the helas3 cytotoxicity test of less than 5 μmol , generally less than 1 μmol . to measure the cytotoxicity on cultivated human tumour cells , cells of the cervical cancer tumour cell line helas3 ( obtained from american type culture collection ( atcc )) in ham &# 39 ; s f12 medium ( life technologies ) and 10 % foetal calf serum ( life technologies ) were cultivated and harvested in the logarithmic growth phase . then the helas3 cells were placed in 96 - well plates ( costar ) at a density of 1000 cells per well and incubated overnight in an incubator ( at 37 ° c . and 5 % co 2 ), while on each plate 6 wells were filled only with medium ( 3 wells as a control of the medium , 3 wells for incubation with reduced alamarblue ). the active substances were added to the cells in various concentrations ( dissolved in dmso ; final concentration : 1 %) ( in each case as a triple measurement ). after 72 hours &# 39 ; incubation , 20 μl of alamarblue ( accumed international ) were added to each well , and the cells were incubated for a further 7 hours . as a control , 20 μl of reduced alamar blue ( alamarblue reagent which had been autoclaved for 30 min ) were added to 3 wells . after 7 h incubation the colour change of the alamarblue reagent in the individual wells was determined in a perkin elmer fluorescence spectrophotometer ( excitation 530 nm , emission 590 nm , slits 15 , integrate time 0 . 1 ). the amount of alamarblue reagent reacted represents the metabolic activity of the cells . the relative cell activity was calculated as a percentage of the control ( hela s3 cells without inhibitor ) and the active substance concentration which inhibits the cell activity by 50 % ( ic 50 ) was obtained . the values were calculated from the average of three individual measurements , correcting for the control value ( medium control ). propidium iodide ( pi ) binds stoichiometrically to double - stranded dna , and is thus suitable for determining the percentage of cells in the g1 , s and g2 / m phase of the cell cycle on the basis of the cell dna content . cells in the g0 and g1 phase have a diploid dna content ( 2n ), whereas cells in g2 or mitosis have a 4n dna content . for pi staining , 0 . 4 million helas3 cells were seeded , for example , on a 75 cm 2 cell culture flask , and after 24 h either 1 % dmso was added as control or the substance was added in various concentrations ( in 1 % dmso ). the cells were incubated for 24 h with the substance or with dmso , before the cells were washed with 2 × pbs and detached with trypsin / edta . the cells were centrifuged ( 1000 rpm , 5 min , 4 ° c . ), and the cell pellet was washed 2 × with pbs , before the cells were resuspended in 0 . 1 ml of pbs . then the cells were fixed with 80 % ethanol for 16 hours at 4 ° c . or alternatively for 2 hours at − 20 ° c . the fixed cells ( 10 6 cells ) were centrifuged ( 1000 rpm , 5 min , 4 ° c . ), washed with pbs and then centrifuged again . the cell pellet was resuspended in 2 ml of triton x - 100 in 0 . 25 % pbs , and incubated for 5 min on ice , before 5 ml of pbs were added and the mixture was centrifuged again . the cell pellet was resuspended in 350 μl of pi stain solution ( 0 . 1 mg / ml of raze a , 10 μg / ml of presidium iodide in 1 × pbs ). the cells were incubated for 20 min in the dark with the stain buffer before being transferred into sample measuring vessels for the facs scan . the dna measurement was carried out in a becton dickinson facs analyzer , with an argon laser ( 500 mw , emission 488 nm ), and the dna cell quest program ( bd ). the logarithmic pi fluorescence was determined with a band - pass filter ( bp 585 / 42 ). the cell populations in the individual phases of the cell cycle were quantified with the modfit lt program of becton dickinson . the compounds of general formula ( i ) may be used on their own or combined with other active substances according to the invention , optionally also in conjunction with other pharmacologically active substances . suitable preparations include for example tablets , capsules , suppositories , solutions , particularly solutions for injection ( s . c ., i . v ., i . m .) and infusion , syrups , emulsions or dispersible powders . the amount of pharmaceutically active compound in each case should be in the range from 0 . 1 - 90 wt . %, preferably 0 . 5 - 50 wt . % of the total composition , i . e . in amounts which are sufficient to achieve the dosage range given below . the doses specified may , if necessary , be given several times a day . suitable tablets may be obtained , for example , by mixing the active substance ( s ) with known excipients , for example inert diluents such as calcium carbonate , calcium phosphate or lactose , disintegrants such as corn starch or alginic acid , binders such as starch or gelatine , lubricants such as magnesium stearate or talc and / or agents for delaying release , such as carboxymethyl cellulose , cellulose acetate phthalate , or polyvinyl acetate . the tablets may also comprise several layers . coated tablets may be prepared accordingly by coating cores produced analogously to the tablets with substances normally used for tablet coatings , for example collidone or shellac , gum arabic , talc , titanium dioxide or sugar . to achieve delayed release or prevent incompatibilities the core may also consist of a number of layers . similarly the tablet coating may consist of a number of layers to achieve delayed release , possibly using the excipients mentioned above for the tablets . syrups or elixirs containing the active substances or combinations thereof according to the invention may additionally contain a sweetener such as saccharin , cyclamate , glycerol or sugar and a flavour enhancer , e . g . a flavouring such as vanillin or orange extract . they may also contain suspension adjuvants or thickeners such as sodium carboxymethyl cellulose , wetting agents such as , for example , condensation products of fatty alcohols with ethylene oxide , or preservatives such as p - hydroxybenzoates . solutions for injection and infusion are prepared in the usual way , e . g . with the addition of preservatives such as p - hydroxybenzoates , or stabilisers such as alkali metal salts of ethylenediamine tetraacetic acid , optionally using emulsifiers and / or dispersants , while if water is used as the diluent organic solvents may optionally be used as solubilisers or auxiliary solvents , and transferred into injection vials or ampoules or infusion bottles . capsules containing one or more active substances or combinations of active substances may for example be prepared by mixing the active substances with inert carriers such as lactose or sorbitol and packing them into gelatine capsules . suitable suppositories may be made for example by mixing with carriers provided for this purpose , such as neutral fats or polyethyleneglycol or the derivatives thereof . suitable excipients may be , for example , water , pharmaceutically acceptable organic solvents , such as paraffins ( e . g . petroleum fractions ), oils of vegetable origin ( e . g . groundnut or sesame oil ), mono - or polyfunctional alcohols ( e . g . ethanol or glycerol ), carriers such as e . g . natural mineral powders ( e . g . kaolin , clays , talc , chalk ), synthetic mineral powders ( e . g . highly dispersed silica and silicates ), sugar ( e . g . glucose , lactose and dextrose ), emulsifiers ( e . g . lignin , spent sulphite liquors , methylcellulose , starch and polyvinylpyrrolidone ) and lubricants ( e . g . magnesium stearate , talc , stearic acid and sodium lauryl sulphate ). the preparations are administered in the usual way , preferably by oral or transdermal route , particularly preferably by oral route . when administered orally the tablets may , of course , contain additives , such as e . g . sodium citrate , calcium carbonate and dicalcium phosphate together with various additives , such as starch , preferably potato starch , gelatine and the like , in addition to the abovementioned carriers . lubricants such as magnesium stearate , sodium laurylsulphate and talc may also be used to form tablets . in the case of aqueous suspensions the active substances may be combined with various flavour enhancers or colourings in addition to the abovementioned excipients . for parenteral use , solutions of the active substances may be prepared using suitable liquid carrier materials . the dosage for intravenous use is 1 - 1000 mg per hour , preferably between 5 - 500 mg per hour . however , it may optionally be necessary to deviate from the amounts specified , depending on the body weight or method of administration , the individual response to the medication , the nature of the formulation used and the time or interval over which it is administered . thus , in some cases , it may be sufficient to use less than the minimum quantity specified above , while in other cases the upper limit specified will have to be exceeded . when large amounts are administered it may be advisable to spread them over the day in a number of single doses . the formulation examples that follow illustrate the present invention without restricting its scope : the finely ground active substance , lactose and some of the corn starch are mixed together . the mixture is screened , then moistened with a solution of polyvinylpyrrolidone in water , kneaded , wet - granulated and dried . the granules , the remaining corn starch and the magnesium stearate are screened and mixed together . the mixture is compressed to produce tablets of suitable shape and size . b ) tablets per tablet active substance 80 mg lactose 55 mg corn starch 190 mg microcrystalline cellulose 35 mg polyvinylpyrrolidone 15 mg sodium - carboxymethyl starch 23 mg magnesium stearate 2 mg 400 mg the finely ground active substance , some of the corn starch , lactose , microcrystalline cellulose and polyvinylpyrrolidone are mixed together , the mixture is screened and worked with the remaining corn starch and water to form a granulate which is dried and screened . the sodiumcarboxymethyl starch and the magnesium stearate are added and mixed in and the mixture is compressed to form tablets of a suitable size . c ) ampoule solution active substance 50 mg sodium chloride 50 mg water for inj . 5 ml the active substance is dissolved in water at its own ph or optionally at ph 5 . 5 to 6 . 5 and sodium chloride is added to make it isotonic . the solution obtained is filtered free from pyrogens and the filtrate is transferred under aseptic conditions into ampoules which are then sterilised and sealed by fusion . the ampoules contain 5 mg , 25 mg and 50 mg of active substance . | 2 |
the process according to the invention can be carried out with outer layers made from various materials . examples of suitable materials are acrylic , polycarbonate , glass , fiberglass - reinforced polymer sheet , or other light transmitting sheet materials . acrylic sheet can either be extruded or cell cast although it must behave within standard parameters known in the art of thermoplastic acrylic sheet . the glass may be tempered or untempered , clear , light transmitting , tinted , or it may be textured on one side . polycarbonate and other polymer sheets and reinforced sheets may also be clear , tinted , or surface textured . preferred outer layers include those made from sheet material comprising extruded fiberglass - reinforced polyester with slightly visible glass fibers . the fibers add to the visual depth and texture of the material by providing an iridescent light transmitting effect . such materials are economical , which is important in the architectural and large - scale construction industries . preferred outer layers are untinted , but they may also be tinted or surface textured . in a preferred embodiment the outer layer material may be easily cut using standard woodworking methods , has a durable surface and resists scratching and marring . preferably , the untrimmed finished panel should be at least ½ ″ larger than the desired finished panel in the length and width dimensions in order to allow for trimming of the laminated panels to expose a clean , square edge . the cellular structures may be composed of metals , for example : iron , steel , zinc , zinc - plated iron , tin , bronze , non - ferrous metals , copper , titanium or preferably aluminum , or alloys thereof . the metals used may be provided as foils , tapes or sheets . the cellular structures may also be made from other materials , including plastics , such as polycarbonates and other polymers , pmma ( polymethyl methacrylate ), cellulose acetate , polypropylene , pet ( polyethylene terephthalate ) or the like . preferred cellular structures of the present invention include tubular polycarbonate structures in various densities and cell sizes from 1 . 5 mm to 7 mm , and bonded ribbon polymer structures , specifically the core manufactured by wacotech in various densities and cell sizes , e . g ., from 4 mm to 14 mm . preferred structures also include molded plastic structures . the cellular structures are more preferably made from aluminum or alloys thereof . the cellular structures preferably have a density of 3 . 3 pcf ( pounds / cubic foot ) and a thickness of 0 . 625 inches and a cell size of 0 . 375 inches , although other sizes and configurations are also contemplated by the present invention . the cellular structures are , for example , bundles of individual cells . they may have the shape of tube bundles or honeycombs . the individual cells may have a regular shape , such as circular or polygonal cross - section , e . g ., rectangular or hexagonal . the individual cells may also have irregular shapes or ribbon - like shapes . preferred cellular structures are honeycombs having a hexagonal cross - section for each individual cell . especially preferred cellular structures comprise aluminum honeycomb material with a wall thickness of about 0 . 0026 inches . the aluminum cellular structures of the present invention have numerous advantages over existing cellular structures composed of paper or cardboard honeycomb . such paper structures have a wall thickness of 0 . 005 to 0 . 006 inches or approximately twice as thick as the metal or polycarbonate structures of the present invention . also , paper cores are generally sawed to the desired thickness , creating a frayed bonding surface , and being porous , absorb both adhesive and light , such that they do not possess reflective properties like those of preferred metallic and plastic cores . such structures may be well suited for their intended uses , but are not suitable in the light transmitting panels of the present invention . a preferred cellular structure according to the invention is manufactured by hexcel . expandable honeycomb cores are preferably expanded in such a way as to produce very regular cell shapes . such cores are referred to in the industry as “ visual grade ” core . suitable adhesives for use in the present invention may have a flow temperature , that is , a temperature at which the adhesive begins to melt and flow . examples of preferred adhesive materials include clear urethane , polyester polyurethane , polyester ( acrylic modified or other ), polyolefins , polyethylenes and other thermoplastic and / or thermoset films . the adhesive film is preferably manufactured as a film and applied to the sheet as a film , but it may be applied to the sheet as a liquid to form a film in situ . the adhesive may be heat sensitive and pressure sensitive , or it may be either heat sensitive or pressure sensitive . for example , the aliphatic polyester polyurethane film tecoflex ag8451 , or agkr , a reprocessed version of ag8451 , both manufactured by thermedics may be used , and acrylic modified polyester films manufactured by bemis , inc ., may be used . the times and temperatures appropriate for any particular adhesive to achieve desired aspects can be determined by those skilled in the art based on the processes , examples and disclosures set forth herein . the thickness of the adhesive film determines whether the cellular structure bonds sufficiently to the outer sheet , but too thick a film may tend to produce visually distorting glue fillets typically found in honeycomb panels constructed with liquid , reticulated or thicker film adhesives . the adhesive film may have a thickness of between 0 . 002 and 0 . 060 inches , a preferred thickness is between 0 . 004 and 0 . 006 inches . a most preferred adhesive is a 0 . 005 inches thick water clear thermoplastic urethane film adhesive provided in roll form , with a textured release liner on one side . the liner protects the film and provides an embossed surface texture which allows for ease in handling . the present invention may utilize a two step process wherein the outer layer or the outer layers can be adhered to the cellular structure after the adhesive film is adhered to the outer layer or layers . this two step process insures an intimate contact between the adhesive film and the outer layer . in the prior art glue fillets of a structurally sound panel ranged from about 0 . 03 inches up to about 0 . 125 inches wide , measured from the edge of the cell to the area where the fillet returned to the level of the surrounding glue film or sheet face and ceased to alter the transmission of light through the panel ( see x in fig5 ), and they rose above the surface of the surrounding adhesive by up to about 0 . 03 inches in the present invention the width of glue fillets and other variations in the thickness of the glue film , if they exist at all , is preferably less than about 0 . 005 inches , and most preferably less than 0 . 001 inches or zero for practical purposes . see fig4 . the compositions and processes of the present invention may be understood through the following examples , but these examples do not limit the present invention . a light transmitting facing material with a protective film which can be removed immediately prior to handling is selected — sequentia product # 75539 manufactured by kemlite company , inc . this material is a 0 . 06 inch thick composite of fiberglass reinforcement in a plastic ( polymer ) matrix . the protective film provides a clean and unmarred surface to which the adhesive film can be laminated and also eliminates the need for additional labor and material costs associated with preparing the facing for pre - lamination . the facing is lightly cleaned with alcohol to ensure that no marks or debris are laminated onto the interior of the panel . the adhesive film is 0 . 005 inches tecoflex ™ ag 8 451 , manufactured by thermedics polymer products , a division of thermo electron corp ., and composed of aliphatic polyetherurethane . this film has a melting point between 325 to 375 ° f . and 85 - 95 % light transmission . referring to fig1 the adhesive film 4 is set to unroll from the supply roll 1 onto one face of the outer layer 5 in a manner such that the adhesive does not touch the heated top roller 3 until the point of contact in order to prevent the film from reaching flow temperature prior to lamination . the film 4 is laminated to the outer layer 5 with release liner 2 interposed between the hot roller 3 and the film 4 and preferably with the aid of a second roller 6 which may be heated . an alternative to the hot roll lamination method of example 1 is depicted in fig2 and comprises the steps of : a ) laying an outer layer 5 and release film 7 facing down , on a flat surface such as a lay up table 8 , which is at least 6 ″ larger than the outer layer on all sides ; b ) laying an adhesive film 4 on the outer layer 5 , using appropriate tension to ensure that it lays flat with no folds , wrinkles or uneven areas ; c ) repeating steps a ) and b ) until approximately 20 outer layer / adhesive film layers have been stacked ; e ) overlaying the stack with a vacuum bag and providing an air tight seal ; f ) placing the stack in an oven under a minimum of 15 psi in order to adhere the films to the outer layer , and to eliminate air pockets ; g ) cooling the stack while maintaining the vacuum until the outer layer returns to ambient temperature ; and h ) immediately before panel lay - up ( in order to keep ambient debris and dust from contaminating the adhesive side of the layer ), removing the release film from each pre - laminated outer layer . in the oven step ( f ) the temperature is at or near the low point of the adhesive film &# 39 ; s flow temperature [ approximately 285 ° f .] so that the adhesive film does not completely liquefy but rather becomes clear and tacky , and it adheres to the outer layer . in this example , the temperature is maintained for approximately 1 hour per 1 ″ of stack height , although those skilled in the art will recognize that the time will vary with the temperature and materials used . a light transmitting panel is prepared according to the following procedure as shown in fig3 : a ) laying release film 7 on a flat table 8 ; b ) placing a first outer layer 9 ( its release film having been removed ) with its adhered pre - laminated film adhesive face up on the release film 7 ; c ) placing a cellular structure 10 on the pre - laminated outer layer 9 so that direct contact between the adhesive film and the cellular structure is provided ; d ) centering the structure on the pre - laminated outer layer such that the structure has approximately the same dimensions as the outer layer ; e ) placing a second pre - laminated outer layer 9 ( its release film having been removed ) on the core 10 such that the adhesive film adhered to 9 is facing down and in direct contact with the structure and is aligned with the first outer layer ; f ) placing a second layer of release film 7 on the second outer layer 9 on the side opposite the structure 10 ; g ) repeating steps b ) to f ) until the desired number of panels is reached , although it is preferable to provide no more than 10 to 15 inches high stack in order to insure an even heat distribution throughout the stack ; i ) overlaying the stack with a vacuum bag and providing a seal ; j ) placing the stack in an oven under a minimum pressure of 15 psi ; k ) increasing the temperature in the oven slowly to 200 ° f . over a period of about 45 minutes ; l ) increasing the oven temperature to 250 ° f ., over a period of about 45 minutes , such that the entire stack of panels reaches a point approximately just below the flow temperature of the adhesive at approximately the same time ; m ) increasing the temperature further to about 300 ° f . oven a period of about 45 minutes ; n ) thereafter increasing the temperature further to 325 ° f ., which is somewhat above the flow temperature , for about 30 minutes . one skilled in the art will realize that the exact times and temperatures could vary from this example according to the performance characteristics of individual ovens and materials and may adjust them as necessary . during the step ( j ), the pressure does not exceed a level which would deform the outer layer or the cellular structure materials . a thermocouple , for example the dpr 300 digital process recorder by honeywell , is used to insure accurate temperatures . after the flow temperature is attained in the entire stack , the stack is removed from the heat and allowed to cool while being maintained under vacuum , until the entire stack reaches room temperature . the vacuum bag is removed and a protective film applied to insure that the finished panels remain in good condition during trimming , shipping , on - site storage , on - site fabrication , handling , installation , and the like . it will be understood that other variations of the processes and components of the present may be used without deviating from the invention . for example , in place of ovens in the steps of prelaminating the adhesive film or preparing the panel , autoclaves or heated platens may be used , or an adhesive may be applied to a sheet in liquid form and then partially or fully cured or dried to form an adhesive film on the sheet . | 1 |
preferred embodiments of the brushless motor drive system according to the present invention will now be described in detail with reference to fig1 to 12 . fig1 is an overall block circuit diagram showing the construction of a preferred embodiment of the brushless motor drive system according to the present invention . in fig1 like reference numerals are used to designate like functional parts appearing in fig1 showing a prior art brushless motor drive system so as to dispense with repeated description of such parts . referring to fig1 drive transistors 10 , 11 and 12 are connected at their bases to respective output terminals of a first amplifier 71 , and drive transistors 13 , 14 and 15 are also connected at their bases to respective output terminals of a second amplifier 72 . the first and second amplifiers 71 and 72 are connected at their input terminals to respective output terminals of a distribution circuit 70 , and the distribution circuit 70 is connected at its input terminals to respective output terminals of a slope synthesizing circuit 63 and to those of a speed error amplifier 80 . a torque command voltage et is externally applied to a non - inverting input terminal of the speed error amplifier 80 . the speed error amplifier 80 is connected in common at its inverting input terminal to the emitters of the drive transistors 13 to 15 and to one terminal of a resistor 81 which is grounded at its other terminal . the slope synthesizing circuit 63 is connected at its input terminals to respective output terminals of a logic circuit 61 and to those of a slope generating circuit 62 . the slope generating circuit 62 is connected at its input terminals to an output a of the logic circuit 61 and to an output ib of a voltage - controlled oscillator 40 . the logic circuit 61 is connected at its input terminal to an output f of the voltage - controlled oscillator 40 . the combination of the slope synthesizing circuit 63 , the slope generating circuit 62 and the logic circuit 61 constitutes a slope synthesizer 60 . the voltage - controlled oscillator 40 is connected at its input terminals to an output of a lowest frequency setting circuit 50 and to an output eao of an operational amplifier 31 . a series circuit consisting of a resistor 33 and a capacitor 34 is connected together with another capacitor 35 between an inverting input terminal and an output terminal of the operational amplifier 31 . a predetermined bias voltage is applied by resistors 36 and 37 to a non - inverting input terminal of the operational amplifier 31 , and the inverting input terminal of the operational amplifier 31 is connected through a resistor 32 to an output pd of a comparator 27 . the combination of the components 31 to 37 described above constitutes an error amplifier 30 . energization voltage signals u o , v o appearing at one side ends of drive coils 1 , 2 and 3 , respectively , are supplied to input terminals of buffer circuits 21 , 22 and 23 respectively . output signals u b , v b and w b of these buffer circuits 21 , 22 and 23 are connected to respective input terminals of a comparator 27 and are also applied to a common connection point n b through respective resistors 24 , 25 and 26 . the common connection point n b is connected to the other input terminal of the comparator 27 . the operation of the brushless motor drive system having the above - described construction will now be described in detail . fig2 illustrates the basic principle of the operation of the brushless motor drive system of the present invention . that is , fig2 shows the relation between the phase of a counter - electromotive voltage waveform induced in one of the drive coils and that of the energization signal waveform supplied to that drive coil . fig2 ( a ) shows that the relation between the phase of the counter - electromotive voltage waveform indicated by the broken curve and that of the drive - coil energization signal waveform indicated by the solid curve is optimum . on the other hand , fig2 ( b ) and 2 ( c ) show that the phases of these two wave - forms deviate from each other by a phase angle ψ , that is , the phase relation is not optimum . referring to fig1 again , the output signal f of the voltage - controlled oscillator 40 is transmitted to the drive coils 1 to 3 through the slope synthesizer 60 , the distribution circuit 70 and the drive transistors 10 to 15 . therefore , there is a fixed phase relation between the waveform of the output signal f of the voltage - controlled oscillator 40 and the energization signal waveforms supplied to the drive coils 1 to 3 . thus , by suitably controlling the oscillation frequency and phase of the waveform of the output signal f of the voltage - controlled oscillator 40 , the phase difference between the counter - electromotive voltage waveforms induced in the drive coils 1 to 3 and the drive - coil energization signal waveforms can be controlled . therefore , when the phase difference represented by the phase angle ψ occurs between the drive - coil counter - electromotive voltage waveform and the drive - coil energization signal waveform as shown in fig2 ( b ) or 2 ( c ), that phase error ψ is detected by the phase error detector 20 and amplified by the error amplifier 30 . thus , by the provision of the phase control loop for controlling the oscillation frequency and phase of the output signal f of the voltage - controlled oscillator 40 thereby cancelling the phase error ψ , the state of optimized energization as shown in fig2 ( a ) can be assured , and the brushless motor can be driven under the optimum condition . fig3 shows , for example , a preferred practical structure of the phase error detector 20 . in fig3 the same reference numerals are used to designate the same functional parts appearing in fig1 . referring to fig3 the energization signal waveforms u o , v o and w o at respective one ends of the drive coils 1 , 2 and 3 are also supplied to the buffer circuits 21 , 22 and 23 respectively . output terminals generating the output signals u b , v b and w b from the buffer circuits 21 , 22 and 23 are common - connected at the point n b through the resistors 24 , 25 and 26 respectively . the common connection point n b is connected to inverting input terminals of comparison circuits 100 , 120 and 140 and also to non - inverting input terminals of comparison circuits 110 , 130 and 150 . the output signal u b of the buffer circuit 21 is connected to the non - inverting input terminal of the comparison circuit 100 and to the inverting input terminal of the comparison circuit 110 . the output signal v b of the buffer circuit 22 is connected to the non - inverting input terminal of the comparison circuit 120 and to the inverting input terminal of the comparison circuit 130 . the output signal w b of the buffer circuit 23 is connected to the non - inverting input terminal of the comparison circuit 140 and to the inverting input terminal of the comparison circuit 150 . output signals of the comparison circuits 100 , 110 , 120 , 130 , 140 and 150 appear as open - collector output signals of transistors 101 , 111 , 121 , 131 , 141 and 151 respectively , and these transistors 101 , 111 , 121 , 131 , 141 and 151 are common - connected at their collectors to the collector of a transistor 161 to provide the output signal pd of the phase error detector 20 . the transistor 161 is connected at its base to the base and collector of a transistor 162 . the transistor 161 is also connected at its base to the collector of a transistor 164 and to the collector of a transistor 169 acting as a constant current source . a stabilized or regulated power supply voltage v reg is applied through a resistor 163 to the emitter of the transistor 162 and is also applied directly to the emitters of the transistors 161 and 164 . the transistor 164 is connected at its base to its emitter through a resistor 166 and also to the collector of a transistor 167 through a resistor 165 . the transistor 167 is grounded at its emitter . the logic circuit 61 has an output terminal s 0 which is connected to the base of the transistor 167 through a resistor 168 . the logic circuit 61 has other output terminals s 1 , s 2 , s 3 , s 4 , s 5 and s 6 which are connected through resistors 171 , 173 , 175 , 177 , 179 and 181 to the bases of transistors 170 , 172 , 174 , 176 , 178 and 180 respectively . these transistors 170 , 172 , 174 , 176 , 178 and 180 are grounded at their emitters and are connected at their collectors to the bases of the transistors 101 , 111 , 121 , 131 , 141 and 151 respectively . the operation of the phase error detector 20 having the above - described structure will now be described with reference to fig4 . fig4 which illustrates the operation of the phase error detector 20 , shows how to detect a phase error between a counter - electromotive voltage u e induced in the drive coil 1 and the drive - coil energization signal waveform u o . referring to fig1 and 4 , the drive coil 1 is energized under the command of signals u h and u l which are synchronized with the output signal f of the voltage - controlled oscillator 40 . therefore , the period of time in which both of these signals u h and u l are not generated is an energization pause period , and , during this period , the drive - coil energization signal waveform u o coincides with the waveform of the counter - electromotive voltage u e . in fig4 this energization pause period ranges from the time at which the signal u h is turned into its low level to the time at which the signal u l starts to rise to its high level , and the length of this energization pause period corresponds to the two clock periods of the output signal f of the voltage - controlled oscillator 40 . such an energization pause period also exists between the time at which the signal u l is turned into its low level and the time at which the signal u h starts to rise to its high level . however , for the purpose of simplifying the description , the former pause period will only be considered herein . now , a neutral voltage n o of the drive coil 1 in the energization pause period will be compared with the drive - coil energization signal waveform u o . when the phase difference ψ between the drive - coil energization signal waveform u o and the counter - electromotive voltage u e induced in the drive coil 1 is zero , the neutral voltage n o coincides with the signal waveform u o at the middle of the energization pause period , that is , at the time later by the one clock period of the signal f after the signal u h is turned into its low level . further , when the phase of the signal waveform u o lags that of the neutral voltage n o to provide the phase difference ψ therebetween , the voltage n o coincides with the signal waveform u o at the time earlier by the one clock period of the signal f after the signal u h is turned into its low level . on the other hand , when the phase of the signal waveform u o leads that of the voltage u e to provide the phase difference ψ therebetween , the voltage n o coincides with the signal waveform u o at the time later by the one clock period of the signal f after the signal u l is turned into its low level . accordingly , the relation between the phase of the signal waveform u o and that of the voltage u e can be determined by comparing the voltage n o with the signal waveform u o at the time later by the one clock period of the signal f after the signal u h is turned into its low level . therefore , a preferred method for detecting the phase difference ψ includes generating a phase error detection pulse signal s ul having a suitable pulse width on the basis of the time later by the one clock period of the signal f after the signal u h is turned into its low level , and comparing the voltage n o with the signal waveform u o only when the signal s ul is generated . thus , a comparator output signal pd ul having a duty factor corresponding to the detected phase difference ψ can be obtained . fig4 shows the case where the signal s ul appears during a ± 1 / 2 clock period of the signal f on the basis of the time later by the one clock period of the signal f after the signal u h is turned into its low level , and the phase of the signal waveform u o leads that of the voltage u e to provide the phase difference ψ therebetween . the above description refers to the basic principle of the present invention in which the energization pause period ranging between the time of turning the signal u h into its low level and the time of turning the signal u l into its high level is utilized to detect the phase difference ψ between the energization signal waveform u o supplied to the drive coil 1 and the counter - electromotive voltage u e induced in the drive coil 1 . however , the phase difference ψ between the signal waveform u o and the voltage u e can be similarly detected utilizing the other energization pause period , that is , the period ranging between the time of turning the signal u l into its low level and the time of turning the signal u h into its high level . it is also apparent that the above phase difference ψ can be similarly detected for each of the energization signal waveforms v o and w o supplied to the other drive coils 2 and 3 respectively . in the illustrated embodiment , all of the comparator output signals pd ul are combined or added together to provide the output signal pd of the phase error detector 20 . fig5 shows , for example , preferred practical structures of the voltage - controlled oscillator 40 and the lowest frequency setting circuit 50 . referring to fig5 the output terminal of the error amplifier 30 generating the output signal eao is connected to one input terminal of a differential amplifier 191 through a resistor 190 and also to the emitter of a transistor 192 . a voltage dividing circuit consisting of resistors 193 and 194 is connected between a regulated voltage supply line and ground , and the voltage dividing point of the voltage dividing circuit is connected to the other input terminal of the differential amplifier 191 . the error between the two inputs to the differential amplifier 191 is amplified to be applied to the base of the transistor 192 . the transistor 192 is connected at its collector to the collector and base of a transistor 195 . the transistor 195 is common - connected at its base to the bases of transistors 196 and 197 so as to generate the output signal i b . also , these transistors 195 , 196 and 197 and grounded at their emitters to constitute a current mirror circuit . transistors 198 and 199 having their emitters connected to the regulated voltage supply line are common - connected at their bases , and these bases are connected to the collector of the transistor 198 and to the collector of the transistor 196 respectively . the transistor 199 is connected at its collector to the collector of the transistor 197 and also to one input terminal of a comparator 200 . a capacitor 201 is connected between ground and the said one input terminal of the comparator 200 . the comparator 200 includes an output transistor 202 , and a resistor 203 is connected between the collector of the output transistor 202 and the other input terminal of the comparator 200 . the terminal of the resistor 203 on the side of the other input terminal of the comparator 200 is connected through a resistor 204 to a bias voltage source 205 . the output transistor 202 is connected at its collector to the collector of a transistor 208 supplying a constant current and also to the base of a transistor 207 through a resistor 206 . the transistor 207 is connected at its emitter to the regulated voltage supply line , at its base to its emitter through a resistor 210 , and at its collector to the common connection point between the bases of the transistors 198 and 199 . the bias voltage of the bias voltage source 205 is divided by a voltage dividing circuit consisting of resistors 212 and 213 , and the voltage dividing point of the voltage dividing circuit is connected to one input terminal of a differential amplifier 211 . the differential amplifier 211 includes an output transistor 215 whose emitter is grounded through a resistor 214 and connected to the other input terminal of the differential amplifier 211 . the output transistor 215 has a multicollector configuration and is connected at 1 / 4 of its multiple collectors to the base of a transistor 218 having a grounded collector and also to the collector of a transistor 216 . the transistor 216 is connected at its base to the base of a transistor 217 and also to the emitter of the transistor 218 . the transistors 216 and 217 are connected at their emitters to the regulated voltage supply line . the transistor 217 is connected at its collector to the collector of the transistor 192 . the operation of the voltage - controlled oscillator 40 and the lowest frequency setting circuit 50 having the above - described structures will now be described . in the error amplifier 30 shown in fig1 the voltage dividing circuit consisting of the resistors 36 and 37 is connected between ground and the regulated voltage supply line supplying the voltage v reg . suppose now that these two resistors 36 and 37 have the same resistance value . in such a case , the voltage value of the output signal eao appearing from the error amplifier 30 immediately after the main power supply switch is turned on is equal to v reg / 2 . suppose further that the resistors 193 and 194 connected to one of the input terminals of the differential amplifier 191 in the voltage - controlled oscillator 40 shown in fig5 have the same resistance value . in this case , the value of the voltage applied to this input terminal of the differential amplifier 191 is equal to v reg / 2 . accordingly , the value of the voltage appearing at the connection point between the other input terminal of the differential amplifier 191 and the emitter of the transistor 192 is also equal to v reg / 2 . therefore , no voltage drop occurs across the resistor 190 immediately after the main power supply switch is turned on . that is , no direct current is supplied to the transistor 192 . the function of the lowest frequency setting circuit 50 will now be described . suppose now that v 205 is the value of the bias voltage of the bias voltage source 205 , and r 212 , r 213 and r 214 are the resistance values of the respective resistors 212 , 213 and 214 . then , the value of the voltage applied to one input terminal of the differential amplifier 211 is equal to ## equ1 ## since the condition for imaginary short holds between the two input terminals of the differential amplifier 211 , the value of the voltage appearing at the connection point between the other input terminal of the differential amplifier 211 and the emitter of the transistor 215 is equal to the value of the voltage applied to the said one input terminal of the differential amplifier 211 . that is , this voltage value is also equal to ## equ2 ## therefore , the value of the emitter current of the transistor 215 is given by ## equ3 ## because of the provision of the transistor 215 having the multicollector configuration together with the current mirror circuit composed of the transistors 216 and 217 , a current value which is 1 / 12 of the emitter current of the transistor 215 , that is , a collector current i 217 having a value given by ## equ4 ## is supplied from the transistor 217 to the voltage - controlled oscillator 40 to set the lowest frequency of the output signal f of the voltage - controlled oscillator 40 . how to determine the oscillation frequency of the voltage - controlled oscillator 40 will now be explained . when the capacitor 201 connected between ground and one of the input terminals of the comparator 200 is not charged , a transistor 220 is in its on state , while a transistor 221 is in its off state . under the above condition , the output transistor 202 of the comparator 200 is turned off thereby turning off the transistor 207 . as a result , the current mirror circuit composed of the transistors 198 and 199 operates . also , the current mirror circuit composed of the transistors 195 , 196 and 197 operates on the basis of the current flowing through the transistor 195 . accordingly , the capacitor 201 is charged by the difference current between the collector current of the transistor 199 and the collector current of the transistor 197 . when the emitter - collector saturation voltage of the transistor 208 is ignored , a voltage v j given by v j = v 205 + ## equ5 ## is applied to the other input terminal of the comparator 200 at this time . in the above expression , v reg is the voltage supplied by the regulated power supply line , and r 203 and r 204 are the resistance values of the respective resistors 203 and 204 . as the capacitor 201 is progressively charged until the terminal voltage of the capacitor 201 , that is , the voltage applied to the said one input terminal of the comparator 200 becomes higher than the voltage v j , the output transistor 220 is turned off thereby turning on the transistor 221 . as a result , the transistor 202 is turned on thereby turning on the transistor 207 , and the current mirror circuit composed of the transistors 198 and 199 is turned off . therefore , discharge of the capacitor 201 is started by the collector current of the transistor 197 . when the emitter - collector saturation voltage of the transistor 202 is ignored , a voltage v j given by ## equ6 ## is applied to the other input terminal of the comparator 200 . as the capacitor 201 is progressively discharged until the terminal voltage of the capacitor 201 , that is , the voltage applied to the said one input terminal of the comparator 200 becomes lower than the voltage v j , the output transistor 202 of the comparator 200 is now turned on , and charging of the capacitor 201 is started again . in the manner described above , the capacitor 201 is repeatedly charged and discharged , and an oscillation output waveform having a frequency corresponding to the repeated charge - discharge cycles is generated from the collector of the output transistor 202 of the comparator 200 . because the magnitude of the voltages v j is constant , the oscillation frequency of the voltage - controlled oscillator 40 is determined by the value of the charge - discharge current of the capacitor 201 . that is , when the value of the capacitor charge - discharge current is large , the terminal voltage of the capacitor 201 sharply rises and falls resulting in a high oscillation frequency , while when the value of the capacitor charge - discharge current is small , the oscillation frequency is low . the value of this capacitor charge - discharge current is determined by the value of the current supplied to the transistor 195 . this value of the current supplied to the transistor 195 is the sum of the value of the collector current i 217 of the output transistor 217 in the lowest frequency setting circuit 50 and the value of the collector current i 192 of the output transistor 192 of the differential amplifier 191 in the voltage - controlled oscillator 40 . as described already , the value of the collector current i 192 of the output transistor 192 is zero immediately after the main power supply switch is turned on . at this time , the value of the current supplied to the transistor 195 is equal to the value of the current i 217 supplied from the lowest frequency setting circuit 50 . therefore , the voltage - controlled oscillator 40 starts to oscillate at the lowest oscillation frequency determined by the current i 217 supplied from the lowest frequency setting circuit 50 . by suitably adjusting this lowest oscillation frequency so that the rotor of the brushless motor can sufficiently follow up the oscillator output signal , the brushless motor can be reliably started as a synchronous motor which operates in a relation synchronized with a frequency corresponding to the determined lowest oscillation frequency . the lowest oscillation frequency can be adjusted as desired by making variable the resistance value of the resistor 214 thereby changing the value of the current i 217 . when the motor starts to rotate , a counter - electromotive voltage is induced in each of the drive coils 1 to 3 of the motor . the phase error detector 20 shown in fig1 detects , for each of the drive coils 1 to 3 , the phase difference between the counter - electromotive voltage and the drive - coil energization switching signal during the drive - coil energization pause period , and the error amplifier 30 generates , as its output signal eao , a d . c . voltage corresponding to the composite phase difference detected by the phase error detector 20 . the d . c . voltage is applied to one of the terminals of the resistor 190 , while the other terminal of the resistor 190 is maintained at the voltage level of v reg / 2 , as described already . as a result , a current having a value corresponding to the voltage difference between the two terminals of the resistor 190 is supplied to the transistor 192 . therefore , the current having the value representing the sum of the value of the current i 217 supplied from the lowest frequency setting circuit 50 and that of the collector current i 192 of the transistor 192 is supplied to the transistor 195 , thereby increasing the oscillation frequency of the voltage - controlled oscillator 40 . thus , in response to the detected composite phase difference between the counter - electromotive voltages induced in the drive coils 1 to 3 and the drive - coil energization switching signals , the level of the output signal eao of the error amplifier 30 is incessantly changed so as to control the oscillation frequency of the voltage - controlled oscillator 40 . fig6 shows , for example , a preferred practical structure of the slope generating circuit 62 . in fig6 the voltage - controlled oscillator 40 and the logic circuit 61 are also shown . referring to fig6 the output terminal of the voltage - controlled oscillator 40 generating the output signal i b is connected to the base of a transistor 230 which is grounded at its emitter . the output terminal of the logic circuit 61 generating the output signal a is connected to the base of a transistor 231 which is grounded at its emitter . the base of transistors 232 , 233 , 234 and the collector of the transistor 232 are common - connected and connected also to the collector of the transistor 230 . the transistors 232 , 233 and 234 are connected at their emitters to the power supply terminal supplying the voltage v cc . the collector of the transistor 235 is common - connected to the bases of the transistor 235 and a transistor 236 and connected also to the collectors of the transistors 231 and 233 . the emitter of the transistor 236 has an area four times as wide as that of the emitter of the transistor 235 and is grounded . the transistor 236 is connected at its collector to the collector of the transistor 234 and also to one input terminal of a differential amplifier 240 . the collector of the transistor 236 is grounded through a capacitor 237 . the differential amplifier 240 includes an output transistor 241 whose emitter is grounded through a resistor 242 . the collector and base of a transistor 246 are common - connected to the bases of transistors 247 and 248 and connected also to the collector of the output transistor 241 of the differential amplifier 240 . the transistors 246 , 247 and 248 are connected at their emitters to the power supply terminal v cc through resistors 243 , 244 and 245 respectively . transistors 249 and 250 are grounded at their emitters through resistors 251 and 252 respectively . the bases of these transistors 249 , 250 and the collector of the transistor 249 are common - connected , and the transistor 249 is connected at its collector to the collector of the transistor 247 . the collectors of the transistors 248 and 250 act as output terminals of the slope generating circuit 62 , and current outputs i sw2 and i sw1 are generated from the collectors of these transistors 248 and 250 respectively . fig7 shows , for example , a preferred practical structure of the slope synthesizing circuit 63 . referring to fig7 the current outputs i sw1 and i sw2 of the slope generating circuit 62 are supplied to the slope synthesizing circuit 63 . transistors 270 , 271 , 272 , 273 , 274 and 275 are common - connected at their emitters . transistors 276 , 277 and 278 common - connected at their emitters are connected through a constant current source 279 to the power supply terminal v cc . the transistors 270 , 271 , 272 , 273 , 274 , 275 , 276 , 277 and 278 are common - connected at their bases through diodes 260 , 261 , 262 , 263 , 264 , 265 , 266 , 267 and 268 respectively , and these bases are connected through a diode 269 to the power supply terminal v cc . further , the bases of these transistors 270 , 271 , 272 , 273 , 274 , 275 , 276 , 277 and 278 are connected through resistors 280 , 281 , 282 , 283 , 284 , 285 , 286 , 287 and 288 to the collectors of transistors 290 , 291 , 292 , 293 , 294 , 295 , 296 , 297 and 298 which are grounded at their emitters , respectively . output signals ns1 , pe1 , ns2 , pe2 , ns3 , pe3 , no1 , no2 and no3 of the logic circuit 61 shown in fig1 are applied to the bases of the transistors 290 , 291 , 292 , 293 , 294 , 295 , 296 , 297 and 298 respectively . transistors 300 , 301 , 302 , 303 , 304 , 305 , 306 , 307 , 308 and 309 , which are common - connected at their bases , are connected at their emitters to the power supply terminal v cc . the transistors 300 , 301 , 302 , 303 , 304 , 305 , 306 , 307 and 308 are also common - connected at their collectors through diodes 320 , 321 , 322 , 323 , 324 , 325 , 326 , 327 and 328 respectively , and these collectors are then grounded through a single diode 329 . the transistor 300 is connected at its collector to the base of the transistor 310 and to the collector of a transistor 330 . similarly , the transistor 301 is connected at its collector to the base of the transistor 311 and to the collector of a transistor 331 , the transistor 302 is connected at its collector to the base of the transistor 312 and to the collector of a transistor 332 , the transistor 303 is connected at its collector to the base of the transistor 313 and to the collector of a transistor 333 , the transistor 304 is connected at its collector to the base of the transistor 314 and to the collector of a transistor 334 , the transistor 305 is connected at its collector to the base of the transistor 315 and to the collector of a transistor 335 , the transistor 306 is connected at its collector to the base of the transistor 316 and to the collector of a transistor 336 , the transistor 307 is connected at its collector to the base of the transistor 317 and to the collector of a transistor 337 , and the transistor 308 is connected at its collector to the base of the transistor 318 and to the collector of a transistor 338 . the transistors 330 , 331 , 332 , 333 , 334 , 335 , 336 , 337 and 338 are grounded at their emitters , and output signals ne1 , ps1 , ne2 , ps2 , ne3 , ps3 , po1 , po2 and po3 of the logic circuit 61 shown in fig1 are applied to their bases respectively . the transistors 270 , 310 and 276 are common - connected at their collectors to generate an output current i p1 through a diode 340 . the cathode of the diode 340 is connected through a diode 341 to the collectors of the transistors 271 , 311 and 316 . the transistors 272 , 312 and 277 are common - connected at their collectors to generate an output current i p2 through a diode 343 . the cathode of the diode 343 is connected through a diode 344 to the collectors of the transistors 273 , 313 and 317 . similarly , the transistors 274 , 314 and 278 are common - connected at their collectors to generate an output current i p3 through a diode 345 . the cathode of the diode 345 is connected through a diode 346 to the collectors of the transistors 275 , 315 and 318 . the transistors 276 , 277 and 278 are common - connected at their emitters which are connected through the constant current source 279 to the power supply terminal v cc . the transistors 316 , 317 and 318 are common - connected at their emitters which are grounded through a constant current source 289 . the transistor 309 is connected at its base to the emitter of the transistor 319 whose collector is grounded . the transistor 309 is connected at its collector to the base of the transistor 319 which is grounded at its base through a constant current source 299 . the current output i sw1 of the slope generating circuit 62 shown in fig1 and 6 is supplied to the emitters of the transistors 310 to 315 , while the current output i sw2 of the slope generating circuit 62 is supplied to the emitters of the transistors 270 to 275 . the operation of the slope generating circuit 62 and the slope synthesizing circuit 63 having the above - described structures will now be described . fig8 illustrates the operation of the slope generating circuit 62 and the slope synthesizing circuit 63 . that is , fig8 shows operating waveforms appearing from various parts to generate the current outputs i p1 , i p2 and i p3 on the basis of which energization switching signals used for energizing the drive coils 1 to 3 are produced . referring to fig5 and 6 again , the transistor 230 constitutes the current mirro circuit together with the transistors 195 , 196 and 197 . a current equivalent to the charge - discharge current of the capacitor 201 constituting the essential part of the voltage - controlled oscillator 40 flows out from the collector of the transistor 230 . thus , the same current also flows out from the collectors of the transistors 232 , 233 and 234 constituting the current mirror circuit . when the output signal a of the logic circuit 61 is in its high level , the transistor 231 is turned on , while the transistors 235 and 236 are turned off . the capacitor 237 is charged with a current i 237 (= i 234 ), and the potential v sw of the capacitor 237 increases gradually . then , when the output signal a of the logic circuit 61 is turned into its low level , the transistor 231 is turned off . as a result , a current i 233 is supplied to the transistor 235 constituting the current mirror circuit together with the transistor 236 , while a current i 236 four times as large as the current i 233 is supplied to the transistor 236 . thus , the capacitor 237 is discharged with a discharge current which is equal to the difference ( i 236 - i 234 ), and the potential v sw decreases gradually . the differential amplifier 240 is a voltage follower in one sense , and , with the increase and decrease in the potential v sw of the capacitor 237 , the potential difference across the output resistor 242 of the differential amplifier 240 changes accordingly . as a result , a corresponding output current i sw appears , and a current equivalent to the current i sw is supplied to the current mirror circuit composed of the transistors 246 , 247 and 248 and to the current mirror circuit composed of the transistors 249 and 250 . that is , an inflow current i sw1 and an outflow current i sw2 appear from the slop generating circuit 62 . referring to fig7 and 8 , the signals ns1 to ns3 , ne1 to ne3 , ps1 to ps3 , no1 to no3 , and p01 to po3 are required to synthesize the energization switching signals having the trapezoidal waveform . these signals are obtained by frequency division or logical processing of the output signal f of the voltage - controlled oscillator 40 by the logic circuit 61 . first , in fig7 when the signal ns1 is turned into its high level , the transistors 290 and 270 are turned on , and , in response to the supply of the current i sw2 corresponding to the voltage v sw , the output current i p1 is generated through the diode 340 . then , the signal n01 is turned into its high level thereby turning on the transistors 296 and 276 , and the current i 279 supplied from the constant current source 279 is added to the current i p1 through the diode 340 . as soon as the signal n01 is turned into its high level , the current i sw2 corresponding to the voltage v sw starts to decrease , and a horn - like projection is produced on the waveform of the current i p1 as shown in fig8 . then , before the voltage v sw starts to rise , the signal ns1 is turned into its low level thereby turning off the transistors 290 and 270 , and only the current i 279 is generated as the output current i p1 . then , the signal ne1 is turned into its low level thereby turning off the transistor 330 and turning on the transistor 310 , and the output current i p1 (= i 279 ) generated in response to the supply of the current i sw1 corresponding to the voltage v sw is gradually decreased until the value of the current i p1 becomes zero . then , at the time when the signal ne1 turns to high level , the signal psi turns to low level , so that the transistors 330 and 310 are turned on and off respectively . also , the transistors 331 and 311 are turned off and on respectively , and , in response to the supply of the current i sw1 corresponding to the voltage v sw , the current component of the output current i p1 gradually increases in the inflowing direction . the signal p01 is then turned into its low level thereby turning off the transistor 336 and turning on the transistor 316 , and the current i 289 supplied from the constant current source 289 is added through the diode 341 to increase the current component of the output current i p1 in the inflowing direction . at the same time when the signal p01 is turned into its low level , the current i sw1 corresponding to the voltage v sw starts to decrease , and a horn - like projection similar to that produced in the outflowing case is also produced on the waveform of the output current i p1 . before the voltage v sw starts to rise , the signal ps1 is turned into its high level thereby turning on the transistor 331 and turning off the transistor 311 , and only the current i 289 forms the output current i p1 . then , the signal pel is turned into its high level thereby turning on the transistors 291 and 271 , and the output current i p1 (= i 289 ) generated through the diode 341 in response to the supply of the current i sw2 corresponding to the voltage v sw gradually decreases until the value of the current i p1 becomes zero . then , the signal pel is turned into its low level thereby turning off the transistors 291 and 271 , and , at the same time , the signal ns1 is turned into its high level . thereafter , the sequence described above is repeated to provide the output current i p1 of the slope synthesizing circuit 63 . it is apparent that the output currents i p2 and i p3 are similarly provided . it will thus be seen that , in the slope generating circuit 62 employed in the illustrated embodiment , the output signal of the voltage - controlled oscillator 40 is used to form the triangular waveform currents and to determine the timing of generation thereof , in the same way as the energization switching signals which are based on the output signal f of the voltage - controlled oscillator 40 . therefore , a variation in the motor rotation speed is immediately followed by corresponding variations in the gradient and duration of the slope portions of the energization switching signal waveforms , so that the so - called slope control for providing optimized slope portions can be achieved . fig9 shows the phase relation between the signals required for the slope synthesization according to the present invention . fig1 shows , for example , a preferred practical structure of the distribution circuit 70 . referring to fig1 , transistors 352 , 354 and 356 are connected at their collectors to the power supply terminal v cc , while transistors 353 , 355 and 357 are grounded at their collectors . the bases of all of these transistors 352 to 357 are common - connected , and a voltage dividing point of a voltage dividing circuit consisting of resistors 350 and 351 connected between v cc and ground is connected to the common connection point of the transistors 352 to 357 . the transistors 352 and 353 are common - connected at their emitters to the bases of transistors 358 and 359 to which the output current i p1 of the slope synthesizing circuit 63 is supplied . the transistors 354 and 355 are common - connected at their emitters to the bases of transistors 360 and 361 to which the output current i p2 of the slope synthesizing circuit 63 is supplied . similarly , the transistors 356 and 357 are common - connected at their emitters to the bases of transistors 362 and 363 to which the output current i p3 of the slope synthesizing circuit 63 is supplied . the transistors 358 , 360 and 362 are common - connected at their emitters , and the output current i 01 of the speed error amplifier 80 is supplied to the common connection point of these transistors . the collector outputs of these transistors 358 , 360 and 362 are applied to the amplifier 72 to generate the energization switching signals u l , v l and w l respectively . also , the transistors 359 , 361 and 363 are common - connected at their emitters , and the output current i 02 of the speed error amplifier 80 is supplied to the common connection point of these transistors . the collector outputs of these transistors 359 , 361 and 363 are applied to the amplifier 71 to generate the energization switching signals u h , v h and w h respectively . the operation of the distribution circuit 70 having the above - described structure will now be described . as described already , the voltage dividing circuit consisting of the resistors 350 and 351 is connected between v cc and ground . suppose that these resistors 350 and 351 have the same resistance value . then , the common connection point of the transistors 352 to 357 common - connected at their bases is biased by the voltage which is equal to v cc / 2 . the output currents i 01 and i 02 of the speed error amplifier 80 are such that errors between the currents of the drive coils 1 to 3 and the torque command signal et are amplified to provide corresponding current signals . fig1 is a partial equivalent circuit diagram of the distribution circuit 70 when the current outputs i p1 and i p2 of the slope synthesizing circuit 63 are source currents . fig1 illustrates the operation of the distribution circuit 70 to show how the current outputs i p1 and i p2 ( or i p3 ) of the slope synthesizing circuit 63 are changed over . referring to fig1 , the relation of i 358 = i 01 holds when the value of i p2 is equal to zero , and the following equations ( 1 ) to ( 4 ) hold at the time of change - over between the current outputs i p1 and i p2 of the slope synthesizing circuit 63 : ## equ7 ## where v be353 , v be355 , v be358 , v be360 are the base - emitter potentials of the respective transistors 353 , 355 , 358 , 360 , k is the boltzmann &# 39 ; s constant , t is the absolute temperature , q is the electron charges , and i s1 , i s2 are saturation currents of the transistors 353 , 355 and transistors 358 , 360 respectively . since v be353 - v be355 = v be358 - v be360 , the following equation ( 5 ) is derived from the equations ( 1 ), ( 2 ), ( 3 ) and ( 4 ): ## equ8 ## also , the following equation ( 6 ) holds : it can be seen from the equation ( 5 ) that , when the current output i p1 is gradually changed over to the current output i p2 , the current i 358 is also changed over to the current i 360 at the same change - over rate as that between i p1 and i p2 . it can also be seen from the equation ( 6 ) that , when the value of i p1 becomes zero in fig1 before a horn - like projection is produced on the waveform of i p2 , the waveform of the energization switching signal u h is entirely free from any adverse effect attributable to the presence of the horn - like projection on the current waveform . the same applies also to the change - over between the phases other than that between i p1 and i p2 . it will be seen from the above description of the preferred embodiment that the energization switching signals u h , v h , w h , u l , v l and w l having the trapezoidal waveforms and having their slope portions synthesized on the basis of the output signal of the voltage - controlled oscillator 40 are used so as to energize the drive coils 1 to 3 of the brushless motor . the so - called phase control loop ( pll loop ) is provided in which the phase difference between each of the drive - coil energization signal waveforms and the counter - electromotive voltage induced in each of the drive coils 1 to 3 is detected by the phase error detector 20 , and the output signal of the phase error detector 20 is applied , after amplification , to the voltage - controlled oscillator 40 so as to control the oscillation frequency and phase of the output signal of the voltage - controlled oscillator 40 until the detected phase error is cancelled . therefore , the brushless motor can be efficiently driven without being adversely affected by the armature reaction and at a minimized level of electromagnetic noise . further , the filter circuit required hitherto need not be provided , and the number of large - capacity capacitors can be greatly decreased . further , because the phase error is detected in the energization pause period , the system operation is free from the voltage drop attributable to the flow of energization current during the energization period and the impedance of the drive coils as well as power supply voltage variations and load variations . furthermore , the width of the phase error detection output pulses generated during the energization pause period is fixed relative to the electrical angle or mechanical angle of the rotor of the motor , and the phase error depends only on the duty factor of the comparison output obtained by comparing the neutral voltage with the counter - electromotive voltage induced in each of the drive coils in the period in which the phase error detection output pulses are generated . therefore , no change occurs in the phase error detection gain due to the rotation speed of the brushless motor , and the phase control loop can continuously stably operate . it will be understood from the foregoing detailed description of the present invention that the energization switching signals having the trapezoidal waveform based on the output signal of the voltage - controlled oscillator are used so as to energize the drive coils of the brushless motor . the so - called phase control loop is provided in which the phase difference between each of the drive - coil energization signal waveforms and the counter - electromotive voltage induced in each of the drive coils is detected by the phase error detector , and , after amplification of the detected phase error signal by the error amplifier , the phase error signal is applied to the voltage - controlled oscillator so as to control the frequency and phase of the output signal of the voltage - controlled oscillator . therefore , the filter circuit required hitherto need not be provided , and , therefore , the number of large - capacity capacitors can be greatly decreased . further , the brushless motor can operate without the prior art problems including the voltage drop attributable to the energization current flow and the impedance of the drive coils , power supply voltage variations and load variations , and the reduced efficiency due to the armature reaction . further , the lowest frequency setting circuit is provided so that the oscillation frequency of the voltage - controlled oscillator can be set at its lowest oscillation frequency at the time immediately after the main power supply switch is turned on , and so that the rotating magnetic field having the velocity which can be easily followed up by the rotor of the motor can be produced . therefore , the brushless motor can be reliably started , and , after starting , the slope portions of the energization switching signals used for energizing the drive coils can be suitably controlled , so that the motor can be efficiently driven at a minimized level of electromagnetic noise . further , by using essential parts of the system to form integrated circuits which require a very small number of externally mounted parts , an inexpensive brushless motor drive system having very excellent operating characteristics can be realized . the aforementioned embodiment of the present invention has referred to the application of the present invention to a brushless motor drive system of a three - phase full - wave drive type . however , it is apparent that the present invention is similarly applicable to a brushless motor drive system of , for example , a three - phase half - wave drive type , a two - phase full - wave drive type or a two - phase half - wave drive type . | 8 |
hereunder , embodiments of the present invention will be explained with reference to the accompanying drawings . fig1 is a view showing an essential structure of a mass spectroscope according to the present embodiment . the mass spectroscope is an ion - trap type , and includes a vacuum chamber 1 and a vacuum pump 2 for evacuating the vacuum chamber 1 . an esi ( electro spray ionization ) ion source 3 for generating ions , an ion trap 4 as an ion retention portion , and a mass spectrometer 5 ( tofms ; time of flight mass spectrometer ) as a mass spectrometry portion are disposed inside the vacuum chamber 1 . as shown in fig1 , the esi ion source 3 , ion trap 4 , and tofms 5 are arranged in the same vacuum chamber 1 , and may be arranged in different vacuum chambers separated by dividing walls with small holes having a size that each ion can pass through . the ion source and mass spectrometer are not limited to the types described above . the ion trap 4 includes a ring electrode 41 and two opposing end cap electrodes 42 and 43 . a power supply 45 is provided for applying a high frequency and high voltage to the ring electrode 41 . a quadrupole electric field is formed at a space surrounded by the ring electrode 41 and the end cap electrodes 42 and 43 to provide an ion trapping space 44 for storing the ions . the power supply 45 applies an auxiliary voltage on the end cap electrodes 42 and 43 according to an analytical mode . a gas feed - through 48 is connected to the ion trap 4 for introducing a cooling gas from a gas supply 46 . a pulse valve 47 is disposed in the gas feed - through 48 for opening and closing the gas feed - through 48 . a gas such as helium ( he ), argon ( ar ), and nitrogen ( n 2 ) is usually used as the cooling gas . the cooling gas is stable so that the gas is not ionized or dissociated when an ion collides with a gas molecule . a control unit 7 having a computer as a main component controls the esi ion source 3 , the tofms 5 , the power supply 45 , and the pulse valve 47 . a data processing unit 6 receives a detected signal from the tofms 5 . the data processing unit 6 performs a predetermined processing operation to obtain a mass spectrum , and also performs various processing operations such as qualitative analysis and quantitative analysis if necessary . an operation of the mass spectroscope will be explained next . the esi ion source 3 sprays charged liquid droplet from a nozzle to generate the ions . the generated ions are introduced into the ion trap 4 and temporarily trapped in the ion trapping space 44 . when the ions are introduced into the ion trap 4 , a voltage is applied to the end cap electrodes 42 and 43 so that the ions lose kinetic energy thereof . after all the ions are trapped in the ion trapping space 44 , the ions are discharged and introduced into the tofms 5 . the ions are separated according to the mass numbers thereof and detected with a detector . the detected signal is sent to the data processing unit 6 to obtain the mass spectrum , in which an abscissa represents the mass number and an ordinate represents signal intensity . the ions move into the ion trap 4 from the esi ion source 3 with a high level of kinetic energy . therefore , it is difficult to effectively trap all the ions only with the quadrupole electric field formed by the electrodes 41 , 42 and 43 . as a result , a large number of the ions collide with the end cap electrode 43 or directly move out from opening of the electrodes . for this reason , the cooling gas is introduced to decrease the kinetic energy of the ions moving into the ion trap 4 so that the electric field easily traps the ions . when the cooling gas is introduced through the gas feed - through 48 , and is filled in the ion trap 4 with an appropriate pressure , the ions entered into the ion trap 4 collide with the gas molecules to lose their kinetic energy , so that ion trajectories are converged toward the center of the ion trap properly . as a result , it is possible to efficiently store the ions in the ion trapping space 44 . it is preferred to supply the cooling gas to the ion trap 4 with a predetermined flow rate so that an internal gas pressure of the ion trap 4 is maintained at , for example , approximately 6 . 0 × 10 − 3 [ pa ] during at least a part of a retention operation in which the ions are stored in the ion trap 4 . on the other hand , it is preferred that the ions do not collide with the gas molecules during an introducing operation in which the ions are introduced into the ion trap 4 and a discharging operation in which the ions are discharged from the ion trap 4 to the tofms 5 . if the gas pressure inside the ion trap 4 is too high when the ions are introduced , the ions collide with the gas molecules on entering the ion trap 4 , thereby changing their paths and decreasing efficiency of introducing the ions into the ion trap 4 . if the gas pressure inside the ion trap 4 is too high when the ions are discharged from the ion trap 4 , the ions that are trying to move out from the ion trap 4 collide with the gas molecules , thereby changing their paths and the initial energy of the ions departing from the ion trap 4 . thus , discharging efficiency of the ions into the tofms 5 is decreased and the direction of discharged ions is scattered , and further , the characteristic at the mass separation of the ions is adversely affected . in the present embodiment , the control unit 7 controls the pulse valve 47 according to each of the operations of the mass spectrometry as follows . fig2 is a chart for explaining the control operation . the control unit 7 controls the esi ion source 3 , the power supply 45 , and the tofms 5 in a series of the introducing operation , retention operation , and discharging operation . the control unit 7 turns off or closes the pulse valve 47 in the introducing and discharging operations , and turns on or opens the pulse valve 47 in the retention operation . the retention operation normally takes 10 msec to 100 msec , and the pulse valve 47 can be operated at a far higher speed . accordingly , when the pulse valve 47 is turned on , the cooling gas flows into the ion trap 4 at a certain flow rate balancing with an evacuating speed of the vacuum pump 2 , so that the gas pressure inside the inner ion trap 4 is maintained at about 6 × 10 − 3 [ pa ]. when the pulse valve 47 is turned off , a leak flow rate of the pulse valve 47 balances with the discharge rate of the vacuum pump 2 , so that the gas pressure inside the inner ion trap 4 is maintained at about 1 × 10 − 3 [ pa ]. with the control operation described above , the ion trap 4 is maintained at a higher inner gas pressure to converge the ion trajectory in the retention operation , so that the ions are reliably stored in the ion trapping space 44 . on the other hand , in the introducing operation , the ion trap 4 has a lower inner gas pressure and the density of gas molecules is low , so that the ions are efficiently introduced into the ion trap 4 . also , the ion trap 4 has a lower inner gas pressure in the discharge operation , so that the ions are extracted with adequate initial velocities in proper directions . therefore , it is possible to efficiently separate the ions , and to obtain the mass spectrum with a finely separated peak of each ion . fig3 ( a ) and 3 ( b ) are charts of the mass spectra specifically showing an effect of the control operation in the mass spectroscope of the present embodiment . fig3 ( a ) is a mass spectrum obtained by a mass spectroscope having a configuration same as that of the present embodiment , and the pulse valve 47 is turned on so that the inner pressure of the ion trap 4 is maintained at about 8 × 10 − 3 [ pa ] in the introducing operation , retention operation , and discharging operation . fig3 ( b ) is a mass spectrum obtained by the mass spectroscope of the present embodiment , and the cooling gas is supplied into the ion trap 4 only during the retention operation as described above . as shown in fig3 ( a ), adjacent peaks are overlapped with each other and the separation of the peaks is not good . on the other hand , peaks shown in fig3 ( b ) are finely separated . according to the mass spectroscope of the present embodiment , the mass resolution is greatly improved , and a larger number of the ions are introduced into the tofms 5 , thereby improving analytical sensitivity . in the embodiment , the pulse valve 47 is turned on during the retention operation and turned off during the other operations . the present invention is not limited to such a protocol . for example , the pulse valve 47 may be turned on during a part of the retention operation , so that the ion trajectories are converged during the part of the retention operation . accordingly , it is possible to increase the number of the ions stored in the ion trapping space 44 , so that the effect described above is partially achieved . the pulse valve 47 may be turned off during a period partially overlapping with the introducing operation or discharging operation . in this case , it is possible to improve the efficiency of introducing the ions to the ion trap 4 or to properly discharge the ions from the ion trap 4 into the tofms 5 at least during a period with no overlap , so that the effect described above is partially achieved . as described above , the pulse valve 47 can be operated at a high speed to block or flow the cooling gas . it is still possible to cause a certain level of time delay until the inner gas pressure of the ion trap 4 becomes stable . in this case , it is possible to control the operation of the pulse valve 47 with the time delay in consideration . in the embodiment described above , cooling the ion is carried out inside the ion trap 4 . alternatively , a dissociation gas for inducing collisional dissociation may be introduced into the ion trap 4 instead of the cooling gas . in this case , the ions collide with the gas molecules to enhance dissociation of the ions . the ions , thus , generated by the dissociation are discharged from the ion trap 4 to the tofms 5 in the discharge operation to get a mass spectrum of fragment ions . while the invention has been explained with reference to the specific embodiments of the invention , the explanation is illustrative and the invention is limited only by the appended claims . | 7 |
fig1 is a block diagram of a semiconductor chip system 2 including timing circuitry , an analog system 4 , and a digital system 5 in turn including a digital multiplier 10 , according to the present invention . the operation of the semiconductor chip system 2 is governed by a master clock ( not shown ) which produces a master clock signal which is provided to timing circuitry 3 configured to produce an analog clock signal and a digital clock signal , which are provided from timing circuitry 3 respectively to analog system 4 and digital system 5 , to enable their coordinated operation according to well - known electric circuit principles . the various master , analog , and digital clock signals are described below in greater detail with reference to fig4 . fig2 is a block diagram of a digital multiplier 10 for use in connection with the present invention . in particular , the figure shows an eight bit by eight bit digital multiplier having a plurality of rows . the top row includes nine booth encoders / multiplexers . the second row includes nine multiplier cells with half adders . the next two rows respectively each have nine multiplier cells , m ′ and m . a carry propagate adder 30 includes 14 8 - 4 multiplexers , m ; 14 ecdl full adders , fa ; and two edcl half adders , hfa . each of the multipliers m and m ′ and each of the adders fa and hfa provide a sum output s and a carry output c . the outputs of adders fa and hfa provide output bits p 0 - p 15 of multiplier 10 . as shown in fig3 , a multiply cell block system 99 of a multiplier 10 according to the present invention includes an ecdl full adder system 101 ; first , second , and third multiplexers respectively 102 - 104 ; and first and second bypassed input data sources ( bds ) respectively 111 and 112 . according to one embodiment of the present invention , the first bds 111 is an ecdl full adder corresponding to ecdl full adder system 101 and resident in an immediately prior row of the multiplier 10 , and the second bds 112 is an ecdl full adder corresponding to ecdl full adder system 101 and resident in a row of the multiplier 10 which precedes the immediately prior row of the multiplier . multiplexers 102 and 103 are each in receipt of first and second input signal of which one is selected for production at the output the applicable one of the multiplexers . the first and second bypassed input data sources 111 , 112 are connectable to ecdl full adder system 101 through multiplexer 104 . multiplexer 104 is in receipt of four signals and produces an output of two signals only , by selection of first and second signals from one of first and second bypassed input data sources 111 , 112 . when multiplexer 104 receives an appropriate noop signal from the prior ( i . e ., the past ) row indicating that it has been skipped in the course of multiplication operation , then multiplexer 104 will engage second sds 112 to ecdl full adder system 101 for addition operation as well as providing the multiplexer output data to a next multiplier row on signal lines 122 . the output of ecdl full adder system 101 is additionally provided to a next multiplier row on signal lines 121 . ecdl full adder system 101 is further provided with a control input mx on line 131 . similarly , multiplexers 102 and 103 are provided with a control signal on line 133 which enables multiplexers 102 and 103 to provide sidewards row enable and done signals to adjacent ecdl full adder systems in the same row . fig4 is a diagram of the relationship between clock signals propagating into and from timing circuitry 3 in semiconductor chip circuitry 2 for driving the analog system 4 and digital system 5 which are embedded in the semiconductor chip circuitry 2 . analog system 4 engages in sampling operations which are optimally undisturbed in a reduced noise environment . fig4 particularly shows a master clock signal stream having the same clock pattern as the digital clock signal stream . as shown , the digital clock waveform lags the master clock waveform by a delay amount . the analog waveform indicates a rising edge which defines the event of analog sampling . a counter of digital clock pulses is used according to the present invention to determine a power saving mode during which asymmetric , relatively noisy , but substantially reduced in power consumption , can be undertaken . however , during critical digital clock period precedent to and succeeding the event of analog sampling , the noise level is diminished by asserting a less power conservative mode of multiplier operation in which noisy operation due to asymmetric operation is halted . during noisy mode , the full adder is on . fig5 is a circuit diagram of a switch 299 according to the prior art , according to which row_enable ( l ) and bypass_out ( l ) signals are generated in response to bypass_in , row_done , and ip_row_noop signals , to permit skippage of rows to enable asymmetric operation which creates a higher noise level , but results in power savings . in particular , switch 299 includes nor gates 301 - 305 , with the bypass_in signal serving as input to nor gates 301 and 303 . the signal row_done is input to nor gates 302 and 303 . the signal ip_row_noop is input to each of nor gates 301 - 303 . the inputs for nor gate 304 are the outputs of nor gates 301 and 302 . the inputs for nor gate 305 are the outputs of nor gates 302 and 303 . fig6 is a block diagram of a power saving switch system 402 according to the present invention , which includes power saving switch 299 of the prior art receiving as input signals bypass_in and row_done ( l ). the power saving switch system 402 further includes and gate 401 configured to receive ip_row_noop as well as a noise ( l ) signal . thus , according to the present invention , a row will not be skipped during a noise prevention period signified by the appropriate logical state of the input signal to and gate 401 which must be “ 1 ” when ip_row_noop reaches a “ 1 ” state , to permit noisy operation which is incompatible with analog sensing operation . thus , a logical state zero indication will prevent skippage of a particular row , ensuring low noise operation , albeit at a cost of reduced power savings . | 6 |
an exemplary robot tool , an exemplary robot system and an exemplary method for processing of workpieces , are disclosed herein by which processing can , for example , be carried out more quickly and more exactly than in the past . an exemplary robot tool as disclosed herein includes a cutting blade that can be held in a predetermined position ( e . g ., a position established by a user ) by a holding element . the holding element can be connected to the robot by the connecting element . this can result in an exemplary robot tool which carries out exact cutting tasks , as part of workpiece processing . this is because , for example , the cutting blade can be held in a predetermined position and can be used in conjunction with the robot , with the accuracy of the robot movement . an exemplary robot tool as disclosed herein can have a cutting blade changer . this can ensure that any cutting blades which may have become blunt can be replaced in a simple manner , or can easily be replaced on a periodic basis ( for example , after a certain usage time ). an exemplary robot tool as disclosed herein can have a test apparatus for the cutting blades . this can allow the cutting blade which is currently in use to still be used while it is still of a predetermined sharpness . it can then be replaced as appropriate when , for example , the cutting blade is found to be unusable . an exemplary robot tool as disclosed herein can have the cutting blade connected in a sprung manner to the holding apparatus . this can advantageously result in tolerance compensation . if , for example , the sprung holder is acting in one spatial direction , then uneven features on a cutting edge or material thickness changes on the workpiece to be cut , or other unpredictable events , can be compensated for particularly easily . the cutting performance can be advantageously improved by having the cutting blade of an exemplary robot tool be a hot blade . an exemplary robot tool as disclosed herein includes a further connecting element that can be provided on the holding apparatus . this can result in the capability to integrate a further processing appliance with the holding apparatus , and thus on an exemplary robot tool . a further processing appliance such as this can be , for example , a second cutting blade with the advantage that a second cutting blade can be available particularly quickly when required . however , it is also feasible to connect other appliances or apparatuses , for example a suction apparatus or measurement apparatuses , without any problems . in an exemplary robot tool , a gripping apparatus can be connected , for example , detachably connected , to the holding element . an exemplary robot tool can use the gripping apparatus to first move the workpiece to be processed to a predetermined processing position and then , without any need for a second robot or even a tool change on the relevant robot , to start processing of the workpiece immediately . when , for example , the gripping apparatus is detachably connected to the holding element , the exemplary robot tool can leave the gripping apparatus on the workpiece . this allows the workpiece to be picked up again later in a particularly simple manner . in an exemplary robot tool , the holding element may have a sensor , such as an optical or laser - based sensor , or any other suitable sensor . this can allow the exemplary robot tool to use the sensor , for example a digital camera , to record an image of its environment and in this way to identify its environment by analysis of the image , in the process making it possible to take account of possible obstructions in the movement path . the sensor can also be used for verification purposes , at least by a previously predetermined reference point or a reference edge line , or the like on a workpiece to be processed or in the working area of the robot . a desired position and orientation of the workpiece can be processed to be determined or to be confirmed in a particularly simple manner . by way of example , verification can be carried out by searching for the reference point at an expected or planned point on the workpiece . if the reference point cannot be found there , search movements can be carried out around the expected position to search for the actual reference point , for example a marker that has been applied or a typical point on the workpiece . the sensor can measure the workpiece overall . furthermore , the sensor can be used to identify the position and orientation of the workpiece and , if necessary , can be used to correct a movement programme for the robot , using the identified position and orientation . this can also allows slight discrepancies in the position of the workpieces in their workpiece holder to be corrected as desired , that is to say , for example , individually for the respective processing process . an exemplary robot system can include at least one of the exemplary robot tools according to the disclosure , and can achieve advantages mentioned above . an exemplary robot system can include a blade changer arranged in the working area of the robot , and an exemplary robot tool can interact with the blade changer when desired . an exemplary robot tool can be relieved of the function of blade replacement and can accordingly be made simpler . a corresponding situation applies to the design of an exemplary robot system with a blade tester , which can be arranged in the working area of the robot and interact with an exemplary robot tool as desired . an exemplary method for processing of workpieces using an exemplary robot tool can move a cutting blade along a predetermined movement path by an exemplary robot system . the exemplary method for processing of workpieces using a robot tool can achieve uniformity and repeatability of processing , and therefore a correspondingly high quality level . furthermore , the cutting speed can be optimized as appropriate to the blades that are used , and this can lead to considerably better cutting performance . furthermore , the working area of the robot can be a safety zone in which no operator may be located during operation of the robot . this therefore can preclude from the start the otherwise normal possibilities of injury or danger to people such as these . an exemplary method for processing of workpieces using a robot tool can use a sensor to determine a reference point for a starting point of the predetermined movement path . this can ensure verification of the predetermined movement path or correction of the predetermined movement path as appropriate for the individual position and orientation of the workpiece currently to be processed , in a particularly simple manner . in order to improve the cutting quality , an exemplary method for processing of workpieces using a robot tool can include testing the condition of the cutting blade before and / or after each cut ( for example breakage , bending , etc ). this can allow predetermined quality standards to be implemented in a particularly simple manner . the single figure shows an exemplary robot system 10 with a robot 12 , a workpiece table 14 on which a workpiece 16 is arranged . in the illustrated example , the robot 12 has a robot foot 18 and a robot arm , such as a multi - axis robot arm 20 which is fitted with a combination tool 22 at its free end . in this example , the combination tool 22 can be firmly connected to a connecting element , such as a flange which can be attached and / or formed at a desired position of the robot arm 20 , so that the robot 12 determines both the spatial position and the alignment of the combination tool 22 by simple movement . the combination tool 22 is connected to the robot arm 20 by a holding element 24 for holding the tool in a predetermined position ( e . g ., a position established in advance by a user ) when the connection flange is connected to the robot 12 . the holding element 24 can be used as a basic element for a blade holder 26 in which a blade 28 is clamped , for a sensor system 30 and for a suction gripping apparatus 32 . the holding element 24 can be firmly connected to all these components 26 , 30 , 32 . the combination tool 22 is illustrated in this figure in such a way that the suction gripping apparatus 32 is arranged directly opposite the tool 16 to be processed , with this tool 16 having already been placed in a workpiece holder 34 on the tool table 14 , which is positioned on the ground . furthermore , the suction gripping apparatus 32 is at a distance from the workpiece 16 in the illustrated figure . a protective sheet 36 can be connected to a relevant side of the workpiece 16 , on the side of the workpiece 16 facing away from the workpiece table 14 . in this example , the workpiece 16 is intended to be a solar module which has been produced from an arrangement of a multiplicity of individual solar cells , with the protective sheet 36 being intended to be used as protection for the solar cells for other processing steps as well as for any subsequent transport . in the illustrated example , however , this protective sheet 36 is even larger than the relevant surface of the workpiece 16 , so that the task for the robot with its tool is to cut off the protective sheet along the edges bounding the surface , as close as possible to these edges . a blade tester 40 and a blade changer 42 are also shown on the ground alongside the tool table 14 , in a working area of the robot . this makes it possible for the robot 12 to check the condition of the cutting blade during the processing of the workpiece 16 , before or after , each processing operation on a workpiece , and if necessary , to carry out a blade replacement . it is also within the disclosure for appliances 40 , 42 such as these to be arranged in an appropriately adapted form on the holding base element 24 of the combination tool 22 itself . this can avoid the need for the various robot arm movements which are desired in order to reach the blade tester 40 or the blade changer 42 . the example shows a cold blade . however , it is equally possible to use hot blades as well , as are known by those skilled in the art . this can increase the life of the blades . the example shows that the processing of the workpiece 16 by the combination tool 22 with the robot 20 and further components 40 , 42 , 14 relating to an exemplary robot system 10 ensures that workpieces can be processed particularly quickly and reliably . using the illustrated robot system 10 , an exemplary method according to the disclosure for processing of the workpiece 16 can be carried out with the combination tool 22 as follows . first , the robot approaches a handover station for unprocessed workpieces . there , the suction gripping apparatus 32 is moved to a position above the next workpiece to be processed , to a similar position to that shown in this figure , for example , immediately above one side of the workpiece which is fitted with the protective sheet . the figure shows a side view of the suction gripping tool 32 , so that this view shows only a first and a second suction gripper 44 . one suction gripper can be adequate depending on the objective , the shape and the size of the workpiece , although a considerably greater number of suction grippers 44 can be desired . for example , six or more ( or less ) suction grippers 44 may be used in order to maintain a safe grip on a solar module , and also to transport it . the robot now moves the suction gripping apparatus 32 until the suction grippers 44 rest on the surface of the workpiece 16 . the suction grippers 44 are then operated so as to produce a suction effect , with the workpiece 16 adhering to the suction gripping apparatus . the robot can now move the workpiece 16 from the transfer position to a point above the tool table 14 . in a further robot movement , the workpiece 16 is placed in the holding apparatus 34 on the tool table 14 , and the suction effect of the suction gripping apparatus 32 is switched off , so that it is now decoupled or released from the workpiece 16 . by way of example , as an alternative to this procedure , a connecting element 46 between the suction gripping apparatus 32 and the base element 24 can be designed as a disengagable or operable coupling such that a robot controller or a tool controller decouples or uncouples the suction gripping apparatus 32 from the base element 22 as desired . for example , as soon as the workpiece 16 is positioned in the workpiece holder 34 , the suction gripping apparatus 32 remains on the workpiece as a result of the connection to the suction grippers 44 and the workpiece , with the complete suction gripping apparatus being completely decoupled by decoupling the coupling on the intermediate piece 46 . the robot tool 22 is now able to carry out further processing steps using different apparatuses . first the sensor system , for example a camera 30 , can be moved by an appropriate combination tool / robot movement to a position above the workpiece 16 , so that the sensor system can measure the entire workpiece . the exact position of the workpiece 16 in its workpiece holder 34 can be determined on the basis of the measurement points and , in addition , a reference point can be calculated and used to define , to correct and to verify the starting point of the cutting movement by the blade 28 , exactly and individually for this workpiece to be processed at that time , in its current position . the cutting blade 28 can first be moved to the blade tester 40 by a suitable change in the position of the combination tool 22 , where it is moved to a test position such that the appliance can test the blade . for example , it is assumed that the blade has been worn and that the robot now moves the combination tool 22 to the blade changer 42 , in which the blade is replaced . however , the sharpness test and / or the blade replacement can be carried out on appropriate appliances on the combination tool 22 itself , which is then designed appropriately . the robot moves the blade 28 to its starting position in the area close to the workpiece 16 . during this positioning , care is taken to ensure that the movement path of the blade 18 has a profile which is technically as optimum as possible for the cutting of the protective sheet 36 , so that the cutting speeds , cutting angles , and so forth are complied with . comparatively minor disturbances in the movement process of the blade 18 which result , for example , from dimensional inaccuracies of the workpiece 16 on the edge to be cut , can be compensated for by an appropriate compensation apparatus . the blade can be mounted in a sprung ( e . g ., extended ) manner , for example , in a compensation apparatus such as this , for example , at right angles to the cutting movement of the blade cutter . in the chosen example , the movement path for cutting the protective sheet 36 runs along the edges on which the protective sheet 36 projects beyond the workpiece 16 including four individual straight - line movement elements , so that , once these four movement elements have been completed , the process has moved around the edges once . after the end of the cutting process , the robot arm 20 of the combination tool 22 moves back to a position approximately above the workpiece 16 , in such a way that the sensor 30 can record a further image of the workpiece 16 . a quality check of the cut can be carried out by an appropriately designed image processing system and , if the cut quality is adequate , the workpiece 16 is picked up again by the suction gripping apparatus 22 , and is moved from the workpiece table 14 to a transfer position for processed workpieces . thus , it will be appreciated by those skilled in the art that the present invention can be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the presently disclosed embodiments are therefore considered in all respects to be illustrative and not restricted . the scope of the invention is indicated by the appended claims rather than the foregoing description and all changes that come within the meaning and range and equivalence thereof are intended to be embraced therein . | 1 |
according to some embodiments of the present invention , an improved technique is described to resolve the issues with ultrasonic locationing of a device with an ultrasonic emitter within an environment . in particular , the present invention utilizes a cross correlation of ultrasonic signals impinging on multiple microphones for more accurate locationing of a mobile device . specifically , the present invention derives two frequencies from the ultrasonic burst to be used for cross correlation . the present invention recognizes that an ideal reception of a burst , using perfectly matched ideal amplifiers yields very little cross correlation strength . in addition , while it is commonly known that noise does not correlate , noise does reduce the cross correlation strength and can shift the point of maximum cross correlation . moreover , due to the relatively low speed of ultrasonic signals it proves difficult to be sure exactly which ultrasonic cycle is the correct cycle to be correlated to . as a result , picking the correct cross correlation cycle when the signal - to - noise ratio drops below ideal conditions is not possible with any known techniques . the present invention resolves this difficulty by deriving two frequencies from the single frequency emitter ultrasonic burst and correlating the phase difference between those frequencies , as will be described below . the device to be locationed and incorporating the emitter can include a wide variety of business and consumer electronic platforms such as cellular radio telephones , mobile stations , mobile units , mobile nodes , user equipment , subscriber equipment , subscriber stations , mobile computers , access terminals , remote terminals , terminal equipment , cordless handsets , gaming devices , personal computers , and personal digital assistants , and the like , all referred to herein as a device . each device comprises a processor that can be further coupled to a keypad , a speaker , a microphone , a display , signal processors , and other features , as are known in the art and therefore not shown . various entities are adapted to support the inventive concepts of the embodiments of the present invention . those skilled in the art will recognize that the drawings herein do not depict all of the equipment necessary for system to operate but only those system components and logical entities particularly relevant to the description of embodiments herein . for example , routers , controllers , switches , access points / ports , and wireless clients can all includes separate communication interfaces , transceivers , memories , and the like , all under control of a processor . in general , components such as processors , transceivers , memories , and interfaces are well - known . for example , processing units are known to comprise basic components such as , but not limited to , microprocessors , microcontrollers , memory cache , application - specific integrated circuits , and / or logic circuitry . such components are typically adapted to implement algorithms and / or protocols that have been expressed using high - level design languages or descriptions , expressed using computer instructions , expressed using messaging logic flow diagrams . thus , given an algorithm , a logic flow , a messaging / signaling flow , and / or a protocol specification , those skilled in the art are aware of the many design and development techniques available to implement one or more processors that perform the given logic . therefore , the entities shown represent a system that has been adapted , in accordance with the description herein , to implement various embodiments of the present invention . furthermore , those skilled in the art will recognize that aspects of the present invention may be implemented in and across various physical components and none are necessarily limited to single platform implementations . for example , the memory and control aspects of the present invention may be implemented in any of the devices listed above or distributed across such components . fig1 is a block diagram of a system for ultrasonic locationing of a single emitter , in accordance with the present invention . a single transponder such as a piezoelectric speaker or emitter 106 can be implemented within a mobile device 100 . the emitter can send a short burst of ultrasonic sound ( e . g . 140 ) to indicate the presence of the mobile device 100 within the environment . the mobile device can include a controller 102 that can be coupled to a wireless local area network interface 104 for wireless communication with other devices in the communication network 120 . the wireless communication network 120 can include local and wide - area wireless networks , wired networks , or other ieee 802 . 11 wireless communication systems , including virtual and extended virtual networks . however , it should be recognized that the present invention can also be applied to other wireless communication systems . for example , the description that follows can apply to one or more communication networks that are ieee 802 . xx - based , employing wireless technologies such as ieee &# 39 ; s 802 . 11 , 802 . 16 , or 802 . 20 , modified to implement embodiments of the present invention . the protocols and messaging needed to establish such networks are known in the art and will not be presented here for the sake of brevity . an ultrasonic receiver 110 includes a transducer such as one or more ultrasonic microphones 116 that can respond to an ultrasonic sound pressure wave ( e . g . 140 ) transmitted from the ultrasonic emitter 106 of the mobile device . each microphone 116 provides electrical signals 118 to a receiver circuitry including signal processors ( not shown ) and a controller 112 , such that the receiver controller will be aware of the presence of a device incorporating that ultrasonic emitter within the environment . the receiver controller 112 can also be coupled to a wireless local area network interface 114 for wireless communication with other devices in the communication network 120 . alternatively , the controller 112 could be connected to the communication network 120 through a wired interface connection ( not shown ), such as an ethernet interface connection . in order to provide positioning ability , using a multilateration technique for example , the transducers of the present invention includes a plurality of microphones 116 able to discriminate between different arrival times of a particular ultrasonic signal . in one embodiment , there are four microphones 116 integrated within a single receiver 110 housing . in this embodiment , three of the microphones can be disposed at each apex of a substantially triangular configuration , such as in a substantially flat triangular housing , and are configured in an array having a maximum dimension of not more than twelve inches , and where the fourth microphone is disposed in the middle of the triangular configuration , substantially coplanar with the other microphones . for unobtrusiveness and clear signaling , the housing can be affixed to a ceiling of the environment , where the position of each microphone is known and fixed . of course , it should be recognized than many different housing and microphone configurations could be utilized with any number of microphones . however , the embodiment described herein utilizes relatively closely - spaced microphones within a singular housing , where the closeness of the microphones is accommodated by the present invention as described below . as the location and position of these microphones 116 is known and fixed , a signal received by these microphones can be used to locate and track the position of an emitter device using time difference of arrival ( tdoa ) at each microphone and employing multilateration , trilateration , or other suitable locationing technique . in the embodiment described herein , the mobile device emits an ultrasonic frequency burst at about 43 . 5 khz , although it should be realized that other frequencies could be used . the emission may be accomplished by the controller driving the emitter at its resonant frequency . also , it may be that more than one mobile device within the environment carries an emitter . in this case , the same frequencies can be used for all devices or different frequencies can be used for each device to better distinguish the devices by the receiver . in addition , the emitter frequency of one device could be changed during operation . choosing which frequency to use can be accomplished by a backend controller 130 of the locationing system , which can communicate over the communication network 120 in order to direct different mobile devices 100 to emit the same or different frequencies in its an ultrasonic signal burst . upon receiving the burst , the receiver 110 can communicate with the backend controller over the communication network that it has received the burst , and the backend controller will then know that the burst came from a particular mobile device . the backend controller also knows when the burst was sent , and can then determine the flight time of the burst by subtracting the emitting time from the acknowledgment of the reception time from the receiver . alternatively , the backend controller could also radio the time of the originating burst to the receiver which would allow the receiver to convert tdoa values into flight times allowing trilateration , which has accuracy advantages over multilateration is some cases . flight time can also be calculated once the position is determined by multilateration by simply taking the square root of the sum of the squares of the emitter &# 39 ; s relative position in three dimensional space of the environment and then dividing by the speed of sound . it should be noted that the radio frequency communications are relatively instantaneous next to the flight time of the ultrasonic signal and could be ignored . using a locationing technique such as multilateration , along with the flight time , the receiver 110 could determine and inform the backend controller of the location of the mobile device , which the backend controller can use to track its location during subsequent bursts . in the above scenario , the receiver is subject to reverberations of the ultrasonic signal due to multipath and reflections . therefore , the ultrasonic burst must have a very short burst width such that the capture window is closed before any multipath energy is included in the cross correlation . if not , ultrasonic signal collisions could occur , and emitter signal would not be received properly . in addition , the receiver is configured to have a narrow bandwidth ( high q ) receiver to reject as much environmental acoustic noise as possible . in this example , it is assumed that a 2500 ultrasonic burst is emitted by the emitter . typically , for a single frequency burst , as each microphone of the receiver receives the ultrasonic burst the receiver can use cross - correlation of the burst to determine a direction of an emitter along with distances between microphones to determine flight time distance . for example , existing ultrasonic locationing systems have used a microphone spacing that is typically ten feet . such system can simply correlate on burst envelopes . however , a microphone spacing of one foot or less , as in the present invention , requires correlation to an exact sine wave cycle of a burst . in this case , correlation accuracy drops since correlation must identify the correct correlation peak of the cycle . in particular , the locationing accuracy for closely - spaced microphone decreases with distance . specifically , the sine wave correlations could shift an entire wavelength at the slow speeds of ultrasonic frequencies , thereby providing an incorrect distance calculation . at 40 khz , for example , the period is 25 μs . therefore , locking correlation to the wrong sine wave cycle can introduce integer multiple errors of ± 25 μs , 50 μs or even 75 μs , which can be many feet of location error . fig2 shows a single frequency correlation using two closely - spaced microphones . a correlator 20 is provided under control of a controller 112 . a mobile device with an emitter 21 emits a single frequency ultrasonic pulse which impinges on the microphones , reaching the first microphone 26 before the second microphone 28 . although only two microphones are shown and the pulse is applied collinearly with respect to the microphone positions , it should be recognized that the number and position of the microphones can be expanded into a three dimensional environment . as shown , the correlator 20 obtains the pulse 22 from the first microphone and the pulse 24 from the second microphone as two time shifted signals . fig3 shows the correlation function in the correlator . specifically , the correlator takes the two obtained signals and correlates them , as is known in the art , by time shifting one signal over the other to find a point with the closest match of the waveforms . the amount if time shifting needed to correctly align the waveforms defines the time difference of arrival ( tdoa ) of the pulse between the microphones , which can then be used to locate the emitter . in the first correlation 30 , the correlator finds the proper correlation of pulse 1 and 2 , which the receiver can use to properly locate the emitter at location a ( see fig1 ). however , if the correlator aligns to an improper waveform match , such as matching a sine wave cycle of one pulse to an adjacent cycle 32 of the other pulse , then the calculation of the location of the emitter with be off by 25 μs , which will improperly locate the emitter at location b , for example . even if using a separate flight time calculation using rf synchronization , correlation to the wrong sine wave cycle cannot be tolerated . the key to implementing a precision ultrasonic locationing system with small receiver geometry ( approximately one foot microphone spacing ) is the accurate measurement of the tdoa of the ultrasonic burst between the microphones . however , accurate tdoa measurements have proven to be problematic in single frequency systems with narrow receiver bandwidths ( i . e . high q factor ). an ultrasonic receiver system necessitates a high system q factor to maximize signal - to - noise ratio in an environment where acoustic noise is abundant . this high q factor inhibits the designing of a pulse shape that will facilitate accurate correlation results . as shown in fig4 , the pulse shape that results from a high q system consists of sine waves having an amplitude that slowly rises and then decays . frequency pulses of 40 khz from two microphones in a high q receiver are shown in this ideal representation . in this example , pulse 1 is the ultrasonic pulse received by a first microphone and pulse 2 is that same ultrasonic pulse received by a second microphone , but later in time . these two pulses are cross correlated with each other to yield the correlation buffer shown in fig5 . fig5 shows the correlation buffer results from two ideal 40 khz pulses in a high q system . the key point to recognize here is how close in amplitude the adjacent correlation peaks are at ± one cycle away from the maximum correlation point . in particular , the margin between the maximum correlation point 50 and an adjacent correlation point 52 in this ideal case is only 1 . 1 %. in actuality , these pulse shapes are slightly different from each other and can be affected by a number of different external factors that cannot be controlled ( i . e . noise level , microphone response , electronic component tolerances , etc .). since the correlation margins are so weak to begin with , slight differences in the external factors will most likely result in incorrect correlation results and therefore incorrect tdoa measurements . therefore , the present invention derives two frequencies from an ultrasonic burst received by each microphone , wherein these two frequencies are then used for correlation . the present invention allows the ultrasonic locationing system to more consistently produce accurate tdoa measurements with the use of dual frequencies obtained from the ultrasonic burst emitted from the emitter without any loss in system q factor or signal - to - noise ratio . the key piece of information that is makes this possible is the difference in phase between the two frequencies . referring to fig6 , a representation of the ultrasonic burst received from the emitter is shown in the frequency domain . as shown the ultrasonic burst is centered on the emitter frequency , f t . as can be seen , the frequency spectrum of the ultrasonic burst is not an impulse at f t , but rather a broad pulse incorporating other frequencies . the ( 3 db ) frequency bandwidth of the burst will be determined by the duration of the drive signal and the quality factor ( q ) of the emitter transducer . assuming the q of the transducer is relatively low , the bandwidth will be determined by the pulse duration as follows , bw = 2 / t , where t is the duration of the pulsed drive signal . if the q of the transducer is relatively high , the bandwidth will be determined more from the transducer itself rather than from the burst duration . referring to fig7 , two frequency pulses can be derived from the one ultrasonic burst . in particular , the receiver of the present invention consists of a microphone connected to two high q amplifier chains ( see fig9 ) with respective band pass filters tuned to different frequencies , i . e . center frequency f l and f h , where f l & lt ; f t & lt ; f h . the required separation of the two receiver band pass filter center frequencies is a function of the bandwidth of the ultrasonic burst . a wider bandwidth burst will allow the filters to be spaced further apart while a narrower bandwidth pulse will require the filters to be spaced closer . for example , the filters can be configured such that the 3 db points of the filter and the burst align , as shown . if properly designed , a portion of the energy contained in the ultrasonic burst ( less than f t ) will be located within the pass band of the first receive band pass filter centered at f l and will therefore derive an output pulse of frequency f 1 , somewhere between f l and f t . similarly , a portion of energy contained in the ultrasonic burst ( greater than f t ) will be located within the pass band of the second receive band pass filter centered at f h and will therefore derive an output pulse of frequency f 2 , somewhere between f t and f h . in one example , f t can be 43 . 5 khz , f 1 can be 40 khz , and f 2 can be 47 khz . referring to fig8 , since the two output pulse frequencies , f 1 and f 2 , from the band pass filters are derived from the same burst , they will maintain a fixed phase relationship across multiple microphone amplifier chains assuming the frequency and phase response of all the filters are matched . in this example , the two output pulse frequencies have about 6 db less amplitude than the burst itself , and have frequencies corresponding to the 3 db bandwidth of the burst ( of fig6 ). fig9 shows a simplified block diagram of a dual frequency receiver , in accordance with the present invention . it is envisioned that this receiver is implemented in the digital domain , in a digital signal processor 650 for example . it should be recognized that other components , including a controller , amplifiers , analog - to - digital converters ( i . e . digitizers ), digital filters , and the like , are not shown for the sake of simplicity of the drawings . dual frequencies , f 1 and f 2 , are derived from each microphone signal of the emitted single ultrasonic burst , as previously explained . each microphone signal has been amplified in a high q amplifier chain and digitized before being provided to the receiver . preferably , matched components are used for the first and second high q microphone signal chains of the receiver . optionally , each receiver chain could be equipped with its own digitizer . the receiver splits each microphone signal into its two frequency components , f 1 and f 2 , by passing each microphone signal through two different band pass filters , as detailed above . one band pass filter 602 has a center frequency at f l , and passes the first frequency component , f 1 , of the first microphone signal of the ultrasonic burst ( i . e . pulse 1 ). another band pass filter 604 has a center frequency at f h and passes the second frequency component , f 2 , of the first microphone signal of the ultrasonic burst ( i . e . pulse 1 ). similarly , another band pass filter 606 has a center frequency at f l , and passes the first frequency component , f 1 , of the second microphone signal of the ultrasonic burst ( i . e . pulse 2 ). another band pass filter 608 has a center frequency at f h and passes the second frequency component , f 2 , of the second microphone signal of the ultrasonic burst ( i . e . pulse 2 ). fig1 shows the individual frequency components output from the band pass filters . in the example described herein , the lower first frequency components , f 1 , 610 , 614 are at 40 khz and the higher second frequency components , f 2 , 612 , 616 are at 47 khz . referring back to fig9 , the output from each band pass filter is combined in a digital multiplier which provides sum and difference products of the first and second frequency components , f 1 and f 2 . fig1 shows the multiplied product of the two frequency components of each receiver after being multiplied in the digital domain . in particular , the pulse 1 frequency components 610 and 612 produce the product 618 in multiplier 640 , and the pulse 2 frequency components 614 and 616 produce the product 620 in multiplier 642 . inasmuch as f 1 is 40 khz and f 2 is 47 khz , the combined waveform includes 87 khz products ( 47 khz + 40 khz ) and 7 khz products ( 47 khz - 40 khz ). referring back to fig9 , the output from each multiplier is digitally filtered in a low pass filter to pass only the low frequency products . fig1 shows the pulse 1 low frequency product 618 and the pulse 2 low frequency product 620 of fig1 after being low pass filtered to provide the respective pulse 1 signal and pulse 2 signals 622 and 624 for correlation . the correlator 20 obtains these signals and correlates the phase difference between the two different frequency pulses as previously described to obtain a tdoa between the microphones for the emitted ultrasonic burst . fig1 shows the correlation buffer results from two signals 622 and 624 of fig1 . the key point to recognize here is that the margin between the maximum correlation point 90 and an adjacent correlation point 92 resulting from the use of the dual frequencies in the present invention is about 21 . 4 %, which is far better than the 1 . 1 % margin of the previous single frequency embodiment of fig5 . accordingly , the present invention provides much improved tdoa accuracy and locationing . however , if the system is subject to more than one cycle error , i . e . incorrect correlation to farther cycles than just the adjacent cycle , a less aggressive frequency selection must be made to reduce the correlation strength of those farther cycle points . the optimal frequency selection becomes difficult to calculate when the amplitudes vary during the burst . therefore , frequency selection was computer modeled considering ± four cycles . real world amplitude shaping was simulated to be 24 % reduction in correlation strength of all cycles . however , 15 % was measured on the actual system using the finally chosen modeled frequencies of 40 khz and 47 khz . the choice of these two frequencies results in a correlation strength of the correct cycle being considerably larger than that of the adjacent cycles , as shown in fig1 , thereby providing increased immunity to noise and non - ideal components . looking at fig1 , the sharpness of the correlation peak 90 is not as sharp as the correlation peak 50 of fig5 . therefore , even though fig1 provides the correct cycle , the actual measurement of tdoa is less accurate than it would be if choosing the correct cycle from fig5 . in other words it can be difficult to find the exact peak of a sine wave , and therefore having a sine wave of a higher frequency will provide a more accurate time offset measurement . therefore , the present invention can optionally combine the results from fig1 with fig5 to provide a more exact time offset measurement . referring back to fig9 , the present invention can provide a second correlator 600 that can take a single frequency correlation ( as was done for fig4 and 5 ) for use to improve the time offset measurement . for example , the phase difference between the same frequency component , 610 and 614 , ( although 612 and 616 could have been used ) of each pulse chain is correlated in correlator 600 to provide the combined result of fig5 . the sine waves of fig5 are on approximately 40 khz cycles , whereas the sine waves of fig1 are on approximately 7 khz cycles . therefore , fig5 can provide almost a 20 × ( 40 / 2 ) improvement in tdoa measurement assuming the correct cycle is chosen . in practice , the ± time offset measurement error at 7 khz is sufficient to bracket the correct cycle in fig5 and then the measured time offset of the correct cycle in fig5 is used to provide the more accurate tdoa result . in effect , the correlation result of fig5 is used to fine tune the correlation result of fig1 . in effect , the present invention provides a novel technique to determine if a correlation is wrong and how the correct cycle can be found with a high degree of confidence . if after correlating the f 1 outputs , 610 and 614 , from each microphone chain in correlator 600 , it is determined that the tdoa between the two pulses is t tdoa microseconds , then it can be confirmed that the difference in phase between f 1 and f 2 at any time t microseconds on one microphone will be identical to the difference in phase between f 1 and f 2 on the other microphone at time t + t tdoa microseconds . therefore , the qualifying test for a correct tdoa calculation is : one way to measure the changes in relative phase between the two frequencies is to multiply them together ( see fig1 ). the trigonometric identity for the product of two different frequencies yields terms with both the sum and difference frequency : sin ( f 1 t )* sin ( f 2 t )= ½ *[ cos (( f 1 − f 2 ) t )− cos (( f 1 + f 2 ) t )] filtering out the higher frequency sum component leaves the difference ( beat ) frequency ( see fig1 ) which represents the relative change in phase between the two sine waves . cross correlating the two low pass filter outputs ( see fig1 ) give a good measurement of the tdoa between the channels accurate to well under half a cycle of the original f 1 and f 2 input frequencies . this tdoa value can then be used to choose the correct correlation cycle on the original single frequency correlation of fig5 to obtain the true tdoa . the correlation strength of the output will be relatively strong with little chance for an incorrect tdoa result , due primarily to the fact that the pulse is of short duration at low frequency ( i . e . it will only contain as little as one or two complete sine wave cycles .) fig1 is a diagram illustrating a method for ultrasonic locationing of a single emitter , according to some embodiments of the present invention . a first step 200 includes emitting a single frequency ultrasonic burst from one emitter of a mobile device . a next step 202 includes receiving the ultrasonic burst from the single frequency emitter in each of at least two microphones to provide respective microphone signals . a next step 204 includes deriving two different ultrasonic frequency pulses from the ultrasonic burst in each microphone signal . this can include band pass filtering each microphone , a first band pass filter passing a first frequency component from the ultrasonic burst and a second band pass filter passing a second frequency component from the ultrasonic burst different from the first frequency component . this step can also include multiplying the first and second frequency components from its respective microphone in the digital domain to provide the obtained signals for the correlator . this step can also include low pass filtering that passes a difference frequency of a multiplied combination of the two different ultrasonic frequency components from each microphone to the correlator . a next step 206 includes correlating the phase difference between the two different frequency pulses in each microphone signal to establish a time difference of arrival of the ultrasonic burst at each microphone . this step can also include a second correlation of a same frequency component from each microphone to produce a second frequency correlation , and wherein the ( first ) correlation providing its time difference of arrival measurement to the second correlation which is used to select the correct correlation cycle in the second frequency correlation and its respective time difference of arrival measurement . a next step 208 includes using the time difference of arrival of the ultrasonic burst from the emitter transducer impinging on each microphone to determine a location of the emitter and mobile device . advantageously , the present invention provides an accurate ultrasonic locationing of a single frequency emitter using an ultrasonic receiver integrated with closely spaced microphones , which is not known in the prior art . in addition , the present invention provides reasonable immunity to close reflectors ( multipath signals ), and a reasonable minimum snr ratio . the present invention has been demonstrated in the lab to show a large increase in correlation strength when subject to actual center of excellence in wireless and information technology ( cewit ) noise environment . the present invention opens the door to phase measurements which have been shown to provide further immunity against picking the wrong cycle during correlation . in the foregoing specification , specific embodiments have been described . however , one of ordinary skill in the art appreciates that various modifications and changes can be made without departing from the scope of the invention as set forth in the claims below . accordingly , the specification and figures are to be regarded in an illustrative rather than a restrictive sense , and all such modifications are intended to be included within the scope of present teachings . the benefits , advantages , solutions to problems , and any element ( s ) that may cause any benefit , advantage , or solution to occur or become more pronounced are not to be construed as a critical , required , or essential features or elements of any or all the claims . the invention is defined solely by the appended claims including any amendments made during the pendency of this application and all equivalents of those claims as issued . moreover in this document , relational terms such as first and second , top and bottom , and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions . the terms “ comprises ,” “ comprising ,” “ has ”, “ having ,” “ includes ”, “ including ,” “ contains ”, “ containing ” or any other variation thereof , are intended to cover a non - exclusive inclusion , such that a process , method , article , or apparatus that comprises , has , includes , contains a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process , method , article , or apparatus . an element proceeded by “ comprises . . . a ”, “ has . . . a ”, “ includes . . . a ”, “ contains . . . a ” does not , without more constraints , preclude the existence of additional identical elements in the process , method , article , or apparatus that comprises , has , includes , contains the element . the terms “ a ” and “ an ” are defined as one or more unless explicitly stated otherwise herein . the terms “ substantially ”, “ essentially ”, “ approximately ”, “ about ” or any other version thereof , are defined as being close to as understood by one of ordinary skill in the art , and in one non - limiting embodiment the term is defined to be within 10 %, in another embodiment within 5 %, in another embodiment within 1 % and in another embodiment within 0 . 5 %. the term “ coupled ” as used herein is defined as connected , although not necessarily directly and not necessarily mechanically . a device or structure that is “ configured ” in a certain way is configured in at least that way , but may also be configured in ways that are not listed . it will be appreciated that some embodiments may be comprised of one or more generic or specialized processors or processing devices such as microprocessors , digital signal processors , customized processors and field programmable gate arrays and unique stored program instructions ( including both software and firmware ) that control the one or more processors to implement , in conjunction with certain non - processor circuits , some , most , or all of the functions of the method and / or apparatus described herein . alternatively , some or all functions could be implemented by a state machine that has no stored program instructions , or in one or more application specific integrated circuits , in which each function or some combinations of certain of the functions are implemented as custom logic . of course , a combination of the two approaches could be used . moreover , an embodiment can be implemented as a computer - readable storage medium having computer readable code stored thereon for programming a computer ( e . g ., comprising a processor ) to perform a method as described and claimed herein . examples of such computer - readable storage mediums include , but are not limited to , a hard disk , a compact disc read only memory , an optical storage device , a magnetic storage device , a read only memory , a programmable read only memory , an erasable programmable read only memory , an electrically erasable programmable read only memory , and a flash memory . further , it is expected that one of ordinary skill , notwithstanding possibly significant effort and many design choices motivated by , for example , available time , current technology , and economic considerations , when guided by the concepts and principles disclosed herein will be readily capable of generating such software instructions and programs and integrated circuits with minimal experimentation . the abstract is provided to allow the reader to quickly ascertain the nature of the technical disclosure . it is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims . in addition , in the foregoing detailed description , it can be seen that various features are grouped together in various embodiments for the purpose of streamlining the disclosure . this method of disclosure is not to be interpreted as reflecting an intention that the claimed embodiments require more features than are expressly recited in each claim . rather , as the following claims reflect , inventive subject matter lies in less than all features of a single disclosed embodiment . thus the following claims are hereby incorporated into the detailed description , with each claim standing on its own as a separately claimed subject matter . | 6 |
fig3 is an illustration of computer network 100 associated with the present invention . computer network 100 comprises local workstation 108 electrically coupled to network connection 102 . local workstation 108 is coupled electrically to remote workstation 110 and remote workstation 112 via network connection 102 . local workstation 108 also is coupled electrically to server 104 and persistent storage 106 via network connection 102 . network connection 102 may be a simplified local area network ( lan ) or may be a larger network such as a wide area network ( wan ) or the internet . furthermore , computer network 100 depicted in fig3 is intended as a representation of a possible operating network that may contain the present invention and is not meant as an architectural limitation . the internal configuration of a computer , including connection and orientation of the processor , memory , and input / output devices , is well known in the art . the present invention can be embodied in a computer program . referring to fig4 , the present invention is implemented in database propagation program ( dpp ) 220 , which resides in memory 200 . dpp 220 comprises capture 230 and apply 240 . dpp 220 described herein can be stored within memory 200 of any workstation or server depicted in fig4 . alternatively , dpp 220 can be stored in an external storage device such as persistent storage 106 , or a removable disk such as a cd - rom ( not pictured ). memory 200 is only illustrative of memory within one of the machines depicted in fig4 and is not meant as a limitation . memory 200 also contains resource data 210 . resource data 210 comprises subscription table 250 and member table 260 . the present invention may interface with resource data 210 through memory 200 . in alternative embodiments , dpp 220 and its components can be stored in the memory of other computers . storing dpp 220 in the memory of other computers allows the processor workload to be distributed across a plurality of processors instead of a single processor . further configurations of dpp 220 across various multiple memories and processors are known by persons skilled in the art . as described in detail below , dpp 220 uses subscription sets to determine the order in which to propagate tables . as used in this disclosure , a “ subscription set ” is any listing of database tables to be copied , in which the database tables are grouped in larger sets . in the preferred embodiment , a subscription set comprises a record in subscription table 250 and a record in member table 260 . fig5 illustrates the preferred embodiment of a subscription table , and fig6 illustrates the preferred embodiment of a member table . the difference between a prior art subscription table ( fig1 ) and the table illustrated in fig5 is the field labeled “ order .” in the preferred embodiment , a database administrator assigns a subscription rank to each record in subscription table 250 and stores this rank in the order field . the “ subscription rank ” indicates the order , relative to other records in subscription table 250 , in which dpp 220 should propagate the subscription set identified by the record . in the preferred embodiment , the order field is an integer value , but a person of skill in the art will appreciate that other data types can be used to indicate relative order , including without limitation alphabetical characters and decimal numbers . the database administrator cannot assign the same rank to more than one record in subscription table 250 . similarly , the difference between a prior art member table ( fig2 ) and the member table illustrated in fig6 is the field labeled “ order .” in the preferred embodiment , a database administrator determines which tables should be propagated and assigns the tables to a subscription set identified in subscription table 250 . the subscription set to which the database administrator assigns the tables is recorded in the set_name field , as illustrated in fig6 . as used herein , a “ source table ” refers to a database table that has been assigned to a subscription set . in fig6 , source table members are stored in the source_table field . the database administrator also assigns a member rank to each record in member table 260 and stores this rank in the order field . the “ member rank ” of a record in member table 260 indicates the order , relative to other records belonging to the same subscription set , in which dpp 220 should propagate the source table identified by the record . again , the order field in member table 260 is an integer value in the preferred embodiment , but a person of skill in the art will appreciate that other data types can be used to indicate relative order . the database administrator cannot assign the same rank to more than one record within the same subscription set ( as identified in the set_name field ) in member table 260 . once the database administrator has configured subscription table 250 and member table 260 and assigned a rank to each subscription set and each source table member in each subscription set , dpp 220 sorts the order data by rank to generate a propagation sequence . as used herein , a “ propagation sequence ” is any ordered list of source tables to be copied . the propagation sequence ultimately dictates the order that dpp 220 copies tables from a source server to a target server . in the preferred embodiment , dpp 220 first sorts the subscription sets by subscription rank , and then sorts the source tables by member rank within each subscription set . it should be noted that the particular sorting method employed is not critical to the operation of dpp 220 , and a person of skill in the art will appreciate that sorting methods are widely available in many different forms . a person of skill in the art will further appreciate that any program can execute the sorting operation , including the underlying database management system , without affecting the novel aspects of the present invention . after dpp 220 generates a propagation sequence , apply 240 then propagates the source tables in the order that the tables appear in the propagation sequence . in the preferred embodiment , the source tables are copied from one server to another , referred to herein as a “ source server ” and a “ target server ” respectively . a person of skill in the art , though , will appreciate that the technology described herein also may be applied to many other configurations , including without limitation copying from one table to another within the same server . in the preferred embodiment , dpp 220 also comprises capture 230 that monitors source server 720 for changes . responsive to detecting a change , apply 240 copies data from source server 720 to target server 730 , as illustrated in fig7 . a person of ordinary skill in the art will appreciate that there are many different methods for monitoring and detecting changes to a database . generally , though , a database server creates a log file that records database activity , and the preferred embodiment of capture 230 monitors the log file for changes . thus , when the log file indicates a change in a database , capture 230 captures the data and apply 240 , when executed by dpp 220 , copies the data to the target substantially as described above . it should be noted that the invention described above does not address the issue of propagating tables that refer to each other , through foreign keys and primary keys , in a circular order . for example , if table c has a foreign key referring to b , b has a foreign key referring to a , and a has a foreign key referring to c , then there is no way to designate a rank or otherwise give priority to table a or to table c . a person of skill in the art will appreciate that various modifications and changes may be made in the preferred embodiment of the present invention without departing from its true spirit . the preceding description is for illustrative purposes only and should not be construed in a limiting sense . the present invention encompasses all embodiments equivalent to those illustrated in the drawings and described in the specification . the scope of the invention should be limited only by the language of the following claims . | 6 |
the present constitutes a marked improvement in the area of injection of therapeutic materials into voids in tissue such as bone and / or implant devices such as bone screws , not only because it provides multiple functions in a single device , which both saves time and reduces the potential for error during surgery , but also because the interaction between the parts provides functionality not available if the components were implanted individually . noted advantages include : the plug material is maintained in a sleeve , namely the plug guide cannula , prior to and during implantation and may be pre - formed to be compatible with the standard trocar , drill bit , or bone screw bore sizes . this plug guide cannula , not only compresses the plug into the desired geometric configuration , but also serves as a channel and mating unit which engages the proximal opening to the void in the tissue or implant and guides the plug into such . additionally , the plug guide cannula serves a protective purpose while the device is in the sterile package and during handling in surgery ; in particular , the plug guide cannula protects against mechanical damage , and reduces exposure to open air which might result in excessive evaporation of liquid components of the plug or exposure to airborne contaminants . the needle transits the length of the plug prior to insertion in the body tissue ( or implanted device ), and the needle and plug may be assembled and inserted as a unit . if the needle is inserted after the plug is inserted , there is the potential for the needle to either not completely transit the plug or push the plug further into the tissue than desired ; plug material may also jam in the bore of the needle . the device provides a positive means to set both the plug depth and the needle tip depth in the tissue . the plug pusher holds the plug in place during the injection of therapeutic material , thereby allowing the surgeon to apply a force sufficient to overcome hydraulic resistance in the surrounding tissue , not only assuring delivery of the therapeutic , but also providing important tactile feedback to the surgeon . if the surgeon were just to inject through a plug , there is the potential for the plug to ‘ blow back ’. the plug pusher can hold the plug in place while the needle is being extracted ; otherwise friction between the needle and the plug might pull the plug part or all of the way out of the hole in the bone or bore of the screw . although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention , the preferred methods , devices , and materials are now described . however , before the present materials and methods are described , it is to be understood that the present invention is not limited to the particular sizes , shapes , dimensions , materials , methodologies , protocols , etc . described herein , as these may vary in accordance with routine experimentation and optimization . it is also to be understood that the terminology used in the description is for the purpose of describing the particular versions or embodiments only , and is not intended to limit the scope of the present invention which will be limited only by the appended claims . unless otherwise defined , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs . however , in case of conflict , the present specification , including definitions , will control . the words “ a ”, “ an ” and “ the ” as used herein mean “ at least one ” unless otherwise specifically indicated . thus , for example , reference to a “ molecule ” is a reference to one or more molecules and equivalents thereof known to those skilled in the art , and so forth . the term “ proximal ” as used herein refers to that end or portion which is situated closest to the user of the device , farthest away from the target surgical site . the term “ distal ” as used herein refers to that end or portion situated farthest away from the user of the device , closest to the target surgical site . the term “ axial ” as used herein refers to the direction relating to or parallel with the longitudinal axis of the device . in the context of the present invention , the plug positioned within the bore of the plug guide cannula and may be axially ( distally ) moved therein and displaced therefrom by means of a plug pusher or plunger . the term “ lateral ”” as used herein refers to the direction relating to the transverse axis of the device . in the context of the present invention , the target site may be provided with a fenestrated surgical screw having a series of pores or fenestrations positioned about its lateral surface . the present invention is directed , at least in part , to the introduction and retention of therapeutic materials ( also referred to herein as remedial , beneficial and / or therapeutic agents ) through holes or voids in bodily tissue or through the bore of an implanted device . in the context of the present invention , the term “ therapeutic ”, “ therapeutic materials ” and “ remedial ”, “ beneficial ” and “ therapeutic ” “ agents ” refers to any material which is , or can be , injected through a hypodermic needle or other cannula device , into tissue with an intended effect which is advantageous to the health or well - being of the patient . of particular value in the context of the present invention are those agents with known benefit to the musculoskeletal system , such as , stem and precursor cells and other biological cells , bioactive cytokines ( particularly growth factors , bone morphogenetic protein , angiogenesis factors ), hormones , adipose extracts , anti - cancer drugs ( including chemo - therapy agents ), bone cements and mixtures comprising in part calcium bearing molecules , antibiotics and other anti - infection agents , blood thinning agents , analgesics , dna and combinations of any or all of the above . in the context of the present invention , bone marrow aspirate and compositions comprising such are of particular value . in the context of the present invention , the term “ stem cell ” represents a generic group of undifferentiated cells that possess the capacity for self - renewal while retaining varying potentials to form differentiated cells and tissues . stem cells can be totipotent , pluripotent or multipotent . derivative stem cells that have lost the ability to differentiate also occur and are termed ‘ nullipotent ’ stem cells . a totipotent stem cell is a cell that has the ability to form all the cells and tissues that are found in an intact organism , including the extra - embryonic tissues ( i . e . the placenta ). totipotent cells comprise the very early embryo ( 8 cells ) and have the ability to form an intact organism . a pluripotent stem cell is a cell that has the ability to form all tissues found in an intact organism although the pluripotent stem cell cannot form an intact organism . a multipotent cell has a restricted ability to form differentiated cells and tissues . typically adult stem cells are multipotent stem cells and are the precursor stem cells or lineage restricted stem cells that have the ability to form some cells or tissues and replenish senescing or damaged cells / tissues . further information may be found in wo 08 / 007082 , the contents of which are incorporated by reference herein . in the context of the present invention , the term “ progenitor cell ” refers to unipotent or multipotent cells , which comprise the stage of cell differentiation between stem cells and fully differentiated cells . in the context of the present invention , the term “ biological cell ” refers to any cell capable of performing useful biological functions in a living organism , particularly replication to form a tissue structure . the term as used herein includes stem cells , progenitor cells and fully differentiated cells . biological cells may include cells from the intended host organism or those from a donor organism . biological cells can include cells from recombinant or genetic engineering techniques . in the context of the present invention , the term “ bioactive molecules ” refers to any molecule which has the capacity to interact with a living tissue or system in such a way as to exhibit or induce a biological activity in an organism , tissue , organ or cell , either in vivo , in vitro or ex vivo . the term “ bioactive molecule ” extends to precursor forms thereof . precursor proteins , for example bmp precursors , are typically inactive until they undergo endoproteolytic cleavage ; however , in that this is a process that naturally occurs in the body , the present invention extends to precursor proteins that participate in useful biological processes in the body . of particular interest in the context of the present invention are bioactive peptides that trigger or regulate biological functions . illustrative examples of bioactive molecules suitable for use in the context of the present invention include , but are not limited to , are growth factor proteins , such as tgfβ , bmp - 2 , fgf and pdgf . in the context of the present invention , the term “ growth factors ” refers to the broad class of bioactive polypeptides which controlling and regulating a variety of endogenous biological and cellular processes , such as cell - cycle progression , cell differentiation , reproductive function , development , motility , adhesion , neuronal growth , bone morphogenesis , wound healing , immune surveillance and cell apoptosis . growth factors typically operate by binding to specific receptor sites on the surface of target cells . growth factors include , but are not limited to , cytokines , chemokines , polypeptide hormones and the receptor - binding antagonists thereof . examples of well known growth factors include but are not limited to : bone morphogenic protein ( bmp ); transforming growth factor beta ( tgf - β ); interleukin - 17 ; transforming growth factor alpha ( tgf - α ); cartilage oligomeric matrix protein ( comp ); cell density signaling factor ( cds ); connective tissue growth factor ( ctgf ); epidermal growth factor ( egf ); erythropoietin ( epo ); fibroblast growth factor ( fgf ); glial derived neurotrophic factors ( gdnf ); granulocyte - colony stimulating factor ( g - csf ); granulocyte - macrophage colony stimulating factor ( gm - csf ); growth differentiation factor ( gdf ); myostatin ( gdf - 8 ); hepatocyte growth factor ( hgf ]; insulin - like growth factor ( igf ); macrophage inhibitory cytokine - 1 ( mic - 1 ); placenta growth factor ( pigf ); platelet - derived growth factor ( pdgf ); thrombocyte concentrate ( prp ); thrombopoietin ( tpo ); vascular endothelial growth factor ( vegf ); activin and inhibin ; coagulogen ; follitropin ; gonadotropin and lutropin ; mullerian inhibiting substance ( mis ) also called : anti - müllerian hormone ( amh ) mullerian inhibiting factor ( mif ) and mullerian inhibiting hormone ( mih ); nodal and lefty ; and noggin therapeutic molecules which regulate , induce or participate in useful biological processes in the body , including those listed above , are often categorized or classified according to their particular structure or function . for example , immunoregulatory proteins secreted by cells of the immune system , such as interleukin and interferon , are often referred to as cytokines . other categories of regulatory molecules include , but are not limited to : morphogens ( e . g ., molecules that regulate or control the formation and differentiation of tissues and organs ); chemokines ( e . g ., any of a group of cytokines produced by various cells , as at sites of inflammation , that stimulate chemotaxis in white blood cells such as neutrophils and t cells ); hormones ( e . g ., a product of living cells that circulates in body fluids such as blood and produces a specific , often stimulatory effect on the activity of cells , usually remote from its point of origin ); receptors ( e . g ., a molecule present on a cell surface or in the cell interior that has an affinity for a specific chemical entity , including both endogenous substances such as hormones and ligands as well as foreign materials , such as viral particles , that serves as an intermediary between the stimulating agent and the downstream physiological or pharmacological response thereto ; receptor - binding agonists ( e . g ., a chemical substance capable of combining with a specific receptor on a cell and initiating the same reaction or activity typically produced by the endogenous binding substance ( such as a hormone ); and receptor - binding antagonists ( e . g ., a chemical substance that reduces the physiological activity of another chemical substance ( such as a hormone ) by combining with and blocking one or more receptors associated therewith ). however , since the study of the function of the various regulating moieties in the body is still an emerging science , the categorization thereof is also evolving . accordingly , the present invention is not limited to any one particular class or category of regulating or stimulating molecules . as used herein , the term “ growth factors ” also refers to precursor forms of growth factors , which are typically inactive until they undergo endoproteolytic cleavage , as well as synthesized and recombinant forms which provide part or all of the same or similar functions as the naturally occurring growth factors . accordingly , the present invention encompasses precursors , analogues , and functional equivalents of growth factors , provided the resulting molecules retain some or all of the function of regulating useful biological processes in the body , typically by binding to specific receptor sites on the surface of target cells associated with the wild - type or endogenous moiety . the term “ therapeutic agents ” as used herein refers to any molecule , compound or composition having therapeutic potential , more particularly pharmaceutical activity . examples of particularly useful therapeutic and / or pharmaceutical activities include but are not limited to anti - coagulation activity , anti - adhesive activity , anti - microbial activity , anti - proliferative activity , and biomimetic activity . in the context of the present invention , the term “ therapeutic materials ” refers to any composition which comprises any of the following : therapeutic agents , bioactive molecules , stem cells , progenitor cells or biological cells . the term “ bioactive solution ” refers to a liquid composition which comprises , in part , bioactive materials . in the context of the present invention , the term “ antimicrobial ” refers to any molecule which has the capacity to limit or interfere with the biological function of a bacterial , fungal or viral pathogen or a toxin . antimicrobial is intended to also encompass antibacterial , antibiotics , antiseptics , disinfectants and combinations thereof . as used herein , the term “ tissue ” refers to biological tissues , generally defined as a collection of interconnected cells that perform a similar function within an organism . four basic types of tissue are found in the bodies of all animals , including the human body and lower multicellular organisms such as insects , including epithelium , connective tissue , muscle tissue , and nervous tissue , and additional specialized tissue , such as teeth . these tissues make up all the organs , structures and other body contents . as used herein , the term “ bone ” refers to the rigid organs that form part of the endoskeleton of vertebrates and function to move , support , and protect the various organs of the body , produce red and white blood cells and store minerals . one of the types of tissues that make up bone is the mineralized osseous tissue , also called bone tissue , which gives it rigidity and honeycomb - like three - dimensional internal structure . other types of tissue found in bones include marrow , endosteum , and periosteum , nerves , blood vessels and cartilage . cartilage is a type of dense connective tissue composed of collagen fibers and / or elastin fibers that can supply smooth surfaces for the movement of articulating bones . cartilage is found in many places in the body including the joints , the rib cage , the ear , the nose , the bronchial tubes and the intervertebral discs . there are three main types of cartilage : elastic , hyaline , and fibrocartilage . accordingly , the term “ tissue ” as used herein broadly encompasses all biological components including , but not limited to , skin , muscle , nerves , blood , bone , cartilage , teeth , tendons , ligaments , and organs composed of or containing same , as well as derivatives thereof , such as demineralized bone matrix . while the constructs and assemblies of the present invention have particular applicability to bone treatment , the present invention is not limited thereto . rather , the teachings of the present invention may be applied to other analogous situations , in connection with other tissues and organs . in the context of the present invention , the term “ plug ” or “ plug material ” refers to any solid , semi - solid , or gel material , or combinations thereof , which when implanted in tissue or the bore of a cannulated implant device , such as a bone screw , provides a full or partial hydraulic barrier to flow from one side of the plug along the linear axis of the hole or bore to the other side . additionally , said plug material can include one or more liquid components . typical materials are bio - compatible . typically , in the case of plugs inserted into non - elastic ( or less - elastic ) implants or tissue , said plug is comprised , at least in part , of elastomeric or otherwise deformable or shapeable materials . alternatively , the use of a non - deformable plug material combined with a deformable coating , including , but not limited to , an adhesive is contemplated by the present invention . plugs inserted into more - elastic implants or tissues ( i . e ., those that are themselves deformable ) may be fabricated from either non - deformable or deformable materials or a combination thereof . illustrative plug materials include , but are not limited to : polymer solids , foams , films and fibers , with particular value in biodegradable polymers , such as polylactic acid ( pla ) and poly - lactic - co - glycolic acid ( plga ), biological solids , foams and fibers , such as collagen , bone matrix and bone products treated to exhibit properties , such as elastic or other properties , bone putty , gel and cement and the range of calcium based compounds known to those skilled in the art , adipose tissue , other biological tissue , including autogenic and allogenic tendon and ligament tissue . additionally , the plug can also comprise balloon - type constructs and highly viscous materials . additional components to imbue specific properties to the plug are also of value , such as , but not limited to the use of fibrin glue and related materials to increase the adhesion between the plug and the wall of the hole in the tissue or bore of the implant device . bone void fillers , such as collagen mixed with calcium phosphate salt or other calcium molecule bearing compounds , or collagen mixed with demineralized bone matrix are readily available and are of value as plug materials in the context of the present invention . of particular interest in the context of the present invention are materials and mixtures which expand through absorption of water or other materials , such as mixtures comprising , in part , hydrophilic materials which form hydrogels , or materials , such as sponge - like materials , which are maintained in a compressed state by a material with water soluble bonds are of particular interest . plug materials which under go a state change through change in temperature , such as a bone wax which can transition from a liquid or semi - liquid state to a more solid state once implanted at body temperature are of value . plug materials which undergo a reactive or solvent based transition to a more solid state are also of interest , such as epoxies , or other cements known to those skilled in the art . plug materials which comprise different materials in different areas of the plug are of particular interest in the context of the present invention ; a plug wherein the walls of the plug have an effective concentration of material which provides increased friction between the plug and the walls of the hole in the bone or bore of the implant device , such as fibronectin based molecules , is of value ; as previously mentioned a core of the plug which is expansive in nature and increases the radial force of plug against wall is of value ; a material at the proximal end of the plug which abuts to the distal end of the plug pusher which exhibits a low level of binding between the two , such as fibrous polymer , is of value ; and other configurations , which might be envisioned by one skilled in the art to achieve the desired effects described herein . in the context of the present invention , a flow barrier is anything that restricts or impedes , at least in part , the movement of material from one area to another . typically this is a result of reduction in the open area available for the flow of material . accordingly , plug materials can present either a complete barrier to flow , such as with a wax plug which occupies all the cross - sectional space , or a partial barrier to flow , such as might be envisioned with a fibrous filter material . in either context , a substantial reduction in fluid flow across the opening is achieved . in the context of the present invention , in addition to serving as a proximal flow barrier , the plug of the present invention can also be used to itself deliver , either as a bolus or over an extended period of time , a therapeutic material which is identical to or separate from the therapeutic material which is injected ; for example , there might be advantages to the plug containing anti - infectious agents . the therapeutic agents which may be contained ( e . g ., adsorbed ) within and dispensed from , preferably over an extended period of time , the material of the plug are analogous to those which may be injected across the plug , via the hypodermic needle , and include those mentioned above . specifically preferred examples include , but are not limited to , growth factors and other cytokines , stem and progenitor cells , antibiotics , chemotherapeutics and other cancer drugs , imaging compounds , analgesics , and the like as well as combinations thereof . in the context of the present invention , the “ core device ”, “ flow tube ”, hypodermic needle or other cannulated fluid delivery tube can comprise any fluid portal which can provide a hydraulic path between the proximal side of the plug and the distal side of the plug . the length and gauge of the needle required will vary with the length of the assembled device , the diameter of the hole being injected into and the propensity of the therapeutic material to plug . of particular value in the context of the present invention is a hypodermic needle with a luer - lock - type fitting , such as might be found with a spinal needle ; this type of needle typically has an extended length which makes it of value in transiting the length of the assembled device . in the context of the present invention , the cannulated flow tube can be of any material which is compatible with being provided in a sterile state and does not adversely react with any other component in the system or the body tissue . stainless steel is in common use for hypodermic needles and is well - suited to the device of the present invention . polymer tubes , both rigid and flexible are also of value in the present invention . a collapsible tube which only passes fluid when sufficient pressure is introduced at one end is also of value in the present invention , and it should be noted that in such a case , the tube may not have to be removed from the plug after injection of the therapeutic material . the connection of the needle or tube to the therapeutic fluid reservoir and the fluid reservoir itself can be of any form readily envisioned by one skilled in the art ; in the context of the present invention , a syringe with luer - lock - type connection is preferred because of the prevalence of these devices on the market . the “ plunger ” or “ plug pusher ” of the present invention may be fabricated from any material having the requisite structural integrity to transit force applied by the surgeon to insert the plug into the hole or bore and maintain the plug in that position during injection of the therapeutic material . typically , the proximal end ( end away from the patient ) will have some form of protuberance to afford the surgeon leverage in pushing the plug into the tissue and holding it there during injection and during the process of extracting the hypodermic needle . in the case of a luer - lock - type or other twist type connect on the needle , the plug pusher may , but is not required to , have a design which restricts the ability of the needle to rotate around the linear axis in relation to the plug pusher . additionally , the plug pusher may , but is not required to , have a positive restraint to maintain the needle in the plug pusher until the surgeon wishes to remove it ; said restraint can consist of a removable clip , or any other restraint as might be envisioned by one skilled in the art . typically , the shaft of the plug pusher will have some type of indicia or mark ( s ) along the length of the shaft which are covered up by the plug guide cannula as the plug pusher is pushed into the plug guide to displace the plug into the tissue or implant device . the covering up of this mark ( or marks ) will provide the surgical personnel with a visible indication of the depth of insertion of the plug . in the context of the present invention , the plug guide ( also referred to herein as a plug guide cannula , channel , tube or sleeve ) comprises a tube - like structure which constrains the plug in a configuration compatible with insertion into a void of predetermined diameter , protects the plug prior to insertion , engages with the opening of the hole or bore in a manner which is conducive to the transfer of the plug from the plug guide into the hole , provides a positive stop to insure the relative position of the plug guide and the tissue or the cannulated implant device , provides a limiting stop for the plug pusher . the plug guide cannula may also comprise a specialized distal end to mate with bone or implant device in a specific manner , for example , the exterior wall of the plug guide cannula may have a hexagonal cross - section to mate securely with the head of a hex - drive bone screw . the plug guide cannula may also comprise at the proximal end protuberances to facilitate handling by the surgeon , or to provide a limiting stop in the case where the plug guide is being inserted into a surgical cannula that has been used as a guide for forming a hole in tissue or bone . the plug guide cannula may also have incorporated in the proximal end a positive stop to prohibit the plug guide from being pulled off of the plug pusher ; this can be accomplished by tabs on the plug guide which run in a groves along a portion of the length of the plug pusher , or through other means readily envisioned by one skilled in the art . the plug guide cannula can comprise any material or combination of materials that provide the requisite structural integrity and are compatible with other components of the system and medical use . of particular interest in the context of the present invention are low - friction polymers that can be sterilized , such as certain grades of nylon , which have are slightly elastic such that they provide a tight fit to the plug pusher . in some instances , a straight metallic sleeve or a metallic sleeve with a polymer lining may be preferred over a straight flexible polymer sleeve for structural reasons , particularly when dealing with hole diameters less than 2 millimeters . in certain instances , it may be advantages to advance the plug through a surgical cannula which is of a size which is compatible with the opening in the tissue . this is often the case when a trocar / cannula combination has been used to create the hole in bone . in this case , the surgical cannula of the trocar / cannula combination may be used as the plug guide cannula . the device of the present invention will include a plug guide cannula , or in this case a “ plug holder ” which mates with the proximal end of the surgical cannula and permits transfer of the plug to the surgical cannula , such that the plug pusher pushes the plug through the surgical cannula and into the bone or implant device . the present invention is particularly useful for introducing therapeutic materials into the bore of a surgical implant , such as a bone screw . however , the invention is not limited to osteoimplants . it not only finds utility in connection with other type of implants or prosthetic devices but also finds utility in connection with bones or tissue alone , in the absence of such implants . accordingly , the device and assembly of the present invention may used to introduce therapeutic materials into voids in tissue or bone through openings that are natural , disease - associated or surgically introduced . for example , the device and assembly of the present invention may used to deliver useful material to areas of necrotic or cancerous bone . in addition to serving as a means for delivering therapeutic materials , the constructs of the present invention also find utility in the aspiration or removal of material from a hole or void in a tissue or bone , for example , aspirating bone marrow from the hip bone or aspirating excess fluid from an arthritic joint . the constructs of the present invention also have spinal column applications as well as potential utility in connection with soft organs and tissues . hereinafter , the present invention is described in more detail by reference to the figures and examples . however , the following materials , methods , figures , and examples only illustrate aspects of the invention and are in no way intended to limit the scope of the present invention . for example , while the present invention makes specific reference to orthopedic bone screws , it is readily apparent that the present invention has other applications , such as those mentioned herein . as such , methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention . surgical treatment is provided for a patient with chronic degenerative insertional tendinopathy with thickening fibrosis and tearing of the achilles tendon from the calcaneus extending approximately 5 - 6 cm , who has failed conservative treatment . in surgery , the peritinon is incised , the tendon is debrided and all non - viable tendon is removed , the diseased portion of the calcaneus is resected , and the flexor hallucis longus ( fhl ) tendon is approached . a section of the fhl tendon is harvested and formed into a 5 mmø × 3 mm plug and inserted and securely packed into a plug guide cannula of the present invention by trained personnel . a 2 mmø guide wire is driven into the calcaneus at the desired point of reattachment of the tendon . a 5 mmø cannulated drill is then used over the guide wire to create the attachment tunnel . the free end of the portion of fhl tendon which remains attached to muscle is sutured and passed through the tunnel and appropriately tensioned before a 5 . 5 mmø × 3 mm pla / plga interference screw is inserted in the tunnel to secure the tendon . a syringe with 4 cc of autologous bone marrow aspirate concentrate is attached by means of a luer - lock fitting to the needle of the device of the present invention , and the syringe is depressed sufficiently to clear the needle of entrapped air . the device is then positioned at the head of the interference screw and the plug and needle assembly is displaced into the screw according to the method of the present invention . the bone marrow aspirate is then injected into the region of the screw at the distal side of the plug . the needle is removed while the plug pusher is held in place , and then the plug pusher and plug guide assembly is removed . surgical treatment is provided for a patient with an osteopenia and intertrochanteric femur fracture . the fracture is reduced and a hip screw and plate device is surgically inserted and affixed using 4 . 5 mmø × 4 cm cannulated titanium screws . in the process of screw placement , the screws are driven to a point representing 75 % of the final insertion depth . at that point , a device of the present invention is utilized in conjunction with the screw . the device comprises , in part , a calcium putty plug , and has attached to the needle , a reservoir of methyl - methacrylate bone cement . the device is abutted to the partially inserted screw ; the plug pusher is displaced into the plug guide cannula to a point where the plug and the needle tip are displaced into the target screw . the bone cement is then injected into the screw . the needle is removed , and then the plug pusher is removed . the screw is then driven the remaining portion to full depth and , in this process , the driving bit provides the additional benefit of holding the plug in place in the screw during the process of driving the screw further into the bone . a patient with avascular necrosis of the femoral head prior to the onset of subchondral fracture undergoes a procedure for structural decompression that involves core drilling , flushing of the affected zone with a solution thought to halt osteoclastic breakdown ( in cases of suspected infection , an antibiotic treatment may be added or substituted ), and then treatment of the area with cellular therapy through the insertion of mesenchymal stem cells ( msc ) in a autologous plasma matrix which also contains therapeutic levels of platelet - derived growth factor ( pdgf ). this is accomplished through the following procedure : ( a ) an incision is made to access the trochanteric section of femur . ( b ) a 6 . 5 mmø outside × 60 mm surgical cannula is introduced into the incision and placed on the bone as a guide . ( c ) a 5 mm drill is introduced into the cannula and under image guidance the affected area is penetrated by a plurality of holes originating from the single cannula access point using a fanning technique . ( d ) a construct of the present invention is introduced into the cannula , the construct comprising : i . a plug guide cannula with a 5 mm inside diameter and an outside diameter less than the said surgical cannula , and a straight - wall length of 60 mm with a limiting protrusion on the proximal end to constrain insertion in the surgical cannula beyond 60 mm , ii . a 7 mm long plug of collagen sponge ( also foam ) compressed to 5 mm diameter , iii . a plug pusher , 5 mm in diameter and 63 mm straight wall length ; the plug pusher has a two 18 gauge needles with flexible shafts mounted within the plug guide cannula and eccentrically on opposite sides of the plug . ( e ) the surgical cannula is put at an angle to the surface of the bone , and one of the two needles is slid under imaging system guidance into the drill hole at one extreme of the fan pattern to an extent where it extends into an area of necrosis ; the surgical cannula is then reoriented to a different angle such that the second needle can be slid under imaging system guidance into a hole at the other extreme of the fan pattern . ( f ) the plug pusher is displaced into the plug guide cannula in a manner where the plug enters and seals the drilled entrance hole in the bone which is the focal point of the fan pattern of drill holes . ( g ) one needle is attached to a reservoir of an osteoclastic breakdown inhibitor solution and the second to a drain reservoir , and 1 cc / sec of solution is pumped through the area of necrosis for a 10 minute period . ( h ) the inhibitor ( or alternatively , antimicrobial ) solution reservoir is disconnected and the msc / pdgf solution is then introduced into the same needle until either the supply of msc / pdgf solution is exhausted or there is evidence of the same in the needle to the drain . ( i ) the needles are removed from the plug pusher / plug guide cannula assembly , and then the assembly is removed from the surgical cannula . the present invention provides a means for introducing and retaining a broad range of therapeutic cells , particularly stem cells , and other biologically significant and / or bioactive molecules in cannulated implants as well as in surgical holes in bone , cartilage , teeth and other tissue . applicable procedures that would benefit from the devices and assemblies of the present invention are common in orthopedic surgery , including spinal surgery , and dentistry . the present invention provides the surgeon with tools and devices which are compatible with existing surgical techniques and permits a more focused delivery of often expensive therapeutic materials . the present invention has particular value in the introduction of stem and other precursor cells , bioactive cytokines , including but not limited to growth factors as well as to the introduction of anti - cancer drugs , particularly those having a toxic effect and for which restricted application is desired . the devices , constructs , assemblies and methods presented herein provide for increased efficiency of operation in a surgical operating room environment with reduced potential for error . the devices , constructs , assemblies and methods also may result in fewer avenues of potential bacterial infections during surgeries . the efficiencies derived from the methods of the present invention can reduce the time in surgery , which , in turn , can reduce the stress on the patient &# 39 ; s body and has the potential to reduce the cost of the surgical procedure . the ability to efficiently introduce and retain therapeutic materials may result in a faster recovery from a medical condition . the disclosure of each publication , patent or patent application mentioned in this specification is specifically incorporated by reference herein in its entirety . however , nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention . while the invention is herein described in detail and with reference to specific embodiments thereof , it is to be understood that the foregoing description is exemplary and explanatory in nature and is intended to illustrate the invention and its preferred embodiments . through routine experimentation , one skilled in the art will readily recognize that various changes and modifications can be made therein without departing from the spirit and scope of the invention , the metes and bounds of which are defined by the appended claims . | 0 |
the asymmetric hydraulic press electric generator of the present invention comprises a hydraulic subsystem and a generating subsystem , wherein by pressurizing fluid the hydraulic subsystem generates an amount of force which is used by the generating subsystem to generate electrical energy . additionally , as the asymmetric hydraulic press electric generator is a closed , energy recycling system , a portion of the electrical energy generated by the generating subsystem is used to power the hydraulic subsystem so that the hydraulic subsystem can generate additional force . referring to the figures , an exemplary hydraulic subsystem 10 comprises a tank 12 , a filter 14 , an electric motor 16 , a pump 18 , a cylinder 20 , a gearbox 22 , a compound type sequence valve 24 , and a directional control valve 26 . an exemplary generating subsystem 100 comprises a generator 102 , a regulator 104 , a converter 106 , batteries 108 , sensors , a signal control device , and a manual and automatic switchbox . fig1 depicts the level principle upon which the present invention is at least partially based . referring to fig1 , given that the asymmetric hydraulic press electric generator of the present invention comprises : ( 1 ) a hydraulic subsystem (“ part a ”) and ( 2 ) a generating subsystem (“ part b ”), then it only need to be show that the force produced by part a is greater than the force needed by part b to generate electric power . a simple algebraic inequality can be used to illustrate this relationship : first , it is observed that a - b is either positive , zero , or negative . another way to say the same thing is to note that given two real quantities a and b , only one of the following is true : second , let us apply this statement to the amount of force generated or needed by the subsystems of the asymmetric hydraulic press electric generator , where a can be the amount of torque exerted by the hydraulic subsystem , and b can be the amount of torque needed by the generating subsystem . in our case , a - b is positive , or , this is also to say that a can neither be equal to , nor lesser than , b . let us then conduct a theoretical experiment using the lever principle , to prove the inequality a & gt ; b . the experiment is as follows : given a 6 m - long lever , the fulcrum divides the lever into a 5 m - long arm and a 1 m - long arm . a 3000 - kg object is placed on the 1 m - arm of the lever . the question is : how much force must be applied on the 5 m - arm to balance the 3000 - kg object ? where f is the force , l is the lever arm , a is the longer arm and b is the shorter arm . thus , this means that 5880 n of force is needed to balance 29400 n of force on a lever with a 5 : 1 arm ratio . this balanced lever then creates two similar triangles relative to the ground , triangle a and triangle b . triangle a has a base that is equal to l ( a ), or 5 m , and a height of 1 . 2 m . triangle b has a base that is equal to l ( b ), or 1 m , and a height of 0 . 24 m . now let us assume that the 3000 - kg object is a solid disk , and that the 600 kg needed to balance the lever is also a solid disk . 1 .) first , let us introduce the concept of gravitational potential energy , where peg = mgh , where m is mass , g is the gravitational force , and h is height . in other words , the potential energy exerted by the longer lever arm a bearing the lighter 600 - kg disk , is equal to the potential energy exerted by the shorter lever arm b bearing the heavier 3000 - kg disk , because the height of lever arm a from the ground exceeds the height of lever arm b from the ground . therefore , energy is neither gained nor lost in balancing the lever . 2 .) let us now turn to the concept of rotational kinetic energy , ker =( ½ ) mv 2 , where m is mass and v is linear velocity , such that v = ωr , where ω is angular velocity and r is the radius of the circle . if we then suppose that both discs are rotating at 120 rpm , then in other words , ker ( a )& gt ; ker ( b ), or , the rotational kinetic energy exerted by the longer lever arm a bearing the lighter 600 - kg disk exceeds the rotational kinetic energy exerted by the shorter lever arm b bearing the heavier 3000 - kg disk . this may seem to contradict the fact that peg ( a )= peg ( b ), but let us recall that the height of the lighter 600 - kg disk from the ground ( which we also know as the height of triangle a ) exceeds the height of the heavier 3000 - kg disk from the ground ( which we also know as the height of triangle b ). this means that the angular momentum of the longer lever arm a exceeds the angular momentum of the shorter lever arm b when the disks rotate to create rotational kinetic energy . now , let us also recall that the lever arm exhibits a 5 : 1 ratio . under a normal torque transmission scenario with a gear , chain or belt instead of a lever , the lighter disc a , which is farther from the ground , would complete one turn for every five turns that the heavier disc b ; which is closer to the ground , completes , and ker ( a ) would equal ker ( b ). however , with a lever , disc a completes one turn for every one turn that disc b completes . this means that a system which uses a lever gains four times the rotational kinetic energy than a system without a lever . if a is the amount of force applied to lever arm a and b is the amount of force applied to lever arm b , then we have proven that a & gt ; b . in other words , the force produced by part a of the fluid pressure exceeds the force produced by part b of the electric generator . to summarize , the hydraulic subsystem produces more than enough force for the electric generator to function . this critical imbalance between the energy used versus the energy generated therefore renders it asymmetric and self - sufficient . referring to the figures , the asymmetric electric hydraulic press generator operates through the following steps : ( 1 ) turn on the switch . the electric current from the battery 108 will travel through the cable and start the motor 16 that runs the hydraulic pump 18 . ( 2 ) two running pumps each exert up to 3000 psi of fluid power to turn over one or two customized cylinders 20 or a customized hydraulic motor ( see fig3 a , reference numeral 28 ) which produces approximately 75400 lb of force . ( 3 ) the two cylinders 20 turn a 6 - inch diameter crank , producing approximately 230000 lb - in of torque to run the gearbox 22 . ( 4 ) the torque changes the speed of the gearbox 22 from 30 rpm or 60 rpm to 1800 rpm , turning over the 100 hp generator 102 at 1800 rpm . ( 5 ) the 100 hp generator 102 produces 75 kw of electric power . 60 kw of electric power is needed to run through the converter 106 and the regulator 104 in order to keep the electric motor 16 running and recharge the battery 108 . 15 kw are then available for other applications . a portion of the electric power produced is converted from alternate current to direct current to run the hydraulic components . these five steps complete a single energy loop . without any external disturbance , this process will continually repeat itself . now , let us prove that each step is possible : a ) since we know that the rate at which work is done to maintain an electric current is given by : p = iv , where p is power , i is the current , and v is the potential difference , then , given that 1 hp = 750 w , i = p / v =( 80 hp × 750 w )/ 12v = 60000 w / 12v = 5000 a . therefore , 5000 amperes of electric current is needed to start two 40 hp direct current electric motors . if we use six 12v batteries ( such as , for example everstart ® 12 - v battery , part no . maxx 65 n ) cranking 1000 a at 32 degrees f ., then we will have more than enough electric current to start two 40 hp direct current electric motors . hpin = gpm × psi 11714 eff , where hpin is horsepower input , gpm is flow rate , eff is efficiency ( overall ), b ) once the two electric motors begin to run two 20 gpm hydraulic pumps at 1800 rpm , the pumps will deliver both 3000 maximum psi . since we know that the pressure exerted when a force acts perpendicular to a surface is : p = f / a , where p is pressure , f is force , and a is the area , then , given that we use two customized 4 - inch bore , 6 - inch stroke and automatic return valve cylinders , or , one customized hydraulic motor : therefore , the pumps exert a total of 3000 maximum psi to turn over two customized cylinders or a customized motor producing 75362 lb of force . c ) since the torque acting on a body can be defined as the product : therefore , the two cylinders turn a 6 - inch diameter crank , producing 2 × 113043 lb - in of torque to run the gearbox . d ) since we know the cylinder speed , we can calculate its stroke . v = 231q / 720a , where q is flow rate ( gpm ), a is area ( square inches ), e ) use the hydraulic motor or the cylinders to rotate the gearbox . the input speed of the gearbox will be 30 rpm , while the output speed will be 1800 rpm . the input torque of the gearbox is therefore 226086 lb - in at 30 rpm , while its output torque is 3768 lb - in at 1800 rpm . a decrease in torque is accompanied by an increase in the speed of rotation , while an increase in torque is accompanied by a decrease in the speed of rotation . f ) use the gearbox to turn over the 100 hp generator at 1800 rpm . since the transmitted torque can be expressed as : τ = 63025 h / n ( lb - in ), where h is in hp and n in rpm , then , the 100 hp generator generating 75 kw of electricity only needs since the hydraulic subsystem produces 3768 lb - in of torque whereas the generating subsystem only needs 3501 lb - in of torque to generate 100 hp of electric power , then we do not need to consider any energy losses incurred during the generating process in order to prove that the entire system is viable . | 7 |
referring now in detail to the drawings for the purpose of illustrating preferred embodiments of the present invention , the system for packing soybean sprouts as shown in fig1 includes a bag 10 having an open portion , at the top of the bag 11 ; a retainer or clip 12 for closing the top of the bag ; and multiple soybean sprouts 13 clustered in the bag 10 . the soybean sprouts have elongated stems 14 extending substantially in the upper direction of the bag so that they can be grasped as a bundle by the user when the bag is opened . the stems 14 terminate as severed ends 14 a , with such ends positioned at or near the top of the bag 10 , as shown in fig1 . the soybean sprouts are thus ready to be removed as in bunches from the bag 10 for cooking . the soybean sprouts 13 have bead - like heads 15 which are disposed at the bottom wall 16 of the bag 10 . the bag 10 containing the soybean sprouts 13 with stems 14 and heads 15 adopt a trapezoid - like configuration and an almost rectangular bottom surface 16 which facilitates storage on a shelf or in a refrigerator , or the like . because the stems 14 are located in the upper interior of the bag , the stem ends stay dry , eliminating the possibility of roots growing from the ends of the stems . since the space occupied by the heads 15 is larger than the space occupied by the ends 14 a of the stems 14 , the bag 10 sits in a stable manner . the bag 10 preferably consists of a flexible film plastic material , and has an opaque side portion 17 , and a transparent side portion 18 , or panel , located for viewing the stems 14 , extending in substantially parallel relationship . the opaque bag side portion 17 preferably has a yellow coloring , which in general matches the yellow color of the heads 15 of the soybean sprouts 13 , when fresh . it will be noted that the side wall portion 17 includes a vertical band 17 a immediately adjacent the lower edge 18 a of the transparent sidewall portion . edge 18 a is just above the level of the heads 15 , so that the heads 15 of the soybean sprouts 13 are substantially concealed from view , by the opaque band 17 a . therefore , any change in color , for example , darkening of the heads 15 is for the most part concealed , and such change in color due to light entering through the panel or portion 17 will be slowed due to the use of band 17 a . reference will now be made to the steps involved in preparation of the package as shown in fig1 . referring first to fig2 it shows soybean sprouts 13 being grown in a vessel or tray 19 , the soybean sprouts 13 having their heads 15 above the level of the nutrient substance 20 into which the root ends 14 b of the stems extend . string - like roots 14 c grow in the nutrient substance 20 . in fig3 the soybean sprouts 15 have been removed from the tray 19 , inverted , and placed in a rinsing vessel 21 containing water 22 in which the soybean sprouts 13 are rinsed , by shaking in the water 22 . as shown in fig4 the rinsed soybean sprouts 14 are positioned on a cutting board 24 in the direction indicated by arrow ( a ), as shown , so that the stems 13 generally extend in parallel relationship . the ends 14 b of the stems 14 from which the roots are growing are cut - off as along a line 26 , using a cutter shown as element 27 . this step produces the severed ends 14 a of stems 14 . fig5 shows the soybean sprouts 13 being placed at 28 into the opened bag 10 in the direction indicated by arrow ( b ). therefore , the stems 14 of the soybean sprouts 13 will extend upright in registration with the transparent panel 18 , when the bag is closed . the basic steps of the method of providing a system for packaging soybean sprouts 13 includes a bag 10 having an open end portion and a closed end portion , multiple soybean sprouts 13 clustered together in the bag 10 , with the sprouts 13 having elongated cut stems 14 , facing in the upper direction where they can be grasped as a bundle by a user when the bag 10 is opened . when the bag containing the soybean sprouts is sealed or closed , the cut stems face the top of the bag and the heads of the soybeans face the bottom of the bag . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included in the scope of the following claims . | 1 |
in fig1 , parts of an implant are designated by 1 . in said part , the implant is provided with a thread which is exposed to the jaw bone and which , in fig1 , is represented with two thread flanks 3 and 4 . the thread flanks are provided on their upper sides 3 a and 4 a with grooves 5 and 6 . the surface of the thread or thread flanks which is exposed to the jaw bone 2 is designated by 1 a . in this illustrative embodiment , the thread flanks are designed with an oxide layer 1 b which is already known from the implants sold by nobel biocare ab . the oxide layer is characterized on the one hand by a high pore content and on the other hand by the fact that it stimulates new formation of bone in conjunction with application of the implant in the jaw bone . the surface 1 a or the oxide layer 1 b can be provided with bone - growth - stimulating agent , for example ha , in the manner specified by the applicant of the present application in said applications and patents . the type of implant or implant type or implant type can be of the kind called tiunite , which is a type of oxide layer . alternatively , bone - growth - stimulating agent in the form of ts of soft consistency can be applied in the grooves 5 , 6 before the implant is fitted in the jaw bone ( not shown ). in fig1 , new bone 7 , 8 has formed in the bottom of the peripheral spiral groove , which in fig1 is represented by 5 and 6 . the new - formed bone is of the cortical type and thus extends from the cortical part ( not shown in fig1 ) of the jaw bone down into the part 2 of the jaw bone which has been assumed to consist of trabecular or marrow - filled bone . the cortical spiral 7 , 8 is thus contiguous with the cortical part of the jaw bone and thus arranged to participate in the retention of the implant in the jaw bone in the specific case where the latter has a considerable involvement of soft bone . fig2 and 3 are enlargements showing bone growths 7 and 8 down into the groove 5 , 6 ( cf . fig1 ). the downward growth emanates principally from the cortical part of the jaw bone , and the figures also show the enclosed osteocytes 7 a . the case according to fig1 - 3 is comparable to a case with tibia in which the upper sides and undersides of the flanks were studied . 30 % of all the threads with grooves showed bone growth , while only 3 % of the threads without grooves showed bone growth . osteogenesis evidently appears to take place in the grooves . the case according to fig4 shows new growth 2 a of bone which fills out a respective groove 5 ′ in close contact with the implant surface 1 a . it will be noted here that there is no contact between bone and implant under the groove 5 ′, i . e ., at the implant surface part 1 a ′. a space or gap 1 a ″ can be present for body fluid . there is therefore preferential bone growth in the groove , which permits bone guidance and bone formation . the presence of osteocytes indicates that mature bone is present . in accordance with fig5 , the implant 1 has a length l which can assume values of known type , and in this connection reference is made to the so - called branemark system . the implant is arranged with a thread 9 which can extend along all or substantial parts of the longitudinal extent l of the implant . the thread flanks , for example thread flanks 3 and 4 , are arranged with an external diameter r and an internal diameter r 1 . said diameters can be constant or can vary along the longitudinal extent l . the recesses on the thread flanks , for example thread flanks 3 , 4 , comprise grooves which combine to form a spiral groove along the longitudinal extent l of the implant . groove parts on the thread flanks 3 and 4 are designated by 5 and 6 . in accordance with the above , the grooves are arranged on the upper sides of the thread flanks . the groove parts on the thread flanks can be arranged at central parts 3 b , 4 b of the thread flanks . in one illustrative embodiment , the groove or the groove parts are arranged at a distance r 3 from the center axis 10 of the implant . said distance r 3 can be the same for all the groove parts or can vary between the different groove parts . alternatively or complementarily , the thread flanks can be provided with more than one groove , and an example of such an additional groove has been designated by 11 . alternatively or complementarily , the thread flanks can be provided with grooves 11 ′ on their undersides . the terms upper sides and undersides can also relate to whether the implant is to be applied in the upper jaw or lower jaw . fig6 shows how a thread flank groove 12 extends circularly and peripherally around the thread flank 13 ( see also fig5 ) in question . in accordance with the examples below , it has been shown that the degree of anchoring increases considerably by what is proposed according to the invention . thus , the removal torques m have increased considerably , see below . in the view shown in fig6 , the groove 12 can be given a variation for radius r 3 . fig7 shows a cross section of a groove 14 in a thread flank 15 . in this case the width of the groove is indicated by b and the depth of the groove is indicated by h . in the cross section shown according to the embodiment in fig7 , the groove has been shown in a semicircle shape . however , the groove can assume other shapes , for example triangular , rectangular or square , or combinations thereof , etc . in one embodiment , the groove is configured to increase the surface area of the thread flanks exposed to the jaw bone by 5 - 15 %. other amounts of increase to the surface area may be achieved using different shapes and geometries . fig8 shows a cortical part 16 of a jaw bone which also has a trabecular part 17 . an implant 18 with peripheral spiral - shaped groove is shown by 18 . in fig8 a , the lower parts of the implant 18 have been removed for the sake of clarity . the spiral - shaped 3 groove is shown by 19 , which in principle can also represent a reinforcement element for securing the implant . the reinforcement element has arisen through formation of new bone . the parts of the groove or of the reinforcement element at the cortical part 16 permit access for the body fluid generated by the cortical part in the hole formed ( pre - formed ) in the jaw bone during application of the implant in the inward ( downward , upward ) extending recess . a reinforcement element consisting of new cortical bone can thus be obtained down ( deep down ) in the trabecular part of the gum . fig8 b shows that other shapes or extents of the reinforcement element 19 ′ are possible , for example straight or twisted reinforcement elements . the reinforcement element increases the retention of the implant , and the element ( s ) can be arranged with greater dimensions at their outer parts . fig9 shows the use of bone - growth - stimulating agent 20 which can have a gel - like consistency and is applied in the spaces 21 between the thread flanks . the agent can stimulate bone growth in the soft parts of the jaw bone over a comparatively long time and contribute to the increased retention function even for a protracted period of time . fig1 aims to show alternative groove applications for obtaining alternative reinforcing elements , cf . fig8 b . thus , recesses 22 , 23 and 24 in the thread flanks can be seen to form grooves which extend through the recesses and the spaces 25 , 26 between the thread flanks . in a further alternative or complementary embodiment , the implant can be provided with grooves 27 extending in the longitudinal direction of the implant . fig1 shows examples of the removal torques which were required on the implant applied on rabbits and dogs in accordance with the principles of the invention . the case with rabbits is indicated by 28 and 29 and the case with dogs is indicated by 30 , 31 and 32 . in the case with rabbits ( 9 rabbits were used ), implants si and s3 were used in a bone ( femur and tibia ) and a control implant in another bone . the time of incorporation was 6 weeks . the implants had tiunite , ( oxide layer ), surfaces . the groove widths were 110 ( s1 ) and 200 ( s3 ) μm and the groove depth was 70 μm . the following removal torques were obtained : where sx − c is the mean value of the sum taken from each pair from each rabbit . in the case with dogs , the following values were obtained in the same way with groove widths 80 ( so ), 110 ( si ) and 160 ( s2 ): where sx − c is the mean value of the sum taken from each pair from each dog . the implant as such can be made of tissue - compatible material , for example titanium . although the foregoing systems and methods have been described in terms of certain preferred embodiments , other embodiments will be apparent to those of ordinary skill in the art from the disclosure herein . additionally , other combinations , omissions , substitutions and modifications will be apparent to the skilled artisan in view of the disclosure herein . while certain embodiments of the inventions have been described , these embodiments have been presented by way of example only , and are not intended to limit the scope of the inventions . indeed , the invention is not limited to the embodiments shown above by way of example , and instead it can be modified within the scope of the attached patent claims and the inventive concept . | 0 |
although specific embodiments of the present invention will now be described with reference to the drawings , it should be understood that such embodiments are by way of example only and merely illustrative of but a small number of the many possible specific embodiments which can represent applications of the principles of the present invention . various changes and modifications obvious to one skilled in the art to which the present invention pertains are deemed to be within the spirit , scope and contemplation of the present invention as further defined in the appended claims . referring to fig1 an automatic shock actuated valve of the prior art is illustrated . this valve is that disclosed in u . s . pat . no . 4 , 915 , 122 issued apr . 10 , 1990 and which valve description is incorporated herein by reference for disclosure of the preferred embodiment of the instant invention . the prior art reference includes as co - inventors the two inventors of this instant disclosure . while this prior art reference is included to present a preferred embodiment of the improvement mechanism , it is understood the structure and principles can be used with other ball weight actuating valves . there is illustrated a shock and vibration force responsive valve assembly ( 10 ) which is adapted to automatically close off the control of a fluid through a conduit . the assembly includes a tubular main body ( 11 ) having flanges ( 12 ) and ( 13 ) at its opposite ends connectable by fasteners ( 14 ) to abutting flanges ( 15 ) of adjacent conduit or pipe sections to connect the body into a pipeline . the illustration orientation is such that fluid , for example , natural gas , flows in a left to right direction as viewed in fig1 in an inner passage ( 16 ), partially illustrated , in body ( 11 ) and parallel to a central horizontal axis of the passage . the flow control mechanism includes a circular valve element ( 18 ) which is engageable with an annular seat ( 19 ) formed in body ( 11 ) to close off the flow of fluid through the assembly ( 10 ) valve element ( 18 ) is carried by arm ( 20 ) which swings about a horizontal axis ( 21 ) between a closed position and the open position illustrated in fig1 . arm ( 20 ) and the carried valve disc ( 18 ) are releasably retained in the open position by engagement of arm ( 20 ) with latch pin ( 22 ) carried by a second arm ( 23 ) which is mounted for swinging movement about a horizontal axis ( 24 ) between the position illustrated in fig1 and the dashed line position illustrated therein . arm ( 23 ) is in turn releasably retained in position by a shock actuation control mechanism ( 25 ). the control mechanism ( 25 ) is principally contained in housing ( 58 ) having bulge ( 59 ). the housing ( 58 ) is attached to the tubular main body ( 11 ) at annular flanges ( 62 ) which have a sealing o - ring ( 63 ). the housing ( 58 ) is retained by circular clamp ( 60 ) and fasteners ( 61 ). the control mechanism ( 25 ) includes a weight or mass ( 36 ) illustrated as a ball . when disc valve ( 18 ) is in the open position the ball ( 36 ) is supported on a pedestal ( 37 ) extending upwardly along vertical axis ( 38 ). the pedestal as illustrated is an externally cylindrical form about axis ( 38 ) and has an upwardly facing shallow circular recess ( 39 ) to retain the ball ( 36 ) in its centered , at rest position . the pedestal ( 37 ) is attached to the body ( 11 ) by plate ( 40 ) and fasteners ( 41 ). referring to fig1 and 2 , a vertical tube ( 42 ) centered about axis ( 38 ) is disposed about and spaced from pedestal ( 37 ), and is movable upwardly and downwardly relative to the pedestal ( 37 ). the tube ( 42 ) is mounted for vertical movement by a parallelogram mechanism ( 43 ), including two similar parallel upper links ( 44 ) each pivoted at one end to the tube ( 42 ) by a horizontal pin ( 45 ) extending through vertical slot ( 46 ) in pedestal ( 37 ), and each pivoted by a second parallel horizontal pin ( 47 ) to a pair of vertical bracket arms ( 48 ) projecting upwardly from and attached to plate ( 40 ). the parallelogram mechanism also includes two similar parallel lower links ( 49 ) each pivoted by a first pin ( 50 ) to tube ( 42 ) and by a second pin ( 51 ) to bracket arms ( 48 ). a downward movement of the tube ( 42 ) causes a rightward swinging movement of cross pin ( 54 ) to release arm ( 20 ) for closure of the valve ( 10 ) by seating valve element ( 18 ) by a spring force . the tube ( 42 ) is yieldingly urged upwardly , as for example by a leaf spring or plate spring ( 57 ). when ball ( 36 ) is moved laterally from its centered position in any horizontal direction relative to pedestal ( 37 ) the weight engages the upper edge of tube ( 42 ) and displaces the tube ( 42 ) downwardly relative to the pedestal to move cross pin ( 54 ) carried on projection ( 53 ) out of notch ( 55 ) in arm ( 23 ) and allows downward swinging movement of arm ( 23 ) to cause the valve to close . the amount of shock or vibration force to displace ball ( 36 ) from recess ( 39 ) is determined by the shape and depth of the recess ( 39 ) and the mass of the ball ( 36 ). in some instances the ball ( 36 ) may be displaced by a force which causes ball ( 36 ) partial engagement with vertical tube ( 42 ), but due to force frequency or other factors the ball ( 36 ) does not downwardly displace the vertical tube ( 42 ) sufficiently and the ball ( 36 ) retreats to a second position . this motion delays the actuation of the valve ( 10 ) and thereby the ceasing of flow of the fluid . referring to fig3 through 5 , an improved pedestal ( 37 ) embodiment is illustrated . the pedestal ( 37 ) upper end has been modified to create a ridge ( 1 ) or circular protrusion with generally cylindrical recess ( 2 ) therein and a step or offset ( 3 ) circumferentially formed external to the ridge ( 1 ). while a cylindrical recess is discussed in the embodiment other recess shapes , such as that disclosed in the prior art , may be used with the circumferential external offset ( 3 ). the ball ( 36 ) is supported on pedestal ( 37 ) and retained in its central , at rest position by ridge ( 1 ). when a shock or vibration force is experienced by the shock actuation control mechanism ( 25 ), the ball ( 36 ) is displaced when such force reaches a specified value . if the force is of sufficient strength and duration , the ball ( 36 ) is urged upwardly and over the ridge ( 1 ). once the center of gravity of the ball ( 36 ) passes the vertical center position of the ridge ( 1 ), gravitational force will act on the ball ( 36 ) to move it downwardly toward offset ( 3 ). this vertical gravitational force combines with the horizontal force displacing the ball ( 36 ) to force the vertical tube ( 42 ) in a downwardly direction actuating closure of the valve ( 18 ). the offset ( 3 ) must be sized to aid the ball ( 36 ) engagement with vertical tube ( 42 ), but not be so large as to inhibit the return of the ball ( 36 ) to its central position when the valve assembly ( 10 ) is reset after the shock and vibration forces have ceased . the vertical tube ( 42 ) top end may also be beveled ( 4 ) for more controlled uniform force application by the ball ( 36 ). the diameter of the ridge ( 1 ) and the size of the offset ( 3 ) are adjusted to cause the valve to close upon sensing the specified motion forces . in this embodiment the value at which the ball ( 36 ) will be caused to engage the vertical tube ( 42 ) may be adjusted by changing the inside diameter of the ridge ( 1 ). it has been found by experiment that for minor adjustment the ball ( 36 ) may be impacted by a force , as from example a hammer , causing a spreading impact force to the ridge ( 1 ). use of the improved pedestal structure has been found by experiment to improve the accuracy of the time for mechanism response to specified shock and vibration forces to be repeatable to within 0 . 001 of a second . referring to fig6 through 9 , alternatively , there is shown at 110 the present invention shock and vibration force responsive valve assembly which is adapted to automatically close off the flow of a controlled fluid such as natural gas through a conduit in response to seismic forces or other shock forces of a predetermined magnitude . the valve assembly 110 includes a tubular main valve body 111 having flanges 112 and 113 at its opposite ends connectable by fasteners to abutting flanges of adjacent conduit sections or pipe sections ( not shown ) to connect the main body 111 into a pipeline . it may be assumed that natural gas or another controlled fluid flows in a downward direction ( top to bottom ) as shown by the flow arrow 109 through an inner passage 116 formed in the main body 111 and parallel to a central vertical axis 117 of the inner passage 116 . the valve assembly 110 further includes a flow control mechanism which has a circular disc valve 118 engageable with an annular seat 119 formed in the main valve body 111 to close off the flow of fluid through the valve assembly 110 ( see fig9 ). the disc valve 118 is carried by a swing arm 120 which swings about a horizontal axis 121 between the closed condition ( see fig9 ) and the open condition ( see fig8 ). the arm 120 and the carried disc valve 118 are releasably retained in the open condition of the valve by engagement of the arm 120 with a latch pin 154 carried by a projection trip arm 123 . the trip arm 123 is in turn releasably retained in its position by a shock responsive mechanism 125 which is contained within a dome shaped housing cover 158 having a bulge 159 . the housing cover 158 is attached to the tubular main body 111 at annular flanges 162 which have a sealing o - ring 163 or other gasket . the housing cover 158 is retained by a circular clamp 160 typically formed of two semi - circular sections secured together at their opposite ends by fasteners such as screws , rivets , or other suitable fasteners . referring to fig8 and 10 , the shock actuated responsive mechanism 125 includes a weight or mass 136 , such as a metal ball . when the disc valve 118 is in the open position , the ball 136 is supported on a cradle 137 which extends outwardly and away from the main body 111 . the cradle 137 has a flat horizontal base plate 170 and two opposite arms 172 that extend away from the base plate 170 and attached to a vertical plate 140 which is then attached to the main body 111 by fasteners . the base plate 170 has a circular recess 139 therethrough which has contour to normally retain the ball 136 in its centered position . the ball 136 is displaceable from the centered position relative to the cradle 137 , as to the position represented in broken lines in fig9 by shock induced movement of the cradle 137 relative to the ball 136 , during which movement the inertia of the weight resists movement thereof with the cradle 137 . a horizontal cylindrical tube or pipe 142 is disposed between the two opposite arms 172 of the cradle 137 and located adjacent to the base plate 170 and is movable in a horizontal direction relative to the cradle 137 . the horizontal cylindrical tube 142 is mounted for horizontal movement by a parallelogram mechanism 143 , including a projection trip arm 123 , a first pair of parallel links 128 extending downwardly from the trip arm 123 and a second pair of parallel links 130 extending downwardly from the trip arm 123 , each pair of links pivoted at one end of the horizontal tube 142 by a horizontal pin 145 extending through a horizontal slot 146 in the horizontal cylindrical tube 142 and secured by a pair of fasteners 126 , each pair of links pivoted by a second parallel horizontal arm 147 to a pair of horizontal bracket arms 148 projecting outwardly from and attached to the vertical plate 140 and secured by a second pair of fasteners 132 . the projection trip arm 123 is located above the ball 136 . a horizontal movement of the horizontal cylindrical tube 142 causes a cross pin 154 to release the swing arm 120 for closure of the valve assembly 110 by seating the disc valve 118 by a spring force . the horizontal cylindrical tube 142 is yieldingly urged outwardly by a leaf spring or plate spring 157 which is mounted to the vertical plate 140 . when the ball 136 is moved laterally from its centered position in any horizontal direction relative to the cradle 137 , the weight engages the outer end of the horizontal cylindrical tube 142 and displaces the horizontal tube 142 horizontally relative to the cradle 137 to move the cross pin 154 carried on the projection trip arm 123 and allows horizontal swinging movement of the projection trip arm 123 to cause the disc valve 118 to close . the amount of shock or vibration force to displace the ball 136 from the circular recess 139 is determined by the shape of the recess 139 and the mass of the ball 136 . the outer end of the horizontal cylindrical tube 142 may also be beveled 164 for more controlled uniform force application by the ball 136 . the ball 136 and its associated parts are enclosed within the dome shaped housing cover 158 which is attached to and projects outwardly from the main valve body 111 . thus , the housing cover 158 effectively closes an opening 124 at the side of the main body 111 . when a shock or vibration force is experienced by the shock actuated responsive mechanism 125 , the ball 136 is displaced when such force reaches a specified value . if the force is of sufficient strength and duration , the ball 136 is urged upwardly and out of the circular recess 139 . the ball 136 rattles around within the housing cover 158 and there is no way to know which direction the ball 136 will rattle since it is in a horizontal configuration . the ball 136 might rattle directly against the outer end of the horizontal tube 142 to trip the valve assembly 110 . alternatively , it can rattle sideways against the housing cover 158 or up , front or back against the housing cover and ricochet off the housing cover to then strike the horizontal cylindrical tube 142 to trip the valve assembly . the ball 136 can rotate 360 ° in any direction , and thereby hits the housing cover 158 and then ricochets off the housing cover 158 and strikes the horizontal cylindrical tube 142 to activate the valve assembly to cover the disc valve 118 . the ball 136 thus automatically resets itself in the centered position when permitted to do so . referring to fig1 , there are shown the positions of the projection trip arm 123 and the vertical plate 140 for a vertical shock and vibration force responsive valve assembly for fluid flow from bottom to top ( see fig1 and 12 ). it will be appreciated that the positions of the projection trip arm and the vertical plate can be rotated 180 ° for fluid from top to bottom ( see fig8 and 9 ). referring to fig1 and 12 , there is shown at 210 an alternative embodiment of the present invention shock and vibration force responsive valve assembly which is adapted to automatically close off the flow of a controlled fluid such as natural gas through a conduit in response to seismic forces or other shock forces of a predetermined magnitude . this embodiment of the present invention is very similar to the embodiment just discussed above and the only difference is the nature and configuration of the projection trip arm 223 which is located underneath the ball 236 and the vertical plate 240 of the shock actuated responsive mechanism 225 . all of the parts of this embodiment are correspondingly numbered in a 200 series reference number rather than a 100 series reference number used in the embodiment just discussed above arrangement . the valve assembly 210 includes a tubular main valve body 211 having flanges 212 and 213 at its opposite ends connectable by fasteners to abutting flanges of adjacent conduit sections or pipe sections ( not shown ) to connect the main body 211 into a pipeline . it may be assumed that natural gas or another controlled fluid flows in an upward direction ( bottom to top ) as shown by the flow arrow 209 through an inner passage 216 formed in the main body 211 and parallel to a central vertical axis 217 of the inner passage 216 . the valve assembly 210 further includes a flow control mechanism which has a circular disc valve 218 engageable with an annular seat 219 formed in the main valve body 211 to close off the flow of fluid through the valve assembly 210 ( see fig1 ). the disc valve 218 is carried by a swing arm 220 which swings about a horizontal axis 221 between the closed condition ( see fig1 ) and the open condition ( see fig1 ). the arm 220 and the carried disc valve 218 are releasably retained in the open condition of the valve by engagement of the arm 220 with a latch pin 254 carried by a projection trip arm 223 . the trip arm 223 is in turn releasably retained in its position by a shock responsive mechanism 225 which is contained within a dome shaped housing cover 258 having a bulge 259 . the housing cover 258 is attached to the tubular main body 211 at annular flanges 262 which have a sealing o - ring 263 or other gasket . the housing cover 258 is retained by a circular clamp 260 typically formed of two semi - circular sections secured together at their opposite ends by fasteners such as screws , rivets , or other suitable fasteners . the shock actuated responsive mechanism 225 includes a weight or mass 236 , such as a metal ball . when the disc valve 218 is in the open position , the ball 236 is supported on a cradle 237 which extends outwardly and away from the main body 211 . the cradle 237 has a flat horizontal base plate 270 and two opposite arms that extend away from the base plate 270 and attached to a vertical plate 240 which is then attached to the main body 211 by fasteners . the base plate 270 has a circular recess 239 therethrough which has contour to normally retain the ball 236 in its centered position . the ball 236 is displaceable from the centered position relative to the cradle 237 , as to the position represented in broken lines in fig1 , by shock induced movement of the cradle 237 relative to the ball 236 , during which movement the inertia of the weight resists movement thereof with the cradle 237 . a horizontal cylindrical tube or pipe 242 is disposed between the two opposite arms 272 of the cradle 237 and located adjacent to the base plate 270 and is movable in a horizontal direction relative to the cradle 237 . the horizontal cylindrical tube 242 is mounted for horizontal movement by a parallelogram mechanism 243 , including a projection trip arm 223 , a first pair of parallel links extending upwardly from the trip arm 223 and a second pair of parallel links extending upwardly from the trip arm 223 , each pair of links pivoted at one end of the horizontal tube 242 by a horizontal pin extending through a horizontal slot in the horizontal cylindrical tube and secured by a pair of fasteners , each pair of links pivoted by a second parallel horizontal arm to a pair of horizontal bracket arms 248 projecting outwardly from and attached to the vertical plate 240 and secured by a second pair of fasteners . a horizontal movement of the horizontal cylindrical tube 242 causes a cross pin 254 to release the swing arm 220 for closure of the valve assembly 210 by seating the disc valve 218 by a spring force . the horizontal cylindrical tube 242 is yieldingly urged outwardly by a leaf spring or plate spring which is mounted to the vertical plate 240 . when the ball 236 is moved laterally from its centered position in any horizontal direction relative to the cradle 237 , the weight engages the outer end of the horizontal cylindrical tube 242 and displaces the horizontal tube 242 horizontally relative to the cradle 237 to move the cross pin 254 carried on the projection trip arm 223 and allows horizontal swinging movement of the projection trip arm 223 to cause the disc valve 218 to close . the amount of shock or vibration force to displace the ball 236 from the circular recess 239 is determined by the shape of the recess 239 and the mass of the ball 236 . the outer end of the horizontal cylindrical tube 242 may also be beveled 264 for more controlled uniform force application by the ball 236 . the ball 236 and its associated parts are enclosed within the dome shaped housing cover 258 which is attached to and projects outwardly from the main valve body 211 . thus , the housing cover 258 effectively closes an opening 224 at the side of the main body 2111 . when a shock or vibration force is experienced by the shock actuated responsive mechanism 225 , the ball 236 is displaced when such force reaches a specified value . if the force is of sufficient strength and duration , the ball 236 is urged upwardly and out of the circular recess 239 . the ball 236 rattles around within the housing cover 258 and there is no way to know which direction the ball 236 will rattle since it is in a horizontal configuration . the ball 236 might rattle directly against the outer end of the horizontal tube 242 to trip the valve assembly 210 . alternatively , it can rattle sideways against the housing cover 258 or up , front or back against the housing cover and ricochet off the housing cover to then strike the horizontal cylindrical tube 242 to trip the valve assembly . the ball 236 can rotate 360 ° in any direction , and thereby hits the housing cover 258 and then ricochets off the housing cover 258 and strikes the horizontal cylindrical tube 242 to activate the valve assembly to cover the disc valve 218 . the ball 236 thus automatically resets itself in the centered position when permitted to do so . by way of example , only the weight or ball 136 and 236 can be made of steel . referring to fig1 through 16 , there is shown at 310 another alternative embodiment of the present invention shock and vibration force responsive valve assembly which is adapted to automatically close off the flow of a controlled fluid such as natural gas through a conduit in response to seismic forces or other shock forces of a predetermined magnitude . the valve assembly 310 includes a tubular main valve body 311 having flanges 312 and 313 at its opposite ends connectable by fasteners to abutting flanges of adjacent conduit sections or pipe sections ( not shown ) to connect the main body 311 into a pipeline . it may be assumed that natural gas or another controlled fluid flows in a downward direction ( top to bottom ) as shown by the flow arrow 309 through an inner passage 316 formed in the main body 311 and parallel to a central vertical axis 317 of the inner passage 316 . the valve assembly 310 further includes a flow control mechanism which has a circular disc valve 318 engageable with an annular seat 319 formed in the main valve body 311 to close off the flow of fluid through the valve assembly 310 ( see fig9 ). the disc valve 318 is carried by a swing arm 320 which swings about a horizontal axis 321 between the closed condition ( see fig1 ) and the open condition ( see fig1 ). the arm 320 and the carried disc valve 318 are releasably retained in the open condition of the valve by engagement of the arm 320 with a latch pin 354 carried by a projection trip arm 323 . the trip arm 323 is in turn releasably retained in its position by a shock responsive mechanism 325 which is contained within a dome shaped housing cover 358 having a bulge 359 . the housing cover 358 is attached to the tubular main body 311 at annular flanges 362 which have a sealing o - ring 363 or other gasket . the housing cover 358 is retained by a circular clamp 360 typically formed of two semi - circular sections secured together at their opposite ends by fasteners such as screws , rivets , or other suitable fasteners . referring to fig1 , 16 and 17 , the shock actuated responsive mechanism 325 includes a weight or mass 336 , such as a metal ball . when the disc valve 318 is in the open position , the ball 336 is supported on a cradle 337 which extends outwardly and away from the main body 311 . the cradle 337 has a flat horizontal base plate 370 and two opposite arms 372 that extend away from the base plate 370 and attached to a vertical plate 340 which is then attached to the main body 311 by fasteners . the base plate 370 has a circular recess 339 therethrough which has contour to normally retain the ball 336 in its centered position . the ball 336 is displaceable from the centered position relative to the cradle 337 , as to the position represented in broken lines in fig1 , by shock induced movement of the cradle 337 relative to the ball 336 , during which movement the inertia of the weight resists movement thereof with the cradle 337 . a trip fork mechanism 342 is disposed between the two opposite arms 372 of the cradle 337 and located adjacent to the base plate 370 and is movable in a horizontal direction relative to the cradle 337 . the trip fork 342 comprises a semi - circular base member 341 which is contoured at an angle “ a ” relative to the horizontal . the angle “ a ” is preferably 45 degrees although any angle from 15 degrees to 75 degrees will function with the alternative embodiment of the present invention . the trip fork 342 further comprises a pair of spaced apart parallel vertical walls 351 and 353 having openings 346 therethrough . the trip fork mechanism 342 is mounted for horizontal movement by a movable mechanism which by way of example is a parallelogram mechanism 343 , including a projection trip arm 323 , a first pair of parallel links 328 extending downward from the trip arm 323 and a second pair of parallel links 330 extending downwardly from the trip arm 323 , each pair of links pivoted on the vertical walls 351 and 353 of the trip fork mechanism 342 by a horizontal pin 345 extending through the horizontal openings 346 in the vertical walls 351 and 353 of the trip fork mechanism 342 and secured by a pair of fasteners 326 , each pair of links pivoted by a second parallel horizontal arm 347 to a pair of horizontal bracket arms 348 projecting outwardly from and attached to the vertical plate 340 and secured by a second pair of fasteners 332 . the projection trip arm 323 is located above the ball 336 . a horizontal movement of the trip fork mechanism 342 causes a cross pin 354 to release the swing arm 320 for closure of the valve assembly 310 by seating the disc valve 318 by a spring force . the trip fork mechanism 342 is yieldingly urged outwardly by a leaf spring or plate spring 357 which is mounted to the vertical plate 340 by rivets 359 . when the ball 336 is moved laterally from its centered position in any horizontal direction relative to the cradle 337 , the weight engages the base member 341 of the trip fork mechanism 342 and the contoured surfaced of the base member 341 enables both the weight and acceleration of the ball 336 to act on the trip fork mechanism 342 to cause the trip fork mechanism to be displaced in a horizontal direction and thereby move the cross pin 354 carried on the projection trip arm 323 and allows horizontal swinging movement of the projection trip arm 323 to cause the disk valve 318 to close . the amount of shock or vibration force to displace the ball 336 from the circular recess 339 is determined by the shape of the recess 339 and the mass of the ball 336 . as illustrated in fig1 , there is a gap between the horizontal base 341 of trip fork mechanism 342 and the ball 336 and the semi - circular shape of the contoured horizontal base 341 further facilitates action of the ball 336 to hit the trip fork mechanism 342 . the contoured angle “ a ” preferably at 45 degrees further facilitates activation of the trip fork mechanism 342 by both the acceleration and weight of the ball 336 coming in contact with the contoured surface set at an angle “ a ” of base mechanism 341 . the ball 336 and its associated parts are enclosed within the dome shaped housing cover 358 which is attached to and projects outwardly from the main valve body 311 . thus , the housing cover 358 effectively closes an opening 324 at the side of the main body 311 . when a shock or vibration force is experienced by the shock actuated responsive mechanism 325 , the ball 336 is displaced when such force reaches a specified value . if the force is of sufficient strength and duration , the ball 336 is urged upwardly and out of the circular recess 339 . the ball 336 rattles around within the housing cover 358 and there is no way to know which direction the ball 336 will rattle since it is in a horizontal configuration . the ball 336 might rattle directly against the base member 341 of the trip fork mechanism 342 to trip the valve assembly 310 . alternatively , it can rattle sideways against the housing cover 358 or up , front or back against the housing cover and ricochet off the housing cover to then strike the base member 341 of trip fork mechanism 342 to trip the valve assembly . the ball 336 can rotate 360 ° in any direction , and thereby hits the housing cover 358 and then ricochets off the housing cover 358 and strikes the trip fork mechanism 342 to activate the valve assembly to cover the disc valve 318 . the ball 336 thus automatically resets itself in the centered position when permitted to do so . referring to fig1 , 19 and 20 , there is shown at 410 an alternative embodiment of the present invention shock and vibration force responsive valve assembly which is adapted to automatically close off the flow of a controlled fluid such as natural gas through a conduit in response to seismic forces or other shock forces of a predetermined magnitude . this embodiment of the present invention is very similar to the embodiment just discussed above and the only difference is the nature and configuration of the projection trip arm 423 which is located underneath the ball 436 and the vertical plate 440 of the shock actuated responsive mechanism 425 . all of the parts of this embodiment are correspondingly numbered in a 400 series reference number rather than a 300 series reference number used in the embodiment just discussed above . the valve assembly 410 includes a tubular main valve body 411 having flanges 412 and 413 at its opposite ends connectable by fasteners to abutting flanges of adjacent conduit sections or pipe sections ( not shown ) to connect the main body 411 into a pipeline . it may be assumed that natural gas or another controlled fluid flows in an upward direction ( bottom to top ) as shown by the flow arrow 409 through an inner passage 416 formed in the main body 411 and parallel to a central vertical axis 417 of the inner passage 416 . the valve assembly 410 further includes a flow control mechanism which has a circular disc valve 418 engageable with an annular seat 419 formed in the main valve body 411 to close off the flow of fluid through the valve assembly 410 ( see fig1 ). the disc valve 418 is carried by a swing arm 420 which swings about a horizontal axis 421 between the closed condition ( see fig1 ) and the open condition ( see fig1 ). the arm 420 and the carried disc valve 418 are releasably retained in the open condition of the valve by engagement of the arm 420 with a latch pin 454 carried by a projection trip arm 423 . the trip arm 423 is in turn releasably retained in its position by a shock responsive mechanism 425 which is contained within a dome shaped housing cover 458 having a bulge . the housing cover 458 is attached to the tubular main body 411 at annular flanges 462 which have a sealing o - ring 463 or other gasket . the housing cover 458 is retained by a circular clamp typically formed of two semi - circular sections secured , together at their opposite ends by fasteners such as screws , rivets , or other suitable fasteners . the shock actuated responsive mechanism 425 includes a weight or mass 436 , such as a metal ball . when the disc valve 418 is in the open position , the ball 436 is supported on a cradle 437 which extends outwardly and away from the main body 411 . the cradle 437 has a flat horizontal base plate 470 and two opposite arms that extend away from the base plate 470 and attach to a vertical plate 440 which is then attached to the main body 411 by fasteners . the base plate 470 has a circular recess 439 therethrough which has contour to normally retain the ball 436 in its centered position . the ball 436 is displaceable from the centered position relative to the cradle 437 , as to the position represented in broken lines in fig1 , by shock induced movement of the cradle 437 relative to the ball 436 , during which movement the inertia of the weight resists movement thereof with the cradle 437 . a trip fork mechanism 442 is disposed between the two opposite arms 472 of the cradle 437 and located adjacent to the base plate 470 and is movable in a horizontal direction relative to the cradle 437 . the trip fork mechanism 442 comprises a semi - circular base member 441 which is contoured at an angle “ a 1 ” relative to the horizontal . the angle “ a 1 ” is preferably 45 degrees although any angle from 15 degrees to 75 degrees will function with the alternative embodiment of the present invention . the trip fork mechanism 442 further comprises a pair of spaced apart parallel vertical walls 451 and 453 having openings 446 therethrough . referring to fig2 , the trip fork mechanism 442 is mounted for horizontal movement by a movable mechanism which by way of example is a parallelogram mechanism 443 including a projection trip arm 423 , a first pair of parallel links 426 and 428 extending upwardly from the trip arm 423 and a second pair of parallel links 430 extending upwardly from the trip arm 423 , each pair of links respectively pivoted at one end vertical walls 451 and 453 by a horizontal pins 445 extending through the horizontal openings 446 and secured by a pair of fasteners 426 , each pair of links pivoted by a second pair of pins 447 to a pair of horizontal bracket arms 448 projecting outwardly from and attached to the vertical plate 440 and secured by a second pair of fasteners 432 . a horizontal movement of the trip fork mechanism 442 causes a cross pin 454 to release the swing arm 420 for closure of the valve assembly 410 by seating the disc valve 418 by a spring force . the trip fork mechanism 446 is yieldingly urged outwardly by a leaf spring or plate spring 457 which is mounted by rivets to the vertical plate 440 . when the ball 436 is moved laterally from its centered position in any horizontal direction relative to the cradle 437 , the weight engages the semi - circular base member 441 of trip fork mechanism 442 and the angle “ a 1 ” further enables the inertia as well as the weight of the ball to act upon the ball 436 to act upon the trip fork mechanism 446 and causes the trip fork mechanism 442 to move horizontally relative to the cradle 437 and move the cross pin 454 carried on the projection trip arm 423 and allows horizontal swinging movement of the projection trip arm 423 to cause the disc valve 418 to close . the amount of shock or vibration force to displace the ball 436 from the circular recess 439 is determined by the shape of the recess 439 and the mass of the ball 436 . the ball 436 and its associated parts are enclosed within the dome shaped housing cover 458 which is attached to and projects outwardly from the main valve body 411 . thus , the housing cover 458 effectively closes an opening 424 at the side of the main body 411 . when a shock or vibration force is experienced by the shock actuated responsive mechanism 425 , the ball 436 is displaced when such force reaches a specified value . if the force is of sufficient strength and duration , the ball 436 is urged upwardly and out of the circular recess 439 . the ball 436 rattles around within the housing cover 458 and there is no way to know which direction the ball 436 will rattle since it is in a horizontal configuration . the ball 436 might rattle directly against the ball member 441 of trip fork mechanism 442 to trip the valve assembly 410 . alternatively , it can rattle sideways against the housing cover 458 or up , front or back against the housing cover and ricochet off the housing cover to then strike the trip fork mechanism 442 to trip the valve assembly . the ball 436 can rotate 360 ° in any direction , and thereby hits the housing cover 458 and then ricochets off the housing cover 458 and strikes the trip fork mechanism 442 to activate the valve assembly to cover the disc valve 418 . the ball 436 thus automatically resets itself in the centered position when permitted to do so . by way of example , only the weight or ball 436 can be made of steel . defined in detail , the present invention is a vertical shock actuated valve assembly adapted to automatically close off the flow of a controlled fluid through a conduit in response to a shock or vibration force of a predetermined magnitude and having a shock actuated responsive mechanism comprising : ( a ) a cradle having a horizontal base plate and a pair of arms extending away from the horizontal base plate and opposing each other and attached to a vertical plate which in turn is attachable to a main body of said valve assembly , the horizontal base plate having a central circular bore therethrough in which a weight in the form of a ball is supported and retained thereon ; ( b ) a parallelogram mechanism including a projection trip arm , a first pair of parallel links extending from said trip arm and a second pair of parallel arms extending from said trip arm , the parallelogram mechanism movably attached to the valve assembly by pin means extending through said first and second parallel links ; ( c ) a trip fork mechanism having a contoured semi - circular base member and a pair of spaced apart vertical walls by which the trip fork mechanism is secured between said first and second pairs of parallel links of said parallelogram mechanism by pin means , the trip fork mechanism located adjacent to said horizontal base plate such that the contoured semi - circular base member faces said ball ; and ( d ) a housing cover enclosing said ball , said cradle , said parallelogram mechanism , and said trip fork mechanism so that when said ball is moved out of said central circular bore and retained on said horizontal base plate by the housing cover and rattles around and ricochets off the interior of the housing cover , the ball thereby strikes said contoured semi - circular base member of said trip fork mechanism to cause a cross pin to release a swing arm to cause a valve member to move against a valve seat and thereby activate said valve assembly to stop the flow of the fluid therethrough . defined broadly , the present invention is a vertical shock actuated valve assembly having valve closing means and adapted to automatically close off the flow of a fluid through a conduit in response to a shock or vibration force of a predetermined magnitude and having a shock actuated responsive mechanism comprising : ( a ) a cradle having a horizontal plate and at least two arms extending away from the horizontal plate and attached to a vertical plate which in turn is attachable to a main body of said valve assembly , the horizontal plate having a central bore therethrough in which a weight is supported and retained thereon ; ( b ) a parallelogram mechanism including a projection trip arim having attachment means extending therefrom , the parallelogram mechanism movably attached to the valve assembly by said attachment means ; ( c ) a trip fork mechanism having a base member and a pair of spaced apart vertical walls by which the trip fork mechanism is secured between said attachment means of said parallelogram mechanism , the trip fork mechanism located adjacent to said horizontal base plate such that the base member faces said weight ; and ( d ) a cover enclosing said weight , said cradle , said parallelogram mechanism , and said trip fork mechanism so that when said weight is moved out of said central bore and retained on said horizontal plate by the cover and rattles around and ricochets off the interior of the cover , the ball thereby strikes said base member of said trip fork mechanism to activate valve closing means of said valve assembly to stop the flow of the fluid therethrough . defined more broadly , the present invention is a vertical shock actuated valve assembly having a valve closing means and having a shock actuated responsive mechanism comprising : ( a ) a horizontal plate having a bore therethrough in which a weight is supported and retained centrally on the horizontal plate , the horizontal plate attached to the valve assembly ; ( b ) a movable mechanism movably attached to the valve assembly ; ( c ) a trip fork mechanism having a base member and a pair of spaced apart vertical walls by which the trip fork mechanism is movably attached to said movable mechanism , the trip fork mechanism located adjacent to said horizontal base plate such that the base member faces said weight ; and ( d ) a cover enclosing said weight , said horizontal plate , said movable mechanism , and said trip fork mechanism so that when said weight is moved out of said central bore and retained on said horizontal plate by the cover and rattles around and ricochets off the interior of the cover , the ball thereby strikes said base member of said trip fork mechanism to activate the valve closing means of said valve assembly to stop the flow of the fluid therethrough . defined even more broadly , the present invention is a shock actuated valve assembly having a shock actuated responsive mechanism comprising : ( a ) a horizontal plate having a bore therethrough in which a weight is supported and retained centrally on the horizontal plate , the horizontal plate attached to the valve assembly ; ( b ) a movable mechanism movably attached to the valve assembly ; ( c ) a trip fork mechanism having a base member and means to movably attach the trip fork mechanism to said movable mechanism , the trip fork mechanism located adjacent to the horizontal base plate such that the base member faces said weight ; and ( d ) a cover enclosing said weight , said horizontal plate , said movable mechanism , and said trip fork mechanism so that when said weight is moved out of said central bore and retained on said horizontal plate by the cover and rattles around and ricochets off the interior of the cover , the weight thereby strikes said base member of said trip fork mechanism to activate said valve assembly to stop the flow of the fluid therethrough . further defined more broadly , the present invention is a vertical shock actuated valve assembly adapted to automatically close off the flow of a controlled fluid through a conduit in response to a shock or vibration force of a predetermined magnitude and having a shock actuated responsive mechanism comprising : ( a ) horizontal plate having a bore therethrough in which a weight is supported and retained centrally on the horizontal plate , the horizontal plate attached to the valve assembly ; ( b ) a movable mechanism movably attached to the valve assembly ; and ( c ) a trip fork mechanism having a base member and means to movably attach the trip fork mechanism to said movable mechanism , the trip fork mechanism located adjacent to the horizontal base plate such that the base member faces said weight ; ( d ) whereby when the shock or vibration force is experienced by said shock actuated responsive mechanism , said ball is displaced when such force reaches the predetermined magnitude causing said ball to roll out of said bore to strike said trip fork mechanism to cause the trip fork mechanism to move in a horizontal direction to thereby actuate and close said valve assembly to stop the flow of the fluid therethrough . further defined even more broadly , the present invention is a shock actuated valve having a shock responsive mechanism comprising : ( a ) a horizontal plate having a bore therethrough in which a weight is supported and retained centrally on the horizontal plate and means for attaching to a main body of said shock actuated valve ; and ( b ) a trip fork mechanism having at least a portion located adjacent to said weight ; ( c ) whereby when the shock or vibration force is experienced by said shock responsive mechanism , said weight is displaced when such force reaches the predetermined magnitude causing said weight to move out of said bore to strike said trip fork mechanism and cause it to move in a horizontal direction to thereby actuate and close said shock actuated valve to stop the flow of the fluid therethrough . of course the present invention is not intended to be restricted to any particular form or arrangement , or any specific embodiment , or any specific use , disclosed herein , since the same may be modified in various particulars or relations without departing from the spirit or scope of the claimed invention hereinabove shown arid described of which the apparatus or method shown is intended only for illustration and disclosure of an operative embodiment and not to show all of the various forms or modifications in which this invention might be embodied or operated . the present invention has been described in considerable detail in order to comply with the patent laws by providing full public disclosure of at least one of its forms . however , such detailed description is not intended in any way to limit the broad features or principles of the present invention , or the scope of the patent to be granted . therefore , the invention is to be limited only by the scope of the appended claims . | 8 |
one embodiment of the invention is an apparatus for compressing molding sand comprising a pipe device 1 with a top surface and a bottom surface and provided with a plurality of compressed gas pipes 9 that run therethrough and are provided with openings on the top surface and the bottom surface , a compressed gas container 18 that communicates with the openings on the top surface of said compressed gas pipes 9 , an opening valve 10 provided at each of the openings of the top surface of said compressed gas pipes 9 to close or open said openings by adjusting pressure working on the valve , the pressure being independent of the pressure of the compressed gas within the container 18 , and a control valve 16 operatively connected to each of the opening valves 10 to open them by reducing the pressure working on the opening valve to a level that is lower than the pressure of the compressed gas within the container 18 . by using this device , the different parts of the mold provided within the molding frame can be independently compressed to different degrees . therefore , even of the model is complex in shape , the most preferred local compression will be caused . as needed , the strength of various parts of the mold can be freely selected from various choices . thus , the mold can be released from the model without any adverse effect on the mold . any damage caused from separation of the mold from the model , such as a protruding part of the mold that corresponds to a pocket section of the model breaking , can be definitely avoided . by this invention , the energy consumed for compression can be greatly reduced compared to the prior art . this effect is cause by controlling the pressure of the compressed gas blown onto the parts of the molding sand , wherein no strong compression rate is required . in a most effective sample of this invention , a plurality of or a group of openings are orderly controlled by different strengths of compressed gas , and this causes a uniform compression throughout the process , and the level of the pressure inside the mold can be controlled to various degrees . when each compressed gas opening that is provided on an opening area or on an end of each compressed gas pipe is controlled by the operation of a valve piston , it becomes very easy to control parts of or entire openings . thus , the openings can be effectively and easily adjusted . preferably , when each opening or a group of openings are controlled by various pressures , or by various volumes and flow rates of compressed gas , or both , the method of this invention will assure unrestricted variations of the degree of compression in different parts and in wide ranges . unexpectedly , using a plurality of lightweight valve pistons of this invention enables the entire compression to be carried out in various , and in a wide range of , ways , because lightweight valves have a high mobility . also , if the valves are lighter , the noise caused by the apparatus can also be reduced . clearly , all the valves can also be simultaneously operated in the same way . it might be easily considered that a mold can be produced by merely controlling the compressed gas openings by using compressed gas and compressing molding sand thereby . however , using squeezing members in addition to such a device will be highly effective and increase the degree of compression . when squeezing members are used , it is preferable to operate the squeezing members while , or after , the gas blowing from the openings for compressed gas is controlled . this not only causes the squeezing members to carry out fine pre - compression of the molding sand to a predetermined degree , but also enables a subsequent compression step to be carried out by the use of squeezing members driven by oil pressure , which can generate high pressure . in a simple form , all the squeezing members are uniformly designed and operated in the same way . by this , the squeezing members can apply uniform compression to the mold . however , to accelerate applying various degrees of compression to various parts of the mold by controlling the degree of compression by the compression gas , each squeezing member or a group of squeezing members are preferably arranged to generate independent compression . to make a mold that precisely conforms to the model , it is considered to adjust the compressed gas openings that correspond to the parts that are difficult to produce a mold , independently of the other openings . however , it is most preferable to enlarge the range of compression by the apparatus of this invention and to independently control the compression gas blown from each opening . by doing so , the device of this invention can provide preferable compression to the parts near edges of , or to any relevant parts of , the mold . effective embodiments of this invention can decrease the cost and simply the structure of the compression apparatus . at least one opening valve to control the compressed gas is provided on the parts of openings or the pipes of the openings that are controlled by those opening valves independently . it is most preferable if compressed gas openings are provided with opening valves at the opening areas or at compressed gas pipes . this will enable flexible use of the apparatus according to the required conditions . it is preferable for the safety of the construction and motion of the valves to provide a controllable valve piston for each opening valve . according to the most preferable embodiment of this invention , each valve piston contains an inclined ring surface at a transitional section between its side wall and a piston head facing the exhaust side of the valve . this results in the smooth control of the valves by controlling the inner spaces of the valve pistons to have a lower pressure than the pressure maintained by compression gas ports ( each gas port is preferably a pressure container provided around each , or around a part of each , opening valve ). the effect caused by the compressed gas acting on the ring surface at the external surface of the piston results in an easy and quick opening of each valve . as the ring surface at the external edge of the valve piston head is inclined , when the gas in the inner space of the valve piston is discharged while the valve is subjected to the compressed gas the valve readily opens . if the surface of the head of the valve piston facing the exhaust side of the valve is shaped so that the area between the outermost end of the head and the periphery of the head is concave , the outermost end of the head being symmetrically positioned relative to the center of the piston , a laminar flow of the compressed gas will be caused through the compressed gas openings . according to another preferred embodiment of this invention , each squeezing member can be independently controlled to carry out the suitable degree of compression corresponding to the purpose predetermined for the model . furthermore , in addition to the pressure containers provided above the pipe device and commonly communicating with the plurality of openings at the top edges of compressed gas pipes , one or a plurality of independent pressure containers can be provided so that they are made to communicate with one or a few compressed gas pipes . each added pressure container can be operatively connected to opening valves communicating with control valves that reduce pressure to cause a lower pressure at the space within the opening valves than that of the main pressure container . by using such a structure , just the four corners of the molding frame , for instance , can be compressed independently of the remaining parts of the mold . this invention has a plurality of embodiments . below , this invention is explained by referring to the attached drawings . fig1 is a cross - sectional view of the apparatus of an embodiment of this invention for compressing molding sand , viewed from one side of the apparatus . fig2 is an enlarged view of the valve piston of fig1 . as shown in fig1 the apparatus of this embodiment comprises a model plate 3 on which the model 4 is provided . model 4 ( sometimes referred to as a pattern ) is provided inside the molding frame 6 ( sometimes referred to as a flask ) that is also provided on the model plate 3 ( sometimes referred to as a pattern plate ). molding sand 5 , which is placed within the molding frame or flask 6 , surrounds the model 4 . the model plate 3 comprises an exhaust vent 2 at an area near an edge of the plate . a chamber 22 of a pipe device 1 is provided above a filling frame 21 that is provided above the molding frame 6 . the molding sand 5 can be placed within the filling frame 21 and the molding frame 6 . the chamber 22 is provided above the filling frame 21 in a pressure - sealed condition . the filling frame 21 is also connected to the modeling frame 6 and model plate 3 in a pressure - sealed condition . the chamber 22 communications , for example , with a pressure container 18 that is filled with compressed gas , such as compressed air , at an end opposite to the end that faces the filling frame 21 and molding frame 6 . the pressure container 18 adjoins the squeezing device 1 . the pipe device 1 comprises compressed gas pipes 9 ( sometimes referred to as gas guiding pipes ), each provided with a compressed gas opening 7 and a squeezing member 8 , and a plurality of squeezing mechanisms comprising plunger pistons that are not shown in the drawing . compressed gas is directly supplied from the pressure container 18 into the compressed gas pipes 9 . in doing so , opening valves 10 , which are provided at the bottom part of the pressure container 18 , control the flow of the compressed gas from the openings 7 . each opening valve 10 comprises a valve piston 11 that is pneumatically controlled by a control valve 16 through a controlling pipe 17 . the valve pistons 11 can be controlled independently from one another . to clearly explain the structure of the opening valve 10 , fig2 shows enlarged details of the opening valve shown in fig1 . in fig2 the valve piston 11 is u - shaped in cross section and comprises a side wall 12 and a bottom section 15 . the transitional section between the side wall 12 and the bottom section 15 forms an inclined ring surface 13 [ 18 ]. the bottom surface 14 faces toward the exhaust side of the valve 10 and is shaped concavely and converges to the lowest section 25 of the valve piston 11 . it is preferable to place the pipe device 1 so as to be able to have it be slidably adjusted in a vertical direction , so that the pipe device 1 can be placed on top of the filling frame 21 and be removed after compression is completed . providing the pipe device 1 on the filling frame 21 before the squeezing process occurs will cause a tight connection between the pipe device 1 , filling frame 21 , molding frame 6 , and model plate 3 . this tight connection forms a pressure - seal between them . by using the control valves 16 and controlling pipes 17 to decrease pressure within the inner space 26 of each valve piston 11 to a level lower than the pressure in the pressure container 18 , the valve pistons 11 of the valves 10 are lifted so as to open those valves . in doing so , compressed gas that acts on the inclined ring surfaces 13 enables the valves 10 to open quickly . since each of the valves 10 connects to the control valves 16 through controlling pipes , if the control valves 16 can be controlled independently of one another , compressed gas will be blown from specific compressed gas openings 7 to the parts of the molding sand to cause a predetermined degree of compression . for example , it is feasible , by program control , to determine the compression process by predetermining the position , the lengths of time , and sequence of the flows of compressed gas from the openings 7 , thereby enabling purposeful compression . the valves 10 can have different opening strokes . for example , by starting to blow compressed gas from the openings of the valves 10 having smaller opening strokes , and thereafter switching to open the valves 10 having larger opening strokes , the rising gradient of compression can be at first gradual , and then become increasingly steep . in contrast , if the valves having a uniform opening stroke are opened one by one , the compression gradient will be linear . when all the openings are opened simultaneously to attain a high ratio of compression , it is preferable to design the compression gas pipes 9 and compression gas openings 7 to cause the rise of the compression ratio within the space in the mold . the compressed gas blown out from the openings 7 compresses the molding sand 5 . thereafter it will be discharged through an exhaust vent 2 in the model plate 3 . after the compressed gas is discharged , squeezing members 8 of the squeezing mechanisms can be used to further compress the molding sand 5 . in doing so , the squeezing members 8 will compress all the molding sand 5 . in the case where compressed gas continues to be blown from the compressed gas openings 7 when the process of compression by squeezing members is carried out , it is preferable to provide squeezing members 8 , each having a large surface area for compression . this is because the effect of squeezing will be greater by the additional compression from the compressed gas on a larger rear surface of the squeezing members provided by expanding the surface area . in contrast , to carry out a uniform compression process with a relatively low degree of compression , it may be effective to eliminate the compression by the squeezing mechanisms and only use compression by gas from as many compressed gas openings 7 as possible . as is clear from the above explanation of this invention , by using compressed gas separated by compressed gas ports , this invention controls one or a group of the compressed gas pipes that are provided on substantially the entire surface of the molding sand . the apparatus of this invention also compresses the molding sand located in areas corresponding to the compressed gas pipes by using the compressed gas blown from those pipes . thus , different parts in the molding sand within the entire mold can be compressed to various degrees . this invention also enables various parts of the mold within the molding frames to be compressed independently . as clear from the above , even if the mold is complex in shape , this invention can cause a most appropriate compression for appropriate parts of the mold . according to the compression degree needed , the strength of the model can be controlled to fulfill the required degree for various parts . this degree can be freely selected from a wide range of strengths provided by this invention . therefore , releasing the mold from the model can be readily done , and damage to the protruding parts of the mold corresponding to the pocket section of the model can be certainly avoided . these are the superior effects provided by this invention , and they will have a large impact in the industry this invention belongs to . | 1 |
as used herein , all parts , percentages , ratios and proportions are on a weight basis unless otherwise stated herein or otherwise obvious herefrom to one skilled in the art . as used herein , all temperatures are in degrees fahrenheit unless otherwise stated herein or otherwise obvious herefrom to one skilled in the art . the dog biscuits can be made from any suitable dough , which is modified as described herein to provide nutritionally - balanced dog biscuits containing pyrophosphate . any suitable dough comprising at least one flour , meal , fat and water can be employed for the coated product . for instance , when the desired product is a canine biscuit , a conventional dough for dog biscuits can be used , optionally containing discrete particles of meat and / or meat byproducts or farinaceous material . such doughs typically contain fat solids . examples of suitable doughs for the production of hard dog biscuits are disclosed in u . s . pat . no . 4 , 454 , 163 , and suitable doughs for the production of soft dog biscuits ( containing humectant to control water activity ) are disclosed in u . s . pat . no . 4 , 454 , 164 . the pertinent portions of u . s . pat . nos . 4 , 454 , 163 and 4 , 454 , 164 are incorporated herein by reference . particulate proteinaceous particles , such as particles of meat , texturized vegetable protein and / or meat byproducts can be incorporated to add flavor to the biscuits and texturize the surface . particulate farinaceous materials such as bran particles can also be employed to texturize the surface of the biscuits and to provide other useful properties to the product . a dough found to produce biscuits highly palatable to dogs includes suitable proportions of wheat flour , wheat meal , soybean meal , meat and bone meal , animal fat and natural flavors in admixture with water . the meal used in the doughs suitable for production of biscuits useful in the invention can comprise meat and / or bone and / or vegetable matter including farinaceous materials , materials prepared from legumes such as beans and peas , tuberous materials such as potato meal , and the like . the meals can be finely or coarsely ground as desired for the texture . flours made from any suitable farinaceous material can be used . the doughs generally have a water activity of about 0 . 90 and above upon completion of mixing of the dough ingredients . a suitable dough contains farinaceous material , an edible oil , an antioxidant , an antimycotic , salt , animal fat , added vitamins and minerals , such as those disclosed in u . s . pat . no . 4 , 229 , 485 , column 5 , lines 7 to 57 , which is incorporated herein by reference . the compositions of the invention also preferably contain at least one animal - derived proteinaceous meal such as meat meal , bone meal , and fish meal . a good biscuit dough for producing the biscuits of the invention contains about 50 to 60 percent by weight wheat flour , about 5 to 10 percent by weight soybean meal , about 3 to 10 percent by weight meat and bone meal , about 1 to 5 percent wheat meal , about 1 to 5 percent animal fat preserved with bha , about 20 to 30 percent by weight water , and about 2 to 5 percent by weight of natural flavors , vitamin and mineral preblend , and acidulant . the dough can also contain suitable surfactants or emulsifying agents , e . g ., which are best used in minor amounts . the dog biscuit dough can be mixed using any suitable or conventional equipment . for example , the mixing can be at 20 to 100 rpm . for example , a dry blending step can be done typically at room temperature for a period of time of about 3 minutes to about 10 minutes . the dry - blended mixture can then be mixed with the hot water to form a first stage dough . the water which can be admixed with the dry - blended mixture is typically at a temperature of about 65 ° to about 150 ° f . the hot water can be added , with mixing , over a period of time of about 3 minutes to about 5 minutes to form the first stage dough . then , the fat portion of the biscuit dough can be admixed with the first stage dough to form the final stage dough . the fat portion can be added at a temperature at which it is at least fluid , typically at about 100 ° to about 150 ° f . the fat portion can be mixed for a period of time which is sufficient to form a dough whose homogeneity is visually apparent . a typically final mixing time is about 3 to about 5 minutes . formation of the dough is usually achieved at about atmospheric pressure with mixing of the components being conveniently achieved in an upright sigma blade mixer or other bakery - type mixers . the various ingredients can be added over a period of time or in a one - shot manner according to the above order of addition . however , melted fat and water can be added simultaneously and mixed from 6 to 10 minutes . the dog biscuits are formed in any conventional or suitable manner , such as , by extrusion , stamping , cutting or molding . any suitable dog biscuit shapes can be used , such as , a bone - shaped canine biscuit . for many products , such as , the bone - shaped canine biscuits of the invention , a rotary molding system is preferred because it permits the rapid forming of dough pieces with good control over their shape , form and surface characteristics . docker holes are preferbly formed in the dough piece during molding to facilitate the escape of moisture during baking . the dough can be then formed into pieces by machining on a rotary molder with specific die shapes . the dough can also be formed into pieces by sheeting followed by either a vertical or rotary cutter or by a rotary molder . suitable die and cutter shapes are those which result in a round , square , triangular , t - bone or chop - shaped biscuit product and the like . the forming is achieved at conventional temperatures of ambient to 110 ° f . and pressures of less than 75 p . s . i . ( gauge ), used with a rotary molder , a vertical cutter or rotary cutter . the solvent used in the coating is preferably water , but other non - toxic , edible solvents , such as , ethanol or ethanol / water , can be used . the problem of the necessity of solvent removal from the coated dough due to toxicity is to be avoided in most cases . if a mixture of ethanol and water is used , the amount of ethanol in the mixture is generally about 5 to about 60 percent , preferably about 5 to about 25 percent . when one or more of the inorganic pyrophosphates is not water soluble , it may be ethanol soluble . the invention includes the use of at least one inorganic pyrophosphate . preferably the inorganic pyrophosphates are water soluble . a mixture of inorganic pyrophosphates can be used to provide a desired ph . the use of a water insoluble inorganic pyrophosphate , by itself or in a mixture , ( along with the other water insoluble ingredients ) results in a slurry . the use of very fine particles of a water insoluble inorganic pyrophosphate provides better suspension in the coating formulation . the inorganic pyrophosphates are preferably alkali metal pyrophosphates . the preferred alkali metal pyrophosphate is tetrasodium pyrophosphate and tetrapotassium pyrophosphate . an example of useful tetraalkali metal pyrophosphates is tetralithium pyrophosphates . alkaline earth metal pyrophosphates are also useful , but they are generally insoluble in water . preferably the inorganic pyrophosphates are soluble in water . the formula m n + 2 p n o 3n + 1 , where m is a univalent metal , is the formula for univalent metal pyrophosphates when n is 2 . the formula m &# 39 ; n p n o 3n + 1 , where m , is a divalent metal , is the formula for divalent metal pyrophosphates when n is 2 . such univalent metal pyrophosphates and divalent metal pyrophosphates can be used in the invention . polyphosphates have the formula m n + 2 p n o 3n + 1 or m &# 39 ; n p 2 o 3n + 1 , where n is 2 , 3 , 4 , 5 , . . . , and the oxide ratio r between the cationic oxides ( m 2 o or m &# 39 ; o ) and anionic oxides ( p 2 o 5 ) is between 1 and 2 . the oxide ratio for pyrophosphate is 2 . generally 0 . 1 to 10 weight percent , advantageously about 0 . 5 to about 5 weight percent and preferably about 1 . 5 to about 3 weight percent of inorganic pyrophosphate is used . kirk + othmer , &# 34 ; encyclopedia of chemical technology &# 34 ;, 2nd ed ., vol . 15 , ( 1965 ), pages 232 to 276 , discloses a number of water - soluble inorganic pyrophosphate salts . the pertinent portions of kirk + othmer , &# 34 ; encyclopedia of chemical technology &# 34 ;, 2nd ed ., vol . 15 , ( 1965 ), pages 232 to 276 , are incorporated herein by reference . examples of dialkaline metal pyrophosphates are dicalcium pyrophosphate , dibarium pyrophosphate , and dimagnesium pyrophosphate . trialkali metal monoacid pyrophosphates , such as , trisodium hydrogen pyrophosphate ( sapp ), can be used . monoalkali metal triacid pyrophosphates , such as , sodium trihydrogen pyrophosphate , can also be present in limited amounts . examples of other inorganic pyrophosphates include dimanganese pyrophosphate and dizinc pyrophosphate . tetrasodium pyrophosphate , one part , is soluble in 13 parts of cold water and in 2 . 5 parts of boiling water . it is insoluble in ethanol . dicalcium pyrophosphate is practically insoluble in water . the invention use of the term &# 34 ; solution &# 34 ; includes slurries , suspensions and the like . tetrapotassium pyrophosphate is freely soluble in water and is insoluble in ethanol . the invention product does not include any fluorine - containing compound or other fluoride ion source , or quaternary ammonium compounds . the invention does not include organic acid pyrophosphates . more preferably a mixture of trisodium monoacid pyrophosphate and tetrapotassium pyrophosphate is used ( in a ratio to achieve the desired ph ). the maximum allowable gras level in the u . s . in a composition for sodium acid pyrophosphate ( sapp ) is 2 . 1 weight percent and for tetrapotassium pyrophosphate ( tkpp ) or tetrasodium pyrophosphate ( tspp ) 1 . 4 weight percent in baked goods . if gras levels change ( rise ) or if higher levels are allowed by the regulatory agencies , higher levels can be used in the invention . tspp delivers about 65 . 4 percent by p 2 o , tkpp delivers about 52 . 65 percent of p 2 o 7 and sapp delivers about 78 . 36 percent of p 2 o 7 . the preferred invention coating contains trisodium monoacid pyrophosphate and tetrapotassium pyrophosphate in a weight ratio of about 60 to about 40 . the pyrophosphate ( s ) is used in sufficient amount to deliver generally from about 0 . 1 to about 5 , preferably from about 3 . 5 , most preferably 1 . 4 to 2 . 5 weight percent ( based on the total composition ), of p 2 o 7 . a study of the application of aqueous solutions of a mixture of tetrasodium pyrophosphate and sodium acid pyrophosphate to the teeth of dogs by spraying for one mouth resulted in dose response data . the aqueous solutions containing 5 and 3 weight percent of a mixture of tetrasodium pyrophosphate and sodium acid pyrophosphate resulted in significant reductions in tartar accumulation . the aqueous solutions containing 1 . 5 and 0 . 5 weight percent of such mixture resulted in directional trends of reductions in tartar accumulation . see also u . s . pat . no . 3 , 323 , 551 . the ratio of sodium acid pyrophosphate ( sapp ) to tetrapotassium pyrophosphate ( tkpp ) is between 4 to 1 and 3 to 7 , preferably between 7 to 3 and 1 to 1 , most preferably about 3 to about 2 . sapp has a ph of 4 . 2 and tkpp ( and tspp ) has a ph of 10 . 2 , so the combination of sapp and tkpp ( or tspp ) provides a resultant ph which is a balance of the phs of the two components . the ph of the coating solution of at least one inorganic pyrophosphate salt ( and baked , coated dog biscuit ) is generally in the range of about 4 to about 10 . 5 , typically from about 4 . 5 to about 7 . 5 , preferably from about 5 to about 7 , most preferably about 5 . 6 to 6 . 1 . milk bone ® has a ph of 6 . 1 to 6 . 4 . tartar reduction is indicated to be best at neutral ph and palatability is indicated to be best at a slightly acidic ph , so the best mode contemplates a balance of such two factors in any commercial product . the coating solution application is usually conducted at a temperature of about 45 ° to about 140 ° f ., preferably about 60 ° to about 125 ° f . the coating solution contains a suitable surfactant . the preferred surfactant is lecithin or a modified lecithin , most preferably a modified lecithin which is in a dry form . preferably about 0 . 5 to about 1 . 75 weight percent of the lecithin or modified lecithin is used . the surfactant or wetting agent helps the coating material to apply over the entire surface of the dog biscuit dough pieces . the liquefied coating formulation best contains at least one suspension agent . the preferred suspension agent is a polysaccharide gum . preferably about 0 . 05 to 1 . 25 weight percent of xanthan gum is used . xanthan gum is one of the few gums which acts as an acceptable suspension agent in the invention . any suitable gums and mucilages can be used . xanthan gum is preferred because it is stable over a broad range of temperature and holds the same viscosity in the liquefied coating formulation over the broad temperature range . the xanthan gum has a bodying effect so that little or no separation occurs . malto - dextrin produced by hydrolyzing corn starch is preferred . it serves as a carrier ( bodying ), binding agent and suspension agent and helps the appearance of the coating . it is a preferred ingredient , but any suitable dextrin can be used in its place . other malto - dextrins can also be used for the same functions . an adhesive or binding agent , such as , malto - dextrins , is needed in the coating slurry to help the coating material bind ( adhere ) to the dog biscuit when the dog biscuit is dipped in the coating slurry . preferably about 5 to about 15 weight percent of the dextrin or malto - dextrin is included in the coating material . a carrier , such as , starch or a modified food starch , is included in the coating formulation . preferably about 0 . 1 to about 5 weight percent of the food starch or modified food starch is included in the coating material . the food starch or modified food starch also serves to control the viscosity . animal fat preferably is included for flavor purposes . other suitable flavorants can be included , particularly salt . the flavorants can be any dairy product flavorant , such as , milk or cheese , meat flavorants , such as , liver or beef , poultry and fish . flavorants help provide palatability for the invention coating . preferably a hydrogenated vegetable oil is included in the coating formulation for sheen and to modify the melting point of the formula fats in the finished product . it also helps to prevent flaking of the coating ; also the coating does not have a tacky feeling . any suitable colorant can be included in the coating formulation . the preferred colorant is caramel color , which also provides some flavor to the product . the coating also incorporates sufficient water to achieve the liquefied coating composition . amounts of the other ingredients are those which are effective to achieve their functions in the coating formulation . the preferred coating formulation , besides the inorganic pyrophosphates , contains animal fat , a surfactant , such as , a modified lethicin , polysaccharide gum , a modified food starch , flavorant , colorant , hydrogenated vegetable oil , a carrier , such as a malto - dextrin , and water . the coating slurry can be applied to the dog biscuit dough pieces by any suitable means , such as , spraying , dipping , soaking in a container , etc . the coating slurry is applied generally at a temperature of 45 ° to 200 ° f ., preferably at about 60 ° to about 190 ° f ., and most preferably at about 180 °. the coating slurry has a low microbial profile at such higher temperatures . the coated dough pieces can be baked using any suitable or conventional equipment and conditions . for example , the coated dough pieces can be passed into an oven such as a conventional band oven where the biscuit is baked . the conveyor belts of the oven can be coated with an edible lubricant such as a natural or synthetic cooking oil or shortening to facilitate separation from the conveyor belts of the baked coated products . temperatures in the range of about 300 ° to about 600 ° f . can be used . the baked coated biscuits can also be subjected to subsequent drying at temperatures of about 200 ° to 400 ° f , either within the baking oven or separately , to produce the desired moisture content in the final product . the coated , formed pieces are baked , followed by drying , to achieve a shelf stable product without the need of any moisture barrier protection . baking and drying temperatures and times are those conventionally used in the production of a hard , dry canine biscuit . the pieces are dried to obtain a biscuit having a water activity of 0 . 70 or less . typically baking temperatures and times are about 300 ° f . to about an average of 475 ° f . for about 25 minutes to about 8 minutes . drying conditions are typically about 200 ° to about 325 ° f . for about 25 minutes to about 12 minutes in a forced air dryer . on a weight basis , the moisture content of the final coated biscuit product is less than or equal to 13 percent by weight , usually at least 5 weight percent , and most preferably about 8 to about 12 percent by weight , of the final biscuit at 70 percent relative humidity . the ingredients , ph and ranges for the invention coated dough are the same for the invention coated dog biscuits . the invention product is similar in palatability to milk bone ® dog biscuits , which have been widely accepted and a commercial success for many years . the invention product does not include any fluorinecontaining compound or other fluoride ion source , or quaternary ammonium compounds . also the invention product does not include any organic pyrophosphates . the invention deals primarily with dogs , but has a scope of teeth - bearing non - human mammals , such as , cats . the invention composition is used to reduce and control tartar accumulation on canine teeth . table 1______________________________________ percentagesingredients specific ranges______________________________________sodium acid pyrophosphate ( sapp ), 1 . 73 0 . 25 to 5anhydrous powder , ( non - leaveningtype ) tetrapotassium pyrophosphate 1 . 15 0 . 25 to 5 ( tkpp ), anhydrous powdersalt 0 . 50 0 . 05 to 2 . 5malto - dextrin 9 . 17 2 to 30modified food starch 2 . 00 0 . 1 to 10colorant 0 . 50 0 . 01 to 3flavorant 2 . 00 0 . 01 to 5xanthan gum 0 . 20 0 . 05 to 1 . 5lecithin or modified lecithin 1 . 25 0 . 5 to 1 . 75vegetable fat 0 . 50 0 . 1 to 3animal fat 1 . 00 0 . 1 to 5subtotal 20 . 00water ( assumed completely 80 . 00 50 to about 97evaporated after drying ) total 100 . 00______________________________________ ( c ) adding remaining 3 / 4 of the water and mixing to form the coating formulation . ( d ) heating the coating formulation to 185 ° to 200 ° f . with intermittent stirring ( add animal fat at about 125 ° f . during the heating ). ( g ) baking the coated , unbaked dough pieces at 325 ° f . for 25 minutes ( h ) drying the baked , coated dough pieces for 25 minutes at 225 ° f . in a forced - air dryer . | 0 |
fig1 sets forth a block diagram of a brush motor amplifier control constructed in accordance with the present invention . a dc power supply 10 provides a source of operating dc power and includes a positive terminal 15 and a negative terminal 16 . a switching circuit 11 is coupled between positive terminal 15 and a junction 45 . a switching circuit 14 is coupled between junction 45 and negative terminal 16 . a switching circuit 12 is coupled between positive terminal 15 and a junction 46 and a switching circuit 13 is coupled between junction 46 and negative terminal 16 . a brush - type dc motor 34 defines an armature terminal 35 coupled to junction 46 and an armature terminal 36 . a current shunt resistor 44 is coupled between junction 45 and armature terminal 36 . a quartet of driver circuits 20 , 21 , 22 and 23 are coupled to switching circuits 11 , 12 , 13 and 14 respectively . a quartet of gate circuits 30 , 31 , 32 , and 33 are coupled to driver circuits 20 , 21 , 22 and 23 respectively . a shut - off circuit 43 is coupled commonly to gates 30 , 31 , 32 , and 33 . an overspeed detector 42 is coupled to shut - off 43 . an armature encoder 41 is mechanically coupled to the armature of motor 34 by a coupling not shown in fig1 and is coupled electrically to overspeed detector 42 . a master control 40 , which may for example , comprise a digital electronic control system , is coupled to armature encoder 41 . a timing circuit 25 is coupled to gates 30 and 32 and a timing circuit 26 is coupled to gates 31 and 33 . a hysteresis circuit 37 is coupled to timing circuits 25 and 26 . an isolation amplifier 52 includes a pair of input terminals 54 and 55 and an output terminal 56 . input terminal 54 of isolation amplifier 52 is coupled to armature 36 while input terminal 55 is coupled to junction 45 . a discriminator circuit 53 has input terminals 57 and 58 and an output terminal 59 . input terminal 57 is coupled to master control circuit control 40 while input 58 is coupled to output 56 of isolation amplifier 52 . discriminator output terminal 59 is coupled to hysteresis circuit 34 . in operation and assuming motor 34 is mechanically coupled to a suitable load , such as a horizontal continuous casting billet and further assuming that motor 34 is initially at rest , master control 40 , which may comprise any number of systems for providing a desired input signal voltage for establishing the desired current in motor 34 but which , in its preferred form , is a digital computer control system which provides a time varying signal to input 57 of discriminator 53 . while the frequency of signal applied to input 57 by master control 40 is to a great extent a matter of design choice , it has been found advantageous to select a signal frequency of between 2 and 3 kilohertz for large brush - type dc motors . the input at input terminal 57 of discriminator 53 therefore comprises a computer produced digitized signal which corresponds to the motor voltage intended to produce the desired motion of motor 34 and thereby its driven load . inputs 54 and 55 of isolation amplifier 52 receive the voltage developed across resistor 44 which , because of its position within the armature circuit of motor 34 , corresponds to the armature current within motor 34 . as a result , isolation amplifier 52 receives a voltage at inputs 54 and 55 indicative of armature current in motor 34 . this motor current indicative signal is amplified by isolation amplifier 52 to produce an increased power output signal at output terminal 56 which is coupled to input 58 of discriminator 53 . discriminator 53 may be any of the well - known voltage discrimination circuits which function to compare input signals and produce an error signal corresponding to the difference between the two inputs . in this case , discriminator 53 makes a comparison of the input control signal at input 57 and the actual motor current at input 58 and produces an error signal at output terminal 59 indicative of the difference therebetween . in a case of initial start - up of motor 34 there will be virtually no input signal at input 58 and discriminator 53 will produce an output error signal at terminal 59 which is the maximum error signal producible by the discriminator . because the input during initial start - up at terminal 58 is substantially less than that at terminal 57 , the output signal at output terminal 59 will be a signal indicative of the need for the system to increase motor current . the discriminator output error signal at terminal 59 is applied to a hysteresis circuit 37 which includes a bistable amplifier operable in either of two voltage states . hysteresis circuit 37 operates in either of its two stable voltage states in response to the condition of the error signal at output terminal 59 of discriminator 53 . timing circuit 25 is responsive to one of the voltage states of hysteresis circuit 37 while timing circuit 26 is responsive to the remaining voltage state . the construction of hysteresis circuit 37 and timing circuits 25 and 26 is set forth below in greater detail . in addition , as is set forth below in greater detail , timing circuits 25 and 26 further include means for assuring that the timing circuits operate in an exclusive manner such that both timing circuits are not active at the same time . the output signal of timing circuit 25 comprises an enabling signal which is coupled to gates 30 and 32 . conversely , the output of timing circuit 26 comprises a second enabling signal which is coupled to one input of gates 31 and 33 . gates 30 through 33 comprise gate matrix circuits which function in an and gate configuration such that an output signal is produced in response to the coincident inputs of two signals at the gate . therefore , timing circuit 25 produces an enabling signal which is coupled to inputs 60 and 64 of gates 30 and 32 respectively . similarly , timing circuit 26 produces an enabling signal which is coupled to inputs 62 and 66 of gates 31 and 33 respectively . the remaining input terminals 61 , 63 , 65 and 67 of gates 30 through 33 respectively are coupled to a shut - off circuit 43 , the functions of which will be set forth in greater detail . however , suffice it to state here that shut - off circuit 43 supplies an enabling signal to inputs 61 , 63 , 65 and 67 of gates 30 through 33 respectively . as a result , gates 30 and 32 are operative to produce output signals at output terminals 68 and 70 respectively only during the presence of an enabling signal from timing circuit 25 . similarly , gates 31 and 33 produce output signals at their respective output terminals 69 and 71 only during the presence of an enabling signal from timing circuit 26 . because gates 30 and 32 are operated simultaneously by timing circuit 25 , the output signals at terminals 68 and 70 of gates 30 and 32 respectively are coincident . similarly , because gates 31 and 33 are simultaneously operated by timing circuit 26 , the output signals of gates 31 and 33 at output terminal 69 and 71 are coincident . as mentioned , timing circuits 25 and 26 operate exclusive of each other such that no simultaneous operation of the timing circuits occurs . as a result , coincident output signals are present at terminals 68 and 70 at times when no output signal is present at output terminal 69 and 71 . conversely , output signals are present at output terminals 69 and 71 at times when no output signal is present at output terminals 68 and 70 . driver 20 , which comprises a signal amplifying circuit , increases the power of the output signal at terminal 68 and couples it to a power switching circuit 11 . the structure of driver 20 is set forth below in greater detail . suffice it to note here however that the function of driver 20 is to raise the power of the output of gate 30 to a level sufficient to drive power switching circuit 11 . driver 21 performs a similar power gain function for the output of gate 31 and couples it to a power switching circuit 12 . similarly , driver 22 amplifies and couples the output signal of gate 32 to power switching circuit 13 and driver 23 amplifies and couples the output of gate 33 to power switching circuit 14 . power switching circuits 11 , 12 , 13 and 14 are substantially identical in structure and are set forth below in greater detail . for purposes of explanation here however , it is sufficient to understand that power switching circuits 11 through 14 are operative in response to their respective driver output signals to conduct maximum current when an output signal is applied from their respective drivers and to remain nonconducting in the absence of such driver output signal . it should be noted that in accordance with the foregoing description of timing circuits 25 and 26 , drivers 20 and 22 are simultaneously operated and drivers 21 and 23 are simultaneously operated . as a result , switches 11 and 13 are operated simultaneously as are switches 12 and 14 . in accordance with switch mode power design , the current through motor 34 produced by dc power source 10 , flows in the direction of arrow 50 when switches 12 and 14 are activated . conversely , current flows through motor 34 in the direction of arrow 51 when switches 11 and 13 are activated . as a result , the current through motor 34 is controlled by the respective operation of timing circuits 25 and 26 through the activation of the gate and driver circuits applied to the power switching circuits . simply stated , timing circuit 25 activates gates 30 and 32 simultaneously which in turn operates drivers 20 and 22 simultaneously which in turn turns on power switching circuits 11 and 13 causing current to flow from positive terminal 15 through switch 11 and thereafter through motor 34 in the direction of arrow 51 and then through power switching circuit 13 to negative potential terminal 16 . conversely , the operation of timing circuit 26 activates gates 31 and 33 which operate drivers 21 and 23 which in turn turns on power switching circuits 12 and 14 . in such case , current flows from positive terminal 15 through power switching circuit 12 and through motor 34 in the direction of arrow 50 and then through power switching circuit 14 to negative terminal 16 . during the initial start - up operation , master control 40 continues to apply the desired motor operations signal at terminal 57 and timing circuits 25 and 26 are operated in response thereto to cause current to flow in the desired direction through motor 34 . as current through motor 34 increases as a result of the operation of switching circuits 11 through 14 , the voltage produced across current sensing resistor 44 increases the input voltage to isolation amplifier 52 which in turn applies this increased current indicative signal to discriminator 58 . at a certain point , the voltage developed across resistor 44 produces a signal through isolation amplifier 52 at discriminator terminal 58 which approaches the desired motor input signal at terminal 57 . as the system approaches equilibrium , operation of hysteresis circuit 37 and timing circuits 25 and 26 provide activation of switching circuits 11 and 13 and 12 and 14 in accordance with the differential between actual motor current sensed by resistor 44 and the desired motor current indicated by input signal 57 . in essence , switching circuits 11 through 14 are operative to apply square wave voltage signals in which the resultant current through motor 34 is controlled by the timing and duration of the operation of the respective switching circuits . for example , to operate motor 34 in a direction corresponding to increased current in direction 50 , switching circuits 12 and 14 are operated for longer intervals than switching circuits 11 and 13 . conversely , to produce that current through motor 34 in the direction of arrow 51 , switching circuits 11 and 13 are operated for longer durations than switching circuits 12 and 14 . in accordance with the control function of master control 40 and as mentioned above , armature encoder 41 is mechanically coupled to the armature of motor 34 . while armature encoder 41 may comprise any number of position detection mechanisms , in its preferred form , armature encoder 41 comprises a optical coupling system in which a optically slotted member rotates in conjunction with the armature of motor 34 and produces an output signal pulse for each increment of armature motion of motor 34 . in essence , armature encoder 41 produces a train of pulse signals as the armature of motor 34 rotates . these pulse signals are applied to master control 40 and are operative to permit master control 40 to adjust the output signal at terminal 57 of discriminator 53 in accordance with a desired armature motion profile . in the case for example of horizontal continuous casting , the operation of master control 40 functions to produce an output signal at terminal 57 of discriminator 53 which is proportional to the force required to produce the desired motion profile of the casting billet . in addition and in accordance with an important aspect of the present invention , the output of encoder 41 is coupled to an overspeed detector 42 . overspeed detector 42 comprises a frequency to voltage converter , the details of which are set forth below in greater detail . however , suffice it to note here that in response to the train of input pulses to armature encoder 41 , overspeed detector 42 produces an output voltage indicative of the frequency of pulse occurence from encoder 41 . in essence , overspeed detector 42 functions to frequency detect the motion of the armature of motor 34 which in turn translates to the rotational speed of the motor armature . the output frequency indicative voltage of overspeed detector 42 is applied to a shut - off circuit 43 which in turn is commonly coupled to the second inputs 61 , 63 , 65 and 67 of gates 30 through 33 respectively . as mentioned , in the absence of signal output by shut - off 43 , gates 30 through 33 respectively will not respond to the respective timing signals produced by timing circuits 25 and 26 . accordingly , shut - off 43 , in its normal mode , produces an output signal which enables gates 30 through 33 to function in the presence of applied signals from timing circuits 25 and 26 . conversely , however , shut - off 43 in the off condition , gates 30 through 33 do not respond to timing circuits 25 and 26 and accordingly , switches 11 through 14 remain inoperative and motor 34 receives no current . returning to overspeed detector 42 , the output voltage therefrom which , as mentioned , is a function of the frequency of armature encoder rotation is operative upon a threshold circuit within shut - off circuit 43 , the details of which are set forth below in greater detail . simply stated here however , shut - off 43 responds to a predetermined voltage threshold from overspeed detector 42 to interrupt the enabling voltage at gates 30 through 33 when the overspeed detector voltage exceeds a predetermined threshold . the threshold operative upon shut - off 43 to disable gates 30 through 33 is selected to correspond to the speed of armature encoder 41 at which the above - described lack of resolution ability approaches and a danger exists that the system will erroneously determine that armature encoder 41 is static . this failure mode is avoided by the operation of the present invention overspeed detector and shut - off circuit 43 . as the speed of armature encoder 41 increases , the output signal of overspeed detector 42 increases correspondingly . when the speed of armature encoder 41 reaches the threshold speed , the corresponding output voltage of overspeed detector 42 is operative to trip shut - off 43 causing gates 30 through 33 to be disabled and instituting the interruption in power switches 11 through 14 which in turn deprives motor 34 of armature current . thus , the system is protected by the operation of master control 40 , armature encoder 41 and overspeed detector 42 and shut - off 43 against the above - described overspeed failure mechanism . it should be noted that the protection of the present invention system from overspeed failure mode is accomplished without compromising the resolution of encoder 41 . fig2 sets forth a schematic diagram of the discriminator , timing and gates systems of the present invention . input terminal 57 should be understood to be coupled to master control 40 as shown in fig1 . similarly , input terminal 58 should be understood to be coupled to isolation amplifier 52 as shown in fig1 . a capacitor 80 is coupled to input terminal 57 and to ground and inverting amplifier 84 includes a non - inverting input 86 coupled to ground and inverting input 85 coupled to terminal 57 by a resistor 81 and an output terminal 87 . a series combination of a resistor 82 and a rheostat 83 is coupled between input terminal 85 and output terminal 87 . a resistor 88 is coupled to output terminal 87 and a junction terminal 89 . a resistor 79 is coupled between input terminal 58 and junction 80 . a high gain amplifier 90 includes a non - inverting input 92 coupled to ground and inverting input 91 coupled to junction 89 and an output terminal 93 . a resistor 94 and a rheostat 95 are serially connected between input terminal 91 and output terminal 93 . an amplifier 100 includes a non - inverting input 102 , an inverting input 101 and an output terminal 103 . a resistor 96 couples junction 59 with input 101 of amplifier 100 . a resistor 104 is coupled between output terminal 103 and non - inverting input terminal 102 of amplifier 100 . a positive low voltage supply 111 is coupled to a resistor 113 while a negative supply 112 is coupled to a resistor 114 . a voltage divider 122 is coupled between the remaining ends of resistors 113 and 114 . a diode 115 and anode 117 coupled to resistor 114 and a cathode 116 coupled to a common junction 118 which in turn is coupled to ground . a second diode 119 has an anode electrode coupled to junction 118 and a cathode electrode coupled to resistor 113 . an amplifier 107 has a non - inverting input terminal 109 coupled to the moveable wiper of voltage divider 122 and inverting input 108 and an output terminal 110 . output 110 and input terminal 108 are commonly coupled to one end of a rheostat 106 . the remaining end of rheostat 106 is coupled to input terminal 102 of amplifier 100 at a reference junction 105 . a voltage squaring circuit 125 comprises an lm361 integrated circuit having a positive supply terminal 126 and a a negative supply terminal 129 . squaring circuit 125 further includes a non - inverting output terminal 127 and an inverted output terminal 128 . squaring circuit 125 further includes an input terminal 134 coupled to the junction of resistor 104 and output terminal 103 of amplifier 100 . squaring circuit 125 further includes a second input terminal 133 and a ground terminal 130 which are commonly coupled to ground . squaring circuit 125 further includes an st1 terminal 131 and a st2 terminal 132 which are commonly coupled to a source of operating potential . a timing circuit 125 comprises a blank integrated circuit having an rc terminal 112 and a c1 terminal 141 coupled together by a capacitor 143 . terminal 112 is further coupled to a source of operating potential by a resistor 144 . timing circuit 135 further includes a q1 terminal 136 which is unconnected and a - q1 terminal 137 . circuit 135 further includes a reset terminal 138 which is unconnected . circuit 135 further includes an a1 terminal 140 which is connected to ground and a b1 terminal 139 which is connected to terminal 127 of circuit 125 . a three input and gate 145 has a first input 146 coupled to output 127 of circuit 125 , a second input 147 coupled to terminal 137 of circuit 135 and an input 148 and an output terminal 149 . an inverting amplifier 150 has an input terminal 152 and an output terminal 151 coupled to input 148 . a timing circuit 155 has a q2 terminal 156 unconnected and a - q2 terminal 157 . circuit 155 further includes a c2 terminal 161 and an rc terminal 162 . rc terminal 162 is coupled to a source of operating potential by a resistor 164 and to terminal 161 by a capacitor 163 . circuit 155 further includes an inverting input 160 coupled to ground and a non - inverting input 159 coupled to inverting output 128 of circuit 125 . a three input and gate 165 includes a first input 166 coupled to output 128 of circuit 125 , a second input 167 coupled to terminal 157 of circuit 155 , a third input terminal 168 and an output terminal 169 . an inverting amplifier 170 has an input terminal 171 coupled to output terminal 149 of gate 145 and an output terminal 172 coupled to input 168 of gate 165 . an and gate 175 has an input 176 coupled to output terminal 149 of gate 145 and an input terminal 127 coupled to voltage shut - off 43 ( as shown in fig1 ) and an output terminal 178 . a nand gate 180 has an input terminal 181 coupled to output terminal 169 of gate 165 , an input terminal 182 coupled to input terminal 127 and an output terminal 183 . a nand gate 185 has an input terminal 186 coupled to output terminal 149 of gate 145 , an input terminal 187 coupled to input 127 and an output terminal 188 . a nand gate 180 has an input terminal 191 coupled to output 169 of gate 165 , an input terminal 192 coupled to input 127 and an output terminal 193 . output terminals 178 , 183 , 188 and 193 are coupled to drivers 20 , 21 , 22 and 23 as shown in fig1 . in operation , the input signal from master control 40 applied to input terminal 57 is amplified and inverted by amplifier 84 and coupled by resistor 88 to junction 89 . similarly , the input motor current signal coupled to input terminal 58 is coupled by resistor 79 to junction 89 . at junction 89 , the inverted signal from master control 40 and the motor current signal from input terminal 58 are added producing a different signal which is applied to high gain amplifier at inverting input 91 . as a result of the summing at junction 89 , the signal amplified and appearing at output terminal 93 of amplifier 90 comprises the difference signal or error signal of the motor control system . this error system is coupled by resistor 96 to the inverting input 101 of amplifier 100 . the combination of resistors 113 and 114 and diodes 115 and 119 together with potentiometer and amplifier 107 provide a reference voltage at junction 105 the amplitude of which may be adjusted by adjustment of rheostat 106 . amplifier 100 has a reference voltage input at input 102 and therefore produces an output error signal which is applied to squaring circuit 125 . as configured , circuit 125 is essentially a bistable circuit having two operable output states . in the first output state a positive output appears at terminal 127 and in the second operating state , a negative output appears at terminal 128 . the outputs of squaring circuit 125 comprise a positive going signal at terminal 127 and a negative going signal at 128 . the positive going output of squaring circuit 125 is coupled to the input of timing circuit 135 . the combination of timing circuit 135 , inverting amplifier 150 and and gate 145 provide a timing operation on the positive going signal coupled from output terminal 127 of circuit 125 to output terminal 149 of gate 145 . similarly , the negative going input signal is applied to timing circuit 155 which processes the negative going signal appearing at output terminal 169 in accordance with the following . the combination of circuits 135 and gate 145 , together with circuit 155 and gate 165 , are regeneratively coupled by inverting amplifiers 150 and 170 respectively to preclude the simultaneous operation of gates 145 and 165 . this timing function is carried forward to achieve the above - described timing of timing circuits 25 and 26 to provide that switching circuits 11 and 13 and switching circuits 12 and 14 are operated exclusive of each other and never simultaneously . nand gates 175 , 180 , 185 and 190 each have one respective input commonly coupled to shut - off circuit 43 ( seen in fig1 ) and their remaining inputs coupled in pairs to gates 149 and 165 . as a result , the output signal of gate 149 enables gates 175 and 185 to produce output signals at output terminals 178 and 188 respectively . similarly , the output signal of gate 165 at terminal 169 enables gates 180 and 190 producing output signals at output terminals 183 and 193 . as described above , the outputs of gates 175 , 180 , 185 and 190 are operative upon switching circuits 11 through 14 in accordance with the above - described power switching operation . fig3 sets forth a schematic diagram of driver circuits 20 , 21 , 22 and 23 . as mentioned above , driver circuits 20 through 23 are identical in construction and operation . accordingly , fig3 will be used to describe the construction of the driver circuits , it being understood that each of driver circtuis 20 through 23 comprise the structure set forth in figure 3 . input terminals 200 and 201 which receive the output of a selected one of gates 175 , 180 , 185 and 190 , depending upon which driver circuit the circuit of fig3 represents , provide the input signal for the driver of fig3 . a light emitting diode 202 has a cathode electrode 203 connected to input terminal 201 and an anode electrode 204 connected to input terminal 200 . a photo sensitive amplifier 211 has an input terminal 205 coupled to a source of low voltage operating bias 210 and an output terminal 206 . by means not shown , photo sensitive amplifier 211 is coupled to a source of operating potential 208 . a capacitor 207 couples terminal 205 to a source of ground potential . a bias resistor 209 couples output 206 to operating supply 208 . an inverting amplifier 215 has an input terminal 216 coupled to terminal 206 and an output terminal 217 and a supply terminal 218 coupled to a source of operating potential 225 . an inverting amplifier 220 has an input terminal 221 coupled to output terminal 217 of amplifier 215 , an output terminal 222 and a operating supply terminal 223 . a capacitor 226 couples output terminal 222 to supply 225 . a transistor 228 has an emitter electrode 229 coupled to a source of operating supply 227 , a base electrode 230 coupled to terminal 222 by a resistor 232 and a collector electrode 231 coupled to the junction of a resistor 260 and a resistor 259 . resistor 260 is coupled at its other end to a source of negative operating potential . a transistor 235 has an emitter electrode 236 , a base electrode 237 coupled to collector 231 by a resistor 233 and a collector electrode 238 coupled to operating supply 227 . a transistor 240 has an emitter electrode 241 , a base electrode 242 coupled to emitter 236 and a collector electrode 243 coupled to collector 238 . a transistor 250 has an emitter electrode 251 , a base electrode 252 coupled to resistor 259 and a collector electrode 253 coupled to a source of negative operating supply . a transistor 255 has an emitter electrode 256 coupled to emitter 241 , a base electrode 257 coupled to emitter 251 and a collector electrode 258 coupled to a source of negative operating supply . a resistor 244 couples emitters 241 and 256 to supply 225 . a diode 261 has a cathode electrode 263 coupled to supply 265 and an anode electrode 262 . a resistor 264 is coupled between anode 262 and supply 225 . a field effect transistor 270 has a source electrode 271 , a gate electrode 272 and a drain electrode 273 . a capacitor 265 couples the junction of resistor 264 and anode 262 to output terminal 280 . drain 273 is coupled to output terminal 280 , and gate 272 is coupled to emitters 241 and 256 . a zener diode 275 has a cathode 277 coupled to gate 272 and an anode 276 coupled to source 271 . the series combination of a capacitor 266 and a resistor 267 couples drain electrode 273 to terminal 282 . in operation , the input signal at terminals 200 and 201 coupled from the selected one of gates 175 , 180 , 185 and 190 ( seen in fig2 ) energizes light emitting diode 202 causing a light output therefrom when a signal is present at terminals 200 and 201 . the output light from light emitting diode 202 is received by photo sensitive amplifier 211 and is inverted and amplified thereby and applied to a pair of amplifiers 215 and 220 . the function of the light coupling between light emitting diode 202 and light sensitive amplifier 211 provides isolation of the gate circuitry from the remainder of the system to insure that the low level gate circuitry of the output gates and timing circuits is not affected by the high power currents present in the remainder of the system . the output of amplifier 220 is further amplified by transistor 228 and thereafter coupled to a pair of darlington configured transistor pairs . resistor 233 couples the output of transistor 228 to the darlington amplifier pair formed by transistors 235 and 240 while resistor 259 couples the output of transistor 228 to a second darlington pair of transistors 250 and 255 . it should be noted that while transistors 235 and 240 are npn transistors , transistors 250 and 255 are pnp transistors , the resulting configuration comprises a dc coupled stacked arrangement in which the output signal is taken from the junction of emitters 241 and 256 . the output signal of the darlington pairs is applied to the gate electrode 272 of field affect transistor 270 . transistor 270 has its source 271 coupled to an output terminal 281 and its drain electrode coupled to an output terminal 280 . a series combination of capacitor 266 and resistor 267 are coupled to an output terminal 282 . as will be shown and described below in conjunction with fig4 field affect transistor 270 is operative in response to the output of the darlington transistor pairs to operate the base junction of the transistors within the power switching circuits operative upon motor 34 . suffice it to note here however that the driver circuit shown in fig3 provides an optically isolated amplifier configuration which raises the signal level provided by the selected one of gates 175 , 180 , 185 and 190 to a power level sufficient to drive the output devices found in the power switching circuits shown in fig3 . fig4 sets forth a schematic diagram of power switching cirtuis 11 , 12 , 13 and 14 together with motor 34 . a transistor 350 has an emitter 351 , a base 352 and a collector 353 . collector 353 is coupled to the positive motor supply terminal 15 . a transistor 355 has an emitter 356 coupled to base 352 , a base 357 and a collector 358 coupled to collector 353 . a transistor 360 has an emitter 361 coupled to a source of ground potential 16 , a base 362 and a collector 363 coupled to junction 46 and to emitter 351 of transistor 350 . a transistor 365 has an emitter electrode 366 coupled to base 363 , a base 367 and a collector 368 coupled to collector 363 . a transistor 370 has an emitter 371 coupled to a junction 45 , a base 372 and a collector 373 coupled to the source of operating potential 15 . a transistor 375 has an emitter 376 coupled to base 372 , a base 377 and a collector 378 coupled to collector 373 . a transistor 380 has an emitter electrode 381 coupled to a source of ground potential 16 , a base 382 and a collector electrode 383 coupled to junction 45 . a transistor 385 has an emitter electrode 386 coupled to base 382 , a base electrode 387 and a collector electrode 388 coupled to collector 383 . a motor 34 has an armature terminal 35 coupled to junction 46 and an armature terminal 36 coupled to junction 45 by a shunt resistor 44 . armature terminal 36 is coupled to input 54 while junction 45 is coupled to input 55 ( both shown in fig1 ). it should be noted that the darlington pair formed by transistors 355 and 350 comprise switching circuit 12 in fig1 . similarly , the darlington transistor pair formed by transistors 360 and 365 comprise switching circuit 13 of fig1 . the darlington pair of transistors 370 and 375 comprise the switching circuit 11 in fig1 and the darlington pair of transistors 380 and 385 comprise switching circuit 14 of fig1 . accordingly , each darlington transistor pair includes a pair of input terminals coupled to the input transistor base and the other coupled to the input transistor collector . for example , in the pair formed by transistors 350 and 355 , input terminals 359 and 354 are coupled to the base and collector respectively of transistor 355 . similarly , with respect to the transistor pair of transistors 360 and 365 , input terminals 369 and 364 are coupled to the base 367 and collector 363 respectively of input transistor 365 . in the same manner , with respect to the transistor pair formed by transistors 370 and 375 , input terminals 379 and 374 are coupled to base 377 and collector 378 respectively of input transistor 377 and input terminals 389 and 390 are coupled respectively to base 387 and collector 383 of input transistor 385 . with reference to fig3 it should be noted that in the typical coupling of the driver circuit shown , output terminal 281 would be coupled to the base input of the respective transistor pair to which the driver circuit is coupled and output terminal 280 would be coupled to the respective collector input terminal . for example , if the driver of fig3 is coupled to the transistor pair formed by transistors 350 and 355 , output terminal 281 is coupled to input terminal 359 and output terminal 280 is coupled to input terminal 354 . in addition , it should be noted that terminal 282 of the driver in fig3 would also be coupled to terminal 354 . a similar configuration would result in the coupling of the respective drivers to the remaining three power switching transistor pairs . as mentioned above , the operation of the present invention brush motor amplifier provides that power is coupled through motor 34 by the activation of the appropriate pair of power switching devices . accordingly , and as described above in conjunction with fig1 the result in current through motor 34 is controlled by the duration of respective operations of the darlington transistor pairs . for example , with the transistor pair of 350 and 355 , together with the transistor pair 380 and 385 operative in response to their respective input signals from their driver circuits , transistor 350 and transistor 380 are turned on fully and current flow through motor 34 in the direction indicated by arrow 50 . conversely , with activation of the transistor pair formed by transistors 370 and 375 , and the transistor pair formed by transistors 360 and 365 , transistors 370 and 360 are fully conductive and current flows through motor 34 in the direction of arrow 51 . it should be noted , and in accordance with an important aspect of the present invention , motor 34 is entirely dependent upon the conduction of the switching transistors within the circuit of fig4 for its armature current . accordingly , in the absence of drive signals to the respective inputs of the transistor pairs , no motor current flows through motor 34 . fig5 sets forth a schematic diagram of the overspeed detector of the present invention . an input terminal 301 should be understood to be coupled to armature encoder 41 as shown in fig1 . an inverting amplifier 300 has an input terminal 301 and an output terminal 302 . a series resistor pair 305 and 304 are coupled from a source of operating potential to ground . the junction of resistors 304 and 305 is coupled to terminal 302 by a capacitor 303 . an integrated circuit 315 is configured to form a frequency to voltage converter and , in its preferred form , comprises an integrated circuit manufactured by burr - brown having a generic part number vfc62bg . it should be apparent to those skilled in the art however that other frequency to voltage converter circuits may be substituted for integrated circuit 315 without departing from the spirit and scope of the present invention . it should also be noted that while the respective terminals utilized in the frequency to voltage converter of integrated circuit 315 have been numbered in accordance with patent reference numbers , the individual terminal designations commonly used in the electronics art to functionally describe the terminals have been retained to assist in understanding the circuit shown in fig5 . accordingly , integrated circuit 315 includes a positive v terminal 319 coupled to a source of positive operating potential and a negative v terminal 318 coupled to a source of negative operating potential . a negative input terminal 320 is coupled to one end of a resistor 310 , the other end of which is coupled to a wiper 309 of a voltage divider 308 . positive input terminal 321 is coupled to c1 terminal 322 by a capacitor 324 . a cin terminal 323 is coupled to the junction of resistors 304 and 305 while a ground terminal 317 is coupled directly to ground . a v output terminal 316 is coupled to output terminal 325 . a capacitor 326 is coupled between output terminal 325 and input terminal 320 . a series combination of a resistor 327 and a rheostat 328 are coupled in parallel with capacitor 325 . a voltage divider 308 is coupled between a source of positive operating potential and a source of negative operating potential and a pair of capacitors 306 and 307 are coupled to ground from the positive and negative operating potential sources respectively . in operation , the output signal of armature encoder 41 in the form of a plurality of positive going pulses is coupled to input terminal 301 and is amplified and inverted by inverter 300 and thereafter coupled by capacitor 303 to input terminal 323 of integrated circuit 315 . as a result , a supply of pulse signals , the frequency of which directly corresponds to the rotational speed of armature encoder 41 , is applied to input terminal 323 . in accordance with the voltage to frequency version operation of integrated circuit 315 , the input pulses applied to input terminal 323 produce an output signal at terminal 316 which comprises an analog voltage proportional to the frequency of input signals at terminal 323 . as a result , the frequency of armature encoder 41 ( shown in fig1 ) is indicated by the analog voltage appearing at output terminal 325 . output terminal 325 is coupled to shut - off 43 ( shown in fig1 ). with reference to fig1 it should be recalled that shut - off 43 comprises a threshold operative circuit in which the output signal is maintained in the absence of an input signal exceeding a predetermined threshold . accordingly , and in simultaneous reference to fig1 and 5 , as the speed of armature encoder 41 increases , the frequency of incoming signals applied to terminal 332 of integrated circuit 315 also increases . this increase in frequency results in an increase in the amplitude of the analog voltage produced at terminal 325 . the increasing signal is applied to shut - off 43 . at a predetermined point at which the frequency of incoming signals from armature encoder 41 apply to input terminal 323 of integrated circuit 315 produces a voltage level at output terminal 325 sufficient to activate the switching threshold circuitry within shut - off 43 . upon such occurrence , and as mentioned above , shut - off 43 interrupts the output signal applied to gates 30 through 33 . with reference to fig2 it should be noted that input terminal 179 comprises the point at which the enabling signal from shut - off 43 is applied . what has been shown is an improved brush motor amplifier in which an overspeed detector is operative upon the armature encoder of the system to provide a frequency dependent voltage which in turn is operative to remove the armature current from the motor in the event the motor speed exceeds a predetermined rotational speed . while particular embodiments of the invention have been shown and described , it will be obvious to those skilled in the art that changes and modifications may be made without departing from the invention in its broader aspects . therefore , the aim in the appended claims is to cover all such changes and modifications as fall within the true spirit and scope of the invention . | 7 |
the numerous innovative teachings of the present application will be described with particular reference to the presently preferred embodiment ( by way of example , and not of limitation ), in which : fig1 shows a first sample device structure according to the present invention . this is a vdmos , in which the mobility of the channel regions 52 , but not of the regions 54 where jfet pinchoff occurs , has been increased . the dashed horizontal line indicates the approximate boundary between the sige . sub .. 1 material , in the presently preferred embodiment , and the pure silicon . however , a too - shallow boundary makes process control more difficult ( especially in relation to control of oxide growth ). this structure operates conventionally ( except that the current density is increased ); i . e . the potential of insulated gate 51 controllably pulls the channel 52 into accumulation , and thereby permits electrons to flow from source 50 down through the n - type epitaxial layer 62 and n - type substrate 60 to a backside drain contact 61 . the channel 52 is formed by a surface portion of the p - type body diffusion 52 . deep body diffusion 59 provides added jfet gating for high - voltage withstand . fig2 shows a second sample device structure according to the present invention , in which a surface dmos , with enhanced mobility , drives the emitter of a buried bipolar transistor which provides high - voltage withstand . in the illustrated example the surface dmos is a vdmos , but of course this can be varied . the dashed line indicates the approximate boundary between the sige . sub .. 1 material , in the presently preferred embodiment , and the pure silicon . in this embodiment this boundary is indicated as lying below the source junction , but alternatively this could be as shallow as the source junction depth , or even shallower . ( ultimately the relevant depth is the depth of the accumulation region when the device is fully turned on , and some benefit will still be obtained if bandgap gradation occurs within this depth .) in this structure , the connections to external terminals c ( collector ), b ( base ), s ( source ) and g ( gate ) are indicated . the insulating layer 12 separates the gate 9 from the source metallization 10 . regions 1 , 2 , 3 and 4 of the figure constitute , respectively , the collector , the base and the emitter of a bipolar transistor , while region 5 constitutes the drain of the mos . switched - emitter devices , like igbts , preferably use clamping diodes when used with inductive loads . fig2 a shows a sample doping profile for a vertical line through the structure of fig2 . germanium fraction is shown with a dotted line , since germanium is not a dopant ( strictly speaking ). the lateral dimensions of this figure are not to scale , but this figure does give some indication of relative dopant levels . fig3 shows a third sample device structure according to the present invention . this is another switched - emitter structure , but in this case the control device is a trench transistor with enhanced mobility . due to the scale required , this drawing does not explicitly show the bandgap variation , but this is shown in the detail view of fig3 a . the n + emitter portions 110 , in the presently preferred embodiment , have a pitch in the range of 10 - 15 μm and a minimum width of e . g . 3 - 4 μm . ( the width is less than half the pitch in order to avoid current crowding between adjacent emitters .) the pitch , in the presently preferred embodiment , is limited by the n + pitch rather than the trench pitch . ( minimum geometries for buried layers are typically larger than those of overlying structures .) the dopant density ( q ) for the buried layers is typically in the range of 5e14 - 5e16 cm - 2 for each ( specifically e . g . 5 × 10 15 cm - 2 for the p - type and 2 × 10 16 cm - 2 for the n - type ). many bipolar structures use a heavier doping for the n - type buried layer ( and this may be preferable in some implementations of the disclosed structure ), but this is not strictly necessary for the practice of the present invention ( emitter injection efficiency is not particularly a concern ). the p - type doping density is preferably selected to provide a low sheet resistance in the extrinsic base 120e while retaining base width control ; the n - type dopant density is preferably selected to provide counterdoping of the p - type dopants , and to provide a heavier doping on the emitter side of the emitter / base junction . boron is preferred for the p - type buried layer 120 . ( the greater diffusivity of boron , as opposed to gallium , would provide greater counterdoping , hence a greater ratio of extrinsic base width to intrinsic base width .) a slow diffusing dopant ( as or sb ) is preferred for the n - type buried layer , but phosphorus can also be used . the length of the channel 130 of the trench fet , in the presently preferred embodiment , is selected to withstand only a moderate voltage ( e . g . about 20 v , which implies a channel length of about 0 . 5 to 1 μm with typical epitaxial layer doping levels . the epitaxial layer thickness can accordingly be e . g . 5 to 10 microns . the channel 130 is provided by the portion of p - type body diffusion 131 which is nearest the trench ( and hence can be gated by trench gate 134 ). the gate 134 of the trench fet is , e . g ., n + polysilicon . a clamp diode is preferably used to protect the switched - emitter structure when inductive loads must be driven . the minimum intrinsic base thickness in this type of structure is selected in accordance with the desired gain and ruggedness , but is typically in the range of 1 - 4 μm . larger base widths imply lower gain but greater ruggedness . the bipolar transistor is preferably be a fairly low - gain device , e . g . beta of 20 - 100 . ( the beta is controlled by selecting the base width ; lower base widths produce higher gain , but transistors with lower beta are typically more rugged .) typical operating voltages on this structure may be , e . g ., 3 v constant base voltage ( optionally fed through a load impedance ); 0 v source voltage on the control device ; gate voltage switched between e . g . 0 v and e . g . 10 v ; collector voltage 500 v . of course a wide variety of different operating voltages can be specified , with or without modifications to optimize the device structure , but this example will help to illustrate the advantages of the disclosed structure . as seen in the detail view of fig3 a , a region of sige alloy exists along the walls of the trench , and thus the channel regions 130 are located in a region of higher mobility . there are several process options in constructing the innovative devices . the simplest approach is simply to epitaxially grow a thin layer of sige , e . g . sige . sub .. 1 to a thickness in the range of 100 - 5000 å ( preferably e . g . 1000 å ). this is preferably performed on a naked wafer , but optionally can be performed after a locos - patterned field oxide has been grown ( since the wider - bandgap material is preferred under the field oxide ). optionally n - wells and p - wells , if desired , can also be formed before the epitaxial growth . ( optionally a brief silicon epitaxy can be performed after the sige epitaxy ( e . g . to 300 å ), to facilitate the subsequent growth of a gate oxide which is predominantly sio 2 . depending on the thickness of this overgrowth a reverse bandgap gradation may occur near the surface , but this can be tolerated as long as lower - bandgap portions dominate the depth of the channel accumulation layer .) after these initial steps , the rest of the process uses normal transistor fabrication steps , for whatever mix of devices is desired , which are entirely conventional and well - known . this embodiment is generally less preferable , due to greater process complexity and defect density . however , this may be preferred for other reasons . also , this is the most straightforward way ( although not contemplated as the most preferable ) to construct a switched - emitter device with trench fet control devices . in this case the sige epitaxy would be made thick enough to extend down to the drain of the trench transistor , e . g . 2 μm thick . this is a more preferable way to fabricate device embodiments with a trench control transistor . in this process embodiment a short sige epitaxial growth step , as described in the first process embodiment above , is performed after the trenches have already been etched . ( the epitaxial growth thickness is less than 1 / 4 of the ultimate minimum trench width , and more preferably less than 1 / 10 thereof .) this provides a high current density in the trench fets ( which is where the limit on current density arises ), without requiring a long epitaxial growth step . this process also provides good compatibility with use of the epitaxial layer for other devices , e . g . cmos . in this embodiment an implant of ge is performed with a dose in the range of e . g . 5e17 to 1e19 cm - 2 and an energy selected to provide a stopping distance in the range of 100 to 500 å . after annealing this provides a lower - bandgap surface portion as desired . as will be recognized by those skilled in the art , the innovative concepts described in the present application can be modified and varied over a tremendous range of applications , and accordingly the scope of patented subject matter is not limited by any of the specific exemplary teachings given . for example , as will be obvious to those of ordinary skill in the art , other circuit elements can be added to , or substituted into , the specific circuit topologies shown . for another example , it is not at all necessary to use a pure silicon substrate : the substrate may itself be a low - alloy ( wider - bandgap ) sige alloy while the surface layer is a higher - alloy ( lower - bandgap ) sige alloy . for another example , it is not strictly necessary to use only the si / sige alloy spectrum to provide the desired bandgap engineering capability . the above teachings can optionally also be adapted to si / sic alloys or to ternary semiconductors such as gesic alloys . for another example , the capability for bandgap engineering can also be used for other portions of the device structure . for example , in the switched - emitter embodiments the high - mobility control device channel , as described above , can optionally be combined with a heterojunction at the level of the buried emitter / base junction , to provide improved emitter injection efficiency in the buried device . this narrow / wide / narrow bandgap structure is not particularly preferred , but can be implemented if desired ( e . g . by growing a silicon epi layer on a sige . sub .. 1 substrate ). | 8 |
referring to fig4 there is shown a discharge cell in a dc - type pdp according to an embodiment of the present invention . the discharge cell includes a cathode 30 formed on an upper substrate 10 , an anode 32 and an auxiliary anode 34 each formed on a lower substrate 18 , a barrier rib 24 provided between the upper substrate 10 and the lower substrate 18 , and first and second radio frequency electrodes 44 and 46 opposed to the barrier rib 24 provided with a main discharge space 31 . the upper substrate 10 as a display screen of a picture is arranged in opposition to the lower substrate 18 . the barrier rib 24 is formed between the upper substrate 10 and the lower substrate 18 to provide the main discharge space 31 and an auxiliary discharge space 33 . in addition , the barrier rib 24 is formed in a lattice structure to prevent a mis - discharge between the adjacent cells caused by a diffusive movement of the charge particles generated by the auxiliary discharge . the anode 32 is formed on the lower substrate 18 provided with the main discharge space 31 while the auxiliary anode 34 is formed on the lower substrate 18 provided with the auxiliary discharge space 33 . the anode 32 and the auxiliary anode 34 are connected to each bus line ( not shown ) arranged in a direction crossing with the cathode 30 formed on the upper substrate 10 . a current limiting resistor 36 is provided between the anode 32 and the lower substrate 18 to limit an overshoot of the discharge current as well as to restrain a sputtering into the cathode . each of the first and second radio frequency electrodes 44 and 46 are formed in opposition to the barrier rib 24 provided with the main discharge space 31 . for instance , the first and second radio frequency electrodes 44 and 46 are formed in the diagonal direction in opposition to each other . a fluorescent material ( not shown ) is coated on the surface of the barrier rib 24 and the peripheral of the anode 32 in the main discharge space 31 . a method of driving the dc - type discharge cell with the above - mentioned structure will be described in detail with reference to driving waveform diagrams in fig5 . first , a scanning pulse is applied to the cathode 30 and an auxiliary discharging pulse is applied to the auxiliary anode 34 , to thereby generate an auxiliary discharge at the auxiliary discharge space 33 . charged particles produced by the auxiliary discharge are diffused , via a hole at the barrier rib 24 , into the main discharge space 31 . at the same time , a write pulse is applied to the anode 32 to generate the discharge at the main discharge space 31 . such a discharge is sustained by a sustaining pulse applied to the cathode 30 . by this sustaining discharge , electrons excite gas atoms and molecules sealed in the main sustaining space 31 while moving from the cathode 30 into the anode 32 to emit a vacuum ultraviolet ray . during the sustaining discharge , a radio frequency voltage is applied between the first and second radio frequency electrodes 44 and 46 to change an electric field of the main discharge space 31 . more specifically , a radio frequency voltage is applied to the first radio frequency electrode 44 and a center voltage vb of the radio frequency voltage is applied to the second radio frequency electrode 46 , to thereby generate an oscillating electric field at the main discharge space 31 . by this oscillating electric field , a motion direction of electrons being moved from the cathode 30 into the anode 32 is disturbed . in other words , the electrons are moved in a zigzag direction at the main discharge space 31 by the oscillating electric field . accordingly , the electrons excite greater amount of gas atoms and molecules sealed in the main discharge space 31 while moving along a considerably long path . as a result , much more vacuum ultraviolet rays are generated to radiate a fluorescent body , so that the brightness and the discharge efficiency can be improved . in this case , a radio frequency voltage applied to the first radio frequency electrode 44 is applied in such a manner to have a desired time difference from a sustaining pulse applied to the cathode 30 so as not to make an affect to an initiation of the sustaining discharge . further , in order to prevent charged particles caused by the sustaining discharge ( or the direct current discharge ) from being leaked into the barrier rib 24 , the voltage and frequency values of a radio frequency voltage signal applied to the first radio frequency electrode 44 are selected in such a manner that an oscillation width of electrons being moved from the cathode 30 into the anode 32 by the sustaining discharge is much smaller than that of the main discharge space 31 . herein , the radio frequency voltage pulse may have various waveform shapes such as rectangular wave and sinusoidal wave , etc . as described above , the dc - type pdp according to the present invention applies a radio frequency voltage to a motion path of charged particles caused by the direct current discharge to lengthen a discharge path of the charged particles , so that it can improve the brightness and the discharge efficiency . referring now to fig6 there is shown a pdp discharge cell with a dc - type discharge structure according to another embodiment of the present invention . further , fig7 is a plan view of the lower substrate of the discharge cell shown in fig6 . fig8 a and fig8 b are sectional views of the lower substrate taken along a - a ′ line and b - b ′ line in fig7 respectively . in fig6 to fig8 b , the discharge cell includes an upper plate having a first radio frequency electrode 48 provided on an upper substrate 10 , a lower plate having a second radio frequency electrode 50 , a dielectric layer 52 , a scanning electrode 54 , an insulating pattern 56 and an address electrode 58 formed sequentially on a lower substrate 18 , and a barrier rib 24 coated with a fluorescent material 26 . the scanning electrode 54 and the address electrode 58 carry out an address discharge in a dc - type discharge structure to produce priming particles , that is , charged particles as a seed of the radio frequency discharge . an insulating pattern 56 for insulating the scanning electrode 54 and the address electrode 58 is formed in a line shape at the lower portion of the address electrode 58 in such a manner that two electrodes 54 and 58 has a dc - type discharge structure exposed directly to the discharge space . since the scanning electrode 54 and the address electrode 58 is adjacent to each other with having the insulating pattern 56 therebetween , they cause an address discharge by a lower voltage . a resistor layer ( not shown ) may be formed under the scanning electrode 54 or the address electrode 58 . this resistor layer is used as a current limiting resistor for restraining the overshoot of a discharge current and the sputtering . the first radio frequency electrode 48 consists of a transparent electrode so as not to interfere a luminous light . a radio frequency voltage with a frequency of several mhz to hundreds of mhz is applied to the first radio frequency electrode 48 and a center voltage ( i . e ., a reference voltage ) of the radio frequency voltage is applied to the second radio frequency electrode 50 , thereby causing a radio frequency discharge . the dielectric layer 52 is responsible for an insulating layer between the second radio frequency electrode 50 and the scanning electrode 54 . the barrier rib 24 formed between the upper substrate 10 and the lower substrate 18 plays a role to provide a discharge space excluding an optical interference from the adjacent discharge cells as well as to support the upper substrate 10 and the lower substrate 18 . the fluorescent material 26 is coated on the surface of the barrier rib 24 . a discharge gas is injected into the discharge space . the penning effect is mainly utilized for the general ac or dc discharge . on the other hand , in the radio frequency discharge , positive ions keep almost a stationary state and only electrons excite gas atoms while doing an oscillating motion , so that it is effective to use xe gas with a relatively low excitation energy level as the discharge gas . in this case , since a discharge voltage is raised if the xe gas only is used , a mixture gas of he and ne , etc can be used so as to improve the efficiency . the general ac or dc discharge has a disadvantage in that the color purity becomes poor due to a radiation of an orange color generated at an excitation level of ne during the penning action . otherwise , the radio frequency discharge concentrates an energy level of electrons on the excitation energy of xe to prevent the radiation of an orange color generated from ne , so that it can improve the color purity . fig9 a to 9 c are sectional views representing a driving mechanism of the discharge cell in fig6 step by step . referring to fig9 a and 9b , a scanning pulse and a data pulse is simultaneously applied to each of the scanning electrode 54 and the address electrode 58 to generate an address discharge of dc type at the discharge cell . by this address discharge , charged particles are produced at the discharge space as shown fig9 c . these charged particles , that is , electrons and positive ions form a current path between the first and the second radio frequency electrodes 48 and 50 . a discharge current flows via the current path when the scanning pulse and the data pulse is being applied . in other words , electrons as a seed of the radio frequency sustaining discharge are produced within the discharge space by the address discharge . then , a radio frequency pulse is applied to the first radio frequency electrode 48 and a reference voltage of a radio frequency pulse is applied to the second radio frequency electrode 50 , thereby generating an oscillating electric field at the discharge space . by this oscillating electric filed , the electrons ionize and excite discharge gases continuously while doing an oscillation motion within the discharge space as shown in fig9 d to thereby emit more lots of vacuum ultraviolet rays . as a result , a luminous amount of the fluorescent body is increased the vacuum ultraviolet rays . meanwhile , since electrons as a seed of the radio frequency discharge are not produced within the discharge space , a radio frequency discharge fails to be generated in a discharge cell in which an address discharge does not occur . the radio frequency discharge can be stopped by applying a desired level of dc erasing voltage to any one of the scanning electrode 54 , the address electrode 58 , and the first and second radio frequency electrodes 40 and 50 . in this case , electrons are vanished toward an electrode to which an erasing pulse is applied , thereby terminating the radio frequency discharge . fig1 shows an electrode arrangement of a pdp having the discharge cell in fig6 arranged in a matrix pattern . in fig1 , the pdp includes n address electrode lines x 1 to xn , m scanning electrodes y 1 to ym crossed and arranged alternately with the address electrode lines x 1 to xn , and first and second radio frequency electrodes rf 1 and rf 2 . discharge cell are provided at intersections among the address electrode lines x 1 to xn , scanning electrodes y 1 to ym and the first and second radio frequency electrode lines rf 1 and rf 2 . a scanning pulse is line - sequentially applied to the scanning electrode lines y 1 to ym , and a data pulse synchronized with the scanning pulse is applied to the , address electrode lines x 1 to xn in a horizontal line unit . a radio frequency voltage is commonly applied to the first radio frequency electrode line rf 1 while a reference voltage of the radio frequency voltage is commonly applied to the second radio frequency electrodes rf 2 . herein , the first radio frequency electrode line rf 1 and / or the second radio frequency electrode line rf 2 is fabricated in a shape of electrode plate so as to improve the discharge uniformity . fig1 represents waveform diagrams of drive signals for driving the pdp shown in fig1 . in fig1 , xs represents a drive waveform applied to the address electrode lines x 1 to xn ; ys 1 and ts 2 do drive waveforms applied to the first and second scanning electrode lines y 1 and y 2 , respectively ; and rfs 1 and rfs 2 do drive waveforms applied to the first and second radio frequency electrode lines rf 1 and rf 2 , respectively . a scanning pulse − vy is sequentially applied to the scanning electrode lines y 1 to ym , and a data pulse vx corresponding to one bit of each pixel data is applied to the address electrode lines x 1 to xn in a horizontal line unit with being synchronized with the scanning pulse . accordingly , an address discharge of dc type is sequentially generated in a horizontal line unit in accordance with a logical value of the data pulse . at this time , a radio frequency voltage vr is applied to the first radio frequency electrode lines rf 1 while a reference voltage , that is , a direct current bias voltage vb is applied to the second radio frequency electrode line rf 2 . by this radio frequency voltage , a radio frequency discharge is continuously generated at discharge cells producing charged particles by the address discharge to display a desired brightness . in this case , since the radio frequency discharge is generated continuously with the address discharge generated in a line sequence , it is line - sequentially initiated and sustained . further , electrons having done an oscillation motion in the discharge space is attracted and vanished into the scanning electrode lines y 1 to ym by an erasing voltage pulse vcy applied to the scanning electrode lines y 1 to ym sequentially , thereby stopping the radio frequency discharge . accordingly , the brightness can be controlled by adjusting an application time of the erasing voltage pulse vcy . referring now to fig1 , there is shown a discharge cell of a pdp according to still another embodiment of the present invention . fig1 a and fig1 b are plan views showing the structure of the upper plate and the lower plate of the discharge cell in fig1 , respectively . the discharge cell includes a first radio frequency electrode 60 and a scanning electrode 62 arranged , in parallel , on an upper substrate 10 , a second radio frequency electrode 66 and an address electrode 68 arranged , in parallel , on a lower substrate 18 , and a barrier rib 24 coated with a fluorescent material 26 . the first radio frequency electrode 60 and the scanning electrode 62 are arranged , in parallel , on the upper substrate 10 in the horizontal direction , whereas the second radio frequency electrode 66 and the address electrode 68 are arranged , in parallel , on the lower substrate 18 in the vertical direction . the first and second radio frequency electrodes 60 and 66 initiate and sustain a radio frequency discharge . the scanning electrode 62 and the address electrode 68 stop the radio frequency discharge in accordance with a logical value of the data pulse . the scanning electrode 62 and the address electrode 68 has a dc - type discharge structure . in light of a principle of the radio frequency discharge , positive ions sustain almost a stationary state because they have a relatively heavy mass compared with electrons and , therefore , fail to move instantly in accordance with a change in a radio frequency field . accordingly , a protective layer is not need on the upper plate because an ion impact to the electrodes does not exist during the radio frequency discharge , but a protective layer 36 may be formed only on the first radio frequency electrode 60 as shown in fig1 a so as to improve a generation efficiency of secondary electrons . the fluorescent material 26 is coated on the surface of the barrier rib 24 and the lower substrate 18 provided with the second radio frequency electrode 66 and the address electrode 26 . in such a discharge cell , any one of the upper substrate 10 and the lower substrate 18 can be used as a picture display surface . in this case , electrodes arranged at the substrate used as the picture display surface are formed of transparent electrodes capable of transmitting a light . fig1 a and 14c are sectional views showing a driving mechanism of the discharge cell in fig1 step by step . a radio frequency voltage able to initiate the discharge is applied to the second radio frequency electrode 66 and a bias voltage , that is , a center voltage of a radio frequency voltage is applied to the first radio frequency electrode 60 , thereby initiating a radio frequency discharge at the discharge cell as shown in fig1 a . then , a voltage value of the radio frequency voltage applied to the second radio frequency electrode 66 is lowered into such a voltage value that can sustain the discharge while the bias voltage applied to the first radio frequency electrode 60 being sustained as it was . accordingly , in the discharge cell , electrons ionize and excite discharge gases while doing an oscillation motion within the discharge space as shown in fig1 b to emit a vacuum ultraviolet ray , thereby radiating the fluorescent body 26 . subsequently , by applying a positive dc voltage to the scanning electrode 62 and , at the same time , applying a negative dc voltage to the address electrode 68 , electrons are attracted into the scanning electrode 62 applied with the positive voltage with reducing their oscillation width to vanish charged particles , thereby stopping the discharge . fig1 shows an electrode arrangement of a pdp having the discharge cell in fig1 arranged in a matrix pattern . in fig1 , the pdp includes first radio frequency electrode lines rf 1 and scanning electrode lines y 1 to ym arranged alternately , and second radio frequency electrode lines rf 2 and address electrode lines x 1 to xn crossing with the first radio frequency electrode lines rf 1 and the scanning electrode lines y 1 to ym . a discharge cell 45 is provided at each intersection between the first radio frequency electrode lines rf 1 and the scanning electrode lines y 1 to ym and between the second radio frequency electrode lines rf 2 and the address electrode lines x 1 to xn . the first and second radio frequency electrode lines rf 1 and rf 2 are used to initiate and sustain a radio frequency discharge . the address electrode lines x 1 to xn and the scanning electrode lines y 1 to ym are used to erase the discharge selectively in accordance with a data while scanning the screen . in this case , the address electrode lines x 1 to xn and the scanning electrode lines y 1 to ym are driven individually , whereas the first and second radio frequency electrode lines rf 1 and rf 2 are driven commonly . fig1 represents waveform diagrams of drive signals for driving the pdp shown in fig1 . the driving waveforms in fig1 are applied to a selective erasing method that erasing the discharge in discharge cells without any display data in a row line unit while initiating a radio frequency discharge at all the discharge cells simultaneously and then sustaining the radio frequency discharge . first , a radio frequency voltage vrf with a voltage for the discharge initiation is applied to the second radio frequency electrode lines rf 2 and a center voltage vc of the radio frequency voltage is applied to the first radio frequency electrode lines rf 1 , thereby initiating a radio frequency discharge at all the discharge cells . next , a voltage value of the radio frequency voltage applied to the second radio frequency electrode lines rf 2 is lowered into a discharge sustaining voltage value vrs to sustain the radio frequency discharge . then , a scanning pulse ( i . e ., an erasing pulse ) with a positive voltage value va 1 is line - sequentially applied to the scanning electrode lines y 1 to ym . at the same time , a data pulse with a negative voltage value − va 2 is synchronized with the scanning pulse ( or the erasing pulse ) and applied to the address electrode lines x 1 to xn in a line unit in correspondence with a low logical value ( i . e ., ‘ 0 ’) of video data . accordingly , the radio frequency discharge is erased at the discharge cells to which a low logical value of data pulse is applied , whereas the discharge is sustained at the discharge cells to which a low logical value of data pulse is not applied by the radio frequency voltage applied between the first and second radio frequency electrodes rf 1 and rf 2 . at this time , a voltage value va 1 of the scanning pulse ( or the erasing pulse ) applied to the scanning electrode lines y 1 to ym is properly enlarged compared with a voltage value va 2 of the data pulse applied to the address electrode lines x 1 to xn , thereby minimizing an interference upon addressing of other lines . if a desired discharge sustaining interval for displaying a certain brightness lapses , then an erasing voltage ( ve ) pulse with a relatively large width is line - sequentially applied to the scanning electrode liens y 1 to yn to stop the radio frequency discharge having been sustained in a desired time interval . in this case , the brightness control is permitted by adjusting an application time of the erasing voltage ( ve ) pulse in accordance with a gray level of the display cell . as described above , in the pdp according to the present invention , an address discharge of dc type and a radio frequency discharge is allowed , so that the brightness and the discharge efficiency can be maximized . also , according to the present invention , charged particles formed by the dc priming discharge is used for the sustaining discharge to allow an easy radio frequency discharge , so that a low power consumption is permitted . although the present invention has been explained by the embodiments shown in the drawings described above , it should be understood to the ordinary skilled person in the art that the invention is not limited to the embodiments , but rather that various changes or modifications thereof are possible without departing from the spirit of the invention . accordingly , the scope of the invention shall be determined only by the appended claims and their equivalents . | 7 |
the surgical instrument in the first embodiment includes an elongate support member having a proximal portion and a distal portion lying along a longitudinal axis . a distal wrist member is rotatably coupled to the distal portion of the support member by a wrist joint . first and second opposed work members are mounted to respective first and second driven capstans . the first and second driven capstans are rotatably mounted to the wrist member by respective first and second capstan joints which preferably have a common axis . first , second , third and fourth intermediate idler pulleys are rotatably mounted to the wrist member about the wrist joint . a cable drive system including first , second , third and fourth cables is provided . each intermediate idler pulley is engaged by one cable and each driven capstan is drivingly engaged by two cables . the cable drive system is capable of pivoting the wrist member about the wrist joint and pivoting the work members independently of each other about the capstan joints . in preferred embodiments , a linear bearing is mounted in sliding engagement with the support member for allowing the distal portion of the support member to be reciprocated along the longitudinal axis relative to the proximal portion of the support member . in such embodiments the cable drive system is capable of translating the support member along the longitudinal axis . in preferred embodiments , the support member may also include a rotary joint separating the proximal and distal portions of the support member for allowing rotation of the distal portion relative to the proximal portion about the longitudinal axis . in such embodiments the first through fourth cables are capable of twisting about the longitudinal axis during rotation of the distal portion and the cable drive system comprises a fifth cable coupled to the rotary joint for rotating the distal portion about the longitudinal axis . the present invention also provides a novel system for tensioning the first , second , third and fourth cables . a first proximal idler pulley rotatably engages and tensions the first and second cables . a second proximal idler pulley rotatably engages and tensions the third and fourth cables . fifth and sixth cables are connected to the first and second proximal idler pulleys for tensioning the first and second proximal idler pulleys . a third more proximal idler pulley is rotatably mounted to a support member for rotatably engaging and tensioning the fifth and sixth cables . the surgical instrument further includes a plurality of actuators , each for driving one of the cables of the cable drive system . the instrument preferably comprises one actuator for each degree - of - freedom of the instrument . the actuators are preferably servomotors which are positioned between the intermediate idler pulleys and the proximal idler pulleys . the servomotors are preferably directly coupled to the cables by means of a drive capstan mounted on the drive shaft of the servomotor . the surgical instrument is adapted to be a slave device which is controlled by a master device and a controller . movements of the instrument and the master device as well as forces exerted thereon may be scaled between the instrument and the master device . a positioning mechanism having two degrees - of - freedom may be mounted to the instrument for positioning the instrument over a work site . the positioning mechanism may provide the instrument with redundant degrees - of - freedom for positioning the endpoint . the combination of a positioning mechanism with the applicants articulated surgical instrument is adapted to enable a surgeon operating the master device to feel forces that are experienced by the instrument during positioning and use of the instrument with greater sensitivity than with prior systems . details about the preferred attributes of the surgical system are also described in applicants &# 39 ; copending applications titled “ force - reflecting surgical instrument and positioning mechanism for performing minimally invasive surgery with enhanced dexterity and sensitivity ” and “ wrist mechanism for surgical instrument for performing minimally invasive surgery with enhanced dexterity and sensitivity ” filed on even date herewith . the disclosures of these applications are incorporated herein by reference . referring to fig1 , telesurgery system 10 allows a surgeon at one location to perform surgery on a patient at another location . the surgeon may be in the same operating room as the patient or many miles away . telesurgery system 10 includes a force - reflecting surgical instrument 12 which is mounted by a bracket 36 to a positioning mechanism 14 . instrument 12 and positioning mechanism 14 are controlled by a computer 11 and a master device 150 which is manipulated by a surgeon at a remote location . instrument 12 and positioning mechanism 14 are driven by drive motors m 1 , m 2 , m 3 , m 4 , m 5 , m 6 and m 7 ( fig3 , 6 and 7 a - b ) in conjunction with a series of cables and pulleys . instrument 12 has low friction , low inertia and high bandwidth but a small range of motion . positioning mechanism 14 has a large range of motion but typically has a higher inertia and a lower bandwidth than the instrument . the combination of instrument 12 and positioning mechanism 14 in a macro / micro actuation scheme results in a system with increased dynamic range compared to either of its individual components . positioning mechanism 14 provides telesurgery system 10 with redundant degrees - of - freedom and helps positions instrument 12 at a surgical worksite so that instrument 12 is generally in the proper location for performing the necessary surgery . thus , by mounting instrument 12 on positioning mechanism 14 , telesurgery system 10 is provided with high quality force control through the use of instrument 12 while at the same time having a large range of motion due to positioning mechanism 14 . instrument 12 is mounted on positioning mechanism by means of mounting bracket 36 . preferably , the instrument 12 is releasably attached to positioning mechanism 14 using any suitable releasable attachment means such as screws , bolts , clamps . instrument 12 has a proximal portion 28 a which is rotatably coupled to a distal portion 28 b by a rotary joint 26 . proximal portion 28 a is slidably coupled to a sliding bracket 96 which forms a sliding joint 30 . sliding bracket 96 is fixed to bracket 36 . bracket 36 is a mounting bracket which releasably connects instrument 12 to positioning mechanism 14 . distal portion 28 b of instrument 12 includes a wrist member which is rotatably coupled to a tubular support member 24 by a wrist joint 16 . two opposed work members 20 a and 20 b are fixed to respective driven capstans 18 a and 18 b which are rotatably coupled to wrist member 22 about capstan joints 19 a and 19 b . the work members 20 a and 20 b can be the operative end of standard surgical instruments such as scissors , retractors , needle drivers and electrocautery instruments . instrument 12 has five degrees - of - freedom with sliding joint 30 providing linear motion along longitudinal axis c - c , rotary joint 26 providing rotational motion about axis c - c , wrist joint 16 providing rotational motion about axis b - b and capstan joints 19 a and 19 b providing rotational motion about axis a - a for work members 20 a and 20 b . instrument 12 provides master device 150 with four degrees of force reflection so that the surgeon can have tactile feedback of surgical procedures . these degrees of force reflection include x , y and z forces exerted on the work members 20 a and 20 b , as well as the holding force between work members 20 a and 20 b . however , force reflection can be provided on more or fewer motion axes as required in any particular embodiment . positioning mechanism 14 is a two degree - of - freedom linkage which is preferably a four bar linkage which rotates about an axis e - e . positioning mechanism 14 has a series of rigid members 36 , 40 , 42 , 60 and 62 which are joined together by joints 34 , 38 , 48 , 50 , 52 , 54 , 56 . positioning mechanism 14 also includes a base 68 having ears 58 which engage shafts 64 and 66 to form a joint 57 for pivoting about axis e - e . joint 56 allows link 62 to rotate about axis d - d which is orthogonal to axis e - e . the four bar linkage of rigid members 36 , 40 , 42 , 60 and 62 transmits this rotation to instrument 12 via bracket 36 causing instrument 12 to rotate about axis e - e and axis d ′- d ′ ( axis d ′- d ′ is parallel to axis d - d and intersects axis e - e orthogonally ). thus the four bar linkage operates to move point p . sub . s of instrument 12 about the surface of a sphere having its center at a remote center 111 . although a four bar linkage has been shown , the articulated surgical instrument of the present invention can be supported by any suitable positioning mechanism . to be suitable for minimally invasive surgery the positioning mechanism must pivot the surgical instrument about axes that intersect at the orifice through which the instrument is inserted into the patient . haptic master device 150 suitable to control instrument 12 is a seven degree - of - freedom input device . during use the master 150 is fixed in place to a console or cart or similar stationary support such that the mount provides a fixed reference point . during use , the surgeon manipulates the position and orientation of the master mechanism relative to its stationary support . linkages , motors and encoders of the master detect the surgeon &# 39 ; s movements and transmit them to the computer . the motors of the master preferably also provide force feedback to the surgeon . this controls motions of instrument 12 and positioning mechanism 14 and thus controls the position of the distal end of instrument 12 relative to the surgical site . one apparatus suitable for use as a master in the presently described system is described in u . s . pat . no . 5 , 587 , 937 , titled force reflecting haptic interface the contents of which are incorporated by reference herein . another suitable master device is described in u . s . pat . no . 5 , 576 , 727 , titled electromechanical human - computer interface with force - feedback the contents of which are incorporated by reference herein . the haptic master apparatus disclosed in the above references would require the addition of a further powered degree - of - freedom to provide force reflection from gripping the work members . for example , finger grippers may be attached to a motor and encoder on a separate mechanism for operation by the other hand of the surgeon . alternatively , finger grippers may be attached to a motor and encoder on the same device for operation by the surgeon . when employing telesurgery system 10 for laparoscopic surgery , positioning mechanism 14 is mounted to a manually - operated setup joint ( not shown ). after the setup joint has been used to position the tool and lock the tool in place , the surgeon then manipulates master device 150 to move instrument 12 through a cannula 113 inserted through small incision 112 in the abdominal wall 110 of the patient . in response to manipulation of master device 150 , the distal portion 28 b of the instrument 12 is translated downwardly relative to positioning mechanism 14 along sliding joint 30 for insertion through cannula 113 and abdominal wall 110 . once within the abdomen , the distal portion 28 b of instrument 12 is further positioned over the desired surgical site . fig2 depicts motion of mechanism 14 pivoted about axis d - d in forward and rearward positions for making large position movements . positioning mechanism 14 pivots about axes d - d and e - e to perform large movements of telesurgery system 10 while precise movements are made by the joints of instrument 12 . point 111 on instrument 12 is a remote point of rotation from positioning mechanism 14 which coincides with entry wound 112 . when positioning mechanism 14 is pivoted about axes d and e , instrument 12 pivots about point 111 . note that point 111 adjacent incision 112 remains stationary as the instrument 12 is pivoted within the patient . as a result , incision 112 only needs to be large enough to accept instrument 12 . as positioning mechanism 14 pivots , if wrist member 22 or work members 20 a / 20 b engage tissue causing rotation about joints 16 or 19 a / 19 b , instrument 12 will reorient itself so that instrument 12 is maintained relative to positioning mechanism 14 in the middle of its workspace . if necessary , positioning mechanism 14 can slow down as instrument 12 is reorienting itself . once instrument 12 is in the proper position , by further manipulating master device 150 , the surgeon can perform the necessary surgical procedures on the patient with instrument 12 . forces experienced by instrument 12 are reflected back to the surgeon by master device 150 . the reflected forces may be scaled up in order to allow the surgeon to better “ feel ” the surgical procedures . as a result , the surgeon can feel instrument 12 engaging types of tissue that do not provide much resistance . in addition , movements of master device 150 relative to instrument 12 may be scaled down so that the precision and dexterity of instrument 12 can be increased . positioning mechanism 14 , because it is optimized to have a large range of motion , is likely to have higher inertia , higher friction and lower resolution than instrument 12 . moreover , friction forces in cannula 113 and disturbance forces at incision 112 may be applied to the positioning mechanism . however , in applicants &# 39 ; preferred embodiment , primarily the surgical instrument detects forces for force reflection . therefore , the higher inertia and friction of the positioning mechanism and the extraneous forces acting on it are excluded from the force reflection system . thus , the quality of the force reflection between the tip of the instrument 12 and the master device is greatly improved . referring to fig3 and 5 , instrument 12 is now described in greater detail . tubular support member 24 of distal portion lies along axis c - c and houses a series of cables c 1 , c 2 , c 3 and c 4 which travel the length of tubular support member 24 . cables c 1 , c 2 , c 3 and c 4 control the rotation of joints 19 a , 19 b and 16 for controlling the operation of work members 20 a and 20 b and the orientation of wrist member 22 . wrist member 22 includes two opposed distal ears 21 a and 21 b forming a clevis for supporting driven capstans 18 a and 18 b at respective capstan joints 19 a and 19 b which lie along axis a - a . wrist member 22 also includes two opposed proximal ears 23 a and 23 b forming a clevis for supporting intermediate idler pulleys 70 and 72 which lie along axis b - b between ear 23 a and tongue 24 a at wrist joint 16 . intermediate idler pulleys 74 and 76 are supported between ear 23 b and tongue 24 a . cables c 1 , c 2 , c 3 and c 4 engage driven capstans 18 a / 18 b as well as intermediate idler pulleys 70 , 72 , 74 and 76 as described later in greater detail . work members 20 a and 20 b may be removably fixed to respective driven capstans 18 a and 18 b . although work members 20 a and 20 b are depicted in the figures as being grippers , work members 20 a and 20 b can be replaced with other types of work members such as scissors , cutters , graspers , forceps or needle holders for stitching sutures . typically , the work members are fixed to driven capstans 18 a and 18 b by a screw , clip or other suitable fastener . however , the work members may also be permanently affixed to the driven capstans by soldering or welding or the like or may be formed in one piece with the driven capstans . work members 20 a and 20 b together comprise one form of surgical end effector . other surgical end effectors may be used in the surgical instrument of the present invention . end effectors simply may comprise standard surgical or endoscopic instruments with their handles removed including , for example , retractors , electrocautery instruments , microforceps , microneedle holders , dissecting scissors , blades , irrigators , and sutures . the end effectors will typically comprise one or two work members . proximal portion 28 a of instrument 12 includes support brackets 98 and 102 which are connected together by a support rod 100 as well as two guide rails 104 and 106 . a rotary bearing 91 forming rotary joint 26 is housed within support bracket 98 for supporting tubular support member 24 . sliding bracket 96 is slidably mounted to guide rails 104 and 106 along linear bearings . as shown in fig1 , sliding bracket 96 is connected by bracket 36 to positioning mechanism 14 . sliding bracket 96 preferably has about 8 inches of travel for surgical applications . drive motors m 1 , m 2 , m 3 , m 4 and m 5 are mounted to sliding bracket 96 and drive respective cables c 1 c 2 , c 3 and c 4 and c 5 . sliding bracket 96 supports each of the drive motors . during operation sliding bracket 96 is connected to positioning mechanism 14 by mounting bracket 36 . when instrument 12 is mounted on positioning mechanism 14 , the drive motors operate to move distal portion 28 b relative to sliding bracket 96 . sliding bracket 96 thus forms the support bracket of the surgical instrument . each drive motor m 1 , m 2 , m 3 , m 4 and m 5 includes a respective encoder e 1 , e 2 , e 3 , e 4 and e 5 for providing computer 11 with the rotational position of their respective drive shafts . as shown in fig4 , drive motor m 5 has a drive shaft capstan 93 which engages a cable drive loop consisting of cable c 5 . the cable passes around rear tensioning pulley 83 . the cable passes around idler pulleys 84 and 85 and around drive capstan 90 which forms the proximal end of tubular support member 24 . thus rotation of actuation of motor m 5 can be used to rotate tubular support member 24 and the end effector it supports . referring to fig6 , the cable drive system of instrument 12 is now described in greater detail . work members 20 a and 20 b , wrist member 22 and the translation of instrument 12 along longitudinal axis c - c are driven by cables c 1 , c 2 , c 3 and c 4 which are arranged in an n + 1 actuation scheme . the n + 1 actuation scheme allows the actuation of a three degree - of - freedom wrist using four cables . four cables is the theoretical minimum possible number of tension elements required to drive three degrees - of - freedom and thus allows the instrument to be of minimum size and weight . alternative actuation schemes using more cables may be desirable in situations where the forces required for actuation of different motions differ greatly in magnitude . the disadvantage of using more cables is an increase in weight , complexity and minimum size . in fig6 , the rotational motion of joint 26 about axis c - c is omitted in order to more easily show cables c 1 - c 4 . such rotation results only in twisting of the cables c 1 - c 4 between motors m 1 - m 4 and pulleys 70 , 72 , 74 and 76 . the cables are however arranged in tubular support member 24 such that this twisting does not significantly change the length of the cable path . care should however be taken to prevent over - rotation of the instrument which would cause the cables to twist into contact with each other and create friction between the cables . as shown in fig6 , cables c 1 and c 2 form two sides of a continuous cable loop 44 . cable c 1 of loop 44 engages a proximal idler pulley 80 , the drive shaft of motor m 1 , intermediate idler pulley 70 and driven capstan 18 a . cable loop 44 returns from driven capstan 18 a as cable c 2 and engages intermediate idler pulley 76 , the drive shaft of motor m 2 and proximal idler pulley 80 . as shown in fig6 , cables c 3 and c 4 form two sides of a continuous loop of cable 46 . cable c 3 of cable loop 46 engages proximal idler pulley 78 , the drive shaft of motor m 3 , intermediate idler pulley 72 and driven capstan 18 b . cable loop 46 returns from driven capstan 18 b as cable c 4 and engages intermediate idler pulley 74 , the drive shaft of motor m 4 and proximal idler pulley 78 . as shown in fig6 , proximal idler pulleys 78 and 80 are tensioned by cables c 7 and c 6 which are fixed to the center of proximal idler pulleys 78 and 80 . cables c 7 and c 6 form two sides of a single cable 45 which engages proximal idler pulley 82 which is rotatably mounted to support bracket 102 by shaft 82 a . shaft 82 a is preferably movably mounted to support bracket 102 by a mechanism such as a lead screw . the lead screw may then be adjusted to appropriately tension cables c 7 and c 6 . the tension is also applied via idler pulleys 78 and 80 to cables c 1 , c 2 , c 3 and c 4 . a similar lead screw tensioning scheme can be used to tension cable c 5 by longitudinal movement of idler pulley 83 . it may be required for idler pulleys 82 and 83 to be mounted on separately adjustable shafts for these purpose instead of single shaft 82 a illustrated in fig3 . driven capstans 18 a and 18 b may have different diameters in order to allow cables c 1 through c 4 to suitably engage their respective intermediate idler pulleys . cables c 1 and c 2 engage the outer intermediate idler pulleys 70 and 76 while cables c 3 and c 4 engage the inner intermediate idler pulleys 72 and 74 . proximal idler pulleys 78 and 80 are sized such that pulley 80 is larger than pulley 78 to keep the cables straight . drive motors m 1 , m 2 , m 3 and m 4 control rotation of wrist member 22 about axis b - b , translation of instrument 12 longitudinally along axis c - c and rotation of work members 22 a and 22 b independent of each other about axis a - a by driving cables c 1 , c 2 , c 3 and c 4 . drive motors m 1 and m 2 drive cables c 1 / c 2 in unison in opposition to cables c 3 / c 4 driven by drive motors m 3 and m 4 in order to rotate wrist member 22 about axis b - b . drive motor m 1 drives cable c 1 in opposition to cable c 2 driven by drive motor m 2 to rotate capstan 18 a and attached work member 20 a about axis a - a . in addition , drive motor m 3 drives cable c 3 in opposition to cable c 4 driven by drive motor m 4 to rotate capstan 18 b and attached work member 20 b about axis a - a . all four drive motors m 1 , m 2 , m 3 and m 4 drive cables c 1 , c 2 , c 3 and c 4 simultaneously to translate instrument 12 along longitudinal axis c - c . locating drive motors m 1 , m 2 , m 3 , m 4 and m 5 on sliding bracket 96 makes the distal portion 28 b of instrument 12 have a small moving mass since the motors themselves remain stationary during actuation of the instrument . although the motors are moved by positioning mechanism 14 , the weight and inertia , of the motors do not affect force reflection . this is because , as stated above , in the preferred embodiment , only the instrument is used to reflect forces to the master . in addition , employing cables instead of gears to control instrument 12 minimizes the amount of friction and backlash within instrument 12 . the combination of small moving masses and low friction enables instrument 12 to provide force reflection to master device 150 with high sensitivity . certain possible changes to the configuration of pulleys , cables and motors described above will be apparent to those of skill in the art . although cables c 1 / c 2 , c 3 / c 4 , c 5 and c 7 / c 6 have been depicted to be sides of the same cables , cables c 1 - c 7 alternatively can each be individual cables which are fixed to driven capstans 18 a and 18 b , and proximal idler pulleys 78 , 80 and 82 . moreover , although drive motors m 1 , m 2 , m 3 and m 4 have been depicted to drive cables c 1 , c 2 , c 3 and c 4 respectively , alternatively , some drive motors can be relocated from cables c 1 - c 4 onto cables c 7 and c 6 for driving cables c 7 and c 6 . the choice of the particular drive scheme employed in a particular embodiment will depend on the constraints of the forces required to be exerted by the instrument and the need to reduce the inertia and friction of the parts of the instrument that move during its actuation . the surgical instrument of the present invention has been illustrated as using drive motors m 1 , m 2 , m 3 , m 4 and m 5 . this drive motors may be standard servo motors having position encoders as shown in fig3 . however , other actuators may be used , such as hydraulic actuators and piezoelectric motors . to be used as an actuator in the present surgical instrument a drive mechanism should be able to provide variable and controllable force and position control . cables c 1 , c 2 , c 3 , c 4 , c 7 , c 8 and c 9 are driven by being wrapped about the drive shaft of their respective drive motors m 1 , m 2 , m 3 , m 4 , m 5 , m 6 and m 7 . this cable drive method and an alternative cable drive method are illustrated in more detail in fig7 a and 7 b . for example , in fig7 a , cable c 4 of cable loop 46 is wrapped around the drive shaft of motor m 4 . cable c 4 is preferably wrapped two times around the drive shaft to provide enough friction between the cable c 4 and the drive shaft to prevent slippage . in order to further prevent slippage the cable may be fixed to the drive shaft at one point by soldering , welding or mechanical fixing means . however , in such an embodiment the range of motion of the cable is limited by the length of cable wrapped around the drive shaft or capstan thus several turns of cable are usually required . fig7 b depicts another preferred method for driving cables . for example , motor m 4 includes a drive wheel 43 a and a idler wheel 43 b for frictionally driving an elongate member 47 therebetween . cable c 4 consists of two halves , 46 a and 46 b which are fixed to opposite ends of member 47 . fig8 depicts the distal end and wrist member 116 of another preferred instrument 117 . instrument 117 differs from instrument 12 in that instrument 117 includes eight intermediate idler pulleys instead of four . instrument 117 includes intermediate idler pulleys 76 , 74 , 72 and 70 at wrist joint 16 but also includes intermediate idler pulleys 76 a , 74 a , 72 a and 70 a which are positioned adjacent to idler pulleys 76 , 74 , 72 and 70 on tongue 24 a along shaft 118 . cables c 1 , c 2 , c 3 and c 4 do not make a complete wrap around each intermediate idler pulley but instead contacts a variable amount of the of the surface of each pulley varying in a range between 0 . degree . and 180 . degree . over the range of motion of the wrist about axis 16 . this prevents the cables from crossing each other and rubbing together which prevents friction and noise . although the present invention has been described for performing laparoscopic surgery , it may also be used for other forms of endoscopic surgery as well as open surgery . the present manipulator could also be employed for any suitable remote controlled application requiring a dexterous manipulator with high quality force feedback . moreover , while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 0 |
reference is first made to fig1 . the appliance illustrated therein is denoted overall by reference numeral 10 . the appliance is a refrigerator having a cabinet construction , which is used for keeping foods cold , and if needed may additionally have a freezer compartment which is situated either within the cooling chamber of the refrigerator 10 and closable with respect to the cooling chamber by a door , or , as in the case of top freezer or bottom freezer refrigerators , is situated above or below the cooling chamber . the refrigerator 10 has a cabinet body 12 with a base wall 14 , a top wall 16 , a rear wall 18 , and two side walls 20 . the cabinet body 12 forms an access opening 22 which is bordered by the base wall 14 , the top wall 16 , and the two side walls 20 , and which is closable by a cabinet door 24 which is hinged so that is pivotable about a vertical pivot axis , and through which an interior 26 of the refrigerator 10 is accessible to the user . the interior 26 of the refrigerator 10 may be equipped with a wide variety of built - in parts which are suitable for the storage and placement of foods . at least one of these built - in parts is a plate - shaped shelf 28 made of a light - permeable material ( for example , glass or plastic ), with a lighting strip 30 situated on its front narrow side , i . e ., facing the user , which extends essentially over the entire width of the shelf 28 ( i . e ., from one of the side walls 20 to the opposite side wall 20 ). the lighting strip 30 has an illumination function for the shelf and also for the area of the interior 26 situated beneath the shelf 28 . for this purpose , the lighting strip 30 contains a plurality of light sources , situated in succession in the strip longitudinal direction ( corresponding to a direction from one of the side walls 20 to the opposite side wall 20 ), a portion of whose light is coupled into the front narrow side of the shelf 28 and another portion of which is directed past the shelf 28 and into the area of the interior 26 situated beneath the shelf 28 . particulars concerning the design of the lighting strip 30 are explained in greater detail below in conjunction with fig2 . the lighting strip 30 may be fastened to the shelf 28 . alternatively , it may be mounted on the side walls 20 or on retaining elements ( not illustrated in greater detail ) which are fastened to the side walls 20 . besides its illumination function , the lighting strip 30 provides for edge protection of the shelf 28 by covering the front narrow side of the shelf 28 and thus protecting if from mechanical damage . in the example shown , the refrigerator 10 contains an additional shelf 32 , which like the shelf 28 is used for placing foods on it . although this is not illustrated in fig1 , the shelf 32 may also be equipped with a further lighting strip 30 . regardless of whether the shelf 32 is equipped with its own lighting strip 30 , it is preferably likewise ( the same as the shelf 28 ) made of a light - permeable , i . e ., transparent or translucent , material . reference is now also made to fig2 for explaining the design particulars of the lighting strip 30 . in this figure the lighting strip 30 is shown in a sectional illustration ; a corresponding section plane is depicted in dashed lines and denoted by reference character e in fig1 . the lighting strip 30 , which forms an illumination device within the meaning of the invention , has a cover part 34 made of a light - impermeable material ( plastic or metal , for example ) which has an essentially constant cross section over the entire length of the lighting strip 30 and which forms a receptacle for a lighting unit 36 . the lighting unit 36 may be preassembled as a unit and inserted into the receptacle formed by the cover part 34 . the cover part 34 , viewed in the sectional illustration according to fig2 , as a rough approximation is designed as an angled strip having a horizontal upper strip leg 38 and a vertical strip leg 40 adjoining at essentially right angles to the strip leg 38 , and situated in front of the shelf 28 as viewed by the user of the refrigerator 10 . at a distance from the upper horizontal leg 38 , a further horizontal leg 42 which is shorter than the upper horizontal leg 38 and situated at a distance beneath the shelf 28 , viewed in the vertical direction , extends from the vertical leg 40 . the lighting unit 36 is inserted into the space between the upper horizontal leg 38 and the lower horizontal leg 42 of the cover part 34 . a secure connection between the lighting unit 36 and the cover part 34 may be established , for example , by a snap connection or an adhesive bond between the two components . the lighting unit 36 has a hollow profile member 44 manufactured from a light - permeable plastic by extrusion , for example , with a profile cavity 46 that is closed all around . an elongated circuit board 48 which is used as a support strip is inserted into the profile cavity 46 , and a plurality of light - emitting diodes 50 are mounted in succession on the circuit board in the strip longitudinal direction ( corresponding to a direction perpendicular to the plane of the drawing in fig2 ). only one of these light - emitting diodes 50 is discernible in fig2 . the following explanations for directing the light generated by the one light - emitting diode 50 in fig2 similarly apply for the remaining light - emitting diodes of the lighting unit 36 . the board plane of the circuit board 48 is vertically oriented , so that a center axis of the main beam lobe of each of the light - emitting diodes 50 is oriented essentially horizontally for a customary installation of the light - emitting diodes 50 on the circuit board 48 . a portion of the profile wall of the hollow profile member 44 forms a light - directing wall 52 , through which the light generated by the light - emitting diode 50 is directed into the shelf 28 and into the interior 26 of the refrigerator 10 . the light - directing wall 50 [ sic ; 52 ] is made up of a first wall section 54 and a second wall section 56 . the first wall section 54 is situated directly in front of the front narrow side of the shelf 28 denoted by reference numeral 58 , and in the example shown is in contact with this narrow side 58 . in other embodiments , an intermediate space may be present between the first wall section 54 and the narrow side 58 of the shelf 28 . light which exits from the first wall section 54 is coupled into the shelf 28 via the narrow side 58 , as indicated by dashed - line arrows in fig2 . in contrast , light which exits through the second wall section 56 passes directly into the interior 26 of the refrigerator 10 , as indicated by a solid - line arrow in fig2 . the second wall section 56 bridges the vertical intermediate space between the lower horizontal leg 42 of the cover part 34 and the bottom side of the shelf 28 , and in this area extends at an angle with respect to the vertical direction . in the example case shown , the second wall section 56 is slightly curved , and has an essentially constant wall thickness in the area in which it is penetrated by light from the light - emitting diode 50 . the first wall section 54 has a planar design on its outer side facing the narrow side 58 of the shelf 28 , and on its inner side facing the profile cavity 46 has a nose - like projection 60 , at the bottom side of which ( oriented vertically downwardly ) light enters from the light - emitting diode 50 into the projection 60 , and whose nose bridge forms an optical interface with the air present in the profile cavity 46 , so that the light which has passed into the projection 60 may be totally reflected there via the nose underside . as an alternative to a totally reflective interface , it is conceivable to mirror coat the nose bridge with a reflective metal layer . it is apparent in fig2 that the light - emitting diode 50 , viewed in the vertical direction , protrudes partially downwardly over the bottom side of the shelf 28 . this is equivalent to a portion of the light - emitting diode 50 overlapping vertically with the shelf 58 . by a suitable selection of the vertical position of the light - emitting diode 50 relative to the shelf 28 , the ratio of the radiant power that is emitted by the light - emitting diode 50 through the second wall section 56 into the interior 26 of the refrigerator 10 to the radiant power that is coupled into the shelf 28 by the light - emitting diode 50 through the first wall section 54 via the shelf narrow side 58 may be set as desired . for example , of the radiant power that is emitted overall by the light - emitting diode 50 , a larger portion is emitted into the interior 26 through the second wall section 56 , and a smaller portion is coupled into the shelf 28 through the first wall section 54 . at its top side and / or at its bottom side and / or in its interior , the shelf 28 may be designed with one or more light - scattering structures which may be created , for example , by printing , sandblasting , engraving ( by means of a laser , for example ), or some other suitable method . these types of light - scattering structures may ensure good illumination of objects that are placed on the shelf 28 . the light - directing wall 52 together with the two wall sections 54 , 56 forms a light - directing structure within the meaning of the invention . although the preferred embodiments of the present invention have been described herein , the above description is merely illustrative . further modification of the invention herein disclosed will occur to those skilled in the respective arts and all such modifications are deemed to be within the scope of the invention as defined by the appended claims . | 5 |
with reference to the drawing a preferred two stroke variable compression ratio ( vcr ) piston 10 is there illustrated as comprising an inner member 12 having a radially reduced upper portion 14 . an outer piston member 16 is mounted to the outer surface of the reduced portion 14 . the outer member 16 has a crown 18 which serves as the head of the piston 10 and which is compatible with the selected combustion system . the crown 18 forms a movable wall of the lower boundary of the combustion chamber of the engine ( not shown ). the outer member 16 is axially slideably mounted to the outer surface of the section 14 of the inner member 12 . in the illustrated construction a plate 22 is mounted to the top of the inner member 12 preferably by bolts 23a and 23b and a ring 24 having external threads 26 is mounted to the outer member 16 by threads 28 formed on the inside surface of the lower portion of the outer member 16 , the threaded joint formed between the ring 24 and the outer member and 16 being only one preferred method of attachment . the bolts 23a and 23b are alternate methods of fastening the plate 22 to the top of the inner member 12 and only one of these alternate forms need be used . a lock and travel limiting means , such as a lock pin 30 , prevents rotation of the ring 24 relative to the piston outer member 16 and , therefore , axial travel of the ring 24 . there are , of course , other suitable means which have not been shown for limiting travel of the ring 24 . a seal 32 carried by the plate 22 and a seal 34 carried by the reduced portion 14 of the inner member 12 engages the ring 24 to provide a fluid seal between the piston members in the area of the sliding contact . an upper chamber 36 is formed between the plate 22 and the inside surface of the crown 18 and a lower annular chamber 38 is formed between the lower edge of the plate 22 , the outer member 16 and the ring 24 closely adjacent the ring groove area 37 of the piston 10 . the sealing ring 34 prevents oil leakage from the lower chamber 38 except through a passage 40 which is formed through the plate 22 and connects the upper chamber 36 to the lower chamber 38 . the passage 40 provides fluid transfer between the upper chambers 36 and the lower chamber 38 and is not biased to provide a different orifice coefficient between these chambers as is provided in some previous construction . the inner member 12 is connected to a connecting rod 42 by a piston pin 44 in the conventional manner of connecting an engine piston to a connecting rod . a passage 58 in the inner piston member 12 communicates with the lubrication system of the engine through the connecting rod 42 by means not shown . a valve assembly 60 which is carried in a cavity 62 of the plate 22 or in the inner member 12 ( not shown ) communicates and is disposed between upper chamber 36 and an oil passage 65 . the valve assembly 60 is constructed so as to permit the passage of oil from the passage 65 through the valve assembly 60 to the chamber 36 . in the construction of the valve assembly 60 as shown , a ball 68 is carried within the tubular portion 64 and is normally positioned on a seat 70 to block fluid flow from the chamber 36 through the passage 66 to the passage 65 but is movable under pressure and inertia to a position to provide an opening for fluid flow from the passage 65 through the passage 66 to the chamber 56 . a radially extending central portion 72 of the valve assembly 60 provides a means for carrying a tapered washer of belleville spring type discharge valve 74 which in its closed position blocks fluid flow from a passage 76 connected through the plate 22 to the upper chamber 36 to a passage 78 formed through the inner member and open at its lower end to the crankcase ( not shown ) of the engine . a substantially axially extending cylindrical bore 90 is formed within the inner member 12 of the piston assembly 10 and is closed at its lowermost end by any conventional means such as a threaded plug 92 . a plunger 94 preferably constructed of a high density material and having an upper reduced diameter portion 96 is slidably disposed within the recess 90 and is movable between an upper or outer position illustrated in fig2 and a lower or inner position illustrated in fig1 . a leak passage 98 is provided between the upper end of the bore 90 and the outer periphery of the inner member 12 . the leak passage 98 permits oil and crankcase gases entrapped within an upper chamber 100 of the bore 90 to discharge from the chamber 100 past the reduced diameter portion 96 of the plunger 94 to the cylinder walls as long as the large diameter portion of the plunger 94 does not block the passage 98 . a cylindrical chamber 102 is formed in the lower portion of the bore 90 between the plug 92 and the inner end of the plunger 94 . the passage 58 fluidly communicates with the chamber 102 through a one way check valve 104 and passage 105 . preferably the check valve assembly 104 comprises a ball 106 which normally sits on a seat 108 to prevent fluid flow from the chamber 102 into the passage 58 but which opens to permit fluid to flow from the passage 58 and into the chamber 102 . a second supply passage 110 intersects the first supply passage 65 at its upper end and is connected to the chamber 102 by a port 111 at its lower end . thus , the chamber 102 fluidly communicates with the upper chamber 36 via the port 111 , passageways 110 and 65 , and the valve assembly 60 . as thus far described , it is apparent that the inner member 12 being connected to the connecting rod 42 in the conventional manner moves up and down within the cylinder of an internal combustion engine within fixed limits and in the manner of a conventional piston . the outer member 16 reciprocates within the cylinder within the axial limits defined at its lower limits by the crown 18 engaging the top of the plate 22 and at its upper limit by the top of the ring 34 engaging the lower edge of the plate 22 . assuming that the outer piston member 16 is separated from the inner member 12 ( in a manner which will be shortly described in detail ) as the piston assembly 10 approaches its most extended position within the cylinder of the internal combustion engine , the plunger 94 shifts axially upwardly within the bore 90 due to the inertia of the plunger 94 as shown in fig2 . this movement of the plunger 94 increases the volume of the chamber 102 and draws oil from the oil lubrication system of the engine through the passage 58 , the check valve 104 and into the chamber 102 . oil flow through the supply passages 65 and 110 is prohibited since the valve 60 is closed . simultaneously the large diameter portion of the plunger 94 covers the leak passageway 98 such that the relatively small amount of oil and crankcase products entrapped within the chamber 100 acts as a cushion for the rising plunger 94 . the leak passage 98 , however , prevents a build up of excess oil pressure within the chamber 100 . during engine combustion the increased pressure within the combustion chamber of the cylinder is transmitted through the crown 18 to the oil within the chamber 36 . the increased oil pressure within the chamber 36 acts upon the valve 74 and snaps it downwardly upon a predetermined pressure being produced to thereby permit oil from the chamber 36 to discharge through the passageways 76 and 78 and into the crankcase lubrication system of the engine . in this way , a predetermined maximum combustion pressure is mantained after the engine has gradually achieved this pressure by gradual extension of the piston assembly . as more fully described in a patent application entitled variable compression ratio piston , ser . no . 611 , 863 and filed on sept . 10 , 1974 and which is of common ownership with the present application the discharge valve 74 provides a faster dumping of the oil from the chamber 36 then has heretofore been achieved . it also permits the height of the valve assembly 60 and thus of the piston 10 to be substantially reduced thereby saving material costs . also because of the high area to weight ratio of the valve 74 it permits a more precise control and it is less sensitive to inertia than previously known vcr discharge valves . following engine combustion , the piston 10 is driven downwardly in the engine cylinder . as the piston 10 approaches its most retracted position within the engine cylinder , typically within 110 ° of bottom dead center , the plunger 94 due to inertia moves axially downward within the bore 90 and toward the cap 92 . this movement of the plunger 94 pumps the oil entrapped within the chamber 102 through the supply passageways 110 and 65 through the valve assembly 60 and into the chamber 36 thereby separating the outer member 16 from the inner member 12 . the increased pressure in the chamber 102 closes the one way valve 104 and prevents oil flow through the passageways 58 and 105 . as more fully described in the aforementioned patent application , the upper chamber 36 is directly connected to the lower chamber 38 by the restricted passageway 40 . there is no valve within the pasage so that oil can flow back and forth between the chamber 36 and 38 . the restriction of the passage 40 , however , limits the rate of fluid flow from the lower chamber 38 to the upper chamber 36 . the oil in the lower chamber 38 offsets the inertia force on the outer member 16 and by reason of the restricted connection 40 between the chambers 36 and 38 , limits excessive piston travel per stroke . it can thus be seen that the plunger 94 and its associated components provide a simple , inexpensive and effective means for pumping oil into the chamber 36 . the plunger 94 thus provides a means for separating the outer piston member 16 from the inner piston member 12 during each reciprocation of the piston 10 such that the piston 10 is particularly suited for a two cycle internal combustion engine . it can also be seen that the employment of a high density material for the construction of the piston 94 so as to insure a high mass versus bore diameter enhances the low speed capability of this vcr concept , particularly when high pressure supercharging is utilized . it can also be seen that at very low engine speeds , such as may be experienced during starting , the oil pressure of the engine would be affected by the chamber 36 by reason of the direct connection between the oil system of the engine and chamber 36 in the absence of the plunger 94 . while it has been preferred to describe the present invention in a vcr assembly which includes an outer member 16 of relatively short axial length so that the lower chamber 38 is quite near the upper chamber 36 , the invention can be used as well in an assembly in which the outer member is of substantially the same axial length as the inner member and the lower chamber is disposed quite near the inner end of the piston assembly . having thus described our invention many modifications thereto will become apparent to those skilled in the art to which it pertains without deviating from the spirit of the invention as defined by the scope of the appended claims . | 5 |
with reference now to the figures , and in particular with reference to fig1 there is depicted a high - level simplified block diagram of an exemplary product 100 utilizing an embodiment of the invention , age processor 110 . product 100 can be any arbitrary product for which information about effective age is desired , and , for example , can be a laptop computer , a digital camera , a video camera , an automobile , or a space vehicle , or part thereof . product 100 is equipped in the example with an embodiment of the invention 110 , comprising a group of sensors 112 , a processor 111 , a nonvolatile storage 113 , a display 114 , and a clock 115 . sensor group 112 is shown to comprise a number of sensors 112 a , 112 b , and 112 n . the number of sensors in sensor group 112 is arbitrary , and can be a single sensor or many sensors . the sensors in sensor group 112 can all be different , monitoring different environmental conditions , such as temperature , humidity , voltage , and thermal cycle information . a number of sensors in sensor group 112 can be the same , monitoring a condition , perhaps temperature , at different places in product 100 . for example , sensor 112 a and sensor 112 b might be temperature sensors in a laptop computer , with sensor 112 a being located near a processor chip , and sensor 112 b being located near a hard disk drive . in the example , sensor 112 n might be a humidity sensor . the outputs of the sensors 112 are shown being electrically coupled to a processor 111 . processor 111 can be a specialized processor , perhaps designed on an application specific integrated circuit ( asic ) semiconductor chip , or can be an off the shelf , readily available processor chip well - known in the art . nonvolatile storage 113 can be any device that retains information even when power is shut off . examples of such devices include “ flash ” memory , commonly used in digital cameras , magnetic disk storage , or ferroelectric memory devices that are currently available , for example , from ramtron corporation . such devices are commonly separate from the processor , but in some forms can be on the same chip as the processor , especially in the case of ferroelectric memory or flash memory . nonvolatile storage 113 stores such items as total age of the product and effective age , or ages , of the product as will be described below . storage of the program itself , and any constants or parameters needed by the program , would also be stored in nonvolatile storage , although they can be copied to conventional dynamic random access memory ( dram ) or static random access memory ( sram ) during normal operating times when electrical power is available . other forms of nonvolatile memory include , but are not limited to , hard disks , floppy disks , and magnetic tapes . volatile memory is memory that loses stored information when power is removed from the memory . some examples of volatile memory include dram and sram . it is also well - known that dram and sram memory are equivalent to nonvolatile memory if suitable battery backup is provided . display 114 can be any mechanism that will communicate to an interested party information created by age processor 110 . liquid crystal displays ( lcds ), cathode ray tubes ( crts ), warning lights , and light emitting diodes ( leds ) are some of the common forms of displays . clock 115 is a digital clock of known frequency that is electrically coupled to processor 111 . clock 115 can be the normal system clock that processor 111 uses to control its internal processing , or clock 115 can be a separate input to processor 111 . the process of computing age requires a clock of known frequency to update aging values , as will be described later . in general , environmental sensors measure a condition , such as temperature , and produce an analog output . analog to digital converters ( adcs ) are used to produce a digital representation of the analog output . processor 111 is a digital processor and requires such conversion . adc functions can be considered to be included in each of sensors 112 a , 112 b , and 112 n . alternatively , analog signals from sensors 112 a , 112 b , and 112 n can be switched , one at a time , through an analog multiplexer ( not shown ), into a single adc , with the resultant digital representation for the instant analog signal sent to processor 111 . processor 111 receives data from a sensor 112 a , 112 b , or 112 n , and applies that data to an algorithm known to model aging effects of the environmental condition which the instant sensor is measuring . the algorithm will produce an acceleration factor . acceleration factors are usually normalized to some specified environmental condition . for example , a product may have a 70 degree centigrade temperature condition specified as the condition for which its expected life has been calculated . effective aging is often normalized to that specified condition . consider a situation where , due to operation at an elevated temperature , aging is occurring at a rate 20 % faster than aging would occur at the specified condition . the normalized aging rate would be normalized to 1 . 2 . if environmental conditions are less severe than the specified condition , effective aging would be slower than expected from just keeping track of the elapsed hours , often called “ wall clock ” time , and in such a case , the normalized aging rate might be , for example , 0 . 7 . the acceleration factors produced by the models provide an estimate of the rate that aging is occurring . for example , normal “ wall clock ” aging occurs at one hour per hour . an acceleration factor of “ 2 ” means that aging is effectively occurring at two hours per hour . simple “ wall clock ” age is the simple accumulation of one hour for every hour of time that passes . effective age must account for the acceleration factor . if the acceleration factor were a constant “ 2 ” hours per hour , effective age would accumulate at two hours for each hour of time that passes . if the acceleration factor were a constant “ 3 ” hours per hour , effective age would accumulate at three hours for each hour of time that passes . in practice , the acceleration factor is not a constant , but rather , changes as temperature , humidity , voltage , or other environmental factors change during the use of the product . the estimation of effective age in practical applications is accomplished by accumulating , on known time intervals , numbers indicative of the current age acceleration factor . those skilled in the art will recognize this as a time integration of the rate of aging , resulting in effective age . as described earlier , the arrhenius equation is broadly used to model aging rates caused by temperature . processor 111 can have the arrhenius equation included in the set of instructions , or program , that processor 111 executes . the activation energy and specified temperature applicable to each usage of the arrhenius equation would be stored with the program , or alternatively , stored in tables of data used by the program . obviously , well - known table lookup techniques can be utilized in the program instead of use of equations . other aging models were presented earlier and can easily be programmed into and executed by processor 111 . still other aging models are known in the industry , or even will be developed in the future , and such models can be programmed in and executed by processor 111 currently or when they are developed . processor 111 can compute the actual age of the product , the normalized age of the product , or the current effective rate of aging relative to the actual aging of the product . if an expected lifetime is specified by the product manufacturer , based on some specified conditions , processor 111 can compute what fraction of that time has been actually used , or effectively used , given the effective aging of the product . alternatively , the information can be stored and / or presented as how much time does the product have left before it is likely to be worn out . some acceleration factors , such as hallberg - peck , require data on more than one environmental condition . a sensor , such as sensor 112 a , can be thought of as a sensor that returns all the data required for a particular acceleration model . thus , a sensor 112 a providing data for a hallberg - peck model would return both humidity information and temperature information . in practice , such a sensor 112 a would comprise a humidity sensor and a temperature sensor , and would simply report both data when polled by processor 111 . processor 111 can also be readily programmed to use data from multiple sensors in sensor unit 112 to get data about more than one environmental condition . [ 0045 ] fig2 a through fig2 e depict exemplary tables of data that processor 111 can store as aging data into nonvolatile storage 113 . the number of elements in the tables is dependent on the number of sensors 112 that have been implemented . the exemplary tables of fig2 a through fig2 e are illustrative of data that can be stored in nonvolatile storage 113 in the example of fig1 . for descriptive purposes , data in table elements with references ending in “ a , b , or n ” would correspond to sensors with references “ a , b , or n ” respectively . for example , table elements 201 a , 202 a , 203 a , 204 a , and 205 a would contain data related to a measurement by sensor 112 a . [ 0046 ] fig2 a shows table 211 , in which numbers , or elements , indicative of total age , or effective age , are stored . table element 201 , for example , can be “ wall clock ” time units , that is , how many hours the product has been active . wall clock time is not a function of any of the sensors 112 . the value of table element 201 a is shown to be larger than the value of table element 201 to indicate that some environmental factor , as measured by sensor 112 a , has caused effective age as accumulated in element 201 a to be larger than would be expected from a simple accumulation of “ wall clock ” hours . similarly , the value of element 201 b is shown as an even larger number , perhaps the result of an even more severe environmental condition as measured by sensor 112 b . on the other hand , the value of table element 201 n is less than the value of element 201 , thereby indicating that that environmental condition has been less severe , as measured by sensor 112 n , than the specified environmental condition . [ 0047 ] fig2 b shows table 212 , in which the numbers in table 211 are normalized to the number in table element 201 . table element 202 will therefore always be “ 1 ”, and can be simply a hard coded “ 1 ”. table element 202 a in the example would be the value of element 201 a divided by the value of element 201 , that is , { fraction ( 25 , 000 / 20 , 000 )}, or 1 . 25 . this would tell the user that , as far as this measured environmental factor is concerned , the effective age is 1 . 25 times that of a simple “ wall clock ” age . likewise , element 202 b would be 1 . 50 . continuing the example , element 202 n is 0 . 8 , indicating that the effective age of the product , as estimated from sensing and modeling that environmental condition , is lower than the effected age expected under the specified conditions . [ 0048 ] fig2 c shows table 213 , in which fractions of expected life of a product are stored . in this example , 100 , 000 hours are specified as the expected life of the product , under a set of specified environmental conditions . again using the exemplary actual and effective hours of table 211 , element 203 a shows that 0 . 25 , or 25 % of the expected life of the product has been used . this was computed by dividing the 25 , 000 effective hours by the 100 , 000 expected hours . continuing the example , element 203 b indicates that , effectively , 30 % of the expected life has been used , given the environmental conditions resulting in this table entry . element 203 n shows that only 16 % of the expected life of the product has been used . [ 0049 ] fig2 d shows table 214 , in which fractions of expected life of a product remaining are stored . the values in this table are computed exactly as were the values in table 213 , except that they are subtracted from 1 . 0 to convert to life remaining from life used . [ 0050 ] fig2 e shows table 215 , in which numbers indicative of current rate of aging is stored . continuing the example of table 211 , element 205 would always be “ 1 ”, that is , indicative of the rate of “ wall clock ” time . element 205 a shows that the aging rate of the condition associated with this element is currently aging the product at a rate 2 . 0 times the rate expected if the specified conditions were present . this might be very valuable information to a user , who can take immediate action to make improvements in the environmental condition causing the rapid aging . the user might choose to power down the product if an environmental condition becomes too harsh . alternatively , processor 111 might be electrically coupled to a power control on the product and automatically cause the product to shut down should an environmental condition become too harsh as determined by current aging as indicated by one or more of the acceleration models &# 39 ; calculations from sensor 112 inputs . [ 0051 ] fig3 a , 3b , and 3 c collectively show steps of a method that , when programmed and subsequently executed by processor 111 , will periodically poll the sensors 112 , compute an acceleration factor for each environmental condition sensed , and update tables 211 , 212 , 213 , 214 , and 215 . the tables described are exemplary . not all the tables need to exist . other tables holding data that can present the aging factors in different manners are contemplated ; however , the tables described serve to explain the process . [ 0052 ] fig3 a depicts a high - level flow control wherein control will be passed to the processes described in fig3 b ( poll sensors ) and fig3 c ( update display ) on a periodic basis . the length of the period is arbitrary , and can be one second , one minute , or one hour . in general , choice of time period would depend upon how rapidly environmental conditions would be expected to occur . humidity , for example , would be expected to change slowly , and therefore , would not need to be sensed frequently . temperature can change more rapidly . rapid temperature rise occurs when a laptop computer leaves a hibernation mode and enters an active mode . rapid temperature changes can occur if a product , such as a digital camera or a laptop computer is placed in the trunk of an automobile on a sunny day . although fig3 a shows control passing to poll the sensors periodically , based upon a single timer , an obvious variation would include creating a separate timer for each sensor and receiving data from each sensor when it &# 39 ; s individual interval has expired . the timer can be an external timer ( not shown ) checked by processor 111 periodically , or which interrupts processor 111 periodically . the timer can alternatively be an internal timer within processor 111 , perhaps simply counting pulses from clock 115 . block 301 is simply the starting point for the method , and passes control to block 302 , which checks the timer to see if the predetermined period has elapsed . if not , control remains at block 302 ; if so , control passes to block 303 , which comprises the steps described in fig3 b to poll the sensors . upon completion of the process steps of block 303 , control passes to block 304 , which comprises the steps described in fig3 c to display the aging results , and to activate a warning if one or more aging results are not within predetermined bounds . upon completion of the steps of block 304 , control is returned to block 301 , which repeats the control flow . [ 0054 ] fig3 b shows a detailed block diagram of the “ poll sensors ” step 303 of fig3 a , including the steps of reading the sensors , computing age acceleration factors , and updating the aging table elements . block 310 is simply the starting point of the process to poll sensors , and transfers control to block 311 . block 311 is the beginning of a loop that iterates through the sensors , one sensor at a time . in a simple , one - sensor , implementation , a loop would not be required and block 311 would not be required ; control would pass directly from block 310 to block 312 . block 312 reads the value of the instant sensor . depending on the details of the physical implementation ( fig1 is one such implementation ), reading the instant sensor can entail reading a unique input port into the processor , such as shown in fig1 . in other embodiments , such as the single adc embodiment described earlier , the processor can send out control signals to the analog multiplexer and subsequently read the output of the single adc . block 312 &# 39 ; s function is to perform whatever requirements the chosen embodiment imposes to read the data as sensed by the instant sensor . block 313 determines the proper age acceleration algorithm to use with the instant sensor . in a simple , one - sensor embodiment , only one such algorithm would be included in the program executed by processor 111 . in a more general case , block 313 would use information in the program or in tables placed there by the programmer to determine the proper algorithm . some common algorithms known to accurately model age accelerations were listed above , such as arrhenius , coffin - manson , and hallberg - peck . other algorithms are known to model other environmental factors , such as voltage . any algorithm that models age acceleration is to be considered within the spirit and scope of this invention . once block 313 has determined the proper algorithm for the instant sensor , control is passed to that algorithm by means of a branch , a subroutine call , or other well - known programming technique to that algorithm , along with data and constants , or pointers to the data and constants , needed to execute the algorithm . the algorithm is executed in block 314 , which results in an aging acceleration factor for this sensor &# 39 ; s current environmental condition . block 315 updates the accumulated life table for the instant sensor depicted in fig2 a . referring back to table 21 1 , and assuming the units are in hours , assuming an hourly poll , and an acceleration factor of “ 2 ” just computed by the algorithm for the environmental condition of sensor 112 a , table element 201 a would have the value “ 2 ” added to the value in table element 201 a . accumulating or adding the acceleration factor on a fixed periodic basis effectively time integrates the acceleration factor , resulting in an effective age value . table elements can be stored as integers or as floating point values . block 316 updates the normalized age table 212 for the instant sensor . in the current process embodiment , block 315 has just been performed , so that , for example , table element 202 a can be computed as the ratio of table element 201 a divided by table element 201 , when sensor 112 a is the instant sensor . table element 201 b can be computed as the ratio of table element 201 b divided by table element 201 , when sensor 112 b is the instant sensor . block 317 updates table 213 for fraction of expected life used . the table element for the instant sensor in this table would be the ratio of the current effective life used estimated by the current sensor to the expected life of the product under the specified conditions . considering the case where sensor 212 a is the instant sensor , and 100 , 000 hours is the expected life under the specified conditions , table element 203 a is updated by the ratio of table element 201 a , which is an estimate of the product &# 39 ; s effective age , using data from sensor 112 a , divided by 100 , 000 . a similar computation and table update occurs as each sensor becomes the instant sensor . block 318 updates table 214 for fraction of expected life remaining . elements in this table are simply “ 1 ” minus the corresponding table element in the table 213 . in table 213 , table element 203 a is 0 . 25 ; therefore table element 204 a would be 0 . 75 . block 319 updates the current age acceleration factor for the instant sensor . fig2 e shows table 215 element 205 a to be 2 . 00 , per the discussion of block 315 . this value means that , according to the algorithm , using data from sensor 112 a , that the product is aging at twice the rate it would under the specified conditions . block 320 tests to see if all sensors have been polled . if so , control passes to block 321 , which marks the completion of the poll sensors process steps , and returns control back to block 303 for further control transfer to block 304 . if additional sensors need to be read , block 320 passes control to block 311 , which selects another sensor as the instant sensor and continues the loop . if only a single sensor exists in the system , block 320 is unnecessary and control would simply pass from block 319 to block 321 . block 330 in fig3 c begins the update display function shown at high level as block 304 . block 331 checks for user preference regarding which data to display to the user . although subsequent blocks simply display data from one table of aging information described above , the program could easily display data from all tables , or data for one sensor across all tables . the flow is exemplary only , and is not intended to be limiting . user preferences can be entered into aging system 110 in any of a number of well - known ways , such as by keyboard ( not shown ), buttons ( not shown ), or selecting from menus presented on display 114 . block 332 checks to see if the user preference is to display accumulated age data from table 211 . if so , table elements from table 211 are displayed on display 114 by block 333 , with control then passing to block 341 . if block 332 determines that the user preference is not to display accumulated age data from table 211 , control passes to block 334 , which checks to see if the user preference is to display normalized age data from table 212 . if so , table elements from table 212 are displayed on display 114 by block 335 , with control then passing to block 341 . if block 334 determines that the user preference is not to display normalized age data from table of 212 , control passes to block 336 , which checks to see if the user preference is to display life fraction used from table 213 . if so , table elements from table 213 are displayed on display 114 by block 337 , with control then passing to block 341 . if block 336 determines that the user preference is not to display life fraction used data from table 213 , control passes to block 338 , which checks to see if the user preference is to display life fraction remaining from table 214 . if so , table elements from table 214 are displayed on display 114 by block 339 , with control then passing to block 341 . if block 338 determines that the user preference is not to display life fraction used data from table 214 , control passes to block 340 , which displays table elements from table 215 on display 114 , with control then passing to block 341 . block 341 compares all table elements , or perhaps a predetermined subset of table elements , from any or all tables against predetermined ranges for those elements , and triggers an alarm if one or more values are outside the predetermined range for those values . the alarm can be an audible alarm sounded on a bell or buzzer ( not shown ), a message printed on a printer ( not shown ), or a message displayed on display 114 , alerting the user that one or more values have exceeded predetermined bounds . perhaps the product has exceeded its expected lifetime , according to one or more of the aging models . if so , the user may wish to purchase spare parts or to consider replacement of the product . if a current aging acceleration factor is very high , the user can respond to the alarm by taking action to improve one or more environmental conditions . block 342 marks the end of the update display process . control is passed back to block 304 , which then passes control to block 301 . [ 0074 ] fig4 a shows a graph of the arrhenius equation acceleration factor , plotted on a logarithmic scale on the y - axis versus a temperature difference from a specified temperature on the x - axis . the temperature difference is called “ delta t ”. activation energy is 0 . 6 ev ; the specified temperature is 270 degrees kelvin . the acceleration factor is seen to be almost linear on the logarithmic scale , meaning that it is nearly exponential on a linear scale . [ 0075 ] fig4 b shows an embodiment of the invention wherein a digital processor is unnecessary , although a digital processor can still be utilized . the system of fig4 b makes use of the virtually exponential nature of the arrhenius equation within a reasonable temperature range , and produces a value in a counter indicative of effective age per the arrhenius equation . sensor 401 is a temperature sensor , with an analog voltage output . sensor 401 produces a voltage that varies linearly with temperature . such devices are well - known in the art . exponential voltage controlled oscillator ( vco ) 402 is a vco that produces a frequency output that varies exponentially with a linear change in input voltage . such devices are also well known in the art . such vcos typically have gain and offset controls . gain control to the vco is used to provide the proper slope of the logarithmically linear response . this would represent the effect of the activation energy of the device being modeled . offset control of the vco would bring the output frequency to some known value at the specified temperature . in fig4 a , acceleration factor is shown as “ 1 ” when “ delta t ” is zero , that is , when the temperature is 270 degrees kelvin in the graph . “ 1 ” is just a normalized number , representing some known frequency when the temperature is at 270 degrees kelvin . the output of the exponential vco 402 is electrically coupled to a counter 403 . counter 403 is implemented , at least partially , in a nonvolatile technology or is provided with a battery backup . counter 403 has a number of bits suitable to count the number of cycles from vco 402 during the life of the product . the counter has a “ least significant bit ” ( lsb ) and a “ most significant bit ” ( msb ). the lsb toggles every cycle of the vco &# 39 ; s output . the msb only changes once , unless an overflow of counter 403 occurs , which would be very undesirable . counter 403 should be implemented with enough bits such that overflow will not occur . selector 404 couples a number of bits of counter 403 to a display , and , optionally , a processor 406 . selector 404 would select some number of high order bits . the lsb , and , some number of additional lower order bits would not ordinarily be displayed because they would be changing rapidly and carry little information of interest to the user . the counter need not be constructed entirely in a nonvolatile technology . a counter implemented in a nonvolatile technology is expected to be more expensive per bit than one implemented in a volatile technology . suppose that the nonvolatile portion of the counter were to be updated approximately hourly , and the vco frequency is approximately 1 megahertz . there would be approximately four billion cycles per hour . the low order 32 bit part of the counter can then be implemented in a volatile technology ( 2 ** 32 = 4 , 294 , 976 , 296 ). if a 100 , 000 hour expected life is assumed , only 17 bits would then be required to be implemented in a nonvolatile technology . it will be appreciated by those skilled in the art that the 17 bit high order part of the counter described need not be incremented only by a simple overflow from the lower 32 bits . a closer approximation to an hourly increment of the high order part of the counter can be performed by a boolean decode of selected bits in the lower 32 bit counter ; the lower 32 bit counter then being reset . processor 406 in the embodiment shown in fig4 b is optional , and would periodically read the bits selected by selector 404 . processor 406 would not need to execute the arrhenius equation and accumulate the result , since that is effectively what vco 402 and counter 403 do . processor 406 can still update tables as described earlier . in a simplest embodiment of fig4 b , processor 406 would be absent . furthermore , display 405 can be electrically coupled to a single bit selected by selector 404 , or perhaps be “ hard wired ” to the msb itself , obviating the need for selector 404 . display 405 , in such an embodiment , might be a single light , or perhaps an audio alarm . when the msb of counter 403 ( or an output of a boolean combination of selected bits in counter 403 ) changes from a logic “ 0 ” to a logic “ 1 ”, the light or alarm would be activated , signaling that the effective life of the product has been used up . in such a design , the number of bits in counter 403 would be set such that after a number of cycles from the vco indicative of an effective age that exceeds the expected life of the product , the msb would change from a logic “ 0 ” to a logic “ 1 ”. while the present invention has been described with reference to the details of the embodiments of the invention shown in the drawings , these details are not intended to limit the scope of the invention as claimed in the appended claims . | 6 |
the subject invention pertains to a receptacle or container formed of a pleated sheet , said pleated sheet being formed by unsymmetrical pleats defined by preferably parallel folds . as shown in fig1 a , a typical pleated sheet 100 is formed of two sections , 100a , 100b , having widths a and b , respectively , with width a being larger than width b . the two edges of the sheet perpendicular to the pleats are fixed , by using an adhesive material or tape . this type of pleated sheet is disclosed in u . s . pat . no . 4 , 795 , 648 . in u . s . pat . no . 4 , 795 , 648 , a wrapper is made from a simple thin sheet having a planar rectangular shape . in the first embodiment of the fig1 a pleated sheet 101 similar to sheet 100 in fig1 a is used which has been folded over itself along a fold 1 perpendicular to the pleats 3 . the two opposed edges 4 , 5 of the sheet are then glued , soldered or otherwise affixed to each other to form a pouch with two sides , a closed base 8 and an open mouth 10 . along the open mouth 10 , the pleats 3 have a fixation zone 7 for fixing the pleats as described above . sheet 101 may be formed for example , from paper coated with a plastic material such as polyethylene . importantly , the pouch of fig1 could be deployed into one of two configurations . in one configuration the two corners 9 can be pulled apart to expand base 8 to form a roughly semicircular shape as shown . importantly , the sidewalls of the pouch are urged together to close mouth 10 , as shown in fig3 . therefore the pouch may be placed on a straight surface on its side without spilling its contents . moreover , the interior of the pouch will be substantially closed to insure that its contents do not cool off . however , sufficient space remains between the sidewalls to allow some ventilation . fig5 and 6 indicate the use of this pouch , such as for storing french fries . importantly , the french fries are first introduced through the mouth 10 . during this step , the fingers of the operator are protected from by being burned ( if the french fries are too hot ) by the sidewalls of the pouch . the thickness of the sidewalls depends on the ratio a / b . if this ratio is less than 2 , then the pouch sidewalls consists of between one and three layers . if this ratio is greater than 2 , then the several pleats overlap so that the walls consists of three to five layers . once the pouch is filled , its two corners 9 may be pulled apart causing the pleats 3 to expand along the bottom 8 . the expansion of the pleats increases the volume of the pouch allowing the french fries to settle inside , as shown in fig6 . the mouth of the pouch also closes for heat protection . the ratio a / b also controls the size and shape of the pouch in the open configuration . if a / b & gt ; 2 , the interior angle between sides 4 and 5 is less than 180 °. if the ratio a / b is smaller , for example 1 . 5 , and if the width and length of the pouch ( 29 , 30 ) remain approximately equal , then the angle between sides and 4 and 5 as the pouch is deployed , increased exceeds 180 ° substantially , as shown in fig4 . however , the mouth 10 remains closed by the biasing of the pouch sides thereby insuring the contents of the pouch do not spill . of course , a consumer can easily insert his fingers through opening 10 and retract to withdraw the french fries at will . fig2 shows a pouch similar to the one in fig1 except that its bottom 2 is formed by folding sheet 101 three times as shown at 1a , 1b and 1c to form a gusseted flap 8a . the advantage of this embodiment is that when corners 9 are extended or pulled sideways to close the pouch , the flap 8a comes out and forms a relatively straight bottom surface for holding the pouch in upright position ( as seen in fig4 ). in this configuration , the pouch with its contents remains stable . for consumption , the pouch may be opened slightly , by ripping the sidewalls if necessary to provide an easier opening . obviously , the pouch of fig1 and 2 may be formed in other ways as well . in fig6 a an alternate method of opening the pouch of fig2 is shown . for this method , the pleats 3a are fixed in zone 7a by a weak adhesive . the pleats are also fixed at the bottom along pleating zone 8a . the pouch is filled up and closed in the same manner as shown in fig5 and 6 . however , prior to consumption , the pouch is opened up by pulling the upper corners 9a apart . this action causes the pleats to open in zone 7a thereby allowing the pouch to open and form a serving basket . in the embodiment shown in fig7 a sheet is shown having a pleated and an unpleated section ( 13 , 14 ). the sheet is folded in two along a line perpendicular to the pleats 3 , and the edges 15 of the unpleated section is fixed to form a partial pouch . a product is placed in the partial pouch and the pleated section is then deployed around the partial pouch . the shape of the pleated section again depends on height 17 , and length of the pleated section as well as ratio a / b . if desired , the height 16 of unpleated section 13 may be different then height 17 . one advantage of this configuration is that in order to consume the product within the pouch , the pleated section need be opened only partially , as indicated in fig9 . in a variation shown in fig1 , both edges 19 , 20 of an unpleated section 18 are fixed to form a pouch which is then covered at will by the pleated section 21 . in another variation of the invention shown in fig1 , non - pleated section 14 of fig7 is replaced by a pleated section 22 , having pleats fixed along one side 24 along one side 25a , and along bottom 25 . pleated section 23 is attached to section 22 as shown . the two sections 22 , 23 may be made of different materials . for example , section 24 may be made for example of a thermally insulated material , set into a pouch - shaped formed by one or more fixation lines 25 . alternatively , pleated section 22 may be made with more overlapping pleats than section 23 to provide more thermal insulation . in this manner , an opened and closed pouch may be forced as shown in fig1 and 12 which is thermally insulated . in the embodiment of fig1 and 12 , pleats of section 22 are fixed both at the top and bottom so that they do not open as the section 23 is deployed around section 22 . in the embodiment of fig1 and 14 , section 26 is formed in such a manner that the pleats can be opened at least partially to form a double based package as shown in fig1 . advantageously , the border 27 of section 26 is formed at an angle to allow the section 28 to be wrapped around section 26 more tightly . in fig1 - 17 an embodiment of the invention is shown which is suitable for microwave pop - corn . in this embodiment , a pouch 120 similar to the pouch in fig1 is provided . this pouch is provided with an adhesive strip 112 at mouth 111 of the pouch along one or both inner surfaces of sidewalls 118 , 119 . under this adhesive strip , sidewalls 118 , 119 are provided with a plurality of partial cuts 113 extending in line in a parallel with edge 121 . the pouch 120 is used as follows . first , special corn kernels 110 are placed into pouch 120 as shown in fig1 , after which the pouch is sealed with adhesive strip 112 . the pouch filled with the corn kernels are then shipped to stores for sale to customers . for consumption , a customer takes a pouch with the corn and places it into a microwave oven so that the corn kernels can be subjected to heat for popping . during this process the popped corn forces the pouch to expand by opening its pleats as shown in fig1 . after the pouch is removed from the microwave oven , it is opened by separating its top 122 along the cuts 113 as shown in fig1 . obviously numerous modifications may be made to this invention without departing from its scope as defined in the appended claims . | 1 |
the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the disclosed embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . the data structures and code described in this detailed description are typically stored on a computer readable storage medium , which may be any device or medium that can store code and / or data for use by a computer system . this includes , but is not limited to , magnetic and optical storage devices such as disk drives , magnetic tape , cds ( compact discs ) and dvds ( digital versatile discs or digital video discs ), and computer instruction signals embodied in a transmission medium ( with or without a carrier wave upon which the signals are modulated ). for example , the transmission medium may include a communications network , such as the internet . fig2 illustrates an application 202 utilizing inter - process procedure calls in accordance with an embodiment of the present invention . application 202 and database server 206 are located on one tier of multi - tier environment . application 202 is coupled to browsers 108 - 112 via network 106 . note that browsers 108 - 112 can generally include any type of web browser capable of viewing a web site , such as the internet explorert ™ browser distributed by the microsoft corporation of redmond , wash . also note that network 106 can generally include any type of wired or wireless communication channel capable of coupling together computing nodes . this includes , but is not limited to , a local area network , a wide area network , or a combination of networks . in one embodiment of the present invention , network 106 includes the internet . in the embodiment illustrated in fig2 , application 202 and database server 206 are separate operating system processes running on the same server . application 202 and database server 206 both have access to shared memory 210 . application 202 includes oracle call interface ( oci ) client stub 204 . likewise , database server 206 includes oci server stub 208 . in the embodiment of the present invention illustrated in fig2 , oci client stub 204 and oci server stub 208 allow application 202 to make inter - process procedure calls on database server 206 via shared memory 210 as if application 202 was making a local procedure call . these inter - process procedure calls are accomplished by oci client stub 204 and oci server stub 208 via an application programming interface ( api ). this is described in more detail below in fig4 - 6 . fig3 illustrates a parameter control block 300 in accordance with an embodiment of the present invention . note that any manner of keeping track of the inter - process procedure call within shared memory 210 may be used , and is not limited to the use of the parameter control block 300 illustrated in fig3 . parameter control block 300 is a data structure in shared memory 210 for keeping track of an inter - process procedure call . parameter control block 300 comprises a lock , a call_done flag to indicate the processing status of the inter - process procedure call , a count of the number of arguments for the inter - process procedure call , an array of parameter descriptors and an array of arguments for the inter - process procedure call . note that in the parameter control block 300 illustrated in fig3 , the lock is a semaphore . the present invention is not meant to be limited to the use of semaphores , and any type of locking mechanism may be used . in one embodiment of the present invention , the operation to be performed by the inter - process call is indicated by an operation code ( opcode ) in the parameter control block . this is a mutually agreed operation code for the procedure call to be performed . in this embodiment , the number parameter , n , is still passed in the parameter control block . corresponding to the number of parameters , there are n parameter descriptors and parameters . a parameter descriptor describes the data type of the argument ( parameter ) of the call , such as integer , floating point , text string , or pointer to a data structure parameter allocated in the shared memory . the parameters to the call are either arguments for the call , or they are pointers to data structures in the shared memory . in one embodiment of the invention , the process of setting up of parameter control block can be automated by a translator that will generate parameter control blocks based on the prototype ( function declaration ) of the local procedure calls . fig4 presents a flowchart illustrating the process of making an inter - process procedure call in accordance with an embodiment of the present invention . the system starts when application 202 initiates an inter - process procedure call at oracle call interface ( oci ) client stub 204 . the system first initializes the parameter control block and the lock such that the client process has possession of the lock initially . the client process then sets up memory data for data structure parameters in shared memory 210 ( step 402 ). next , the client process acquires the lock in the parameter control block if it did not already have it ( step 404 ). note that in one embodiment of the present invention , the lock is a semaphore . the client process sets up the parameter control block 300 with the call opcode , the number of parameters , the array of parameter descriptors , and the array of parameters ( step 406 ). the client process then clears the call_done flag to indicate that the inter - process procedure call has not been completed ( step 408 ). finally , the client process releases the lock ( step 410 ). fig5 presents a flowchart illustrating the process of executing an inter - process procedure call in accordance with an embodiment of the present invention . the server process starts by acquiring the lock at oci server stub 208 ( step 502 ). next , the server process checks to see if the call_done flag is clear ( step 504 ), and if so , processes the inter - process procedure call from shared memory 210 ( step 508 ). the server process then stores the results of the inter - process procedure call back into shared memory 210 ( step 510 ). next , the server process sets the call_done flag to indicate the inter - process procedure call has been completed ( step 512 ). finally , the server process releases the lock ( step 514 ). note that the checking of the call_done flag by the server process ( step 504 ) after acquiring the lock is to prevent the race condition where the server process re - acquires the lock before the client process had the time to process the results of the inter process procedure call . that is , after acquiring the lock ( step 502 ), if the server process finds that the call_done flag is still set ( step 504 ), then the server process releases the lock ( step 506 ) and tries to re - acquire the lock again ( step 502 ). an optional delay can be introduced between the time the server releases the lock ( step 504 ) and re - acquires the lock ( step 502 ) to give the client process time to acquire the lock ( step 602 ). fig6 presents a flowchart illustrating the process of processing the results of an inter - process procedure call in accordance with an embodiment of the present invention . after making the inter process procedure call , the client process starts by acquiring the lock at oci client stub 204 ( step 602 ). the client process then determines if the call_done flag indicates that the inter - process procedure call has been completed by server process 206 ( step 604 ). if not , the client process releases the lock ( step 606 ) and optionally waits before trying to acquire the lock again ( step 602 ). note that steps 602 - 606 are repeated until oci client stub 204 acquires the lock with the call_done flag set to indicate the completed call . also note that this acquiring of the lock , checking of call_done flag , and releasing of the lock is analogous to steps 502 - 506 of the server process to avoid race condition . that is , after setting up the parameter control block , clearing the call_done flag , and releasing the lock , the client process can acquire the lock again ( step 602 ) before the server process had a chance to acquire the lock ( step 502 ). in this case , the call_done flag indicates to the client process that the inter process call is not done , and the client should retry . once the client process acquires the lock at oci client stub 204 with the call_done flag set , the system then processes the results of the inter - process procedure call from shared memory 210 ( step 608 ). the client process normally holds on to the lock as the client process is either preparing parameters for the call or processing the results of the call . only during the time the server process is executing the inter process procedure call , the server process has the possession of the lock . therefore , the client process does not release the lock after the completion of the call . arguments for a new inter process procedure call can be set by the client process in the parameter call , and lock is only released when the client process is ready to issue the next call as described in fig4 . the foregoing descriptions of embodiments of the present invention have been presented for purposes of illustration and description only . they are not intended to be exhaustive or to limit the present invention to the forms disclosed . accordingly , many modifications and variations will be apparent to practitioners skilled in the art . additionally , the above disclosure is not intended to limit the present invention . the scope of the present invention is defined by the appended claims . | 6 |
explosively - split fragments and a method for manufacturing them from wooden source materials according to an embodiment are explained below with reference to the drawings . fig1 shows a process for manufacturing such explosively - split fragments . in the embodiment shown here , raw materials , such as willow 1 , bamboo 2 and cedar 3 , and remainder pieces 5 from lumber factories , and wastes 5 from destructed houses , among others , are used as original materials . although this embodiment is shown as making explosively - split fragments from each original material illustrated , any other kind of tree and any other residues or wastes may be used , and these different kinds of original materials may be mixed appropriately . the raw materials used here are slim trees and branches as thin as approximately 2 to 10 cm in diameter . as a primary treatment , metal pieces , earth , sand , and so forth , are removed especially from wastes . thereafter , these original materials are cut by a rotary saw into sections 6 as long as approximately 60 cm , such as willow sections 1 a , bamboo sections 2 a , cedar sections 3 a , remainder - piece sections 4 a , waste sections 5 a , for example . also used are source materials shorter than 60 cm . after the primary treatment , the amount of water content of the sections 6 is controlled to not lower than approximately 20 %. for this adjustment , sprinkler means 7 or immersing means 8 is used as illustrated . after that , the sections 6 adjusted in moisture content are set in an explosive - splitting machine 9 . the explosive - splitting machine 9 includes a housing 9 a open to the top and a hot press 9 b vertically movable inside the housing 9 a . the sections 6 are accumulated in parallel alignment with the lengthwise direction within the housing 9 a , and the housing 9 a containing these sections 6 is set in an explosive splitter 9 . then , after heat and pressure are applied to the sections 6 by the hot press 9 b , the pressure is released for a moment . as a result , water vapor explosion occurs inside the accumulated sections 6 , and all of the sections 6 are explosively split . thus , explosively split fragments 10 are obtained in the housing 9 a . conditions for applying heat and pressure by the hot press 9 b are determined appropriately . when the temperature is 200 through 300ec , the pressure is 5 to 15 mpa , and the time for applying heat and pressure is 20 through 200 seconds , explosive - split fragments partly or entirely released in fiber coupling along their fibers into various configurations can be obtained as shown at 10 a through 10 d in fig1 . in fig1 a denotes powdered explosive - split fragments , 10 b denotes cottony ones , 10 c denotes string - shaped ones , and 10 d denotes fine rod - shaped ones . in this manner , wooden raw materials can be divided and split along their fibers without using any cutter , and the products are usable in various modes of use , in addition to the use as new materials like multi - layered materials , explosive - split cement boards , and explosive - split foamed resin boards . that is , wooden material fragments with desired configurations and properties can be obtained efficiently , and the production cost therefor is low . [ 0084 ] fig2 is a diagram illustrating a manufacturing machine of these explosive - split fragments , which embodies the invention . in fig2 reference numeral 11 denotes a storage means of sections 6 such as willow sections 1 a , bamboo sections 2 a , cider sections 3 a , cutting sections 4 a , waste sections 5 a , and so on , which are shown in fig1 . numeral 12 denotes a belt conveyor as transport means for drawing out sections 6 from the storage means 11 , aligning them in a single layer with their fiber orientation in parallel , and transporting them to the next step . numeral 13 denotes a stacking means for stacking several layers of sections 6 consecutively delivered from the transport means 12 while adjusting the width of each layer of sections 6 . the stacking means 13 includes a belt conveyor 13 c , a pair of converging plates 13 a for gradually converging the width of sections 6 spread in a single layer by urging from the opposite sides while the sections move along , and press rollers 13 b interposed between the pair of converging plates 13 a . the converging plates 13 a are slanted such that their height gradually increases from the start end to the final end , and the start end nearer to the transport means 12 , i . e . the inlet end , has the same width as that of the belt conveyor 13 c . the final end , i . e ., the outlet end , is decreased in width to a predetermined width . therefore , sections 6 are accumulated to some layers from the single layer while they run on the belt conveyor 13 c , and when they exit from the stacking means 13 , they exhibit an accumulated configuration adjusted in width and height to the dimension of the outlet end of the pair of converging plates 13 a . numeral 14 denotes an explosively splitting apparatus for explosively splitting a mass of sections delivered from the stacking means 13 into fragments . the explosively splitting apparatus 14 includes a pair of upper and lower steel feeding belt 14 a extending in a housing , and a heating means 14 b for heating the steel feeding belts 14 a . the paired upper and lower steel feeding belts 14 a are largely vertically distant from each other at their inlet side , that is , their end connected to the stacking means 13 . this distance is equal to the height of the outlet end of the converging plates 13 a . the distance between the paired upper and lower steel feeding belts 14 a is getting narrower toward their final end , and at the final end , namely , the outlet end , the distance between the upper and lower steel feeding belts is much narrower than that of the inlet end . therefore , the mass of sections 6 delivered from the stacking means 13 is gradually compressed while running between the upper and lower steel feeding belts 14 a , and simultaneously heated ( 200 to 300 ° c .) by the heating means 14 b via the steel feeding belts 14 a . the pressure to the mass of sections 6 is maximized at the outlet end which is the terminal end of the paired upper and lower steel feeding belts 14 a . in this embodiment , it is set to 10 mpa . the mass of sections 6 is suddenly released from pressure when passing the terminal end of the upper and lower steel feeding belts 14 a , that is , the outlet end . as a result , due to water vapor explosion , the sections 6 are instantaneously released in fiber coupling along their fibers and broken into fragments . the explosive - split fragments 10 through these steps are sent to a container means 15 . operations of the manufacturing machine explained above are automatically controlled by a controller using a microcomputer , for example . explosive - split fragments of various configurations obtained without using any cutter will be usable in various modes from source materials of pulp to aggregate of construction materials . the inventor , however , has developed new materials using these explosive - split fragments as a kind of aggregate . these new materials are expected to have not only the performance of existing wooden materials but also other various performances , and they will be useful as materials of furniture , houses and other buildings , boards for civil engineering constructions , stanchion materials , beam materials , and so on . explanation is made below about these new materials . [ 0090 ] fig3 is a diagram of a manufacturing machine of laminates of explosive - split fragments made by stacking explosive - split fragments according to the invention by a bonding agent . the machine , and laminates of explosive - split fragments and their manufacturing methods , are explained below . in fig3 reference numeral 11 denotes a storage means of sections 6 such as willow sections 1 a , bamboo sections 2 a , cider sections 3 a , cutting sections 4 a , waste sections 5 a , and so on , which are shown in fig1 . numeral 12 denotes a belt conveyor as transport means for drawing out sections 6 from the storage means 11 , aligning them in a single layer with their fiber orientation in parallel , and transporting them to the next step . numeral 13 denotes a stacking means for stacking several layers of sections 6 consecutively delivered from the transport means 12 while adjusting the width of each layer of sections 6 . the stacking means 13 includes a belt conveyor 13 c , a pair of converging plates 13 a for gradually converging the width of sections 6 spread in a single layer by urging from the opposite sides while the sections move along , and press rollers 13 b interposed between the pair of converging plates 13 a . the converging plates 13 a are slanted such that their height gradually increases from the start end to the final end , and the start end nearer to the transport means 12 , i . e . the inlet end , has the same width as that of the belt conveyor 13 c . the final end , i . e ., the outlet end , is decreased in width to a predetermined width . therefore , sections 6 are accumulated in some layers from the single layer while they run on the belt conveyor 13 c , and when they exit from the stacking means 13 , they exhibit an accumulated configuration adjusted in width and height to the dimension of the outlet end of the pair of converging plates 13 a . numeral 14 denotes an explosively splitting apparatus for explosively splitting a mass of sections delivered from the stacking means 13 into fragments . the explosively splitting apparatus 14 includes a pair of upper and lower steel feeding belt 14 a extending in a housing , and a heating means 14 b for heating the steel feeding belts 14 a . the paired upper and lower steel feeding belts 14 a are largely vertically distant from each other at their inlet side , that is , their end connected to the stacking means 13 . this distance is equal to the height of the outlet end of the converging plates 13 a . the distance between the paired upper and lower steel feeding belts 14 a is getting narrower toward their final end , and at the final end , namely , the outlet end , the distance between the upper and lower steel feeding belts is much narrower than that of the inlet end . therefore , the mass of sections 6 delivered from the stacking means 13 is gradually compressed while running between the upper and lower steel feeding belts 14 a , and simultaneously heated ( 200 to 300 ° c .) by the heating means 14 b via the steel feeding belts 14 a . the pressure to the mass of sections 6 is maximized at the outlet end which is the terminal end of the paired upper and lower steel feeding belts 14 a . in this embodiment , it is set to 10 mpa . the mass of sections 6 is suddenly released from pressure when passing the terminal end of the upper and lower steel feeding belts 14 a , that is , the outlet end . as a result , due to water vapor explosion , the sections 6 are instantaneously released in fiber coupling along their fibers and broken into fragments , and explosive - split fragments 10 are obtained . numeral 15 denotes a drier means for drying explosive - split fragments 10 sent from the explosively splitting means 14 . in the drier means 15 , explosive - split fragments 10 are supported on nets transported by a roller , and dried by a high - temperature air blow while they move . in the illustrated example , two nets , upper and lower , are used . but only one net is acceptable depending upon the quantity of explosive - split fragments 10 . numeral 16 denotes a second stacking means for spraying a thermally setting adhesive from nozzles onto explosive - split fragments 10 sent from the drier means 15 and for stacking these explosive - split fragments 10 in a predetermined configuration . the explosive - split fragments 10 sent in upper and lower two layers from the drier means 15 are joined together and sent to a heat - pressing means in the next stage after the thermally setting adhesive is sprayed from the nozzles onto the explosive - split fragments 10 in each layer under movement . numeral 17 denotes the heat - pressing means for compressing accumulated explosive - split fragments 10 sent from the second stacking means 16 under a heat . the heat - pressing means 17 includes an upper steel feeding belt 17 a and a lower steel feeding belt 17 b both extending within a housing , and a heating means for heating the upper and lower steel feeding belts . the upper steel feeding belt 17 a includes a slanted portion and a flat portion whereas the lower steel feeding belt 17 b is entirely flat . the slanted portion of the upper steel feeding belt 17 a gradually slopes down from its start end and merges with the flat portion . the flat portion of the upper steel feeding belt 17 a and the lower steel feeding belt 17 b are distant by a predetermined distance . therefore , accumulated explosive - split fragments 10 sent from the second stacking means 16 are progressively compressed while moving between the upper steel feeding belt 17 a and the lower steel feeding belt 17 b . when they reach between the flat portion of the upper steel feeding belt 17 a and the lower steel feeding belt 17 b , a predetermined pressure is applied thereto under a heat , the adhesive thermally sets , and a multi - layered material 18 made of explosive - split fragments is obtained . in the embodiment shown here , the pressure is set within the range from 1 to 4 mpa , and the heating temperature within the range from 100 to 150 ° c . the pressure can be adjusted by adjusting the distance between the flat portion of the upper belt 17 a and the lower belt 17 b . the multi - layered material 18 of explosive - split fragments is then discharged from the heat - pressing means 17 and cut into a predetermined length by a cross cut saw 19 . the multi - layered material of explosive - split fragments obtained through these steps is made by using as its aggregate a mass of explosive - split fragments obtained by splitting wooden materials along their fiber orientations by explosive splitting , and hardening them with an adhesive . therefore , it has a strength larger than that of lumbers . explosive - split fragments made by splitting wooden materials along their fiber orientations are closely bound together by the adhesive , and the fiber structures of the source materials are maintained . therefore , the multi - layered material of these explosive - split fragments is remarkably strong . additionally , since splitting of wooden materials along their fiber orientations , that is , decomposition of fiber coupling along fiber extending directions , is executed by water vapor explosion without using any cutter , the manufacturing efficiency is high , and the manufacturing cost is low . operations of the manufacturing machine explained above are automatically controlled by a controller including a microcomputer , for example . although the above - explained embodiment is configured to consecutively manufacture multi - layered materials 18 of explosive - split fragments in form of flat plates , the shape of the cement board 27 of explosive - split fragments is not limited to flat plates . that is , as explained with reference to fig1 explosive - split fragments of various shapes and properties , such as powdered ( 10 a ), cottony ( 10 b ), string - shaped ( 10 c ) and rod - shaped ( 10 d ) ones , can be obtained by changing conditions including pressure , heating temperature and compression time , etc ., in the explosively splitting means 14 , and responsively , multi - layered materials of explosive - split fragments of various shapes and properties can be obtained as well . for example , by using powdered ( 10 a ), cottony ( 10 b ) and string - shaped ( 10 c ) explosive - split fragments as source materials and using molding boxes of various configurations , multi - layered materials with any shapes , such as curved faces , can be manufactured . in the embodiment shown here , explosive - split fragments 10 are manufactured continuously , and multi - layered materials 18 of explosive - split fragments are also manufactured continuously . however , it is also possible to obtain explosive - split fragments 10 by using the explosively splitting apparatus 9 shown in fig1 and to supply them consecutively to the drier means 15 shown in fig3 . [ 0105 ] fig4 is a diagram showing a manufacturing machine for manufacturing cement boards of explosive - split fragments using explosive - split fragments according to the invention as their aggregate . the machine , and cement boards of explosive - split fragments and their manufacturing methods , are explained below . in fig4 reference numeral 11 denotes a storage means of sections 6 such as willow sections 1 a , bamboo sections 2 a , cider sections 3 a , cutting sections 4 a , waste sections 5 a , and so on , which are shown in fig1 . numeral 12 denotes a belt conveyor as transport means for drawing out sections 6 from the storage means 11 , aligning them in a single layer with their fiber orientation in parallel , and transporting them to the next step . numeral 13 denotes a stacking means for stacking several layers of sections 6 consecutively delivered from the transport means 12 while adjusting the width of each layer of sections 6 . the stacking means 13 includes a belt conveyor 13 c , a pair of converging plates 13 a for gradually converging the width of sections 6 spread in a single layer by urging from the opposite sides while the sections move along , and press rollers 13 b interposed between the pair of converging plates 13 a . the converging plates 13 a are slanted such that their height gradually increases from the start end to the final end , and the start end nearer to the transport means 12 , i . e . the inlet end , has the same width as that of the belt conveyor 13 c . the final end , i . e ., the outlet end , is decreased in width to a predetermined width . therefore , sections 6 are accumulated in some layers from the single layer while they run on the belt conveyor 13 c , and when they exit from the stacking means 13 , they exhibit an accumulated configuration adjusted in width and height to the dimension of the outlet end of the pair of converging plates 13 a . numeral 14 denotes an explosively splitting means for explosively splitting a mass of sections delivered from the first stacking means 13 into fragments . the explosively splitting means 14 includes a pair of upper and lower steel feeding belt 14 a extending in a housing , and a heating means 14 b for heating the steel feeding belts 14 a . the paired upper and lower steel feeding belts 14 a are largely vertically distant from each other at their inlet side , that is , their end connected to the first stacking means 13 . this distance is equal to the height of the outlet end of the converging plates 13 a . the distance between the paired upper and lower steel feeding belts 14 a is getting narrower toward their final end , and at the final end , namely , the outlet end , the distance between the upper and lower steel feeding belts is much narrower than that of the inlet end . therefore , the mass of sections 6 delivered from the first stacking means 13 is gradually compressed while running between the upper and lower steel feeding belts 14 a , and simultaneously heated ( 200 to 300 ° c .) by the heating means 14 b via the steel feeding belts 14 a . the pressure to the mass of sections 6 is maximized at the outlet end which is the terminal end of the paired upper and lower steel feeding belts 14 a . in this embodiment , it is set to 10 mpa . pressure in the explosively splitting means 14 is adjusted by adjusting the distance between the upper and lower paired steel feeding belts 14 a at their terminal end . the mass of sections 6 is suddenly released from pressure when passing the terminal end of the upper and lower steel feeding belts 14 a , that is , the outlet end . as a result , due to water vapor explosion , the sections 6 are instantaneously released in fiber coupling along their fibers and broken into fragments , and explosive - split fragments 10 are obtained . numeral 20 denotes a second transport means for drying explosive - split fragments 10 obtained in the explosively splitting means 14 , cutting them to a predetermined length with a cross cut saw , for example , and sending them to the next step . numeral 21 denotes a second stacking means for stacking explosive - split fragments 10 sent from the second transport means 20 in several layers within a steel frame 22 . the frame 22 is movable relative to the second stacking means 21 . in response to a movement of the second stacking means 21 , explosive - split fragments 10 are spread in the frame 22 up to a uniform thickness to form a single layer of fragments . responsively , mortar is sprayed onto the single layer of fragments from a mortar injection means 24 . repeating these steps , some layers of explosive - split fragments 10 , each applied with mortar , are stacked in the frame 22 . in the frame 22 , a cement separating agent is previously applied inside the frame 22 . reference numeral denotes a mixer for preparing mortar by mixing cement , sand , water , curing agent , and so forth , by a predetermined ratio , and supplying it to the mortar injection means 24 . when the steel frame 22 is filled with explosive - split fragments 10 and mortar , an upper lid 26 is put on the steel frame 22 , and the steel frame in this status is sent to a vibrating / compressing means 26 . in the vibrating / compressing means 26 , after removing void in the mixture of explosive - split fragments and mortar by vibrating the entirety of the steel frame 22 , the upper lid 22 a is urged and fixed to maintain a predetermined compressing pressure on and between the explosive - split fragments 10 and mortar . after the mortar cures , the pressure is released , and the steel frame 22 is moved to a curing chamber . after one or two days of curing , the steel frame 22 is decomposed to obtain a cement board 27 of explosive - split fragments 27 in which explosive - split fragments 10 are firmly bound by the cured mortar . the cement board 27 of explosive - split fragments completed in this manner may be continuously held under curing where necessary . the cement board of explosive - split fragments obtained through these steps is made by using as its aggregate a mass of explosive - split fragments obtained by splitting wooden materials along their fiber orientations by explosive splitting , and enclosing them with mortar . therefore , it is usable as a material having a fire resistivity and a strength close to that of lumbers . larger than that of lumbers . explosive - split fragments made by splitting wooden materials along their fiber orientations closely bond to mortar , and the fiber structures of the source materials are maintained . therefore , the cement board of these explosive - split fragments is remarkably strong . additionally , since splitting of wooden materials along their fiber orientations is executed by water vapor explosion without using any cutter , the manufacturing efficiency is high , and the manufacturing cost is low . operations of the manufacturing machine explained above are automatically controlled by a controller including a microcomputer , for example . although the above - explained embodiment is configured to consecutively manufacture cement boards 27 of explosive - split fragments in form of flat plates , the shape of the multi - layered material 18 of explosive - split fragments is not limited to flat plates . that is , as explained with reference to fig1 explosive - split fragments of various shapes and properties , such as powdered ( 10 a ), cottony ( 10 b ), string - shaped ( 10 c ) and rod - shaped ( 10 d ) ones , can be obtained by changing conditions including pressure , heating temperature and compression time , etc ., in the explosively splitting means 14 , and responsively , cement boards of explosive - split fragments of various shapes and properties can be obtained as well . for example , by using powdered ( 10 a ), cottony ( 10 b ) and string - shaped ( 10 c ) explosive - split fragments as source materials and using molding boxes of various configurations , multi - layered materials with any shapes , such as curved faces , can be manufactured . in the embodiment shown here , explosive - split fragments 10 are manufactured continuously , and cement boards 27 of explosive - split fragments are also manufactured continuously . however , it is also possible to obtain explosive - split fragments 10 by using the explosively splitting apparatus 9 shown in fig1 and to continuously supply them to the second transport means 20 shown in fig4 . [ 0120 ] fig5 is a diagram showing a manufacturing machine for manufacturing a foamed resin board of explosive - split fragments using explosive - split fragments according to the invention as its aggregate . the machine , and foamed resin boards of explosive - split fragments and their manufacturing methods , are explained below . in fig5 reference numeral 11 denotes a storage means of sections 6 such as willow sections 1 a , bamboo sections 2 a , cider sections 3 a , cutting sections 4 a , waste sections 5 a , and so on , which are shown in fig1 . numeral 12 denotes a belt conveyor as transport means for drawing out sections 6 from the storage means 11 , aligning them in a single layer with their fiber orientation in parallel , and transporting them to the next step . numeral 13 denotes a first stacking means for stacking several layers of sections 6 consecutively delivered from the transport means 12 while adjusting the width of each layer of sections 6 . the first stacking means 13 includes a belt conveyor 13 c , a pair of converging plates 13 a for gradually converging the width of sections 6 spread in a single layer by urging from the opposite sides while the sections move along , and press rollers 13 b interposed between the pair of converging plates 13 a . the converging plates 13 a are slanted such that their height gradually increases from the start end to the final end , and the start end nearer to the transport means 12 , i . e . the inlet end , has the same width as that of the belt conveyor 13 c . the final end , i . e ., the outlet end , is decreased in width to a predetermined width . therefore , sections 6 are accumulated in some layers from the single layer while they run on the belt conveyor 13 c , and when they exit from the stacking means 13 , they exhibit an accumulated configuration adjusted in width and height to the dimension of the outlet end of the pair of converging plates 13 a . numeral 14 denotes an explosively splitting means for explosively splitting a mass of sections delivered from the first stacking means 13 into fragments . the explosively splitting means 14 includes a pair of upper and lower steel feeding belt 14 a extending in a housing , and a heating means 14 b for heating the steel feeding belts 14 a . the paired upper and lower steel feeding belts 14 a are largely vertically distant from each other at their inlet side , that is , their end connected to the first stacking means 13 . this distance is equal to the height of the outlet end of the converging plates 13 a . the distance between the paired upper and lower steel feeding belts 14 a is getting narrower toward their final end , and at the final end , namely , the outlet end , the distance between the upper and lower steel feeding belts is much narrower than that of the inlet end . therefore , the mass of sections 6 delivered from the first stacking means 13 is gradually compressed while running between the upper and lower steel feeding belts 14 a , and simultaneously heated ( 200 to 300 ° c .) by the heating means 14 b via the steel feeding belts 14 a . the pressure to the mass of sections 6 is maximized at the outlet end which is the terminal end of the paired upper and lower steel feeding belts 14 a . in this embodiment , it is set to 10 mpa . pressure in the explosively splitting means 14 is adjusted by adjusting the distance between the upper and lower paired steel feeding belts 14 a at their terminal end . the mass of sections 6 is suddenly released from pressure when passing the terminal end of the upper and lower steel feeding belts 14 a , that is , the outlet end . as a result , due to water vapor explosion , the sections 6 are instantaneously released in fiber coupling along their fibers and broken into fragments , and explosive - split fragments 10 are obtained . numeral 28 denotes a drier means for drying explosive - split fragments 10 sent from the explosively splitting means 14 by using a hot air blow . numeral 29 denotes a second stacking means for spraying expandable resin onto dried explosive - split fragments 10 through a nozzle 29 a and delivering them of a predetermined thickness to the next stage . explosive - split fragments 10 supplied with expandable resin and accumulated to a predetermined thickness are sent to a press means 30 in the next stage before expansion of the resin . the press means 30 includes an upper steel feeding belt 30 a and a lower steel feeding belt 30 b both extending within a housing . the upper steel feeding belt 30 a includes a slanted portion and a flat portion whereas the lower steel feeding belt 30 b is entirely flat . the slanted portion of the upper steel feeding belt 30 a gradually slopes down from its start end and merges with the flat portion . the flat portion of the upper steel feeding belt 30 a and the lower steel feeding belt 30 b are distant by a predetermined distance . therefore , accumulated explosive - split fragments 10 sent from the second stacking means 29 are progressively compressed while moving between the upper steel feeding belt 30 a and the lower steel feeding belt 30 b . when they reach between the flat portion of the upper steel feeding belt 30 a and the lower steel feeding belt 30 b , a predetermined pressure is applied thereto , the expandable resin expands and cures , and a foamed board 31 of explosive - split fragments is obtained . the foamed resin board 31 of explosive - split fragments is cut into a predetermined length by a cross cut saw , for example , when it is discharged from the press means 30 . in the embodiment shown here , pressure of the press means 30 is set in the range from 0 to 0 . 2 mpa , and it is adjusted by adjusting the distance between the flat portion of the upper steel feeding belt 30 a and the lower steel feeding belt 30 b . heat need not be applied during compression . the foamed resin board of explosive - split fragments obtained through these steps is useful as a new heat - resistant material with a the greatest strength ever experienced . additionally , since explosive - split fragments serving as aggregate can be made with any of various shapes and properties , such as powdered ( 10 a ), cottony ( 10 b ), string - shaped ( 10 c ) and rod - shaped ( 10 d ) ones as explained with reference to fig1 heat - resistant materials with various properties , heavy or light , hard or soft , strong or weak , for example , can be obtained depending upon their applications . operations in the manufacturing machine are automatically controlled by a controller equipped with a microcomputer , for example . in the embodiment shown here , foamed resin boards 31 of explosive - split fragments in form of flat plates are manufactured continuously . however , configuration of the foamed resin board 31 of explosive - split fragments is not limited to flat plates . that is , as explained with reference to fig1 explosive - split fragments of various shapes and properties , such as powdered ( 10 a ), cottony ( 10 b ), string - shaped ( 10 c ) and rod - shaped ( 10 d ) ones , can be obtained by changing conditions including pressure , heating temperature and compression time , etc ., in the explosively splitting means 14 , and so , foamed resin boards of explosive - split fragments of various shapes and properties can be obtained as well . for example , by using powdered ( 10 a ), cottony ( 10 b ) and string - shaped ( 10 c ) explosive - split fragments as source materials and using molding boxes of various configurations , foamed resin boards with any shapes , such as curved faces , can be manufactured . in the embodiment shown here , explosive - split fragments 10 are manufactured continuously , and foamed resin boards 31 of explosive - split fragments are also manufactured continuously . however , it is also possible to obtain explosive - split fragments 10 by using the explosively splitting apparatus 9 shown in fig1 and to supply them consecutively to the drier means 28 shown in fig5 . in this example , sample materials were explosively split by using an existing hot press as the explosively splitting apparatus . therefore , samples have no constraint in right angles relative to the load direction , and they are permitted to freely expand and contract in right angles under a load . the samples were of cedar which was largest in storage quantity in japan , and water - saturated ( 100 to 200 %) lumbers , 60 cm long , 10 cm wide and 2 cm thick , were introduced into a hot press . then , by applying the pressure of 2 , 3 , 4 , 6 mpa under the heating temperature of 200 , 250 and 300 ° c ., and by instantaneously releasing the pressure after maintaining constant pressures for predetermined durations of time to invite water vapor explosion , explosive - split fragments of various shapes were obtained . its result is shown in fig6 . the table of fig6 shows durations of time required for explosive splitting when heating and compressing water - saturated 20 mm thick lumbers under the temperatures 200 , 250 and 300 ° c . and compressing pressures 2 , 4 and 6 mpa , and characters of strands ( explosive - split fragments ) obtained thereby . as the heating temperature and the compression pressure increase , the required time decreases , string - shaped strands ( explosive - split fragments ) are getting thinner and shorter , and coupling among strands ( explosive - split fragments ) changes from a cord - fabric configuration , net - shaped configuration to a semi - separated configuration . under the most severe heating and pressing conditions of 300 ° c . and 6 mpa , strands in form of minute cords , approximately 2 mm thick and 30 mm long , were obtained in a duration of time as short as 50 seconds , and strands were slightly coupled like a thread . samples used in this example were water - saturated ( 100 to 200 %) lumbers , 60 cm long , 10 cm wide and 2 cm thick . in the other respects , example 2 was the same as example 1 , and explosive - split fragments of various shapes were obtained . its result is shown in fig7 . the table of fig7 shows durations of time required for explosive splitting when heating and compressing water - saturated 30 mm thick lumbers under the temperatures 200 and 2500 ° c . and compressing pressures 3 and 6 mpa , and characters of strands ( explosive - split fragments ) obtained thereby . as the heating temperature and the compression pressure increase , the required time decreases , string - shaped strands ( explosive - split fragments ) are getting thinner and shorter from plate - shaped ones , through rod - shaped and cord - shaped ones to the form of chips , and coupling among strands ( explosive - split fragments ) changes from a cord - fabric configuration , net - shaped configuration to a semi - separated configuration and a fully separated configuration . under the most severe heating and pressing conditions of 250 ° c . and 6 mpa , strands in form of minute cords , approximately 3 mm thick and 200 mm long , were obtained in a duration of time as short as 90 seconds , and strands were coupled in form of a net . additionally , when lumbers were restricted in their width direction under the same heating and pressing conditions and thereafter released from the restriction simultaneously with release of the pressure , the required time was further decreased to 60 seconds , strands ( explosive - split fragments ) were thin and as short as 100 mm , and they were slightly couples in form of a thread . as explained above , it has been confirmed that various strands ( explosive - split fragments ) can be fabricated by explosively splitting lumbers by the process of heating , compressing and instantaneously releasing in a very short time . source materials used in the experiment were relatively thin lumbers of a uniform shape . however , materials to be practically used contain those of various shapes and sizes , and an enormous quantity of them must be processed . therefore , it is difficult to directly use the heating and compressing conditions used in the experiment also for actual fabrication . however , satisfactory explosive - splitting processing is expected by increasing the compressing pressure , elongating the heating and compressing time and adding restriction in right angles relative to the load applying direction . as described above , since the invention enables the use of all materials including slim trees or low quality trees which have been left unused , cut - off branches which have been discarded , wood cuttings produced in the course of lumbering , and construction wastes without waste , and promises a remarkably high yield relative to the source materials , it greatly improves the rate of effective use of wood materials . additionally , since explosively split fragments can be reconstructed as various veneer laminates or composite materials by using an adhesive , resin or cement , and new functions not found in existing wooden materials can be added , the use of reconstructed materials can be extended not only as plates , pillars , stanchions , etc . of furniture , houses and other buildings , but also as civil engineering materials and industrial materials . | 1 |
it has been observed that tagging is usually worse at the trailing edge of an overcoated document due to the spreading of the shear force along the whole trailing edge in the perpendicular approach to the peel bar 111 as illustrated by fig2 a and 2b . this is observed to be in contrast to characteristics of the operation along the side edges of the document where only a very small area of the overcoat - to - media edge enters the peel area at any time , thus maximizing the shear force . it has been found that the shear force can be magnified at the leading and trail edges along the direction of travel by an angled - approach of a coated document to a peel zone . fig3 a illustrates a first exemplary embodiment in which a peel bar 111 is skewed with respect to the direction of travel ( see labeled arrow ) of the document 113 and film 107 . with the angled - approach , the document 113 leading edge 301 and trailing edge 302 are forced to simulate a perpendicular approach document side edge interface with the peel bar 111 . only a relatively small area of each leading and trailing edge 301 , 302 is exposed to the peel bar 111 , in other words , within a “ peel zone ” ( see so - labeled region ) along the direction of travel , at a given time as the document 113 is separated from the carrier 303 which is then wrapped about the take - up reel 115 . this angled - approach limits and thus maximizes the shear force at that small area where peeling is currently occurring rather than having a peeling force spread simultaneously across the whole edge 301 , 302 simultaneously . fig3 b shows an alternative exemplary embodiment . while the peel bar 111 is perpendicular to the direction of travel ( labeled arrow ) of the film 107 as in fig2 a and 2b , the document 113 has been overcoated in the nip ( see fig1 ) by the adf 101 feeding the document at a skew angle , theta ( 0 ), to the direction of travel . again , as with the exemplary embodiment of fig3 a , the interface between the document 113 and the peel bar 111 will be angular rather than perpendicular ( compare fig2 a and fig3 b ). again , this angled - approach limits and thus maximizes the shear force at that small area where peeling is currently occurring . as many design implementations of the embodiment may constructed and each will related to specific design parameters for the film , media types , throughput , and the like parameters known to persons skilled in the art , the specific skew angle will vary accordingly . for an experimental implementation tested by the applicants for a - size paper , having a throughput speed of approximately 0 . 5 inches per second , a skew angle in the approximate range of five ( 5 ) to ten ( 10 ) degrees was successfully employed . specific implementations may vary as throughput speeds in the range of 0 . 3 to 0 . 5 inch per second and skew of +− 0 . 6 % were employed in the specific experiments of the inventors with satisfactory results . fig4 is a schematic drawing in elevation view of a thermal transfer overcoat mechanism providing an additional mechanism for reducing tags on the trailing edge of the document 113 . it has been found that applying tension to the document substrate during the peel will result in a significant reduction and substantial elimination of trailing edge tags in a thermal transfer overcoat apparatus 100 ′. a pair of pressure - contact exit rollers 121 , 122 , at least one of which is driven , receives the leading edge 124 in a nip therebetween downstream of the peel device 111 . tensioning of the document substrate at the peel can be achieved by driving the exit rollers 121 , 122 at a higher speed than that of the carrier ribbon onto the take - up reel 115 . slippage at the exit rollers surfaces in the nip , or via inclusion of a known - manner slip - clutch mechanism ( not shown ) in the drive train of the driven roller 122 , provides a requisite tension at the peel zone 126 . it has been found that for an experimental implementation relying on slippage at the exit rollers surfaces in the nip , where a throughput speed of approximately 0 . 5 inch / second was in progress , an overdrive speed in the approximate range of one percent ( 1 %) to three percent ( 3 %) was employed ; in an experimental implementation using a slip clutch mechanism , an overdrive speed in the approximate range of one percent ( 1 %) to eight percent ( 8 %) was employed . again , specific implementations will be dependent on the characteristics of the film , media types , throughput , and the like parameters known to persons skilled in the art . in other words , it will be recognized by those skilled in the art that the variables can be tuned to achieve satisfactory results . thus , rather than allowing the tag to peel away from the carrier ribbon as would be the norm for the apparatus as shown in fig1 , the tensioning takes advantage of a stress concentration formed at the substrate &# 39 ; s advance through the peel zone 126 , creating a condition where the release layer between the coating material and the carrier ribbon is loaded in tension rather than in peel . the combination of these factors results in the coating breaking cleanly at the trailing edge with minimal tagging , if any . a skewed operation is shown in fig3 a or 3 b . in the embodiment of fig3 a , the paper sheet 113 is longitudinally aligned with a skewed peel bar 111 . in the embodiment of fig3 a , the peel bar 111 is perpendicular to the direction of travel and the paper sheet 113 is skewed . note for the overdrive roller type of operation described with respect to fig4 , it is preferred that the peel bar not be skewed , allowing the coating to break in tension at once along the entire trailing edge of the sheet . other implementations of the methodology may be employed . for example , rather than overdriving the rollers , take - up tension can be controller by controlling the torque at the take - up motor . in this manner , one embodiment was shown to produce satisfactory results with take - up tension in the range of 1500 - 2000 gr . force . another implementation may incorporate a skew to the take - up reel to produce the shear force at a small area where peeling is currently occurring . the foregoing description of exemplary and preferred embodiments of the present invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form or to exemplary embodiments disclosed . obviously , many modifications and variations will be apparent to practitioners skilled in this art . similarly , any process steps described might be interchangeable with other steps in order to achieve the same result . the embodiments were chosen and described in order to best explain the principles of the invention and its best mode practical application , thereby to enable others skilled in the art to understand the invention for various embodiments and with various modifications as are suited to the particular use or implementation contemplated . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents . reference to an element in the singular is not intended to mean “ one and only one ” unless explicitly so stated , but rather means “ one or more .” moreover , no element , component , nor method step in the present disclosure is intended to be dedicated to the public regardless of whether the element , component , or method step is explicitly recited in the following claims . no claim element herein is to be construed under the provisions of 35 u . s . c . sec . 112 , sixth paragraph , unless the element is expressly recited using the phrase “ means for . . . ” and no process step herein is to be construed under those provisions unless the step or steps are expressly recited using the phrase “ comprising the step ( s ) of . . . .” | 1 |
the present invention provides for a polarization independent optical switch for selectably controlling the propagation of a complete optical signal from one path to another . the switch lacks many of the drawbacks described above while providing for additional advantages . although described with regard to particular embodiments , the invention is not so limited . one skilled in the relevant art would understand that particular modifications can be made without departing from the spirit and scope of the invention . fig6 illustrates a preferred 2 × 2 ( i . e . two input and two output ) embodiment of the present invention for selectably directing the &# 34 ; light &# 34 ; wavelengths between one of at least two different outputs . a dove prism is used for convenience and illustrative purposes only . also , the principle of the present invention is applicable to any electromagnetic radiation and is not limited to light wavelengths . the optical switch 22 incorporates two trapezoidally shaped dove prisms 24 and 26 with their bases 46 and 48 positioned opposite each other . any material which is transparent to the wavelength being switched can be used to construct the prisms ( e . g . plastic , porcelain , etc .). for example , any material that is amorphous , glassy and solid as opposed to a crystalline or birefringent material . further , the material should be an organic plastic or siliceous glass and have no light absorption in the near infrared spectral region . still further , the index of the glass should be greater than the extraordinary refractive index of a positive uni - axial crystal or greater than the ordinary refractive index of a negative uni - axial liquid crystal . still further , the glass should be of optical quality with no scattering centers , holes or cracks . for example , but not by way of limitation , suitable polymers are polycarbonate , polymethymetacrylate , acrylonitrile , polysulfone , or polyallyl diglcol carbonate as manufactured by optical coatings laboratory , inc ( santa rosa , calif .). also by way of example , but not by way of limitation , suitable siliceous materials are barium light crowns , special short flint , lanthanum crown , dense flint , and crown flint as manufactured by schott optical glass , inc . ( duryea , pa .). a high index glass such as lak10 glass by schott glass technologies ( duryea , pa .). furthermore , any geometric shape can be used for the prisms ( e . g . triangles , pyramids , slabs , rectangles , irregular shapes , spheres , cylinder , etc .) sandwiched between the two bases 46 and 48 is an active layer of liquid crystal material 36 for reflecting or transmitting all of the incident light . by &# 34 ; all &# 34 ; it is meant to distinguish from systems wherein only approximately half of the signal is transmitted or reflected . if some of the light is not reflected or transmitted due to a slight degradation of the signal , this is still presumed to be within the scope of the present invention . the generic type of liquid crystals belong to those manufactured by em industries , inc . ( hawthorne , n . y .) or by frinton laboratories ( vineland , n . j .). em manufactures the zli and e mixtures of liquid crystals such as zli - 3412 and e - 49 . these complex mixtures containing as much as 20 different liquid crystal components . the components forming the mixtures are biphenyl , cyclohexyl , cyclohexane , phenylpyrimidines , terphenyls , dioxanes , and many other classes of organic compounds . the general chemical structure consists of side chains , saturated and unsaturated ring systems , linking groups between the rings and terminal groups . the side chains belong to the following classes : alkyl , alkoxy , alkenyl or alkenyloxy groups . the rings systems consists of two or more aromatic , heteroaromatic , cyclohexyl , or heterosaturated cycles . the linking groups are alkanes , esters , unsaturated groups , azoy , and schiff bases . the terminal groups which provide dielectric anisotropy are cyano , halogeno , isocyano , trihalomethyl and similar types of strongly electron withdrawing moieties . these chemical mixtures are designed to have a wide mesophase range extending from below to considerably above room temperature . the mixtures have a large dielectric anistropy greater than 20 and a birefringence greater than 0 . 2 . the rotational viscosity if low . the bend elastic force constant is small . materials having the properties described above are e - 44 , ir - 41 and e - 49 manufactured by e . merck . the desired material has the difference between the extraordinary and ordinary indices of refraction close together . the desirable liquid crystal has a large negative dielectric anisotropy , hut a positive dielectric anisotropy also works . negative materials require homeotropic alignment in the zero voltage mode ; whereas , positive materials need homogeneous alignment . the liquid crystal material 36 is not a polarizing beam splitter as is used in other prior art devices . rather it is a completely reflecting or transmitting material as will be described in more detail below . sandwiching the liquid crystal material 36 , on both sides is a top alignment layer 37a and a bottom alignment layer 37b . alignment layers 37a and 37b , cause the liquid crystal molecules to align themselves homeotropically to the surfaces 46 and 48 when there is no electric field generated between the two transparent electrodes . sandwiching these layers is a top anti - reflective (&# 34 ; ar &# 34 ;) coating 36c and a bottom antireflective coating 36d . because the refractive index of the transparent electrodes is high relative to the refractive indexes of the switch body and the liquid crystal , anti - reflective coating ( 36a , 36c , 36d and 36f ) is applied to both sides of each of the two transparent electrodes . these layers prevent insertion losses due to reflection . these anti - reflective coatings also eliminate stray light which contributes to cross - talk . sandwiching these layers are a top transparent electrode layer 36b and bottom transparent electrode layer 36e . these electrodes are for applying a voltage to the liquid crystal material 36 . sandwiching these layers is another top antireflective coating 36a and another bottom antireflective coating 36f . these additional anti - reflective layers are for reducing reflection from the transparent electrodes which are highly reflective . it should be noted that although described with this layering configuration , the present invention is not limited so limited and can be designed with additional layers , with fewer layers , or with a different layering format . coupled to the sides 28 and 30 are fiber optic input ports 50 and 52 coupled to fiber optic input lines 35 and 42 . fiber optic input ports and lines are well known in the art . coupled to the sides 32 and 34 are fiber optic output ports 54 and 56 coupled to fiber optic output lines 40 and 44 . fiber optic output ports are also well known in the art . of course , the input ports can be used as output ports and the output ports as input ports . a discussion of the operation of the switch 22 follows which describes light entering from the upper left optical fiber 35 and exiting from either the upper right optical fiber 40 or lower right optical fiber 44 . this selection is discussed for illustrative purposes only as the switch is bidirectional and light can enter and exit through any fiber ( 35 , 42 , 40 , 44 ). input light ( polarized or unpolarized ) enters the switch 22 through the upper left fiber 35 . it passes through the upper left input port 50 where the light is collimated . by collimated light , it is meant that the light is non - diverging . the angle a made between the surfaces 28 and 46 ( and also between surfaces 32 and 46 , 30 and 48 , and 34 and 48 ) is set when the switch body is fabricated so that the light emanating from the input lens 50 strikes the surface 46 at a specific angle . in a particular switch operating state ( state 1 ) angle a is equal to or slightly greater than the critical angle determined by the refractive index of the switch 22 and the effective refractive index of the liquid crystal layer 36 . the critical angle a is the arcsin of the ratio of the effective refractive , n eff index divided by the refractive index of the glass , n g . the incident angle is θt . represented as an equation : under these conditions the light is totally reflected at surface 46 and enters the output port 54 which focuses the light into the output fiber 50 . by focusing , it is meant that the light signal passes through the aspheric lens . the effective refractive index of the liquid crystal layer 36 is determined by the strength of an electric field generated between the two transparent electrodes 36b and 36e . the direction of the optic axis with respect to the polarization of light determines the refractive index n eff the light sees . the tilt angle φ ( z ) of the liquid crystal with respect to the distance the molecules are from the surface , z determines n eff . in order to obtain the statistically averaged direction of the optic axis , the gibbs free energy per unit area , g of the system is minimized . g =∫[ f e1 + f die1 ] dz , where f e1 and f die1 are the volume density of free energy originating from the elastic deformation with elastic constants , k ii and die1ectric interaction with the external field , e . for a parallel - aligned cell , the elastic free energy density is f e1 = 1 / 2 ( dφ / dz ) 2 ( k 11 cos 2 φ + k 33 sin 2 φ ). the dielectric free energy density f die1 is related to the dielectric constants ε . sub .⊥ and ε // of the liquid crystal material and the applied electric field , e as f die1 =- 1 / 2ε 0 e 2 ( ε // cos 2 φ + ε . sub .⊥ sin 2 φ ). the following equations give f as a function of voltage , v . the equations are solved iteratively . given a v , φm is determined . once φm is determined then , φ at a distance z from the surface is calculated . 2z / d . sub . 0 ∫. sup . 2π [( 1 + kη sin . sup . 2 ψ )( 1 + γη sin . sup . 2 ψ )/) 1 - η sin . sup . 2 ψ )]. sup . 1 / 2 dψ =. sub . 0 ∫. sup . sin - 1 ( sinφ / sqrtη ) [( 1 + kη sin . sup . 2 ψ )( 1 + γη sin . sup . 2 ψ )/( 1 - η sin . sup . 2 ψ )]. sup . 1 / 2 dψ the threshold voltage v th is given by v th = πsqrt ( k11 / ε 0 ∇ ε ) in a switch operating state ( state 2 ), the strength of the electric field between the two transparent electrodes is adjusted so that the effective refractive index of the liquid crystal is the same as the refractive index of the switch 22 . fig1 presents a graph illustrating the relationship between the tilt angle of the molecules in degrees vs . the voltage relative to the threshold . in this state , the light beam crosses surface 46 of prism 24 , passes through the liquid crystal layer 36 and enters prism 26 at surface 48 . the light passes through prism 26 and enters output port 56 which focuses the light into output fiber 44 . thus , by changing the strength of the electric field impressed across the liquid crystal layer , the light entering through fiber 35 can be switched between output fibers 40 and 44 . optical switching with an active beam splitter involves the following parameters to ensure accurate and complete switching of the optical signal : the index of refraction of the glass , the ordinary and extraordinary refractive indices of the liquid crystal material , the incident angle of the light , polarization of light and applied voltages . there are two types of reflection at a glass surface , external reflection and internal reflection . external reflection occurs when light starts from an air environment and strikes a glass surface . internal reflection occurs when light starts from within the glass and strikes the internal surface of the glass . optical switches employ internal reflection . in place of a surface where glass meets air , the surface is the boundary between glass and liquid crystal material . the glass is part of the container holding the liquid crystal material . if light in the glass meets the liquid crystal material at a critical angle , the light reflects totally . the critical angle depends on the refractive indices of the liquid crystal relative to that of the glass . most materials like glass or water have only one refractive index . liquid crystals , on the other hand , have an ordinary refractive index , an extraordinary refractive index and an effective refractive index . the ordinary refractive index is similar to that found in most materials . it does not depend on the alignment of the molecules in the material . in fact , most ordinary materials have a random alignment of molecules . liquid crystal materials , however , have a well - defined alignment of molecules . the cigar shaped molecules point in the same direction . the direction in which the molecules point is the optic axis . electric fields , magnetic fields , surface properties and heat all influence this optic axis . the present invention utilizes two non - zero but different voltages for totally reflecting and totally transmitting states . the voltage for total reflection corresponds to the optic axis normally aligned to the glass surface . the voltage for total transmission corresponds to the optic axis aligned perpendicularly to both polarizations of the incident light or parallel to the direction of propagation . fig4 a and 4b illustrate a liquid crystal molecule 20 and how the ordinary and extraordinary refractive indexes relate to each other . both polarizations of an incident light correspond to the same refractive index whenever light propagates parallel to the optic axis . the length of the liquid crystal molecule corresponds to the extraordinary refractive index n e . the width of the molecule corresponds to the ordinary refractive index n o . the extraordinary refractive index changes with molecular alignment . the effective refractive index is an average of the ordinary and extraordinary refractive indices . liquid crystal materials have two classes of critical angles . one relates to the quotient of ordinary refractive index and glass . the former critical angle does not change with the angle the light beam makes with molecular alignment . the latter critical angle does change with the optic axis , the angle the molecules make with the surface . fig5 a and 5b illustrate the relationship between the electric field ( e - field ) and the light rays propagation direction . the electric field is perpendicular to the propagation direction of the light ray . the light ray intersects the surface 42 ( i . e . a liquid crystal ) normal at an angle θ . the electric field of the light ray forces electrons in the liquid crystal molecule 22 to oscillate in perpendicular and parallel directions to the longitudinal axis of the surface 24 . depending upon the orientation of the optic axis , the electric field corresponds to either the ordinary or extraordinary refractive indices of the liquid crystal material . in other optical switches , on or off electric fields place the optic axis either parallel or perpendicular to the surface . these are the two natural states of the optic axis . in these optical switches , the refractive index of the glass is greater than the ordinary but less than the extraordinary refractive index . there are several ways to design these switches . the optic axis has several possibilities for parallel alignment to the surface . one is parallel to the plane of incidence . another is perpendicular to the plane of incidence . a third condition is at some arbitrary angle between the parallel and perpendicular arrangements . with the optic axis normal to the surface , light polarized parallel to the surface totally reflects at the critical angle . if the effective refractive index of the liquid crystal is the same as the ordinary index , then the other polarization totally reflects light . with the optic axis parallel to the surface , the polarization reflected rests on the type of parallel alignment selected . electric fields in the present invention align the optic axis either ( 1 ) perpendicular to the surface or ( 2 ) parallel to the direction of propagation of the incident light ray . the glass refractive index is greater than both the ordinary and extraordinary refractive indices of the liquid crystal material . at an incident angle of zero , with respect to the optic axis , both polarizations correspond to the ordinary refractive index . both polarizations transmit . at an incidence angle equal to or greater than a critical angle corresponding to the extraordinary refractive index , both polarizations totally reflect off the surface . this occurs with the optic axis normal to the surface . the incident angle with respect to the optic axis is the critical angle . in order to minimize unwanted reflection , the ordinary refractive index is close in value to that of the glass . the extraordinary refractive index is close in value to the ordinary refractive index . the difference between the extraordinary and ordinary refractive indices , the birefringence , is small . when the refractive index of the glass is greater than both the ordinary , n o , and extraordinary , n e , the critical angle , a , is then the arcsin of the liquid crystal extraordinary refractive index to the glass index . when the refractive index of the glass is greater than the ordinary but smaller than the extraordinary index , then the critical angle , a , is the arcsin of the effective refractive index to the index of the glass . the effective refractive index is an average given by cos 2 a / n e 2 + sin 2 a / n o 2 . the desirable liquid crystal material has negative birefringence . in order to have a small incident angle , the ordinary refractive index lays between 1 . 5 and 1 . 6 . other values for the ordinary refractive index less than 1 . 5 or greater than 1 . 6 are fungible . positive birefringent liquid crystal material has an ordinary refractive index close in value to the ordinary refractive index . the desirable liquid crystal material has only a nematic phase . the nematic isotropic transition temperature is in excess of 120 degrees celsius . the crystalline nematic transition is below minus 20 degrees celsius . the material absorbs no light between 0 . 70 μm to 2 . 0 μm . it has a large dielectric anisotropy with scalar values exceeding 0 . 2 . the present invention never separates light into orthogonal polarizations . the light input is unpolarized . the selection event does not polarize the light . the light leaves the present invention unpolarized . as discussed above , the present invention can be utilized to create larger switches having multiple outputs . for example , fig7 illustrates an alternative 1 × 6 embodiment 60 . here , the switch is formed from a single main prism 62 and six trapezoidally shaped prisms 64 , 66 , 68 , 70 , 72 , 74 . sandwiched between each of the six trapezoidally shaped prisms 64 , 66 , 68 , 70 , 72 , 74 and the single main prism 62 are portions of liquid crystal material 65 , 67 , 69 , 70 , 73 , 75 . a single input 76 coupled to the left most prism 64 allows for input of a light signal 90 into the switch 60 . optical axis &# 39 ; of the liquid crystal material between each prism can then be properly oriented in order to direct the signal to an appropriate one of the output ports 78 , 80 , 82 , 84 , 86 , 88 . fig8 illustrates a larger embodiment of the switch illustrated in fig7 . an input optical signal can be directed to any one of the output ports by selectively applying a particular voltage to particular liquid crystal portions in order to realign their optic axis . for example , the optic axis of the liquid crystal material 65 can be realigned to reflect the light signal from the input port 76 to the output port 78 . alternatively , the optic axis of the liquid crystal materials 65 and 67 can be realigned to transmit the light signal 90 through to the output port 80 . in fig8 the 1 × 6 switch of fig7 has been extended to include additional output ports by extending the length of the main prism and adding additional trapezoidally prisms . the principle of operation is the same . fig9 illustrates another alternative 1 × 6 embodiment of the present invention . here , switch 92 is comprised of a triangularly shaped prism 94 and a trapezoidally shaped prism 96 . the base 95 of the triangularly shaped prism 94 and the base 97 of the trapezoidally shaped prism 96 sandwich portions of liquid crystal material 114 , 116 , 118 , 120 , 122 . an input port 98 is positioned along a side of the trapezoidally shaped prism 96 and five output ports 102 , 104 , 106 108 and 110 are positioned along a side of the triangularly shaped prism 94 . a sixth output port is positioned along an opposite side of the trapezoidally shaped prism 96 . finally , the surface of base 93 of the trapezoidally shaped prism 96 is 100 % reflective in order to continuously reflect . an input optical signal can be directed to any one of the output ports by selectively applying a particular voltage to particular liquid crystal portions in order to realign their optic axis . for example , light signal 100 can be directed to output port 102 by aligning the optic axis in liquid crystal material 114 to allow for a complete transmission of the light signal . alternatively , the optic axis of liquid crystal layer 114 can be realigned to reflect the light signal 100 , thereby reflecting the light signal 100 to the next liquid crystal material 116 . fig1 illustrates yet another alternative 1 × 6 embodiment of the present invention . here , switch 130 is comprised of three prisms : a four sided prism 132 , a rectangularly shaped prism 136 and a triangularly shaped prism 134 . sandwiched between the four sided prism 132 and the rectangularly shaped prism 136 are portions of liquid crystal material 152 , 156 and 160 . sandwiched between the rectangularly shaped prism 136 and the triangularly shaped prism 134 are also portions of liquid crystal material 154 , 158 and 162 . although shown here as discrete portions of liquid crystal material , it is apparent that two complete layers of liquid crystal material may also be utilized as this may be easier to manufacture . coupled to one side of the four sided prism 132 is an input 138 . coupled to another side of the four sided prism are output ports 140 , 142 and 144 . coupled to a side of the triangularly shaped prism are three additional output ports 146 , 148 and 150 . an input optical signal can be directed to any one of the output ports by selectively applying a particular voltage to particular liquid crystal portions in order to realign their optic axis . for example , a light signal can be directed to output port 140 by aligning the optic axis of liquid crystal material 152 to reflect the light signal from the input port 138 to the output port 140 . fig1 illustrates another embodiment which includes multiple input ports and multiple output ports . the switch is comprised of multiple layers 172 , 174 , 176 and 178 . sandwiched between these layers are portions of liquid crystal material 208 , 214 , 218 , 224 , 209 , 210 , 216 and 222 . also , the top surface of the layer 172 and the bottom surface of the layer 178 are coated with some type of reflective coating in order to completely reflect a light signal . this can be accomplished with the ar coating described above or with a layer of liquid crystal material . the reason for these reflective coatings will be described below . as with any of the prisms discussed herein with regard to any of the embodiments , the multiple layers can be formed from the same material . the switch 170 also includes multiple input ports 180 , 182 , 184 and 186 . the switch also includes multiple output ports 188 , 190 , 200 and 202 . an input optical signal can be directed from any of the input ports to any one of the output ports by selectively applying a particular voltage to particular liquid crystal portions in order to realign their optic axis . for example , a light signal can be directed from input port 184 to output port 202 by aligning the optic axis of liquid crystal materials 208 , 214 , 218 and 224 to each reflect the light signal . the light signal will therefore bounce within the layer 172 until it exits from output port 202 . fig1 illustrates a graphical illustration of the relationship between the tilt angle of the molecules in degrees vs . the voltage relative to the threshold . this illustrates the proper voltage to apply in order to obtain the proper rotation of the molecules in order to reflect or transmit the optical signal through the optical switch of the present invention . this graph should only be considered as illustrative however , and not as limiting . different types of liquid crystal material may have varying graphical representations while remaining within the scope and spirit of the present invention . as these alternative embodiments illustrate , the present invention is not limited to a particular embodiment or number of prisms , inputs or outputs . it is also not limited to a particular prism shape . rather , it can be implemented with various designs without departing from the spirit and scope of the invention . therefore , it is apparent that the present invention solves the drawbacks discussed above with respect to the prior art devices . | 6 |
[ 0022 ] fig1 is a block diagram generally depicting an arrangement 100 having a digital media transmitter node ( server ) 102 operatively coupled to provide at least one digital media stream to a receiving node ( client ) 104 through one or more communication resources ( network ) 106 . here , network 106 may include any number of radio - wave transceivers , receivers , transmitter , satellites , cables , fibers , wires , wave - guides , etc ., suitable for carrying a digital media data stream between server 102 and client 104 . server 102 can include one or more computers and other related broadcast devices . client 104 can include a special purpose computer or like device / appliance and / or a general - purpose computer that is configured to receive and process the data stream , accordingly . in certain exemplary implementations below , a high definition television ( hdtv ) appliance is described as having been programmed with the clock slaving algorithm described herein . with this in mind , attention is now drawn to fig2 which is a block diagram depicting an exemplary computing system 200 suitable with arrangement 100 . computing system 200 is , in this example , in the form of a personal computer ( pc ), however , in other examples computing system may take the form of a dedicated server ( s ), a special - purpose device , an appliance , a handheld computing device , a mobile telephone device , a pager device , etc . as shown , computing system 200 includes a processing unit 221 , a system memory 222 , and a system bus 223 . system bus 223 links together various system components including system memory 222 and the processing unit 221 . system bus 223 may be any of several types of bus structures including a memory bus or memory controller , a peripheral bus , and a local bus using any of a variety of bus architectures . system memory 222 typically includes read only memory ( rom ) 224 and random access memory ( ram ) 225 . a basic input / output system 226 ( bios ), containing the basic routine that helps to transfer information between elements within computing system 200 , such as during start - up , is stored in rom 224 . computing system 200 further includes a hard disk drive 227 for reading from and writing to a hard disk , not shown , a magnetic disk drive 228 for reading from or writing to a removable magnetic disk 229 , and an optical disk drive 30 for reading from or writing to a removable optical disk 231 such as a cd rom or other optical media . hard disk drive 227 , magnetic disk drive 228 , and optical disk drive 230 are connected to system bus 223 by a hard disk drive interface 232 , a magnetic disk drive interface 233 , and an optical drive interface 234 , respectively . these drives and their associated computer - readable media provide nonvolatile storage of computer readable instructions , data structures , computer programs and other data for computing system 200 . a number of computer programs may be stored on the hard disk , magnetic disk 229 , optical disk 231 , rom 224 or ram 225 , including an operating system 235 , one or more application programs 236 , other programs 237 , and program data 238 . a user may enter commands and information into computing system 200 through various input devices such as a keyboard 240 and pointing device 242 ( such as a mouse ). a camera / microphone 255 or other like media device capable of capturing or otherwise outputting real - time data 256 can also be included as an input device to computing system 200 . the real - time data 256 can be input into computing system 200 via an appropriate interface 257 . interface 257 can be connected to the system bus 223 , thereby allowing real - time data 256 to be stored in ram 225 , or one of the other data storage devices , or otherwise processed . as shown , a monitor 247 or other type of display device is also connected to the system bus 223 via an interface , such as a video adapter 248 . in addition to the monitor , computing system 200 may also include other peripheral output devices ( not shown ), such as speakers , printers , etc . computing system 200 may operate in a networked environment using logical connections to one or more remote computers , such as a remote computer 249 . remote computer 249 may be another personal computer , a server , a router , a network pc , a peer device or other common network node , and typically includes many or all of the elements described above relative to computing system 200 , although only a memory storage device 250 has been illustrated in fig2 . the logical connections depicted in fig2 include a local area network ( lan ) 251 and a wide area network ( wan ) 252 . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets and the internet . when used in a lan networking environment , computing system 200 is connected to the local network 251 through a network interface or adapter 253 . when used in a wan networking environment , computing system 200 typically includes a modem 254 or other means for establishing communications over the wide area network 252 , such as the internet . modem 254 , which may be internal or external , is connected to system bus 223 via the serial port interface 246 . in a networked environment , computer programs depicted relative to the computing system 200 , or portions thereof , may be stored in the remote memory storage device . it will be appreciated that the network connections shown are exemplary and other means of establishing a communications link between the computers may be used . the next few sections provide details into the basic functional subsystems of a server and client with respect to the handling of a media data stream . [ 0035 ] fig3 is a block diagram depicting an exemplary portion 300 of a server configured to output a transport stream . portion 300 includes a video encoder 302 and an audio encoder 304 configured to receive video and audio signals , and output corresponding mpeg video and mpeg audio , respectively . a video packetizer 306 is operatively coupled to the output of video encoder 302 and configured to output a packetized elementary stream ( pes ) corresponding to the encoded video . likewise , an audio packetizer 308 is operatively coupled to the output of audio encoder 304 and configured to output a pes corresponding to the encoded audio . video packetizer 306 and audio packetizer 308 are further operatively coupled to receive a clock signal from a reference clock 312 and in response to insert presentation timing information into the outgoing pes . the outgoing pes along with other data , such as , e . g ., user data , is provided to a transport multiplexer ( mux ) 310 , which multiplexes the inputs to produce a corresponding transport stream . [ 0036 ] fig4 is a block diagram depicting an exemplary portion 400 of a client configured to receive the transport stream . portion 400 includes a transport demultiplexer ( demux ) 402 , which receives the transport stream and demulitplexes it to produce a pes ( video ), pes ( audio ) and user data ( optional ) data streams . clock slaving logic 404 is provided within demux , 402 in accordance with certain aspects of the present invention , and configured to modify a host clock 406 operatively coupled to demux 402 based on the pcrs received with the transport stream . the pes ( video ) data stream is provided to a video depacketizer 408 , which , as its name suggests , depacketizes the pes ( video ) data stream and outputs corresponding mpeg video data . similarly , the pes ( audio ) data stream is is provided to an audio depacketizer 410 that depacketizes the pes ( audio ) data stream and outputs corresponding mpeg audio data . the resulting mpeg video data is provided to a video decoder 412 that is configured to decode the mpeg video data and output corresponding video data to a video renderer 416 . video decoder 412 does so using timing information provided by host clock 406 . the resulting mpeg audio data is provided to an audio decoder 414 that is configured to decode the mpeg audio data and output corresponding audio data to an audio renderer 418 . audio decoder 414 also does this by using timing information provided by host clock 406 . video renderer 416 generates a display based on the video data and audio renderer 418 reproduces audio based on the audio data . those skilled in the art will recognize that data can be buffered at various stages in either of portions 300 or 400 , as needed , and that such detail is beyond the scope of this description . the next section provides additional details on a clock slaving algorithm that can be implemented , for example , in logic 404 of fig4 or other like devices / configurations . in one example below , the clock slaving algorithm is configured for use with direct show ( dshow ), and in another with an hdtv appliance . in the example below , the code was written for use in hdtv demultiplexing software . for this particular component , the client - side rendering software has to make use of a clock that is slaved to the reference clock . the demultiplexer exposes such a clock when configured with logic 404 . hdtv programs are authored remotely , using a common ( physically ) reference clock . the programs are then broadcast to clients . each client must slave its host clock to the reference clock . to date , hdtv solutions are monolithic . a large application is tightly coupled with hardware . the application , with hardware assist , demultiplexes , decodes , and renders . a hardware - based vco clock is used and is readily accessible from all parts of the application . such a solution is monolithic and fixed , and yields no room for change or improvement . the solution presented herein is non - monolithic . no specific hardware requirements must exist , other than the presence of one high - performance timer . any number of broadcast applications can then use the timer as a basis from which to slave their host clocks . it can be used for any pc - based system , and as such must , and is , sufficiently versatile to work on non - monolithic platforms . furthermore , the algorithm is scalable , and not bound to hdtv &# 39 ; s 27 mhz system clock . if such a slaving scheme were not in place , a buffer underflow or overflow situation would arise . a buffer overflow exists when the incoming stream rate exceeds the actual throughput of the receive - to - render rate , and all buffer space is used . when all extra buffering becomes exhausted , data will be lost at the receiver because no buffer will be available to receive into . buffer overflow would occur if the host clock ran slightly slower than the reference clock . the manifestation of this problem would be lost data . a buffer underflow occurs when the actual throughput of receive - to - render rate is faster than the delivery rate . in this case , no buffering will exist , and all data will be rendered as rapidly as possible . the manifestation of this problem is non - smooth playback . in certain implementations , the clock slaving algorithm can be considered a disparity detection algorithm . in the commented code example below , an initial value selection process is shown . this also outlines how host clock 406 values should be computed and initialized , based on the multimedia timer and the detected clock drift ( e . g ., using pcr timing information ). pcr program clock reference ; a timestamp in an mpeg - 2 transport stream from which decoder / rendering timing information is derived ; variables named “ pcr ” have values derived from the transport stream timestamps . qpc queryperformancecounter ; an api call to sample a high - resolution multimedia timer ; variables named with “ qpc ” have values derived from the multimedia timer . media sample directshow data structure used to reference data ; data is usually of multimedia content , but not restricted to this . undefined constant used to initialize variables and indicate that they are undefined demux 402 / logic 404 exposes a clock that is slaved to a pcr stream . the pcr is a sampled value from reference clock 312 , which is also used to generate the pes pts . since demux 402 / logic 404 produces dshow presentation timestamps , which are scaled - only values of the pes pts values , keeping a graph clock in sync with the headend clock ensures that buffers will never underflow / overflow . demux 402 / logic 404 therefore slaves to the pcrs by sampling the qpc counter every time a pcr is received . over time , a delta which is relatively free of on - host jitter such as batched media sample deliveries , interrupts between buffer reception and buffer processing , etc . . . , is built up for each clock . the slope pcr ( delta )/ qpc ( delta ) would be 1 . 0 if they are identical . most likely , they are not , in which case the slope provides a direct scaling value to skew the qpc clock values to the pcr clock . to return a time , logic 404 keeps track of the following : pcr slaving algorithm : receive ( pcr , discontinuity ) { // sample - on - host clock qpc_now = queryperformancecounter () // normalize the qpc value qpc_now_normalized = qpc_now - qpc_first // normalize the pcr value pcr_normalized = normalize ( pcr ) if ( discontinuity == false ) { if ( pcr_last != undefined ) { pcr_total += pcr_normalized - pcr_last qpc_total += qpc_now_normalized - qpc_last } if ( pcr_last != undefined and pcr_total & gt ; 0 and qpc_total & gt ; 0 ) { pcr_qpcslopenew = pcr_total / qpc_total if ( pcr_qpcslopenew & gt ; pcr_qpcslopeused + allowableerror ) { // above allowable bounds ; // adjust up diff = pcr_qpcslopenew - pcr_qpcslopeused slopestep = min ( diff , maxslopestepvalue ) pcr_qpcslopeused = pcr_qpcslopeused + slopestep ; // allowable error is initialized to a smaller and smaller // value as it converges allowableerror = min ( maxallowableerrorbracket , diff ) } else if ( pcr_qpcslopenew & lt ; pcr_qpcslopeused - allowableerror ) { // below allowable bounds ; // adjust down diff = pcr_qpcslopeused - pcr_qpcslopenew slopestep = min ( diff , maxslopestepvalue ) pcr_qpcslopeused = pcr_qpcslopeused - slopestep // allowable error is initialized to a smaller and smaller // value as it converges allowableerror = min ( maxallowableerrorbracket , diff ) } else { // within allowable bounds // degrade allowableerror allowableerror −= errorbracketdegradation } } pcr_last = pcr_normalized ; qpc_last = qpc_now_normalized ; } } initial values are set as follows : // logic 404 immediately start correcting allowableerror = 0 ; // macro defined below maxslopestepvalue = max_slope_step_value () ; // expect perfect pcr_qpcslopeused = 1 ; // macro defined below errorbracketdegradation = error_bracket_degradation () ; // macro defined below maxallowableerrorbracket = max_allowable_error_bracket () ; timing constants for hdtv example : // h . 222 . 0 , d . 0 . 2 “ audio and video presentation synchronization ”, pp . 95 # define max_intra_pts_interval_millis 700 // h . 222 . 0 , d . 0 . 3 “ system time clock recovery in the decoder ”, pp . 96 # define max_intra_pcr_interval_millis 100 # define max_pcr_rate ( milliseconds_per_second / max_intra_pcr_interval_millis ) // // h . 222 . 0 , 2 . 4 . 2 . 1 places the following restraint on rate of change of the // system clock : // // rate of change of system_clock_frequency & lt ;= 75 × 10 { circumflex over ( )}− 3 hz / s // // since we use qpcs to expose a clock ( that in turn is slaved to pcrs ), the // above constraint must be enforced against the qpc frequency on the local // host , over time // // our slaving schema is to compute a scaling value ( slope ) over time , which // we multiply against a qpc value to skew the value appropriately ( greater , // or less , depending on the pcr - qpc relationship ) // // thus , given qpc ( f ) as being the qpc frequency ( hz / s ) on the local host , // and n ( i ) being a current “ skewing ” value that changes over time as we // slave to the pcrs , our maximum allowable rate of change is computed as // follows [ qpc ( f ) changes from host to host , but is assumed constant on // a single host ]: // // [ i : seconds ] // // abs ( n ( i ) * qpc ( f ) - n ( i + 1 ) * qpc ( f )) & lt ;= 0 . 075 // or // abs ( n ( i ) - n ( i + 1 )) * qpc ( f ) & lt ;= 0 . 075 // or // abs ( n ( i ) - n ( i + 1 )) & lt ;= 0 . 075 / qpc ( f ) // // we can then use the above formula , coupled with the maximum rate of // arrival of pcrs , to compute a maximum “ clock step ” with which to // correct our scaling value : // // [ k : pcrs ] // // pcr_rate = milliseconds_per_second / max_intra_pcr_interval_millis // // abs ( n ( k ) - n ( k + 1 )) & lt ;= ( 0 . 075 / qpc ( f )) / pcr_rate // or // abs ( n ( k ) - n ( k + 1 )) & lt ;= 0 . 075 / ( qpc ( f ) * pcr_rate ) // // macro yields a double value that is the maximum rate change , from // pcr to pcr ; mult is a registry supplied value that defaults to 1 , // but can be increased to increase the rate of closure between what we // are observing and what we are using to slave # define max_slope_step_value ( qpc_freq , mult ) \ (( double ) ((( 0 . 075 ) * ( double ) ( mult )) / ( double ( qpc_freq ) * double ( max_pcr_rate )))) // this is a multiplier that is used in the allowable error bracket , which // is a multiplier , within which we allow the clock to ” jitter ” i . e . drift // up and down without triggering a correction # define acceptable_clock_jitter_multiplier 10 . 0 // macro yields the max correction threshold frame size ; # define max_allowable_error_bracket ( max_clock_step ) \ (( max_clock_step ) * acceptable_clock_jitter_multiplier ) // macro yields the correction frame size degradation ; current frame // size degrades when no corrections are made ; # define error_bracket_granularity 1000 . 0 # define error_bracket_degradation ( max_clock_step ) \ ( max_allowable_error_bracket ( max_clock_step ) / error_bracket_granularity ). with these examples in mind , reference is now made to fig5 - 8 , which are graphs depicting the amount of buffering required over a period of time . fig5 and 6 illustrate the head - end clock relationship , wherein pcrs and ptss are being sampled from the same block , so no drift occurs . fig7 and 8 illustrate the presence of clock - drift and the buffering problem it introduces . the graph in fig9 and accompanying text demonstrates the slope to drift relationship . the diagram in fig1 shows the host_clock timeline and how the graph clock values are computed based on the slope ( m ), and the last returned time ( host_clock &# 39 ; n − 1 ). the various methods and arrangements described herein also ensure that pts values and host clock values always increase monotonically over time . usually , over time , as streams that have been authored in different places are broadcast , the pts / pcr sample values will present discontinuous values when a program is switched . for example , when a switch is made from normal programming to a commercial , such a discontinuity can be observed . when normal programming is resumed after the commercial , another discontinuity can be observed . there can also be discontinuities commercial - commercial . the clock slaving algorithm smoothes out these discontinuities and expose a host clock and generate presentation time stamps that always increase monotonically . although some preferred embodiments of the various methods and arrangements of the present invention have been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the exemplary embodiments disclosed , but is capable of numerous rearrangements , modifications and substitutions without departing from the spirit of the invention as set forth and defined by the following claims . | 7 |
fig1 shows a ring gear carrier 1 formed as a sheet component , illustrated as an individual component . the ring gear carrier 1 is in the form of a disk 1 a whose circumferential edge is shaped to form a fixing flange 1 b . fig2 shows a basic body 2 as an individual component , which is made in the first instance as a cast or forged blank . the basic body 2 has inner teeth 3 whose location is only indicated , which are produced by machining and then case - hardened . on its outer circumference the basic body has individual zones distributed around the circumference , with a carrier tooth array 4 consisting of individual teeth 4 a . fig3 shows a disk carrier 5 formed as a sheet component and produced by deformation . the disk carrier 5 has a driving profile 6 which serves for the positively interlocked connection of the inner disks ( not shown ) of a disk set for a shifting element of a transmission . the driving profile 6 is preferably trapezium - shaped and corresponds to the profile of the driving teeth 4 on the basic body 2 . fig4 illustrates the assembly of the above - mentioned individual components 1 , 2 and 5 to form a ring gear 7 . the ring gear carrier 1 is connected positively to the basic body 2 by deformation of its flange 1 b , so that the two components can rotate freely in the rotation direction but are fixed relative to one another in the axial direction . the disk carrier 5 is pushed in the axial direction over the basic body 2 , in such manner that the driving teeth zones 4 engage in the driving profile 6 and thereby form a positive connection in the rotation direction . fig5 shows the ring gear 7 from another perspective , i . e . looking at the outside of the ring gear carrier 1 . the ring gear 7 is made as a composite structure , i . e . it comprises two sheet components 1 , 5 produced by deformation and the machined basic body 2 . in general terms the ring gear 7 is also referred to as the component with basic body inner teeth 3 and outer teeth of the driving profile 6 . fig6 shows a partial section in the area of the driving teeth 4 of the basic body 2 and the driving profile 6 of the disk carrier 5 . the teeth 4 a have back - tapers or undercuts in the area of their tooth bases 4 b , which are formed as rounded notches in each tooth base 4 b . a tooth 6 a of the driving profile 6 engages in each case in the tooth gap between two adjacent teeth 4 a . the tooth 6 a has two straight flanks 6 b and a tooth tip 6 c with a concave shape ( arched upward in the drawing ), which forms a hollow space relative to the bottom 4 c of the driving tooth 4 . the concave tooth tip 6 c profile forms a preliminary profile during the production of the ring gear 7 , and with this preliminary profile the disk carriers 5 is pushed onto the driving teeth 4 of the basic body 2 . fig7 shows the same partial section as fig6 , but after the driving profile 6 has been deformed , i . e . after the concave tooth tip area 6 c has been stretched , the stretched shape being indexed 6 c ′. by exerting a radially inward - directed force ( not shown ) on the dome of the concave area 6 c ( fig6 ), the latter is stretched to a substantially straight position 6 c ′ whereby the corner areas are forced as projections 6 d , 6 e into the undercut areas 8 , 9 at the root of the tooth 4 b . this produces all - over contact between the driving profile 6 and the driving teeth 4 of the basic body 2 , and thus an interlocked connection in the manner of a dovetail . the carrier profile 6 is therefore held firmly against the basic body 2 even under the action of a centrifugal force at higher rotation speeds , and radial displacement that would lead to “ lifting ” of the disk carrier 5 is prevented . by virtue of frictional locking in the area of the dovetail joint , at the same time the disk carrier 5 is fixed in the axial direction relative to the basic body 2 , and thus onto the ring gear 7 . | 8 |
in the following description , for the purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the present invention . it will be apparent , however , to one skilled in the art that the present invention may be practiced without some of these specific details . in other instances , well - known structures and devices are shown in block diagram form to avoid obscuring the underlying principles of the invention . referring now to fig1 an exemplary wireless device 100 is illustrated within which a double f antenna according to the present invention may be incorporated . although fig1 illustrates a person digital assistant ( pda ), the present double f antenna , may be used on any wireless or bluetooth enabled device , such as a computer keyboard , mouse , digital camera or cordless phone . a double f antenna according to one embodiment of the present invention is within device 100 . fig2 schematically illustrates an integrated circuit 200 having double f antenna 299 with supporting circuitry 250 according to one embodiment of the present invention . antenna 299 has two ports , transmit port 204 and receive port 203 . antenna 299 is symmetrical in one embodiment ; although non - symmetrical embodiments are also considered to be within the scope of the present invention . in one embodiment , the height ( h port 207 ) of ports 203 , 204 are 5 mm , and the width ( w port 206 ) of ports 203 , 204 are 1 . 6 mm . antenna 299 also includes a grounding port and via 202 which connects ground plane 214 to antenna 299 . the width ( w via 205 ) of grounding port and via 202 may be 1 millimeter in one embodiment . the length ( l ant 209 ) of antenna 299 can be 42 mm . the height ( h ant 211 ) can be 1 mm in one embodiment . the length ( l 1 208 ) of one end of antenna 299 to ground port and via 202 can be 20 . 5 mm and the length ( l 2 210 ) of one end of antenna 299 to port 203 can be 16 . 8 mm . in one embodiment , antenna 299 is made from one ounce copper , with conductivity 58 , 000 , 000 and permeability 1 , although other conductive metals are considered to be within the scope of the present invention . because antenna 299 is symmetrical either port 203 , or 204 may be configured to transmit or receive via the radiative portion of antenna 299 . substrate 213 may be fr4 material having relative permittivity of 4 . 5 and electric loss tangent of 0 . 03 or other material with similar dielectric properties . in one embodiment , the height of substrate 213 can be 36 mm . a top side ground plane 215 is also included in circuit 200 . fig2 also illustrates supporting circuitry 250 for use with antenna 299 . circuitry 250 is connected to antenna 299 via ports 203 , 204 . matching circuits 264 and 265 match the impedance of antenna 299 with supporting circuitry 250 . transmit port 204 is connected to transceiver 260 via matching circuit 264 . receive port 203 is connected to transceiver 260 via matching circuit 265 . transceiver 260 includes a transmitter 262 for providing signals for broadcast on antenna 299 . a receiver 263 receives signals from antenna 299 , such as signals in the 2 . 4 ghz frequency range , using bluetooth technology . transmit and receive signals may be ( de ) modulated or mixed at baseband processor 261 . circuit 200 communicates with the rest of device 100 via interface 251 which may be a universal serial bus ( usb ), serial port or joint test action group ( jtag ) connector . interface 251 is connected to transceiver 260 . although circuitry 250 is shown to be a simplified transceiver scheme , other configurations are also considered to be within the spirit and scope of the present invention . fig3 schematically illustrates a top view 300 of antenna 299 ( support circuitry 250 is not shown ). fig4 schematically illustrates a front view 400 of antenna 299 ( support circuitry 250 is not shown ). fig5 schematically illustrates a side view 500 of antenna 299 ( support circuitry 250 is not shown ). fig6 schematically illustrates a front - angle view 600 of antenna 299 ( support circuitry 250 is not shown ). also shown in fig6 are vias 601 for connecting bottom side ground plane 214 with top side ground plane 215 . fig7 schematically illustrates a back - angle view 700 of antenna 299 ( support circuitry 250 is not shown ). fig8 illustrates a graph 800 displaying the frequency response 801 of antenna 299 when receiving signals . at 2 . 45 ghz , antenna 299 shows approximately − 10 . 5 db gain . the shape of graph 800 indicates that energy from other devices broadcasting at frequencies other than 2 . 45 ghz will be rejected by antenna 299 . although , the present example was that of a bluetooth device operating at 2 . 45 ghz , antenna 299 can be tuned to provide a similar frequency response as shown in fig8 for other operational frequencies . fig9 illustrates a graph 900 displaying the frequency response 901 of antenna 299 when transmitting signals . a high performance antenna has little reflection of the energy transmitted or received through it , as is evidenced by the shape of graph 800 . in the present example at 2 . 45 ghz , the gain of antenna 299 is approximately − 15 dbm , which is only approximately 10 % loss of power passed through transmit port 204 . although , the present example was that of a bluetooth device operating at 2 . 45 ghz , antenna 299 can be tuned to provide a similar frequency response as shown in fig9 for other operational frequencies . fig1 is a smith chart 1000 illustrating the impedance characteristics of antenna 299 according to one embodiment of the present invention . according to graph 1001 , a 4 . 7 pf capacitor may be used to perfectly match the input impedance of antenna 299 to 50 ohms . this capacitor may be placed within matching circuits 264 , 265 . fig1 illustrates the radiation pattern 1100 of antenna 299 . thus , in free space , antenna 299 radiation graph 1101 is consistent with a − 20 dbm loss of energy , due to imperfect isolation between ports 203 and 204 . the radiation pattern 1100 is at 2 . 45 ghz although other frequencies are also within the scope of the present design . throughout the foregoing description , for the purpose of explanation , numerous specific details were set forth in order to provide a thorough understanding of the invention . it will be apparent , however , to one skilled in the art that the invention may be practiced without some of these specific details . for example , while the embodiments described above focused on the bluetooth protocol , many of the underlying principles of the invention may practiced using various other types of wireless and terrestrial protocols . accordingly , the scope and spirit of the invention should be judged in terms of the claims which follow . | 7 |
according to the invention , the reactive constituents are reacted with one another in a vacuum in an evacuatable container , the container being evacuated to a first vacuum value , and the first vacuum value being chosen so that the reaction continues and is not stopped , and the pressure in the container due to the gasses forming during the reaction is then allowed to increase with a specified pressure difference up to a second vacuum value . this step is repeated cyclically by repeated , controlled opening and closing of the valve to the vacuum pump , with a specified number of cycles in a specified time , after which the reaction is stopped by drying in a vacuum . consequently , the evolution of carbon dioxide and of steam can be slowed down and controlled . the term “ pendulum vacuum ” was coined for this process . the characteristic data and parameters of the pendulum vacuum , such as the pressure difference , the first and second vacuum value and the number of cycles and the time span in which the cycles take place , optionally also the maximum of the stirrer load , can be specified . with the specification of these parameters essential for the course of the reaction , independently of different raw material qualities , all further production batches of a product can be run fully automatically and these data can be established in a product - specific manner for each product and can be specified for the further production . this is particularly important for automated computer - controlled operation . an advantage of the method according to the invention is that water forming in the reaction — depending on the vapor pressure at the chosen vacuum values — or the solvent introduced evaporates in the course of the reactive granulation as a result of the choice of the vacuum range and the chosen pressure difference and as a result of the number of cycles in a predetermined time in the reduced vacuum and thus does not influence the reaction in a secondary process . as a result , specific and readily controllable reactions are permitted and an uncontrollable chain reaction is avoided . owing to the slowed down and controlled reaction with a pendulum vacuum , a direct sequence of reaction cycles can take place without intermediate drying , whereupon , after the end of the specified number of cycles , within a predetermined time span , the granules can be dried and can be comminuted to the desired particle size . in the present application , “ vacuum ” is understood as meaning a state of space having a pressure reduced relative to the ambient air . it is important that the pressure increase to the second vacuum value does not take place up to the atmospheric pressure which prevails at the location . the second vacuum value should be at least 10 % below the ambient pressure prevailing in each case at the location . the following examples for vacuum values relate to an ambient pressure of 1 bar . the pressure difference between the first and second vacuum value should be from 200 to 700 mbar , preferably from 300 to 500 mbar , and a controlled reaction should take place cyclically in a vacuum range of from 200 to 900 mbar . the first vacuum value is chosen so that a portion of the amount of liquid required for starting the reaction remains behind in the reaction container after the first evacuation to the first vacuum value and hence sufficient moisture is present for the continuation of the reaction after reevacuation to the first vacuum value . the pressure increase up to the second vacuum value is established as a function of the reactivity of the reactive constituents and the amount of carbon dioxide and steam forming as a result of the reaction . for precise control of the course of the reaction , the parameters of the method , i . e . the first and the second vacuum value and also the pressure difference , can be varied from cycle to cycle . the reaction taking place in cycles can also be repeated after the additional introduction of solids or liquids without intermediate drying . for carrying out the automated method , the evacuatable container , for example a drum or a vessel , is loaded with the starting materials containing the reactive constituents , the amount of liquid required for starting the reaction is added and the program is started , which can run under automatic control , for example according to the predetermined values of the parameters ; first vacuum value of 500 mbar , second vacuum value of 800 mbar , pressure difference of 300 mbar , maximum number of cycles of 4 in a maximum duration of reaction of 5 min . the reaction is stopped after the first maximum is reached , i . e . either the number of cycles or the duration of the method . the reaction can be stopped by vacuum drying . thereafter , the further process steps , for example admixing of further ingredients , further granulation , final drying , comminution , sieving and emptying , are actuated . it is possible to use various types of vacuum pumps , such as rotary vane , liquid ring or screw rotor pumps , having a nominal suction capacity adapted to the container size , which pumps should be capable of reaching a final pressure of 0 . 1 mbar and of evacuating the empty container in from 30 sec to two min to 10 mbar . in the case of a reactive granulation , the method according to the invention can be used independently of the temperature and method by which the reaction is started . the temperature at which the method according to the invention is carried out is not critical . it is possible to work at room temperature ( 20 ° c .) or at an elevated product temperature of , for example , from 40 to 80 ° c . the liquid which serves as granulating liquid can either be applied to one of the reactants , such as the edible organic acids or the alkaline effervescent constituents eliminating carbon dioxide , before the second reactant is added , or can be introduced directly into a mixture of the effervescent components . the introduction of the liquid can be effected , as described in u . s . pat . no . 4 , 824 , 664 , by aspiration in a vacuum . if the raw material of one or both reactants has a higher proportion of residual moisture , the cycles take place more rapidly , over reaction or over granulation being prevented according to the method according to the invention , which is not only time - controlled , by the predetermined number of cycles . at relatively low residual moisture content , the cycles take place more slowly , but in this case the required reaction and granulation are nevertheless achieved by the maximum specified duration of the method . apart from polar solvents , binder solutions in water , alcohols or mixtures thereof can also be used as liquids for effervescent granules , such as , for example , polyvinylpyrrolidones , polyethylene glycol or hydroxypropylmethylcellulose , sugar solutions or solutions of sugar alcohols or colloids . furthermore , it is possible to use reactive solutions , such as , for example , solutions of organic acids in water or water / ethanol , or of acidic salts of the edible organic acids or of the alkaline salts thereof . the reactive constituents in the case of effervescent granules include at least one acidic effervescent component , i . e . a solid , organic acid and / or the salts thereof , and at least one alkaline effervescent component eliminating carbon dioxide . the organic acid is preferably edible . it is also possible to react with one another a plurality of different organic acids and / or salts thereof and / or effervescent components eliminating carbon dioxide . furthermore , in certain embodiments of the invention , other components , for example magnesium oxide , may be present as reactive constituents . the method according to the invention is furthermore suitable for the production of effervescent granules , in which the liberation of water from hydrates of the reactive constituents on heating is utilized for the granulation . “ hydrate ” is understood as meaning the chemical compounds of organic or inorganic substances with h2o , the h2o not being a constituent of complex compounds . the bound h2o is also designated as water of crystallization or water of hydration . it is also possible to use for this purpose water - containing organic acids , such as , for example , citric acid monohydrate or water - containing sodium carbonate , which , with increasing temperature , release water which is required for the reactive granulation . this process is known as “ difficult to control in order to achieve reproducible results ” ( lachman & amp ; lieberman : pharmaceutical dosage forms , 1980 ; page 233 ). by means of the method according to the invention , on the other hand , it is possible to carry out a readily controllable and reproducible process in which a number of up to 100 cycles , optionally even more than 100 cycles , of the pendulum vacuum between two specified vacuum values takes place in a certain time or up to warming - up of the material to a temperature of from 30 to 80 ° c ., with a result that a part of the water ( the amount is dependent on the vapor pressure of the water at the chosen temperature and the chosen vacuum value ) and a part of the carbon dioxide is extracted by suction in the repeating cycles and the process can no longer be influenced in an uncontrolled manner . the method according to the invention can be used for the production of a very wide range of effervescent granules and of effervescent tablets which can be produced from these effervescent granules , for example : granules comprising pharmaceutical active substances which react with the acidic effervescent components or the alkaline effervescent components , granules comprising pharmaceutical active substances which do not react with the effervescent components used but are granulated together with the effervescent base , effervescent base granules which , after granulation , are mixed with pharmaceutical active substances suitable for effervescent tablets and optionally excipients , neutral substances and flavors . the examples of suitable groups of active substances are : analgesics , antipyretics , antihistamines , antiallergic agents , antibiotics , antidiabetic agents , oncolytic agents , expectorants , electrolyte preparations , laxatives , vitamins , phytopharmaceuticals , cardiovascular agents , antidiarrhoeal agents , diuretics and agents for stimulating blood flow . in a further embodiment it was found that , by an additional increase of the carbon dioxide partial pressure , not related to the reaction , in the reaction container , at least a part of the residual moisture still adhering to the effervescent crystals after vacuum drying can be “ deactivated ” and the effervescent system thus made more stable during storage . usually , the residual moisture content is in the range of from 0 . 01 to 1 % by weight , in particular in the range of from about 0 . 1 to 0 . 8 % by weight , depending on the effervescent system . in the case of particularly reactive systems , the additional introduction of carbon dioxide proved to be advantageous for making the process of the reactive granulation even better controllable . surprisingly , it was found that this simultaneously led to stabilization of the granules in the context of reduced sensitivity to the remaining residual moisture , which could be checked using our own special measuring instruments , on the basis of the liberation of carbon dioxide from the prepared product . this discovery is utilized in a further embodiment of the method according to the invention by the additional introduction of carbon dioxide in the pendulum process and / or during the subsequent final drying . the advantageous effect mentioned is achieved by allowing additional carbon dioxide gas to flow from an external source into the reaction container with stirring after application of a vacuum in the course of the reaction granulation of effervescent systems , such as , for example , in the cyclic reaction granulation according to the invention under a pendulum vacuum , but especially in the course of the final drying of effervescent systems produced in this manner . in this way , in the reaction granulation , in the course of the cycle and in the final drying of the systems , the increased carbon dioxide partial pressure can lead to a further reduction of the reaction so that — owing to the inflowing carbon dioxide during the reaction granulation — the number of cycles should be typically increased and optionally up to ten times more cycles should take place than in the case of a reaction procedure without external feeding of carbon dioxide . by means of our own measuring instruments especially developed for this purpose , with the aid of which the tiniest amounts of gas of the order of magnitude of microliters can be exactly measured and documented , it is possible to analyze effervescent systems , regardless of the method of their production , for their reactivity by the residual moisture . on the basis of such measurements it can be shown that the use of the additional increase in carbon dioxide partial pressure actually leads to a significantly improved stability of the effervescent systems . in a further embodiment , the carbon dioxide partial pressure prevailing in the container is increased — either additionally or for the first time — after the end of the reaction granulation by repeated implosion of carbon dioxide gas into the reaction container . by means of this measure , it is possible to surround or to saturate the effervescent particles with carbon dioxide to such an extent that , even on prolonged storage of the effervescent granules , a carbon dioxide microatmosphere is evidently retained and effectively inhibits or suppresses further reaction of the acidic and alkaline components with one another . it is known that numerous pharmaceutical active substances , such as , for example , acetylsalicylic acid or acetylcysteine , are very sensitive to residual moisture content in effervescent formulations because , for example , in the case of acetylsalicylic acid , free acetic acid forms through hydrolysis and in turn can initiate a secondary chain reaction . however , it is precisely such a chain reaction that can be substantially reduced owing to the stability - improving measure according to the invention through increasing the carbon dioxide partial pressure . it is a further advantage of this measure that it is applicable not only to a specific method of effervescent production , such as , for example , the reaction granulation by the pendulum vacuum method according to the invention , but very generally to any desired particulate effervescent systems , such as effervescent powders and effervescent granules , regardless of the method of their production . anhydrous sodium bicarbonate and citric acid monohydrate are loaded into a heatable vacuum granulator in a ratio corresponding to the desired ph and are mixed for 5 min until homogeneity is achieved . as the temperature increases , the reaction is started by the water liberated from the citric acid monohydrate . for the reaction , a pendulum vacuum with two preselected vacuum values , e . g . 550 and 900 mbar , is chosen , evacuation being effected to 550 mbar and the valve to the vacuum pump being closed . the reaction results in a pressure increase to 900 mbar . at this value , the valve is opened again , the vessel is evacuated again to 550 mbar and this process is repeated several times . after a duration of reaction of from 20 to 40 min or after a temperature of from 40 to 60 ° c . has been reached , the pendulum vacuum is cut off and the granules are vacuum - dried with full pump power . production of effervescent granules which can be used for a very wide range of pharmaceutical active substances and / or active substance combinations , inter alia vitamins and trace elements , the effervescent granules comminuted to the desired particle size being mixed with the appropriate active substances and sweeteners and optionally flavors and fillers . the granules either can be filled into sachets or , if required , lubricants can be added and said granules can be pressed to give tablets . a vacuum granulator having a heatable jacket is loaded with 31 . 78 parts by weight of citric acid , which is heated to 50 ° c . with stirring . on reaching the temperature , 0 . 16 parts by weight of water is added with stirring and distributed for 5 min . thereafter , 12 . 3 parts by weight of sodium bicarbonate are added , the stirrer and the pendulum vacuum for controlling the reaction are switched on at the predetermined first vacuum value = 450 mbar , second vacuum value = 850 mbar and the number of 4 cycles ( pendulum ) within 4 min at the most . after the end of the fourth cycle ( pendulum ), e . g . after 3½ min , but no later than after the elapse of 4 min and independently of whether 4 cycles were actually achieved in this time , the program is switched off and full vacuum is applied for drying the granules . the dried granules are sieved to the desired particle size and can , if required , be used as effervescent based granules . for fully automatic operation , the characteristic data determined for the product , i . e . vacuum range , first and second vacuum value , pressure difference , number of cycles and duration of the pendulum vacuum , can be set , with the result that the method can take place stepwise after respectively reaching the set values . the following are introduced into a vacuum granulator having a heatable jacket : 31 . 4 parts by weight of citric acid , 5 . 9 parts by weight of magnesium carbonate and optionally sweeteners . heating to 50 ° c . is effected with stirring . thereafter , 0 . 9 parts by weight of water is added with stirring and the program is switched on . the reaction takes place with a pendulum vacuum at the predetermined values between 500 and 900 mbar and with 5 cycles in not more than 9 min . depending on the reactivity of the acid and of the carbonate , the pendulum vacuum is switched off either after the 5th cycle or after the maximum specified time of 9 min depending on which of the two specified maxima is reached first . thereafter , 4 . 4 parts by weight of potassium bicarbonate , 3 . 0 parts by weight of magnesium oxide and 1 . 0 part by weight of citric acid are admixed and 0 . 55 part by weight of a citric acid solution in 50 % ethanol is added to the mixture with stirring . the reaction takes place under a second , predetermined pendulum vacuum between 450 and 750 mbar with 2 cycles in 5 min at the most . after the 2nd cycle or after 5 min the pendulum vacuum is switched off and the product is dried under full vacuum with slow stirring . after sieving to the desired particle size , a flavor can be mixed with the granules obtained , and the granules can be either filled into sachets or pressed to give tablets . the method according to ep - b - 0 076 340 ( prior art ) was compared with the method according to the invention . citric acid , ascorbic acid and sweeteners were heated to 50 ° c . in a vacuum granulator . thereafter , sodium bicarbonate was admixed and evacuation to 10 mbar was effected . 21 ml of water were then added and the reaction was started . the pressure increased to 1 bar in 30 sec , and the granules became very plastic and adhered to the stirrer , with the result that the stirrer was virtually blocked . the product was then dried by means of a vacuum to 20 mbar in 15 min . after a further addition of 21 ml of water , the reaction was started again and the pressure increased to 1 bar in 45 sec , and the granules became very plastic and spherical agglomerates some of them large , formed . addition of sodium carbonate and subsequent drying were carried out , the product drying only slowly and it being possible to reach only 17 mbar in 25 min . citric acid , ascorbic acid and sweeteners were heated to 50 ° c . in the same vacuum granulator . thereafter , sodium bicarbonate was admixed and 21 ml of water were added . a pendulum vacuum was then switched on , fixed between a first vacuum value of 500 mbar and a second vacuum value of 900 mbar . 3 cycles were carried out in 65 sec . the material was slightly lumpy and only somewhat plastic and could be readily mixed by the stirrer without resulting in blockage or the formation of lumps . the addition of sodium carbonate and subsequent drying were then carried out , during which 15 mbar were reached in 17 min . the method according to the invention is substantially shorter and the granulation takes place in a substantially more controlled and uniform manner ( overreaction is prevented ). according to the method of ep - b - 0 076 340 an additional method step comprising drying , further addition of liquid and a further complete reaction procedure , are necessary in order to obtain a product equivalent to the method according to the invention , i . e . a stable product . as a result of the additional method step comprising a second granulation with drying , the method according to the prior art takes substantially longer and the critical granulation reaction has to be carried out a second time , a nonuniform structure of the granules resulting through the formation of spherical agglomerates , some of which are large . this example was carried out according to example 4 b ) but with an increase in the carbon dioxide partial pressure , as described below . citric acid , ascorbic acid , sweeteners and sodium bicarbonate were heated in a vacuum granulator with pendulum vacuum and with aspiration of carbon dioxide during the cycles until 50 ° c . were reached , evacuation being effected to 200 mbar in each cycle and then a pressure increase to 800 mbar being effected . after addition of 21 ml of water , a further 10 cycles were carried out with inflow of carbon dioxide . after addition of sodium carbonate , the granules were dried by means of a vacuum , a further 20 cycles being carried out with inflow of carbon dioxide during the final drying . on checking the stability to storage after one week , these granules showed values improved by 30 % compared with the control sample produced according to example 4 b ). | 0 |
the subject invention relates to an electromagnetic energy spot curing system which utilizes a source of radiation found in the electromagnetic spectrum ( e . g ., ultraviolet ( uv ); infrared ). to describe the invention and illustrate its functioning , reference is made herein to the use of a uv lamp . it is to be understood that the uv lamp can be interchanged with other sources of electromagnetic energy . in addition , the electromagnetic energy source may provide electromagnetic energy of varying intensities and / or of varying wavelengths ( e . g ., various types of radiation ). with reference to fig1 and 2 , an electromagnetic energy spot curing system is generally shown and designated therein with the reference numeral 10 . the system 10 includes a uv lamp 11 , including a light source 12 and an elliptic reflector 13 . the light source 12 is preferably connected to the elliptic reflector 13 so that the energy emanated from the uv lamp 11 is focused at a precise desired location which is an entrance to a light guide 20 . the uv lamp 11 may preferably be a conventional straight mercury arc lamp , metal halide mercury lamp , a xenon - metal halide lamp or any other suitable radiation emitting lamp known in the art . the lamp 11 is controlled by a ballast 14 . ballast 14 is a known electrical device or chip used in fluorescent and hid fixtures for strating and regulating fluorescent and high intensity discharge lamps . ballast 14 acts as a power regulating source providing sufficient increasing power for the lamp 11 and further controlling the level of power supplied to the lamp 11 . the light 20 is preferably positioned within a curing unit . the light guide 20 may be glass , optical fiber or any other suitable light transmissive material known in the art , and is preferably of the liquid - filled type . the light guide 20 includes a light entrance surface 20 a at one end which projects towards the lamp 11 and a light exit / output surface 20 b at the other end which may be directed to a work site or target which contains adhesive material to be light cured . the light exit surface 20 b of the light guide 20 terminates at a single fixture 21 from which the uv radiance is dispersed . the light guide 20 is supported by a light guide tube receptacle 22 . the light guide tube 22 is suitably mounted on a light guiding mounting plate 23 . light guide tube 22 has an opening for supportable receipt of the light guide 20 therein . as will be described in more detail below , the light guide 20 acts to at least partially collimate the uv beam e , and the beam is emitted from the light guide 20 via the light exit surface 20 b . as is readily apparent , the light exit surface 20 b is directed to the work site or target which contains adhesive material to be light cured . furthermore , a shutter / stop mechanism including a shutter 24 which is generally planar and made of aluminum is affixed to the light guide mounting plate 23 . the shutter 24 is positioned generally parallel to the lamp 11 to selectively control uv energy emanating from the system . the shutter 24 also has an opening 24 a of generally circular configuration located at the center of the shutter . preferably the shutter 24 is located to selectively control uv energy entering the light guide 20 through the light entrance surface 20 a . the opening and closing of the shutter 24 is described herein . the shutter 24 is movable from a first position , the closed position , wherein a solid portion of the shutter 24 covers the light entrance surface 20 a of the light guide 20 to a second position , the opened position , wherein the shutter opening 24 a is in registry with the light entrance surface 20 a thereby allowing light to pass through the opening 24 a to the light entrance surface 20 a of the light guide 20 . as the uv light beam passes within the light guide 20 , it is emitted from the light guide 20 via the light exit surface 20 b to the worksite containing adhesive material to be cured . the mechanism for the movement of the shutter 24 is controlled by a solenoid ( not shown ). upon appropriate signals the solenoid is activated which in turn moves the shutter 24 from the first position to the second position as discussed above . a timer 15 preferably controls the time period for shutter 24 to remain in the closed and open positions thereby controlling the exposure time of the radiation . the opening and closing of the shutter 24 may be synchronized with a shut off valve 16 in order to preferably synchronize the uv irradiance with a flow of inert gas as will be described in detail below . the system additionally includes a tube 26 used to feed and disperse inert gas . preference is given to argon , but gas such as nitrogen , helium or neon are also suitable . the tube 26 includes one end 26 a attached to a source from which the inert gas is fed in the tube 26 and an opposing end including a dispersion nozzle 26 b from which the inert gas is dispersed . the dispersion nozzle 26 b of the tube 26 is integrated with the light exit surface 20 b of the light guide 20 into the single fixture 21 and is designed to disperse the inert gas simultaneously with the light output and / or the uv radiance to the adhesive surface of the work piece . the regulator 17 preferably controls the rate of flow of the inert gas received in the tube 26 via shut off valve 16 thereby controlling the amount of gas to be dispensed onto the work piece . the shut off valve 16 is preferably solenoid operated to start and stop the flow or movement of the inert gas . in other words , when solenoid is activated , which in turn either opens the valve 16 to start the flow of inert gas in the tube 26 received from the source or shuts off the valve 16 to stop the flow of inert gas in the tube 26 . also , the operation of the valve 16 is controlled by the timer 15 . the timer 15 is preferably connected to the valve controlling the time period for valve 16 to remain in open and closed positions , thereby controlling the time period of the flow of the inert gas . in operation , the lamp 11 is activated by the ballast 14 to emanate a focused uv energy beam e through the reflector 13 . this focused uv energy beam falls right on the shutter 24 . the shutter 24 being movable in a second position as discussed above , wherein the shutter opening 24 a is aligned with the light entrance surface 20 a , which allows the uv energy beam to travel into the light guide tube 22 to pass through the light entrance surface 20 a into the light guide 20 . as the uv energy beam is originating from the lamp 11 and passed through the light guide 20 , simultaneously , the inert gas provided by a source is fed into the tube 26 which is encountered by the shut - off valve 16 . the shut - off valve 16 as discussed above is opened to pass the flow of the inert gas into the tube 26 . the shut - off valve 16 causes to initiate the flow or movement of the inert gas through the tube 26 upon the uv energy being emitted . in other words , the relative movement of the inert gas is initiated upon opening of the shutter 24 . both the tube 26 and the light guide 20 terminate at a common fixture 21 . in other words , the light exit end 20 b of the light guide and the dispersion nozzle 26 b of the tube 26 integrate into the fixture 21 dispensing both the uv energy and the inert gas 21 from the fixture . therefore , during the curing cycle , both the focused uv energy e and the inert gas are dispersed simultaneously on to the adhesive surface of the worksite . as a result of this operation , material can be cured with the exposure of radiation energy and the dispersion of inert gas simultaneously in order to expel oxygen which would interfere with the curing process . the irradiance levels for spot systems described in the present invention can easily exceed 20 w / cm 2 , whereas , other systems typically produce no more than a couple of w / cm 2 , ( i . e ., fusion system electrodeless lamp system ). the devices and the system of the present invention can be used in conjunction with a variety of different photocurable adhesive compositions . for example , uv curable vinyl and ( meth ) acrylate - containing compositions , which may also be optionally anaerobically curable , may be employed . such compositions may include urethane - acrylate copolymers and block copolymers such as those disclosed in u . s . pat . nos . 3 , 425 , 988 ; 4 , 295 , 909 ; and 4 , 309 , 526 . other useful photocurable compositions containing reactive ( meth ) acrylate components are disclosed in u . s . pat . nos . 4 , 415 , 604 ; 4 , 424 , 252 ; and 4 , 451 , 523 , all to loctite corporation . photoinitiators which are intended to be active primarily in the ultraviolet ( uv ) region are incorporated along with the curable component , and which upon exposure to sufficient ultraviolet light initiate photopolymerization of the curable component . such uv compositions can be used as structural adhesives , potting compounds , gap filling compounds , sealing compounds , conformal coatings as well as other applications known to those skilled in the art . in addition to the aforementioned adhesive compositions , uv curable silicone compositions are also contemplated as being useful with the present invention . such compositions contain a curable silicone component and a uv photoinitiator component . additionally , cyanoacrylate adhesives designed to cure upon exposure to photoirradiation may also be employed . examples of commercially available uv curing compositions include loctite product numbers adhesive 352 , 3321 , 3491 , 3525 and 3201 . having described the preferred embodiments herein , it should be further appreciated that various modifications may be made thereto without departing from the contemplated scope of the invention . as such , the preferred embodiments described herein are intended in an illustrative rather than a limiting sense . the true scope of the invention is set forth in the claims appended hereto . | 8 |
the applicant has now demonstrated that the administration of sulbutiamine allows recovery from psychomotor and psycho - intellectual disorders described in the first paragraph , in parkinson &# 39 ; s patients , deficient schizophrenics , alcoholics hospitalized for subsequent cure of alcohol deprival , dysthymic patients or alternatively patients suffering major depressive episodes . in the different studies conducted on these patients , sulbutiamine has in every case allowed psychomotor slowing , inhibition of action , intellectual strategy disorders as well as executive function disorders to be avoided . the pharmaceutical compositions used according to the invention contain sulbutiamine , alone or in combination with one or more inert , nontoxic , pharmaceutically acceptable vehicles . the medicaments intended for the treatment of psychomotor and intellectual disorders in these subjects , obtained using sulbutiamine according to the invention , will be present in the form of pharmaceuticals suitable for administration by the oral , parenteral , transcutaneous , nasal , rectal or perlingual route , especially tablets , sublingual tablets , glossettes , gelatin capsules , capsules , tablets , suppositories , transdermal patches , buccal patches , etc . . . the dosage varies according to the age and the weight of the patient , the administration route , the nature of the therapeutic indication and of the associated treatments , and ranges from 400 mg to 800 mg per day orally . effects of sulbutiamine on the psycho - cognitive evolution of alcohol - dependent and deprived patients the study was carried out on a population of hospitalized alcohol - dependent patients after a deprival cure . these patients were divided into two parallel groups and were treated under double - blind conditions for 6 weeks , either with sulbutiamine , or with a placebo , the treatments being allocated according to a randomization code . we evaluated , with the aid of the following tests , the effects of the treatment on : in these alcohol - dependent and deprived patients , treated with sulbutiamine , an improvement of the cognitive and mnesic functions and the attention was observed . effects of sulbutiamine on cognitive slowing , objective and subjective , and on the feeling of fatigue of parkinson &# 39 ; s patients the study was carried out on a population of patients having idiopathic parkinson &# 39 ; s disease , treated by l - dopa and / or dopaminergic agonists , stable on entry into the study , without major fluctuations of the motor state and without signs of dementia . these patients were divided into 2 parallel groups and were treated under double - blind conditions for 8 weeks , either with sulbutiamine , or with a placebo , the treatments being allocated according to a randomization code . by means of the following tests , we evaluated the effects of the treatment on : 1 - the cognitive functions , attention , verbal , ideational and motor slowing : in parkinson &# 39 ; s patients , treated with sulbutiamine , an improvement in the cognitive , executive and mnesic functions was observed , with diminution of the sensation of fatigue . the study was carried out in unhospitalized dysthymic patients having a motor , ideational and cognitive inhibition and slowing . these patients were divided into two parallel groups and treated under double - blind conditions for 8 weeks , either with sulbutiamine , or with a placebo , the treatments being allocated according to a randomization code . a net diminution of the motor , verbal and cognitive slowing in dysthymic patients treated with sulbutiamine was observed . effects of sulbutiamine on inhibition symptoms of major depressive patients treated with a tricyclic antidepressant the study was carried out in patients hospitalized for a major depressive state and treated with clomipramine in a variable dose . these patients were divided into 2 parallel groups and treated for 8 weeks , either with sulbutiamine , or with a placebo , the treatments being allocated according to a randomization code . an improvement in the inhibition symptoms was observed in the group treated with sulbutiamine , in particular of the cognitive functions . effects of sulbutiamine on inhibition symptoms of deficient schizophrenics treated with a neuroleptic the study was carried out on deficient schizophrenic patients treated as outpatients with a neuroleptic . these patients were divided into two parallel groups , then treated under double - blind conditions for 12 weeks , either with sulbutiamine , or with a placebo , the treatments being allocated according to a randomization code . a regression of the signs of schizophrenia was observed in the group treated with sulbutiamine , with an improvement in the quality of life in parallel . | 0 |
in the figs ., an illustrative embodiment of the invention is illustrated by the vehicle 10 . the vehicle 10 is constructed to mimic an old - time , or antique type car which performs a comic function . several component parts can be seen in fig1 . these would include a body 12 , a knurled knob 14 and a left side ornamental wheel section 16 as well as a right side ornamental wheel section 18 . both the left and right side ornamental wheel sections 16 and 18 are for appearance purposes only and do not form the actual supporting or driving wheels of the vehicle . the supporting and driving wheels of the vehicle are as seen in the other figs . and would include a single front wheel 20 which is set at an angle such that the vehicle 10 does not travel in a straight line . the vehicle 10 is further supported by left and right rear wheels 22 and 24 which both support the vehicle in certain instances and provide the driving force to propel the vehicle across a support surface . the vehicle is operated as follows . the knurled knob 14 is turned to wind up a spring motor 26 located inside the vehicle 10 . the vehicle is then set on a support surface and it is driven forward by the rear wheels 22 and 24 for a period of time . during this period of time , the left and right side ornamental wheel sections 16 and 18 are in a position as is seen in fig1 . after a particular time period has expired , a lever 28 extends downwardly from the under side of the vehicle 10 and engages the support surface , lifting the right and left rear wheels 22 and 24 above its support surface , thus disengaging them and ceasing the forward motion of the vehicle 10 . concurrently , the body 12 of the vehicle 10 starts to descend downwardly with respect to the chassis 30 . as the body 12 descends downwardly , the left and right side ornamental wheel sections 16 and 18 start spreading outwardly , as is evident from viewing fig6 a . when the body 12 is in its lower limit of travel with respect to the chassis 30 and the left and right side ornamental wheel sections 16 and 18 are prolapsed with respect to the support surface , the vehicle can assume somewhat of a comical appearance . as the spring motor 26 continues to operate , the body 12 is then raised with respect to the chassis 30 , drawing in the left and right side ornamental wheel sections 16 and 18 until they assume their upright configuration as is seen in fig1 and 17 , and concurrently withdrawing the lever 28 upwardly into the chassis 30 allowing rear wheels 22 and 24 to once again contact the support surface , at which time the vehicle 10 again resumes forward motion . the vehicle 10 will continue going forward in a somewhat curved path because of the orientation of the front wheel 20 until once again the body section 12 starts to descend and the rear wheels 22 and 24 are lifted upwardly from the support surface . the motor 26 is a typical spring wound motor housed in a motor case 32 , which has an axle 34 on which the left and right rear wheels 22 and 24 are mounted . a shaft 36 extends into the motor case 32 and includes the knurled knob 14 on its end . the shaft 36 transmits rotation of the knurled knob 14 to wind the spring motor 26 and it also serves as an outer shaft which governs the functioning of the lever 28 and the raising and the lowering of the body 12 . fixedly attached to shaft 36 is a member 38 having two spring arms collectively identified by the numeral 40 . a disk member 42 has a plurality of holes collectively identified by the numeral 44 . the ends of the spring arms 40 fit into the holes 44 and transmit rotation of the shaft 36 to the disk member 40 during counterclockwise rotation of the shaft 36 under the influence of the spring motor 26 . during winding of the spring motor 26 however , clockwise rotation of the shaft 36 is not necessarily transmitted to the disk 42 if the disk 42 is refrained from turning by other components as hereinafter explained . during winding of the motor 26 the spring arms 40 can flex outwardly from the disk member 42 , slipping out of the holes 44 such that clockwise rotation of the shaft 36 and the member 38 is not transmitted to the disk 42 because of slippage of the spring arms 40 with respect to the holes 44 . movement of the spring arms 40 with respect to the holes 44 also serves as an override mechanism to prevent damage to certain of the components of the vehicle 10 should the child playing with the vehicle 10 grasp the same in a tight grip preventing movement of the body 12 with respect to the chassis 30 during unwinding of the motor 26 . the front wheel 20 is pivotally mounted to the chassis 30 via an axle 46 . the axle 46 passes through appropriate holes not identified or shown in the drawings , located in a section 48 of the chassis 30 which is located over the front wheel 20 and is integrally formed with the remainder of the chassis 30 . the orientation of the axle 46 , and thus the front wheel 20 is at an angle with respect to the longitudinal direction of the chassis 30 such that the front wheel 20 will guide the vehicle 10 in somewhat of a circular path when it is moving across the support surface . the motor case 32 is appropriately mounted in chassis 30 such that the left and right rear wheels 22 and 24 extend downwardly beneath the bottom of the chassis 30 and can contact a support surface . the placement of the motor case 32 within the chassis 30 , in conjunction with the diameter of the left and right rear wheels 22 and 24 , compare to the height of the left and right side ornamental wheel sections 16 and 18 is such that the sections 16 and 18 are suspended above the support surface when the rear wheels 22 and 24 support the chassis upwardly from the support surface as is evident from fig7 . during forward movement of the vehicle 10 , the vehicle 10 is thus supported above the support surface via front wheel 20 and the rear wheels 22 and 24 , with the lowermost periphery of the sections 16 and 18 suspended above the support surface . the body 12 is slidably mounted with respect to the chassis 30 via a front support shaft 50 and a rear support shaft 52 which are appropriately journaled in bearing surfaces 54 and 56 formed in the chassis 30 . this allows upward and downward movement of the body 12 with respect to the chassis 30 . a screw 58 fits into a boss 60 . the boss 60 passes through an opening 62 in the chassis 30 . the head of the screw 58 is larger than the opening 62 , thus preventing complete withdrawal of the body 12 with respect to the chassis 30 . the boss 60 however , is free to move within the opening 62 , allowing for the upward and downward movement of the body 12 with respect to the chassis 30 . the interior of the chassis 30 is hollow and the chassis itself is composed of a lower plate 64 and an upper plate 66 which mate with each other after the appropriate components located therein are placed within their interior during assembly of the vehicle 10 . the disk member 42 includes a first flange 68 and a second flange 70 located on its surfaces . both of the flanges 68 and 70 are arcuately shaped surfaces and extend around a portion of the disk member 42 . the flange 68 is located on the outside of the disk member 42 towards the knurled knob 14 , while the flange 70 is located on the inside of the disk member 42 toward the motor case 32 . the flange 68 is essentially shaped as a semicircular arc , whereas the flange 70 , for the most part shaped as a semicircular arc , also includes a section 72 which is bent inwardly and joins the remainder of the flange 70 in a smooth curve at the point 74 . both of the flanges 68 and 70 are integrally formed with the disk member 42 and rotate in conjunction with rotation of the disk member 42 . the lever 28 is pivotally mounted via an axle 78 inside of the chassis 30 by locating the axle 78 within two ears collectively identified by the numeral 80 formed on the lower chassis plate 64 . the lever 28 includes a small projection 82 located on its underneath surface . the projection 82 is located in conjunction with the left and right rear wheels 22 and 24 . a cam surface 84 on the lever 28 is located in association with the first flange 68 . as the first flange 68 rotates , it engages the cam surface 84 . when it is engaged against the cam surface 84 , it pivots the lever 28 about its axle 78 such that the projection 82 extends downwardly below the bottommost periphery of the rear wheels 22 and 24 , lifting the rear wheels 22 and 24 above the support surface such that they no longer engage the support surface and they no longer drive the vehicle 10 forward . when the flange 68 is located with respect to the cam surface 84 as seen in fig2 the cam surface 84 does not contact the flange 68 and thus the flange 68 does not press downwardly against the lever 28 allowing for the weight of the vehicle to push down on the rear wheels 22 and 24 , lifting the lever 28 upwardly within the chassis 30 such that the rear wheels 22 and 24 contact the support surface and the vehicle 10 is driven forward on the support surface via the rotation of these rear wheels 22 and 24 in response to rotation of the rear wheels 22 and 24 by the spring motor 26 . as seen in fig6 as the disk member 42 rotates , the flange 68 engages the cam surface 84 on the lever 28 and extends the projection 82 downwardly with respect to the chassis 30 , raising the rear wheels 22 and 24 . in moving from fig6 to fig7 continued rotation of the disk member 42 then locates the cam surface 84 on the very end of the flange 68 . at this time the rear wheels 22 and 24 are still raised above the support surface . however , as soon as the disk member 42 has rotated several more degrees counterclockwise , as seen in fig7 the cam surface 84 is no longer in contact with the flange 68 and the weight of the vehicle 10 then causes the rear wheels 22 and 24 to descend to engage the support surface . a member 86 is pivotally mounted to the upper chassis plate 66 via two short axle sections collectively identified by the numeral 88 located thereon , which fit into two bearing surfaces collectively identified by the numeral 90 which are integrally formed on the upper chassis plate 66 . the member 86 includes an arm 92 located on either of its sides which terminates in the axles sections 88 . the arms 92 are joined by cross member 94 which carries on it a small projection 96 . the projection 96 is located in association with a wedge - shaped projection 98 located on the inside of the top of the body 12 . the projection 96 can slide against the wedge - shaped projection 98 as hereinafter explained . member 86 also includes a downwardly projecting arm 100 . together , the arm 100 and the arms 92 form a bent lever structure , as is evident in side elevation in fig2 and 7 . the end 102 of arm 100 is positioned to engage the flange 70 located on the disk member 42 . as the disk member 42 rotates counterclockwise , the end 102 of the arm 100 rides against the flange 70 . at all times when the end 102 is engaged against the flange 70 , the member 86 is pivoted upwardly about its axles 88 such that the projection 96 engages the projection 98 and holds the body 12 in an upward position with respect to the chassis 30 . when the disk member 42 is rotated in a position as is seen in fig6 such that the flange 70 is not in position to engage the end 102 of arm 100 , the member 86 rotates counterclockwise about its axle 88 such that it moves into the position as seen in fig6 and disengages the projection 96 against the projection 98 of the body 12 . this allows the body 12 to descend downwardly with respect to the chassis 30 . as the disk member 42 rotates counterclockwise from the position as seen in fig6 to that seen in fig7 the section 72 of the flange 70 engages the end 102 of the arm 100 and as the end 102 of the arm 100 rides across this section 72 it comes upwardly around the rounded point 74 of the flange 70 , rotating the member 86 clockwise about its axles 88 which lifts the projections 96 until it engages the wedge - shaped projection 98 on the body 12 . continued counterclockwise rotation of the disk member 42 then engages the end 102 of the arm 100 onto the surface of the flange 70 which maintains the body 12 in an upright position as is seen in fig3 . in fig7 engagement of the end 102 of the arm 100 against the rounded section about point 74 on the flange 70 is illustrated . at this time , the body 12 is starting to raise with respect to the chassis 30 from the orientation as seen in fig6 to the orientation as seen in fig7 and continued rotation in a counterclockwise manner of disk member 42 completely raises the body 12 with respect to the chassis 30 such that the body 12 is located as is seen in fig2 and 1 . when the disk member 42 is rotated such that the flange 70 is no longer located with respect to the end 102 of the arm 100 , it allows for rotation of the member 86 about its axle 88 as described above , with the lowering of the body 12 with respect to the chassis 30 . this event happens concurrently with the engagement of the cam surface 84 on the lever 28 with the flange 68 . thus , as the body 12 is lowered with respect to the chassis 30 the rear wheels 22 and 24 are raised upwardly from the support surface and with the lowering of the body 12 on the chassis 30 , the vehicle 10 is no longer driven in the forward direction . when the end 102 of the arm 100 engages the flange 70 , the cam surface 84 on the lever 28 disengages the flange 68 and as the body 12 is raised with respect to the chassis 30 the vehicle 10 is lowered downwardly toward the support surface such that the rear wheels 22 and 24 engage the support surface . thus , when the body 12 is in its upper position with respect to the chassis 30 , the rear wheels 22 and 24 are engaged with the support surface and the vehicle is driven forward by the rear wheels 22 and 24 . the left and right side ornamental wheel sections 16 and 18 are both identically pivotally mounted to the body 12 . the mounting of these is illustrated for the left side 16 in fig6 a and 7a . the right side ornamental wheel section 18 is identically pivoted to the body 12 . the left side section 16 includes an axle 104 which is appropriately journaled within the sidewall 106 of the body 12 . both of the sections 16 and 18 include a small inwardly projecting , elongated , wedge - shaped flange 108 located on their inner side . as the body 12 descends with respect to the chassis 30 , the left and right side ornamental wheel sections 16 and 18 engage the support surface and the wedge - shaped flanges 108 contact the support surface and direct the downward portion of the sections 16 and 18 outwardly with respect to the remainder of the body 12 . this causes the sections 16 and 18 to assume the orientation as seen in fig6 a . it will be remembered that at this time the projection 82 on the lever 28 has engaged the support surface and the left and right hand rear wheels 22 and 24 have been raised with respect to that support surface . upon raising of the body 12 with respect to the chassis 30 , the left and right side ornamental wheel sections 16 and 18 are raised upwardly from the support surface , and under the influence of gravity they are moved inwardly such that they hang directly downwardly from the body 12 as seen in fig7 a . thus , in fig7 a the sections 16 and 18 are in a perpendicular orientation with respect to the support surface and in fig6 a the sections 16 and 18 are in a prolapsed orientation with respect to the support surface . | 0 |
fig1 is a block diagram of a typical servomechanism digital control application , in which the various aspects of the present invention are utilized . a host computer 10 activates a dual processor 20 to execute a program stored in an external program memory 50 ( wherein the terms &# 34 ; off - chip &# 34 ; and &# 34 ; external &# 34 ; are defined herein as referring to a device which is not on the same chip as the dual processor 20 ) which controls in some manner a physical device 70 . the host computer 10 communicates with the dual processor 20 via a system bus 15 . the dual processor 20 then communicates with the external program memory 50 via a data / address bus 45 and with the physical device 70 via an input measurement line 55 and an output control line 60 . fig2 is a simplified block diagram of the dual processor 20 which illustrates aspects of the present invention . both the system bus 15 and the data / address bus 45 only interface with the μc 22 -- neither bus directly interfaces with the dsp 30 . thus , it is necessary for the μc 22 to pass program code from the external program memory 50 , which are intended to be executed by the dsp 30 , to the dsp 30 via an internal bus 24 . the measurement line 55 and output control line 60 , however , are not required to directly interface with the μc 22 . the measurement line 55 can directly interface with the dsp 30 through typical means such as an analog - to - digital converter 34 via an internal bus 32 , and the output control line 60 can be driven by the dsp 30 through typical means such as an digital - to - analog converter 36 , also via the internal bus 32 . by allowing the dsp 30 to access , process and control data from and to the physical device 70 directly , without intervention from the μc 22 , the resulting measurement and control process is not only faster , but the μc 22 is also freed up to perform other tasks in parallel with the dsp 30 . fig3 is a flow diagram illustrating how program source code instructions 100 are routed to the μc 22 or the dsp 30 for execution . first , when an assembler 110 compiles the source code 100 , it recognizes which instructions are for the μc 22 and which are for the dsp 30 . a simple means for the assembler to do this is to have separate sets of unitary instructions that either only the μc 22 or the dsp 30 will execute . thus , by recognizing which set of unitary instructions a given instruction belongs to , the assembler 110 will know which processor is to execute that instruction . after the assembler 110 determines which processor is to execute a given instruction , the assembler 110 then structures the resulting object code 120 such that the μc 22 commands are translated into their appropriate μc 22 opcode , and the dsp 30 commands are translated into μc 22 load data commands with the dsp 30 commands treated as data . the object code 120 is then stored in the external program memory 50 . within the μc 22 is a number of registers and related logic including an instruction fetch and decode unit 130 ( fig3 ), instruction mapping logic 180 ( fig4 ), a pseudo instruction register 150 ( fig4 ), a pseudo program counter 170 ( fig4 ), and a μc instruction register 160 ( fig3 ). within the dsp 30 are several memory areas including a program memory 140 ( fig3 ). when a program is executed , the instructions are read from the external program memory 50 via the data / address bus 45 into the instruction fetch and decode unit 130 of the μc 22 . if the instruction is in μc 22 opcode , then it is stored in the instruction register 160 of the μc 22 for execution by the μc 22 . however , if the instruction is a μc 22 load data command , then the data storage location depends upon whether the programmer specified that the instruction should be stored in the dsp 30 program memory 140 , or by default , the pseudo instruction register 150 of the μc 22 . in either event , the dsp 30 will look in either location for its program instructions . fig4 is a block diagram further elaborating upon the execution of dsp 30 commands from either the program memory 140 or the pseudo instruction register 150 . when the programmer does not specify the program memory 140 as the program storage location , each dsp 30 instruction is stored in the pseudo instruction register 150 via the internal bus 24 , then mapped from the unitary instruction command mneumonic to the dsp 30 instruction command mneumonic via the mapping logic 180 , and then finally executed in the dsp 30 . the instruction fetch and decode unit 130 would then receive the next program command from the external program memory 50 , and if it is another dsp 30 instruction , the process would be repeated . thus , in this mode , the μc 22 would intervene after each dsp 30 program instruction was executed . on the other hand , if several dsp 30 program instructions are desired to be executed without intervention by the μc 22 , then the programmer can designate each of those instructions to be stored in the program memory 140 . this can be done by a program directive to dump the following number of commands in program memory 140 starting with the directive instruction . after filling program memory 140 with instructions to be executed , initializing the pseudo instruction register 150 with the first instruction to be executed , and the pseudo program counter 170 with the location of the next instruction to be executed , all of the dsp 30 program instructions stored in the program memory 140 are then executed under control of the pseudo program counter 170 before the instruction fetch and decode unit 130 receives another instruction from the external program memory 50 . thus , in this mode , the μc 22 would only intervene after all the instructions stored in the program memory 140 have been executed , and meanwhile , would be free to execute in parallel other tasks . an 8 - bit zilog z8 ® microcontroller is representative of the μc 22 . likewise , a cd2400 ( clarkspur ) 16 - bit digital signal processor is representative of the dsp 30 . for additional μc and dsp details , public information on these two devices can be referenced . although the various aspects of the present invention have been described with respect to a preferred embodiment , it will be understood that the invention is entitled to full protection within the full scope of the appended claims . | 6 |
fig1 is a block diagram of a program and system information protocol ( psip ) data generator according to the invention in the context of system 100 that can produce an advanced television standards committee ( atsc ), standard a / 65 , compliant digital television ( dtv ) signal . the system 100 of fig1 includes : a psip generator 102 according to the invention ; sources of data upon which the psip generator operates , such as a source 108 of listing service data , a source 110 of traffic system data and a source 112 of other data ; a multiplexer 114 to incorporate the psip data from the psip generator 102 into an a / 65 - compliant dtv signal ; and a source 116 of audio data , video data , etc . in fig1 , the psip generator 102 includes an interface unit 104 and a non - uniform interval calculation unit 106 . the psip generator 102 according to the invention can be implemented by adapting a well known psip generator according to the discussion herein . an example of a known psip generator is the psip builder pro brand of psip generator manufactured and sold by triveni digital inc . the psip builder pro itself is based upon a programmed pc having a pentium type of processor using the microsoft windows nt4 . 0 operating system . the software can be written in the java language . the other blocks of fig1 correspond to known technology . in fig1 , the invention has been depicted in the context of a digital television broadcast such as a terrestrial broadcast , and more particularly one that is compliant with the advanced television standards committee ( atsc ), where each event is a program , and the schedule data is psip data . however , the invention is readily applicable to any television format , e . g ., analog terrestrial , analog cable , digital cable , satellite , etc ., for which an electronic schedule is maintained and corresponding data is sent to a receiver for the purpose of presenting an electronic program guide ( epg ) to a viewer . the units 104 and 106 within the psip generator 102 do not necessarily correspond to discrete hardware units . rather , the units 102 and 104 can represent functional units corresponding to program segments of the software that can embody the invention . the interface unit 104 can generate a graphical user interface ( gui ) that operates to receive at least one issuance parameter for like psip tables ( e . g ., etts or eits ) that do not all have an issue interval assigned by the a / 65 standard . such an interface will be described in more detail below with regard to fig2 . the non - uniform interval calculation unit 106 is operable to determine non - uniform issuance intervals for ones of the like psip tables that do not have an assigned interval , based upon the issuance parameter ( s ) received via the interface unit 104 . fig2 is an example image of a dialog window 200 ( a gui ) that can be generated by the interface unit 104 according to the invention . in fig2 , the dialog window 200 can include : a cycle time settings tab 202 ; a miscellaneous settings tab 204 ; a ftp periodic update controls tab 206 ; an “ apply settings ” button 226 ; a “ defaults ” button 228 ; a “ refresh ” button 230 ; and a “ close ” button 232 . the position of the cursor can be indicated via the reverse highlighting 234 . the cycle time settings tab 202 can include a “ cycle times ( in seconds ) for eits :” region 208 , a “ cycle times ( in seconds ) for psip tables :” region 210 , a “ cycle times ( in seconds ) for psi tables :” region 212 and a “ cycle times ( in seconds ) for etts .” region 214 . it is well known that eits carry program schedule information including program title information and program start information . each eit covers a three - hour time span . etts carry text messages associated with the eits , e . g ., program description information for an eit . in fig2 , the “ cycle times ( in seconds ) for eits :” region 208 of the dialog window 200 can include : a box 216 in which a user can enter a fixed interval for the eit 0 table ; a box 218 in which a user can enter an increment for the eit k table ; and a box 220 in which a user can enter a maximum number of eit tables that are to be sent . usually , the number entered in box 220 will be far smaller than the maximum number of eit tables permitted by the a / 65 standard . also , in fig2 , the “ cycle times ( in seconds ) for etts :” region 214 can include : a box 222 in which a user can enter a fixed interval for the ett 0 table ; and a box 224 in which a user can enter an increment for the ett k table . the non - uniform interval calculation unit 106 can receive the values in the boxes 216 , 218 , 220 , 222 and 224 from the regions 208 and 214 , respectively , and use them to determine the non - uniform issuance intervals of , e . g ., the eit and ett tables . further discussion of the operation of the unit 106 is couched in a particular non - limiting example , for simplicity . the a / 65 standard recommends a time interval for outputting the zeroith event information table ( eit ), i . e ., eit 0 , but provides no guidelines regarding eit 1 through eit 128 . for the rating region table ( rrt ), the a / 65 standard recommends a value only for the output frequency of rrt 1 . and no recommendation is made regarding the output frequencies of any of the extended text tables ( etts ). under the a / 65 standard , it is left to the discretion of the operator of a psip data generation system to select the frequency of table output for the unmentioned tables . the operator could specify an entry for each group of tables , but that would be burdensome because it would require a total of over 500 entries . a simple solution to the problem of unspecified output frequencies would be to set each type of table to the same output frequency , but that creates a problem in that the guidelines for bandwidth specified by the a / 65 standard would be exceeded . a further consideration to solve the problem , namely of how to insert the least amount possible of meta data into the dtv signal and yet still achieve an a / 65 compliant dtv signal , is : how closely in time to the present moment does each table relate ? that is , table types such as the eit describe event information up to two weeks into the future . a user of an electronic program guide that receives such table types will typically want to view event information concerning only the next 24 - 48 hours . users typically do not look farther into the future than this because ( at least in part ) the event schedule information two weeks into the future is much more likely to change than is event schedule information concerning the next 24 - 48 hours , i . e ., the farther into the future , the less reliable the event information becomes . care must be exercised so as not to set the intervals to be too infrequent . this is because the dtv receiver can become stalled waiting for a table to arrive . if the dtv receiver is stalled for 0 . 5 seconds , a user might not notice or object if she did . but such a delay of , e . g ., 4 - 5 seconds probably would be noticed by , and probably would annoy , the user . this reinforces the need to set short intervals for near term events because users are likely to want to display epg information about them . again , the invention , in part , provides an interface unit 104 that defines parameters that the non - uniform interval calculation unit 106 than can use to generate the time intervals between tables of the same type . typically ( but not necessarily ) the function performed by the unit 106 will be linear , e . g ., with a defined start interval ( the root_time ) and an increment interval ( increment_time ). for example , if the user desires eit 0 to be output every half second ( root_time ) with each succeeding eit i to be output 0 . 25 seconds less frequently than the preceding eit , namely eit i − 1 , the user would enter 0 . 5 seconds as the root_time in box 216 and 0 . 25 seconds as the increment_time in box 218 . the function for each table eit - i interval would then be : time between any two instances of table i = root_time + ( increment_time * i ) = 0 . 5 sec + ( 0 . 25 sec * i ) for example , eit 12 can be output every 0 . 5 sec +( 0 . 25 sec * 12 )= 3 . 5 seconds , which is less frequent than eit 0 . obviously , other examples are possible , e . g ., the increment_time for each of different groups of like tables can be set . a similar calculation for etts can be performed by the unit 106 . the invention has at least the following advantages : 1 ) it provides an easy way of entering the interval times for the tables : 2 ) it defines the interval times for like tables that are not all fixed to a constant interval ; and 3 ) it provides an interval function that increases the interval for tables that represent information further out in time . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . | 7 |
in the preferred embodiment of the invention , fig1 shows a unitary convertible work table having four surface portions whereby each surface portion is inclinable according to the desire of the individuals at the various work stations . even though a work table having four surface portions is shown and described in the description , it is not the intention of applicants to limit the invention to what is shown or described , but to include a work table of the type shown having any number of inclinable surface portions . generally shown in fig1 is the entire table structure having table top assembly 10 , inclinable surface portions 11 , and support cabinets 12 with multiple compartments defined by cabinet partitions 14 and 15 . cabinets 12 are equiped with hinged doors 17 , latch means 19 , and handle means 20 . now , referring to fig2 a side view of the entire work table structure of fig1 is shown . as clearly illustrated in the drawings , surface portion 11 is shown in an inclined position supported therein by support means 30 . support means 30 is adapted to be connected to a portion of the table top assembly 10 and the underside of inclinable surface portion 11 . support means 30 may also be adapted to have a variable length whereby the incline of surface portion 11 may be changed . also indicated in fig2 is stop ledge 29 which is shown to be connected to only one of the surface portions 11 to allow for retainment of equipment or work utensils on the upper - most surface of surface portion 11 . the raised surface portion 11 is also shown with hinge means 28 which connects the surface portion to a support member of table top assembly 10 in a manner whereby the surface portion may be pivotably lowered from a horizontal position or raised to an inclined position . hinges 18 are shown on doors 17 or cabinets 12 in the side view . partitions 14 , 15 , and 16 divide the cabinets 12 into several compartments . handle means 20 are also shown near the upper extremity of doors 17 . fig3 shows a portion of the surface member 22 in contact with a portion of support member 21 of the surface top assembly . now , referring to fig4 and 5 , the table top assembly 10 is shown in spaced - apart relation and in assembled relation , respectively . in fig4 only one of the surface portions 11 is shown . a surface member is defined by connecting elements 26 and 27 which are of a thickness so as to be flush with the surface portions to form a substantially smooth work surface when all surface portions are lowered to a horizontal position . the support member for supporting the surface portions on hinges is shown in fig4 by connecting elements 21 , 22 , 23 , and 25 . the assembly in assembled relation is shown in fig5 wherein elements 11 are the inclinable surface portions and element 26 is a cross section of a portion of the surface member , and element 21 is a cross section of the support member . no hinges or connection means are shown in fig5 . referring now to fig6 a base member for connecting the support cabinets 12 to the surface top assembly 10 is shown wherein base member element 31 is connected to cross members 32 by brackets 34 having associated therewith , machine screws 33 . brackets 36 having connection plates 37 are adapted to be connected to the walls of the respective support cabinets 12 via connection means 40 . brackets 36 are adapted to be connected to member 31 via adjustable connection means 39 and screws 38 and 40 . fig8 shows a planar view of the manner of connecting elements 31 and 32 of the base member . as clearly illustrated , brackets 34 , together with machine screws 33 , hold the elements of the base member in rigid assembled relation . fig9 shows a wood screw 41 for connecting a portion of base member 31 to a portion of support member 21 . element 26 of surface member assembly is also shown . in operation , the surface portion 11 , which define the individual work surfaces , may be selectively raised to an incline position and held by support means 30 or lowered to a horizontal position according to the desire of the users . all of the surface portions may be lowered so as to provide a relatively large and substantially smooth work surface as the surface member is substantially flush and in the same plane of the surface portions in the horizontal position . furthermore , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to as falling within the scope of the invention as claimed . | 0 |
it is to be understood that the figures and descriptions of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the invention . the detailed description will be provided hereinbelow with reference to the attached drawings . the present invention may be generally employed by lead designers and other members of a design team to organize and prioritize the information obtained from using a metaphor elicitation technique to interview , for example , the future users of a product or occupants of a building . the deep design filter of the present invention allows designers to use this information to develop a project &# 39 ; s initial design concepts , which are extensions of the occupants &# 39 ; thoughts . thus , deep metaphors are converted into design solutions , and ultimately , incorporated into final designs . the system and method of the present invention will preferably be described through the presentation of a presently - preferred embodiment , namely the application of the present invention to architectural design . the use of this example is not meant to be limiting in any sense . the same principles would apply to the development of a design for any number of design projects , including interior design of a residence , interior design of an automobile , design of landscape , design of furniture , and similar design projects . further examples of design situations to which the present invention may relate include the design of any public building such as a hospital , a library , a hotel , a community center , a spa , a resort , a health club , a university student union , a museum , a sports arena , a sports stadium , or an auditorium . the present invention may also be applied to exterior designs that include such projects as landscape , gardens , planned communities , and courtyards . in addition , the present invention may relate to the design of interior spaces , such as the interior of an automobile , public transit vehicles , the interior of military vehicles such as submarines , tanks , helicopters , and fighter jets , and office spaces . the present invention may also be applied to the design of so - called “ virtual ” spaces , such as a three dimensional world within a computer game or other simulated environment . generally , the present invention may be particularly applicable to projects in which the design costs of the project comprise at least 5 % of the overall cost of a project . in each of the above examples , the users or occupants of the design space who will be interviewed will preferably include individuals who use that space in some way , such as occupants , military personnel , tourists , game players , etc ., as is appropriate for the particular design project . in the context of architectural design , the present invention may be employed by architects and other members of a architectural design team to organize and prioritize the information obtained from using a metaphor elicitation technique to interview the future occupants of a building . the architectural design team may include such individuals as architects , builders , engineers , and other individuals who normally contribute to the design and eventual construction of a building . the deep design filter of the present invention allows the architectural design team to use this information to develop the project &# 39 ; s initial design concepts , which are extensions of the occupants &# 39 ; thoughts . thus , the deep metaphors that are elicited are converted into architectural design solutions , and ultimately influence the final design . a generalized flowchart that depicts one presently preferred embodiment of the present invention is shown in fig1 . in this example , a zmet interview process is initially conducted . this is one example of a metaphor elicitation technique , though others may be used . through analysis of the interview process , deep metaphors are identified . by applying the deep design filter of the present invention , relevant dimensions and activating cues are derived and subsequently prioritized . these data are used in various brainstorming sessions ( both among a design team and with users / occupants of the product of the design ) and are compared to some traditional project requirements to arrive at design objectives , and ultimately a design . following the application of a metaphor elicitation technique , the systems and methods of the present invention preferably provide an interview report for review . the interview report lists and identifies the metaphors that emerged during an interview process . often , there will be one overarching metaphor and several other supportive metaphors that serve to reinforce the overarching metaphor . alternatively , several metaphors of equal importance may emerge with no general overarching metaphor . the metaphors discovered and identified during the interview are then broken down , analyzed , and prioritized by the deep design filter of the present invention so that the gathered information can be effectively used in formulating architectural design objectives . as a first step , preferably two major domains of data are extracted from the interviews . one of the domains extracted is preferably the “ relevant dimensions ”. within the context of the present invention , relevant dimensions are defined as the issues that the interviewees requested to be addressed in creating a more desirable physical environment for a given design and are in many ways a general conceptual expression of the underlying deep metaphors . thus , by way of example , a relevant dimension for occupants of a hospital could be that most hospitals appear “ bland ” and “ antiseptic ”. the relevant dimensions are then described in more detail by the other domain , which is a collection of supporting statements defined as “ activating cues ”. within the context of the present invention , activating cues are defined as specific desires for the design that are identified by the interviewees . the activating cues emerge from the interview and detail the related wants and needs of users of an object or occupants of a designed space as they were expressed more generally in the relevant dimensions . for example , as stated above , a relevant dimension for a hospital could be its bland and antiseptic appearance and feeling . the activating cues corresponding with this relevant dimension may be the ( i ) lack of artwork on the walls ; ( ii ) the lack of bright - colored paints ; ( iii ) the perceived darkness of the environment ; ( iv ) that the environment feels stuffy ; or ( v ) the perceived cramped or restricted nature of the hospital space . various types of occupants of a given type of building can be interviewed . for example , if input was being sought to aid in the architectural design of a hospital , interviews could be conducted with patients , family members of patients who visit the facility , and various staff who work at the hospital . by mapping all the relevant dimensions and activating cues identified by the various occupants , designers can prioritize them according to their contextual relationships to the deep metaphors . prioritization of any relevant dimensions and their associated activating cues may occur as described below . any dimensions or activating cues that are identified by more than one type of occupant are preferably given a higher priority in their application to the design process . a dimension that is identified by all or nearly all types of occupants would be given a higher priority , while a dimension identified by only one type of occupant would be given a lower priority . similarly , prioritization may also be based on the number of metaphors that correspond with a given relevant dimension and its activating cues . thus , a relevant dimension that is identified by many different types of occupants and that relates to the most individual metaphors , would be given a higher priority in creating a design . the entire prioritization process may be performed manually or in an automated manner . in the manual process , the relevant dimensions and activating cues could be listed in chart format and color - coded based on their corresponding deep metaphors and / or based on which occupant provided the input . the frequency of responses can then be diagrammatically mapped , and the responses that overlap various deep metaphors can be illustrated by way of venn diagrams ( see , e . g . fig2 ). in an automated version , a computer could be used to determine the frequency of the various responses and suggestions . additionally , the computer could be programmed with data related to cost and / or other design limitations to examine the practically of implementing the prioritized responses and to circumscribe the output accordingly . next , the design team will preferably translate these prioritized relevant dimensions and their associated activating cues into a series of design objectives . in a presently - preferred embodiment of the present invention , the design team will engage in brainstorming sessions , both internally among the design team and externally with the future occupants to develop the initial design objectives . during sessions with the occupants , the design team can stimulate input from the occupants by showing photographs or drawings of potential designs and inquiring how the designs might meet the related design objectives . as well as allowing for an evaluation of the existing design possibilities , feedback from the occupants can result in additional design ideas that may be implemented . thus , the brainstorming sessions will further explore the results obtained by the deep design filter process and incorporate these results into actual design ideas . the input obtained during these brainstorming sessions will allow the designers to reframe the design objectives and then produce provisional conceptual images and drawings . finally , these provisional conceptual images and drawings are evaluated and refined by the design team to develop final images and drawings that can then be executed into the final design of the building . in example 1 , the deep design filter process can be applied to the architectural design of any type of building , whether residential or commercial , regardless of size or function . by way of example , the deep design filter process can be employed to optimize the occupants &# 39 ; experiences with a hospital building . through metaphor elicitation technique interviews with the various occupants of a hospital facility ( patients , visiting family members , staff , etc . ), insight is gained into the metaphors underlying the hospital experience . the overarching metaphor obtained from the metaphor elicitation techniques for a hospital may be one of transformation . transformation occurs by the healing process that takes a patient from an unbalanced state ( sickness ) to a balanced state ( health ). a successful transformation depends on many factors , including quality medical care obviously , and also including the physical environment of the hospital . thus , architecture is essential for restoring balance . several supportive deep metaphors combine to reinforce this transformation : for example , control , connection , and energy . an example of the results of a metaphor elicitation technique that could be generated within this example is shown in fig2 . control is specifically the need for control over one &# 39 ; s life and environment . connection is the need to connect with the outside world , and to oneself and other people . energy is the need for certain types of energy and energy sources . at the most basic level , control is enhanced by the physical environment , and connection is enhanced by the social environment , although certain ideas , such as privacy , escape , isolation , or loneliness can be shared between the metaphors . both control and connection provide energy , which is vital to a successful transformation . control can be broken down further into two components : control over the hospital environment and control over the illness . control over the hospital environment includes feeling safe and secure and having a sense of privacy in intimate spaces . privacy gives comfort and security , which in turn facilitates comfort and security . control over the illness allows patients and family to escape from the stresses of the illness . connection appears in many varieties during the hospital experience : connection with the internal hospital world , connection to the external world , connection to one &# 39 ; s self , and connection to the hospital building itself . allowing for positive connections to be made will lead to a more positive overall hospital experience . connections in the hospital environment can foster the feeling of home and create a family - like support network . connection can provide empathy to patients and family members , enable information sharing , help individuals escape their worries , and diminish feelings of isolation . connection to others provides empathy to patents and family who seek others whom understand their situation . connection also allows for information sharing among hospital occupants who are constantly in need of information . information allows patients and family members to be better prepared for their hospital journey . connection also helps people escape from their worries . individuals may escape either through leisure time spent performing activities either alone or with others . privacy is also a critical component of connection . family members need privacy to communicate privately and connect with one another . individuals also need privacy to focus on themselves and maintain a healthy mental balance . finally , control and connection feed into energy , which causes the transformative process to occur . people are in constant need of energy while in the hospital . energy gives people the strength and hope they need to make it through their hospital journey . stress and other negative feelings can drain energy and jeopardize a successful transformation . on the other hand , when energy is replenished , successful transformation can occur . energy from relaxation is sought when people need to refocus or clear their minds . after these deep metaphors ( e . g . control , connection , energy ) have been determined via the metaphor elicitation technique interview process , the deep design filter of the present invention is employed to examine the corresponding major domains of data , namely the relevant dimensions and activating cues . for example , the deep metaphor of control can be broken down into several relevant dimensions and their associated activating cues . an example of the results of such an analysis may be found in fig3 . in many large modern hospitals , navigating through a confusing system of hallways leaves patients , visitors , and staff alike feeling lost , confused , or frustrated . floor layouts are often illogical , convoluted , and maze - like . it is not uncommon for patient rooms or visitor areas to give the feeling of being trapped or closed in , which adds to already - present anxiousness and impatience . many hospital rooms and other areas have no clocks , leading to a feeling that time is moving slowly . this can cause family members of patients to feel frustrated and upset . bland architecture and muted colors make the hospital feel more institutional , which , in turn , lead to feelings of boredom , discomfort , and hopelessness . the relevant dimensions and activating cues behind the deep metaphor of connection are similarly analyzed through use of the deep design filter . generally , occupants want the hospital to feel more warm , welcoming and comforting , or more “ like home .” this includes creating an atmosphere of normalcy for patients and families , and enhancing the sense of belonging for hospital staff . windowless rooms make all occupants feel that they are cut off from the outside world , which fosters feelings of loneliness and isolation . the deep metaphor of energy is also broken down by the deep design filtering process . patients need sources of energy in their environment to facilitate the healing process necessary for their transformations . family members need physical surroundings that can stimulate them and aid in their support to the patients , and also to revitalize them and sustain their own psychological well being under stressful conditions . staff members similarly desire an environment that will invigorate them and enable them to provide the best possible patent care . having determined the above relevant dimensions and activating cues , prioritization can be done by comparing the results from the various groups of occupants . thereafter , the design team , both amongst themselves and in conjunction with groups of patients , family members and staff , can formulate design objectives to meet the needs of the occupants based on the relevant dimensions and activating cues . in the present scenario , the design team would implement a variety of decisions based on the deep design filter process . hallways and corridors would be designed with an efficient layout to diminish the lack of control that occupants feel over their physical environment . control over the illness can be facilitated through a sense of escape provided by pleasant distractions such as colorful paintings and artwork . these distractions divert people &# 39 ; s focus away from feeling trapped , and may be particularly beneficial in waiting areas and patient rooms . connection can be achieved through design by providing skylights , atriums , patios , or other means of experiencing sunlight and providing contact with he outside world . physical escapes to the outside world brighten the spirits , and nature cues inside the hospital itself represent health and provide hope to patients &# 39 ; families , while simultaneously reducing stress and promoting relaxation of staff members . private rooms for patients and private waiting areas for families away from staff conversations can provide the privacy to connect with one &# 39 ; s immediate family or to stay in tune with one &# 39 ; s own thoughts . energy can be supplied through many design features in a hospital setting . hospital environments such as outdoor patios , chapels , and libraries are examples of potential energy sources . energy can also come from stimulating activities that are sought out when people need distractions . decorative hallways , gyms , and playrooms for children are a few such facilities that allow for stimulation . other types of escapes include running water , music , natural light , and color . specifically , bright colors can stimulate bored individuals , while soft colors can be used to relieve stress . taken together , in this hospital example of the deep design filter process , the final design decisions as guided by the deep design filter should involve the relevant dimensions and activating cues for the metaphor of transformation . specifically , the design choices guided by the deep design filters will lead to feelings of control and connection , which will complement each other , and further lead to or reinforce the metaphor of energy . in a second example , the deep design filter could also be used in the design of a residential home . initially , a metaphor elicitation technique process would likely yield several deep metaphors . the first metaphor , for example , might be containment , i . e ., a home is a container that allows for certain types of connections and emotional drivers to exist . certain rooms will be “ closed ” containers , which will primarily provide security , intimacy , and calmness . one example of such a room is a bedroom . on the other hand , some rooms are “ open ” containers , which primarily provide space for social activities , which can be both fun and exciting or simply calm . examples of such open container rooms include family rooms and kitchens . another metaphor that arises in thinking about a home is connection . this can include self connection or connection to others . rooms and areas of the house should be designed in order to foster these types of connections . emotional experiences are other metaphors that may emerge . two particular types of emotional experiences are feeling relaxed and feeling energized . relaxation deals with calm , soothing , and tranquil experiences and is often associated with self connection and connection to others . energization comes from experiences that are fun , interesting , and lively and is often associated with connection to others . each room of a home can involve different relevant dimensions and activating cues when the deep design filter process is employed . for instance , relevant dimensions and activating cues for a bedroom may be that sleep is important and that the bedroom should be worry - free and restful . a bedroom should therefore be simple , yet comfortable . in contrast , a family room may involve very different relevant dimensions and activating cues . these may include a desire for fun and a comfortable area for all the members of the family . a kitchen may involve yet another differing set of relevant dimensions and activating cues . a primary purpose of a kitchen is for the preparation of meals , and thus adequate space is needed to allow for this . additionally , a kitchen should also allow for informal socialization and connection with others . after the deep design filter is used to determine the relevant dimensions and activating cues for the occupants of a home , important design issues can be addressed to meet these needs . these could include : providing for adequate storage and closet space to allow the home to be organized and functional and thus promote a feeling of control for the occupants ; creating feelings of openness and connection to nature through natural lighting to promote self connection and energy ; employing more soothing colors in areas such as the bedrooms and more stimulating colors in rooms where more social interaction will take place ; and allowing for speakers to be placed through the house so that soothing and / or invigorating music may be played . by way of example , the deep design filter process can be employed in the design of the interior of an automobile . in this example , potential drivers of an automobile would participate in a metaphor elicitation technique . the metaphors felt by drivers and passengers would be extracted through interviews in which drivers and passengers were asked to express their impressions and feelings regarding their experience in an automobile . for example , drivers may feel the need for energy and freedom while driving the automobile . in addition , drivers and passengers may also identify security as a secondary metaphor , particularly if the automobile is a more family - oriented vehicle . using these deep metaphors , the deep design filter of the present invention is employed to examine the corresponding relevant dimensions and activating cues . an example of a potential relevant dimension regarding an experience in an automobile could be that passengers like to be in control , even when they are in the rear seat of an automobile . an activating cue could be that there are no controls ( e . g . climate or radio controls ) for the rear seats of an automobile . a design objective could then be to include personal controls in the back seat so as to allow passengers to control their environment . nothing in the above description is meant to limit the present invention to any specific materials , geometry , or orientation of elements . many part / orientation substitutions are contemplated within the scope of the present invention and will be apparent to those skilled in the art . the embodiments described herein were presented by way of example only and should not be used to limit the scope of the invention . although the invention has been described in terms of particular embodiments in an application , one of ordinary skill in the art of design , in light of the teachings herein , can generate additional embodiments and modifications without departing from the spirit of , or exceeding the scope of , the claimed invention . accordingly , it is understood that the drawings and the descriptions herein are proffered only to facilitate comprehension of the invention and should not be construed to limit the scope thereof . | 6 |
the device of the invention utilizes a sensor element made of a high temperature superconducting material such as bscco in the form of a very thin tape or a filament encapsulated in a very thin layer of a metal such as silver or a silver based alloy . the resistance of the superconductor based sensor element is measured accurately by a four terminal method by passing a constant current through the two outer terminals and measuring the voltage generated across the two inner terminals . since the portion of the element in liquid nitrogen becomes superconducting and loses its resistance , the resulting resistance of the element gives a measure of the portion of the element above the liquid nitrogen . thus the liquid nitrogen level at any given point of time can be determined by the plot of the resistance versus liquid nitrogen level ( fig2 ). this method is highly sensitive since the change in resistance of the superconductor from normal to the superconducting state is extremely large and sharp and can be measured accurately to levels better than 10 − 9 ohms . the measurement can be taken on demand , continuously or periodically with very low consumption of the cryogen , fast response and stability since the sensor element is thin and continuous . the use of liquid nitrogen level sensor - monitor device of the invention to measure the liquid nitrogen level in a cryocan is depicted schematically in fig1 . the sensor element ( 1 ) is encapsulated in a thin layer of silver ( 2 ) ( silver based alloy may also be used ). the encapsulated sensor element is fixed on a cryostable fiber reinforced plastic strip ( 3 ) ( materials such as epoxy can be used to form the strip ) by means of a cryostable adhesive . any converntional cryostable adhesive may be used to affix the encapsulated sensor element to the plastic strip . a resistance measuring means comprising four terminals ( 4 , 4 ′ and 5 , 5 ′) is provided on the encapsulated sensor element . terminals ( 4 , 4 ′) comprise the current terminals are connected to a current source ( 6 ) by means of leads ( 7 ). terminals ( 4 , 4 ′) are provided on the respective ends of the encapsulated sensor element ( 1 ). terminals ( 5 , 5 ′) comprise the voltage terminals and are connected to a sensitive voltmeter ( 6 ′) by means of leads ( 8 ). terminals ( 5 , 5 ′) are provided on the inside of the encapsulated sensor element ( 1 ), generally about 1 cm from the respective ends of the encapsulated sensor element . the entire assembly is dipped in a cryocan ( 10 ) containing liquid nitrogen . to determine the level of liquid nitrogen in the cryocan , constant current is applied by current source ( 6 ) across terminals ( 4 , 4 ′) provided on the encapsulated sensor element ( 1 ) and the voltage measured across terminals ( 5 , 5 ′) by voltmeter ( 6 ′). since portion of the encapsulated sensor element in the liquid nitrogen in the cryocan becomes superconducting , the resulting resistance gives a measure of the portion of the element above liquid nitrogen thus providing a measure of the level of the liquid nitrogen left in the cryocan . the sensor element is prepared by powder in tube ( tit ) technique described in copending indian application no . 2370 / del / 95 and 259 / del / 97 which are incorporated herein by reference . the method for the manufacture of liquid nitrogen level sensing - monitoring device comprises packing a highly reactive precursor powder free from carbon in high purity seamless silver tubes , end sealing the silver tubes containing the precursor , repeatedly groove rolling and annealing the silver tubes to form silver sheathed wires , repeatedly flat rolling and annealing the wires to form silver sheathed tapes , repeatedly flat rolling and heat treating the tapes at a temperature in the range of 810 to 840 ° c . in an oxidising atmosphere for a period in the range of 100 to 150 hours to obtain silver sheathed mono layer superconducting tape . the monolayer tapes can stacked and folded in silver sheets of high purity and then repeatedly annealed and flat rolled to form multilayered tapes which are then heat treated at a temperature in the range of 810 to 840 ° c . in an oxidising atmosphere for a period in the range of 100 to 150 hours to obtain silver sheathed multilayer superconducting tape . the number of such monolayer tapes stacked are in the range of 5 to 20 . the thickness of the multilayer superconducting tape is in the range of 0 . 25 to 1 . 5 mm . the invention will now be explained in greater detail with reference to the following examples , which are illustrative and should not be construed as limiting the scope of the invention . a multifilamentary silver sheathed bismuth based superconducting tape comprising five filaments and having a length of 60 cm was prepared using a powder in tube ( tit ) technique ( described in copending indian application no . 2370 / del / 95 and 259 / del / 97 ). the tape was then fixed to a cryostable fiber reinforced plastic strip of size 1 mm × 5 mm × 600 mm using a cryostable adhesive . four lead wires were soldered to the tape ; two at the ends as current leads and the other two about 1 cm inside from both ends of the tape as the voltage leads for measuring resistance . the current leads were connected to a constant dc current source and the voltage leads to a nanovoltmeter . the sensor element thus made was slowly immersed in a cryocan containing liquid nitrogen up to a level of about 40 cm . the resistance of the sensor element at different depths in liquid nitrogen was measured by passing a constant current of 1 a through the element . a graph between the resistance of the sensor element and the sensor level was plotted . a linear plot as shown in fig2 was obtained . the sensor was then used to monitor the level of liquid nitrogen in a dewar at different depths both continuously and periodically . an accuracy of better than 1 mm was achieved in all the measurements . the above experiment was repeated using a monofilamentary silver sheathed bscco tape of length 50 cm . the fiber reinforced strip used to support the tape was 1 mm × 5 mm × 500 mm a calibration graph was plotted by immersing the element in a cryocan containing liquid nitrogen up to a level of 30 cms . again a linear graph was obtained when the resistance of the sensor element was plotted against the sensor level . the sensor was then used to measure the liquid nitrogen level in a dewar up to a level of 30 cm . the measured levels were found to be in agreement with the actual levels within a limit of ± 1 mm . | 6 |
in the following detailed description of the preferred embodiments , reference is made to the accompanying drawings , which form a part thereof , and within which are shown by way of illustration specific embodiments by which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural changes may be made without departing from the scope of the invention . spool : is a structure capable of rotating about an axis and adapted to hold some amount of material wrapped about the structure in an orientation perpendicular to the rotational axis . material : is a flexible member having a length greater than its width . string : is any flexible member having a cross - sectional area small enough to pass through the tubular insulation . cross - sectional area : is the area of a two - dimensional plane that extends outward in a radial or transverse direction and is created between the outermost surfaces of the object . the invention is a machine , which can insulate short or long lengths of wire , tape , or cable with short or long lengths of shrink tube insulation . fig1 , and 3 show conceptual models of the device and are further discussed below . for certain applications , this device is the most suitable choice as opposed to other devices . as an example , using this machine to insulate materials , such as ( re = rare earth ) reba 2 cu 3 o 7 - x ( rebco ) coated conductors , is desired over such devices that use co - extrusion , varnish application , or insulation wrappings . some superconductors such as yba 2 cu 3 o 7 . ( ybco ) coated conductors are highly sensitive to high temperature , which is usually a requirement for co - extrusion devices . certain superconductors would not survive such processes because of the high temperature required for co - extrusion . for ybco , various applications require full coverage insulation . devices that apply varnishes leave a nonhomogeneous coating thickness on the conductor whereas shrink tubing would be desired here because of the homogenous thickness once applied to the material . this is due to the nature of varnish application . devices that wrap insulations usually need insulation with an adhesive side that adheres to the material . this in turn increases the thickness of the insulation , which is undesirable for superconductors in certain applications . when the adhesive is removed and the insulation is applied , the wrapping has a tendency to move and separate which cannot happen when using certain superconductor in various applications . this is where shrink tubing and the shrink tube insulation apparatus are desired since the material is thin , continuously covers the material , and can be applied without the need for adhesive or excessively high temperatures . in fig1 , a fully assembled device is shown with two spools ( 7 , 8 ), two pulleys ( 5 ), and three guide channels ( 3 ). tube friction holders ( 2 ) are removed from each guide channel to allow for shrink tube ( 4 ) placement . usually , the tube friction holders ( 2 ) are comprised of a strip of metal and a strip of rubber with an adhesive backing . the rubber is attached to the metal strip via the adhesive backing . shrink tubing ( 4 ) is placed as needed in the guide channels ( 3 ) with the capability to fill the entire length of each of the guide channels ( 3 ). since a full length of material is to be insulated in this example , fig1 shows shrink tubing ( 4 ) filling the entire length of track with some extra hanging over the track as well . placing the shrink tubes ( 4 ) in the guide channels aligns the shrink tube ( 4 ) with the pulleys ( 5 ) and spools ( 7 , 8 ). once the shrink tube ( 4 ) is placed on the guide channels ( 3 ) the tube friction holders ( 2 ) are placed back on the guide channels ( 3 ) on top of the shrink tube ( 4 ). fig1 shows the material spool ( 7 ) on the bottom most motor ( 6 ) and the empty spool ( 8 ) on the top most motor ( 6 ). the location of the spools ( 7 , 8 ) can be switched between the two motors ( 6 ) if desired . starting with the bottom or top guide channel ( 3 ), at the end nearest material spool ( 7 ) or the empty spool ( 8 ), a string , as an example , will be inserted into the end of the shrink tube of the respective guide channel ( 3 ). it should be noted that a string is one embodiment of how to accomplish this part of the process . a continuous length of string is then threaded through that tube of insulation . during this process , the tube friction holders ( 2 ) keep the insulation stationary while the string is threaded through the shrink tube ( 4 ). this allows the string to be pulled through the insulation . upon reaching the end of that tube and guide channel ( 3 ) the string is pulled around the nearest pulley ( 5 ) in such a way that guides the string to the next guide channel ( 3 ) level threading the insulation of that guide channel ( 3 ) as well . this is done for each tube and guide channel until either the empty spool ( 8 ) or the material spool ( 7 ) is reached . the string is then connected to the empty spool ( 8 ) at one end and connected directly to the material on the material spool ( 7 ) at the other . operating the motors ( 6 ) via the control box the material is pulled through the insulation from the material spool ( 7 ) while the string is wound up on the empty spool ( 8 ). ample friction applied over the length of the insulation from the tube friction holders ( 2 ) will prevent the insulation from moving when pulling the material through the tube . as the material approaches the end of a guide channel ( 3 ), a pulley ( 5 ) transfers the material to a new guide channel ( 3 ). friction will increase as more material is insulated increasing the tension on the material . to assist the movement of material , the pulleys ( 5 ) are motorized and synchronized to help decrease the tension from transferring material from one guide channel ( 3 ) to another . this continues until the material reaches the end of the last guide channel ( 3 ), at which time the motors ( 6 ) are stopped . the shrink tube ( 4 ) is then shrunk onto the material , as needed using a heat source . once the insulation on each level has been shrunk onto the material , the material is wound back on to either spool ( 7 , 8 ) where the process can be repeated if the desired length of the conductor was not insulated during the first run . it should be noted that the length and number of levels of guide channels ( 3 ) can be increased or decreased as needed . the number of pulleys ( 5 ) would scale with how many levels of tracks are desired . in addition , motors ( 6 ) are optional in various forms of this device . apparatuses that insulate lengths of material with sufficiently low friction during material movement can implement hand - powered spools , such as a hand crank mounted onto a spool to move the material . this is shown in fig2 where this device is mounted on a flat surface ( 10 ) and is no longer motorized but hand powered . fig2 illustrates one embodiment where the number of guide channels ( 14 ) can be varied as well as the number of pulleys ( 11 ) if desired . tube friction holders ( 13 ) are shown to also have a varied number as well as length . the process for insulating material on this version of the device can be identical to fig1 except for the hand - powered movement of the material . in fig1 motors ( 6 ) moved the spools ( 7 , 8 ), in fig2 the hand cranks ( 17 ) driven by hand power rotate the spools ( 18 , 19 ). motorized pulleys are optional as shown in fig2 where the pulley ( 11 ) is free spinning in this version of the device . fig3 describes yet another possible embodiment of this device . having the same process as fig1 and fig2 except that this version is hand powered and has a motor ( 27 ) driven by a control box ( 28 ). one possible use of this version of the device would be to mount the guide channel ( 24 ) and the spools ( 20 , 27 ) to a tabletop . this embodiment could allow for a smaller version of this device , which could be operated by hand while the motor ( 27 ) creates tension while moving the material . a feature of this device is the ability to prevent the insulation from moving while wire , tape , or cable is pulled through . the tube friction holder , which applies some force over the length of shrink tube , was given although it should be noted that this is not the only method in preventing the shrink tube from moving . other materials and shapes can be used to prevent the tube from moving by placing the material over part or the total length of the shrink tube . such material can also be placed in the channel to increase the friction as well . examples of the tube friction holder should not limit the scope of the holders and its various forms . fig4 provides a certain embodiment of the method , generally denoted by reference numeral 40 , for insulating material using the machine described above . shrink tube ( or tube of insulation ) of a predetermined length is first set into the guide channels and the friction holders are mated with the guide channels ( 42 ). the spool of material is attached to the device such that the material is axially aligned with shrink tube ( 44 ). a length of string is then threaded through the tube of insulation and around any pulleys that exist in the particular embodiment of the device ( 46 ). during this process , the tube friction holders keep the insulation stationary while the string is threaded through the shrink tube . this is done for each tube and guide channel until either the empty spool or the material spool is reached . the string is then connected to the empty spool at one end and connected directly to the material on the material spool at the other end ( 48 ). the empty spool is rotated to pull the string and the material through the insulation tubing until the material has been pulled to a predetermined location with respect to the insulation tubing ( 50 ). the insulation tubing is heat shrunk onto the material ( 52 ). if the desired length of insulated material has been achieved , the insulated material is cut from the spool of material ( 54 ). if the desired length of insulated material is not reached , then the material is re - wound around the material spool , the string is separated from the empty spool , and the process is repeated ( 56 ). in a certain embodiment that has multiple guide channels and pulleys , the length of the guide channels is equivalent to the distance that the material must travel when leaving one guide channel , going around an intermediate pulley , and entering another guide channel . such an embodiment allows shrink tube insulation to be evenly applied to the material when the material is retracted after a first insulation has been completed and the material has been retracted to the spool of wire . the advantages set forth above , and those made apparent from the foregoing description , are efficiently attained . since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention that , as a matter of language , might be said to fall therebetween . | 7 |
acid catalysts such as sulfuric acid , hydrofluoric acid , aluminum chloride , aluminum bromide and boron trifluoride are commonly used in industry , but have the drawback of being hazardous to the environment . the present invention discloses efficient novel solid superacid catalyst combinations , methods of production of these novel catalyst combinations by the attachment of fluoroalkylsulfonic acid or fluoro , perfluoroalkylsulfonic acid groups to suitable solid nanoscale carrier materials , and describes the use of the novel catalyst combinations to bring about typical acid catalyzed hydrocarbon rearrangement reactions . these novel superacid combinations exhibit the efficacy , convenience of use , and improved environmental safety associated with high surface area solid acid catalysts , combined with superacidity of a magnitude comparable to that of trifluoromethanesulfonic acid . the acid groups of the present invention are preferably of the fluoroalkylsulfonic acid type : --( cf 2 ) n so 3 h , where n is an integer between 1 and 8 ; or of the fluoro , perfluoroalkylsulfonic acid type : --( cf 2 ) n cfr f so 3 h , where n is an integer between 0 and 7 , and rf is a perfluoroalkyl group with a backbone of between 1 and 18 carbon atoms . in one embodiment , the present invention discloses a method for the introduction of the superacid functionality groups onto a solid carrier consisting of a fullerene . buckminsterfullerene , c 60 , with a molecular diameter of 1 nm can be considered as the smallest nanosphere . when reacted with halofluorocarboxylic peroxide ( or halofluorocarboxylic anhydride ) under mild heating --( cf 2 ) n x ( x = cl , br ) groups can be introduced onto c 60 . similarly , reaction with halofluoro perfluoroalkylcarboxylic peroxide ( or halofluoro perfluoroalkylcarboxylic anhydride ) under mild heating leads to introduction of --( cf 2 ) n cfr f x groups onto c 60 . other methods were also developed ( yoshida , et al ., chemistry letters , 1097 ( 1996 ) and references cited therein ). it has now been discovered that such polyhalofluoroalkylated and polyhalofluoro perfluoroalkylated fullerenes can be converted to their corresponding fullerenepolysulfonic acids by treatment with sodium thiosulfate followed by oxidation giving the corresponding fluoroalkylsulfonic and fluoro , perfluoroalkylsulfonic acids . these high surface area new nanoscale bronsted superacid catalysts are highly effective to carry out varied typical electrophilic hydrocarbon transformations . for example , the reaction of c 60 with halodifluoroacetyl peroxide ( or halodifluoroacetic anhydride ) is shown below . ## str1 ## in another embodiment of the present invention , similar methodology was also found to be effective to introduce fluoroalkylsulfonic acid and fluoro perfluoroalkylsulfonic acid groups into polystyrene in high yield and with high para selectivity . the process is particularly effective when carried out with initial reaction of the polystyrene with cf 2 x 2 under ultraviolet irradiation . for example , the reaction of polystyrene with chlorodifluoroacetyl peroxide or chlorodifluoroacetyl anhydride ) is shown below . ## str2 ## cross - linked polystyrene spherical beads with specific uniform dimension ( 100 to 5000 nm size ) are available by controlled emulsion polymerization of styrene and divinylbenzene ( and related cross - linking agents ). these beads , when reacted under the above disclosed conditions of fluoroalkylsulfonation or fluoro , perfluoroalkylsulfonation , produce surface modified beads of high bronsted superacidity . for example , the reaction of a polystyrene bead with chlorodifluoroacetyl peroxide ( or chlorodifluoroacetyl anhydride ) is shown below . ## str3 ## representative , non - limiting member of the class of superacid functionality groups which may be attached to suitable solid carrier materials is esterified difluorosulfonic acid --( cf ) 2 so 3 r . in a further embodiment , the present invention discloses a convenient way to introduce the previously mentioned superacid functional groups onto the solid carrier by reaction using a silicon reagent : tms -- cf 2 so 3 r which allows the general direct introduction of -- cf 2 so 3 r groups and via hydrolysis the -- cf 2 so 3 h acid function into varied carriers . it can be prepared by reacting cf 2 br 2 with na 2 s 2 o 4 under photolytic conditions giving brcf 2 so 2 na which upon oxidation ( such as with h 2 o 2 or by other means ) leads to brcf 2 so 3 h . bromodifluoromethanesulfonic acid can be transformed to its corresponding trimethylsilyl derivatives by aluminum induced reductive procedures resulting in ( ch 3 ) 3 sicf 2 so 3 h ( tms -- cf 2 so 3 h ). when esterified it gives ( ch 3 ) 3 sicf 2 so 3 r ( tms -- cf 2 so 3 r ) reagents which react analogous to the well explored reactions of tms -- cf 3 ( g . a . olah , et al ., eds ., synthetic fluorine chemistry , wiley interscience , 1992 ) allowing introduction of pendant -- cf 2 so 3 r groups into varied polymeric carriers giving after hydrolysis novel solid superacids p -- cf 2 so 3 h . more generally , the method of the present invention can be applied to introduce --( cf 2 ) n so 3 r and --( cf 2 ) n cfr f so 3 r homologous superacid functional groups , by reaction of the solid carrier material with the corresponding trimethylsilyl fluoroalkylsulfonic acid . vinyl monomers with pendant --( cf 2 ) n so 3 r and ## str4 ## --( cf 2 ) n cfr f so 3 r groups can be also prepared and subsequently polymerized to suitable molecular weight polymeric solid superacids . ## str5 ## the prepared solid superacid catalysts with pendant --( cf 2 ) n so 3 r and --( cf 2 ) n cfr f so 3 r groups are effective superacidic catalysts to bring about such typical transformations as substitution and addition reactions , polymerizations , hydrogenation , oxidation and the like ( acid catalyzed hydrocarbon transformations are summarized for example in the monograph olah , g . a ., et al , &# 34 ; hydrocarbon chemistry &# 34 ;, wiley - interscience , new york , 1995 .) certain embodiments and features of the invention are illustrated , and not limited , by the following working examples . c 60 ( 720 mg ) upon treatment with a twelve molar excess of halodifluoroacetyl peroxide (( xcf 2 co 2 ) 2 , x = cl , br ) under heat , 80 ° c ., or uv light ( medium pressure hg vapor lamp ) over 8 h period gave a polyhalodifluoromethylated c 60 mixture . the number of xcf 2 groups on c 60 is around 7 - 10 ( the reaction with the corresponding anhydride is , however , sluggish and the thermal reaction has to be carried out at 150 ° c . in a sealed glass vessel ). similar reaction with cf 2 br 2 under uv irradiation also provides the poly (-- cf 2 -- br ) product . the obtained mixture was treated na 2 s 2 o 4 , ( 1 . 8 g ) and nahco 3 , ( 1 . 0 g ) in 10 ml of deionized water under reflux for 12 h . the resulting mixture was filtered and the aqueous solution was evaporated to dryness to obtain a dark brown precipitate composed of crude , poly ( sodium difluorobenzylsulfinate ) c 60 salt . the crude polysulfinate salt was treated with 2 ml of 30 % h 2 o 2 and stirred overnight to obtain a dark brown solid which was filtered and repeatedly washed with toluene and dried under efficient vacuum at room temperature to obtain the mixture of fullerene polysulfonic acid ( 1 . 2 g ). polystyrene ( 1 g ) was treated with 2 molar excess ( per styrene unit ) of halodifluoroacetyl peroxide as in example ( 1 ) over a period of 8 h . the resulting solid was treated with na 2 s 2 o 4 , ( 1 . 8 g ) and nahco 3 , ( 0 . 9 g ) in 10 ml of deionized water under reflux for 12 h . after filtration , the pale yellow solid was washed repeatedly with deionized water and treated with 30 % aqueous hydrogen peroxide ( 2 ml ) overnight at room temperature . the solid was filtered and washed with 2n hcl repeatedly and dried over dynamic vacuum to obtain 1 . 3 grams of the polystyrene polysulfonic acid . polystyrene beads ( 1 g ) were treated with 2 molar excess ( per styrene unit ) of halodifluoroacetyl peroxide as in example ( 1 ) over a period of 8 h . the resulting solid was treated with na 2 s 2 o 4 , ( 1 . 8 g ) and nahco 3 , ( 0 . 9 g ) in 10 ml of deionized water under reflux for 12 h . after filtration , the pale yellow solid was washed repeatedly with deionized water and treated with 30 % aqueous hydrogen peroxide ( 2 ml ) overnight at room temperature . the solid was filtered and washed with 2n hcl repeatedly and dried over dynamic vacuum to obtain 1 . 3 grams of the polystyrene polysulfonic acid . cf 2 br 2 ( 21 g , 100 mmol ) was treated with na 2 s 2 o 4 , ( 37 g ) and nahco 3 , ( 18 g ) in 200 ml of deionized water and acetonitrile ( 1 : 1 mixture ) under reflux for 12 h . the obtained solid was washed with water and treated with 40 ml of 30 % aqueous hydrogen peroxide . the resulting solid was dried and treated with 100 % sulfuric acid . the bromomethanesulfonic acid was distilled in vacuum ( 10 torr ) at 70 ° c . the acid was found to be a hygroscopic low melting solid ( 10 . 8 g ). it was directly treated with dry tms -- cl ( with triethyl amine ) to obtain br -- cf 2 so 3 si ( ch 3 ) 3 . the tms - bromodifluoromethylsulfonate was treated with tms -- cl ( 10 g ) and dry al ( 2 . 7 g ) powder in n - methylpyrrolidinone ( 200 ml ) to obtain 3 . 2 g of tms -- cf 2 so 3 tms . the reagent was found to react with various polymers containing electrophilic functional groups to deliver -- cf 2 so 3 tms groups under fluoride ion initiation . 10 ml of benzene was treated with benzoyl chloride ( 2 . 5 g , 20 mmol ) in the presence of dry polystyrene polysulfonic acid catalyst ( 200 mg ). the mixture was heated under reflux to obtain benzophenone ( 2 . 5 g , 68 % yield ). similar reaction has been found effective for nitration , alkylation , halogenation and related electrophilic reactions . | 8 |
a preferred embodiment of the present invention will be described herein below with reference to the accompanying drawings . in the following description , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . fig2 is a block diagram of a device for recording information on an optical disc according to an embodiment of the present invention . referring to fig2 , a recording signal generator 1 generates and outputs a recording signal . in the device for recording information on the optical disc according to the present invention , if the recording signal output from the recording signal generator 1 is changed from a low ( l ) level to a high ( h ) level , information recording on the optical disc is started . the recording signal output from the recording signal generator 1 is input to a wave forming unit 2 and a reference voltage generator 3 , respectively . the wave forming unit 2 outputs a selection signal depending on the recording signal . that is , if the recording signal is changed from the l level to the h level at the time t 0 , the selection signal is also changed from the l level to the h level at the time t 0 and then returns to the l level after maintaining the h level for a predetermined time . the reference voltage generator 3 generates and outputs the reference voltage representing the reference intensity of radiation of a laser . that is , if the recording signal is varied from the l level to the h level , the reference voltage generator 3 starts outputting the reference voltage . a laser output - monitoring unit 4 detects the intensity of radiation of the laser output from a laser luminous element 9 which will be described hereinafter , and starts outputting the monitoring voltage depending on the detected intensity of radiation . a subtractor 5 subtracts the reference voltage from the monitoring voltage , and outputs a difference voltage depending on the subtracted result . a constant voltage generator generates and outputs a predetermined constant voltage . a signal selector alternatively outputs the constant voltage from the constant voltage generator 6 and the difference voltage from the subtractor 5 . the signal selector 7 alternatively selects one of the constant voltage and the difference voltage based on the selection signal output from the wave forming unit 2 . that is , the signal selector 7 selects the constant voltage if the selection signal becomes the h level , and selects the difference voltage if the selection signal becomes the l level . the output of the signal selector 7 is input to the laser driver 8 . the laser driver 8 outputs a laser driving current depending on the input signal . the laser luminous element 9 varies the intensity of radiation of the laser which is radiated depending on the laser driving current . also , data for recording information on the optical disc is input to the laser driver 8 , and the laser output by the laser luminous element 9 is turned on / off by the received data . now , the operation of the recording device of the present invention will be explained with reference to fig2 . if the recording signal output from the recording signal generator 1 is varied from the l level to the h level , the information recording is started on the optical disc . that is , the reference voltage generator 3 starts outputting the reference voltage , if the recording signal is varied from the l level to the h level . the subtractor 5 subtracts the reference voltage output from the reference voltage generator 3 from the monitoring voltage output from the laser output monitoring unit 4 , and outputs the difference voltage depending on the subtracted result . since the wave forming unit 2 outputs the h level for a predetermined time after the recording of the information has just started , the signal selector 7 selects the constant voltage output from the constant voltage generator 6 during the predetermined duration after the recording of the information has just started , and then selects the difference voltage output from the subtractor 5 afterward . accordingly , the constant voltage is input to the laser driver 8 during the predetermined duration after the recording has just started , and then selects the difference voltage afterward . next , the laser driver 8 forwards the constant driving current to the laser luminous element 9 during the predetermined duration after the recording has just started , and forwards the driving current which varies depending on the difference voltage afterward . so , the laser luminous element 9 is driven by the constant driving current during the predetermined duration after the recording has just started , and then is controlled by the constant intensity of radiation afterward . thus , the laser luminous element 9 is driven so that the laser is controlled so as to have a constant intensity of radiation after the predetermined duration . as described above , the intensity of radiation of the laser beam radiated by the laser luminous element 9 is not constantly controlled as a constant during the predetermined duration after the recording has just started , i . e ., until the operation of the feedback is at a stable state . however , errors in recording the information or the non recording of the information can be prevented during the predetermined duration after the recording has just started , when the constant voltage generated in the constant voltage generator 6 is determined in a manner that the intensity of radiation of the laser radiated in the laser luminous element 9 is larger than the intensity of radiation which is necessary in recording information on the optical disc . in the present invention , the recording of information is achieved by forming marks on the optical disc . weak laser radiation forms an incomplete mark or a missing mark . errors in recording , in which an incomplete mark that cannot be read correctly , and non recording of the information , in which there is a missing mark , due to the weak radiation , are avoided due to the fact that the intensity of radiation of the laser beam is larger than the radiation which is necessary in recording the information on the optical disc . also , while the temperature within the recording device for recording information on the optical disc the characteristic of the laser luminous element 9 is varied , if the constant voltage output from the constant voltage generator 6 is corrected depending on the temperature , the probability of errors occurring in recording the information or the non recording of the information can be decreased within the predetermined time after the recording has just started . the correction is performed by monitoring the laser driving current for performing the opc ( optimum power control ) operation as an example . here , the opc is an operation for determining the optimized intensity of radiation of the laser by performing a testing record while the intensity of radiation of the laser varies within a predetermined area of the optical disc , as mentioned previously . at this stage , the laser driving current for obtaining the optimized intensity of radiation of the laser can be detected . the temperature may vary from an initial time . in this case , radiation may be weak through the same level of constant voltage as the initial time . in the present invention , the temperature is monitored , and the opc is performed and the level of the constant voltage is redetermined if necessary . this operation occurs before the starting of the ( second , third , . . . ) recording of the information . generally , the opc is performed before the recording of the information has started on the optical disc , and if the difference of the inner temperature of the recording device from an opc target temperature is more than a predetermined value , by monitoring the inner temperature of the recording device using a temperature detector , the opc is performed again . as shown in fig3 , a temperature detecting element 60 detects the inner temperature of the recording device . a microcontroller 62 receives and processes the detected inner temperature to determine the difference with the opc target temperature . the temperature detecting element 60 and the microcontroller 62 form a temperature detector . accordingly , a most suitable value for the voltage generated by the constant voltage generator 6 can be determined . according to the present invention , neither errors in recording the information on the optical disc or the non recording of the information ( formation of non - recording areas ) occur , thereby improving a recording quality on the optical disc after the recording has just started , since the intensity of radiation of the laser recording the information on the optical disc after the recording has just started has reached the necessary intensity . while the present invention has been shown and described with reference to a certain preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 6 |
the present invention discloses painless , non - invasive delivery systems and methods that provide an effective administration to mammals of one or more active pharmacological ingredients ( i . e ., an “ active agent ”) through cellular membranes . as used herein , the term “ membrane ” refers to a selective cellular barrier that is selectively permeable and controls the movement of substances into and out of cells . membranes are generally comprised of proteins and lipids . additionally , membranes include a cell potential ( i . e ., electrical charge ). the term “ membranes ” is intended to encompass all cellular membranes , preferably animal , and more preferably mammalian , and most preferably human . the membrane can be , without limitation , both connective and epithelial membranes . an example of a connective membrane includes a synovial membrane . examples of epithelial membranes include the skin , mucosal membranes and serous membranes . the membranes can be dry membranes or wet membranes . examples of additional mammalian membranes , for both humans and other mammals , include mesenteric , dermal , epidermal , blood - brain barrier , intervaginal , rectal , colonic , ocular , internasal and tympanic membranes . embodiments of the present invention may provide for the delivery of physiologically - active agents to the bloodstream without passing through the gastrointestinal ( gi ) tract . preferred embodiments allow the active ingredient to enter specific organs , such as the skin for dermal application . in certain embodiments , the delivery system provides targeted delivery of the active agent . for example , the blood supply will directly receive the active agent , without requiring the active agent to pass through the liver via the gi tract . elimination of the “ first - pass ” detoxification allows for a decreased burden to the liver , as well as improving the onset of the action of the active “ drug ” and typically reducing the required delivery dose . embodiments of the present invention are intended for administration to animals in need , particularly mammals , and more particularly humans . accordingly , for purposes herein , the terms “ patient ”, “ consumer ” or “ subject ” refer to an individual who is in need of an active agent for therapeutic , prophylactic , cosmetic or preventative reasons , either as an unregulated over - the - counter product or as a regulated product that is prescribed by a medical or clinical professional . a patient can refer to a mammal , including , but not limited to , humans , monkeys , rats , cows , sheep , dogs , cats , goats , etc . a patient may refer to an adult or a child . for the purposes herein , the term “ active agent ” refers to any molecule administered for a therapeutic benefit . an active agent can comprise a pharmacologically - active agent , a sterile fluid and / or an inert filler substance . an active agent can be physiologically active . an active agent may refer to , without limitation , pharmaceuticals , including large - molecule pharmaceuticals , small molecule pharmaceuticals , biopharmaceuticals ( also referred to as “ biologics ”), large molecule biopharmaceuticals , small molecule biopharmaceuticals , nutraceuticals , genetic material ( including dna and rna ), preferably isolated or purified , recombinant nucleic acid vectors ( e . g ., as plasmids , cosmids , etc . ), vaccines , proteins , peptides , hormones , organic or inorganic molecules , nanoparticles ( e . g ., nanocarbons , nanodiamonds , silicons , sulfates / sulfites technologies , etc .) or any combination thereof . examples of proteins / peptides may include antibodies ( e . g ., monoclonal antibodies ), glycosylated and non glycosylated molecules , fusion proteins , protein fragments , sterols and bioidentical compounds , as well as a wide variety of combinations of amino acids and hormones , both human and plant - based . additional examples of suitable active agents are provided herein . one or more active agents may be used . a combination of active agents may be provided , concurrently or serially , preferably in any order . the size of the active agent may range from between about less than 1 kda to about 500 kda or more . one skilled in the art may prefer to use such a formulation for the non - invasive delivery of active agents , where the size of the active agents range from about less than 1 kda to about 20 kda , while other skilled artisans prefer to use the formulation with active agents from about 2 kda to about 200 kda , or from about 200 kda to about 500 kda or even larger . in some embodiments , the active ingredient may range up to about 1000 kda . for the purposes herein , an “ unaltered ” therapeutic active agent refers to an unchanged or unaltered active agent when transported . an unchanged therapeutic active agent is an active agent that undergoes no molecular or irreversible changes . preferably , the active agent does not undergo any irreversible changes in chemical structure , properties , or activity . even more preferably , the active agents in the present disclosure are transported across membranes in their original state . in one preferred embodiment the system maintains , or at least does not alter , the pharmaceutical and / or therapeutic effect of the active agents , so that the delivery system provides the patient with the expected and appropriate effect of the active agent . for example , an unaltered active agent is not glycosylated solely for the purposes of absorption ( wherein the therapeutic agent may not be glycosylated ). as another example , the unaltered active agent does not become conjugated to another molecule for the purposes of absorption ( wherein the therapeutic active agent is not normally conjugated to another molecule ). as still another example , an unaltered active agent is not cleaved into a smaller portion or fragment in order for successful absorption ( i . e ., absorption occurs with the active agent intact ). in preferred embodiments of the present invention , the vehicles of the system and the active agent are not covalently bonded or altered in any way beyond their original formulation . in the most preferred embodiments , the active agent and non - invasive system are bound together through ionic interactions . interactions of the active agent with the non - invasive delivery system do not require , and preferably avoid , conjugation , or the formation of new moieties , that may reduce the therapeutic effectiveness of the active agents . it is preferable that the system does not change the stoichiometry or physiologic functions of the treating agent , and thus , the physiologic therapeutic effect of the active agent is preserved . the term “ an effective amount ,” as used herein , is encompassed by the desired dosage amounts and dose frequency schedule , particularly when coupled with prevention , treatment , or management of one or more conditions requiring therapeutic treatment . effective amounts may vary by subject , disease and active agent , but are generally known in the art or are determinable or optimizable by routine testing . for the purposes herein , “ prophylaxis ” may refer to the prevention of the symptoms of a disease , a delay in onset of the symptoms of a disease , or a lessening in the severity of subsequently developed disease symptoms . the terms “ prevent ”, “ preventing ” and “ prevention ” refer herein to the inhibition of the development or onset of a disorder or the prevention of the recurrence , onset or development of one or more symptoms of a disorder in a subject resulting from the administration of a therapy ( e . g ., a prophylactic or therapeutic agent ), or the administration of a combination of therapies ( e . g ., a combination of prophylactic or therapeutic agents ). for the purposes herein , “ therapy ” or “ treatment ” or “ treat ” can mean a complete abolishment of the symptoms of a disease or a decrease in the severity of the symptoms of the disease . for the purposes herein , the term “ substantially ” is intended to include variations from the absolute condition , e . g ., about 90 percent , preferably about 95 percent , more preferably about 99 percent of the absolute condition . in preferred embodiments , the term “ substantially ” refers to 99 . 9 percent or even 99 . 99 percent of the absolute . for the purposes herein , the term “ immediate environment ” refers to the area at , or substantially near , where the formulation is directly administered . preferably , the immediate environment is directly at the site of administration where the formulation is administered . preferably , the immediate environment includes both the formulation and the site of administration where the formulation is administered and may be in contact with the patient / consumer . the immediate environment may allow for the formulation to interact directly with the membrane to allow the system to facilitate absorption . in some embodiments , the immediate environment is within about 0 - 5 cm or less of the administration site . in one form of the invention , and looking now at fig1 - 11 , there is provided a nano - syringe system 5 comprising a carrier 10 having a syringe 15 carried thereby , wherein syringe 15 comprises a plurality of hollow fibers 20 . more particularly , carrier 10 comprises a flexible concave member 25 having syringe 15 mounted within its concavity 30 . the remainder of the volume of concavity 30 is filled with a gel 35 . preferably , a peel - away strip 40 covers the bottom surface of flexible concave member 25 , sealing syringe 15 and gel 35 until the time of use . syringe 15 is shown in further detail in fig4 - 6 , 6 a , 6 b , 6 c , 7 and 8 . syringe 15 comprises a chamber 45 having a wafer substrate 50 closing off the distal end of chamber 45 . wafer substrate 50 supports hollow fibers 20 , with hollow fibers 20 being in fluid communication with chamber 45 , as will hereinafter be discussed . the distal end of a plunger 55 is movably disposed within chamber 45 . more particularly , plunger 55 comprises a telescoping plunger arm 60 having a silicone plunger disc 65 set at its distal end , and a comfort top 70 disposed at its proximal end . if desired , a spring 75 may be disposed on telescoping plunger arm 60 between silicone plunger disc 65 and comfort top 70 . chamber 45 is disposed in telescoping relation with a locking mechanism 80 , which is disposed in telescoping relation with a support band 85 . shear tabs 87 may be disposed between locking mechanism 80 and support band 85 . as a result of this construction , when comfort top 70 is advanced distally relative to chamber 45 , silicone plunger disc 65 moves distally so as to force the contents of chamber 45 to move distally , out hollow fibers 20 as will hereinafter be discussed . locking mechanism 80 , interacting with support band 85 , prevents plunger 55 from activating prematurely as will also hereinafter be discussed . looking now at fig7 and 8 , an array of hollow fibers 20 extend distally from wafer substrate 50 . as noted above , hollow fibers 20 are in fluid communication with chamber 45 , e . g ., via openings 90 extending through wafer substrate 50 and communicating with the interior of hollow fibers 20 . a large number of hollow fibers 20 are provided , with the hollow fibers being in closely - spaced relation to one another , so that they create a self - supporting meta - structure of long , hollow tubes , each of which is capable of delivering fluid from chamber 45 to the sub - dermal tissues of a patient . hollow fibers may be any hollow nanostructured material , but carbon nanotubes ( cnts ) 20 are one preferred material . carbon nanotubes ( cnts ) 20 may be single - walled cnts ( fig9 ) or multi - walled cnts ( fig1 ). such single - walled cnts and multi - walled cnts are well known in the art of carbon nanotubes . with this form of the present invention , at the time of use , nano - syringe system 5 has its peel - away strip 40 removed from the bottom surface of flexible concave member 25 of nano - syringe system 5 , whereby to expose syringe 15 and gel 35 . the bottom side of nano - syringe system 5 is placed against the skin of a patient at the active agent delivery site , and then the top surface of carrier 10 is depressed toward the skin of the patient . looking now at fig6 a , 6 b and 6 c , this action causes comfort top 70 to move distally , which causes chamber 45 to move distally , until support band 85 contacts the patient &# 39 ; s skin . continued distal movement of comfort top 70 causes shear tabs 87 to break , whereupon chamber 45 moves distally and inserts hollow fibers 20 into the patient &# 39 ; s skin . with further distal movement of chamber 45 being prevented by engagement with the skin , continued distal movement of comfort top 70 overcomes the proximally - biased force of spring 75 , moving silicone plunger disc 65 distally . this action forces active agent in chamber 45 out of chamber 45 , through openings 90 and through hollow fibers 20 so as to deliver the contents of chamber 45 into the sub - dermal tissues of the patient . see fig6 c . thereafter , nano - syringe system 5 may be removed from the patient . nano - needle comprising a plurality of nanofibers ( e . g ., cnts ) arranged to form a hollow tubular meta - structure in another form of the invention , and looking now at fig1 - 14 , there is provided a nano - needle 105 comprising a plurality of nanofibers ( e . g ., cnts ) 110 extending out of a wafer substrate 115 and arranged so as to collectively form a hollow tubular meta - structure 120 having a lumen 125 defined thereby , with hollow tubular meta - structure 120 thereafter being sealed as will hereinafter be discussed so as to form nano - needle 105 . in this form of the invention , wafer substrate 115 comprises at least one opening 130 extending therethrough , so as to allow lumen 125 of nano - needle 105 to communicate with the active agent which is to be delivered , such that the active agent which is to be delivered flows through lumen 125 of nano - needle 105 . thus , by replacing wafer substrate 50 and hollow fibers 20 of nano - syringe system 5 with wafer substrate 115 and a plurality of nano - needles 105 , the active agent may be delivered to the sub - dermal tissue of the patient . more particularly , fig1 a - 12e show an approach for manufacturing nano - needle 105 . fig1 a shows the wafer substrate 115 that is perforated by one or more openings 130 . fig1 b shows a ring of catalyst 135 deposited around the periphery of one or more openings 130 . catalyst 135 ( e . g ., iron , cobalt , nickel and / or another metal well known in the art of growing carbon nanotubes ) is typically deposited via sputtering or evaporation techniques , and patterned using optical or electron beam lithography techniques . multi - layer catalysts or adhesion promoting layers can also be used in catalyst ring 135 without departing from the scope of the present invention . in one preferred form of the invention , aluminum oxide is deposited atop the wafer substrate 115 , before the catalytic layer is deposited , so as to promote adhesion . fig1 c shows an array of cnts 110 having been grown from catalytic ring 135 . during the heating process that precedes carbon nanotube growth , the catalyst metal film , which is typically thin ( e . g ., approximately 1 nm ) will “ break up ” into nanoscale islands . each island then nucleates the growth of a carbon nanotube . a carbon nanotube will grow in a random direction until it encounters another growing carbon nanotube , at which point the carbon nanotubes may either become entangled with one another , or adhere to one another , and then grow as a pair or as a group . this tends to promote vertical alignment in the array of carbon nanotubes . in this way , the hollow tubular meta - structure 120 , having a lumen 125 defined thereby , is grown out of wafer substrate 115 , wherein lumen 125 of hollow tubular meta - structure 120 is aligned with the opening 130 extending through wafer substrate 115 . in fig1 d , a matrix material 140 is deposited within the interstitial spaces between cnts 110 so as to form a rigid , non - porous hollow nano - needle 105 having an inner and outer diameter that is roughly defined by catalyst ring 135 , and a length that is defined by the height of the nanotube array , which is governed by process conditions and growth time . the deposition of a matrix material in the interstitial spaces between the nanotubes is discussed in nicholas : “ electrical device fabrication from nanotube formations ,” us 20100140591 a1 . this filing discusses the use of chemical vapor deposition and atomic layer deposition to embed and encapsulate the nanotubes completely , and references gordon et al ., “ ald of high - k dielectrics on suspended functionalized swnts , electrochemical and solid - state letters ,” 8 ( 4 ) g89 - g91 ( 2005 ) and lu et al ., “ dna functionalization of carbon nanotubes for ultra - thin atomic layer deposition of high k dielectrics for nanotube transistors with 60 mv / decade switching ,” arxiv : cond - mat / 0602454 ; and fahlman et al ., “ cvd of conformal alumina thin films via hydrolysis of alh 3 ( nme 2 et ),” adv . mater . opt . electron 10 , 135 - 144 ( 2000 ). see fig1 e , which provides an isometric , sequential view of the aforementioned four - step process for producing nano - needle 105 . note that in this form of the invention , the individual cnts 110 may be substantially hollow , substantially solid or a combination thereof . fig1 shows an aligned array of cnts 110 at low magnification . in the inset of fig1 , a cluster of cnts 110 is shown , having overall parallel alignment despite significant directional wander of the constituent cnts . fig1 shows nano - needle 105 after a matrix material 140 has been deposited within the interstitial spaces between cnts 110 . looking next at fig1 - 33 , there is shown another preferred form of the present invention . this form of the present invention utilizes the rigid , non - porous hollow nano - needle 105 of fig1 a - 12e , 13 and 14 , combined with a modified form of deployment apparatus . more particularly , and looking now at fig1 - 19 , there is provided a nano - syringe system 205 comprising a carrier 210 having a syringe 215 carried thereby , wherein syringe 215 comprises a plurality of nano - needles 105 comprising a plurality of hollow fibers ( e . g ., cnts ) 110 . carrier 210 comprises a flexible concave member 220 having syringe 215 mounted within its concavity 225 . the remainder of the volume of concavity 225 is filled with a gel 230 . holes 231 formed in carrier 210 allow visualization of the top of syringe 215 as will hereinafter be discussed . preferably , a peel - away strip 235 covers the bottom surface of flexible concave member 220 , sealing syringe 215 and gel 230 in concavity 225 of flexible concave member 220 until the time of use . looking next at fig2 - 24 , syringe 215 generally comprises a hollow base 240 ; a nano - needle assembly 245 movably mounted within hollow base 240 ; a plunger rod 250 and a plunger disc 255 adapted for distal movement within hollow base 240 ; a cap 260 secured to plunger rod 250 for selectively advancing plunger rod 250 and plunger disc 255 distally within hollow base 240 ; a cap spring 265 for biasing cap 260 proximally ; a locking ring 270 , a timing ring 275 , and a plunger spring 280 for controlling the cycling of plunger rod 250 and plunger disc 255 within hollow base 240 ; and a cycle indicator 285 for indicating the cycle status of syringe 215 , all as will hereinafter be discussed . more particularly , hollow base 240 comprises l - shaped slots 290 , a lip 295 and fingers 300 . nano - needle assembly 245 comprises a plurality of nano - needles 105 mounted to a wafer substrate 305 having a plurality of openings 307 , and a needle support plate 310 secured to the distal end of hollow base 240 and including a plurality of openings 315 for permitting nano - needles 105 to extend therethrough . cap 260 comprises tabs 320 for locking onto lip 295 of hollow base 240 , tabs 323 for selectively engaging locking ring 270 , and windows 325 for allowing visualization of cycle indicator 285 , whereby to identify the cycle status of syringe 215 . locking ring 270 comprises slots 330 for engagement with cycle indicator 285 , tabs 335 for engagement in l - shaped slots 290 of base 240 and for selective engagement by tabs 323 of cap 260 , and fingers 340 for engaging timing ring 275 . timing ring 275 comprises longitudinally - extending slots 345 for receiving fingers 340 of timing ring 275 , and keyways 350 for receiving fingers 300 of base 240 . as a result of this construction , locking ring 270 and timing ring 275 are rotationally fixed to one another , but are able to telescope relative to one another ; and timing ring 275 is able to move both rotationally and telescopically relative to base 240 , but only as permitted by the engagement of fingers 300 in keyways 350 . plunger spring 280 is a torsion compression spring , biasing timing ring 275 both distally and rotationally , as will hereinafter be discussed . it will also be appreciated that plunger disc 255 is mounted to timing ring 275 such that plunger disc 255 moves with timing ring 275 moves , as will hereinafter be discussed . cycle indicator 285 comprises legs 355 for seating in slots 330 of locking ring 270 , whereby to couple rotation of cycle indicator 285 with rotation of locking ring 270 , and includes color coding 360 , 365 on its upper surface for visualization through windows 325 of cap 260 ( and through holes 231 in carrier 210 ). with this form of the invention , prior to use , and looking now at fig2 and 26 , nano - needle assembly 245 is disposed within hollow base 240 so that its wafer substrate 305 is disposed intermediate needle support plate 310 and plunger disc 255 , with the distal tips of nano - needles 105 extending into openings 315 in needle support plate 310 . the active agent to be injected into the patient resides in the chamber 370 defined between wafer substrate 305 and plunger disc 255 . when nano - syringe system 205 is to be used to inject the active agent into a patient , peel - away strip 235 is removed from the bottom surface of flexible concave member 220 , and the bottom of the system is placed against the skin of the patient at the active agent delivery site . next , and looking now at fig2 and 28 , cap 260 is depressed . this action causes plunger rod 250 , plunger disc 255 and wafer substrate 305 to move distally as a unit , carrying chamber 370 distally within hollow base 240 while preserving its volume . as wafer substrate 305 moves distally within base 240 , nano - needles 105 advance through openings 315 in needle support plate 310 and enter the skin of the patient . distal movement of nano - needles 105 continues until wafer substrate 305 seats against needle support plate 310 . note that at this point in the operation of nano - syringe system 205 , plunger disc 255 has not advanced with respect to wafer substrate 305 , and hence none of the active agent in chamber 370 has been ejected from nano - needles 105 . at the same time , the downward movement of cap 260 causes plunger rod 250 to move timing ring 275 distally . when this occurs , plunger spring 280 , which is both a torsion and compression spring , causes timing ring 275 to rotate , which causes locking ring 270 to also rotate ( by virtue of the engagement of fingers 340 in longitudinally - extending slots 345 of timing ring 275 ). as a result , plunger spring 280 also moves timing ring 275 distally within hollow base 240 , causing plunger disc 255 to move distally until it engages wafer substrate 305 . distal movement of plunger disc 255 forces the active agent residing in chamber 370 distally , through openings 307 , into nano - needles 105 and into the patient . see fig2 and 30 . when plunger spring 280 has moved timing ring 275 distally a sufficient distance to cause plunger disc 255 to move distally and engage wafer substrate 305 ( and hence eject the active agent into the patient ), the torsional force of plunger spring 280 causes timing ring 275 to rotate , whereby to rotate locking ring 270 . rotation of locking ring 270 causes tabs 335 to move within l - shaped slot 290 , whereby to release tabs 323 of cap 260 . when tabs 323 are released from engagement with tabs 335 , cap 260 is moved proximally by cap spring 265 . proximal movement of cap 260 causes proximal movement of plunger rod 250 and hence proximal movement of wafer substrate 305 and nano - needles 105 , whereby to withdraw nano - needles 105 from the skin of the patient . see fig3 and 33 . with this form of the invention , and looking now at fig3 a and 33b , it can be desirable to provide a spring - biased needle guide plate 372 between wafer substrate 305 and needle support plate 310 , so as to prevent buckling of the nano - needles 105 . more particularly , in this form of the invention , spring - biased needle guide plate 372 comprises spring legs 373 which serve to spring - support spring - biased needle guide plate 372 above needle support plate 310 . in one form of the invention , legs 373 are formed out of a portion of spring - biased needle guide plate 372 and bent out of the plane of spring - biased needle guide plate 372 so as to provide spring support for spring - biased needle guide plate 372 above needle support plate 310 . spring - biased needle guide plate 372 comprises openings 371 for permitting nano - needles 105 to extend from wafer substrate 305 , through spring - biased needle guide plate 372 , and through openings 315 in needle support plate 310 . additional holes 374 enable alignment of the guide plate 372 during assembly . thus it will be seen that with this form of the invention , nano - needle assembly 245 is disposed within base 240 so that its wafer substrate 305 is disposed intermediate needle support plate 310 and plunger disc 255 , with the distal tips of nano - needles 105 extending through openings 371 in spring - biased needle guide plate 372 and then extending into openings 315 in needle support plate 310 . the spring - biased needle guide plate 372 serves as a moving support plate to prevent buckling of the nano - needles 105 during advancement of nano - needles 105 , i . e ., as wafer substrate 305 moves towards needle support plate 310 , wafer substrate 305 engages spring - biased needle guide plate 372 and forces it distally , against the power of spring legs 373 , until spring - biased needle guide plate 372 effectively engages needle support plate 310 . during this “ power stroke ”, spring - biased needle guide plate 372 serves as a moving support plate moving along nano - needles 105 to prevent buckling of the nano - needles 105 during advancement of nano - needles 105 . in the foregoing description , nano - syringe system 5 comprises a carrier 10 having a syringe 15 carried thereon , wherein syringe 15 comprises a plurality of hollow fibers 20 . carbon nanotubes ( cnts ) were used as an exemplary material for the construction of the nano - needles , but , if desired , hollow cnts 20 may be replaced by alternative tubular structures . furthermore , in the foregoing description , nano - needle 105 comprises a plurality of cnts 110 extending out of wafer substrate 115 and arranged so as to collectively form a hollow tubular meta - structure 120 having a lumen 125 defined thereby , with hollow tubular meta - structure 125 thereafter being sealed so as to form nano - needle 105 . however , if desired , cnts 110 may be replaced by alternative tubular structures . also , in the foregoing description , nano - syringe system 205 comprises a carrier 210 having a syringe 215 carried thereon , wherein syringe 215 comprises a nano - needle 105 comprising a plurality of hollow cnts 110 . again , if desired , cnts 110 may be replaced by alternative tubular structures . by way of example but not limitation , cnts 20 and / or cnts 110 may be replaced by tubular structures formed using the process shown in fig3 a - 34e . more particularly , with this process , a support plate 400 , having holes 405 extending therethrough , is provided ( fig3 a ). fibers 410 are inserted into , and fixed to , support plate 400 such that each fiber is supported and freestanding , with spacing between adjacent fibers ( fig3 b ). fibers 410 are then overcoated with a stiff material 415 ( fig3 c ). this fiber overcoating process may utilize any one of several common coating processes , including chemical vapor deposition , plating , physical vapor deposition ( sputtering or evaporation ), atomic layer deposition , spraying , dipping , electrophoretic deposition or the like . fixation may include sintering , heat treating , solvent welding , etc . the stiff material 415 overcoating the free ends of fibers 410 is then removed , whereby to expose fibers 410 ( fig3 d ). fibers 410 are then selectively etched away , without etching stiff material 415 , whereby to leave hollow tubes 420 of stiff material 415 extending out of support plate 400 , with the lumens 425 of hollow tubes 420 communicating with holes 405 in support plate 400 ( fig3 e ). various materials consistent with this approach may be used to form support plate 400 , fibers 410 , stiff material 415 and the preferential etchant . of course , the selections of these materials must be coordinated with one another so as to be consistent with this fabrication process . by way of example but not limitation , in one preferred form of the invention , stiff material 415 comprises tungsten , whereby to form tungsten hollow tubes 420 . in this form of the invention , support plate 400 may comprise an etch - resistant material , fibers 410 may comprise plastics , glass , a ceramic , a low melting metal , or a readily etchable metal , and the preferential etchant may comprise hydrofluoric acid for the glass fibers , or a solvent for the plastic fibers . fig3 and 36 show an exemplary tungsten hollow tube 420 , formed in accordance with the process depicted in fig3 a - 34e , extending out of the skin of a patient . by way of further example but not limitation , in another preferred form of the invention , stiff material 415 comprises alumina , whereby to form alumina hollow tubes 420 . in this form of the invention , support plate 400 may comprise either a plastic or a ceramic , fibers 410 may comprise plastic , glass or metals , and the preferential etchant may comprise solvents for plastic fibers , or hf for glass fibers , or hcl for ferrous metal fibers . in general , it is preferred that support plate 400 comprises one from the group consisting of stainless steel or another metal , plastics or ceramics . in general , it is preferred that fibers 410 comprise at least one from the group consisting of glass , carbon or a ceramic . in general , it is preferred that stiff material 415 comprises at least one from the group consisting of a metal , ceramic or diamond - like carbon . in general , it is preferred that the preferential etchant comprises at least one from the group consisting of 1 : 1 hf : hno 3 ; 1 : 1 hf : hno 3 ( thin films ); 3 : 7 hf : hno 3 ; 4 : 1 hf : hno 3 ( rapid attack ); 1 : 2 nh 4 oh : h 2 o 2 ( thin films good for etching tungsten from stainless steel , glass , copper and ceramics , will also etch titanium as well ); 305 g : 44 . 5 g : 1000 ml k 3 fe ( cn ) 6 : naoh : h 2 o ( rapid etch ); hcl ( slow etch , dilute or concentrated ); hno 3 ( very slow etch , dilute or concentrated ); h 2 so 4 ( slow etch , dilute or concentrated ); hf ( slow etch , dilute or concentrated ); h 2 o 2 ; 1 : 1 , 30 %: 70 %, or 4 : 1 hf : hno 3 ; 1 : 2 nh 4 oh : h 2 o 2 ; 4 : 4 : 3 hf : hno 3 : hac ; cbrf 3 rie etch ; 305 g : 44 . 5 g : 1000 ml k 3 fe ( cn ) 6 : naoh : h 2 o ( very rapid etch ); hcl solutions ( slow attack ); hno 3 ( slight attack ) aqua regia 3 : 1 hcl : hno 3 ( slow attack when hot or warm ); h 2 so 4 dilute and concentrated ( slow etch ); hf dilute and concentrated ( slow etch ); and alkali with oxidizers ( kno 3 and pbo 2 ) ( rapid etch ). a roving of 15 micron diameter glass filament was debundled into individual filaments and processed in a chemical vapor deposition chamber . a tungsten coating , 20 microns thick , was deposited on the filaments , leading to the growth in the diameter of the filaments to 55 microns . the coated filaments were then cut to length , and immersed in an hf bath for several days . the disparity in the etch rates of tungsten and glass by hydrofluoric acid enables the glass core to be etched out , leaving the tungsten intact . however , the process is retarded by the limited area of glass exposed to the acid . once etched , one end of each tungsten hollow needle was placed into holes in a lexan support plate , so that each hollow needle was vertically oriented and freestanding . the solvent dicholoromethane was used to solvent - weld the tungsten tubes to the lexan . as the individual handing required in example 1 was arduous , a second process was developed to process the filaments in parallel . a length of 15 micron od glass fiber roving was debundled and one end of each fiber was inserted into a stainless steel support plate , 0 . 1 mm thick , which had been laser drilled with 15 micron holes to receive the fibers . the plate thickness to hole diameter ratio in this case is approximately 6 . 6 : 1 , which has been found sufficient to fixate the filaments , and within the capability of laser drilling . the glass fibers were then overcoated with tungsten by a cvd process , which also covered the stainless support plate , all to a thickness of 20 microns . the backside was protected to prevent coating on the backside of the support plate . the tungsten coating at the fiber tips was exposed to an etchant , ( k 3 fe ( cn ) 6 : naoh : h 2 o 30 . 5 g : 4 . 45 g : 100 ml ) to re - expose the glass fibers . the glass fibers were then etched out with hydrofluoric acid , leaving an array of hollow needles , vertically standing where their glass fiber cores had once been . the process followed in this example is illustrated in fig3 a - 34e . lengths of 15 micron palladium wire were passed through a copper coated polyimide support sheet , such that each wire protruded from the support plate by 5 mm on the metallized side , and protruded by a smaller amount on the side without the metallization . the palladium wires and copper surface were dipped into an alumina ceramic slurry and a dc voltage was applied to cause electrophoretic deposition on the copper and wires , which served as the cathode . the polyimide support was then removed , leaving a ceramic deposit both where the metallized polyimide had been , and also around the wires . the wires were carefully removed , and the ceramic article sintered to create a plate with hollow needles . the needles were not universally open after this process , so the article was potted in a wax , then polished on a silicon carbide paper to expose the inner diameter . the wax was then removed , leaving the article with the holes exposed . the system delivers therapeutic active agents with pharmacologic and pharmacokinetic profiles similar to , or better than , dosing with original modes of delivery , e . g ., via intramuscular injection ( im ), subcutaneous injection ( sc ), intravenous administration ( iv ), suppository administration , oral and / or nasal delivery , etc ., often with reduced toxicities ( which may correlate to the reduced levels of therapeutic active agents or decreased need for hepatic metabolism , or a combination thereof ). the pharmacological active agents can include any molecule or composition in any number or amount . preferably , the active agent may be used individually or in combination with one another . classes of active agents can include analgesics ( acetaminophen , cox - 1 and / or cox - 2 inhibitors , ibuprofen , lidocaine , etc . ); emergency medications ( e . g ., epinephrine , atropine , 17 -( cyclopropylmethyl )- 4 , 5α - epoxy - 3 , 14 - 25 dihydroxymorphinan - 6 - one ( naltrexone and flumazenil )); anti - arrhythmics ( e . g ., amiodarone , diltiazem and atropine ); lipid modulators ( e . g ., statins , atorvastatin , etc . ); anti - convulsants ( e . g ., phenytoin sodium , topiramate , oxcarbazepine , etc . ); anti - coagulants ( e . g ., low molecular weight heparin , enoxaparin , etc . ); vitamins and nutritional supplements ( e . g ., co - enzyme q10 , etc . ); corticosteroids ( e . g ., prednisone ); oncology agents ( e . g ., paclitaxel , carboplatin , etc . ); centrally active agents ( e . g ., sumatriptan ); micropeptides ( e . g ., xen 2174 ); rheumatologic agents ( e . g ., etanercept , adalimumab , etc . ); bone marrow stimulators ( e . g ., filgrastim , erythropoetin alfa , etc . ); osteoporosis medications ( e . g ., teriparatide ); growth factors ( e . g ., somatotropin ); immune modulators ( e . g ., cyclophosphamide , tacrolimus , mycophenylate mofetil , azathioprine , etc . ); anti - human antibodies ( e . g ., gamma globulin ); central and peripheral neuromuscular disorder agents ( e . g ., glatirameracetate ); endocrines ( e . g ., human growth hormone ( hgh ), profasi ( hcg analogue ), insulin and / or insulin analogues , etc . ), and vascular tone modulators ( e . g ., sildenafil ). an additional example of an active agent may include pt - 141 . exemplary active agents include agents for treating infections such as antibacterial , anti - fungal and antibiotic agents ; agents for treating cardiovascular conditions such as chlorothiazide ( diuretic ), propranolol ( antihypertensive ), hydralazine ( peripheral vasodilator ), isosorbide or nitroglycerin ( coronary vasodilators ), metoprolol ( beta - blocker ), procainamide ( antiarrythmic ), clofibrate ( cholesterol reducer ) or coumadin ( anticoagulant ); agents for treating internal conditions such as conjugated estrogen ( hormone ), tolbutamide ( antidiabetic ), levothyroxine ( thyroid conditions ), propantheline ( antispasmodic ), cimetidine ( antacid ), phenyl propanolamine ( anti - obesity ), atropine or diphenoxalate ( antidiarrheal agents ), docusate ( laxative ), or prochlorperazine ( antinauseant ); agents for treating mental health conditions such as haloperidol or chlorpromazine ( tranquilizers ), doxepin ( psychostimulant ), phenytoin ( anticonvulsant ), levo dopa ( anti - parkinism ), benzodiazepine ( anti - anxiety ) or phenobarbital ( sedative ); agents for treating inflammation ( anti - inflammatories ) such as fluorometholone , acetaminophen , phenacetin , aspirin , hydrocortisone , or predisone ; agents for treating allergic reactions ( antihistamines ) such as diphenhydramine hydrochloride or dexchlorpheniramine maleate ; agents for treating infection ( antibiotics ) such as sulfanilamide , sulfamethizole , tetracycline hydrochloride , penicillin and its derivatives , cephalosporin derivatives or erythromycin ; agents for providing chemotherapy ( chemotherapeutic agents ) such as sulfathiazole , doxorubicin , cisplatin or nitrofurazone ; agents for providing local pain relief ( topical anaesthetics ) such as benzocaine ; agents for treating cardiovascular disorders ( cardiac tonics ) such as digitalis or digoxin ; agents for treating pulmonary distress ( antitussives and expectorants ) such as codeine phosphate , dextromethorphan or isoproterenol hydrochloride ; agents for treating oral conditions ( oral antiseptics ) such as chlor hexidine hydrochloride or hexylresorcinol ; agents for providing enzymes such as lysozyme hydrochloride or dextronase ; birth control agents such as estrogen ; agents for treating ophthalmic disorders such as timolol or gentamycin , and the like . in addition , active agents may also include whole proteins such as the vp3 capsid protein ( also known as the vpthr and vp1 capsid proteins in other nomenclature systems ), insulin or interferon ; polypeptide treating agents such as endorphins , human growth hormone or bovine growth hormone , or still lower molecular weight polypeptides or conjugates of those polypeptides , linked protein carriers , etc . the system can , optionally deliver an effective amount of active agents selected from at least one of an anti - infective , a cardiovascular system drug , a central nervous system drug , an autonomic nervous system drug , a respiratory tract drug , a gastrointestinal ( gi ) tract drug , a hormonal drug , a drug for fluid or electrolyte balance , a hematologic drug , an antineoplactic drug , an immunomodulation drug , an ophthalmic drug , an otic or nasal drug , a topical drug , a nutritional drug , a statin , or the like . active agents can also be at least one selected from nonnarcotic analgesics or at least one selected from the group consisting of antipyretics , nonsteroidal anti - inflammatory drugs , narcotics or at least one opioid analgesics , sedative - hypnotics , anticonvulsants , antidepressants , antianxiety drugs , antipsychotics , central nervous system stimulants , antiparkinsonians , and miscellaneous central nervous system drugs . the active agent can be at least one selected from the group consisting of cholinergics ( parasympathomimetics ), anticholinergics , adrenergics ( sympathomimetics ), adrenergic blockers ( sympatholytics ), skeletal muscle relaxants , and neuromuscular blockers . nonnarcotic analgesics or antipyretics can be at least one selected from the group consisting of acetaminophen , asprin , choline magnesium trisalicylate , diflunisal , and magnesium salicylate . nonsteroidal anti - inflammatory drugs can be at least one selected from the group consisting of celecoxib , diclofenac potassium , diclofenac sodium , etodolac , fenoprofen calcium , flurbiprofen , ibuprofen , indomethacin , ketoprofen , ketorolac tromethamine , nabumetone , naproxen , naproxen sodium , oxaprozin , piroxicam , rofecoxib , and sulindac . narcotic or opioid analgesics can be at least one selected from the group consisting of alfentanil hydrochloride , buprenorphine hydrochloride , butorphanol tartrate , codeine phosphate , codeine sulfate , fentanyl citrate , fentanyl transdermal system , fentanyl transmucosal , hydromorphone hydrochloride , meperidine hydrochloride , methadone hydrochloride , morphine hydrochloride , morphine sulfate , morphine tartrate , nalbophine hydrochloride , oxycodone hydrochloride , oxycodone pectinate , oxymorphone hydrochloride , pentazocine hydrochloride , pentazocine hydrochloride and naloxone hydrochloride , pentazocine lactate , propoxyphene hydrochloride , propoxyphene napsylate , remifentanil hydrochloride , sufentanil citrate , and 25 tramadol hydrochloride . a sedative - hypnotic agent can be at least one selected from the group consisting of chloral hydrate , estazolam , flurazepam hydrochloride , pentobarbital , pentobarbital sodium , phenobarbital sodium , secobarbital sodium , temazopam , triazolam , zaleplon , and zolpidem tartrate . an anticonvulsant agent can be at least one selected from the group consisting of acetazolamide sodium , carbamazepine , clonazepam , clorazepate dipotassium , diazepam , divalproex sodium , ethosuximde , fosphenytoin sodium , gabapentin , lamotrigine , magnesium sulfate , phenobarbital , phenobarbital sodium , phenytoin , phenytoin sodium , phenytoin sodium ( extended ), primidone , tiagabine hydrochloride , topiramate , valproate sodium , and valproic acid . an antidepressant agent can be at least one selected from the group consisting of amitriptyline hydrochloride , amitriptyline pamoate , amoxapine , bupropion hydrochloride , citalopram hydrobromide , clomipramine hydrochloride , desipramine hydrochloride , doxepin hydrochloride , fluoxetine hydrochloride , imipramine hydrochloride , imipramine pamoate , mirtazapine , nefazodone hydrochloride , nortriptyline hydrochloride , paroxetine hydrochloride , phenelzine sulfate , sertraline hydrochloride , tranylcypromine sulfate , trimipramine maleate , and venlafaxine hydrochloride . an antianxiety agent can be at least one selected from the group consisting of alprazolam , buspirone hydrochloride , chlordiazepoxide , chlordiazepoxide hydrochloride , clorazepate dipotassium , diazepam , doxopin hydrochloride , hydroxyzine embonate , hydroxyzine hydrochloride , hydroxyzine pamoate , lorazepam , mephrobamate , midazolam hydrochloride , and oxazopam . an antipsychotic agent can be at least one selected from the group consisting of chlorpromazine hydrochloride , clozapine , fluphenazine decanoate , fluephenazine enanthate , fluphenazine hydrochloride , haloperidol , haloperidol decanoate , haloperidol lactate , loxapine hydrochloride , loxapine succinate , mesoridazine besylate , molindone hydrochloride , olanzapine , perphenazine , pimozide , prochlorperazine , quetiapine fumarate , risperidone , thioridazine hydrochloride , thiothixene , thiothixene hydrochloride , and trifluoperazine hydrochloride . a central nervous system stimulant agent can be at least one selected from the group consisting of amphetamine sulfate , caffeine , dextroamphetamine sulfate , doxapram hydrochloride , methamphetamine hydrochloride , methylphenidate hydrochloride , modafinil , pemoline , and phentermine hydrochloride . an anti - parkinsonian agent can be at least one selected from the group consisting of amantadine hydrochloride , benztropine mesylate , biperiden hydrochloride , biperiden lactate , bromocriptine mesylate , carbidopa - levodopa , entacapone , levodopa , pergolide mesylate , pramipexole dibydrochloride , ropinirole hydrochloride , selegiline hydrochloride , tolcapone , and trihexyphenidyl hydrochloride . a central nervous system active agent can be at least one selected from the group consisting riluzole , bupropion hydrochloride , donepezil hydrochloride , droperidol , fluvoxamine maleate , lithium carbonate , lithium citrate , naratriptan hydrochloride , nicotine polacrilex , nicotine transdermal system , propofol , rizatriptan benzoate , sibutramine hydrochloride monohydrate , sumatriptan succinate , tacrine hydrochloride , duoxetene , milnaciprin , gabapentin , pregabalin and zolmitriptan . a cholinergic ( e . g ., parasymathomimetic ) active agent can be at least one selected from the group consisting of bethanechol chloride , edrophonium chloride , neostigmine bromide , neostigmine , methylsulfate , physostigmine salicylate , and pyridostigmine bromide . a anticholinergics agent can be at least one selected from the group consisting of atropine sulfate , dicyclomine hydrochloride , glycopyrrolate , hyoscyamine , hyoscyamine sulfate , propantheline bromide , scopolamine , scopolamine butylbromide , and scopolamine hydrobromide . an adrenergic ( sympathomimetics ) active agent can be at least one selected from the group consisting of dobutamine hydrochloride , dopamine hydrochloride , metaraminol bitartrate , norepinephrine bitartrate , phenylephrine hydrochloride , pseudoephedrine hydrochloride , and pseudoephedrine sulfate . an adrenergic blocker 1 ( sympatholytic ) agent can be at least one selected from the group consisting of dibydroergotamine mesylate , ergotamine tartrate , methysergide maleate , and propranolol hydrochloride . a skeletal muscle relaxant agent can be at least one selected from the group consisting of baclofen , carisoprodol , chlorzoxazone , cyclobenzaprine hydrochloride , dantrolene sodium , methocarbamol , and tizanidine hydrochloride . a neuromuscular blocker active agents can be at least one selected from the group consisting of atracurium besylate , cisatracurium besylate , doxacurium chloride , mivacurium chloride , pancuronium bromide , pipecuronium bromide , rapacuronium bromide , rocuronium bromide , succinylcholine chloride , tubocurarine chloride , and vecuronium bromide . an anti - infective active agent can be at least one selected from the group consisting of amebicides or at least one antiprotozoals , anthelmintics , antifungals , antimalarials , antituberculotics or at least one antileprotics , aminoglycosides , penicillins , cephalosporins , tetracyclines , sulfonamides , fluoroquinolones , antivirals , macrolide anti - infectives , and miscellaneous anti - infectives . a cardiovascular active agent can be at least one selected from the group consisting of inotropics , antiarrhythmics , antianginals , antihypertensives , antilipemics , and miscellaneous cardiovascular drugs . a central nervous system active agent can be at least one selected from the group consisting of nonnarcotic analgesics or at least one selected from antipyretics , nonsteroidal anti - inflammatory drugs , narcotic or at least one opioid analgesics , sedative hypnotics , anticonvulsants , antidepressants , antianxiety drugs , antipsychotics , central nervous system stimulants , antiparkinsonians , and miscellaneous central nervous system drugs . an autonomic nervous system agent can be at least one selected from the group consisting of cholinergics ( parasympathomimetics ), anticholinergics , adrenergics ( sympathomimetics ), adrenergic blockers ( sympatholytics ), skeletal muscle relaxants , neuromuscular blockers . a respiratory tract active agent can be at least one selected from the group consisting of antihistamines , bronchodilators , expectorants or at least one antitussive , and miscellaneous respiratory drugs . a gi tract active agent can be at least one selected from the group consisting of antacids or at least one adsorbents or at least one antiflatulents , digestive enzymes or at least one gallstone solubilizers , antidiarrheals , laxatives , antiemetics , and antiulcer drugs as well as the new irritable bowel molecules which operate as guanylate cyclase inhibitors ( linaclotide ). a hormonal active agent can be at least one selected from the group consisting of corticosteroids , androgens or at least one anabolic steroids , estrogens or at least one progestins , gonadotropins , antidiabetic drugs or at least one glucagon , thyroid hormones , thyroid hormone antagonists , pituitary hormones , and parathyroid - like drugs . an active agent for fluid and electrolyte balance can be at least one selected from the group consisting of diuretics , electrolytes or at least one replacement solution , acidifiers or at least one alkalinizer . a hematologic active agent can be at least one selected from the group consisting of hematinics , anticoagulants , blood derivatives , thrombolytic enzymes . an antineoplastic agent can be at least one selected from the group consisting of alkylating drugs , antimetabolites , antibiotic antineoplastics , antineoplastics that alter hormone balance , and miscellaneous antineoplastics . an immunomodulation active agent can be at least one selected from the group consisting of immunosuppressants , vaccines or at least one toxoid , antitoxins or at least one antivenins , immune serums , biological response modifiers . an ophthalmic , otic , and nasal active agent can be at least one selected from the group consisting of ophthalmic anti - infectives , ophthalmic anti - inflammatories , miotics , mydriatics , ophthalmic vasoconstrictors , miscellaneous ophthalmics , otics , and nasal active agents . a topical active agent can be at least one selected from the group consisting of local anti - infectives , scabicides or at least one pediculicides , and topical corticosteroids . amebicide or antiprotozoal can be at least one selected from atovaquone , chloroquine hydrochloride , chloroquine phosphate , metronidazole , metronidazole hydrochloride , and pentamidine isethionate . an anthelmintic active agent can be at least one selected from the group consisting of mebendazole , pyrantel pamoate , and thiabendazole . an antifungal agent can be at least one selected from the group consisting of amphotericin b , amphotericin b cholesteryl sulfate complex , amphotericin b lipid complex , amphotericin b liposomal , fluconazole , flucytosine , griseofulvin microsize , griseofulvin ultramicrosize , itraconazole , ketoconazole , nystatin , and terbinafine hydrochloride . an antimalarial agent can be at least one selected from the group consisting of chloroquine hydrochloride , chloroquine phosphate , doxycycline , hydroxychloroquine sulfate , mefloquine hydrochloride , primaquine phosphate , pyrimethamine , and pyrimethamine with sulfadoxine . an antituberculotic or antileprotic agent can be at least one selected from the group consisting of clofazimine , cycloserine , dapsone , ethambutol hydrochloride , isoniazid , pyrazinamide , rifabutin , rifampin , rifapentine , and streptomycin sulfate . an aminoglycoside agent can be at least one selected from the group consisting of amikacin sulfate , gentanicin sulfate , neomycin sulfate , streptomycin sulfate , and tobramycin sulfate . the penicillin can be at least one selected from the group consisting of amoxcillin / clavulanate potassium , amoxicillin trihydrate , ampicillin , ampicillin sodium , ampicillin tribydrate , ampicillin sodium / sulbactam sodium , cloxacillin sodium , dicloxacillin sodium , mezlocillin sodium , nafcillin sodium , oxacillin sodium , penicillin g benzathine , penicillin g potassium , penicillin g procaine , penicillin g sodium , and penicillin v potassium . the cephalosporin can be at least one selected from the group consisting of at least one of cefaclor , cefadroxil , cefazolin sodium , cefdinir , cefepime hydrochloride , cefixime , cefmetazole sodium , cefonicid sodium , cefoperazone sodium , cefotaxime sodium , cefotetan disodium , cefoxitin sodium , cefpodoxime proxetil , cefprozil , ceftazidime , ceftibuten , ceftizoxime sodium , ceftriaxone sodium , ceffiroxime axetil , cefuroxime sodium , cephalexin hydrocllloride , cephalexin monohydrate , cephradine , and loracarbef . the tetracycline can be at least one selected from the group consisting of demeclocycline hydrochloride , doxycycline calcium , doxycycline hyclate , doxycycline hydrochloride , doxycycline monobydrate , minocycline hydrochloride , and tetracycline hydrochloride . sulfonamide can be at least one selected from co - trimoxazole , sulfadiazine , sulfamethoxazole , sulfisoxazole , and sulosoxazole acetyl . fluoroquinolone can be at least one selected from alatrofloxacin mesylate , ciprofloxacin , enoxacin , levofloxacin , lomefloxacin hydrochloride , nalidixic acid , norfloxacin , ofloxacin , sparfloxacin , and trovafloxacin mesylate . the fluoroquinolone can be at least one selected from the group consisting of alatrofloxacin mesylate , ciprofloxacin , enoxacin , levofloxacin , lomefloxacin hydrochloride , nalidixic acid , norfloxacin , ofloxacin , sparfloxacin , and trovafloxacin mesylate . the antiviral active agent can be at least one selected from the group consisting of abacavir sulfate , acyclovir sodium , amantadine hydrochloride , amprenavir , cidofovir , delavirdine mesylate , didanosine , efavirenz , famciclovir , fomivirsen sodium , foscarnet sodium , ganciclovir , indinavir sulfate , lamivudine , lamivodine / zidovodine , nelfinavir mesylate , nevirapine , oseltamivir phosphate , ribavirin , rimantadine hydrochloride , ritonavir , saquinavir , saquinavir mesylate , stavodine , valacyclovir hydrochloride , zalcitabine , zanamivir , and zidovudine . a macroline anti - infective active agent can be at least one selected from the group consisting of azithromycin , clarithromycin , dirithromycin , erythromycin base , erythromycin estolate , erythromycin ethylsuccinate , erythromycin lactobionate , and erythromycin stearate . an antiinfective active agent can also be at least one selected from the group consisting of aztreonam , bacitracin , chloramphenicol sodium sucinate , clindamycin hydrochloride , clindamycin palmitate 30 hydrochloride , clindamycin phosphate , imipenem and cilastatin sodium , meropenem , nitrofurantoin macrocrystals , nitrofurantoin microcrystals , quinupristin / dalfopristin , spectinomycin hydrochloride , trimethoprim , and vancomycin hydrochloride . an inotropic active agent can be at least one selected from the group consisting of amrinone lactate , digoxin , and milrinone lactate . an antiarrhythmic active agent can be at least one selected from the group consisting of adenosine , amiodarone hydrochloride , atropine sulfate , bretylium tosylate , diltiazem hydrochloride , disopyramide , disopyramide phosphate , esmolol hydrochloride , flecainide acetate , ibutilide fumarate , lidocaine hydrochloride , mexiletine hydrochloride , moricizine hydrochloride , phenytoin , phenytoin sodium , procainamide hydrochloride , propafenone hydrochloride , propranolol hydrochloride , quinidine bisulfate , quinidine gluconate , quinidine polygalacturonate , quinidine sulfate , sotalol , tocainide hydrochloride , and verapamil hydrochloride . an antianginal active agent can be at least one selected from the group consisting of amlodipidine besylate , amyl nitrite , bepridil hydrochloride , diltiazem hydrochloride , isosorbide dinitrate , isosorbide mononitrate , nadolol , nicardipine hydrochloride , nifedipine , nitroglycerin , propranolol hydrochloride , verapamil , and verapamil hydrochloride . an antihypertensive active agent can be at least one selected from the group consisting of acebutolol hydrochloride , amlodipine besylate , atenolol , benazepril hydrochloride , betaxolol hydrochloride , bisoprolol fumarate , candesartan cilexetil , captopril , carteolol hydrochloride , carvedilol , clonidine , clonidine hydrochloride , diazoxide , diltiazem hydrochloride , doxazosin mesylate , enalaprilat , enalapril maleate , eprosartan mesylate , felodipine , fenoldopam mesylate , fosinopril sodium , guanabenz acetate , guanadrel sulfate , guanfacine hydrochloride , hydralazine hydrochloride , irbesartan , isradipine , labetalol hydrchloride , lisinopril , losartan potassium , methyldopa , methyldopate hydrochloride , metoprolol succinate , metoprolol tartrate , minoxidil , moexipril hydrochloride , nadolol , nicardipine hydrochloride , nifedipine , nisoldipine , nitroprusside sodium , penbutolol sulfate , perindopril erbumine , phentolamine mesylate , pindolol , prazosin hydrochloride , propranolol hydrochloride , quinapril hydrochloride , ramipril , telmisartan , terazosin hydrochloride , timolol maleate , trandolapril , valsartan , and verapamil hydrochloride . an antilipemic active agent can be at least one selected from the group consisting of atorvastatin calcium , cerivastatin sodium , cholestyramine , colestipol hydrochloride , fenofibrate ( micronized ), fluvastatin sodium , gemfibrozil , lovastatin , niacin , pravastatin sodium , simvastatin . a cardiovascular active agent can be at least one selected from the group consisting of abciximab , alprostadil , arbutamine hydrochloride , cilostazol , clopidogrel bisulfate , dipyridamole , eptifibatide , midodrine hydrochloride , pentoxifylline , ticlopidine hydrochloride , and tirofiban hydrochloride . an antihistamine active agent can be at least one selected from the group consisting of brompheniramine maleate , cetirizine hydrochloride , chlorpheniramine maleate , clemastine fumarate , cyproheptadine hydrochloride , diphenlydramine hydrochloride , fexofenadine hydrochloride , loratadine , promethazine hydrochloride , promethazine theoclate , and triprolidine hydrochloride . a bronchodilator agent can be at least one selected from the group consisting of albuterol , albuterol sulfate , aminophylline , atropine sulfate , ephedrine sulfate , epinephrine , epinephrine bitartrate , epinephrine hydrochloride , ipratropium bromide , isoproterenol , isoproterenol hydrochloride , isoproterenol sulfate , levalbuterol hydrochloride , metaproterenol sulfate , oxtriphylline , pirbuterol acetate , salmeterol xinafoate , terbutaline sulfate , and theophylline . an expectorant or antitussive agent can be at least one selected from the group consisting of benzonatate , codeine phosphate , codeine sulfate , dextramethorphan hydrobromide , diphenhydramine hydrochloride , guaifenesin , and hydromorphone hydrochloride . respiratory active agent may be at least one selected from acetylcysteine , beclomethasone dipropionate , beractant , budesonide , calfactant , cromolyn sodium , dornase alfa , epoprostenol sodium , flunisolide , palivizumab , triamcinolone acetonide , zafirlukast , and zileuton . an antacid , adsorbent , or antiflatulent agent can be at least one selected from the group consisting of aluminum carbonate , aluminum hydroxide , calcium carbonate , magaldrate , magnesium hydroxide , magnesium oxide , simethicone , and sodium bicarbonate . a digestive enzyme or gallstone solubilizer active agent can be at least one selected from the group consisting of pancreatin , pancrelipase , and ursodiol . an antidiarrheal active agent can be at least one selected from the group consisting of attapulgite , bismuth subsalicylate , calcium polycarbophil , diphenoxylate hydrochloride or atropine sulfate , loperamide , octreotide acetate , opium tincture , and opium tincure ( camphorated ). laxative active agents may be at least one selected from bisocodyl , calcium polycarbophil , cascara sagrada , cascara sagrada aromatic fluidextract , cascara sagrada fluidextract , castor oil , docusate calcium , docusate sodium , glycerin , lactulose , magnesium citrate , magnesium hydroxide , magnesium sulfate , methylcellulose , mineral oil , polyethylene glycol or electrolyte solution , psyllium , senna , and sodium phosphates . an antiemetic active agent can be at least one selected from the group consisting of chlorpromazine hydrochloride , dimenhydrinate , dolasetron mesylate , dronabinol , granisetron hydrochloride , meclizine hydrochloride , metocloproamide hydrochloride , ondansetron hydrochloride , perphenazine , prochlorperazine , prochlorperazine edisylate , prochlorperazine maleate , promethazine hydrochloride , scopolamine , thiethylperazine maleate , and trimethobenzamide hydrochloride . an antiulcer active agent can be at least one selected from the group consisting of cimetidine , cimetidine hydrochloride , famotidine , lansoprazole , misoprostol , nizatidine , omeprazole , esomeprazole , rabeprozole sodium , rantidine bismuth citrate , ranitidine hydrochloride , and sucralfate . a coricosteroid active agent can be at least one selected from the group consisting of betamethasone , betamethasone acetate or betamethasone sodium phosphate , betamethasone sodium phosphate , cortisone acetate , dexamethasone , dexamethasone acetate , dexamethasone sodium phosphate , fludrocortisone acetate , hydrocortisone , hydrocortisone acetate , hydrocortisone cypionate , hydrocortisone sodium phosphate , hydrocortisone sodium succinate , methylprednisolone , methylprednisolone acetate , methylprednisolone sodium succinate , prednisolone , prednisolone acetate , prednisolone sodium phosphate , prednisolone tebutate , prednisone , triamcinolone , triamcinolone acetonide , and triamcinolone diacetate . an androgen or anabolic steroid can be at least one selected from the group consisting of danazol , fluoxymesterone , methyltestosterone , nandrolone decanoate , nandrolone phenpropionate , testosterone , testosterone cypionate , testosterone enanthate , testosterone propionate , and testosterone transdermal system . an estrogen or progestin agent can be at least one selected from the group consisting of esterified estrogens , estradiol , estradiol cypionate , estradiol / norethindrone acetate transdermal system , estradiol valerate , estrogens ( conjugated ), estropipate , ethinyl estradiol , ethinyl estradiol and desogestrel , ethinyl estradiol and ethynodiol diacetate , ethinyl estradiol and desogestrel , ethinyl estradiol and ethynodiol diacetate , ethinyl estradiol and levonorgestrel , ethinyl estradiol and norethindrone , ethinyl estradiol and norethindrone acetate , ethinyl estradiol and norgestimate , ethinyl estradiol and norgestrel , ethinyl estradiol and norethindrone and acetate and ferrous fumarate , levonorgestrel , medroxyprogesterone acetate , mestranol and norethindron , norethindrone , norethindrone acetate , norgestrel , and progesterone . a gonadroptropin agent can be at least one selected from the group consisting of ganirelix acetate , gonadoreline acetate , histrelin acetate , and menotropins . an antidiabetic active agent can be at least one selected from the group consisting of acarbose , chlorpropamide , glimepiride , glipizide , glucagon , glyburide , insulins , metformin hydrochloride , miglitol , pioglitazone hydrochloride , repaglinide , rosiglitazone maleate , and troglitazone . a thyroid hormone active agent can be at least one selected from the group consisting of levothyroxine sodium , liothyronine sodium , liotrix , and thyroid . a thyroid hormone antagonist active agent can be at least one selected from the group consisting of methimazole , potassium iodide , potassium iodide ( saturated solution ), propylthiouracil , radioactive iodine ( sodium iodide ), and strong iodine solution . a pituitary hormone active agent can be at least one selected from the group consisting of corticotropin , cosyntropin , desmophressin acetate , leuprolide acetate , repository corticotropin , somatrem , somatropin , and vasopressin . a parathyroid - like active agent can be at least one selected from the group consisting of calcifediol , calcitonin ( human ), calcitonin ( salmon ), calcitriol , dihydrotachysterol , and etidronate disodium . a diuretic agent can be at least one selected from the group consisting of acetazolamide , acetazolamide sodium , amiloride hydrochloride , bumetanide , chlorthalidone , ethacrynate sodium , ethacrynic acid , furosemide , hydrochlorothiazide , indapamide , mannitol , metolazone , spironolactone , torsemide , triamterene , and urea . an electrolyte or replacement solution active agent can be at least one selected from the group consisting of calcium acetate , calcium carbonate , calcium chloride , calcium citrate , calcium glubionate , calcium gluceptate , calcium gluconate , calcium lactate , calcium phosphate ( dibasic ), calcium phosphate ( tribasic ), dextran ( high - molecular - weight ), dextran ( lowmolecular - weight ), hetastarch , magnesium chloride , magnesium sulfate , potassium acetate , potassium bicarbonate , potassium chloride , potassium gluconate , ringer &# 39 ; s injection , ringer &# 39 ; s injection ( lactated ), and sodium chloride . a hematinic active agent can be at least one selected from the group consisting of ferrous fumarate , ferrous gluconate , ferrous sulfate , ferrous sulfate ( dried ), iron dextran , iron sorbitol , polysaccharide iron complex , sodium ferric gluconate complex . an anticoagulant active agent can be at least one selected from the group consisting of ardeparin sodium , dalteparin sodium , danaparoid sodium , 15 enoxaparin sodium , heparin calcium , heparin sodium , and warfarin sodium . a blood derivative agent can be at least one selected from the group consisting of albumin 5 %, albumin 25 %, antihemophilic factor , anti inhibitor coagulant complex , antithrombin m ( human ), factor ix ( human ), factor ix complex , and plasma protein fractions . a thrombolytic enzyme active agent can be selected from the group consisting of alteplase , anistreplase , reteplase ( recombinant ), streptokinase , urokinase . an alkylating active agent can be at least one selected from the group consisting of busulfan , carboplatin , carmustine , chlorambucil , cisplatin , cyclophosphamide , ifosfamide , lomustine , mechl oreth amine hydrochloride , melphalan , melphal an hydrochloride , streptozocin , temozolomide , thiotepa . an antimetabolite agent can be selected from the group consisting of capecitabine , cladribine , cytarabine , floxuridine , fludarabine phosphate , fluorouracil , hydroxyurea , mercaptopurine , methotrexate , methotrexate sodium , thioguanine . an antibiotic antineoplastic agent can be selected from the group consisting of bleomycin sulfate , dactinomycin , daunorubicin citrate liposomal , daunorubicin hydrochloride , doxorubicin hydrochloride , doxorubicin hydrochloride liposomal , epirubicin hydrochloride , idaubicin hydrochloride , mitomycin , pentostatin , plicamycin , and valrubicin . an antineoplastic agent can be selected from the group consisting of anastrozole , bicalutamide , estramustine phosphate sodium , exemestane , flutamide , goserelin acetate , letrozole , leuprolide acetate , megestrol acetate , nilutamide , tamoxifen citrate , testolactone , toremifene citrate , asparaginase , bacillus calmette - guerin ( bcg ), dacarbazine , docetaxel , etoposide , etoposide phosphate , gemcitabine hydrochloride , irinotecan hydrochloride , mitotane , mitoxantrone hydrochloride , paclitaxel , pegaspargase , porfimer sodium , procarbazine hydrochloride , rituximab , teniposide , topotecan hydrochloride , trastuzumab , tretinoin , vinblastine sulfate , vincristine sulfate , and vinorelbine tartrate . an immunosuppressant active agent can be at least one selected from the group consisting of azathioprine , basiliximab , cyclosporine , daclizumab , lymphocyte immune globulin , muromonab - cd3 , mycophenolate mofetil , mycophenolate mofetil hydrochloride , sirolimus , inflixamab , rituximab , entanerecept , certalizumab , adalimumab , tocilizumab , golimumab and tacrolimus . a vaccine or toxoid active agent can be at least one selected from the group consisting of bcg vaccine , cholera vaccine , diphtheria and tetanus toxoids ( adsorbed ), diphtheria and tetanus toxoids and acellular pertussis vaccine adsorbed , diphtheria and tetanus toxoids and whole - cell pertussis vaccine , haemophilius b conjugate vaccines , hepatitis a vaccine ( inactivated ), hepatisis b vaccine ( recombinant ), influenza virus vaccine 1999 - 2000 trivalent types a & amp ; b ( purified surface antigen ), influenza virus vaccine 1999 - 2000 trivalent types a & amp ; b ( subvirion or purified subvirion ), influenza virus vaccine 1999 - 2000 trivalent types a & amp ; b ( whole virion ), japanese encephalitis virus vaccine ( inactivated ), influenza h1n1 vaccine , lyme disease vaccine ( recombinant ospa ), measles and mumps and rubella virus vaccine ( live ), measles and mumps and rubella virus vaccine ( live attenuated ), measles virus vaccine ( live attenuated ), meningococcal polysaccharide vaccine , mumps virus vaccine ( live ), plague vaccine , pneumococcal vaccine ( polyvalent ), poliovirus vaccine ( inactivated ), poliovirus vaccine ( live , oral , trivalent ), rabies vaccine ( adsorbed ), rabies vaccine ( human diploid cell ), rubella and mumps virus vaccine ( live ), rubella virus vaccine ( live , attenuated ), tetanus toxoid ( adsorbed ), tetanus toxoid ( fluid ), typhoid vaccine ( oral ), typhoid vaccine ( parenteral ), typhoid vi polysaccharide vaccine , varicella virus vaccine , and yellow fever vaccine . an antitoxin or antivenin ( or antivenom ) active agent can be at least one selected from the group consisting of black widow spider antivenin , crotalidae antivenom ( polyvalent ), diphtheria antitoxin ( equine ), and micrurus fulvius antivenin ). an immune serum active agent can be at least one selected from the group consisting of cytomegalovirus immune globulin , hepatitis b immune globulin ( human ), immune globulin intramuscular , immune globulin intravenous , rabies immune globulin ( human ), respiratory syncytial virus immune globulin intravenous ( human ), rho ( d ) immune globulin ( human ), rho ( d ) immune globulin intravenous ( human ), tetanus immune globulin ( human ), and varicella - zoster immune globulin . biological response modifiers can be at least one selected from aldesleukin , erythropoetin alfa , filgrastim , glatiramer acetate for injection , interferon alfacon - 1 , interferon alfa - 2a ( recombinant ), interferon alfa - 2b ( recombinant ), interferon beta - 1a , interferon beta - 1b ( recombinant ), interferon gamma - 1b , levamisole hydrochloride , oprelvekin , and sargramostim . an ophthalmic anti - infective agent can be selected form the group consisting of bacitracin , chloramphenicol , ciprofloxacin hydrochloride , erythromycin , gentamicin sulfate , ofloxacin 0 . 3 %, polymyxin b sulfate , sulfacetamide sodium 10 %, sulfacetamide sodium 15 %, sulfacetamide sodium 30 %, tobramycin , vidarabine . ophthalmic anti - inflammatory active agents may be at least one selected from dexamethasone , 5 dexamethasone sodium phosphate , diclofenac sodium 0 . 1 %, fluorometholone , flurbiprofen sodium , ketorolac tromethamine , prednisolone acetate , and prednisolone sodium phosphate . a miotic agent can be at least one selected from the group consisting of acetylocholine chloride , carbachol ( intraocular ), carbachol ( topical ), echothiophate iodide , pilocarpine , pilocarpine hydrochloride , and pilocarpine nitrate . mydriatic active agents may be at least one selected from atropine sulfate , cyclopentolate hydrochloride , epinephrine hydrochloride , epinephryl borate , homatropine hydrobromide , phenylephrine hydrochloride , scopolamine hydrobromide , and tropicamide . ophthalmic vasoconstrictors may be at least one selected from naphazoline hydrochloride , oxymetazoline hydrochloride , and tetrahydrozoline hydrochloride . an ophthalmic agent can be at least one selected from the group consisting of apraclonidine hydrochloride , betaxolol hydrochloride , brimonidine tartrate , carteolol hydrochloride , dipivefrin hydrochloride , dorzolamide hydrochloride , emedastine difumarate , fluorescein sodium , ketotifen fumarate , latanoprost , levobunolol hydrochloride , metipranolol hydrochloride , sodium chloride ( hypertonic ), and timolol maleate . an otic ( ear ) active agent can be at least one selected from the group consisting of boric acid , carbamide peroxide , chloramphenicol , and triethanolamine polypeptide oleate - condensate . a nasal active agent can be at least one selected from the group consisting of beclomethasone dipropionate , budesonide , ephedrine sulfate , epinephrine hydrochloride , flunisolide , fluticasone propionate , naphazoline hydrochloride , oxymetazoline hydrochloride , phenylephrine hydrochloride , tetrabydrozoline hydrochloride , triamcinolone acetonide , and xylometazoline hydrochloride . an anti - infective agent can also be at least one selected from the group consisting of acyclovir , amphotericin b ., azelaic acid cream , bacitracin , butoconazole nitrate , clindamycin phosphate , clotrimazole , econazole nitrate , erythromycin , gentamicin sulfate , ketoconazole , mafenide acetate , metronidazole ( topical ), miconazole nitrate , mupirocin , naftifine hydrochloride , neomycin sulfate , nitrofurazone , nystatin , silver sulfadiazine , terbinafine hydrochloride , terconazole , tetracycline hydrochloride , tioconazole , and tolnaftate . scabicide or pediculicide active agents may be at least one selected from crotamiton , lindane , permethrin , and pyrethrins . a corticosteroid in all forms ( iv , oral , sq , im , topical , suppository , intranasal , intraocular , tympanic , transdermal ) may be at least one selected from the group consisting of betamethasone dipropionate , betamethasone valerate , clobetasol propionate , desonide , desoximetasone , diacetate , fluocinolone acetonide , fluocinonide , flurandrenolide , fluticasone propionate , halcionide , hydrocortisone , hydrocortisone acetate , hydrocortisone butyrate , hydrocorisone valerate , mometasone furoate , and triamcinolone acetonide . additional active agents , or classes of active agents , include tumor necrosis factor ( tnf ) antagonists ( e . g ., a tnf chemical or protein antagonist ), tnf monoclonal or polyclonal antibody or fragment , a soluble tnf receptor ( e . g ., p55 , p70 or p85 ) or fragment , fusion polypeptides thereof , or a small molecule tnf antagonist ( e . g ., tnf binding protein i or ii ( tbp - 1 or tbp - ii )), nerelimonmab , infliximab , enteracept , cdp - 571 , 2 5 cdp - 870 , afelimomab , lenercept , and the like ), bremelanotide , banana spider venom ( peptide k ), various vitamins and minerals , etc . active agents can further include an antirheumatic ( e . g ., methotrexate , auranofin , aurothioglucose , azathioprine , etanercept , gold sodium thiomalate , hydroxychloroquine sulfate , leflunomide , sulfasalzine ), a muscle relaxant , a narcotic , a non - steroid anti - inflammatory drug ( nsaid ), an analgesic , an anesthetic , a sedative , a local anesthetic , a neuromuscular blocker , an antimicrobial ( e . g ., aminoglycoside , an antifungal , an antiparasitic , an antiviral , a carbapenem , cephalosporin , a flurorquinolone , a macrolide , a penicillin , a sulfonamide , a tetracycline , another antimicrobial ), an antipsoriatic , a corticosteriod , an anabolic steroid , a diabetes related agent , a mineral , a nutritional , a thyroid agent , a vitamin , a calcium related hormone , an antidiarrheal , an antitussive , an antiemetic , an antiulcer , a laxative , an anticoagulant , an erythropieitin ( e . g ., epoetin alpha ), a filgrastim ( e . g ., g - csf , neupogen ), a sargramostim ( gm 3 5 csf , leukine ), an immunization , an immunoglobulin , an immunosuppressive ( e . g ., basiliximab , cyclosporine , daclizumab ), a growth hormone , a hormone replacement drug , an estrogen receptor modulator , a mydriatic , a cycloplegic , an alkylating agent , an antimetabolite , a mitotic inhibitor , a radiopharmaceutical , an antidepressant , antimanic agent , an antipsychotic , an anxiolytic , a hypnotic , a sympathomimetic , a stimulant , donepezil , tacrrne , an asthma medication , a beta agonist , an inhaled steroid , a leukotriene inhibitor , a methylxanthine , a cromolyn , an epinephrine or analog , dornase alpha , a cytokine or a cytokine antagonist . non - limiting examples of such cytokines include , but are not limited to , any of the interleukins , including il - 1 to il - 23 . active ingredients for over - the - counter cosmetic purposes can include gras compounds including , but not limited to , caffeine , deionized water , simmondsia , chinensis seed oil , acetyl hexpeptide - 8 , hydroxyethyl acrylate , sodium acryloyldimethyltaurate copolymer , squalane , polysorbate 60 , ubiquinone , cyclomethicone , dimethiconol , ethylhexyl cocoate , glycine soja oil , retinol , lecithin , glycolipids , camellia sinensis leaf extract , glycerin , dipeptide diaminobutyroyl benzylamide diacetate , sodium hyaluronate , phenoxyethanol , caprylyl glycol , potassium sorbate , aqua , hexylene glycol , caprylic / capric triglyceride , triethanolamine , rosa canina extract , malus domestica fruit cell culture , xanthan gum , panax ginseng extract , scorbic acid , punica granatum extract , melaleuca alternifolia leaf oil , frangrance , polymethylsilsesquinoxane , cyclopentasiloxane , dimethicone , polysilicone - 11 , butylene glycol , decyl glucoside , macadamia ternifolia seed oil , macelignan , tocopherol , acetyl hexapeptide - 8 , hydroxyethyl acrylate , sodium acryloyldimethyltaurate copolymer , squalane , polysorbate 60 , sodium hyaluronate , silica , phenoxyethanol , caprylyl glycol , potassium sorbate , hexylene glycol , seaweed extract , plankton extract , sea buckhorn extract , watercress extract , marine algae , hyaluronic acid , phenoxyethanol , caprylyl glycol , potassium sorbate , hexylene glycol , hyaluronic acid , algae extract , pseudoalteromonas ferment extract , hydrolyzed wheat protein , hydrolyzed soy protein , tripeptide - 10 cirulline , tripeptide - 1 , lecihin , xanthan gum , carbomer , triehanolamine , malus domestica acetyl hexapeptide - 8 , pullulan , henoxyethanol , caprylyl glycol , potassium sorbate , hexylene glycol , tranilast , bromelain , rhamnose , cats claw , eucommia boswellic acid , resveratrol , lipoic acid , and butchers broom rhizome . active ingredients for medical cosmetic purposes , including inert fillers , can include hyaluronic acid , silicone and collagen , lidocaine , saline , botulism toxin , calcium hydroxylapatite , poly - l - lactic acid (“ pplla ”), polymethylmethacrylate beads (“ pmma microspheres ), calcium sulfate and caffeine . the amount of active agent can range from about 0 . 01 mg to about 1000 mg . specific active agent dosages within a single formulation can include , but are not limited to about 0 . 01 , 0 . 02 , 0 . 05 , 0 . 1 , 0 . 5 , 1 , 2 , 5 , 10 , 25 , 30 , 50 , 75 , 100 , 125 , 150 , 175 , 200 , 225 , 250 , 275 , 300 , 325 , 350 , 375 , 400 , 425 , 450 , 475 , 500 , 525 , 550 , 575 , 600 , 625 , 650 , 675 , 700 , 725 , 750 , 775 , 800 , 825 , 850 , 875 , 900 , 925 , 950 , 975 , and about 1000 mg . the active agent may comprise , but is not limited to , about 0 . 01 to 95 % of the total composition weight of the delivery fluid volume , such as about 0 . 01 , 0 . 02 , 0 . 05 , 0 . 1 , 0 . 5 , 1 , 2 , 5 , 10 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 or about 95 % of the total composition by weight . the formulations of active ingredients delivered by the delivery system described herein may be in any suitable shape , size or form . advantageously , the formulations described herein can be designed such that they provide immediate release of the treating agent . “ immediate release ” refers to the release of the active agent at the time of administration . thus , the release of the active agent may occur at the moment of contact with the patient . alternatively , the formulations of the active ingredients described herein can be designed to delay the release of the active agent as would be understood by one skilled in the art . such sustained and / or timed release formulations may be made by sustained release means of delivery devices that are well known to those of ordinary skill in the art . these active ingredient compositions can be used to provide slow or sustained release of one or more of the active compounds using , for example , hydroxypropylmethyl cellulose , other polymer matrices , gels , permeable membranes , osmotic systems , multilayer coatings , microparticles , liposomes , microspheres , or the like . suitable sustained release formulations known to those skilled in the art , including those described herein , may be readily selected for use with the active ingredient compositions delivered by the invention . thus , the release of the active agent may occur after a period of time from the moment of contact with the patient . additionally formulations may include a combination of delayed release and immediate release . as used herein , the term “ non - invasive ” is intended to describe a proprietary vehicle as delivering an active agent from an external site ( i . e ., mucocutaneous ) to an internal site without disruption , or at only a nanoscale of disruption of the membrane interface . in one aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly . in another aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly , wherein the system includes at least one composition that includes at least one of the following : a sterile fluid with or without a therapeutic agent . in another aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly , wherein the system includes at least a salty fluid that is ionizable or ionized . in another aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly , wherein the system includes at least a amino acid , protein , sugar , a detergent , or a combination thereof . in another aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly , wherein the system includes at least a ph buffered fluid . in another aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly , wherein at least one component is a micro - syringe assembly and includes a reservoir and / or a continuous fluid input system . in another aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly , wherein the system is in the form of a tablet , a reusable device , a patch , gel , cream or lotion . in another aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly , wherein the system can be administered , topically to the skin or through a mucosal membrane . in another aspect of the present invention , there is provided a painless , non - invasive delivery system for delivering a therapeutic agent across an epithelial membrane , the system comprising : ( a ) an effective amount of a therapeutic agent ; and ( b ) at least one vehicle for facilitating delivery of the agent across the epithelial membrane , the vehicle being selected from the following : ( i ) a sterile fluid , such as normal saline ; and ( ii ) the use of carbon nanotube ring structures in a delivery system , either free - standing or in an array formation affixed to or embedded in a substrate assembly including scaffolding , and possibly hollow ; and ( iii ) nanosyringes ( microsyringes ) of appropriate lengths arranged in either an array formation or free - standing , affixed to or embedded in a substrate assembly , wherein the system further comprises a patch - like design with an adhesive component to stabilize the micro - syringes during penetration of the skin or mucosal membrane . in another aspect of the present invention , there is provided a method of treating a disease or condition in a mammal , the method comprising : administering a non - invasive delivery system that comprises an effective amount of an agent being delivered across an epithelial membrane via a micro - syringe - based assembly . in another aspect of the present invention , there are provided novel methods and apparatus for delivering an active agent to a patient , the methods and apparatus comprising the use of : ( a ) an effective amount of an agent ; and ( b ) at least one vehicle for facilitating delivery of the active ingredient across the epithelial membrane , the vehicle being selected from the following : ( i ) a carbon nanotube - based micro - syringe assembly ; and ( ii ) a sterile fluid incorporated during or after the manufacture of the painless , non - invasive delivery system for delivering an agent into a patient by penetration through an epithelial membrane . in another aspect of the present invention , there are provided novel methods and apparatus for delivering an active agent to a patient , the methods and apparatus comprising the use of : ( a ) an effective amount of an agent ; and ( b ) at least one vehicle for facilitating delivery of the active ingredient across the epithelial membrane , the vehicle being selected from the following : ( i ) a carbon nanotube - based micro - syringe assembly ; and ( ii ) a sterile fluid incorporated during or after the manufacture of the painless , non - invasive delivery system for delivering an agent into a patient by penetration through an epithelial membrane , wherein the delivery system is for use in treating a condition that requires immediate , sustained or delayed release of the active agent . in another aspect of the present invention , there are provided novel methods and apparatus for delivering an active agent to a patient , the methods and apparatus comprising the use of : ( a ) an effective amount of an agent ; and ( b ) at least one vehicle for facilitating delivery of the active ingredient across the epithelial membrane , the vehicle being selected from the following : ( i ) a carbon nanotube - based micro - syringe assembly ; and ( ii ) a sterile fluid incorporated during or after the manufacture of the painless , non - invasive delivery system for delivering an agent into a patient by penetration through an epithelial membrane , wherein the delivery system is for use in treating a condition that requires immediate , sustained or delayed release of the active agent , and further wherein the delivery system is for use in treating anaphylactic shock , diabetes ( both high and low blood sugars ), ischemic heart disease or trauma . in another aspect of the present invention , there is provided a painless , non - invasive delivery system that comprises an effective amount of an agent and at least one enabler so as to facilitate absorption of the agent into the epithelial membrane , the delivery system being for use in treating a condition that requires immediate , sustained or delayed release of said active agent . in another aspect of the present invention , there is provided a painless , non - invasive delivery system that comprises an effective amount of an agent and at least one enabler so as to facilitate absorption of the agent into the epithelial membrane , the delivery system being for use in treating a condition that requires immediate , sustained or delayed release of said active agent , wherein the condition to be treated is selected from anaphylactic shock and diabetes . in another aspect of the present invention , there is provided a non - invasive delivery vehicle for use in filtration through the gradation of cnt lumen diameter either in an increasing , decreasing or variable pattern . it should be understood that many additional changes in the details , materials , steps and arrangements of parts , which have been herein described and illustrated in order to explain the nature of the present invention , may be made by those skilled in the art while still remaining within the principles and scope of the invention . | 0 |
referring to the drawing figures , fig1 illustrates a first exemplary embodiment of a virtually coherent signal controlled laser oscillator 10 in accordance with the principles of the present invention . the virtually coherent signal controlled laser oscillator 10 comprises a signal controlled laser oscillator 11 that receives a fixed bias input signal . the output of the signal controlled laser oscillator 11 is coupled to a single sideband mixer 12 . a signal controlled microwave oscillator 13 having a frequency control input signal outputs a microwave frequency , f m that is input to the single sideband mixer 12 . the output of the single sideband mixer 12 is a single controlled optical frequency signal . if a carrier frequency to which the signal controlled laser oscillator 11 is to be phase locked is defined as f o , the signal controlled laser oscillator 11 is tuned to a frequency offset from f o by the microwave frequency , f m generated by the signal controlled microwave oscillator 13 . the single sideband mixer 12 combines the outputs of the signal controlled microwave oscillator 13 and signal controlled laser oscillator 11 and generates a controlled output signal at f o . since the signal controlled laser oscillator 11 is not subject to active control of its frequency within the phase locked control loop , its dynamic response does not prevent phase lock to the signal input to the phase locked loop . care must be taken in the selection of fm since several criteria must be met : where optical filtering is used to suppress the signal controlled laser oscillator output frequency from the single sideband mixer 12 , the offset frequency from the desired f o must be large enough so that the signal controlled laser oscillator output signal at the single sideband mixer 12 is suppressed to the required degree . further , the signal displaced by 2xf m from f o must also be suppressed . moreover , the tunability of the signal controlled microwave oscillator 13 must be large enough to compensate all of the optical frequency uncertainties in the transmission system so that the virtually coherent signal controlled laser oscillator 10 functions as required . this includes uncertainties associated with the laser oscillator 11 as well as the signal controlled microwave oscillator 13 . the single sideband mixing function provided by the single sideband mixer 12 shown in fig1 may also be implemented by means of an optical single sideband mixer 12 a having an exemplary configuration as shown in fig2 . more particularly , fig2 illustrates an exemplary embodiment of a virtually coherent signal controlled laser oscillator 10 a employing the optical single sideband mixer 12 a . the exemplary embodiment of a virtually coherent signal controlled laser oscillator 10 a comprises a signal controlled laser oscillator 11 that receives a fixed bias input signal , and a signal controlled microwave oscillator 13 having a frequency control input signal . the signal controlled laser oscillator 11 outputs an optical frequency , f 0 . the signal controlled microwave oscillator 13 outputs a microwave frequency , f 0 + f m . outputs of the signal controlled laser oscillator 11 and signal controlled microwave oscillator 13 are input to the optical single sideband mixer 12 a . the radio frequency single sideband mixer 12 a comprises a zero ( 0 ) degree power splitter 14 , a ninety ( 90 ) degree hybrid coupler 15 , two optical modulators 16 a , 16 b , and an output ninety ( 90 ) degree hybrid coupler 17 . the zero ( 0 ) degree power splitter 14 receives the output from the signal controlled laser oscillator 11 , and the ninety ( 90 ) degree hybrid coupler 15 receives the output from the signal controlled microwave oscillator 13 . respective first outputs of the zero ( 0 ) degree power splitter 14 and ninety ( 90 ) degree hybrid coupler 15 are input to first inputs of two optical modulators 16 a , 16 b . respective second outputs of the zero ( 0 ) degree power splitter 14 and ninety ( 90 ) degree hybrid coupler 15 are input to second inputs of the two optical modulators 16 a , 16 b . respective outputs of the two optical modulators 16 a , 16 b are coupled to inputs of the output ninety ( 90 ) degree hybrid coupler 17 . the output ninety ( 90 ) degree hybrid coupler 17 outputs upper sideband and lower sideband output signals . the upper sideband output signal is at frequency f 0 + 2xf m and the lower sideband output signal is at frequency f 0 . the hybrid optical - microwave single sideband mixer 11 a illustrated in fig2 is new art in the context of the present invention along with that of the virtually coherent signal controlled laser oscillator 10 . either desired sideband may be derived from this mixer 11 a by selection of the appropriate signal phasing at the optical mixer inputs or outputs . thus , improved virtually coherent signal controlled laser oscillators have been disclosed . it is to be understood that the above - described embodiments are merely illustrative of some of the many specific embodiments that represent applications of the principles of the present invention . clearly , numerous and other arrangements can be readily devised by those skilled in the art without departing from the scope of the invention . | 7 |
the figure shows a schematic representation of the architecture of a series of components that form a device with a failsafe configuration . applied to a carrier substrate ( 1 ), which may be glass , suitable types of film or a similar material , are several layers ( 2 - 4 ). the bottom layer is the anode layer ( 2 ) and consists of a conductive layer , e . g . an indium tin oxide layer ( ito ). deposited on the anode are one or multiple layers of an organic material ( 3 ). they constitute the actual illuminating layer , which emits light . deposited onto this layer is cathode material ( 4 ). up to this point , the configuration reflects the configuration of an oled lighting component 11 . in many applications , the structures are configured to create a large serial chain of oled lighting components . a conventional oled chain has the disadvantage that the failure of one of these lighting components leaves the entire chain without power and therefore unable to function . a break - through layer ( 5 ) is deposited onto the layer of cathode material ( 4 ). deposited on top of the break - through layer ( 5 ) is a conductive layer ( 6 ) designed to bypass a failed component . the break - through layer ( 5 ) can be electrically insulating and may include an oxide layer . in some embodiments , the break - through layer ( 5 ) and conductive layer ( 6 ) are applied together such that the break - through layer ( 5 ) spans a full length of the conductive layer ( 6 ). in some embodiments the break - through layer ( 5 ) is only between the conductive layer ( 6 ) and the light device below the conductive layer ( 6 ) and does not extend between the two adjacent light devices . in some embodiments , a break - through layer ( 5 ) is only beneath one end of the conductive layer ( 6 ). when an oled lighting component ( 11 ) fails , the electric circuit is open and the voltage level between the cathode of the failed oled lighting component and the cathode of the neighboring oled lighting component is in all cases greater than the sum total of the forward voltages of all oled lighting components in the chain . this means that this voltage is also present between the respective cathode layers and the conductive bypass layer , i . e ., at the break - through layer . the break - through layer , unable to insulate such a high voltage , breaks down and conductively connects two adjacent cathode layers . as a result , the defective oled lighting component is bypassed and the electric circuit is closed again , allowing the remaining oled lighting components to operate normally . the layer is preferably so thin that it will reliably break at multiples of the oled forward voltage level . when an oled fails and interrupts the electric circuit , the voltage of the entire chain is applied to this oled . this voltage is roughly the forward voltage of the oleds multiplied by their number . in some embodiments , such a chain is comprised of a number of oleds in the high one - digit range , thus this voltage is a multiple of the oled forward voltage and the defective diode can be reliably bypassed . at the same time , the layer should preferably be thick enough to reliably withstand at least the regular or twice the regular forward voltage of the series . this prevents the unwanted effect of a break - through in the event of brief voltage spikes or fluctuations , which may cause a still functioning oled component to be bypassed and switched off . a chain of led lighting components can be treated in a similar manner . due to the fact that led lighting components are often built in the form of single chips and the anode at the top has a bonded wire , a cathode - to - cathode bypass is conceivable . also possible for use is a wire equipped with a break - through layer — an oxide layer , for example — wrapped around the contact legs of a wired led . in the case of smd light - emitting diodes , the bypass could be installed on the underside between the contact plates . in some embodiments , instead of the bypass being adjacent to the cathode , the bypass can be adjacent to anodes of adjacent components . this configuration may be used , such as when the cathodes of the devices are closer to the substrate than the anodes . | 7 |
referring now to fig1 , an electrolytic cell 10 in accordance with the present invention is there shown generally at numeral 10 . this cell 10 includes a non - conductive cylindrical housing shown generally at numeral 12 and open at each end thereof . this housing 12 is formed of vitreous lab - quality glass having a wall thickness of 2 mm , an outside diameter of 11 mm , and a length of 3 cm , producing a chamber volume of 7 . 63 cm 3 . conductive ( preferably brass ) end members 14 and 16 are fitted into each end of the housing 12 and are sealably engaged against the inside diameter of the tubular housing 12 by elastomeric o - rings 54 . end plates 18 and 20 are positioned against the outer ends of each of the end members 14 and 16 , respectively , and are held substantially parallel one to another and spaced apart by elongated threaded fasteners 22 which are spaced apart in a triangular or rectangular pattern as desired . conductive brass adaptors 36 and 38 are fitted into threaded engagement with mating apertures in each end of each end member 14 and 16 , respectively . these adaptors 36 and 38 have a longitudinally extending aperture therethrough into which conductive tubular extensions 44 and 46 are sealably engaged and longitudinally extending therefrom as shown in fig1 . each of the end members 14 and 16 further include a longitudinally extending passageway 26 and 28 , respectively , which are each in fluid communication with the extension tubes 44 and 46 , respectively . a closely packed admixture of gamma ray emitting powder or particles 34 is positioned between the proximal end faces of each of the end members 14 and 16 . details of the composition of these catalytic particles 34 and the method of compressing them are discussed herebelow . a d . c . or a . c . voltage source is applied during operation of the cell 10 between each of the conductive tubular extensions 44 and 46 . the chamber which contains the catalytic particles 34 may be completely closed to atmosphere by valves 48 and 50 during calibration and operation of the cell 10 or may be opened to introduce the hydrogen or deuterium gas during charging of the cell 10 10 . the charging process will be described more fully herebelow . a thermocouple 56 is placed directly against the outer surface of the non - conductive housing 12 and in close proximity to the center of the catalytic particles 34 . a temperature read out 58 is provided which will read the surface temperature of the housing 12 . a layer of insulation 60 , although now not preferred , is wrapped around the housing 12 and the exposed outer surfaces of each of the end members 14 and 16 up to each of the end plates 18 and 20 as shown . this insulation 60 is held in place by at least one wrap of non - conductive tape 62 such as duct tape and is provided for more accurate and consistent temperature readings . this mechanism and the catalytic particles 34 are formed as an admixture of nano - palladium black and zirconium oxide , with a solution of radium nitrate added to this admixture , and then dried . this now radioactive particle mixture 34 is placed into the chamber of the electrolytic cell 10 and a gamma ratemeter g probe 64 placed in close proximity , with the distance of the probe 64 window and it &# 39 ; s geometrical relationship to the cell 10 remaining unchanged at approximately 1 cm from the side of the cell 10 throughout the experiment . radium - 226 is the decay daughter of thorium - 230 , and the fifth daughter of uranium - 238 . by means of alpha particle and gamma emission , ra - 226 decays to radon - 222 and has a half - life of 1600 years ( about 1 % of the ra - 226 is transmuted to radon - 222 in 25 years ), with the final decay product being lead - 206 ( stable ) after seven more decay steps . an excellent diagram of u - 238 decay series from argonne national laboratory is reproduced in fig2 . starting at radium - 226 , about halfway down the diagram , the following decay series is shown : radium - 226 radon - 222 polonium - 218 lead - 214 bismuth - 214 polonium - 214 lead - 210 bismuth - 210 polonium - 210 lead - 206 ( stable ) an extremely fine palladium black was prepared by dissolving 20 grams of palladium chloride in 200 mls of distilled water ( acidified to ˜ ph 2 with hcl ). approximately 50 grams of zinc metal shavings were added to the beaker , and then allowed to stand for a one week . the reduced pd black powder ( formed around the zinc ) was vigorously stirred into the solution and then poured into another beaker , leaving the un - reacted zinc behind . the pd black solution was then allowed to settle , the supernatant siphoned off , and replaced with 200 mls distilled water and allowed to settle again . this process was repeated ten ( 10 ) times in order to rid the solution of zinc ions , avoiding filtration . the reason for not filtering the pd black out of the solution using paper was to avoid losing the finer particles through the paper . after the final siphoning , the wet pd black was transferred to an evaporating dish , and dried in a vacuum over calcium chloride . the resulting pd black produced in this manner is extremely fine , and is called nano - pd . after drying , the 2 . 5 grams of the nano - pd was thoroughly mixed with 5 . 5 grams of zirconium oxide powder ( zno ). an aliquot of radium nitrate solution was then combined with the powder mixture , which was then dried at 70c , then re - ground in a mortar . the powder described above was prepared on 19 jul ., 2007 , and then stored in a capped plastic tube , about ten times its volume . approximately 2 . 63 gm of one of the above - described radioactive powder 34 was loaded into the chamber formed between the proximate opposing faces 30 and 32 of each of the conductive end members 14 and 16 within the cylindrical housing 12 . the particles 34 were placed within the chamber in several stages or layers totaling more than one and preferably five to ten layers . a small quantity ( approximately ⅕ of the total of the catalytic particles ) was placed into the chamber with the cylindrical housing 12 in an upright orientation and only one of the end members 14 or 16 in place . the particles 34 were tamped with a 1 kg load for approximately 2 - 5 minutes after each layer of the conductive particles were placed within the chamber . the total length of the chamber was approximately 10 mm . after both end members 14 and 16 were in position and the end plates 18 and 20 held as shown in fig1 , slight tightening of the elongated threaded fasteners 22 at 24 was effected . this further compressed the conductive particles 34 and secured the end members 14 and 16 in proper positioning within the housing 12 . a resistance of in the range of 10 - 150 ohms was targeted . to insure a sealed chamber , approximately 100 p . s . i . of either hydrogen ( h 2 ) or deuterium ( d 2 ) gas was introduced into one of the tubular extensions 46 through valve 50 as shown by the arrow , while the other valve 48 was closed . the pressurized hydrogen or deuterium gas within the chamber was allowed to sit in the pressurized condition for approximately twenty - four hours . the gamma ratemeter probe placed 1 . 0 cm from the outer glass wall of the cell 10 . since alpha and beta radiation cannot penetrate the glass , any radiation registered was due to gamma . the basic idea of the experiment was to let the powder sit in the cell 10 , while counting the gammas daily as the daughters came to equilibrium , especially pb214 and bi - 214 since they are major gamma emitters . in the tight confines of the closed cell 10 , the rn - 222 ( some of it gaseous ) is trapped , and on it &# 39 ; s subsequent decay to po - 218 ( a metal ), is adsorbed onto particles nearby [ see crc , handbook of physics and chemistry , radon , 1968 - 1967 , pg . b - 132 ]. all gamma counting was done using a technical associates ratemeter / sealer ( canoga park , calif . ), model # prs - 5 and probe model # bgs 251 . counting was performed for 30 , 60 and 90 minute periods several times per day , and the cpm calculated by hand . the average daily gamma counts observed were as follows : deuterium gas admission ( d 2 ), voltage ( v ) and current ( t ) before the addition of d 2 , the cell 10 resistance ( r ) was 150 , 000 ohms . after the d 2 addition , r dropped to 20 ohms . this drop in r is due to the swelling of the pd particles as they absorb the d 2 gas . after the d 2 addition , a power ( p ) of 5 watts was applied , v = 10 volts , i = 0 . 5 amps for several hours . applied power varied over subsequent days varied in time between approximately 3 to 9 hours per day , and 1 to ten watts . the cell 10 temperature never exceeded 220 degrees c . ( average of three ( 3 ) thermocouples 56 , 56 a and 56 b attached to the outside of the glass body ). the d 2 pressure in the cell 10 was maintained at between 1 psi and 20 psi . the gas was held in the cell 10 as a static system ( no flow ), although fresh gas could be allowed to flow through it for flushing . it is interesting to note that neither d 2 flushing nor heating / cooling had any effect on gamma output when re - measured immediately afterward . * after the 59th day , the power supply was changed to norbatron dcr 150 - 10 in order to attain a higher amperage at low cell 10 resistances ; the lodestar was only capable of 3 . 0 amps . a literature search , along with talks with nuclear physicists and a medical radiologist , have yielded no reasonable explanation to explain the drop in cell 10 gamma output argon is known to have a high solubility in pd [ see mellor , a comprehensive treatise on inorganic and theoretical chemistry , 1932 , pg . 616 ], and one would reasonably expect radon to have at least some solubility . this would not necessarily block gamma emissions however . indeed , gamma emissions are seen to increase in the closed cell 10 before the addition of d 2 and power application . once daughter isotope ( secular ) equilibrium has been reached , the only known way to reduce , or change , the gamma output of the source is to bombard it with neutrons ( usually causing counts to increase ). since pb - 214 and bi - 214 are the strongest gamma emitters in the series , then it is predominantly their radiation that is being counted . these two radioisotopes also come to secular equilibrium in about 38 days ( ie , approximately ten half - lives of radon - 222 ). if pb - 214 and bi - 214 levels are somehow reduced by the combination of d 2 and electron flux ( in the presence of nano - pd and zro particles ), then this would account for the observed data . however , nearing the end of the experiment ( when the counts are less than 1320 ), it seems to appear possible that the ra - 226 itself has been affected . gamma ray spectroscopy could be used to answer this important question . other metal oxides may be used as a carrier catalyst such as tio 2 , z n o 2 , c a o , n i o and b a o , so long as they are not reducible by h 2 or d 2 at temperatures less than in the range of 400 ° c . ( cell operating temperature ). since the glass tube of the cell 10 ( containing the powder ) has a1 . 0 cm id , then the electron flux through the cross - sectional area of the powder is 3 . 57 × 10 ^ 19 electrons per second at 4 . 5 amps . increasing the current , while cooling the cell 10 , would certainly be worth investigating ( the glass should be used below 400c . this would increase the “ concentrated negativity ” in the powder , a parameter that seems to have an effect on the gamma decrease . certainly , it is known that simply heating radioactive matter in a furnace has no bearing on it &# 39 ; s radiation output . an increase in powder radioactivity , as well as trying other radioactive materials ( especially some without radioactive daughters ), would be very interesting . this experiment will be repeated again with a more sensitive gamma ratemeter . a new scintillation counter , including a prs - 5 scaler / ratemeter / analyzer and a pgs - 3 gamma scintillation probe with a bismuth germinate 1 ″ thick was used in the experiment herebelow . in the repeated experiment , as reported in table i below , the results generally mirrored the above experiment . this above experiment was again repeated using alternating current ( a . c .). again , a significant reduction ( 5 . 6 %) in gamma ray emissions was realized in less than 7 hours of testing . while the instant invention has been shown and described herein in what are conceived to be the most practical and preferred embodiments , it is recognized that departures may be made therefrom within the scope of the invention , which is therefore not to be limited to the details disclosed herein , but is to be afforded the full scope of the claims so as to embrace any and all equivalent apparatus and articles . | 6 |
the detailed discussion set forth below in connection with the appended drawings is intended as a description of the presently preferred embodiment of the invention , and is not intended to represent the only form in which the present invention may be constructed or utilized . the description sets forth the functions and sequences of steps for constructing and operating the invention in connection with the illustrated embodiment . it is to be understood , however , that the same or equivalent functions and sequences may be accomplished by different embodiments that are also intended to be encompassed within the spirit and scope of the invention . the self - tensioning tailgate barrier 10 of the present invention is illustrated in fig1 - 6 which depict a presently preferred embodiment of the invention . referring more particularly to fig1 and 2 , the tailgate barrier or net 10 of the present invention is comprised of a flexible barrier 20 having a multiplicity of apertures and having edge stiffeners 22 disposed on opposite sides thereof . the tailgate barrier 10 further includes a pair of connecting members 30 disposed on each side of the barrier 20 for movably attaching the barrier 20 to the respective sidewalls of the truck . the movable attachment members preferably allows a vertical sliding movement of the barrier between the truck sidewalls during installation and removal of the barrier from the truck . the tailgate barrier 10 also includes , for each of the connecting members 30 , a biasing or tensioning member 32 , preferably comprising a compression spring . the biasing member 32 is operative to continuously urge or bias the edge stiffener 22 towards the truck sidewall , placing the barrier 20 under a constant tension load . the constant tension forces support the barrier 20 and eliminate sag and / or fluttering of the barrier 20 out of the plane of the tailgate during use . referring now to fig3 - 5 , the details of the barrier 20 may be described . the barrier 20 is preferably formed of a weave of horizontal straps 24 and vertical straps 25 , preferably affixed together where they intersect by rivets 26 . in the preferred embodiment , the straps 24 and 26 are fabricated from a nylon webbing material . however , the barrier 20 could alternatively be constructed of a vinyl / fabric membrane material with die cut apertures , with reinforcements in the membrane material as required . opposite ends of the tailgate barrier 10 are provided with edge stiffeners 22 , preferably fabricated of a lightweight yet stiff flat stock material , such as aluminum strips . the barrier 20 may also include one or more center stiffeners 23 ( see fig1 and 2 ) formed of similar flat stock material disposed midway between the edge stiffeners 22 . the center stiffeners 23 may be the same or very similar in configuration to the edge stiffeners 22 . as shown in fig3 the outboard ends of the horizontal straps 24 are preferably sized to extend past the edge stiffeners 22 and are preferably folded back one or more times ( as shown in fig4 and 5 ), so as the outboard edge of the outboard end of the horizontal straps 24 ( fig3 ) is not exposed . standard hardware such as a bolt 27 , a washer 28 , and a nut 29 are preferably used to structurally fasten and secure the barrier 20 to the stiffeners 22 and 23 . referring now to fig6 and 7 , the connecting member 30 is preferably fabricated as a conventional bolt 34 having a head portion , a shank portion , and a threaded portion . the biasing or tensioning member 32 preferably comprises compression spring 36 disposed along the shank and threaded portions of the connecting member 34 . each connecting member 30 and biasing member 32 cooperates with a cylindrically - shaped retainer 38 having an inboard opened end and an outboard end 39 . the outboard end 39 has a clearance hole sized to slidingly receive the connecting bolt 34 . each retainer 38 is preferably welded to the edge stiffener 22 , or fixedly attached in some other manner . mounted to each of the truck sidewalls is a slotted rail 40 , preferably formed as an extruded piece of channel . the slotted rail 40 is preferably attached with several mounting screws 41 to the sidewalls of the truck bed . as best shown in fig6 and 7 , the connecting bolts 34 are attached to a slider bar 42 which is sized to be slidingly received through the slot in the slotted rail 40 . an adjusting nut 45 is threadingly engaged upon the threaded portion of the connecting bolt 34 . a locking cable 48 ( fig2 ) may also be attached to the barrier 20 to prevent theft . with the structure defined the use of the tailgate barrier 10 of the preferred embodiment of the present invention may be discussed as the conventional heavy solid tailgate ( not shown ) has been removed from the vehicle . first , each of the slotted rails 40 are mounted to the inside sidewalls of the pickup truck with at least two fasteners 41 ( see fig6 ). then the self - tensioning tailgate barrier 10 is installed one side at a time by one individual , or both sides installed simultaneously by two individuals . the slider bar 42 is inserted into the open end of the slotted rail 40 , and the connecting bolts 34 pass through the slot in the slotted rail 40 as the barrier is moved vertically downward until the lowest of the horizontal straps 24 of the barrier 20 reaches the bed of the truck . the compression springs 36 bear against the outboard end 39 of the housing 38 , thereby pushing the edge stiffener 22 towards the slotted rail 40 and inducing a tension load into the horizontal straps 24 of the barrier 20 . the edge stiffeners 22 act to evenly distribute the load from the connecting bolts 34 into the horizontal straps 24 with any additional center stiffeners 23 also contributing to evenly distributing the load among the horizontal straps 24 . the tension within the barrier 20 may be adjusted by turning the adjustment nut 45 , thereby compressing or relieving the pressure on the compression spring 36 . once the tension has been grossly adjusted and set upon initial installation of the barrier 20 , no further adjustments ( or only fine adjustments ) will be required for subsequent reinstallations after removal of the barrier 20 . finally , the locking cable 48 may be secured to the truck sidewall to prevent theft . it is understood that the self - tensioning tailgate barrier described herein and shown in the drawings represents only a presently preferred embodiment of the invention . indeed , various modifications and additions may be made to the embodiment without departing from the spirit and scope of the invention . these and other modifications and additions may be obvious to those skilled in the art and may be implemented to adapt the present invention for use in a variety of different applications . | 1 |
fig1 illustrates a partial sectional view of a tip turbine engine ( tte ) type gas turbine engine 10 taken along an engine centerline a . the engine 10 includes an outer nacelle 12 , a rotationally fixed static outer support structure 14 and a rotationally fixed static inner support structure 16 . a plurality of fan inlet guide vanes 18 are mounted between the static outer support structure 14 and the static inner support structure 16 . each inlet guide vane preferably includes a variable trailing edge 18 a . a fan - turbine rotor assembly 24 is mounted for rotation about the engine centerline a fore of a core airflow passage 26 having a core airflow inlet 27 . the fan - turbine rotor assembly 24 includes a plurality of hollow fan blades 28 to provide internal , centrifugal compression of the compressed airflow for distribution to an annular combustor 30 located within the rotationally fixed static outer support structure 14 . the core airflow inlet 27 is aft of the fan blades 28 and leads to the core airflow passage 26 , which reverses the core airflow such that it flows back toward the fan - turbine rotor assembly 24 in a direction generally parallel to the engine centerline a . a turbine 32 includes a plurality of tip turbine blades 34 ( two stages shown ) which rotatably drive the hollow fan blades 28 relative a plurality of tip turbine stators 36 which extend radially inwardly from the rotationally fixed static outer support structure 14 . the annular combustor 30 is disposed axially forward of the turbine 32 . the fan - turbine rotor assembly 24 includes a fan hub 64 that supports a plurality of the hollow fan blades 28 . each fan blade 28 includes an inducer section 66 , a hollow fan blade section 72 and a diffuser section 74 . the inducer section 66 receives airflow traveling generally parallel to the engine centerline a from the core airflow passage 26 , and turns the airflow from an axial airflow direction toward a radial airflow direction . the airflow is radially communicated through a core airflow passage 80 within the hollow fan blade section 72 , which acts as a compressor chamber where the airflow is centrifugally compressed . from the core airflow passage 80 , the airflow is diffused and turned once again toward an axial airflow direction toward the annular combustor 30 . preferably , the airflow is diffused axially forward in the engine 10 , however , the airflow may alternatively be communicated in another direction . in operation , airflow enters the engine 10 and passes between inlet guide vanes 18 and rotating fan blades 28 . the rotating fan blades 28 compress the airflow and discharge high - pressure fan exhaust . a portion of the fan exhaust enters the core airflow inlet 27 and is reversed by the core airflow passage 26 . the core airflow passage 26 turns the axially rearward flowing fan exhaust radially inwardly and then axially forward toward the inducer section 66 . the reversed core airflow enters the inducer section 66 in a direction generally parallel to the engine centerline a , and is then turned by the inducer section 66 radially outwardly through the core airflow passage 80 of the hollow fan blades 28 . the airflow is further compressed centrifugally in the hollow fan blades 28 by rotation of the hollow fan blades 28 . from the core airflow passage 80 , the airflow is turned and diffused axially forward in the engine 10 into the annular combustor 30 . the compressed core airflow from the hollow fan blades 28 is mixed with fuel in the annular combustor 30 , where it is ignited to form a high - energy gas stream . the high - energy gas stream is expanded over the plurality of tip turbine blades 34 mounted about the outer periphery of the fan - turbine rotor assembly 24 to drive the fan - turbine rotor assembly 24 . concurrent therewith , the fan - turbine rotor assembly 24 discharges fan bypass air ( fan exhaust ) axially aft to merge with the core airflow from the turbine 32 in an exhaust case 106 . a plurality of exit guide vanes 108 extend inwardly from the rotationally fixed static outer support structure 14 to guide the combined airflow out of the engine 10 and provide forward thrust . an exhaust mixer 109 mixes the airflow from the turbine blades 34 with the bypass airflow through the fan blades 28 . by feeding back some of the high - pressure fan exhaust as the core airflow , the efficiency of the engine 10 is increased , without the need for an axial compressor . this reduces the overall length and weight of the engine 10 and reduces the number of parts . fig2 illustrates a second embodiment of a tip turbine engine 110 according to the present invention which additionally incorporates an axial compressor 122 for even further compression of the core airflow . components that are similar to those described above with respect to fig1 are indicated with the same reference numeral , and the description of those components and their operation is incorporated by reference here . the axial compressor 122 is mounted between the core airflow passage 26 and the inducer sections 66 . the axial compressor 122 includes an axial compressor rotor 146 , from which a plurality of compressor blades 152 extend radially outwardly , and a fixed compressor case 150 . a plurality of compressor vanes 154 extend radially inwardly from the compressor case 150 between stages of the compressor blades 152 . the compressor blades 152 and compressor vanes 154 are arranged circumferentially about the axial compressor rotor 146 in stages ( two stages of compressor blades 152 and compressor vanes 154 are shown in this example ). the axial compressor rotor 146 may be driven by the fan - turbine rotor assembly 24 either directly , or via a gearbox assembly 190 , as shown . the gearbox assembly 190 shown provides a speed increase between the fan - turbine rotor assembly 24 and the axial compressor 122 , at a ratio of 3 . 34 to 1 , for example . the gearbox assembly 190 may include a planetary gearset , including a sun gear 192 coupled to the axial compressor rotor 146 and a planet carrier 194 coupled to the fan - turbine rotor assembly 24 to provide a speed differential therebetween . a plurality of planet gears 193 ( one shown ) are mounted to the planet carrier 194 . the planet gears 193 engage the sun gear 192 and a ring gear 195 . rotating the axial compressor rotor 146 at a rate higher than that of the fan - turbine rotor assembly 24 increases the compression provided by the axial compressor 122 . the gearbox assembly 190 could alternatively provide a speed decrease between the fan - turbine rotor assembly 24 and the axial compressor rotor 146 . an alternative gearbox assembly 290 that reverses the direction of rotation between the fan - turbine rotor assembly 24 and the axial compressor 122 is shown schematically in fig3 . the gearbox assembly 290 provides second planet gears 198 coupled between each planet gear 193 and the ring gear 195 and mounted to the planet carrier 194 . the gearbox assembly 290 is otherwise similar to gearbox assembly 190 as described above . the gearbox assembly 290 may also provide a speed increase or a speed decrease . in accordance with the provisions of the patent statutes and jurisprudence , exemplary configurations described above are considered to represent a preferred embodiment of the invention . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . | 5 |
fig1 is a block diagram of an embodiment of a data acquisition and rescanning system 150 . the data acquisition and rescanning system 150 comprises a data acquisition device 100 , which comprises a data capture device 101 , a normalization processor 102 , and a communication device 103 . examples of data capture devices 101 include , but are not limited to scanners , cameras , video recorders , infrared cameras , acoustic cameras , digital cameras , facsimile machines , any devices capable of capturing an image , acoustic sensors , any devices having an acoustic sensor , and the like . data capture devices 101 can be non - real time devices , such as , for example , scanners , or data capture devices 101 can be real time devices , such as , for example , cameras and video recorders . the data acquisition and rescanning system 150 further comprises a user system 110 , which comprises a communication device 104 , which communicates with the communication device 103 , a random access data cache 105 , a data processor 106 , a user interface 107 , and a data display 108 . in an embodiment , the random access data cache stores the data in at least one subsection , zone , band , image strip , data strip , or the like , and in a manner that is randomly accessible . the data reacquisition and rescanning system 150 further comprises an application / storage device 109 . examples of the application / storage device 109 include , but are not limited to , computer processors , program logic , controller circuitry , general purpose single - chip or multi - chip microprocessors , digital signal processors , embedded microprocessors , microcontrollers , and the like . analog data are presented to the acquisition device 100 . the analog capture device 101 measures the analog data . the normalization processor 102 transforms the measured data into normalized data . it calibrates and compensates for known errors and biases introduced by the sensors measuring the analog data to produce normalized data . the normalized raw data , referred to as raw data from here on , are transmitted via a fast connection using the communication devices 103 and 104 to the user system 110 and stored at the random access data cache 105 . the raw data are stored as bands , image strips , data strips , or the like in the random access cache 105 . in an embodiment , the random access data cache 105 is partitioned into 64 k byte bands . in addition to the raw data , data pertaining to the raw data , or metadata for each band , are also stored at the cache 105 . these metadata comprise , but are not limited to , a tag identifying the data and the location in the cache , a time and date stamp of the acquisition , the sequence number , the beginning of the data band , the end of the data band , height , width , a pointer to the next band , and the like . in some embodiments , tags identify subsections or zones of raw data . the data processor 106 processes the raw data using the default data processor settings . the order in which the raw data are processed by the data processor 106 is either determined automatically or interactively . in an automatic embodiment , the most current or more current raw data first stored at the cache 105 are processed . in an interactive embodiment , the user identifies specific raw data bands or subsections of these for processing utilizing the data tags or metadata . the bands are randomly accessible in the cache 105 . this allows non real - time virtual reacquisition . the processed data together with their metadata are displayed at the data display 108 . the default data processor settings are adjustable through the user interface 107 . changing the settings triggers the data processor 106 to reprocess the selected raw data stored in the random access data cache 105 with the changed settings and to display the reprocessed data at the data display 108 . by interactively readjusting the processor settings , the data are processed until they satisfy the user &# 39 ; s preferences . in addition to controlling the data processor 106 , the user interface 107 also controls the random access data cache 105 . the user , through the user interface 107 , can access subsections , zones , bands , image strips , or data strips of the raw data as well as selecting specific raw data for non real time interactive processing . the user can transmit the processed data to the application / storage device 109 for further processing as well as storage . the data acquisition and rescanning system 150 depicted in fig1 supports multiple user usage . the data acquisition device 100 can be accessed by multiple users . in an embodiment , the user system 110 further comprises a computer ( not shown ). in an embodiment , the user system 110 is implemented , at least in part , as software on the computer . fig2 is a block diagram of an embodiment of a remotely deployed data acquisition and rescanning system 250 . the data acquisition and rescanning system 250 comprises the data acquisition device 100 , a storage and processing system 212 , a user system 210 , and the acquisition / storage device 109 . the storage and processing system 212 comprises the communication device 103 , the random access data cache 105 , the data processor 106 , and a communication device 203 . the user system 210 comprises a communication device 204 , the user interface 107 , and the data display 108 . the raw data from the acquisition device 100 are transmitted , via a fast connection using the communication devices 103 and 104 , to the storage and processing system 212 . the raw data and the metadata are stored at the random access data cache 105 . the data processor 106 processes the raw data using the default data processor settings . the user system 210 communicates with the storage and processing system 212 via a communication medium 216 using the communication devices 203 and 204 . focusing now on the communication medium 216 , as shown in fig2 , in one embodiment , the communications medium is internet , which is a global network of computers . in other embodiments , the communication medium 216 can be any communication system including by way of example , dedicated communication lines , telephone networks , wireless data transmission systems , infrared data transmission systems , two - way cable systems , customized computer networks , interactive kiosk networks , and the like . the processed data together with their metadata are displayed at the data display 108 . the default data processor settings are adjustable through the user interface 107 . changing the settings triggers the data processor 106 to reprocess the selected raw data stored in the random access data cache 105 with the changed settings and to display the reprocessed data at the data display 108 . by interactively readjusting the processor settings , the data are processed until they satisfy the user &# 39 ; s preferences . the user can transmit the processed data to the application / storage device 109 for further processing as well as storage . the data acquisition and rescanning system 250 is similar to the data acquisition and rescanning system 150 except the user system 210 is located remotely from the data acquisition device 100 and the storage and processing system 212 . in the remotely deployed system 250 , the data cache 105 is local to the data acquisition device 100 . the user system 210 does not have to be connected to the data acquisition device 100 with a fast connection in order to ensure an effective use of the embodiment . the data acquisition and rescanning system 250 is implemented , at least in part , as software , firmware , or any combination of software and firmware . fig3 is a block diagram of an embodiment of a data acquisition and rescanning system 350 comprising an analytic engine . the data acquisition and rescanning system 350 comprises the data acquisition device 100 , a user system 310 , and the application / storage device 109 . the user system 310 comprises the communication device 104 , the random access data cache 105 , the data processor 106 , the user interface 107 , the data display 108 , and an analytic engine 314 . analog data are presented to the acquisition device 100 . the analog capture device 101 measures the analog data . the normalization processor 102 transforms the measured data into normalized raw data . the raw data are transmitted via a fast connection using the communication devices 103 and 104 to the user system 310 . at the user system 310 , the raw data are stored at the random access data cache 105 . selected raw data are analyzed by the analytic engine 314 . in an embodiment , the analytic engine 314 is an acquisition controller 314 . the selection mechanism can be either automatic or interactive as described in the embodiments above . the analysis performed by the analytic engine 314 yields new data processor settings for the selected raw data . examples of analyses comprise , but are not limited to , page boundary detection , streak detection , page border detection , blank page detection , conversion from rgb color representation to a ycbcr color representation , hue measurement , saturation measurement , luminescence measurement , creating a grayscale intensity histogram , creating a color histogram , geometric analysis , color detection , gamma detection for brightness and color levels , textual orientation , and the like . the settings are transferred to the data processor 106 , and the raw data are processed with the new settings . the processed data are displayed at the data display 108 . the data processor settings can be adjusted interactively using the user interface 107 . in addition to determining the data processor settings , the analytic engine 314 also detects automatically raw data that will potentially result in poor quality processed data and alerts the user upon selection of these data through the user system 310 . the corresponding trapping conditions ( e . g ., user - defined parameters specifying quality thresholds such as brightness range , contrast range , missing corner , blank page , and the like ) are accessible to the user through the user interface 107 . the user through the user system 310 is able to control the quality of the acquired data . the user system 310 can transmit the processed data to the application / storage device 109 for further processing as well as storage . additionally the user can , via the user interface 107 , access subsections , or zones of the raw data stored at the random access data cache 105 to be processed at the data processor 106 . the data acquisition and rescanning system 350 allows the non real time interactive processing of specific raw data . the data acquisition and rescanning system 350 also supports multiple user usage . the data acquisition device 100 can be accessed by multiple user systems 310 with each data processor 106 having unique processor settings . in an embodiment , the data acquisition and rescanning system 350 further comprises a computer ( not shown ). in an embodiment , the data acquisition and rescanning system 350 is implemented , at least in part , as software on the computer . fig4 is a block diagram of an embodiment of a data acquisition and rescanning system 450 comprising the data acquisition device 100 , a user system 410 , and the analytic engine 314 . the data acquisition and rescanning system 450 implements the data acquisition and rescanning system 350 shown in fig3 as hardware . the random access data cache 105 , the data processor 106 , and the analytic engine 314 are implemented at the data acquisition device 100 . the data acquisition device 100 further comprises the data capture device 101 , the normalization processor 102 , and the communication device 103 . the user system 410 comprises the communication device 104 , the user interface 107 , and the data display 108 . fig5 is a block diagram of an embodiment of a remotely deployed data acquisition and rescanning system 550 comprising the analytic engine 314 . the data acquisition and rescanning system 550 comprises the data acquisition device 100 , a storage and processing system 512 , a user system 510 , and the acquisition / storage device 109 . the storage and processing system 512 comprises the communication device 104 , the random access data cache 105 , the data processor 106 , the analytic engine 314 , and a communication device 503 . the user system 510 comprises a communication device 504 , the user interface 107 , and the data display 108 . the raw data from the acquisition device 100 are transmitted , via a fast connection using the communication devices 103 and 104 , to the storage and processing system 512 . the raw data and the metadata are stored at the cache 105 . the data processor 106 processes the raw data using the default data processor settings . selected raw data are analyzed by the analytic engine 314 . the analysis performed by the analytic engine 314 yields new data processor settings for the selected raw data . the settings are transferred to the data processor 106 , and the raw data are processed with the new settings . the user system 510 communicates with the storage and processing system 512 via the communication medium 216 using the communication devices 503 and 504 . the processed data are displayed at the data display 108 . the data processor settings can be adjusted interactively using the user interface 107 . the user , through the user system 510 , can transmit the processed data to the application / storage device 109 for further processing as well as storage . additionally the user can , via the user interface 107 , access subsections , or zones of the raw data stored at the random access data cache 105 to be processed at the data processor 106 . the data acquisition and rescanning system 550 allows the non real time interactive processing of specific raw data . the data acquisition and rescanning system 550 is similar to the data acquisition and rescanning system 350 except the user system 510 is located remotely from the data acquisition device 100 and the storage and processing system 512 . in the remotely deployed system 550 , the data cache 105 and the analytic engine 314 are local to the data acquisition device 100 . the data acquisition and rescanning system 550 also supports multiple user usage . the data acquisition device 100 can be accessed by multiple user systems 510 with each data processor 106 having unique processor settings . the data acquisition and rescanning system 550 is implemented , at least in part , as software , firmware , or a combination of software and firmware . fig6 is a block diagram of a hardware implemented embodiment of a remotely deployed data acquisition and rescanning system 650 comprising the analytic engine 314 . the data acquisition and rescanning system 650 implements the data acquisition and rescanning system 450 shown in fig4 in a remote deployment . the data acquisition and rescanning system 650 comprises the data acquisition device 100 , a user system 610 , and the application / storage device 109 . the random access data cache 105 , the data processor 106 , and the analytic engine 314 are implemented as hardware on the data acquisition device 100 directly . the data acquisition device 100 further comprises the data capture device 101 , the normalization processor , and the communication device 103 . the user system 610 comprises the user interface 107 , the data display 108 , and a communication device 604 . the user system 610 communicates with the data acquisition device 100 via the communication medium 216 using the communication devices 103 and 604 . fig7 is a block diagram of an embodiment of a data acquisition and rescanning system 750 having a first analytic engine 714 and a second analytic engine 718 . the data acquisition and rescanning system 750 comprises the data acquisition device 100 and a user system 710 . the data acquisition device 100 comprises the data capture device 101 , the normalization processor 102 , and the communication device 103 . the user system 710 comprises the communication device 104 , the random access data cache 105 , the data processor 106 , the user interface 107 , and the data display 108 . the user system 710 further comprises the first analytic engine 714 and the second analytic engine 718 . in an embodiment , the first and second analytic engines 714 , 718 are first and second acquisition controllers 714 , 718 , respectively . analog data are presented to the acquisition device 100 . the data capture device 101 measures the analog data . the normalization processor 102 transforms the measured data into normalized raw data . the raw data are transmitted via a fast connection using the communication devices 103 and 104 to the user system 710 . at the user system 710 , the raw data are stored at the data cache 105 . the raw data are stored as bands , image strips , data strips , or the like in the random access data cache 105 . in an embodiment , the random access data cache is partitioned in to 64 k byte bands . in addition to the raw data , data pertaining to the raw data , or metadata for each band , are also stored at the cache 105 . these metadata comprise , but are not limited to , a tag identifying the data and the location in the cache , a time and date stamp of the acquisition , the sequence number , the beginning of the data band , the end of the data band , height , width , a pointer to the next band , and the like . in some embodiments , tags identify subsections or zones of raw data . selected raw data are analyzed by the first analytic engine 714 . the selection mechanism can be either automatic or interactive as described in the embodiments above . the analysis performed by the first analytic engine 714 yields an improved or close to optimal data processor settings for the selected raw data . in an embodiment , the first analytic engine 714 performs geometric processing , such as for example , document orientation , background compensation , color compensation , text extraction , text / background separation , page boundary detection , streak detection , page border detection , blank page detection , conversion from rgb color representation to a ycbcr color representation , hue measurement , saturation measurement , luminescence measurement , creating a grayscale intensity histogram , creating a color histogram , color detection , gamma detection for brightness and color levels , and the like . the settings are transferred to the data processor 106 , and the raw data are processed with the settings . the processed data are transferred to the second analytic engine 718 . in an embodiment , the processor 106 sends the processed data to the second analytic engine 718 for analysis . in another embodiment , the processor 106 sends the processed data to the first analytic engine 714 and the first analytic engine 714 sends the processed data to the second analytic engine 718 for analysis . at the second analytic engine 718 the processed data are analyzed and improved data processor settings are determined . the second analytic engine 718 compares the quality of the processed data to a predetermined metric . the second analytic engine 718 selects new processor settings based on the quality of the processed data as determined by the metric . in an embodiment , the second analytic engine performs feature or quality processing , such as , for example , recognizing an area of poor optical character recognition , non - linear gamma , high background noise , character color distortion , and the like . in an embodiment , the second analytic engine replaces , at least in part , the user &# 39 ; s data review at the data display 108 and the user &# 39 ; s revised processor settings input from the user interface 107 . the new settings are transmitted to the data processor 106 and the raw data are reprocessed using the new settings . in an embodiment , the second analytic engine 718 sends the metadata containing the location of the raw data in the random access cache 105 and the new processor settings to the processor 106 . the processor 106 processes the data with the new processor settings . in another embodiment , the second analytic engine 718 sends the metadata associated with the data and the new processor settings to the first analytic engine 714 . the first analytic engine 714 receives the metadata containing the location of the raw data in the random access cache 105 and the new processor settings and sends the metadata containing the location of the raw data in the random access cache 105 and the new processor settings to the processor 106 . the processor processes the raw data with the new processor settings . in yet another embodiment , the second analytic engine 718 sends the metadata associated with the data to the first analytic engine 714 . the first analytic engine 714 receives the metadata containing the location of the raw data in the random access cache 105 and the new processor settings and processes the band of raw data with the new processor settings . the processed data are transferred to the second analytic engine 718 for analysis . in an embodiment , the processor 106 sends the processed data to the second analytic engine 718 for analysis . in another embodiment , the first analytic engine 714 sends the processed data to the second analytic engine 718 for analysis . in another embodiment , the processor 106 sends the processed data to the first analytic engine 714 and the first analytic engine 714 sends the processed data to the second analytic engine 718 for analysis . the step of reprocessing the raw data with the revised data processor settings and the step of analyzing the processed data and determining revised data processor settings are repeated until convergence , i . e . until the metric does not detect any improvements in the quality of the processed data . this yields improved or optimal processor settings . for example , a scanner scans a document at a resolution of 600 dots per inch ( dpi ). the document includes text of various font sizes . the raw data are stored in the random access cache 105 in bands , along with the metadata associated with each band of raw data . to save processing time and user storage space , the first analytic engine 714 sends the processor 106 settings to process the data at a resolution of 200 dpi , for example , along with other possible geometric processing settings , as describe above . the processor 106 processes the raw data using the settings from the first analytic engine 714 . the processed data and the associated metadata are transferred to the second analytic engine 718 . the second analytic engine 718 analyzes the processed data using a predefined metric . for example , the second analytic engine 718 determines that a band of the processed data is not recognizable , perhaps because the text size is too small to be recognizable at a resolution of 200 dpi . the second analytic engine 718 sends the metadata associated with the band of unrecognizable data along with new processor setting to process the data at a resolution of 400 dpi to the processor 106 . the processor 106 receives the metadata containing the location of the raw data in the random access cache 105 and the new processor settings and processes the band of raw data at 400 dpi . the processor 106 sends the processed band of data and its associated metadata to the second analytic engine 718 for analysis . the second analytic engine 718 determines if the processed band of data meets the predetermined metric . if not , the second analytic engine 718 sends the metadata associated with the band along with new processor settings to process the band of raw data to the processor 106 . for example , the second analytic engine 718 determines that the text in the band is unrecognizable even at a resolution of 400 dpi and sends the metadata associated with the band along with new processor settings to process the band of raw data at a resolution of 600 dpi to the processor 106 . the process of analyzing the data and reprocessing the raw data with new processor setting occurs until the second analytic engine 718 determines that the processed data meet the predefined metric . processing parameters can be changed on portions or bands of the raw data without reprocessing all of the raw data . in an embodiment , reprocessing portions of the captured data saves processing time and data storage space . the processed data obtained by these steps are displayed at the data display 108 . the data processor settings can be adjusted interactively using the user interface 107 . in addition to determining the data processor settings , the first analytic engine 714 and the second analytic engine 718 automatically detect raw data that will potentially result in poor quality processed data . the corresponding trapping conditions , described above , are accessible to the user through the user interface 107 , enabling the user to efficiently control the quality of the acquired data . additionally the user can , via the user interface 107 , access subsections or zones of the raw data stored at the random access data cache 105 to be processed at the data processor 106 . the data acquisition and rescanning system 750 also allows the non real time interactive processing of specific raw data . the user can transmit the processed data to the application / storage device 109 for further processing as well as storage . the data acquisition and rescanning system 750 supports multiple user usage . the acquisition device 100 can be accessed by multiple user systems 710 with each data processor 106 having unique processor settings . in an embodiment , the data acquisition and rescanning system 750 further comprises a computer ( not shown ). in an embodiment , the data acquisition and rescanning system 750 is implemented , at least in part , as software on the computer . fig8 is a block diagram of an embodiment of a data acquisition and rescanning system 850 comprising the first analytic engine 714 and the second analytic engine 718 . the data acquisition and rescanning system 850 implements the data acquisition and rescanning system 750 shown in fig7 as hardware . the data acquisition and rescanning system 850 comprise the data acquisition device 100 , a user system 810 , and the application / storage device 109 . the random access data cache 105 , the data processor 106 , the first analytic engine 714 , and the second analytic engine 718 are implemented at the data acquisition device 100 . the data acquisition device 100 further comprises the data capture device 101 , the normalization processor 102 , and the communication device 103 . the user system 810 comprises the communication device 104 , the user interface 107 , and the data display 108 . fig9 is a block diagram of an embodiment of a remotely deployed data acquisition and rescanning system 950 comprising the first analytic engine 714 and the second analytic engine 718 . the data acquisition and rescanning system 950 comprises the data acquisition device 100 , a storage and processing system 912 , a user system 910 , and the acquisition / storage device 109 . the data acquisition device comprises the data capture device 101 , the normalization processor , and the communication device 103 . the storage and processing system 912 comprises the communication device 104 , the random access data cache 105 , the data processor 106 , the first analytic engine 714 , the second analytic engine 718 , and a communication device 903 . the user system 910 comprises a communication device 904 , the user interface 107 , and the data display 108 . the raw data from the acquisition device 100 are transmitted , via a fast connection using the communication devices 103 and 104 , to the storage and processing system 912 . the raw data and the metadata are stored at the cache 105 . the data processor 106 processes the raw data using the default data processor settings . at the data storage and processing system 912 , the raw data are stored at the data cache 105 . selected raw data are analyzed by the first analytic engine 714 . the selection mechanism can be either automatic or interactive as described in the embodiments above . the analysis performed by the first analytic engine 714 yields an improved or close to optimal data processor settings given the selected raw data . the settings are transferred to the data processor 106 , and the raw data are processed with the given settings . the processed data are transferred to the second analytic engine 718 . at the second analytic engine 718 the processed data are analyzed and improved data processor settings are determined . the second analytic engine 718 determines the quality of the processed data using a metric . the second analytic engine 718 selects new processor settings depending on the quality of the processed data as determined by the metric . the improved settings are transmitted to the data processor 106 and the raw data are reprocessed . the step reprocessing the processed data with the revised data processor settings and the step of analyzing the processed data and determining revised data processor settings are repeated until convergence , i . e . until the metric cannot detect any improvements in the quality of the processed data , as described above . this yields improved or optimal processor settings . the user system 910 communicates with the storage and processing system 912 via a communication medium 216 using the communication devices 903 and 904 . the processed data are displayed at the data display 108 . the data processor settings can be adjusted interactively using the user interface 107 . the user , through the user system 910 , can transmit the processed data to the application / storage 109 for further processing as well as storage . additionally the user can , via the user interface 107 , access subsections , or zones of the raw data stored at the random access data cache 105 to be processed at the data processor 106 . the data acquisition and rescanning system 950 allows the non real time interactive processing of specific raw data . the data acquisition and rescanning system 950 is similar to the data acquisition and rescanning system 750 with the user system 910 located remotely from the data acquisition device 100 and the storage and processing system 912 . in the remotely deployed system 950 , the data cache 105 , the data processor 106 , the first analytic engine 714 , and the second analytic engine 718 are local to the data acquisition device 100 . the data acquisition and rescanning system 950 also supports multiple user usage . the data acquisition device 100 can be accessed by multiple user systems 910 with each data processor 106 having unique processor settings . the data acquisition and rescanning system 950 is implemented , at least in part , as software , firmware , or a combination of software and firmware . fig1 is a block diagram of a hardware implemented embodiment of a remotely deployed data acquisition and rescanning system 1050 comprising the first analytic engine 714 and the second analytic engine 718 . the data acquisition and rescanning system 1050 implements the data acquisition and rescanning system 850 shown in fig8 in a remote deployment . the data acquisition and rescanning system 1050 comprises the data acquisition device 100 , a user system 1010 , and the application / storage device 109 . the random access data cache 105 , the data processor 106 , the first analytic engine 714 , and the second analytic engine 718 are implemented as hardware at the acquisition device 100 . the data acquisition device 100 further comprises the data capture device 101 , the normalization processor 102 , and the communication device 103 . the user system 1010 comprises the user interface 107 , the data display 108 , and a communication device 1004 . the user system 1010 communicates with the data acquisition device 100 via the communication medium 216 using the communication devices 103 and 1004 . fig1 is a block diagram of an embodiment of a data acquisition and rescanning system 1150 comprising a plurality of data acquisition devices 100 and a plurality of user systems 1110 . the plurality of user systems 1110 are located remotely from the plurality of data acquisition devices 100 . the data acquisition device 100 comprises the data capture device 101 , the normalization processor 102 , the communication device 103 , the random access data cache 105 , and the data processor 106 . in an embodiment , the data processor 106 is a low processing capability engine . the user system 1110 comprises the user interface 107 , the data display 108 , a communication device 1104 , and an analytic engine 1114 . in an embodiment , the analytic engine 1114 is a high performance analytic processor . analog data are presented to the acquisition device 100 . the analog capture device 101 measures the analog data . the normalization processor 102 transforms the measured data into normalized raw data . the data processor 106 is used for transformations of the data . the transformed data are stored at the random access data cache 105 . examples of data processing include , but are not limited to , document orientation , background compensation , color compensation , text extraction , text / background extraction , threshold , correlation , despeckle , and the like . working in a real time broadcast push mode or upon request from at least one of the user systems 1110 , selected cached data are scaled and compressed by the data processor 106 . the communication device 105 sends the scaled and compressed data , and the associated tag or metadata to the user system 1110 via the communication medium 216 using the communication device 103 . in an embodiment , the tag data comprises the capture device address and the data location in the cache 105 . in an embodiment , the metadata comprise , but are not limited to , a tag identifying the data and the location in the cache , a time and date stamp of the acquisition , the sequence number , the beginning of the data band , the end of the data band , height , width , a pointer to the next band , and the like . the tag data is embedded in the communication network protocol of the communication medium 216 . the user system 1110 receives the data via the communication medium 216 and the communication device 1104 . the data is analyzed by the analytic engine 1114 . if the analysis detects some relevant data area ( s ) characterized by analysis results that are outside of a boundary determined by the user , the analytic engine 1114 activates the user interface 107 by sending the tag associated with the data and the location of the area ( s ) of interest within the data . the user interface 107 can be an automatic or a manual operation . the user interface 107 uses the tag content and the area location to request a new data set with new processing settings from the corresponding data capture device 100 . the data processor 106 reprocesses the selected data using the new settings and the data capture device 100 retransmits the reprocessed data to the user system 1110 . this virtual rescan operation is an interactive process , which can use different settings or windows . during the interactive process described above , the data continue to be transmitted in real time by the plurality of the capture devices 100 to the plurality of user systems 1110 . in an embodiment , the user , through the data display 108 , can visualize any of the incoming data . in an embodiment , any part of the receiving data can be stored by the application / storage device 109 . in an embodiment , the user system 1110 can lock selected data in the data cache 105 of one or more data acquisition devices 100 associated with the selected data . when the user system 1110 receives the selected data at the desired resolution , the user system 1110 unlocks the data . in an embodiment , the user system 1110 has an authorization level in order to lock data . the non - locked data in the data cache 105 is overwritten in a first in first out model . this section includes exemplary embodiments of a virtual rescan workflow , a detection orientation method , a detect bleed - through method , a color detection method , a background smoothing method , and a detection of scanned page boundaries method . if , in an embodiment , the user chooses to scan images with vrs processing , the vrs processing initializes the scanner to acquire a raw ( unprocessed ) master image . the master image is in grayscale if the user chooses to scan in black and white , else the master image is in grayscale or color as the user specifies . vrs processing also initializes the scanner using predefined scanner specific settings . these settings help the vrs processing improve performance . for example , one of the settings is to perform overscanning ( i . e ., scan more than the size requested so vrs can perform a good deskew operation ). the scanner scans an image , per the specified settings , and the raw image is transmitted from the scanner to a vrs cache . the vrs software performs one or more image processing algorithms . in an embodiment , an analytic engine comprises the vrs . one algorithm determines the actual page boundaries within the scanned raw image . in an embodiment , the scanned image contains scanner - introduced background due to overscanning . determining the page boundaries is done for a variety of backgrounds , such as black , white , grey , and the like . techniques , such as streak detection , are used , for example , for line streaks introduced by a dirty scanner camera / lamp , rollers , or the like . other techniques , such as page border shadow detection are used to determine a page boundary . another image processing algorithm determines if the scanned page is blank . a page may contain colors that bleed through from the other side of the page when scanning is done in duplex . if the algorithm determines that the page contains no content , the page can be deleted per the user setting . another image processing algorithm converts the page contents from an rgb color representation to a ycbcr ( luminance , hue , and saturation format ). this permits many color related operations on the hue and saturation aspects of the page , and hence , results in a speed improvement . if the scanner scans the image in black and white , this step is not performed . yet another image processing algorithm analyzes the image . possible analyses are performing luminance analysis and extracting the grayscale intensity information into a histogram , extracting color information into a color histogram , performing geometric analysis on the page , and the like . another image processing algorithm detects if the document has color , based on previous analyses . if there is no color content , the algorithm sets the scanner settings to indicate that the document is a black and white document . if document has background color and that background color is the predominant color , the algorithm sets the scanner settings to indicate that the document is a color document . additionally , if the document contains color content , the user can adjust the scanner settings to reproduce the color or not to reproduce the color , based on a determination of whether the color content is related to specific document content , or is a predominate characteristic of the document , such as a document on yellow paper . another image processing algorithm performs gamma correction on the image to adjust the brightness and color levels . a further image processing algorithm performs deskew and cropping on the page image based on the previous analyses . yet another image processing algorithm detects textual orientation in the image and rotates the image orthogonally , if required . another image processing algorithm performs other operations , such as , for example , barcode detection , line filtering , despeckling , annotating with an endorsement string , or the like . a further image processing algorithm performs background smoothing by detecting the background colors and merging them together . if the image has problems that cannot be corrected automatically , the image processing software displays the processed image and the settings to the user . the user then determines the settings for the image . as the user changes the settings , the image processing software performs one or more of the image processing algorithms discussed above using the user specified settings and displays the processed image to user . when the user accepts the image , the image processing software re - processes the raw image using the final settings chosen by the user . in another embodiment , a second analytic engine performs additional analyses to determine if the processed image meets predetermined requirements . if the image does not meet the predetermined requirements , the second analytic engine determines new settings and reprocess the raw image using the new settings . this process repeats until the image meets the requirements . in an embodiment , the detect orientation algorithm automatically detects which way to orthogonally rotate a text page for viewing . the algorithm selects possible individual characters from connected components of black within the page . the algorithm then determines the orientations of the individual characters by employing a trained neural network . the algorithm uses the orientation results of the neural network to determine a better page orientation . the algorithm finds the connected components within the page image . since some of these components can contain graphic elements , the algorithm uses a number of constraints to filter out non - characters within the page image . examples of the constraints are the number of pixels exceeds a predetermined threshold ; both width and height are large enough ; the ratio of height to width does not exceed a predetermined threshold ; the ratio of the number of black pixels in the connected component to the area of its bounding box is not too large or too small ; the size of the component does not approach the size of the page ; and the number of transitions from white to black and back along a line crossing the character in either horizontal or vertical direction is not too large . some of the components passing this test may contain glued characters , pieces of broken characters , and the like . in an embodiment , assuming reasonable image quality , a statistically meaningful majority contains individual characters . the algorithm proportionally scales of each of the components to fit into a gray - scale square of 20 by 20 pixels . the algorithm then adds a 2 pixel white margin around the gray - scale square and sends the resulting 24 × 24 image to a trained feed - forward neural network for orientation detection . the neural network used in the algorithm , in an embodiment , has a preprocessing layer that converts the 576 inputs into 144 features . the features pass through two hidden layers of 180 and 80 nodes , respectively . the result of the neural network is four outputs indicating confidences in “ up ”, “ down ”, “ left ”, or “ right ” orientation . this neural network with its rather distinct preprocessing using gabor wavelets has been described in the papers , “ a subspace projection approach to feature extraction : the two - dimensional gabor transform for character recognition ”, neural networks , 7 ( 8 ), pp . 1295 - 1301 , 1994 , and “ neural network positioning and classification of handwritten characters ”, neural networks 9 ( 4 ), pp . 685 - 693 , 1996 . the training of the neural network is not a part of the run - time algorithm and is performed off - line using scaled characters from common business fonts , such as , for example , arial , times roman , courier , and the like . next , the algorithm decides whether to accept the orientation having the highest confidence level . the algorithm decides based on confidence ratios that exceed predetermined thresholds . for increased or maximum accuracy , in an embodiment , the analysis of the page utilizes the components found within it . typically , for most text pages a small percentage of the components is sufficient to make a confident decision . to achieve a reasonable tradeoff between accuracy and speed , the page is divided into several sets of stripes . the stripes in each set are distributed over the page to make the selection of components quasi - random . if , in an embodiment , the number of good connected components in the first set exceeds a predefined number and the votes confidently determine the winning orientation , the algorithm returns the result . otherwise , the next set of stripes is processed , then the next , etc ., until the end condition is met , or until all or a predetermined percentage of the components on the page have been examined . recognition of character shapes becomes more difficult as the font size and resolution become smaller . for the algorithm to perform well , in an embodiment , the height of binary characters exceeds 16 pixels . the algorithm can show graceful degradation for characters up to 8 pixels in height . the algorithm , in an embodiment , may assume that the majority of connected components on the page are individual characters . embodiments of the algorithm have been trained with the latin alphabet . since there are many common shapes between latin and cyrillic as well as between the latin and greek alphabets , the algorithm also performs well for cyrillic and latin . the algorithm can be trained specifically for different character sets . an embodiment of the detect bleed - through algorithm addresses automatically detecting bleed - through on sides of scanned documents in order to perform further image processing on these pages . in an embodiment , the algorithm uses page boundary detection within front and back scanned images to approximately match side coordinates . then , the algorithm uses existing color or gray content to fine - tune the mapping . this additional step can be used because of slightly different optics and skews of front and back cameras . if residual ( unexplained ) content fall below predetermined density criterion , the algorithm determines that the page is blank . in an embodiment , the algorithm detects each side of the page against the background of the scanner . next , the algorithm runs individual blank page detection on both sides of the page to determine if one or both sides of the page are blank regardless of possible bleed - through . if one or both sides are blank , the algorithm ends . if one or both sides are not blank , the algorithm determines the main background of the page on both sides . next , the algorithm chooses the side with greater volume of content as the front side . next , the algorithm maps the back side to the front side using corresponding rectangles of the page . dark pixels with color sufficiently different from the background are marked on both sides to form mask images . the algorithm analyzes the mask images locally block by block to determine the local shift relative to the rough mapping . next , the algorithm uses a least mean squares approximation to finalize the back - to - front mapping . the algorithm cancels content on the back side within a predefined distance of darker content on the front side , and then the algorithm sends the residual image to the blank page detection step . an embodiment of the color detection algorithm detects the color content in a scanned image and distinguishes between the foreground and background color . the algorithm eliminates the background color if it is the most predominant color in the document . the algorithm examines pixels in the scanned image and determines if the pixel is a color pixel and if the pixel is a background pixel . this determination uses the saturation and luminance levels of the pixel . in an embodiment , the algorithm converts the image from an rgb representation to a ycbcr ( luma and chrominance ) representation . the algorithm looks at the saturation component of the pixel to determine the saturation level . saturation provides a measure of the amount of color in a pixel . the higher the saturation , the more vivid the color . the lower the value , the less color the pixel contains . saturation is expressed as a number between 0 and 182 , which comes from the mathematical formulation used to calculate saturation . a user adjustable color threshold value , in an embodiment , is used to determine if a pixel is a color pixel . if the saturation value is greater than the threshold , the pixel is color , else it is not . the algorithm determines if the pixel is a background pixel . when scanner scans a document , the white or black background of the document and / or the scanner can appear as a low saturated light or dark color . for most images , the amount of background pixels is a large percentage of the total area . the color detection algorithm , in order to exclude the contributions of the white and / or black background portions of an image , uses a white background threshold , a black background threshold , and a background saturation threshold to determine background pixel membership . if , in an embodiment , the luminance of a pixel is higher than the white background threshold or lower than the black background threshold , and the saturation of the pixel is lower than the background saturation threshold , then the pixel is a classified as a background pixel . otherwise , the pixel is non - background pixel . the algorithm analyzes the non - background pixels to determine the various color contents by building a histogram of the pixels based on their saturation values . a scanner can introduce some color to the scanned image because of the lamp or the camera . a dirty camera can add color spots , for instance . if a color saturation value of a pixel is below a predetermined threshold , the algorithm determines that the pixel does not have color . otherwise , the pixel is considered a valid color . if the document contains any valid color , the document is considered a color document . an embodiment of the background smoothing algorithm reduces the number of colors within the backgrounds of an image to improve the appearance of the image as well as decreases the size of the image after compression . the algorithm clusters the colors found in the image and selects those that contain enough pixels to be considered backgrounds . the algorithm determines the co - occurrence of the background clusters to determine if two or more clusters actually represent a single background . these types of backgrounds are commonly generated by dithering or using micro - dots , which the eye perceives as the averaged color within the background . when the scanner scans the image at a high resolution , the individual colors are seen for each of the pixels . the algorithm merges the co - occurring clusters and calculates an average color for the cluster . then , the algorithm determines if backgrounds have neighboring clusters with colors that are slightly darker or slightly brighter . often , when scanning , for example , the paper going through the transport will buckle due to the rollers and forces acting on the paper , and can create shadows and highlights within the image . these shadows and highlights can be perceived as different clusters and they can be merged with the main background . the algorithm modifies the image pixel by pixel by searching the image and determining if the color of the pixel belongs to one of the background clusters . if the pixel belongs to a background cluster , the algorithm changes the pixel color to the averaged color of the cluster . the detection of scanned page boundaries algorithm automatically detects page boundaries within a scanned image ; generally , page skew detection algorithms used in the industry work reliably only for black background scanning where the contrast between very dark background of the scanner and typically white page is difficult to miss . in an embodiment , this algorithm detects the page against any background , thus , performing page skew correction and cropping even for white background scanners . since there may be very small color or gray level differences between the background of the scanner and the background of the page , the differences alone cannot be relied upon to detect the page boundary points . instead , the algorithm calculates and compares statistics collected in a small window centered on pixels of analysis . the algorithm compares these statistics to the range of the statistics collected in the corners of the scanned image , where the algorithm expects the background of the scanner . the algorithm calculates the statistics in the four corners of the scanned image . if some of the corners are not uniform , which can occur when the content of the page is close to the corner , the algorithm does not consider the non - uniform corners . if some of the corners are significantly different from the other corners , the algorithm chooses the majority of like corners . if the choice has to be made between equally plausible alternatives , the algorithm compares the corners to the background of the inside of the scanned image in order to disqualify the background of an over - cropped page . for qualifying corners , the algorithm aggregates the statistics of the scanner background for later use . the algorithm searches rows and columns of the scanned image looking for the first and last pixel with statistical properties significantly different from those of the scanner background . predetermined thresholds determine the significance of the deviations of the pixel - centered windows from the range of the scanner background . the detected first and last non - background pixels can be used to determine candidate edge points . several constraints are used to filter out outliers . for example , if searching for the left boundary of the page , the candidate edge point has immediate neighbors above and below such that the angles formed by connecting segments are within 45 degrees from the vertical and are close to each other . candidate edge points are analyzed with a variant of a least mean square approximation to find best straight lines representing the main rectangle of the page . the algorithm assigns a confidence measure to the found rectangle based on the ratio of edge points supporting the rectangle to the maximum possible number of edge points , which may depend on the size of the page , the resolution of the scan , and the like . after the algorithm determines the angle of skew , the algorithm , checks if individual edge points outside of the main rectangle of the page have enough support from their neighbors to indicate a tab or another existing deviation from the assumed rectangular shape of the page . edge points deemed meaningful are used to determine the crop lines . in case of dual scanning , the algorithm reconciles the skew angles between the front and back of the page image . if the angles of skew detected on the front side are different from that of the back side , it is likely that one of the two is wrong . in this case , the algorithm uses the angle associated with the higher confidence and recalculates crop lines for the other side . similarly , if the crop lines on the front and back significantly disagree , the algorithm reconciles the crop lines between the front and back of the page image . the algorithm considers the differences between the main rectangle of the page and its crop line to determine and remove extensions due to scanner artifacts . in an embodiment , the detection of page boundaries algorithm assumes that the background of the scanner is uniform , that variation in brightness between individual sensors over the width of the scan are not significant , and that there are very few non - functioning or badly calibrated sensors causing streaks . while certain embodiments of the inventions have been described , these embodiments have been presented by way of example only , and are not intended to limit the scope of the inventions . indeed , the novel methods and systems described herein may be embodied in a variety of other forms ; furthermore , various omissions , substitutions , and changes in the form of the methods and systems described herein may be made without departing from the spirit of the inventions . the accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of the inventions . | 7 |
as indicated above , in a cellular radio environment each cell is served by a base station communicating with multiple mobile stations . the setup channel is a full duplex channel with separate frequencies in the forward ( base to mobile ) and reverse ( mobile to base ) directions . the forward setup channel is used by the base station to transmit messages to the mobiles . this channel is a broadcast channel in which all the mobile stations can receive all the messages transmitted from the base station . the reverse channel is a random contention multiple access channel , in which mobile stations may transmit messages to the base station with relatively little coordination . in the present embodiment of the invention , a new multiple access protocol is used in the setup channel . as shown in fig1 both the forward channel 10 and reverse channel 11 are divided into timeslots . the forward and reverse channel time slots are arranged in such a way that after a mobile station transmits a burst 12 on reverse channel 1 , an acknowledgement burst 13 from the base station will be transmitted and received by the mobile station before the mobile transmits burst 14 . the time slots need not occupy the complet channel , duration not used by the forward or reverse channel can be allocated to other services or form other pairs of time division multiple access channels . for each burst of transmission in both directions , two fields are used to support the multiple access protocol . in the forward direction , these are the forward access / acknowledgement ( faa ) field 15 and the forward “ more ” ( faa ) field 16 . in the reverse direction , these are the reverse access / acknowledgement ( raa ) field 17 and the reverse “ more ” ( rm ) field 18 . in the reverse channel , the raa field carries an abbreviated identifier of the mobile station . this identifier need not uniquely identify the mobile station as long as the probability of mis - identification is much less than the probability of correct identification . if the identifier in the raa field does not uniquely identify the transmitting mobile station , the rest of the message must contain a full identifier which will uniquely identify the mobile station . messages in either direction may be of one or more bursts ( words ). the rm is a binary field which is set of open if the current message is not continued on the next burst , otherwise the rm is set to reserved . in the forward direction , the faa field is sued to reflect the result of access in the last received slot in the reverse channel . if the last received slot i the reverse channel contained a successful transmission burst , the faa will provide an acknowledgement code which is the same as the content of the raa field of the last slot received by the base station . if the last reverse channel slot received is idle , the faa will contain a distinct idle code which is different from all possible abbreviated identities of mobiles . if multiple mobile stations transmitted in the last reverse channel slot resulting in mutual destruction of the collided messages , a distinct collision code which is different from all possible abbreviated mobile identifies will be transmitted . the fm field holds a the binary value representing either an open or reserved state . the value or state representing open indicates the next reverse channel slot is available for contention access . the value representing reserved indicates the next reverse channel slot is reversed for the mobile station whose abbreviated identifier is transmitted in the faa field of the current forward burst . the base station will set the faa and fm fields according to the result of the last reversed slot , as follows : a mobile station with a message to send to the base station will use the following algorithm to determine when to transmit , as best shown in fig2 ( d ); 1 ) wait until the fm field indicates the next slot is open for contention . 2 ) transmit the first word of the message in the next reverse slot with raa set to the mobile station &# 39 ; s abbreviated identifier . 3 ) in the next forward burst check if the faa field is equal to the mobile station &# 39 ; s abbreviated identifier , as an example of implementation , the faa can be assigned a 7 - bit field which can hold an arbitrary value ranging from 0 to 127 ( decimal ). the abbreviated identifier uses the last two digits of the telephone number of a mobile station . the valid abbreviated identifier therefore can range between 00 ( decimal ) to 99 ( decimal ). the idle and collision codes for the faa field must be set to number that are greater than 99 , since numbers 00 to 99 are reserved for abbreviated identifiers . in this embodiment , an idle code field number of 120 ( decimal ) and a collision code filed number of 127 ( decimal ) is used . it will be understood by those knowledgeable in this art that the above idle and collision codes are arbitrary and may be assigned differently . the raa field can have the same - length as the faa with a valid abbreviated identifier range of 0 to 99 decimal . both the rm and fm can be assigned a one bit filed with 0 indicating open and 1 indicating reserved . fig2 ( a ) shows a successful transmission of bursts without collisions . in the forward channel 20 , bursts 21 and 22 are transmitted and received to and by mobile stations a , b and c . mobile a sends a burst 23 to the base station . it contains an abbreviated identifier raa = 72 i . e . the mobile &# 39 ; s last two telephone number digits and a reverse field rm = 0 indicating only one burst is sent . in the acknowledgement burst 24 sent by the base station , on the forward channel , the faa filed indicates that transmission was received since station &# 39 ; s a abbreviated identifier is transmitted . the fm field is set to 0 indicating to all mobiles that the next reverse channel slot is available for contention access since only one burst was to be sent by station a . upon receiving burst 24 from the forward channel , mobile station b identifies that the reverse channel is available and sends a burst 25 having a field with the identifier raa = 37 and rm = 1 . a field with rm = 1 indicates that at least one additional burst will be transmitted . the next burst 26 sent on the forward channel 20 by the base station includes an acknowledgement field identifier faa = 37 and a reserved field fm = 1 indicating to all mobiles that the next burst is reserved for the mobile with id 37 . upon receiving burst 26 , mobile station b identifies that the previous burst was successfully received by the base station and sends burst 27 , again including the identifier raa = 37 and reserved field rm = 1 . the base station responds again in the forward channel with a similar burst 28 . mobile station b sends it last burst 29 for that message . the burst includes the same identifier field raa = 37 but includes a field rm = 0 indicating that again the next reverse channel slot will be available for contention access . the base station responds with a burst 30 indicating to all mobiles that the next reverse channel slot is now available for contention access . if no mobile station sends a burst , the next two bursts 31 and 32 from the base station indicate the status of the channel as being idle . fig2 ( b ) shows a burst transmission scenario in which a collision destroys messages from mobile station b and c . a subsequent successful retransmission of the messages is also shown . upon receiving burst 40 from the base station indicating that the channel is idle , station b sends burst 41 and station c sends burst 42 . since both are sent simultaneously , a collision occurs resulting in destruction of the bursts . at the base station , a stats burst 43 indicating that a collision has occurred is transmitted . upon receipt of burst 43 , transmission from both mobiles is terminated . after a randomly selected delay , both mobile stations will try a retransmission of a burst . in the example of fig2 ( b ), mobile station c is the first to retransmit its burst after identifying that the channel is idle again . in this example , a one - word message is sent by station c . again after a random delay , mobile b sends its message , which consist of a two - word message , i . e . bursts 44 and 45 . fig2 ( c ) shows a burst transmission in which a prospective collision event results in the successful transmission of one message to the base station but the loss of the other burst . this is reflected in the next burst transmitted by the base station with the faa code set to the abbreviated identifier of the successful mobile station ( i . e . station a ). the above scenario can occur even though both messages where sent at the same time . this is possible if the burst of one station is of much greater relative power than that of the other station . the burst from the station having lower power will be discarded as noise by the base station . in fig2 ( c ), station a transmits burst 50 and station b transmits burst 51 . since the base station &# 39 ; s acknowledgement burst includes identifier 72 , station a identifies a successful transmission . however , station b identifies an unsuccessful transmission and therefore terminates the transmission of its second burst . after a random delay , mobile station b will retransmit its message , i . e . bursts 52 and 53 . a typical cellular system 60 in which the present invention may be used is disclosed in fig3 . the cellular system 60 is connected to a public telephone network central office ( co ) 62 . the area served by the cellular system 60 is typically divided into multiple cells 64 . each cell 64 is served by a base station 66 . the base stations 66 are connected to a mobile telephone exchange ( mtx ) 68 via trunk lines 70 that are used to carry both traffic and signaling information . each cell 64 serves a large number of mobile stations 72 of which only a small fraction would be engaged in conversation at any one time . the mobile telephone exchange 68 is connected to the central office 62 via a trunk line 74 . the present invention is used in the set - up channel between the base station 66 and a mobile station 72 . similarly , it could be used in the communication access channel of trunk line 70 between base station 66 and the mobile telephone exchange 68 . also , between mtx 68 and the central office 62 . the protocol of the present invention is thus not limited to either wire or wireless based communication access channels . therefore , it will be understood to those knowledgeable in the art that , while the invention has been described with reference to a particular embodiment , modifications may be made without departing from the spirit or scope of the present invention . | 7 |
referring now to the drawings and in particular to fig1 - 3 , there is shown a harvester ( 100 ) such as may be utilized for harvesting corn or other crops . the harvester ( 100 ) includes a chassis ( 102 ) and a head ( 104 ). the head ( 104 ) is at the front of the harvester with transversely spaced apart gathering assemblies ( 106 ) aligned with the rows . as the harvester ( 100 ) travels along the rows , it removes and gathers ears of corn and separates them from the corn stalks . the harvested crop is generally transported from the head ( 104 ) inward to the center of the head ( 104 ) by a cross conveyor , generally configured as a rotary auger ( 108 ) extending generally horizontally and transverse to the direction of travel . the auger ( 108 ) includes a helical blade ( 110 ) and a center core or shaft ( 112 ) about which the auger ( 108 ) rotates . the auger ( 108 ) includes a left side helical blade and a right side helical blade that wind around the center shaft in opposite directions . therefore , upon rotation of the auger ( 108 ) in one direction , the blades push material toward the center . as shown in fig4 , a gathering assembly ( 106 ) directs the corn rearward to the auger ( 108 ). the auger ( 108 ) includes a pan ( 20 ) extending generally below and to the rear of the auger ( 108 ). as used herein , the term “ longitudinal ” refers to a direction running generally along the length of the auger ( 108 ) parallel to the shaft ( 112 ) and rotational axis of the auger ( 108 ). the terms “ lateral ” and “ laterally ” refer generally to a direction transverse to the longitudinal direction . the terms “ radial ” and “ radially ” refer to a direction extending relative to a point at or near a center of curvature of a generally curved section of the pan ( 20 ) or from the core or shaft ( 112 ) of the auger ( 108 ). referring to fig5 - 7 , the auger pan ( 20 ) has a rear wall ( 22 ) and a lower generally upward curving trough section ( 24 ). the trough section ( 24 ) includes a front quadrant ( 26 ) and a rear quadrant ( 28 ). the corn enters the auger through a front entry ( 30 ) above the upper edge of the front quadrant portion ( 26 ) of the pan ( 20 ). the auger pan ( 20 ) includes one or more projections extending radially inward and generally positioned at the rear quadrant ( 28 ). in the embodiment shown , the pan ( 20 ) includes two radially inward extending ridges including an upper ridge ( 32 ) and a lower ridge ( 34 ). the ridges ( 32 ) and ( 34 ) extend longitudinally along the length of the auger pan and around the auger ( 108 ). although the pan ( 20 ) is shown with two ridges ( 32 ) and ( 34 ) it can be appreciated that the present invention may also include a single ridge or more than two ridges . the projections are shown as being flattened radially inward extending peaks but the angle may be sharper or shallower . moreover , the projections may also be rounded bumps or flanges or other radially inward extending structures that provide a level of lateral / radial resistance to the material being transported . the pan ( 20 ) may also be configured with other contours such as radially outward extending ridges that resist lateral or radial movement and promote movement of materials longitudinally along the auger ( 108 ). in operation , the separated ears of corn are delivered from the gathering assembly ( 106 ) rearward through the entry ( 30 ) of the auger ( 108 ) and fall into the trough ( 24 ) of the auger pan ( 20 ). as the auger ( 108 ) rotates , the helical blade ( 110 ) generally urges the ears of corn along a lower trough portion ( 24 ) of the pan ( 20 ). in order for the helical blade ( 110 ) to efficiently move the ears , the ears must have some lateral / radial resistance or the helical blade lifts the ears upward until the ears slide off the blade or are lifted over the shaft ( 112 ) and fall back to the bottom of the trough ( 24 ) with little movement longitudinally along the length of the auger ( 108 ) towards the center of the head ( 104 ). however , by adding inward projecting contours ( 32 ) and / or ( 34 ), the ears of corn engage the ridges ( 32 ) and ( 34 ) are then pushed by the blade ( 11 ) while the ridges ( 32 ) and ( 34 ) prevent sliding up the rear quadrant ( 28 ) and / or rear wall ( 22 ). ears of corn engaging either of the ridges when engaged by the helical blade ( 110 ) have a lateral or radial force component as well as a longitudinal force component from engagement by the angled surface of the helical blade ( 110 ). however , the projections ( 32 ) and ( 34 ) impede radial movement of the ears of corn . therefore , the longitudinal component acts on the ears of corn and the helical blade ( 110 ) moves the ears along the auger ( 108 ) towards the center of the harvester ( 100 ). it can be appreciated that although the ridges ( 32 ) and ( 34 ) extend radially inward , a balance must be struck between extending too far in and causing clogging , and not extending inward far enough , in which case the ears would simply slide over the ridges and not move efficiently along the length of the auger towards the center . it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . | 0 |
the present invention facilitates creation of a new global marketspace for arranging loans by bringing borrowers of capital and lenders of capital together , on - line , in real - time . the exemplary embodiment encompasses proprietary software , computer hardware , telecommunications ( specifically , a global information network such as the internet ) and encrypted data transfer . it is contemplated , however , that other telecommunications facilities may be used , for example , a dedicated dial - up connection to the company &# 39 ; s server . one aspect of the exemplary embodiment of the invention is a web site that may be viewed by both borrowers and lenders . with reference to fig1 the web site functions to bring borrowers or clients 110 seeking capital and lenders 120 who provide capital together by utilizing proprietary software 100 , which has been designed to facilitate real - time interactivity via the internet . the invention has been modeled to foster a competitive environment among myriad lenders for the benefit of a borrower seeking capital . utilization of the model benefits borrowers because it creates competition among lending sources for a single lending opportunity . the competitive forces that the model fosters tend to cause lending sources to reduce margins and improve terms , thus benefiting the borrower of capital . the three areas of concentration that the exemplary embodiment of the invention operates in are equipment lease finance , commercial real estate finance and select bank lending . the computer system uses an extensive database of capital sources including lending sources &# 39 ; requirements for various loan types , locational preferences , minimum and maximum loan amounts and terms . this database of lending sources is used by the subject invention to match loan requests from borrowers with the preferences of the lending sources . the subject invention empowers borrowers with more access to global capital sources than the current marketplace process offers . because a summary of the borrower &# 39 ; s loan request is made available to more lending sources via the internet than the borrower could reach on his own , the interactive on - line , real time bidding model of the present invention creates a stable of lending sources seeking to fund the same project . when several lending sources looking at the same potential loan are combined with an interactive on - line , real time market that dynamically moves price and terms to more efficient levels , the borrower has an opportunity to more easily improve the terms of his loan . contrast that with the world &# 39 ; s current conventional market practices of funding loans in which terms are dictated by lending sources instead of competed over by them . as shown in fig2 once a prospective borrower visits the website and reads about the company 210 to gain an understanding of its business purpose and methods he / she makes a decision to register as a member . then , the prospective borrower has the option of inputting 224 general data about himself or herself and the project , in a registration form which is sent to a central server via the internet in an encrypted format . ( data transmissions originated in the united states utilize 128 bit encryption and non united states originated data transmissions utilize 40 bit encryption pursuant to federal law .). as an alternative to step 224 , a borrower may call to speak with a global capital specialist ( gcs ) about the company and the project . if the prospective borrower telephones the company , the gcs performs step 224 , opening a new form and filling it out . this may be done during or after the telephone call . an account number is assigned to the prospective borrower once the form is submitted . because one of the company &# 39 ; s goals is to reach prospective borrowers and lenders globally , web site visitors have the ability to communicate with the company in english initially , and in other languages ( e . g . spanish , german , french , and italian ) thereafter . once the prospective borrower completes the form at step 224 and submits it , an automatic e - mail response is generated acknowledging that a gcs will be calling . if the gcs has completed the form an automatic e - mail response is sent to the prospective borrower . at step 226 , an electronic file on the prospective borrower is created from the initial form . all subsequent communication , including e - mails , faxes , phone calls , and correspondence is entered into that borrower &# 39 ; s file . this contract management format is designed to permit accessibility by the gcs responsible for that account and his / her workmates . management 220 , shareholders 218 and third - party service providers 216 may view certain aspects of the file at step 308 . a secure record of all who access the file , when they access the file and an audit trail of the changes made is incorporated so as to provide an audit tool that notes all proper and improper changes made to the files . some data from the file , such as name , address , phone numbers , e - mail , etc . may be “ exportable ” for other purposes such as specific deal tracking , letter writing campaigns , holiday greeting cards , event invitations , telephone call list , follow up and to do lists generation . the contact management file contains a chronological summary noting all contact with the client . specific details for each deal , step 310 , are noted within a file for that deal . for example , the gcs may open a contact management file for prospective borrower x , which is established from the initial contact with him / her , to read about how the initial contact occurred in the notes section . if the contact management file or the project summary data are incomplete , the gcs completes it during the current call . the gcs then enters notes pertaining to the call and project being discussed and schedule follow up communication as necessary . follow up contact is posted to the gcs &# 39 ; s calendar automatically . lenders 214 may also register with the company using the process shown in fig3 a . at step 311 , the lender completes a form that specifies the funding parameters that he will use for various programs . once the lender has completed the form , he / she is assigned a unique number to identify the lending program . after obtaining the form from the lender , the system , at step 313 , notifies the gcs of the new lending program and the gcs reviews the lending program and works with the lender to define a lending program which fits the general parameters of the system . once the relationship develops with a borrower and a specific deal is being discussed , step 312 , the details of that deal are maintained in a sub - file of the contact management file for that client . an account number is automatically assigned to the deal . the gcs goes to that sub - file and enters detailed information about the conversation with the client pertaining to that deal . the first line of notes from that sub - file automatically posts to the notes summary section of the main file for that prospective borrower . this way , when a gcs or manager looks at the main file for prospective borrower or client x , glancing at the note section , would reveal a record of chronologically summarized correspondence . if more than one deal were pending with that prospective borrower or client , specifics about each deal would be viewable by “ clicking ” the note summary . the system , at step 316 performs an internal screening of its lending source database to create a list of prospective global lending sources that have previously indicated a willingness to see projects of the type at hand . the list automatically provides the name of the lending source ; contact name and phone numbers , contact e - mail and fax number . furthermore , by “ clicking ” on the name of any lending source , the gcs may view the entire file of the lending source . as in the case of the borrower &# 39 ; s record , a main level for each lending source provides chronologically summarized notes for all correspondence with that particular lending source . “ clicking ” on a summarized note for each deal permits viewing of the details for that deal . additionally , if data is entered in the sub - file a summary of that information is posted for viewing at the main level . once the contact file is established at step 226 , and the project file is established at step 310 , the prospective borrower and the gcs discuss the project at step 312 . if necessary , the gcs enters appropriate notations into the electronic file . if the gcs and the client agree to proceed with the transaction at step 312 , the prospective borrower executes and returns the exclusive engagement agreement and wire transfers ( or tenders ) the processing fee at step 318 . the processing fee becomes the breakup fee if the client subsequently terminates the agreement . if the prospective borrower does not execute the exclusive engagement agreement nor post the processing fee at step 318 , then , at step 322 , the project is suspended . if the prospective borrower does execute the exclusive engagement agreement and posts the processing fee , he / she becomes a client at step 318 . at step 320 , the gcs obtains from the client the documents that are needed to prepare the summary project data files ( spdf ) and the complete project data files ( cpdf ). this data may be provided by the client in traditional paper format or in electronic form . the gcs , at step 322 , 324 or 326 depending on the project type , reviews the client &# 39 ; s data and works with the client to put the data into a form suitable for use by the system . at step 320 , the gcs also performs basic due diligence on the project . at step 322 , 324 or 326 , the gcs prepares the on - line spdf and cpdf data files . this information may be formatted as either a hypertext markup language ( html ), portable document format ( pdf ), graphics interchange format ( gif ), joint picture experts group ( jpeg ) file or other file type that accommodates both graphics and text . the formatted file is placed on the server where it is linked to the client &# 39 ; s main file . all projects that are associated with a given client are accessible from the client &# 39 ; s main file . at step 332 , if the project is for an equipment lease transaction , the appropriate spdf and cpdf are created . if the client data are to be used for select banking or commercial real estate financing then the spdf and cpdf for those transactions are created at steps 324 and 326 , respectively . next , at step 328 , the client reviews the contents of the spdf and cpdf . if these files are acceptable , the client approves them and , at step 330 , the gcs orders the appropriate third party reports via the system . if at step 328 the files are not acceptable , the client works with the gcs until they are . after step 328 , the gcs orders the appropriate third - party reports for the project via the system at step 330 . a significant differentiating feature the present invention relative to prior financing methods is its ability to compress the lending process . one of the ways it accomplishes that is to provide all third party due diligence documentation on - line for immediate review by lending sources . a second component of the company &# 39 ; s business model that saves time is the company &# 39 ; s practice of ordering the necessary reports — the building or equipment appraisal , the engineering report and the environmental report — from third party agents at step 330 shortly after the prospective borrower is engaged as a client and approves the spdf and cpdf at step 328 . by ordering these reports at the beginning of the lending process , instead of after a lending source has been chosen , the overall time it takes to complete and fund a loan request is reduced . increasing a client &# 39 ; s timeliness of success is a unique advantage that the business model of the subject invention offers both borrowers and lenders . next at step 332 , the global lending sources who appear on the internally generated preliminary list are sent a personalized , simple e - mail stating that because “ you ” ( lending source ) had expressed an interest in reviewing certain types of loans , “ you ” are invited to preview this offering describing a ( type of loan ) for $ x , located in town , state , country . please select a link in the e - mail message to preview the project summary . lending sources that select the displayed link are taken directly to the company &# 39 ; s web site at step 214 of fig4 a , and directly to a specific project file . they are prompted to enter security codes to include name , the company &# 39 ; s name , e - mail address and project number at step 410 . if any information is entered incorrectly , the lender may either retry entry , at step 412 , or call the company for assistance . once the lending sources have completed those steps , then at step 416 the spdf is displayed on the web site . these files may contain , for example , a project narrative , condensed financial data , pictures and maps . the lender may also view any third party reports that have been received . in addition , the lender may choose to submit a request for quote ( rfq ) or register to participate in the final quote event ( fqe ). finally , from step 416 , the lender may view the legal details of the deal at step 426 . this entry point may be used after the fqe to prepare and review the legal documents that conclude the transaction . at steps 418 , 420 and 422 , if the lender asks to preview the respective spdf , cpdf and third party reports , these reports may be displayed on screen , saved to their file , and / or printed it out at the respective steps 430 , 434 and 440 . after reviewing and / or downloading the spdf at step 430 , the cpdf at step 434 or the third party reports , at step 440 , the lender , at step 432 , 436 and 442 , respectively is asked if her or she would like to submit a preliminary quote by filling out a request for quote ( rfq ) form . the lender may also request the rfq form directly from step 416 via step 424 . if the lender requests the rfq for by any of these means , then , at step 438 the appropriate rfq form : equipment lease ( el ), select banking ( sb ) or commercial real estate finance ( cref ), is presented to the lender . referring to fig4 b , at step 438 and based upon the information in hand , the lender can submit a preliminary quote on line via the web site by entering the loan terms they would offer on the request for quote ( rfq ) form , for either commercial / resort real estate , steps 448 and 454 , equipment leasing , steps 444 and 450 , or select bank loans , steps 446 and 452 . next at step 456 the quotes submitted by the lending sources are posted to the project file , and a summary is posted to the main correspondence section of each lender &# 39 ; s file . when viewing the project files , company personnel and management are able to call up responses from lending sources that have quoted on a specific project . additionally , when reviewing a lender &# 39 ; s file for volume or for responses to rfq &# 39 ; s , management can review all responses that each lending source has provided since being contacted initially . referring to fig4 a , if the lending sources determine that they need more information than what is available to them via the spdf , they have the option , at step 416 , of downloading the cpdf , which includes a complete financial information file for the project , by clicking the appropriate “ button ” for commercial / resort real estate , equipment leasing or select banking lines of credit and loans . financial information , including , three years of trailing balance sheet and profit and loss data , as well as current rent roll summaries , projected cash flow and a current year operating budget are available for downloading . the complete financial information file is formatted on financial reporting software provided by a strategic partner , and not on software developed by the company . the strategic partner &# 39 ; s software is contained within the complete project data file associated with the specific project that lending sources are requesting to review . exemplary financial reporting is available from argus or moodys . when downloading the financial information contained within the cpdf at step 434 in the format of the strategic partner , if the lending sources do not have the software , they receive a “ trial ” version from the strategic partner . once downloaded onto their computer , the “ trial ” version permits the lending sources to utilize the strategic partner &# 39 ; s software to open , read , manipulate , print out and save the complete financial file on the project that they downloaded from the company . the strategic partner is simultaneously notified of any lending sources , that have received the “ trial ” version , and those lending sources become prospects for the strategic partner to sell one or more complete copies of its software . the strategic partner receives the lender &# 39 ; s name , contact name , phone number , e - mail address , etc . automatically without the company having to take the time and assign someone on staff to transfer that data to the strategic partner . the company then opens a file on its server to track information on this lending source and on all lending sources who have received leads and have subsequently downloaded the “ trial ” version of the software . if lending sources need additional historical records such as appraisals on buildings and equipment , environmental and engineering reports , subject company data , additional photographs , comparable market data ( for real estate ), management contracts and other due diligence documentation , they may obtain it from the cpdf . lending sources effectuate accessibility to the file once the appropriate security hurdles are cleared . these documents are formatted as a single encrypted , compressed file , which requires a password to open . an index notes which documents are formatted , for example , as pdf files and which ones are formatted as third party software files . in the exemplary embodiment of the invention , the pdf files do not permit modification by lending sources , but the third party financial files are designed to permit modification . lending sources that submit rfq &# 39 ; s have their responses transmitted to the company via the internet at step 456 and filed under the project and under the lending sources &# 39 ; files . the spdf that the lending sources review when responding to the initial e - mail contains a cover letter thanking them for their interest in financing the project and explains to them the procedure and timelines for submitting their rfq . compliance within the time schedule is critical . all lending sources that respond with a preliminary quote within the timeline established have their responses posted to a file for comparison to other lending sources &# 39 ; responses . at step 458 the system determines if the rfq &# 39 ; s have been received by the deadline . lending sources that quote after the response date are posted to the same file but to a section noting their response was received after the bid submission date . if all of the rfq &# 39 ; s are late , the gcs consults with the client , at step 460 to determine whether these submissions should be considered . the gcs responsible for the transaction assesses the various rfq &# 39 ; s at step 462 and causes the system , at step 464 to prepare a report . this report is then reviewed by the gcs and his / her supervisors . once the report is approved , the gcs , at step 468 , communicates with the client in person , on - line or by telephone to discuss the responses from the various lending sources . statistical information is also made available to the client at step 468 in the form of a report noting the number of e - mails sent , lending sources &# 39 ; response timeline , whether the responses were in compliance with the terms sought by the client according to the various components of their quotes . for example , were 100 % of the responses at or less than the interest rate sought by the client ? what percentage of the loan amounts offered by the lending sources were less than , equal to or greater than the amount sought by the client ? the statistical data is part of the report issued by the company to the client . the report also contains the company &# 39 ; s suggestions noting which lending sources to invite to the interactive on - line , real - time final quote event ( fqe ). at step 510 of fig5 a , the system allows the client to select which lending sources will participate in the fqe . once the lending sources have been selected they are transmitted back to the company at step 512 . at step 514 , the lending sources that were selected by the client are reviewed by the gcs and company management and , are notified as to the date and time and the procedure for participating . ( all business days are based upon the us business calendar and times are eastern standard time , est .) the lending sources that are not selected are notified and an appropriate reason is given . respective form letter responses allowing for customization are generated by the system and forwarded to the gcs at steps 516 and 518 . the gcs and company management again review the selection of lending sources that will participate in the fqe . if they want to make changes , then , at step 522 , the gcs and / or company management can add or delete lending sources from either or both of the sets of “ winning ” or “ losing ” e - mail messages . at step 524 , the modified e - mail message sets are sent to the client for approval . after step 520 or 524 , the “ winning ” and “ losing ” e - mail messages steps 526 and 528 , respectively , are sent to the lending sources . the correspondence is posted to the lending source &# 39 ; s files and to the project correspondence file . as shown in step 532 of fig5 b , the winning e - mail messages contain the fqe procedures and the date and time of the event . the losing e - mail messages invite the losing lending sources to track the event progress by viewing , but not participating , in the fqe . after the winning and losing e - mail messages have been sent , the rfq report listing the client , the company team members who will conduct the fqe and the participating lending sources is posted on the web site for the client and gcs to view ( lending sources are not permitted to view the list ). in addition , an interim notice is e - mailed reminding the lending sources of the date and time for the fqe . the gcs is prompted by an automatic reminder from his / her networked calendar to verify that the winning lending sources were notified of the fqe , and to answer any questions they might have before the event . if lending sources have not previously downloaded the cpdf , or additional historical records pertaining to a project , they can do so between acceptance of their rfq the and the fqe date by logging on to the company web site , as described above . this is illustrated by step 536 in fig5 b . during this time , lending sources may conduct initial or additional due diligence . because this model rewards lending sources that perform with greater efficiencies and penalizes those who cannot improve their response times , lending sources that have prepared for the fqe should perform well when compared to those lending sources that did not . the fqe is conducted via the internet on the company web site . participants include the rfq winning lenders , the client and invited guests , if any . access by participants to the project is permitted once his / her name , company name and e - mail address and project number are entered . the lending source logs in at step 538 , the client logs in at step 540 and the company team member logs in at step 542 . at a predetermined time , the fqe begins . at step 544 , during the fqe , each lending source sees , on their screen the components of their rfq and beside it the “ best ” components of the loan quote taken from other rfq &# 39 ; s . this split screen permits a lending source to see how their rfq fares in comparison to each component making up the loan quote . a correspondence or “ chat ” section facilitates communication between individual lending sources and the team member or gcs , who views the process at step 548 , in a secure , private way that other lending sources and invited guests can not see . the option to permit the client to “ see ” what the company “ sees ” on its screen or screens at step 546 is desirable in the case where a client wants to watch the bid event from a remote location . a voice link with each lending source may also be used . at the company office , each lending source &# 39 ; s activity is viewable on one or more monitors in the conference room . while the company conducts the fqe , at step 550 of fig5 c , the client views the activity and interacts with the gcs and any lending source it chooses to . after a predetermined time has elapsed the client makes his final selection , at step 554 the lending source with the “ best ” quote is selected . the client also chooses a “ runner - up ,” and the session is closed . the lending sources not selected are immediately notified by letter and / or e - mail describing the “ winning ” bid terms . they are thanked for their participation and told that they will be notified of the next event . the winning lending source and runner - up are e - mailed a company award & amp ; commitment ( a & amp ; c ) letter at steps 558 and 556 , respectively . the a & amp ; c letter contains the terms committing the lending source to book or block deal funds for a date certain closing . the winning lending source negotiates with the client through e - mail messages transmitted through the system at steps 560 and 562 until both the lending source and the client approve the terms of the a & amp ; c letter . at this point , the lending source electronically executes the a & amp ; c letter , at step 564 of fig5 d , and sends it back to the company . upon execution and return of the a & amp ; c letter a copy is filed , at step 566 , in the respective files for the client , project and lending source files . at step 568 , a wire transfer of a “ good faith ” payment is sent by the client directly to the lending source or to the escrow agent , depending on the terms of the agreement between the client and the lending source . if the third party reports had not been completed prior to the fqe , the winning lending source is notified when they will be available to him / her to complete his / her due diligence . because those reports were started shortly after the exclusive engagement agreement was executed , their completion should coincide with the fqe or be available before the event begins . when available , those reports are posted on - line and the lending source is notified of their availability . at steps 570 and 572 , for equipment leases ; 574 for select loans ; and 576 for commercial real estate loans , the legal documents are prepared by the lending source and sent to the client . the company uses standard legal documents that may be utilized with or instead of lending source &# 39 ; s legal documents . the client , the company and the lender complete the documentation as agreed between all parties at steps 578 and 580 . at step 582 , the loan is funded , and the company is compensated . at step 584 , the system automatically generates the tombstone announcement and posts the announcement to the web site as a completed project . at step 586 of fig5 e , the system prepares a bulk e - mail of the tombstone announcement for review by the gcs and company management . when the e - mail announcement is approved at step 588 , it is sent at step 590 . finally , at steps 592 and 594 , all of the transaction documents are compiled , for example , in a single pdf file which is reviewed and approved by the company , the lending source and the client . this document is then “ burned ” onto a writeable medium such as a compact disk read - only memory ( cdrom ), at step 596 , copies of which are sent to the lending source and the client . in addition , the company maintains a copy in its archives . internally , the company performs a best practices review of the transaction and prepares internal comments for staff to comment upon . it is contemplated that this invention may be implemented in computer software residing on a computer readable carrier such as a magnetic or optical disk or as a radio - frequency or audio frequency carrier wave . while the invention has been described in terms of an exemplary embodiment , it is contemplated that it may be practiced as described above within the scope of the attached claims . | 6 |
fig1 is an equivalent circuit diagram showing a concept of hot carrier deterioration of a p - mos transistor according to simulation of the invention . in the conventional simulation , as shown in fig1 , injection of hot carriers causes change of transistor parameters in accordance with passage of time , and these transistor parameters are obtained based on a quantity of stress . according to the concept of simulation of the invention , however , the transistor parameters are maintained , and characteristics such as a drain current id and a threshold voltage vth which are changed by the hot carriers are represented by an equivalent circuit using a current source 1a of a voltage control type . the concept of the invention is also characterized in that parameters characterizing the characteristics of voltage control type current source 1a are determined by a preliminary experiment with the hot carrier stress . further , the concept is characterized in that the parameters which are changed by the hot carrier stress are selected and the hot carrier deterioration is simulated using a correlation between these parameters . fig2 shows a relationship between drain voltage vd and threshold voltage vth measured in an fwd mode after hot carrier deterioration caused by applying a stress voltage to a p - mos transistor . in fig2 a stress was applied for 0 second , 10 seconds , 100 seconds , 1000 seconds and 10000 seconds under the condition of vd =- 6 . 0v and the condition that achieves a maximum value of gate current ig . from the graph of fig2 it can be found that threshold voltage vth is represented as a linear function of drain voltage vd expressed by the following formula ( 1 ) in the graph of fig2 intersections of each line and vth axis correspond to flat band voltages vfb , and a gradient of each line corresponds to a dibl ( drain induced barrier lowering ) effect u by the drain voltage . it can be seen from fig2 that flat band voltage vfb changes depending on the stress time , but the dibl effect σ is constant ( gradient of each line is constant ). therefore , variation avth of threshold voltage in the fwd mode is expressed by the following formula ( 2 ): in fig3 a relationship between variation δvfb of the flat band voltage and the stress time in the fwd mode is plotted on a log - log scale . in fig3 v , - 4 . 5v , - 5v , - 5 . 5v and - 6v were applied as the drain voltage during a stress period . gate voltage vg was applied under the condition that gate current ig attained a maximum value for maximizing the hot carrier variation . it can be seen from the graph of fig3 that variation δvfb of the flat band voltage can be expressed by the following formula ( 3 ) which is similar to the formula ( 102 ): where a and n are coefficients depending on manufacturing process conditions of the transistor and stress conditions . therefore , by defining , for example , that lifetime τ of a transistor expires when ( δvfb ) r attains to 10 mv , lifetime τ can be expressed by the following formula ( 4 ). fig4 is a graph showing a relationship between lifetime τ and gate current ig , and it can be seen that lifetime τ can be expressed by the following formula ( 5 ) similarly to the formula ( 105 ): therefore , coefficient a in the formula ( 3 ) can be expressed by the following formula ( 6 ) similar to the formula ( 107 ): therefore , variation avfb of the flat band voltage can be expressed by the following formula ( 7 ) similar to the formula ( 109 ) by extracting coefficients b , m and n in the formula ( 7 ) by a preliminary experiment , simulation can be performed to obtain flat band voltage vfb after the hot carrier deterioration or threshold voltage vth in the fwd mode of the p - mos transistor . more specifically , in the fwd mode of the embodiment 1 , threshold voltage vth after the application of stress can be simulated with high accuracy by changing flat band voltage vfb by δvfb , because dibl effect σ does not change . fig5 shows a relationship between threshold voltage vth and drain voltage vd which were measured in the rev mode when a stress voltage was applied in the p - mos transistor to generate the hot carrier deterioration . the stress conditions in fig5 are the same as those in fig2 . in the graph of fig5 the gradients of straight lines increase as the stress time increases . thus , it can be seen that the absolute value of dibl effect σ in the formula ( 1 ) increases as the stress time increases . therefore , variation δvth of threshold voltage in the rev mode is expressed not by the formula ( 2 ) but by the following formula ( 8 ). from comparison between fig5 and 4 , it can be found that flat band voltage vfb changes by the same amount of δvfb depending on the stress time in both the fwd and rev modes . thus , it can be found that the change by δvfb of the flat band voltage is based on the oxide film trap of electrons caused by hot carrier injection . therefore , variation δvfb of the flat band voltage in the rev mode can be obtained similarly to the embodiment 1 . by taking variation δvfb of the flat band voltage thus obtained as well as variation δσ of the dibl effect into consideration , it is possible to obtain variation δvth of the threshold voltage in the rev mode after the hot carrier deterioration based on the formula ( 8 ). thus , in the rev mode of the embodiment 2 , vth in the rev mode after the hot carrier deterioration can be simulated with high accuracy by taking variation δvfb of the flat band voltage depending on the stress time as well as variation δσ of the dibl effect σ depending on the stress time into consideration . fig6 shows a relationship between variation δvfb of the flat band voltage and variation δσ of the dibl effect in the rev mode which was found when the hot carrier deterioration was caused by application of the stress voltage in the p - mos transistor . as the stress conditions , drain voltage vd of - 4 . 5v , - 5 . 0v , - 5 . 5v or - 6 . 0v was applied . gate current vg was applied under the conditions that gate current ig attained a maximum value . from fig6 it can be seen that δvfb and δσ are expressed by the following formula ( 9 ) regardless of a value of drain voltage vd . where coefficient c1 depends on manufacturing process conditions , a thickness of a gate oxide film and a gate length . from a relationship between the formulas ( 8 ) and ( 9 ), variation δvth of the threshold voltage in the rev mode can be obtained from the following formula ( 10 ): therefore , simulation can be performed to obtain variation δvth of the threshold voltage by obtaining variation δvfb of the flat band voltage , which can be obtained by extracting coefficients b , m and n in the formula ( 1 ) described in the embodiment ( 1 ) by the preliminary experiment , and by determining coefficient c1 in the formula ( 9 ) by the preliminary experiment . thus , in the rev mode of the embodiment ( 3 ), threshold voltage vth after application of the stress can be simulated with high accuracy only by obtaining δvfb , if the preliminary experiment is performed to determine coefficient c1 which determines a relationship between variation δvfb of the flat band voltage and variation do of the dibl effect . fig7 shows a relationship between effective channel length leff and dibl effect o in the p - mos transistor before application of the hot carrier stress . in the graph of fig7 the relationship between leff and σ is expressed by the following formula ( 11 ), where a coefficient c2 depends on the manufacturing process conditions and the thickness of the gate oxide film . since the hot carrier stress may change dibl effect σ as stated in the embodiment 2 , variation δσ of the dibl effect and the formula ( 11 ) can be used to express , as the following formula ( 12 ), a shortening let of effective channel length leff which occurs due to the oxide film trap of electrons caused by the hot carrier stress : by determining coefficient c2 by the preliminary experiment , therefore , shortening let of the effective channel length can be obtained . by incorporating this let into the parameters of the p - mos transistor subjected to the hot carrier stress as is done in an embodiment which will be described layer , the change of transistor characteristics caused by the hot carrier deterioration can be simulated more accurately . thus , in the embodiment 4 , shortening let of the effective channel length can be quantitatively obtained using dibl effect σ and variation δσ of the dibl effect caused by the hot carrier stress . by utilizing this let , the hot carrier deterioration of the p - mos transistor can be simulated more accurately . in fig8 / β is plotted in connection with a difference between measured gate voltage vg and threshold voltage vth . circular , square , triangular , diamond - shaped and solid circular marks represent the measured results after the stress time of 0 second , 10 seconds , 100 seconds , 1000 seconds and 10000 seconds . β is defined in the linear region of the transistor by the following formula ( 14 ): β is used in the following model formula ( 15 ) of the drain current in the linear region , and is expressed by the following formula ( 16 ): ## equ1 ## where cox represents a capacitance of a gate oxide film , and vmax represents a saturation speed . it has been known that the carrier mobility μs can be expressed by the following formula : where u0 represents the mobility when vg is equal to vth , and θ represents dependency of the mobility on the vertical electric field . since saturation speed vmax is an invariable physical quantity which does not depend on the hot carrier stress , β in a region where . linevert split . vg . linevert split . is larger than . linevert split . vth . linevert split . by a relatively large amount can be approximately expressed as a linear function of vg , whereby a proportionality constant al of the linear function can be expressed as the following formula ( 18a ) based on the formula ( 16a ): an intercept b1 of 1 / β axis at vg = vth can be expressed by the following formula ( 18b ) based on the formula ( 16a ): based on the formulas ( 18a ) and ( 18b ), therefore , dependency θ of the mobility on the vertical electric field can be expressed by the following formula ( 19 ): in the graph of fig8 it can be seen that the proportionality constant al in the relationship between 1 / β and ( vg - vth ) changes depending on the stress time . the change of proportionality constant al depends on variation δθ of dependency θ of the mobility on the vertical electric field in the formula ( 17 ). in fig9 there is shown a relationship between variation δvfb of the flat band voltage shown in the embodiments 1 and 2 and variation δθ of dependency of the mobility on the vertical electric field . circular , triangular and square marks show the stress with drain voltage vd of - 6 . 0v , - 5 . 5v and - 5 . 0v , respectively . δθ can be calculated with the formula ( 19 ). as can be seen from the graph of fig9 there is a linear relationship between δθ and θvfb , which can be expressed by the following formula ( 20 ): where c3 is a constant depending on the manufacturing process conditions , the thickness of gate oxide film and the gate length . by determining the coefficient c3 by the preliminary experiment , therefore , it is possible to simulate variation δθ of the dependency of the carrier mobility on the vertical electric field in the drain current after the hot carrier stress , using variation δvfb of the flat band voltage obtained in the embodiment 1 or 2 . thus , in the embodiment 5 , coefficient c3 is extracted by the preliminary experiment , and thereby it is possible to obtain variation δθ of the dependency of the carrier mobility on the vertical electric field having a close relationship with the drain current characteristics after the hot carrier deterioration of the p - mos transistor . accordingly , mobility μs after the hot carrier stress can be accurately simulated based on the formula ( 17 ). as already described in connection with fig8 it is known that the formula ( 16a ) can express 1 / β in the region where . linevert split . vg . linevert split . is relatively large with respect to . linevert split . vth . linevert split .. also , dependency θ of the mobility on the vertical electric field can be obtained from the formula ( 19 ). therefore , mobility u0 at vg = vth can be expressed by the following formula ( 21 ) based on the formula ( 18a ): u0 can also be obtained from the following formula ( 22 ) using an intercept b1 of 1 / β axis at vg = vth in fig8 . in fig8 intercept b1 of 1 / β axis at vg = vth changes depending on the hot carrier stress time . it can be seen from the formula ( 18b ) that the change of intercept b1 is based on change ( leff - let ) of leff and change δu0 of u1 . change δu0 of u0 can be obtained by incorporating shortening let of leff , which is obtained in the embodiment 4 , into the formula ( 21 ) or ( 22 ). fig1 shows a relationship between change δu0 of the mobility at vg - vth obtained as described above and variation δvfb of the flat band voltage obtained in the embodiment 1 or 2 . in the graph of fig1 , circular , triangular and square marks represent the stress with the drain voltage of - 6 . 0v , - 5 . 5v and - 5 . 0v , respectively . it can be seen from the graph of fig1 that δuo and δvfb have a linear relationship , and can be expressed by the following formula ( 23 ): where c4 is a constant depending on the manufacturing process conditions , the thickness of gate oxide film and the gate length . by determining the coefficient c4 by the preliminary experiment , therefore , it is possible to simulate variation δu0 of the carrier mobility at vg = vth after the hot carrier stress based on δvfb obtained in the embodiment 1 or 2 . thus , according to the embodiment 6 , the coefficient c4 is determined by the preliminary experiment , and thereby it is possible to obtain the variation δu0 of the carrier mobility under the condition of vg - vth after the hot carrier stress , so that it is possible to simulate accurately the carrier mobility having a close relationship with the drain current of the p - mos transistor . in fig1 , a relationship between variation rate δid / id of the drain current and the stress time during the fwd mode in the linear region of the p - mos transistor is plotted on the log - log scale . for the stress conditions , drain voltage vd of - 6 . 0v and gate voltage vg achieving the maximum gate current were applied . in the graph of fig1 , circular marks represent the results of measurement with vd =- 0 . 2v and vg =- 1 . 5v , and triangular marks represent the results of measurement with vd =- 0 . 2v and vg =- 2 . 0v . solid curves represent the results obtained by the simulation . it has been known that drain current id in the linear region is expressed by the following formula ( 15 ): threshold voltage vth &# 39 ; in the fwd mode after the hot carrier stress can be expressed by the following formula ( 24 ) based on the relationship with the formula ( 2 ) in the embodiment 1 : dependency θ &# 39 ; of the mobility on the vertical electric field in the fwd mode after the hot carrier stress can be expressed by the following formula ( 25 ) based on the embodiment 5 , and the mobility u0 &# 39 ; at vg = vth can be expressed by the following formula ( 26 ) based on the embodiment 6 . therefore , carrier mobility μs &# 39 ; after the hot carrier deterioration can be expressed by the following formula ( 27 ). effective channel length leff &# 39 ; after the hot carrier stress is expressed by the following formula ( 27 . 5 ) based on the embodiment 4 : therefore , drain current id &# 39 ;. sub . ( fwd , lin ) at the linear region in the fwd mode after the hot carrier stress is expressed by the following formula ( 28 ) using vth &# 39 ; in the formula ( 24 ), μs &# 39 ; in the formula ( 27 ) and leff in the formula ( 27 . 5 ): ## equ2 ## accordingly , the drain current variation rate δid &# 39 ;/ id . sub . ( fwd , lin ) at the linear region in the fwd mode after the hot carrier stress can be expressed by the following formula ( 29 ): the solid curves in the graph of fig1 represent the results of simulation using the formula ( 29 ), and it can be seen that the results are accurately coincident with the results of actual measurement . thus , in the embodiment 7 , the drain current id at the linear region in the fwd mode after the hot carrier stress can be accurately simulated by using δvth , δθ , δu0 and leff &# 39 ; obtained by the formula ( 29 ) and the foregoing embodiments . in fig1 , a relationship between variation rate δid / id of the drain current and the stress time at the linear region of the p - mos transistor in the rev mode after the hot carrier stress is plotted on the log - log scale . in the graph of fig1 , the stress condition was that drain voltage vd of - 6 . 0v and gate voltage vg achieving the maximum gate current were applied . circular marks represent the results of measurement with vd =- 0 . 2v and vg =- 1 . 5v , and triangular marks represent the results of measurement with vd =- 0 . 2v and vg =- 2 . 0v . solid curves represent the results obtained by the simulation . in connection with the rev mode after the hot carrier stress , formulas ( 15 ), ( 25 ), ( 26 ), ( 27 ) and ( 27 . 5 ) can also be utilized . in addition to these formulas , the threshold voltage vth &# 39 ; after the hot carrier stress in the rev mode can be expressed by the following formula ( 30 ) based on the relationship between the formula ( 8 ) in the embodiment 2 and the formula ( 10 ) in the embodiment 3 . therefore , drain current id &# 39 ;. sub . ( rev , lin ) at the linear region in the rev mode after the hot carrier stress can be expressed by the following formula ( 31 ) using vth &# 39 ; in the formula ( 30 ), μs &# 39 ; in the formula ( 27 ) and leff &# 39 ; in the formula ( 27 . 5 ). ## equ3 ## as a result , variation rate δid / id . sub . ( rev , lin ) of the drain current at the linear region in the rev mode after the hot carrier stress is expressed by the following formula ( 32 ): ## equ4 ## solid curves in the graph of fig1 show the results of simulation using this formula ( 32 ), and it can be seen that the results are coincident with the results of actual measurement with high accuracy . thus , in the embodiment 8 , the drain current at the linear region in the rev mode after the hot carrier stress can be accurately simulated by using δvth , δθ , δu0 and leff &# 39 ; obtained in the formula ( 32 ) and the foregoing embodiments . in fig1 , a relationship between variation rate δid / id of the drain current and the stress time at the saturation region in the fwd mode of the p - mos transistor is plotted on the log - log scale . in the graph of fig1 , the stress condition was that drain voltage vd of - 6 . 0v and gate voltage vg achieving the maximum gate current were applied . square marks represent the results of measurement with vd =- 1 . 5v and vg =- 1 . 5v , and diamond - like marks represent the results of measurement with vd =- 2 . 0v and vg =- 2 . 0v . solid curves represent the results obtained by the simulation . it has been known that drain current id in the saturation region is expressed by the following formula ( 33 ): ## equ5 ## saturation drain voltage vdsat in the formula ( 33 ) is expressed by the following formula ( 34 ), and saturation speed region length δl is expressed by the following formula ( 35 ): internal electric field em in the formula ( 35 ) is expressed by the following formula ( 36 ), and k is expressed by the following formula ( 37 ) including a junction depth xj and a gate oxide film thickness tox : threshold voltage vth &# 39 ; in the fwd mode after the hot carrier stress is expressed by the formula ( 24 ), and mobility μs &# 39 ; is expressed by the formula ( 27 ). saturation drain voltage vdsat &# 39 ; in the fwd mode after the hot carrier stress is expressed by the following formula ( 38 ): therefore , drain current id &# 39 ; fwd , sat ) at the saturation region in the fwd mode after the hot carrier stress is expressed by the following formula ( 39 ), using vth &# 39 ; in the formula ( 24 ), μs &# 39 ; in the formula ( 27 ) and vdsat &# 39 ; in the formula ( 38 ## equ6 ## as a result , variation rate δid / id . sub . ( fwd , sat ) of the drain current at the saturation region in the fwd mode after the hot carrier stress is expressed by the following formula ( 40 ): ## equ7 ## solid curves in the graph of fig1 represent the results of simulation using the formula ( 40 ), and it can be seen that the results are accurately coincident with the results of actual measurement . thus , according to the embodiment 9 , the drain current at the saturation mode in the fwd mode after the hot carrier stress can be accurately simulated by using δvth , δθ and δu0 obtained in the foregoing embodiments and vdsat &# 39 ; obtained in the formula ( 38 ) as well as the formula ( 40 ). in fig1 , a relationship between variation rate δid / id of the drain current and the stress time at the saturation region in the rev mode after the hot carrier stress of the p - mos transistor is plotted on the log - log scale . in the graph of fig1 , the stress condition was that drain voltage vd of - 6 . 0v and gate voltage vg achieving the maximum gate current were applied . square marks represent the results of measurement with vd =- 1 . 5v and vg =- 1 . 5v , and diamond - like marks represent the results of measurement with vd =- 2 . 0v and vg =- 2 . 0v . solid curves represent the results obtained by the simulation . before application of the stress , as described before , saturation drain voltage vdsat is expressed by the formula ( 34 ), and saturation measurement region length δl is expressed by the formula ( 35 ). at the same time , internal electric field em is expressed by the formula ( 36 ), and k is expressed by the formula ( 37 ). threshold voltage vth &# 39 ; in the rev mode after the hot carrier stress is expressed by the formula ( 30 ), and mobility μs &# 39 ; is expressed by the formula ( 27 ). effective channel length leff &# 39 ; in the rev mode after the hot carrier stress is expressed by the formula ( 27 . 5 ), and saturation drain voltage vdsat &# 39 ; is expressed by the following formula ( 41 ). therefore , drain current id &# 39 ;. sub . ( rev , sat ) at the saturation region in the rev mode after the hot carrier stress is expressed by the following formula ( 42 ) using vth &# 39 ; in the formula ( 30 ), μs &# 39 ; in the formula ( 27 ), leff &# 39 ; in the formula ( 27 . 5 ) and vdsat &# 39 ; in the formula ( 41 ). ## equ8 ## consequently , the variation rate δid / id . sub . ( rev , sat ) of the drain current at the saturation region in the rev mode after the hot carrier stress is expressed by the following formula ( 43 ): ## equ9 ## solid curves in the graph of fig1 represent the results of simulation using the formula ( 43 ), and it can be seen that the results are accurately coincident with the results of actual measurement . thus , according to the embodiment 10 , the drain current at the saturation region in the rev mode after the hot carrier stress can be accurately simulated by using δvth , δθ , δuo and leff &# 39 ; obtained in the foregoing embodiments , and vdsat &# 39 ; obtained in the formula ( 41 ) as well as the formula ( 43 ). as described hereinbefore , the invention can provide the method by which it is possible to simulate accurately the hot carrier deterioration of various transistor characteristics in the fwd and rev modes after the hot carrier stress of the p - mos transistor . although the present invention has been described and illustrated in detail , it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of the present invention being limited only by the terms of the appended claims . | 6 |
now referring to the drawings , the construction of the improved hammock 10 including the modular component parts thereof for ready assembly and disassembly will be described in detail . the complete hammock 10 ( see fig1 ) comprises only three modular components for defining a hammock stand assembly , as illustrated in fig2 of the drawings . the modular components comprise two tripod - like hammock supporting leg assemblies lar and lal for storage in a fabric bag b , as illustrated in fig1 . the bag b may have handles bh for readily carrying the disassembled component parts of the hammock 10 therein . the bag b may also be provided with a shoulder strap ( not shown ) between the opposite ends of the bag b for permitting the bag to be carried on an individual &# 39 ; s shoulder by the shoulder strap . the bag b also stores the hammock bed hb and the hammock bed securing means sm , illustrated in the drawings in the form of two securing chains with a plurality of connected chain links . the securing means sm secure the hammock bed hb to the assembled hammock stand , as illustrated in fig1 for example . the bag b will also store a canopy c mountable over the assembled hammock stand , as illustrated in fig1 . the two hammock stands lar and lal are constructed identically and , therefore , only one of the tripod - like hammock supporting leg assemblies needs to be explained , as the other supporting leg assembly is identical . the tripod - like hammock supporting leg assembly la comprises two hammock supporting legs 12 and 14 pivotally secured to a shroud 15 along with a third leg 16 fixed to the shroud 15 in a preselected , fixed relationship therewith and the legs 12 and 14 . the shroud 15 has a generally u - shaped configuration and comprises two side plates 18 and 19 of a preselected configuration , as best illustrated in fig6 and 8 , integrally constructed with a rear plate 20 for securing the three legs of the tripod - like hammock supporting leg assemblies to the individual shroud 15 . the top ends of side plates 18 and 19 are spaced apart a distance to accommodate the periphery of the third leg 16 that is welded to the plates 18 and 19 , so as to extend outwardly thereof , as best illustrated in fig6 and 8 . the side plates 18 and 19 each pivotally support an individual hammock supporting leg 12 and 14 , respectively , and may be secured by means of individual spring clips 22 and 23 mounted to the outside surface of the respective plates 18 and 19 , as evidenced from examining fig7 . each of the legs 12 , 14 and 16 are preferably of a tubular construction . the legs 12 and 14 are secured to the inside surfaces of the plates 18 and 19 of the shroud 15 by means of individual fasteners 24 and 25 which in turn secure spring clips 26 and 27 , for respectively securing the legs 12 and 14 in a hammock supporting position when pivoted to such a position . the fasteners 24 and 25 are secured to the outside surfaces of their respective side plates 18 and 19 identically and , therefore , only one need be described , namely , the fastener 24 . the fastener 24 secures the spring clip 26 by means of the fastener head through a suitable aperture provided for the clip 22 and a corresponding coaxial aperture for the side plate 18 , along with aligned coaxial apertures for the leg 12 , all receiving the shank of the fastener 24 . a spacer 12s is provided for the leg 12 having a length approximately the same as the inside diameter of the leg 12 whereby the shank of the fastener 24 extends through the opposite walls of the tubular leg 12 and is secured on its outer end by means of a fastener nut 24n . in this fashion , the spring clip 26 is maintained in position overlying the outer surface of the side plate 18 for the shroud 15 . the spring clip 26 carries a securing pin 26p which is mounted adjacent the free end thereof for securing the hammock supporting position of the leg 12 when pivoted to that position from its storage or transport folded position for this purpose the side plate 18 is provided with an aperture 18p and the leg 12 is provided with a coaxial aligned aperture 12p for permitting the securing pin 26p to be mounted through the apertures 18p and 12p when the leg is pivoted against the pin 12p for maintaining it in a secured hammock - supporting position . as indicated , the spring clip 27 carries a corresponding locking pin 27p mounted with suitable apertures for the side plate 19 and the leg 14 with corresponding reference numerals , as illustrated in fig7 . similarly , the fastener 25 for the leg 14 is secured by a nut 25n at the inner end of the leg 14 . with the above construction of the legs 12 and 14 in mind , the legs may be pivoted inwardly , towards one another , for storage purposes which causes the pins 26p and 27p to be withdrawn from their respective securing apertures , such as the aperture 12p in the leg 12 , and frees them for further pivotal movement whereby they are positioned in a side - by - side relationship , as illustrated . when the legs are so pivoted for storage and transportation , they assume a side - by - side relationship and are arranged alongside the fixed leg 16 to provide a compact modular component of the hammock , as illustrated in fig1 , for example . the shroud 15 includes means for securing the securing member or chain sm therein for adjusting the elevation of the hammock bed hb above the supporting surface . for this purpose a keyhole aperture 20a ( see fig7 and 9 ) is provided at the rear plate 20 of the shroud 15 for receiving and securing the securing member sm . for this purpose the keyhole aperture 20a has an enlarged portion illustrated in the drawings as the top portion for receiving a securing member or the chain sm proper therein and is then slidable into the locking aperture 20al arranged below the receiving aperture 20ar for securing one of the links of the chain therein in accordance with the desired elevation of the head or foot of the hammock bed hb , as will be described immediately hereinafter . the shroud 15 also includes an inwardly extending lip 20l constructed integrally with the shroud 15 and arranged at the bottom end of the back plate 20 and extends a preselected distance inwardly of the plate 20 to support the lower edge of the shroud 15 . this section 20l prevents distortion of the lower shroud edge when weight is applied to the securing element sm secured in the aperture 20al . the opposite or top end of the back plate 20 is also provided with a securing aperture 20c of an essentially semicircular configuration at the end and is spaced from the secured end of the third leg 16 for securing the canopy c to the tripod - like hammock supporting leg assembly lal . now referring to fig8 - 10 , the specific structural organization for adjustably securing the securing member sm to support the hammock bed hb in a desired elevational position will be further examined relative to the design of the shroud 15 . the securing member sm is illustrated in its presently preferred form , namely , a chain having a plurality of connected links to extend between an end of the hammock bed hb and through the keyhole aperture 20a for the shroud 15 . the aperture 20a has a diameter of a size to permit the links of the securing chain sm to freely pass therethrough and then moved outwardly to the securing portion of the aperture , namely , the aperture 20al for securing the chain to provide a desired elevation for the adjacent end of the hammock bed hb . to correctly maintain the position of the chain sm and prevent it from sliding through the aperture 20al as may occur in some prior art structures , the aperture 20al is provided with a securing detent 20d , as best illustrated in fig9 and 10 , so that a selected chain link is secured against the detent 20d , as best illustrated in fig1 , to prevent the weight in the hammock bed hb or the hammock bed itself , from causing the chain sm to slip through the securing aperture 20al . the free end of the chain securing member sm will extend outwardly of the aperture 20al in a loose configuration , the length being selected in accordance with the desired elevations for the adjacent end of the hammock bed hb . the opposite end of the securing chain sm is provided with an &# 34 ; s &# 34 ; shaped hook sh with a pair of openings so that it may be coupled between an end of the hammock bed hb and the free link on the securing member sm . the free end of the securing chain sm is identified by the reference numeral 30 and is engaged with the smaller opening for the &# 34 ; s &# 34 ; hook sh identified by the reference numeral 31 in fig8 . the larger opening 32 at the opposite end of the &# 34 ; s &# 34 ; hook sh is arranged to receive a single coupling member for the hammock bed hb , as will be explained immediately hereinafter . it is understood that the present invention permits both ends of the hammock bed hb to be adjusted in elevation , independently . the remaining module element for defining the hammock stand per se is the crossover member co . the crossover member , as best appreciated from examining fig2 has a straight section intermediate its ends and each end section constructed and defined with an arcuate configuration for interfitting in a telescopic relationship with the adjoining third legs 16 for each of the pair of tripod - like hammock supporting leg assemblies lar and lal . the described interfitting relationships are illustrated in fig1 and 2 , for example . the arcuate end sections for the element co are defined relative to the third legs 16 since these legs extend outwardly and upwardly from their respective shroud members 15 so that the two legs may be readily inerfitted , and when interfitted , support the hammock stand in an upright position and any weight resting in the hammock bed hb proper . in the preferred arrangement , the opposite end sections of the crossover member co are swaged at the arcuate end sections for providing a complementary , interfitting relationship with the free ends of the third legs 16 for each tripod - like hammock supporting leg assemblies lal and lar . the interfitted relationship is best illustrated in fig4 and 5 . the swaged end sections of the crossover member co have essentially a figure &# 34 ; 8 &# 34 ; configuration seen from its free end , as is best illustrated in fig5 . for this purpose the ends of the &# 34 ; 8 &# 34 ; have longitudinally extending concavities cc at opposite sides thereof extending the full length of the arcuate sections for the crossover member co . the outside dimensions of the swaged arcuate end sections of element cc are dimensioned so as to tightly interfit with the inside wall of the associated third leg 16 ; see fig5 . for this purpose , the free end of the third legs 16 are each defined with inwardly extending securing elements 16c for receiving the ends of the crossover member co and receiving it in only one orientation and to prevent relative rotation of the secured element 16 and the end of the element co . this relationship is best illustrated in fig4 and 5 . the opposite end of the crossover member co is similarly defined relative to the remaining third leg 16 for the other tripod - like hammock supporting leg assemblies , as illustrated . this swaged configuration for the member co not only better supports the hammock stand and any weight in the mounted hammock but also allows the parts to be interfitted without the need to resort to fasteners or special tools and essentially prevents the improper insertion of the interfitted elements at both ends thereof in accordance with the desired modular configuration of the present invention for providing a kit of modular components . with the above structure in mind , the arrangement of the modular elements comprising the hammock 10 for assembly and disassembly will now be described in detail . it will be initially assumed that each of the tripod - like hammock supporting leg assemblies lar and lal have their hammock supporting legs , such as the legs 12 and 14 of assembly lal , pivoted or folded to a storage position , as illustrated in fig1 . in this folded condition , the assemblies lar and lal , the crossover member co and the securing chain sm are removed from the bag b along with the hammock bed hb for the present purposes . to assemble the hammock stand in the configuration illustrated in fig2 one of the hammock supporting leg assemblies , such as the assembly lal , as illustrated in fig1 a , is grasped so as to pivot the supporting legs 12 and 14 away from its storage position to cause the ground engaging ends of the legs 12 and 14 to be pivoted in a spaced apart relationship , as illustrated . the legs are pivoted apart until the locking pins 26p and 27p for the spring clips 26 and 27 respectively , lock the legs in an upright position , as illustrated in fig1 b . at this stage of assembly , the leg assembly lal is oriented with regard to the supporting surface to receive the crossover member co at the leg 16 , as illustrated in exploded relationship in fig1 b . the remaining leg assembly lar at this time is still maintained on the ground in its folded position . the next assembly step is the interfitting of the crossover member co and the free end of the leg 16 to assume the configuration illustrated in fig1 c . the hammock frame is completed by pivoting the legs 12 and 14 for the supporting leg assembly lar in a spaced apart relationship , as described hereabove , for the leg assembly lal ; see fig1 c . in this arrangement , the remaining end of the crossover member co is interfitted to the free end of the third leg 16 for the leg assembly lar and when so interfitted , the stand will assume the completed assembly configuration of fig2 . this provides an improved hammock stand that can be assembled by only the three modular components and is easily disassembled utilizing the steps described in reverse . in the reverse relationship , the crossover member co is freed from each third leg 16 and then the pivotable legs of the leg assemblies lar and lal are pivoted out of their secured relationship and the free ends moved towards one another wherein they lie essentially side - by - side adjacent the third leg 16 for reinsertion into the bag or carrier b . to complete the hammock 10 , the thus assembled hammock stand will have the hammock bed hb secured thereto . the hammock bed hb is illustrated in fig1 in the form of a conventional rope - style hammock bed having a head end illustrated at the left hand end of fig1 and a foot end at the right hand end of the hammock bed hb . the head end has a stabilizing bar 40 to receive the rope ends that are threaded through suitable apertures provided in the bar 40 . these rope ends are individually tied together to a single coupling element illustrated as the coupling loop 41 , so as to be secured to the &# 34 ; s &# 34 ; hook sh at the free end of the securing member sm . the open end of the &# 34 ; s &# 34 ; hook sh or the end 32 is secured to the loop 41 or the single coupling element 41 to suspend the head end of the hammock bed hb . the foot end of the hammock bed hb is not provided with a stabilizer bar , but has the ends of the ropes defining the bed secured together at one end and to a corresponding single coupling loop 42 for securing the &# 34 ; s &# 34 ; hook sh for the foot end tripod - like hammock supporting leg assembly lar . in the assembly of the hammock bed hb to the hammock stand , it is preferred to first insert the securing chain sm into the securing aperture sa with the &# 34 ; s &# 34 ; hook arranged on the inside of the shroud 15 , as illustrated in fig8 . the opposite end of the chain sm would then be secured into the detent 20d for the securing aperture 20al to secure the chain in the desired elevation , as illustrated in detail in fig1 . the hammock bed hb then can be secured to the free end of the &# 34 ; s &# 34 ; hook sh for coupling one end thereof and once the securing member for the opposite leg assembly is mounted to the respective leg assembly , the hook sh can be coupled to the coupling element 42 for the foot end of the hammock bed hb . in this fashion , the head end may be elevated readily by manipulation of the chain securing detent 20d to either pull more chain through the securing aperture 20a or to release a portion of the chain in accordance with whether the elevation of the head of the hammock bed hb is to be elevated or lowered , respectively . similarly , the foot end of the hammock bed hb may be adjusted in elevation in accordance with the desires of the user . it should be recognized that this ability to adjust both ends of the hammock bed hb may be desired for therapeutic purposes required by the hammock user with regard to the blood of the body either rising to the head or the legs . it should now be recognized that the disassembly of the hammock 10 follows the same sequence , but in reverse . the hammock bed hb may first be detached from the securing &# 34 ; s &# 34 ; hooks for storage back into the bag b , for this purpose , the hammock bed hb may be roiled up and inserted into the bag b . the leg assemblies ar and lal are removed from the co and then folded . in accordance with the present invention , the canopy c is provided for the hammock 10 to cover essentially the entire length of the hammock bed hb and one such arrangement is illustrated in fig1 . fig1 illustrates a hammock 10 embodying the present invention but having a hammock bed hb &# 39 ; that is constructed of a fabric material rather than a rope , as is conventional in the art . the hammock bed hb &# 39 ; is illustrated suspended from a single coupling element at each end , as described hereinabove . the canopy c is constructed of a length of fabric which may be a plastic fabric which has a plurality of reinforcing wooden rods spaced apart along the length thereof . for this purpose only one such rod is illustrated in fig1 and is identified as the rod 60 . a second rod spaced towards the head end of the hammock bed hb &# 39 ; may also be provided , along with reinforcing bars provided at the opposite ends of the canopy c and sewn into a hem of the fabric at the opposite ends . the rods 60 have a lengths so as to terminate in a spaced relationship with the longitudinal edges of the canopy fabric . fabric pockets may be provided to secure the rods 60 to the fabric of the canopy c . the longitudinal edges of the canopy c outside of the rods 60 may be turned downwardly , as illustrated in fig1 . each of the reinforcing rods , intermediate the ends of the canopy c , may have three canopy adjusting notches defined thereon for orienting the canopy c with respect to the hammock bed hb &# 39 ; relative to the direction of the sun or wind that is desired to mask or screen out . each rod 60 , then , has a supporting notch having a semicircular configuration arranged centrally of the bar and identified as the notch 60c with a pair of notches 60l and 60r arranged on opposite sides of the notch 60c for moving the canopy to either one side of the notch 60c or the other in accordance with the direction of the sun , for example . when the reinforcing bars 60 are mounted over the overhead tubular elements of the hammock stand and the notch 50c is engaged by the crossover member co , for example , the adjusting notches will be seated therein ; see fig1 , wherein the canopy will be symmetrically oriented with regard to the overhead stand structure and overlie the hammock bed hb &# 39 ; symmetrically . by tilting the canopy c so as to engage the notches 60l and 60r , the canopy may be oriented either to the left or the right of the symmetrical relationship of the canopy c and the hammock bed hb , as illustrated in dotted outline in fig1 for providing the desired shading for the user of the hammock 10 . one end of the canopy c may be provided with a hook for directly securing the hook through the aperture 20c for the shroud 15 to the inner wall of a leg 16 , as described hereinabove . as illustrated in fig1 , the canopy c , at the head end of the hammock 10 ( right hand side as illustrated ) has a hook - like member 62 secured to the end reinforcing rod at the head end of the canopy c for engaging the aperture 20c in the manner best illustrated in fig8 for example . the canopy hook 62 for this purpose is illustrated in fig8 as the hook 62 which merely engages the inside wall of the third leg 16 means of the access permitted by the aperture 20c . in the preferred securing arrangement for the canopy c , the opposite end of the canopy c may be provided with a similar hook that is secured to the end reinforcing rod by means of adjustable straps secured to a t - bar hook 64 , as is illustrated in fig1 . for this purpose , the t - bar hook 64 comprises a single hook - like element for securement to the leg assemblies as described hereinabove , with a cross member 64c at its opposite end secured to a plurality of adjustable straps 64s , in turn secured to the adjacent canopy reinforcing rod to permit the canopy to be longitudinally adjusted so as to be tightly mounted between the leg assemblies without any slack and to avoid being tipped off its hammock stand by winds or the like . the details of the adjusting straps are not illustrated as they are of a conventional construction . it should now be evident that the present invention provides an improved , portable hammock stand comprising three modular elements that permits the stand to be readily assembled and disassembled . the hammock stand mounts a hammock bed that can have its opposite ends adjusted in elevation and positively secured in position . a hammock canopy is also provided . all elements of hammock fit into the carrying bag , namely , the three modular elements , chains , hammock bed and canopy , for storage and portability . | 8 |
fig1 is a longitudinal sectional view of a through - type capacitor according to an embodiment of the present invention , and fig2 a detailed sectional view showing the connection of the dielectric member 1 and the central conductor 2 in fig1 . it should be noted , however , that for facilitating the understanding of the construction , the diagram of fig2 is drawn in an exaggerated form but not in actual dimensional relations . in the drawings , reference numeral 1 designates a cylindrical ceramic dielectric member made of , for instance , strontium titanate ( srtio 3 ) having the central part thereof formed with a through hole for passing the central conductor 2 . the outer peripheral surface 9 of the dielectric member 1 and the inner peripheral surface 8 , that is , the wall surface of the through hole , are galvanized with nickel to form electrode surfaces ( first and second electrode surfaces ). the inner and outer electrode surfaces and the dielectric member 1 make up a capacitor . the central conductor 2 is electrically and mechanically connected with an electrode 10 on the inner peripheral surface 8 by solder 7 . the electrode of the outer peripheral surface 9 of the dielectric member 1 , on the other hand , is connected with an earth electrode plate 3 by solder . the earth electrode plate 3 has the section thereof bent in crank as shown with armor cases 4 , 5 of insulating material embedded therein from upper and lower directions . further , in order to improve the insulation , the insulating resin 6 is injected and solidified in the armor cases 4 , 5 . in mounting this through - type capacitor on a filter case ( not shown ) of the magnetron , the earth electrode plate 3 is connected to be fixed to the filter case , so that the lower part thereof is positioned in the filter case and the upper part thereof is positioned outside the case in fig1 . in fig2 numeral 21 designates solder resist coated on the surface of the central conductor 2 at which solder is not fused with the central conductor 2 . as a result , there is a portion 11 free of solder in part between the inner peripheral surface 8 of the dielectric member 1 and the central conductor 2 . the solder is comparatively soft and plastic and absorbs the difference in thermal deformation between the central conductor 2 and the dielectric member 1 by plastic deformation . the plastic deformation of the solder 7 is made possible by the presence of the solderless portion 11 . the volume of this solderless portion 11 is preferably in the range from 90 % to 30 % of the volume of the clearance between the dielectric member 1 and the central conductor 2 . specifically , the volume of the solder filled in the clearance between the central conductor 2 and the dielectric member 1 is desirably selected in the range from 10 % to 70 % of the volume of the entire clearance between the central conductor 2 and the dielectric member 1 at the time of fabrication . it is recommended that solder be partially filled in the space 11 by applying solder resist to the parts where it is not desired to fill solder . the parts coated with solder resist repel and are kept free of solder which is molten by heat . if the parts filled with solder are less than 10 % of the total clearance volume , sufficient electrical connection is not established , while if the figure is more than 70 %, the plastic deformation of solder becomes difficult . the solder , therefore , is desirably filled in 50 % of the total clearance volume . the solder resist applied to the parts not to be filled with solder does not exhibit any corrosive property against the dielectric member of the central conductor and therefore no problems arise from the remaining solder resist . fig3 a and 3b are detailed sectional views taken along line iii -- iii &# 39 ; in fig1 respectively , showing two examples of the method to fill solder . in both cases , the solder 7 is filled in about 50 % of the total clearance volume between the central conductor 2 and the dielectric member 1 , and the remaining 50 % left as a room or space for plastic deformation of the solder . the surface of the inner peripheral electrode 10 of this space is coated with the solder resist 21 . in the case of fig3 a , the solder is filled in almost one half of the clearance between the central conductor and the dielectric member 1 . in the example shown in fig3 b , on the other hand , the parts filled with solder and the parts coated with solder resist are arranged alternately . even this case , the total volume of the parts filled with solder represents approximately 50 % of the total volume of the space . in a method of applying solder resist to specific parts as shown in these examples , solder resist is coated on the desired portion of the inner peripheral electrode not to be filled with solder by utilizing the well - known printing technique for printed circuit boards . fig4 shows a graph of cumulative failure rate of a through - type capacitor with the solder volumetric ratio of 100 % and 50 % in the space between the central conductor and the dielectric member . the cumulative failure rate is defined as the ratio in percentage of samples broken to the total number of samples which have been subjected repetitively and alternately to low and high temperature conditions . in fig4 the abscissa represents the number of repetitions ( cycles ) of changes in temperature conditions . fig4 shows that the failure rate for the case ( a ) in which solder is filled in 50 % of the volume is much lower than for the case ( b ) where solder is filled up in the entire space at each cycle . fig5 shows another embodiment formed with a space . in fig5 the connection between the dielectric member 1 and the central conductor 2 is shown in detailed enlarged form as in fig2 . in this example a part of the surface of the central conductor 2 facing the dielectric member 1 is formed with a recess . the solder 7 is filled in this recess to connect the inner peripheral electrode 10 and the central conductor 2 electrically . the other parts than the recess is kept free of solder by the solder resist applied on the surface of the central conductor 2 . now , a construction will be described in which a space free of solder is formed without using solder resist . an open area of the solderless portion 11 is previously plugged with similar resin as the insulating resin 6 when the insulating resin 6 is filled into the case 4 so as to prevent leaking out of the insulating resin 6 through the solderless portion 11 . fig6 a and 6b are sectional views taken along line iii -- iii &# 39 ; of fig1 similar to fig3 a . in the embodiment of fig6 a , the section of the central conductor 2 facing the dielectric member 1 forms a square inscribing the section ( circle ) of the through hole . fig7 shows an enlarged view of a corner of the square inscribing the circle , that is , the part defined by a dotted circle in fig6 a . the solder 7 is fused between the dielectric member 1 and the central conductor 2 in the manner as shown in fig7 . ( the inner peripheral electrode surface 10 is not shown .) the gap formed between the corner of the central conductor 2 and the dielectric member 1 is very narrow as compared with that formed between the sides of the central conductor 2 and the dielectric member 1 . as a result , the molten solder is prevented by capillarity and surface tension from flowing out of the region of the narrow gap . a space 11 not filled with solder is thus formed between the sides of the central conductor 2 and the dielectric member 1 . the solder expands into this space 11 and is thus capable of absorbing the difference in thermal deformation between the dielectric member and the central conductor . fig6 b shows a central conductor 7 having a section shaped in a star . the apexes of the star are connected with the inner peripheral electrode of the dielectric member 1 by solder substantially in the same manner as in fig7 . solder resist is not required in this case either . the sectional shape of the central conductor is not limited to those mentioned above but other sectional shapes may be selected with equal effect so that the central conductor is in contact with the through hole at the parts where the radii of their curvature differ greatly from each other . apart from the embodiments of fig6 a and 6b in which the central conductor 2 has a section not circular , the sectional shape of the central conductor may be circular as shown in the embodiments of fig8 a and 8b with the through hole of the dielectric member having a non - circular section . fig8 a and 8b are both sectional views taken along line iii -- iii &# 39 ; in fig1 . fig8 a shows a case in which the section of the through hole takes a square form circumscribing a circular central conductor 2 . fig8 b , on the other hand , shows a case in which the through hole has an elliptical section circumscribing a circular central conductor . in both cases , the parts of the sectional form of the central conductor and the through hole in contact with each other form a very narrow gap as compared with the other parts thereof , so that a connection similar to that in fig7 is established , thereby forming a space 11 not filled with solder . in the cases of fig8 a and 8b , if the section of the dielectric member 1 is circular , the outline thereof is different from the section of the through hole . in the case of fig8 a , for example , the through hole has a square section and the dielectric member a circular section , so that the distance between the outer peripheral electrode and the inner peripheral electrode measured from a corner of the square is different from that measured from a side thereof , and the electric field concentrates in a shorter distance between the parts . this is also the case with an elliptical through hole . this concentration of electric field can be prevented by forming the section of the dielectric member 1 into a shape similar to the section of the through hole . | 7 |
now , preferred embodiments of the present invention will be described in detail while referring to the accompanying drawings . fig1 illustrates a semiconductor laser excitation solid state laser apparatus according to a first embodiment of the present invention . in fig1 the same symbols as those in fig1 designate the same or corresponding parts . in this first embodiment , a solid state laser element 2 containing an active medium comprises an nd : yag ( nd : yttrium aluminum garnet ), for instance , and takes a rod - like shape having a round cross section . a flow tube 4 is mounted on the solid state laser element 2 in such a manner as to enclose it . a cooling medium 5 is caused to flow between the flow tube 4 and the solid state laser element 2 . a semiconductor laser 1 is arranged at a location outside the flow tube 4 . the flow tube 4 is formed of a material such as glass , quartz . etc ., which permits a semiconductor laser beam 3 emitted from the semiconductor lasers 1 to pass therethrough . the semiconductor laser 1 is connected with a temperature controller 7 . the temperature controller 7 controls the temperature of semiconductor laser 1 in such a manner that the spectrum of the semiconductor laser beam 3 emitted from the semiconductor laser 1 substantially coincides with the absorption spectrum of the solid state laser element 2 . the semiconductor laser 1 is connected with a power supply 8 so that current is supplied from the power supply 8 to the semiconductor laser 1 . when current is supplied to the semiconductor laser 1 from the power supply 8 , a semiconductor laser beam 3 is irradiated from the semiconductor laser 1 and absorbed by the solid state laser element 2 , so that the active medium in the solid state laser element 2 is thereby excited . a total reflection mirror 9 and a partial reflection mirror 10 are arranged on an optical axis with the solid state laser element 2 disposed therebetween . the total reflection mirror 9 has a high reflectance so that a laser beam 11 emitted from the solid state laser element 2 is substantially totally reflected by the mirror 9 . the partial reflection mirror 10 has an appropriate reflectance for reflecting a part of the laser beam 11 . thus , these mirrors 9 and 10 cooperate with each other to constitute an optical resonator for taking out the laser beam 11 from the solid state laser element 2 . next , a detailed description of the operation of the semiconductor laser excitation solid state laser apparatus according to the first embodiment will be made while using the prior art as a comparison example . fig2 ( a ) and 2 ( b ) illustrate the waveforms of current supplied from the power supply 8 to the semiconductor laser 1 according to the comparison example and the first embodiment , respectively . the value of current supplied to the semiconductor laser 1 over one pulse is constant in the comparison example ( see fig2 ( a )), but in the first embodiment , it is controlled such that the current value becomes the highest in an initial or early stage of the duration of the one pulse , and decreases successively with the lapse of time in the pulse duration ( see fig2 ( b )). as described above , the oscillation spectrum of the semiconductor laser 1 depends on the temperature thereof . fig3 illustrates an example representative of the relation between the oscillation spectrum and the temperature of the semiconductor laser 1 . as shown in fig3 the higher the temperature of the semiconductor laser 1 , the longer does the oscillation spectrum of the semiconductor laser 1 become . as current is supplied to the semiconductor laser 1 , the semiconductor laser 1 generates heat so that the internal temperature thereof starts rising . when the amount of heat generated by the semiconductor laser 1 and the amount of heat discharged by the temperature controller 7 reach a thermal equilibrium , the temperature of the semiconductor laser 1 becomes constant and the oscillation spectrum thereof becomes constant . however , the temperature controller 7 has a response time , and hence it takes time for the semiconductor laser 1 to reach a thermal equilibrium . therefore , the oscillation spectrum changes at any time within the duration of one pulse until the thermal equilibrium is reached in the interior of the semiconductor laser 1 . fig4 ( a ) and 4 ( b ) show the appearances of a temperature change in the semiconductor laser according to the comparison example and the first embodiment , respectively . since current rapidly rises up simultaneously with the start of a pulse , the amount of heat generated in the interior of the semiconductor laser 1 is greater than the amount of heat discharged therefrom , so that a difference in heat therebetween is accumulated therein to raise the temperature of the semiconductor laser 1 . this temperature rise continues until the interior of the semiconductor laser 1 reaches a thermal equilibrium . however , in the case of the comparison example , a long time will be needed until a thermal equilibrium is reached since a constant amount of energy always continues to be input to the semiconductor laser 1 ( see fig4 ( a )). on the other hand , according to the first embodiment of the invention , the amount of input energy decreases from the start of a pulse with the lapse of time so that a temperature rise due to overheating can be suppressed . thus , the time required to reach a thermal equilibrium can be shortened ( see fig4 ( b )). the oscillation spectrum of the semiconductor laser 1 changes in accordance with this temperature change , so the oscillation spectrum of the semiconductor laser 1 always keeps changing within one pulse if a thermal equilibrium is not reached within the duration of one pulse operation . when a change in the oscillation spectrum of the semiconductor laser 1 with respect to the pulse operation shown in fig2 ( a ) and 2 ( b ) is illustrated in three periods including an initial or early stage ( 0 - 100 μsec from the start of pulse rising ), a middle stage ( 400 - 500 μsec ) and a final or later stage ( 900 - 1000 μsec ), such a change is expressed in fig5 ( a ) for the comparison example , and in fig5 ( b ) for the first embodiment of the present invention . here , for one example , there is shown the case in which the oscillation spectrum of the semiconductor laser 1 is substantially coincides with the absorption spectrum of the solid state laser element 2 at the state of a thermal equilibrium . fig6 illustrates the absorption spectrum of the solid state laser element 2 in the form of an nd : yag , and as shown in this figure , a spectrum absorption factor of the nd : yag laser element has a peak at a wavelength in the vicinity of 808 nm , and rapidly decreases before and after this peak wavelength . the comparison example exhibits that the oscillation spectrum changes greatly within one pulse of the semiconductor laser beam which is an excitation light , and that there is inconsistency between the oscillation spectrum of the semiconductor laser 1 and the absorption spectrum of the solid state laser element 2 over the entire duration of the pulse . fig7 ( a ) and 7 ( b ) illustrate the excitation efficiency of the comparison example and that of the first embodiment of the present invention , respectively . in the comparison example , a change in the oscillation spectrum causes the excitation efficiency to decrease greatly in the initial stage of one pulse ( see fig7 ( a )). on the other hand , in the first embodiment , the excitation efficiency is high over the entire duration of one pulse and can be maintained almost constant ( see fig7 ( b )). the waveform of laser output power of the comparison example obtained finally is shown in fig8 ( a ) and that of the first embodiment is shown in fig8 ( b ). the comparison example has a big collapse in the output waveform , whereas the first embodiment provides a constant , high output over the entire pulse . this is mainly a reflection of the excitation efficiencies . in addition , in the first embodiment , since a large current is supplied to the semiconductor laser 1 in the initial stage of the pulse , the output of the semiconductor laser 1 becomes high , so that a reduction in the excitation efficiency can be compensated , thus achieving the effect of further stabilizing the laser output power . moreover , successive reduction of the current also provides another effect of reducing power consumption . when these lasers are applied to processing or machining , in t he comparison example , processing or machining performance is deteriorated , and laser output power per pulse is low , thus resulting in a reduced processing or machining efficiency . on the other hand , in the first embodiment , the waveform of laser output power maintains substantially a rectangular shape , and high output power is obtained for the entire pulse . as a result , processing or machining can be carried out with excellent performance and efficiency . even in the case of using the semiconductor laser 1 which has an oscillation spectrum at the time of a thermal equilibrium shorter in wavelength than the absorption spectrum of the solid state laser element 2 , it is possible to always achieve an operation nearly as in the state at a thermal equilibrium . therefore , the first embodiment can avoid a remarkable reduction in the excitation efficiency in the initial stage of a pulse , thus maintaining a high excitation efficiency and achieving a further enhanced effect . as described above , according to the first embodiment of the present invention , the current supplied from the power supply 8 to the semiconductor laser 1 is controlled to be changed ( i . e ., decreased successively ) within one pulse , so that the solid state laser element 2 can be excited efficiently while reducing power consumption . as a consequence , it is possible to obtain a high power laser beam in a stable manner . in addition , the first embodiment can achieve the above operation by means of current control alone , and hence has an advantage that a laser apparatus with high performance can be obtained easily at low cost . although in the above - mentioned first embodiment , such a construction has been shown and described that the current supplied from the power supply 8 to the semiconductor laser 1 is decreased successively over the entire duration of one pulse , the method of decreasing the current is not limited to this . for instance , it can be constructed such that the current supplied to the semiconductor laser 1 is decreased only in the initial stage of a pulse , as illustrated in fig9 . such a construction serves to suppress reduction in the excitation efficiency in the initial stage of the pulse , thereby making it possible to always perform excitation in an efficient manner . thus , a stable laser beam is obtained . fig1 illustrates a current waveform for driving a semiconductor laser of a semiconductor laser excitation solid state laser apparatus according to a third embodiment of the present invention . the third embodiment is characterized in that the current to be supplied to the semiconductor laser 1 is successively increased within one pulse . as shown in fig1 , by increasing the current to be supplied to the semiconductor laser 1 within one pulse , substantially a constant oscillation efficiency can be maintained over the entire duration of one pulse in the case where the oscillation spectrum of the semiconductor laser 1 is longer than the absorption spectrum of the solid state laser element 2 , this is explained as follows . first of all , in the initial stage of a pulse , the current value is small so that the oscillation wavelength of the semiconductor laser 1 at this time is shorter and the excitation efficiency higher than in the state of a thermal equilibrium . a change in the excitation efficiency in accordance with the changing oscillation spectrum is illustrated in fig1 ( a ). in the later or the final stage of a pulse , though the oscillation spectrum becomes longer and hence a low excitation efficiency results , the current value is large so the output power of the semiconductor laser becomes great . in this embodiment , however , this is compensated for and an almost constant output is obtained over the entire pulse as illustrated in fig1 ( b ). moreover , when the oscillation spectrum of the semiconductor laser 1 is longer than the absorption spectrum of the solid state laser element 2 as described above , the excitation light absorption factor immediately after the start of laser oscillation becomes high in the comparison example shown in fig1 ( a ). in this case , relaxed oscillation ( i . e ., gradual oscillation ) is generated immediately after the start of laser oscillation , as shown in fig1 ( b ). however , according to the third embodiment , since the absorption factor can be decreased by reducing the current value in the initial stage of the pulse , the relaxed oscillation can be suppressed . in addition , by lowering the current value in the initial stage of the pulse , power consumption is reduced , thus providing an effect to improve the efficiency of the laser . as described above , according to the third embodiment , by successively increasing the current to be supplied to the semiconductor laser 1 when pulse excitation is performed by the use of the semiconductor laser 1 , a constant oscillation efficiency can be maintained at all times while decreasing power consumption . besides , relaxed oscillation can be effectively suppressed . as a result , even with the use of a semiconductor laser having a long oscillation spectrum , the laser output power of one pulse can be held constant and a high degree of processing quality can be obtained . although in the above - mentioned third embodiment , it is constructed that the current to be supplied to the semiconductor laser 1 over the entire pulse is increased successively , the method of increasing the current is not limited to this . for instance , as illustrated in fig1 , by successively increasing the current only in the initial stage of one pulse , the generation of relaxed oscillation can be suppressed effectively irrespective of the oscillation spectrum , and a high degree of processing quality can be obtained . in addition , damage to optical components can be prevented . damaged . although in the first through fourth embodiments , the construction of continuously increasing current has been shown and described , current may be changed in a stepwise manner . for instance , even in the case where the current value is decreased stepwise only in the head or leading portion of a pulse , as illustrated in fig1 , the same effects as in the fourth embodiment can be obtained , and it becomes easy to control the current . here , note that in this fifth embodiment 5 , the current to be supplied to the semiconductor laser 1 is changed stepwise in one step , but it may be changed in a plurality of steps . fig1 illustrates a semiconductor laser excitation solid state laser apparatus according to a sixth embodiment of the present invention . in fig1 , the same parts as those in the first embodiment are identified by the same symbols , while omitting a description thereof . in the following , the components newly added in this embodiment will be described . a diffusive reflector 12 is arranged so as to enclose a solid state laser element 2 , and has its inner surface configured to diffuse and reflect a semiconductor laser beam 3 . the diffusive reflector 12 is provided with an opening ( not shown ) for guiding into the interior thereof the semiconductor laser beam 3 emitted from a semiconductor laser 1 . also , mounted on the diffusive reflector 12 at its opening is an optical waveguide element 14 for guiding the semiconductor laser beam 3 . the optical waveguide element 14 is formed of sapphire , or undoped yag ( yttrium aluminum garnet ), or glass having a high refractive index with respect to the semiconductor laser beam 3 , etc . the semiconductor laser beam 3 having entered the interior of the optical waveguide element 14 is effectively guided therein by virtue of repeated total reflections in the interior of the optical waveguide element 14 owing to a difference in the refractive index between the optical waveguide element 14 and its surroundings . in addition , an antireflection coating nonreflective against the semiconductor laser beam 3 is given to an end face of the optical waveguide element 14 , and the semiconductor laser 1 is arranged adjacent to the end face of the optical waveguide element 14 , so that the semiconductor laser beam 3 is guided into the interior of the diffusive reflector 12 with almost no or little loss . here , note that in the case of the semiconductor laser excitation solid state laser apparatus according to this sixth embodiment , current is supplied to the semiconductor laser 1 in the same manner as previously described with reference to the above - mentioned first through fifth embodiments . thus , according to the sixth embodiment 6 , part of the excitation light not absorbed by the solid state laser element 2 passes through the solid state laser element 2 , and is then diffused and reflected by the inner surface of the diffusive reflector 12 , thereby exciting the solid state laser element 2 again . as a result , the solid state laser element 2 can be excited uniformly and efficiently , making it possible for a laser beam to be taken out with a further increased efficiency . further , since the optical waveguide element 14 is installed on the diffusive reflector 12 , the excitation light can be efficiently guided into the interior of the diffusive reflector 12 by means of the optical waveguide element 14 . this serves to provide a more efficient semiconductor laser excitation solid state laser apparatus . it is to be noted that though the sixth embodiment has been shown and described in the case where a diffusive reflector is used with its inner surface being composed of a diffuse reflection surface , the reflector may instead have an inner surface highly reflective against the semiconductor laser beam 3 , such as , for example , a gold inner surface subjected to mirror polishing . a glass inner surface covered with a total reflection coating totally reflective against the semiconductor laser beam 3 , etc . additionally , although in the sixth embodiment , the optical waveguide element 14 has been shown as a plate - shaped member , it may instead be of any shape such as a wedge shape , the one having a lens effect , etc . further , the construction using the optical waveguide element 14 has been shown herein , but without using this , the semiconductor laser 1 may be arranged adjacent to the unillustrated opening in the reflector 12 . besides , the entire portion or a part of the inner surface at the opening of the reflector may be formed of a coating or an optical element highly reflective against semiconductor laser beam so that the semiconductor laser beam can be efficiently transmitted to the interior of the reflector . although in any of the above - mentioned embodiments , the solid state laser element 2 has been described as having a rod - shaped configuration , the cross sectional shape of the solid state laser element 2 is not limited to a circular shape , but it may be any shape such as , for example , a rectangle , an oval , etc . moreover , it has been described that the solid state laser element 2 is cooled by the cooling medium 5 which is caused to flow in the flow tube 4 arranged to enclose the surroundings of the element 2 , but the means or method for cooling is not limited to this , and any cooling means or method may be used . for instance , if a solid state laser element 2 having a rectangular cross section is arranged on a cooling plate 15 as illustrated in fig1 ( a ) and 16 ( b ), it is possible to cool the solid state laser element 2 by the use of a simple construction . it is to be noted that in any of the above - mentioned embodiments , the solid state laser element 2 has been described as using an nd : yag , but the present invention is not limited to this , and any solid state laser element may be used which is capable of being optically excited by a semiconductor laser . as described in the foregoing , according to the present invention , there is provided a semiconductor laser excitation solid state apparatus including a solid state laser element containing an active medium , a semiconductor laser for optically exciting the solid state laser element , a power supply for supplying electric power to the semiconductor laser , and an optical resonator for taking out a laser beam from the optically excited solid state laser element . when the semiconductor laser is pulse - operated to pulse - excite the solid state laser element , the current supplied to the solid state laser element is changed within one pulse . with this arrangement , the oscillation spectrum and the output power of the semiconductor laser can be controlled within one pulse , thus achieving a stable and efficient semiconductor laser excitation solid state laser apparatus . moreover , since the current to be supplied to the semiconductor laser is controlled to decrease successively within one pulse , the solid state laser element can be excited efficiently while reducing power consumption . additionally , a change in the oscillation spectrum of the semiconductor laser can be reduced to always maintain the oscillation efficiency of the laser at a constant level , as a consequence of which a semiconductor laser excitation solid state laser apparatus can be obtained which operates in a stable and efficient manner . further , in a preferred form of the present invention , by successively decreasing the current to be supplied to the semiconductor laser only in an initial or early stage of the pulse , a reduction in the excitation efficiency in the initial or early stage of the pulse is suppressed , whereby the solid state laser element can be excited efficiently at any time to generate a stable laser beam . furthermore , in another preferred form of the present invention , the current to be supplied to the semiconductor laser is increased successively within one pulse , so that a constant oscillation efficiency can always be maintained while reducing power consumption . in addition , relaxed oscillation , which would be generated immediately after the start of laser oscillation , can be suppressed , so that a semiconductor laser excitation solid state laser apparatus can be obtained which is stable and efficient in operation . still further , in a further preferred form of the present invention , since the current to be supplied to the semiconductor laser is changed to increase successively only in an initial or early stage of the pulse within one pulse , the generation of relaxed oscillation is suppressed irrespective of the oscillation spectrum . consequently , it is possible not only to provide a high - quality laser beam but also prevent damage to optical components . in addition , in a yet further preferred form of the present invention , since the current to be supplied to the semiconductor laser is changed to decrease stepwise within one pulse , it is possible to provide , in addition to the above - mentioned effects , a semiconductor laser excitation solid state laser apparatus which is easy to perform current control and inexpensive to manufacture . moreover , in a still further preferred form of the present invention , by the provision of a diffusive reflector and an optical waveguide element , it is possible to efficiently guide excitation light into the interior of the diffusive reflector . as a result , the solid state laser element can be excited uniformly and efficiently , so that the laser beam can be taken out with a further enhanced efficiency . further , in a further preferred form of the present invention , by arranging a solid state laser element of a rectangular cross section on a cooling plate , it is possible to cool the solid state laser element by using a simple construction . | 7 |
as used in this specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural referents unless the context clearly dictates otherwise . thus , for example , the term “ a member ” is intended to mean a single member or a combination of members , and “ a material ” is intended to mean one or more materials , or a combination thereof . furthermore , the words “ proximal ” and “ distal ” refer to directions closer to and away from , respectively , an operator ( e . g ., surgeon , physician , nurse , technician , etc .) who would insert the medical device into the patient , with the tip - end ( i . e ., distal end ) of the device inserted inside a patient &# 39 ; s body first . thus , for example , the device end first inserted inside the patient &# 39 ; s body would be the distal end of the device , while the device end last to enter the patient &# 39 ; s body would be the proximal end of the device . as used in this specification and the appended claims , the terms “ upper ”, “ top ”, “ lower ”, “ bottom ”, “ front ”, “ back ”, “ rear ”, “ left ”, “ right ”, “ side ”, “ middle ” and “ center ” refer to portions of or positions on the implant when the implant is oriented in its implanted position . as used in this specification and the appended claims , the term “ axial plane ” when used in connection with particular relationships between various parts of the implant means a plane that divides the implant into upper and lower parts . as shown in the figs ., the axial plane is defined by the x axis and the z axis . as used in this specification and the appended claims , the term “ coronal plane ” when used in connection with particular relationships between various parts of the implant means a plane that divides the implant into front and back parts . as shown in the figs ., the coronal plane is defined by the x axis and the y axis . as used in this specification and the appended claims , the term “ sagittal plane ” when used in connection with particular relationships between various parts of the implant means a plane that divides the implant into left and right parts . as shown in the figs ., the sagittal plane is defined by the y axis and the z axis . as used in this specification and the appended claims , the term “ body ” when used in connection with the location where the device of this invention is to be placed to treat spinal disorders , or to teach or practice implantation methods for the device , means a mammalian body . for example , a body can be a patient &# 39 ; s body , or a cadaver , or a portion of a patient &# 39 ; s body or a portion of a cadaver . as used in this specification and the appended claims , the term “ parallel ” describes a relationship , given normal manufacturing or measurement or similar tolerances , between two geometric constructions ( e . g ., two lines , two planes , a line and a plane , two curved surfaces , a line and a curved surface or the like ) in which the two geometric constructions are substantially non - intersecting as they extend substantially to infinity . for example , as used herein , a line is said to be parallel to a curved surface when the line and the curved surface do not intersect as they extend to infinity . similarly , when a planar surface ( i . e ., a two - dimensional surface ) is said to be parallel to a line , every point along the line is spaced apart from the nearest portion of the surface by a substantially equal distance . two geometric constructions are described herein as being “ parallel ” or “ substantially parallel ” to each other when they are nominally parallel to each other , such as for example , when they are parallel to each other within a tolerance . such tolerances can include , for example , manufacturing tolerances , measurement tolerances or the like . as used in this specification and the appended claims , the terms “ normal ”, “ perpendicular ” and “ orthogonal ” describe a relationship between two geometric constructions ( e . g ., two lines , two planes , a line and a plane , two curved surfaces , a line and a curved surface or the like ) in which the two geometric constructions intersect at an angle of approximately 90 degrees within at least one plane . for example , as used herein , a line is said to be normal , perpendicular or orthogonal to a curved surface when the line and the curved surface intersect at an angle of approximately 90 degrees within a plane . two geometric constructions are described herein as being “ normal ”, “ perpendicular ”, “ orthogonal ” or “ substantially normal ”, “ substantially perpendicular ”, “ substantially orthogonal ” to each other when they are nominally 90 degrees to each other , such as for example , when they are 90 degrees to each other within a tolerance . such tolerances can include , for example , manufacturing tolerances , measurement tolerances or the like . a spinal implant 10 is described herein that is particularly adapted for placement between the spinous processes of the l5 vertebra and the s1 vertebra . however , it is to be understood that even though the following description of implant 10 is provided with reference to the l5 spinous process and the s1 spinous process , implant 10 may be used between other adjacent spinous processes and the discussion of the l5 spinous process may be interpreted to include any superior spinous process and the s1 spinous process may be interpreted to include the adjacent inferior spinous process . implant 10 includes an upper saddle 20 defined by a pair of sidewalls 21 a and 21 b joined by a bottom wall 22 . upper saddle sidewalls 21 a and 21 b may flare slightly outwardly away from the sagittal plane toward the top of implant 10 while upper saddle bottom wall 22 may be concavely curved . implant 10 may have a variable radius , which may be from about 3 . 0 mm on the ventral face 12 to about 2 . 0 mm on the dorsal face 45 . this allows implant 10 to engage the l5 spinous process , which is usually thicker at the base . as shown in fig5 , upper saddle bottom wall 22 may be oriented at about a 10 degree angle in the sagittal plane . the angle could be as large as about 20 degrees . the surfaces forming upper saddle sidewalls 21 a and 21 b and upper saddle bottom wall 22 may be generally parallel to the sagittal plane . this configuration for upper saddle 20 allows upper saddle 20 to receive and support the spinous process of an l5 vertebra therein . the height of upper saddle sidewalls 21 a and 21 b should be chosen so that upper saddle sidewalls 21 a and 21 b prevent the upper portion of implant 10 from moving laterally out of engagement with the spinous process of the l5 vertebra . upper saddle sidewalls 21 a and 21 b may extend between ⅓ and ½ of the base of the spinous process so they engage the lamina by about 2 to 3 mm . upper saddle sidewalls 21 a and 21 b may not have a constant cross - section . this allows upper saddle 20 to accommodate the variable thickness of the spinous process . implant 10 also includes a lower saddle 30 defined by a pair of sidewalls 31 a and 31 b joined by a top wall 32 . as described in more detail below , lower saddle 30 has a configuration to provide clearance of implant 10 over the s1 spinous process . as such , lower saddle 30 would not engage the spinous process of the s1 vertebra . lower saddle sidewalls 31 a and 31 b flare outwardly away from the sagittal plane toward the bottom of implant 10 . upper saddle sidewalls 21 a and 21 b flare out and may have a variable angle . the angle starts at about 40 degrees at the upper portion of upper saddle 20 and varies so that the angle is about 25 degrees at about the lowermost portion of upper saddle 20 . lower saddle sidewalls 31 a and 31 b flare out and have a constant angle between about 25 degrees and about 35 degrees . lower saddle top wall 32 may be concavely curved or may have another configuration that allows the lower portion of implant 10 to be fixed to the s1 pedicles and minimize any interference between the s1 spinous process and the rear of implant 10 . lower saddle top wall 32 is inclined between about 30 degrees and about 35 degrees in the sagittal plane . implant 10 has outer sidewalls 11 a and 11 b that extend on either side of implant 10 from the upper portion of implant 10 to the lower portion of implant 10 . outer sidewalls 11 a and 11 b flare outwardly away from the sagittal plane from the upper portion of implant 10 to give implant 10 a generally triangular - like shape . in addition , the overall shape of implant 10 transfers load from the l5 spinous process to the s1 pedicles instead of to the s1 spinous process or the s1 laminae . this is especially helpful where implant 10 is used in the l5 - s1 level since the small size and shape of the s1 spinous process may not provide adequate support for an implant . the front face 12 of implant 10 may have a curved profile that tapers from about 0 degrees along the middle of front face 12 to about 35 degrees adjacent to sidewalls 11 a , 11 b . implant 10 may have a curvature radius of between about 20 mm and about 30 mm . the generally triangular shape , where the base is larger than the top results in a constant pressure applied along the cross - sectional area of implant 10 . the shape of implant 10 also provides a better fit in the l5 / s1 space and therefore offers stability for implant 10 . the rear of implant 10 has a stepped configuration and includes a shelf 40 separating the rear of implant 10 into an upper portion and a lower portion . shelf 40 may be curved and is located so it is generally aligned with or above channels 34 a and 34 b . shelf 40 acts as a transition between the upper and lower portions of the rear of implant 10 and ensures that implant 10 will fit properly in the patient &# 39 ; s anatomy . the upper rear portion of implant 10 is defined by the rear wall 45 , which flares outwardly from the top of implant 10 . rear wall 45 is curved such that it does not compete for engagement with upper saddle 20 but rather allows implant 10 to rest freely on the l5 lamina . this allows for easy implantation on the l5 level . the thickness of implant 10 gradually increases from the top of implant 10 to shelf 40 . this taper may be between about 30 degrees and about 50 degrees . the bottom rear portion of implant 10 has a thinner profile and provides clearance so that lower saddle 30 does not engage the inferior spinous process . this results in practically no load being transferred from implant 10 to the inferior spinous process . indeed , lower saddle 30 may be configured such that it is spaced from and does not engage the inferior spinous process when implant 10 is implanted in the patient . the wider bottom portion of implant 10 allows two lower lobes 33 a and 33 b to be defined along the bottom portion of implant 10 adjacent to either side of lower saddle 30 and provides an area through which implant 10 may be fixed to the spine . each lower lobe 33 a and 33 b defines a channel 34 a and 34 b extending through implant 10 . channels 34 a and 34 b allow a fixation device 60 , such as a cortical screw or similar device , to extend therethrough to fix implant 10 in the desired location on the spine . as such , the internal diameter of channels 34 a and 34 b should be sufficient to allow passage of fixation device 60 therethrough , but should not be so large as to allow too much “ play ”, or too big of a gap , between fixation device 60 and channels 34 a and 34 b . for example , channels 34 a and 34 b could have an internal diameter that is about 0 . 5 mm to about 1 mm greater than the outer diameter of fixation device 60 . channels 34 a and 34 b flare outwardly from adjacent the mid - line of implant 10 and adjacent the top of the bottom portion of implant 10 so that fixation device 60 can be located therein and extend to the pedicles of the s1 vertebra . for example , channels 34 a and 34 b may extend at an angle α of about 60 degrees away from the sagittal plane toward the rear of implant 10 and at an angle β of about 5 degrees toward the top of implant 10 in a direction from the front of implant 10 toward the rear of implant 10 . alternatively , angle α could be between about 45 degrees and about 60 degrees , while angle β could be between about 5 degrees and about 10 degrees . this orientation for channels 34 a and 34 b allows fixation device 60 to extend there through and engage the pedicles of the s1 vertebra . the pedicles have good bone quality and provide superior support for spinal stabilization systems . the wider bottom portion of implant 10 , and indeed the overall configuration of implant 10 , also allows implant 10 to withstand higher forces being placed on it and helps to ensure compression forces placed on implant 10 are evenly distributed throughout the body of implant 10 . implant 10 may be formed from two portions . an inferior portion 300 and a superior portion 200 . inferior portion 300 may be made from a solid or relatively stiff material such as peek , a high durometer polycarbonate - urethane (“ pcu ”), stainless steel , titanium or other hard , durable biocompatible material . by forming inferior portion 300 from a relatively stiff material , fixation device 60 can firmly affix inferior portion 300 to the spine while ensuring that inferior portion 300 will not be pulled from fixation device 60 during flexion or other movement of the spine . such pulling through of a spinal implant from a fixation device is more likely if the implant were formed from a softer , more flexible material . conversely , superior portion 200 may be formed from a softer more flexible material , such as silicone , a low durometer pcu or some other flexible biocompatible material . superior portion 200 may have a durometer of between about 63a and about 85a . forming superior portion 200 from a flexible material prevents subsidence , which may occur when the superior spinous process engages a hard material such as metal . more importantly , forming superior portion 200 from a flexible material allows implant to act as a shock absorber in extension while providing adequate stabilization to the l5 / s1 level and allowing a more normal range of motion . as shown in fig1 , inferior portion 300 may be designed to extend only below , or inferior to , superior portion 200 . in an alternate embodiment shown in fig1 a , inferior portion 300 ′ includes superiorly extending lateral portions 320 a and 320 b . this configuration provides implant 10 with a varying durometer laterally across implant 10 where the sides are stiffer than the central portion of implant 10 . appropriate connection means may be used to connect inferior portion 300 to superior portion 200 . for example , a tab 310 may extend from the upper wall 320 of inferior portion 300 which engages a slot 210 that may be formed in the bottom portion of superior portion 200 , or vice versa . tab 310 may have a generally elongated cross section when view from the top of inferior portion 300 . as shown in fig1 , tab 310 may extend only along a portion of upper wall 320 . alternatively , as shown in fig1 a , tab 310 ′ may extend across substantially the entire width of upper wall 320 ′. the specific dimensions of the tab may be varied as necessary . in addition , the cross - section of the lower portion of tab 310 may be smaller than the cross - section of the upper portion of tab 310 . see fig5 and 6 . slot 210 may be formed with a configuration and dimensions that will allow tab 310 to be received in slot 210 with an interference fit . the configuration for tab 310 and slot 210 ensures that inferior portion 300 is locked to superior portion 200 with no relative movement between them . in addition to the use of a single slot 210 and tab 310 , other connection means may be used to connect inferior portion 300 to superior portion 200 . for example , a tab in the form of a helical screw could engage a tapped hole , the tab could take the form of a barb , multiple slots and tabs could be used , appropriate adhesives could be used , a tongue and groove configuration could be used , or any other connection system known to those of skill in the art could be used . another mechanism to connect inferior portion 300 to superior portion 200 is to overmold superior portion 200 over inferior portion 300 . an advantage of a two - piece implant as described herein , is that the inferior portion may be implanted and fixed in placed first and then the superior portion may be located between the inferior portion and the superior spinous process . once the inferior portion is properly located in the interspinous space adjacent to the s1 vertebra , fixation devices , such as cortical screws , may be placed through channels 34 a and 34 b and driven into the s1 pedicles to fix the inferior portion in place . thereafter , the superior portion may be fitted between the l5 vertebra and the inferior portion of the implant . this may make implantation of the implant easier than if the implant were a single piece . if desired , a tether 90 , or other fixation device , may be used to connect the superior portion of the implant to the superior spinous process . implant 10 may also define a curved passage 80 that extends between outer sidewalls 11 a and 11 b of implant 10 . the curve of passage 80 may be defined by a radius of curvature of about 20 millimeters where the openings 85 a and 85 b to passage 80 are closer to the top of implant 10 than the nadir of passage 80 . openings 85 a and 85 b are generally perpendicular to outer sidewalls 11 a and 11 b . other radii of curvature may also be used to define passage 80 . the nadir of passage 80 may be substantially aligned in the sagittal plane with the bottom most portion of upper saddle bottom wall 22 and the uppermost portion of lower saddle top wall 32 . a tether 90 may extend through passage 80 . the curve of passage 80 facilitates tether 90 being threaded through passage 80 with a standard curved surgical needle . as shown in fig9 and 10 , tether 90 may extend across the superior portion of the superior spinous process when implant 10 is located in the interspinous space . tether 90 thus helps to maintain implant 10 in the proper position in the patient &# 39 ; s anatomy during extension and flexion . it is to be understood that other fixation devices may be used instead of a tether 90 . for example , a pin , rod , screw or other similar mechanical device may be used and would extend through upper saddle 20 and into the upper spinous process . while various embodiments of the flexible interspinous process device have been described above , it should be understood that they have been presented by way of example only , and not limitation . many modifications and variations will be apparent to the practitioner skilled in the art . the foregoing description of the flexible interspinous process device is not intended to be exhaustive or to limit the scope of the invention . it is intended that the scope of the invention be defined by the following claims and their equivalents . | 0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.